[cDNA library construction from panicle meristem of finger millet].
Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B
2014-01-01
The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.
Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).
Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E
2005-12-02
cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.
Complementary DNA libraries: an overview.
Ying, Shao-Yao
2004-07-01
The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.
Immune-Related Transcriptome of Coptotermes formosanus Shiraki Workers: The Defense Mechanism
Hussain, Abid; Li, Yi-Feng; Cheng, Yu; Liu, Yang; Chen, Chuan-Cheng; Wen, Shuo-Yang
2013-01-01
Formosan subterranean termites, Coptotermes formosanus Shiraki, live socially in microbial-rich habitats. To understand the molecular mechanism by which termites combat pathogenic microbes, a full-length normalized cDNA library and four Suppression Subtractive Hybridization (SSH) libraries were constructed from termite workers infected with entomopathogenic fungi (Metarhizium anisopliae and Beauveria bassiana), Gram-positive Bacillus thuringiensis and Gram-negative Escherichia coli, and the libraries were analyzed. From the high quality normalized cDNA library, 439 immune-related sequences were identified. These sequences were categorized as pattern recognition receptors (47 sequences), signal modulators (52 sequences), signal transducers (137 sequences), effectors (39 sequences) and others (164 sequences). From the SSH libraries, 27, 17, 22 and 15 immune-related genes were identified from each SSH library treated with M. anisopliae, B. bassiana, B. thuringiensis and E. coli, respectively. When the normalized cDNA library was compared with the SSH libraries, 37 immune-related clusters were found in common; 56 clusters were identified in the SSH libraries, and 259 were identified in the normalized cDNA library. The immune-related gene expression pattern was further investigated using quantitative real time PCR (qPCR). Important immune-related genes were characterized, and their potential functions were discussed based on the integrated analysis of the results. We suggest that normalized cDNA and SSH libraries enable us to discover functional genes transcriptome. The results remarkably expand our knowledge about immune-inducible genes in C. formosanus Shiraki and enable the future development of novel control strategies for the management of Formosan subterranean termites. PMID:23874972
Constructing and detecting a cDNA library for mites.
Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui
2015-10-01
RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.
Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.
Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B
2004-12-15
cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.
Method for construction of normalized cDNA libraries
Soares, Marcelo B.; Efstratiadis, Argiris
1998-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.
Method for construction of normalized cDNA libraries
Soares, M.B.; Efstratiadis, A.
1998-11-03
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.
Soares, Marcelo B.; Efstratiadis, Argiris
1997-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.
Soares, M.B.; Efstratiadis, A.
1997-06-10
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.
Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D
2010-04-01
We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.
Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.
2010-01-01
Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028
Large-Scale Concatenation cDNA Sequencing
Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.
1997-01-01
A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174
Rise, Matthew L.; von Schalburg, Kristian R.; Brown, Gordon D.; Mawer, Melanie A.; Devlin, Robert H.; Kuipers, Nathanael; Busby, Maura; Beetz-Sargent, Marianne; Alberto, Roberto; Gibbs, A. Ross; Hunt, Peter; Shukin, Robert; Zeznik, Jeffrey A.; Nelson, Colleen; Jones, Simon R.M.; Smailus, Duane E.; Jones, Steven J.M.; Schein, Jacqueline E.; Marra, Marco A.; Butterfield, Yaron S.N.; Stott, Jeff M.; Ng, Siemon H.S.; Davidson, William S.; Koop, Ben F.
2004-01-01
We report 80,388 ESTs from 23 Atlantic salmon (Salmo salar) cDNA libraries (61,819 ESTs), 6 rainbow trout (Oncorhynchus mykiss) cDNA libraries (14,544 ESTs), 2 chinook salmon (Oncorhynchus tshawytscha) cDNA libraries (1317 ESTs), 2 sockeye salmon (Oncorhynchus nerka) cDNA libraries (1243 ESTs), and 2 lake whitefish (Coregonus clupeaformis) cDNA libraries (1465 ESTs). The majority of these are 3′ sequences, allowing discrimination between paralogs arising from a recent genome duplication in the salmonid lineage. Sequence assembly reveals 28,710 different S. salar, 8981 O. mykiss, 1085 O. tshawytscha, 520 O. nerka, and 1176 C. clupeaformis putative transcripts. We annotate the submitted portion of our EST database by molecular function. Higher- and lower-molecular-weight fractions of libraries are shown to contain distinct gene sets, and higher rates of gene discovery are associated with higher-molecular weight libraries. Pyloric caecum library group annotations indicate this organ may function in redox control and as a barrier against systemic uptake of xenobiotics. A microarray is described, containing 7356 salmonid elements representing 3557 different cDNAs. Analyses of cross-species hybridizations to this cDNA microarray indicate that this resource may be used for studies involving all salmonids. PMID:14962987
Method for construction of normalized cDNA libraries
Soares, Marcelo B.; Efstratiadis, Argiris
1996-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.
Method for construction of normalized cDNA libraries
Soares, M.B.; Efstratiadis, A.
1996-01-09
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.
Eberwine, James; Bartfai, Tamas
2011-01-01
We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451
2011-01-01
Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559
Eberwine, James; Bartfai, Tamas
2011-03-01
We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...
Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.
Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero
2003-09-01
The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.
Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng
2012-01-01
To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing. PMID:23202944
Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J
2007-06-01
As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry
2007-01-01
Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hadano, S.; Ishida, Y.; Tomiyasu, H.
1994-09-01
To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less
Display of a maize cDNA library on baculovirus infected insect cells.
Meller Harel, Helene Y; Fontaine, Veronique; Chen, Hongying; Jones, Ian M; Millner, Paul A
2008-08-12
Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV) have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 x 10(5) independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1), was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.
Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie
2003-04-02
Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.
Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y
2004-05-01
Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.
Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine
2002-06-15
To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.
Sequence evaluation of four specific cDNA libraries for developmental genomics of sunflower.
Tamborindeguy, C; Ben, C; Liboz, T; Gentzbittel, L
2004-04-01
Four different cDNA libraries were constructed from sunflower protoplasts growing under embryogenic and non-embryogenic conditions: one standard library from each condition and two subtractive libraries in opposite sense. A total of 22,876 cDNA clones were obtained and 4800 ESTs were sequenced, giving rise to 2479 high quality ESTs representing an unigene set of 1502 sequences. This set was compared with ESTs represented in public databases using the programs BLASTN and BLASTX, and its members were classified according to putative function using the catalog in the Kyoto Encyclopedia of Genes and Genomes (KEGG). Some 33% of sequences failed to align with existing plant ESTs and therefore represent putative novel genes. The libraries show a low level of redundancy and, on average, 50% of the present ESTs have not been previously reported for sunflower. Several potentially interesting genes were identified, based on their homology with genes involved in animal zygotic division or plant embryogenesis. We also identified two ESTs that show significantly different levels of expression under embryogenic and non-embryogenic conditions. The libraries described here represent an original and valuable resource for the discovery of yet unknown genes putatively involved in dicot embryogenesis and improving our knowledge of the mechanisms involved in polarity acquisition by plant embryos.
Illumina sequencing of green stink bug nymph and adult cdna to identify potential rnai gene targets
USDA-ARS?s Scientific Manuscript database
Whole-body transcriptomes for nymphs and adults of the green stink bug, Acrosternum hilare (Say), were sequenced on an Illumina® Genome Analyzer IIx sequencer. The insects were collected from sites in North Carolina and Virginia, USA. The cDNA library for each sample was sequenced on one lane of an...
cDNA library construction of two human Demodexspecies.
Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao
2017-06-01
The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.
Design and screening of M13 phage display cDNA libraries.
Georgieva, Yuliya; Konthur, Zoltán
2011-02-17
The last decade has seen a steady increase in screening of cDNA expression product libraries displayed on the surface of filamentous bacteriophage. At the same time, the range of applications extended from the identification of novel allergens over disease markers to protein-protein interaction studies. However, the generation and selection of cDNA phage display libraries is subjected to intrinsic biological limitations due to their complex nature and heterogeneity, as well as technical difficulties regarding protein presentation on the phage surface. Here, we review the latest developments in this field, discuss a number of strategies and improvements anticipated to overcome these challenges making cDNA and open reading frame (ORF) libraries more readily accessible for phage display. Furthermore, future trends combining phage display with next generation sequencing (NGS) will be presented.
Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Cuttitta, Angela
2013-10-30
Anemonia viridis is a widespread and extensively studied Mediterranean species of sea anemone from which a large number of polypeptide toxins, such as blood depressing substances (BDS) peptides, have been isolated. The first members of this class, BDS-1 and BDS-2, are polypeptides belonging to the β-defensin fold family and were initially described for their antihypertensive and antiviral activities. BDS-1 and BDS-2 are 43 amino acid peptides characterised by three disulfide bonds that act as neurotoxins affecting Kv3.1, Kv3.2 and Kv3.4 channel gating kinetics. In addition, BDS-1 inactivates the Nav1.7 and Nav1.3 channels. The development of a large dataset of A. viridis expressed sequence tags (ESTs) and the identification of 13 putative BDS-like cDNA sequences has attracted interest, especially as scientific and diagnostic tools. A comparison of BDS cDNA sequences showed that the untranslated regions are more conserved than the protein-coding regions. Moreover, the KA/KS ratios calculated for all pairwise comparisons showed values greater than 1, suggesting mechanisms of accelerated evolution. The structures of the BDS homologs were predicted by molecular modelling. All toxins possess similar 3D structures that consist of a triple-stranded antiparallel β-sheet and an additional small antiparallel β-sheet located downstream of the cleavage/maturation site; however, the orientation of the triple-stranded β-sheet appears to differ among the toxins. To characterise the spatial expression profile of the putative BDS cDNA sequences, tissue-specific cDNA libraries, enriched for BDS transcripts, were constructed. In addition, the proper amplification of ectodermal or endodermal markers ensured the tissue specificity of each library. Sequencing randomly selected clones from each library revealed ectodermal-specific expression of ten BDS transcripts, while transcripts of BDS-8, BDS-13, BDS-14 and BDS-15 failed to be retrieved, likely due to under-representation in our cDNA libraries. The calculation of the relative abundance of BDS transcripts in the cDNA libraries revealed that BDS-1, BDS-3, BDS-4, BDS-5 and BDS-6 are the most represented transcripts.
NASA Astrophysics Data System (ADS)
Yu, Jianzhong; Ma, Xiaolei; Pan, Kehou; Yang, Guanpin; Yu, Wengong
2010-07-01
We constructed and characterized a normalized cDNA library of Nannochloropsis oculata CS-179, and obtained 905 nonredundant sequences (NRSs) ranging from 431-1 756 bp in length. Among them, 496 were very similar to nonredundant ones in the GenBank ( E ≤1.0e-05), and 349 ESTs had significant hits with the clusters of eukaryotic orthologous groups (KOG). Bases G and/or C at the third position of codons of 14 amino acid residues suggested a strong bias in the conserved domain of 362 NRSs (>60%). We also identified the unigenes encoding phosphorus and nitrogen transporters, suggesting that N. oculata could efficiently transport and metabolize phosphorus and nitrogen, and recognized the unigenes that involved in biosynthesis and storage of both fatty acids and polyunsaturated fatty acids (PUFAs), which will facilitate the demonstration of eicosapentaenoic acid (EPA) biosynthesis pathway of N. oculata. In comparison with the original cDNA library, the normalized library significantly increased the efficiencies of random sequencing and rarely expressed genes discovering, and decreased the frequency of abundant gene sequences.
Bricheux, G; Brugerolle, G
1997-08-01
The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.
Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger
Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui
2010-01-01
In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376
Brouilette, Scott; Kuersten, Scott; Mein, Charles; Bozek, Monika; Terry, Anna; Dias, Kerith-Rae; Bhaw-Rosun, Leena; Shintani, Yasunori; Coppen, Steven; Ikebe, Chiho; Sawhney, Vinit; Campbell, Niall; Kaneko, Masahiro; Tano, Nobuko; Ishida, Hidekazu; Suzuki, Ken; Yashiro, Kenta
2012-10-01
Deep sequencing of single cell-derived cDNAs offers novel insights into oncogenesis and embryogenesis. However, traditional library preparation for RNA-seq analysis requires multiple steps with consequent sample loss and stochastic variation at each step significantly affecting output. Thus, a simpler and better protocol is desirable. The recently developed hyperactive Tn5-mediated library preparation, which brings high quality libraries, is likely one of the solutions. Here, we tested the applicability of hyperactive Tn5-mediated library preparation to deep sequencing of single cell cDNA, optimized the protocol, and compared it with the conventional method based on sonication. This new technique does not require any expensive or special equipment, which secures wider availability. A library was constructed from only 100 ng of cDNA, which enables the saving of precious specimens. Only a few steps of robust enzymatic reaction resulted in saved time, enabling more specimens to be prepared at once, and with a more reproducible size distribution among the different specimens. The obtained RNA-seq results were comparable to the conventional method. Thus, this Tn5-mediated preparation is applicable for anyone who aims to carry out deep sequencing for single cell cDNAs. Copyright © 2012 Wiley Periodicals, Inc.
Hussey, Richard S; Huang, Guozhong; Allen, Rex
2011-01-01
Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stapleton, Mark; Liao, Guochun; Brokstein, Peter
2002-08-12
Collections of full-length nonredundant cDNA clones are critical reagents for functional genomics. The first step toward these resources is the generation and single-pass sequencing of cDNA libraries that contain a high proportion of full-length clones. The first release of the Drosophila Gene Collection Release 1 (DGCr1) was produced from six libraries representing various tissues, developmental stages, and the cultured S2 cell line. Nearly 80,000 random 5prime expressed sequence tags (EST) from these libraries were collapsed into a nonredundant set of 5849 cDNAs, corresponding to {approx}40 percent of the 13,474 predicted genes in Drosophila. To obtain cDNA clones representing the remainingmore » genes, we have generated an additional 157,835 5prime ESTs from two previously existing and three new libraries. One new library is derived from adult testis, a tissue we previously did not exploit for gene discovery; two new cap-trapped normalized libraries are derived from 0-22hr embryos and adult heads. Taking advantage of the annotated D. melanogaster genome sequence, we clustered the ESTs by aligning them to the genome. Clusters that overlap genes not already represented by cDNA clones in the DGCr1 were analyzed further, and putative full-length clones were selected for inclusion in the new DGC. This second release of the DGC (DGCr2) contains 5061 additional clones, extending the collection to 10,910 cDNAs representing >70 percent of the predicted genes in Drosophila.« less
Sequence verification as quality-control step for production of cDNA microarrays.
Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W
2001-07-01
To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tomkinson, B.; Jonsson, A-K
1991-01-01
Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less
Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András
2003-01-01
A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.
[Construction and characterization of a cDNA library from human liver tissue of cirrhosis].
Chen, Xiao-hong; Chen, Zhi; Chen, Feng; Zhu, Hai-hong; Zhou, Hong-juan; Yao, Hang-ping
2005-03-01
To construct a cDNA library from human liver tissue of cirrhosis. The total RNA from human liver tissue of cirrhosis was extracted using Trizol method, and the mRNA was purified using mRNA purification kit. SMART technique and CDSIII/3' primer were used for first-strand cDNA synthesis. Long distance PCR was then used to synthesize the double-strand cDNA that was then digested by proteinase K and Sfi I, and was fractionated by CHOMA SPIN-400 column. The cDNA fragments longer than 0.4 kb were collected and ligated to lambdaTripl Ex2 vector. Then lambda-phage packaging reaction and library amplification were performed. The qualities of both unamplified and amplified cDNA libraries was strictly checked by conventional titer determination. Eleven plaques were randomly picked and tested using PCR with universal primers derived from the sequence flanking the vector. The titers of unamplifed and amplified libraries were 1.03 x 10(6) pfu/ml and 1.36 x 10(9) pfu/ml respectively. The percentages of recombinants from both libraries were 97.24 % in unamplified library and 99.02 % in amplified library. The lengths of the inserts were 1.02 kb in average (36.36 % 1 approximately equals 2 kb and 63.64 % 0.5 approximately equals 1.0 kb). A high quality cDNA library from human liver tissue of cirrhosis was constructed successfully, which can be used for screening and cloning new special genes associated with the occurrence of cirrhosis.
Molecular Cloning and Sequencing of Channel Catfish, Ictalurus punctatus, Cathepsin H and L cDNA
USDA-ARS?s Scientific Manuscript database
Cathepsin H and L, a lysosomal cysteine endopeptidase of the papain family, are ubiquitously expressed and involve in antigen processing. In this communication, the channel catfish cathepsin H and L transcripts were sequenced and analyzed. Total RNA from tissues was extracted and cDNA libraries we...
Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon
2014-01-01
The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069
EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries
Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P
2008-01-01
Background Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. Results We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. Conclusion EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects. PMID:18402700
EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries.
Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P
2008-04-10
Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects.
cDNA encoding a polypeptide including a hevein sequence
Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.
1993-02-16
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.
Bhore, Subhash J; Kassim, Amelia; Loh, Chye Ying; Shah, Farida H
2010-01-01
It is well known that the nutritional quality of the American oil-palm (Elaeis oleifera) mesocarp oil is superior to that of African oil-palm (Elaeis guineensis Jacq. Tenera) mesocarp oil. Therefore, it is of important to identify the genetic features for its superior value. This could be achieved through the genome sequencing of the oil-palm. However, the genome sequence is not available in the public domain due to commercial secrecy. Hence, we constructed a cDNA library and generated expressed sequence tags (3,205) from the mesocarp tissue of the American oil-palm. We continued to annotate each of these cDNAs after submitting to GenBank/DDBJ/EMBL. A rough analysis turned our attention to the beta-carotene hydroxylase (Chyb) enzyme encoding cDNA. Then, we completed the full sequencing of cDNA clone for its both strands using M13 forward and reverse primers. The full nucleotide and protein sequence was further analyzed and annotated using various Bioinformatics tools. The analysis results showed the presence of fatty acid hydroxylase superfamily domain in the protein sequence. The multiple sequence alignment of selected Chyb amino acid sequences from other plant species and algal members with E. oleifera Chyb using ClustalW and its phylogenetic analysis suggest that Chyb from monocotyledonous plant species, Lilium hubrid, Crocus sativus and Zea mays are the most evolutionary related with E. oleifera Chyb. This study reports the annotation of E. oleifera Chyb. Abbreviations ESTs - expressed sequence tags, EoChyb - Elaeis oleifera beta-carotene hydroxylase, MC - main cluster PMID:21364789
DeWitt, D L; Smith, W L
1988-01-01
Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548
USDA-ARS?s Scientific Manuscript database
Next generation sequencing (NGS) technology was used to analyze the occurrence of viruses in Sorghum almum plants in Florida exhibiting mosaic symptoms. Total RNA was extracted from symptomatic leaves and used as a template for cDNA library preparation. The resulting library was sequenced on an Illu...
Chun, Carlene K; Scheetz, Todd E; Bonaldo, Maria de Fatima; Brown, Bartley; Clemens, Anik; Crookes-Goodson, Wendy J; Crouch, Keith; DeMartini, Tad; Eyestone, Mari; Goodson, Michael S; Janssens, Bernadette; Kimbell, Jennifer L; Koropatnick, Tanya A; Kucaba, Tamara; Smith, Christina; Stewart, Jennifer J; Tong, Deyan; Troll, Joshua V; Webster, Sarahrose; Winhall-Rice, Jane; Yap, Cory; Casavant, Thomas L; McFall-Ngai, Margaret J; Soares, M Bento
2006-01-01
Background Biologists are becoming increasingly aware that the interaction of animals, including humans, with their coevolved bacterial partners is essential for health. This growing awareness has been a driving force for the development of models for the study of beneficial animal-bacterial interactions. In the squid-vibrio model, symbiotic Vibrio fischeri induce dramatic developmental changes in the light organ of host Euprymna scolopes over the first hours to days of their partnership. We report here the creation of a juvenile light-organ specific EST database. Results We generated eleven cDNA libraries from the light organ of E. scolopes at developmentally significant time points with and without colonization by V. fischeri. Single pass 3' sequencing efforts generated 42,564 expressed sequence tags (ESTs) of which 35,421 passed our quality criteria and were then clustered via the UIcluster program into 13,962 nonredundant sequences. The cDNA clones representing these nonredundant sequences were sequenced from the 5' end of the vector and 58% of these resulting sequences overlapped significantly with the associated 3' sequence to generate 8,067 contigs with an average sequence length of 1,065 bp. All sequences were annotated with BLASTX (E-value < -03) and Gene Ontology (GO). Conclusion Both the number of ESTs generated from each library and GO categorizations are reflective of the activity state of the light organ during these early stages of symbiosis. Future analyses of the sequences identified in these libraries promise to provide valuable information not only about pathways involved in colonization and early development of the squid light organ, but also about pathways conserved in response to bacterial colonization across the animal kingdom. PMID:16780587
Mora-Castilla, Sergio; To, Cuong; Vaezeslami, Soheila; Morey, Robert; Srinivasan, Srimeenakshi; Dumdie, Jennifer N; Cook-Andersen, Heidi; Jenkins, Joby; Laurent, Louise C
2016-08-01
As the cost of next-generation sequencing has decreased, library preparation costs have become a more significant proportion of the total cost, especially for high-throughput applications such as single-cell RNA profiling. Here, we have applied novel technologies to scale down reaction volumes for library preparation. Our system consisted of in vitro differentiated human embryonic stem cells representing two stages of pancreatic differentiation, for which we prepared multiple biological and technical replicates. We used the Fluidigm (San Francisco, CA) C1 single-cell Autoprep System for single-cell complementary DNA (cDNA) generation and an enzyme-based tagmentation system (Nextera XT; Illumina, San Diego, CA) with a nanoliter liquid handler (mosquito HTS; TTP Labtech, Royston, UK) for library preparation, reducing the reaction volume down to 2 µL and using as little as 20 pg of input cDNA. The resulting sequencing data were bioinformatically analyzed and correlated among the different library reaction volumes. Our results showed that decreasing the reaction volume did not interfere with the quality or the reproducibility of the sequencing data, and the transcriptional data from the scaled-down libraries allowed us to distinguish between single cells. Thus, we have developed a process to enable efficient and cost-effective high-throughput single-cell transcriptome sequencing. © 2016 Society for Laboratory Automation and Screening.
Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J.; Rohan, Thomas; Ben-Dov, Iddo Z.
2017-01-01
Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens. PMID:28335433
RNA-Seq analysis to capture the transcriptome landscape of a single cell
Tang, Fuchou; Barbacioru, Catalin; Nordman, Ellen; Xu, Nanlan; Bashkirov, Vladimir I; Lao, Kaiqin; Surani, M. Azim
2013-01-01
We describe here a protocol for digital transcriptome analysis in a single mouse blastomere using a deep sequencing approach. An individual blastomere was first isolated and put into lysate buffer by mouth pipette. Reverse transcription was then performed directly on the whole cell lysate. After this, the free primers were removed by Exonuclease I and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase. Then the single cell cDNAs were amplified by 20 plus 9 cycles of PCR. Then 100-200 ng of these amplified cDNAs were used to construct a sequencing library. The sequencing library can be used for deep sequencing using the SOLiD system. Compared with the cDNA microarray technique, our assay can capture up to 75% more genes expressed in early embryos. The protocol can generate deep sequencing libraries within 6 days for 16 single cell samples. PMID:20203668
Simon, J W; Slabas, A R
1998-09-18
The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.
In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library
Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul
2005-01-01
The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642
Using single nuclei for RNA-seq to capture the transcriptome of postmortem neurons
Krishnaswami, Suguna Rani; Grindberg, Rashel V; Novotny, Mark; Venepally, Pratap; Lacar, Benjamin; Bhutani, Kunal; Linker, Sara B; Pham, Son; Erwin, Jennifer A; Miller, Jeremy A; Hodge, Rebecca; McCarthy, James K; Kelder, Martin; McCorrison, Jamison; Aevermann, Brian D; Fuertes, Francisco Diez; Scheuermann, Richard H; Lee, Jun; Lein, Ed S; Schork, Nicholas; McConnell, Michael J; Gage, Fred H; Lasken, Roger S
2016-01-01
A protocol is described for sequencing the transcriptome of a cell nucleus. Nuclei are isolated from specimens and sorted by FACS, cDNA libraries are constructed and RNA-seq is performed, followed by data analysis. Some steps follow published methods (Smart-seq2 for cDNA synthesis and Nextera XT barcoded library preparation) and are not described in detail here. Previous single-cell approaches for RNA-seq from tissues include cell dissociation using protease treatment at 30 °C, which is known to alter the transcriptome. We isolate nuclei at 4 °C from tissue homogenates, which cause minimal damage. Nuclear transcriptomes can be obtained from postmortem human brain tissue stored at −80 °C, making brain archives accessible for RNA-seq from individual neurons. The method also allows investigation of biological features unique to nuclei, such as enrichment of certain transcripts and precursors of some noncoding RNAs. By following this procedure, it takes about 4 d to construct cDNA libraries that are ready for sequencing. PMID:26890679
An efficient and sensitive method for preparing cDNA libraries from scarce biological samples
Sterling, Catherine H.; Veksler-Lublinsky, Isana; Ambros, Victor
2015-01-01
The preparation and high-throughput sequencing of cDNA libraries from samples of small RNA is a powerful tool to quantify known small RNAs (such as microRNAs) and to discover novel RNA species. Interest in identifying the small RNA repertoire present in tissues and in biofluids has grown substantially with the findings that small RNAs can serve as indicators of biological conditions and disease states. Here we describe a novel and straightforward method to clone cDNA libraries from small quantities of input RNA. This method permits the generation of cDNA libraries from sub-picogram quantities of RNA robustly, efficiently and reproducibly. We demonstrate that the method provides a significant improvement in sensitivity compared to previous cloning methods while maintaining reproducible identification of diverse small RNA species. This method should have widespread applications in a variety of contexts, including biomarker discovery from scarce samples of human tissue or body fluids. PMID:25056322
Sakurai, Tetsuya; Plata, Germán; Rodríguez-Zapata, Fausto; Seki, Motoaki; Salcedo, Andrés; Toyoda, Atsushi; Ishiwata, Atsushi; Tohme, Joe; Sakaki, Yoshiyuki; Shinozaki, Kazuo; Ishitani, Manabu
2007-01-01
Background Cassava, an allotetraploid known for its remarkable tolerance to abiotic stresses is an important source of energy for humans and animals and a raw material for many industrial processes. A full-length cDNA library of cassava plants under normal, heat, drought, aluminum and post harvest physiological deterioration conditions was built; 19968 clones were sequence-characterized using expressed sequence tags (ESTs). Results The ESTs were assembled into 6355 contigs and 9026 singletons that were further grouped into 10577 scaffolds; we found 4621 new cassava sequences and 1521 sequences with no significant similarity to plant protein databases. Transcripts of 7796 distinct genes were captured and we were able to assign a functional classification to 78% of them while finding more than half of the enzymes annotated in metabolic pathways in Arabidopsis. The annotation of sequences that were not paired to transcripts of other species included many stress-related functional categories showing that our library is enriched with stress-induced genes. Finally, we detected 230 putative gene duplications that include key enzymes in reactive oxygen species signaling pathways and could play a role in cassava stress response features. Conclusion The cassava full-length cDNA library here presented contains transcripts of genes involved in stress response as well as genes important for different areas of cassava research. This library will be an important resource for gene discovery, characterization and cloning; in the near future it will aid the annotation of the cassava genome. PMID:18096061
Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun
2013-01-01
In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105
Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun
2013-05-24
In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.
2010-01-01
Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644
Single-Cell RNA Sequencing of Glioblastoma Cells.
Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G
2018-01-01
Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.
Helm, Jared R.; Hertz-Fowler, Christiane; Aslett, Martin; Berriman, Matthew; Sanders, Mandy; Quail, Michael A.; Soares, Marcelo B.; Bonaldo, Maria F.; Sakurai, Tatsuya; Inoue, Noboru; Donelson, John E.
2009-01-01
Trypanosoma congolense is one of the most economically important pathogens of livestock in Africa. Culture-derived parasites of each of the three main insect stages of the T. congolense life cycle, i.e., the procyclic, epimastigote and metacyclic stages, and bloodstream stage parasites isolated from infected mice, were used to construct stage-specific cDNA libraries and expressed sequence tags (ESTs or cDNA clones) in each library were sequenced. Thirteen EST clusters encoding different variant surface glycoproteins (VSGs) were detected in the metacyclic library and twenty-six VSG EST clusters were found in the bloodstream library, six of which are shared by the metacyclic library. Rare VSG ESTs are present in the epimastigote library, and none were detected in the procyclic library. ESTs encoding enzymes that catalyze oxidative phosphorylation and amino acid metabolism are about twice as abundant in the procyclic and epimastigote stages as in the metacyclic and bloodstream stages. In contrast, ESTs encoding enzymes involved in glycolysis, the citric acid cycle and nucleotide metabolism are about the same in all four developmental stages. Cysteine proteases, kinases and phosphatases are the most abundant enzyme groups represented by the ESTs. All four libraries contain T. congolense-specific expressed sequences not present in the T. brucei and T. cruzi genomes. Normalized cDNA libraries were constructed from the metacyclic and bloodstream stages, and found to be further enriched for T. congolense-specific ESTs. Given that cultured T. congolense offers an experimental advantage over other African trypanosome species, these ESTs provide a basis for further investigation of the molecular properties of these four developmental stages, especially the epimastigote and metacyclic stages for which it is difficult to obtain large quantities of organisms. The T. congolense EST databases are available at: http://www.sanger.ac.uk/Projects/T_congolense/EST_index.shtml. PMID:19559733
Guo, Chun-Teng; McClean, Stephen; Shaw, Chris; Rao, Ping-Fan; Ye, Ming-Yu; Bjourson, Anthony J
2013-05-01
One novel Kunitz BPTI-like peptide designated as BBPTI-1, with chymotrypsin inhibitory activity was identified from the venom of Burmese Daboia russelii siamensis. It was purified by three steps of chromatography including gel filtration, cation exchange and reversed phase. A partial N-terminal sequence of BBPTI-1, HDRPKFCYLPADPGECLAHMRSF was obtained by automated Edman degradation and a Ki value of 4.77nM determined. Cloning of BBPTI-1 including the open reading frame and 3' untranslated region was achieved from cDNA libraries derived from lyophilized venom using a 3' RACE strategy. In addition a cDNA sequence, designated as BBPTI-5, was also obtained. Alignment of cDNA sequences showed that BBPTI-5 exhibited an identical sequence to BBPTI-1 cDNA except for an eight nucleotide deletion in the open reading frame. Gene variations that represented deletions in the BBPTI-5 cDNA resulted in a novel protease inhibitor analog. Amino acid sequence alignment revealed that deduced peptides derived from cloning of their respective precursor cDNAs from libraries showed high similarity and homology with other Kunitz BPTI proteinase inhibitors. BBPTI-1 and BBPTI-5 consist of 60 and 66 amino acid residues respectively, including six conserved cysteine residues. As these peptides have been reported to have influence on the processes of coagulation, fibrinolysis and inflammation, their potential application in biomedical contexts warrants further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.
cDNA encoding a polypeptide including a hevein sequence
Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil
1993-02-16
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.
Rojas-Cartagena, Carmencita; Ortíz-Pineda, Pablo; Ramírez-Gómez, Francisco; Suárez-Castillo, Edna C.; Matos-Cruz, Vanessa; Rodríguez, Carlos; Ortíz-Zuazaga, Humberto; García-Arrarás, José E.
2010-01-01
Repair and regeneration are key processes for tissue maintenance, and their disruption may lead to disease states. Little is known about the molecular mechanisms that underline the repair and regeneration of the digestive tract. The sea cucumber Holothuria glaberrima represents an excellent model to dissect and characterize the molecular events during intestinal regeneration. To study the gene expression profile, cDNA libraries were constructed from normal, 3-day, and 7-day regenerating intestines of H. glaberrima. Clones were randomly sequenced and queried against the nonredundant protein database at the National Center for Biotechnology Information. RT-PCR analyses were made of several genes to determine their expression profile during intestinal regeneration. A total of 5,173 sequences from three cDNA libraries were obtained. About 46.2, 35.6, and 26.2% of the sequences for the normal, 3-days, and 7-days cDNA libraries, respectively, shared significant similarity with known sequences in the protein database of GenBank but only present 10% of similarity among them. Analysis of the libraries in terms of functional processes, protein domains, and most common sequences suggests that a differential expression profile is taking place during the regeneration process. Further examination of the expressed sequence tag dataset revealed that 12 putative genes are differentially expressed at significant level (R > 6). Experimental validation by RT-PCR analysis reveals that at least three genes (unknown C-4677-1, melanotransferrin, and centaurin) present a differential expression during regeneration. These findings strongly suggest that the gene expression profile varies among regeneration stages and provide evidence for the existence of differential gene expression. PMID:17579180
Informatic selection of a neural crest-melanocyte cDNA set for microarray analysis
Loftus, S. K.; Chen, Y.; Gooden, G.; Ryan, J. F.; Birznieks, G.; Hilliard, M.; Baxevanis, A. D.; Bittner, M.; Meltzer, P.; Trent, J.; Pavan, W.
1999-01-01
With cDNA microarrays, it is now possible to compare the expression of many genes simultaneously. To maximize the likelihood of finding genes whose expression is altered under the experimental conditions, it would be advantageous to be able to select clones for tissue-appropriate cDNA sets. We have taken advantage of the extensive sequence information in the dbEST expressed sequence tag (EST) database to identify a neural crest-derived melanocyte cDNA set for microarray analysis. Analysis of characterized genes with dbEST identified one library that contained ESTs representing 21 neural crest-expressed genes (library 198). The distribution of the ESTs corresponding to these genes was biased toward being derived from library 198. This is in contrast to the EST distribution profile for a set of control genes, characterized to be more ubiquitously expressed in multiple tissues (P < 1 × 10−9). From library 198, a subset of 852 clustered ESTs were selected that have a library distribution profile similar to that of the 21 neural crest-expressed genes. Microarray analysis demonstrated the majority of the neural crest-selected 852 ESTs (Mel1 array) were differentially expressed in melanoma cell lines compared with a non-neural crest kidney epithelial cell line (P < 1 × 10−8). This was not observed with an array of 1,238 ESTs that was selected without library origin bias (P = 0.204). This study presents an approach for selecting tissue-appropriate cDNAs that can be used to examine the expression profiles of developmental processes and diseases. PMID:10430933
Carbohydrate active enzymes revealed in Coptotermes formosanus transcriptome
USDA-ARS?s Scientific Manuscript database
A normalized cDNA library of Coptotermes formosanus was constructed using mixed RNA isolated from workers, soldiers, nymphs and alates of both sexes. Sequencing of this library generated 131,637 EST and 25,939 unigenes were assembled. Carbohydrate active enzymes (CAZymes) revealed in this library we...
Horse cDNA clones encoding two MHC class I genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barbis, D.P.; Maher, J.K.; Stanek, J.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)
Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn
2009-01-01
Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547
Genome-Wide Profiling of RNA–Protein Interactions Using CLIP-Seq
Stork, Cheryl; Zheng, Sika
2017-01-01
UV crosslinking immunoprecipitation (CLIP) is an increasingly popular technique to study protein–RNA interactions in tissues and cells. Whole cells or tissues are ultraviolet irradiated to generate a covalent bond between RNA and proteins that are in close contact. After partial RNase digestion, antibodies specific to an RNA binding protein (RBP) or a protein–epitope tag is then used to immunoprecipitate the protein–RNA complexes. After stringent washing and gel separation the RBP–RNA complex is excised. The RBP is protease digested to allow purification of the bound RNA. Reverse transcription of the RNA followed by high-throughput sequencing of the cDNA library is now often used to identify protein bound RNA on a genome-wide scale. UV irradiation can result in cDNA truncations and/or mutations at the crosslink sites, which complicates the alignment of the sequencing library to the reference genome and the identification of the crosslinking sites. Meanwhile, one or more amino acids of a crosslinked RBP can remain attached to its bound RNA due to incomplete digestion of the protein. As a result, reverse transcriptase may not read through the crosslink sites, and produce cDNA ending at the crosslinked nucleotide. This is harnessed by one variant of CLIP methods to identify crosslinking sites at a nucleotide resolution. This method, individual nucleotide resolution CLIP (iCLIP) circularizes cDNA to capture the truncated cDNA and also increases the efficiency of ligating sequencing adapters to the library. Here, we describe the detailed procedure of iCLIP. PMID:26965263
Comparison of the canine and human acid {beta}-galactosidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.
Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less
Genetic Regulation in the Aiptasia pallida Symbiosis - Performance Report, Year 1.
1997-02-01
and symbiotic zooxanthellae is one developed for serial analysis of gene expression (SAGE). We initially tested the SAGE protocol with cDNA generated...technically difficult. We are now focusing on constructing representative cDNA libraries from cultured and symbiotic zooxanthellae and will sequence
Comparative Analysis of Expressed Genes from Cacao Meristems Infected by Moniliophthora perniciosa
Gesteira, Abelmon S.; Micheli, Fabienne; Carels, Nicolas; Da Silva, Aline C.; Gramacho, Karina P.; Schuster, Ivan; Macêdo, Joci N.; Pereira, Gonçalo A. G.; Cascardo, Júlio C. M.
2007-01-01
Background and Aims Witches' broom disease is caused by the hemibiotrophic basidiomycete Moniliophthora perniciosa, and is one of the most important diseases of cacao in the western hemisphere. Because very little is known about the global process of such disease development, expressed sequence tags (ESTs) were used to identify genes expressed during the Theobroma cacao–Moniliophthora perniciosa interaction. Methods Two cDNA libraries corresponding to the resistant (RT) and susceptible (SP) cacao–M. perniciosa interactions were constructed from total RNA, using the DB SMART Creator cDNA library kit (Clontech). Clones were randomly selected, sequenced from the 5′ end and analysed using bioinformatics tools including in silico analysis of the differential gene expression. Key Results A total of 6884 ESTs were generated from the RT and SP cDNA libraries. These ESTs were composed of 2585 singlets and 341 contigs for a total of 2926 non-redundant sequences. The redundancy of the libraries was low and their specificity high when compared with the few other cacao libraries already published. Sequence analysis allowed the assignment of a putative functional category for 54 % of sequences, whereas approx. 22 % of sequences corresponded to unknown function and approx. 24 % of sequences did not show any significant similarity with other proteins present in the database. Despite the similar overall distribution of the sequences in functional categories between the two libraries, qualitative differences were observed. Genes involved during the defence response to pathogen infection or in programmed cell death were identified, such as pathogenesis related-proteins, trypsin inhibitor or oxalate oxidase, and some of them showed an in silico differential expression between the resistant and the susceptible interactions. Conclusions As far as is known this is the first EST resource from the cacao–M. perniciosa interaction and it is believed that it will provide a significant contribution to the understanding of the molecular mechanisms of the resistance and susceptibility of cacao to M. perniciosa, to develop strategies to control witches broom, and as a source of polymorphism for molecular marker development and marker-assisted selection. PMID:17557832
Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng
2013-11-01
Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.
Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin
2011-10-01
Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.
Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T
1997-12-01
A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.
Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2008-01-01
Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…
Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon
2011-01-01
Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot plants. Codon usages of melon full-length transcripts were largely similar to those of Arabidopsis coding sequences. Conclusion The collection of melon ESTs generated from full-length enriched and standard cDNA libraries is expected to play significant roles in annotating the melon genome. The ESTs and associated analysis results will be useful resources for gene discovery, functional analysis, marker-assisted breeding of melon and closely related species, comparative genomic studies and for gaining insights into gene expression patterns. PMID:21599934
Waugh, Caryll; Cromer, Deborah; Grimm, Andrew; Chopra, Abha; Mallal, Simon; Davenport, Miles; Mak, Johnson
2015-04-09
Massive, parallel sequencing is a potent tool for dissecting the regulation of biological processes by revealing the dynamics of the cellular RNA profile under different conditions. Similarly, massive, parallel sequencing can be used to reveal the complexity of viral quasispecies that are often found in the RNA virus infected host. However, the production of cDNA libraries for next-generation sequencing (NGS) necessitates the reverse transcription of RNA into cDNA and the amplification of the cDNA template using PCR, which may introduce artefact in the form of phantom nucleic acids species that can bias the composition and interpretation of original RNA profiles. Using HIV as a model we have characterised the major sources of error during the conversion of viral RNA to cDNA, namely excess RNA template and the RNaseH activity of the polymerase enzyme, reverse transcriptase. In addition we have analysed the effect of PCR cycle on detection of recombinants and assessed the contribution of transfection of highly similar plasmid DNA to the formation of recombinant species during the production of our control viruses. We have identified RNA template concentrations, RNaseH activity of reverse transcriptase, and PCR conditions as key parameters that must be carefully optimised to minimise chimeric artefacts. Using our optimised RT-PCR conditions, in combination with our modified PCR amplification procedure, we have developed a reliable technique for accurate determination of RNA species using NGS technology.
LaPolla, R J; Mayne, K M; Davidson, N
1984-01-01
A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870
Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.
Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B
1997-06-05
We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.
Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis
2016-08-24
To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.
Brain cDNA clone for human cholinesterase
DOE Office of Scientific and Technical Information (OSTI.GOV)
McTiernan, C.; Adkins, S.; Chatonnet, A.
1987-10-01
A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less
Sequence of Spider Aciniform and Piriform Silks
2001-09-19
7/98nd subtan-6/01 4. TITLE AND SUBTITLE Sequence of Spider Aciniform and Piriform Silks 5. FUNDING NUMBERS DAAD19-01-1-0569 6...aciniform glands from Argiope trifasciata were used to construct a cDNA library. The library was probed with various DNA probes based on known spider silk ...sequence in a number of other spider silks . The 5’end of the clone still appears to be repetitive sequence and thus it is unlikely to be a full-length
Sequence analysis of 497 mouse brain ESTs expressed in the substantia nigra
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stewart, G.J.; Savioz, A.; Davies, R.W.
1997-01-15
The use of subtracted, region-specific cDNA libraries combined with single-pass cDNA sequencing allows the discovery of novel genes and facilitates molecular description of the tissue or region involved. We report the sequence of 497 mouse expressed sequence tags (ESTs) from two subtracted libraries enriched for cDNAs expressed in the substantia nigra, a brain region with important roles in movement control and Parkinson disease. Of these, 238 ESTs give no database matches and therefore derive from novel genes. A further 115 ESTs show sequence similarity to ESTs from other organisms, which themselves do not yield any significant database matches to genesmore » of known function. Fifty-six ESTs show sequence similarity to previously identified genes whose mouse homologues have not been reported. The total number of ESTs reported that are new for the mouse is 407, which, together with the 90 ESTs corresponding to known mouse genes or cDNAs, contributes to the molecular description of the substantia nigra. 21 refs., 4 tabs.« less
A database of annotated tentative orthologs from crop abiotic stress transcripts.
Balaji, Jayashree; Crouch, Jonathan H; Petite, Prasad V N S; Hoisington, David A
2006-10-07
A minimal requirement to initiate a comparative genomics study on plant responses to abiotic stresses is a dataset of orthologous sequences. The availability of a large amount of sequence information, including those derived from stress cDNA libraries allow for the identification of stress related genes and orthologs associated with the stress response. Orthologous sequences serve as tools to explore genes and their relationships across species. For this purpose, ESTs from stress cDNA libraries across 16 crop species including 6 important cereal crops and 10 dicots were systematically collated and subjected to bioinformatics analysis such as clustering, grouping of tentative orthologous sets, identification of protein motifs/patterns in the predicted protein sequence, and annotation with stress conditions, tissue/library source and putative function. All data are available to the scientific community at http://intranet.icrisat.org/gt1/tog/homepage.htm. We believe that the availability of annotated plant abiotic stress ortholog sets will be a valuable resource for researchers studying the biology of environmental stresses in plant systems, molecular evolution and genomics.
Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.
Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M
1987-01-01
Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929
Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.
Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro
2010-05-07
Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.
Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jakob; Gilchrist, Michael J; Panitz, Frank; Jørgensen, Claus; Scheibye-Knudsen, Karsten; Arvin, Troels; Lumholdt, Steen; Sawera, Milena; Green, Trine; Nielsen, Bente J; Havgaard, Jakob H; Rosenkilde, Carina; Wang, Jun; Li, Heng; Li, Ruiqiang; Liu, Bin; Hu, Songnian; Dong, Wei; Li, Wei; Yu, Jun; Wang, Jian; Stærfeldt, Hans-Henrik; Wernersson, Rasmus; Madsen, Lone B; Thomsen, Bo; Hornshøj, Henrik; Bujie, Zhan; Wang, Xuegang; Wang, Xuefei; Bolund, Lars; Brunak, Søren; Yang, Huanming; Bendixen, Christian; Fredholm, Merete
2007-01-01
Background Knowledge of the structure of gene expression is essential for mammalian transcriptomics research. We analyzed a collection of more than one million porcine expressed sequence tags (ESTs), of which two-thirds were generated in the Sino-Danish Pig Genome Project and one-third are from public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. Results Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which approximately 25% have a high confidence match to UniProt. Approximately 6,000 new porcine gene clusters were identified. Expression analysis based on the non-normalized libraries resulted in the following findings. The distribution of cluster sizes is scaling invariant. Brain and testes are among the tissues with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression of genes between different tissues, in particular brain/spinal cord, and found patterns of correlation between genes that share expression in pairs of libraries. Finally, there was remarkable agreement in expression between specialized tissues according to Gene Ontology categories. Conclusion This EST collection, the largest to date in pig, represents an essential resource for annotation, comparative genomics, assembly of the pig genome sequence, and further porcine transcription studies. PMID:17407547
Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design
Ramsey, John S; Wilson, Alex CC; de Vos, Martin; Sun, Qi; Tamborindeguy, Cecilia; Winfield, Agnese; Malloch, Gaynor; Smith, Dawn M; Fenton, Brian; Gray, Stewart M; Jander, Georg
2007-01-01
Background The green peach aphid, Myzus persicae (Sulzer), is a world-wide insect pest capable of infesting more than 40 plant families, including many crop species. However, despite the significant damage inflicted by M. persicae in agricultural systems through direct feeding damage and by its ability to transmit plant viruses, limited genomic information is available for this species. Results Sequencing of 16 M. persicae cDNA libraries generated 26,669 expressed sequence tags (ESTs). Aphids for library construction were raised on Arabidopsis thaliana, Nicotiana benthamiana, Brassica oleracea, B. napus, and Physalis floridana (with and without Potato leafroll virus infection). The M. persicae cDNA libraries include ones made from sexual and asexual whole aphids, guts, heads, and salivary glands. In silico comparison of cDNA libraries identified aphid genes with tissue-specific expression patterns, and gene expression that is induced by feeding on Nicotiana benthamiana. Furthermore, 2423 genes that are novel to science and potentially aphid-specific were identified. Comparison of cDNA data from three aphid lineages identified single nucleotide polymorphisms that can be used as genetic markers and, in some cases, may represent functional differences in the protein products. In particular, non-conservative amino acid substitutions in a highly expressed gut protease may be of adaptive significance for M. persicae feeding on different host plants. The Agilent eArray platform was used to design an M. persicae oligonucleotide microarray representing over 10,000 unique genes. Conclusion New genomic resources have been developed for M. persicae, an agriculturally important insect pest. These include previously unknown sequence data, a collection of expressed genes, molecular markers, and a DNA microarray that can be used to study aphid gene expression. These resources will help elucidate the adaptations that allow M. persicae to develop compatible interactions with its host plants, complementing ongoing work illuminating plant molecular responses to phloem-feeding insects. PMID:18021414
Boltaña, Sebastian; Castellana, Barbara; Goetz, Giles; Tort, Lluis; Teles, Mariana; Mulero, Victor; Novoa, Beatriz; Figueras, Antonio; Goetz, Frederick W; Gallardo-Escarate, Cristian; Planas, Josep V; Mackenzie, Simon
2017-02-03
This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ) to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST) from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS) and peptidoglycan (PGN)). Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO) showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs), carrier proteins/membrane transport (approximately 15%), effectors/modulators and cell communication (approximately 11%), nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5%) and intracellular transducers/signal transduction (approximately 5%). Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ) that provides a platform enriched for the study of gene expression in S. aurata with an emphasis upon immunity and the immune response.
Asamizu, E; Nakamura, Y; Sato, S; Tabata, S
2000-06-30
For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.
Xiao, Yongli; Sheng, Zong-Mei; Taubenberger, Jeffery K.
2015-01-01
The vast majority of surgical biopsy and post-mortem tissue samples are formalin-fixed and paraffin-embedded (FFPE), but this process leads to RNA degradation that limits gene expression analysis. As an example, the viral RNA genome of the 1918 pandemic influenza A virus was previously determined in a 9-year effort by overlapping RT-PCR from post-mortem samples. Using the protocols described here, the full genome of the 1918 virus at high coverage was determined in one high-throughput sequencing run of a cDNA library derived from total RNA of a 1918 FFPE sample after duplex-specific nuclease treatments. This basic methodological approach should assist in the analysis of FFPE tissue samples isolated over the past century from a variety of infectious diseases. PMID:26344216
de Bellocq, J Goüy; Leirs, H
2009-09-01
Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.
ESTminer: a Web interface for mining EST contig and cluster databases.
Huang, Yecheng; Pumphrey, Janie; Gingle, Alan R
2005-03-01
ESTminer is a Web application and database schema for interactive mining of expressed sequence tag (EST) contig and cluster datasets. The Web interface contains a query frame that allows the selection of contigs/clusters with specific cDNA library makeup or a threshold number of members. The results are displayed as color-coded tree nodes, where the color indicates the fractional size of each cDNA library component. The nodes are expandable, revealing library statistics as well as EST or contig members, with links to sequence data, GenBank records or user configurable links. Also, the interface allows 'queries within queries' where the result set of a query is further filtered by the subsequent query. ESTminer is implemented in Java/JSP and the package, including MySQL and Oracle schema creation scripts, is available from http://cggc.agtec.uga.edu/Data/download.asp agingle@uga.edu.
Pratt, Lee H.; Liang, Chun; Shah, Manish; Sun, Feng; Wang, Haiming; Reid, St. Patrick; Gingle, Alan R.; Paterson, Andrew H.; Wing, Rod; Dean, Ralph; Klein, Robert; Nguyen, Henry T.; Ma, Hong-mei; Zhao, Xin; Morishige, Daryl T.; Mullet, John E.; Cordonnier-Pratt, Marie-Michèle
2005-01-01
Improved knowledge of the sorghum transcriptome will enhance basic understanding of how plants respond to stresses and serve as a source of genes of value to agriculture. Toward this goal, Sorghum bicolor L. Moench cDNA libraries were prepared from light- and dark-grown seedlings, drought-stressed plants, Colletotrichum-infected seedlings and plants, ovaries, embryos, and immature panicles. Other libraries were prepared with meristems from Sorghum propinquum (Kunth) Hitchc. that had been photoperiodically induced to flower, and with rhizomes from S. propinquum and johnsongrass (Sorghum halepense L. Pers.). A total of 117,682 expressed sequence tags (ESTs) were obtained representing both 3′ and 5′ sequences from about half that number of cDNA clones. A total of 16,801 unique transcripts, representing tentative UniScripts (TUs), were identified from 55,783 3′ ESTs. Of these TUs, 9,032 are represented by two or more ESTs. Collectively, these libraries were predicted to contain a total of approximately 31,000 TUs. Individual libraries, however, were predicted to contain no more than about 6,000 to 9,000, with the exception of light-grown seedlings, which yielded an estimate of close to 13,000. In addition, each library exhibits about the same level of complexity with respect to both the number of TUs preferentially expressed in that library and the frequency with which two or more ESTs is found in only that library. These results indicate that the sorghum genome is expressed in highly selective fashion in the individual organs and in response to the environmental conditions surveyed here. Close to 2,000 differentially expressed TUs were identified among the cDNA libraries examined, of which 775 were differentially expressed at a confidence level of 98%. From these 775 TUs, signature genes were identified defining drought, Colletotrichum infection, skotomorphogenesis (etiolation), ovary, immature panicle, and embryo. PMID:16169961
Metatranscriptomics of Soil Eukaryotic Communities.
Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia
2016-01-01
Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.
Screening and analyzing genes associated with Amur tiger placental development.
Li, Q; Lu, T F; Liu, D; Hu, P F; Sun, B; Ma, J Z; Wang, W J; Wang, K F; Zhang, W X; Chen, J; Guan, W J; Ma, Y H; Zhang, M H
2014-09-26
The Amur tiger is a unique endangered species in the world, and thus, protection of its genetic resources is extremely important. In this study, an Amur tiger placenta cDNA library was constructed using the SMART cDNA Library Construction kit. A total of 508 colonies were sequenced, in which 205 (76%) genes were annotated and mapped to 74 KEGG pathways, including 29 metabolism, 29 genetic information processing, 4 environmental information processing, 7 cell motility, and 5 organismal system pathways. Additionally, PLAC8, PEG10 and IGF-II were identified after screening genes from the expressed sequence tags, and they were associated with placental development. These findings could lay the foundation for future functional genomic studies of the Amur tiger.
Genes expressed during the development and ripening of watermelon fruit.
Levi, A; Davis, A; Hernandez, A; Wechter, P; Thimmapuram, J; Trebitsh, T; Tadmor, Y; Katzir, N; Portnoy, V; King, S
2006-11-01
A normalized cDNA library was constructed using watermelon flesh mRNA from three distinct developmental time-points and was subtracted by hybridization with leaf cDNA. Random cDNA clones of the watermelon flesh subtraction library were sequenced from the 5' end in order to identify potentially informative genes associated with fruit setting, development, and ripening. One-thousand and forty-six 5'-end sequences (expressed sequence tags; ESTs) were assembled into 832 non-redundant sequences, designated as "EST-unigenes". Of these 832 "EST-unigenes", 254 ( approximately 30%) have no significant homology to sequences published so far for other plant species. Additionally, 168 "EST-unigenes" ( approximately 20%) correspond to genes with unknown function, whereas 410 "EST-unigenes" ( approximately 50%) correspond to genes with known function in other plant species. These "EST-unigenes" are mainly associated with metabolism, membrane transport, cytoskeleton synthesis and structure, cell wall formation and cell division, signal transduction, nucleic acid binding and transcription factors, defense and stress response, and secondary metabolism. This study provides the scientific community with novel genetic information for watermelon as well as an expanded pool of genes associated with fruit development in watermelon. These genes will be useful targets in future genetic and functional genomic studies of watermelon and its development.
Genomic clones for human cholinesterase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kott, M.; Venta, P.J.; Larsen, J.
1987-05-01
A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less
A novel gene, RSD-3/HSD-3.1, encodes a meiotic-related protein expressed in rat and human testis.
Zhang, Xiaodong; Liu, Huixian; Zhang, Yan; Qiao, Yuan; Miao, Shiying; Wang, Linfang; Zhang, Jianchao; Zong, Shudong; Koide, S S
2003-06-01
The expression of stage-specific genes during spermatogenesis was determined by isolating two segments of rat seminiferous tubule at different stages of the germinal epithelium cycle delineated by transillumination-delineated microdissection, combined with differential display polymerase chain reaction to identify the differential transcripts formed. A total of 22 cDNAs were identified and accepted by GenBank as new expressed sequence tags. One of the expressed sequence tags was radiolabeled and used as a probe to screen a rat testis cDNA library. A novel full-length cDNA composed of 2228 bp, designated as RSD-3 (rat sperm DNA no.3, GenBank accession no. AF094609) was isolated and characterized. The reading frame encodes a polypeptide consisting of 526 amino acid residues, containing a number of DNA binding motifs and phosphorylation sites for PKC, CK-II, and p34cdc2. Northern blot of mRNA prepared from various tissues of adult rats showed that RSD-3 is expressed only in the testis. The initial expression of the RSD-3 gene was detected in the testis on the 30th postnatal day and attained adult level on the 60th postnatal day. Immunolocalization of RSD-3 in germ cells of rat testis showed that its expression is restricted to primary spermatocytes, undergoing meiosis division I. A human testis homologue of RSD-3 cDNA, designated as HSD-3.1 (GenBank accession no. AF144487) was isolated by screening the Human Testis Rapid-Screen arrayed cDNA library panels by RT-PCR. The exon-intron boundaries of HSD-3.1 gene were determined by aligning the cDNA sequence with the corresponding genome sequence. The cDNA consisted of 12 exons that span approximately 52.8 kb of the genome sequence and was mapped to chromosome 14q31.3.
Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly
Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka
2010-01-01
Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877
2004-01-01
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334
MytiBase: a knowledgebase of mussel (M. galloprovincialis) transcribed sequences
Venier, Paola; De Pittà, Cristiano; Bernante, Filippo; Varotto, Laura; De Nardi, Barbara; Bovo, Giuseppe; Roch, Philippe; Novoa, Beatriz; Figueras, Antonio; Pallavicini, Alberto; Lanfranchi, Gerolamo
2009-01-01
Background Although Bivalves are among the most studied marine organisms due to their ecological role, economic importance and use in pollution biomonitoring, very little information is available on the genome sequences of mussels. This study reports the functional analysis of a large-scale Expressed Sequence Tag (EST) sequencing from different tissues of Mytilus galloprovincialis (the Mediterranean mussel) challenged with toxic pollutants, temperature and potentially pathogenic bacteria. Results We have constructed and sequenced seventeen cDNA libraries from different Mediterranean mussel tissues: gills, digestive gland, foot, anterior and posterior adductor muscle, mantle and haemocytes. A total of 24,939 clones were sequenced from these libraries generating 18,788 high-quality ESTs which were assembled into 2,446 overlapping clusters and 4,666 singletons resulting in a total of 7,112 non-redundant sequences. In particular, a high-quality normalized cDNA library (Nor01) was constructed as determined by the high rate of gene discovery (65.6%). Bioinformatic screening of the non-redundant M. galloprovincialis sequences identified 159 microsatellite-containing ESTs. Clusters, consensuses, related similarities and gene ontology searches have been organized in a dedicated, searchable database . Conclusion We defined the first species-specific catalogue of M. galloprovincialis ESTs including 7,112 unique transcribed sequences. Putative microsatellite markers were identified. This annotated catalogue represents a valuable platform for expression studies, marker validation and genetic linkage analysis for investigations in the biology of Mediterranean mussels. PMID:19203376
Identification of genes differentially expressed in association with acquired cisplatin resistance
Johnsson, A; Zeelenberg, I; Min, Y; Hilinski, J; Berry, C; Howell, S B; Los, G
2000-01-01
The goal of this study was to identify genes whose mRNA levels are differentially expressed in human cells with acquired cisplatin (cDDP) resistance. Using the parental UMSCC10b head and neck carcinoma cell line and the 5.9-fold cDDP-resistant subline, UMSCC10b/Pt-S15, two suppressive subtraction hybridization (SSH) cDNA libraries were prepared. One library represented mRNAs whose levels were increased in the cDDP resistant variant (the UP library), the other one represented mRNAs whose levels were decreased in the resistant cells (the DOWN library). Arrays constructed with inserts recovered from these libraries were hybridized with SSH products to identify truly differentially expressed elements. A total of 51 cDNA fragments present in the UP library and 16 in the DOWN library met the criteria established for differential expression. The sequences of 87% of these cDNA fragments were identified in Genbank. Among the mRNAs in the UP library that were frequently isolated and that showed high levels of differential expression were cytochrome oxidase I, ribosomal protein 28S, elongation factor 1α, α-enolase, stathmin, and HSP70. The approach taken in this study permitted identification of many genes never before linked to the cDDP-resistant phenotype. © 2000 Cancer Research Campaign PMID:10993653
Craig, R K; Hall, L; Parker, D; Campbell, P N
1981-01-01
A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038
Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T
1990-01-05
We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cool, D.E.; Tonks, N.K.; Charbonneau, H.
1989-07-01
A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less
Purification, cDNA cloning, and regulation of lysophospholipase from rat liver.
Sugimoto, H; Hayashi, H; Yamashita, S
1996-03-29
A lysophospholipase was purified 506-fold from rat liver supernatant. The preparation gave a single 24-kDa protein band on SDS-polyacrylamide gel electrophoresis. The enzyme hydrolyzed lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, lysophosphatidylserine, and 1-oleoyl-2-acetyl-sn-glycero-3-phosphocholine at pH 6-8. The purified enzyme was used for the preparation of antibody and peptide sequencing. A cDNA clone was isolated by screening a rat liver lambda gt11 cDNA library with the antibody, followed by the selection of further extended clones from a lambda gt10 library. The isolated cDNA was 2,362 base pairs in length and contained an open reading frame encoding 230 amino acids with a Mr of 24,708. The peptide sequences determined were found in the reading frame. When the cDNA was expressed in Escherichia coli cells as the beta-galactosidase fusion, lysophosphatidylcholine-hydrolyzing activity was markedly increased. The deduced amino acid sequence showed significant similarity to Pseudomonas fluorescence esterase A and Spirulina platensis esterase. The three sequences contained the GXSXG consensus at similar positions. The transcript was found in various tissues with the following order of abundance: spleen, heart, kidney, brain, lung, stomach, and testis = liver. In contrast, the enzyme protein was abundant in the following order: testis, liver, kidney, heart, stomach, lung, brain, and spleen. Thus the mRNA abundance disagreed with the level of the enzyme protein in liver, testis, and spleen. When HL-60 cells were induced to differentiate into granulocytes with dimethyl sulfoxide, the 24-kDa lysophospholipase protein increased significantly, but the mRNA abundance remained essentially unchanged. Thus a posttranscriptional control mechanism is present for the regulation of 24-kDa lysophospholipase.
ERIC Educational Resources Information Center
Galewsky, Samuel
2000-01-01
Introduces a series of molecular genetics laboratories where students pick a single colony from a Drosophila melanogester embryo cDNA library and purify the plasmid, then analyze the insert through restriction digests and gel electrophoresis. (Author/YDS)
Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A
2009-01-01
Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386
Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1
Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.
2000-01-01
Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440
The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika
2010-01-27
Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set ofmore » tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in EST library sequencing approaches, and thus represent a rich resource for studies of environmental genomics.« less
Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T
2000-05-01
A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.
Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B
2004-03-01
The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.
Expressed sequence tag analysis of guinea pig (Cavia porcellus) eye tissues for NEIBank
Simpanya, Mukoma F.; Wistow, Graeme; Gao, James; David, Larry L.; Giblin, Frank J.
2008-01-01
Purpose To characterize gene expression patterns in guinea pig ocular tissues and identify orthologs of human genes from NEIBank expressed sequence tags. Methods RNA was extracted from dissected eye tissues of 2.5-month-old guinea pigs to make three unamplified and unnormalized cDNA libraries in the pCMVSport-6 vector for the lens, retina, and eye minus lens and retina. Over 4,000 clones were sequenced from each library and were analyzed using GRIST for clustering and gene identification. Lens crystallin EST data were validated using two-dimensional electrophoresis (2-DE), matrix assisted laser desorption (MALDI), and electrospray ionization mass spectrometry (ESIMS). Results Combined data from the three libraries generated a total of 6,694 distinctive gene clusters, with each library having between 1,000 and 3,000 clusters. Approximately 60% of the total gene clusters were novel cDNA sequences and had significant homologies to other mammalian sequences in GenBank. Complete cDNA sequences were obtained for many guinea pig lens proteins, including αA/αAinsert-, γN-, and γS-crystallins, lengsin and GRIFIN. The ratio of αA- to αB-crystallin on 2-DE gels was 8: 1 in the lens nucleus and 6.5: 1 in the cortex. Analysis of ESTs, genome sequence, and proteins (by MALDI), did not reveal any evidence for the presence of γD-, γE-, and γF-crystallin in the guinea pig. Predicted masses of many guinea pig lens crystallins were confirmed by ESIMS analysis. For the retina, orthologs of human phototransduction genes were found, such as Rhodopsin, S-antigen (Sag, Arrestin), and Transducin. The guinea-pig ortholog of NRL, a key rod photoreceptor-specific transcription factor, was also represented in EST data. In the ‘rest-of-eye’ library, the most abundant transcripts included decorin and keratin 12, representative of the cornea. Conclusions Genomic analysis of guinea pig eye tissues provides sequence-verified clones for future studies. Guinea pig orthologs of many human eye specific genes were identified. Guinea pig gene structures were similar to their human and rodent gene counterparts. Surprisingly, no orthologs of γD-, γE-, and γF-crystallin were found in EST, proteomic, or the current guinea pig genome data. PMID:19104676
Townsley, Brad T; Covington, Michael F; Ichihashi, Yasunori; Zumstein, Kristina; Sinha, Neelima R
2015-01-01
Next Generation Sequencing (NGS) is driving rapid advancement in biological understanding and RNA-sequencing (RNA-seq) has become an indispensable tool for biology and medicine. There is a growing need for access to these technologies although preparation of NGS libraries remains a bottleneck to wider adoption. Here we report a novel method for the production of strand specific RNA-seq libraries utilizing the terminal breathing of double-stranded cDNA to capture and incorporate a sequencing adapter. Breath Adapter Directional sequencing (BrAD-seq) reduces sample handling and requires far fewer enzymatic steps than most available methods to produce high quality strand-specific RNA-seq libraries. The method we present is optimized for 3-prime Digital Gene Expression (DGE) libraries and can easily extend to full transcript coverage shotgun (SHO) type strand-specific libraries and is modularized to accommodate a diversity of RNA and DNA input materials. BrAD-seq offers a highly streamlined and inexpensive option for RNA-seq libraries.
Archer, Stuart K; Shirokikh, Nikolay E; Preiss, Thomas
2015-04-01
Most applications for RNA-seq require the depletion of abundant transcripts to gain greater coverage of the underlying transcriptome. The sequences to be targeted for depletion depend on application and species and in many cases may not be supported by commercial depletion kits. This unit describes a method for generating RNA-seq libraries that incorporates probe-directed degradation (PDD), which can deplete any unwanted sequence set, with the low-bias split-adapter method of library generation (although many other library generation methods are in principle compatible). The overall strategy is suitable for applications requiring customized sequence depletion or where faithful representation of fragment ends and lack of sequence bias is paramount. We provide guidelines to rapidly design specific probes against the target sequence, and a detailed protocol for library generation using the split-adapter method including several strategies for streamlining the technique and reducing adapter dimer content. Copyright © 2015 John Wiley & Sons, Inc.
Bernstein, Steven L; Guo, Yan; Peterson, Katherine; Wistow, Graeme
2009-01-01
Background The optic nerve is a pure white matter central nervous system (CNS) tract with an isolated blood supply, and is widely used in physiological studies of white matter response to various insults. We examined the gene expression profile of human optic nerve (ON) and, through the NEIBANK online resource, to provide a resource of sequenced verified cDNA clones. An un-normalized cDNA library was constructed from pooled human ON tissues and was used in expressed sequence tag (EST) analysis. Location of an abundant oligodendrocyte marker was examined by immunofluorescence. Quantitative real time polymerase chain reaction (qRT-PCR) and Western analysis were used to compare levels of expression for key calcium channel protein genes and protein product in primate and rodent ON. Results Our analyses revealed a profile similar in many respects to other white matter related tissues, but significantly different from previously available ON cDNA libraries. The previous libraries were found to include specific markers for other eye tissues, suggesting contamination. Immune/inflammatory markers were abundant in the new ON library. The oligodendrocyte marker QKI was abundant at the EST level. Immunofluorescence revealed that this protein is a useful oligodendrocyte cell-type marker in rodent and primate ONs. L-type calcium channel EST abundance was found to be particularly low. A qRT-PCR-based comparative mammalian species analysis reveals that L-type calcium channel expression levels are significantly lower in primate than in rodent ON, which may help account for the class-specific difference in responsiveness to calcium channel blocking agents. Several known eye disease genes are abundantly expressed in ON. Many genes associated with normal axonal function, mRNAs associated with axonal transport, inflammation and neuroprotection are observed. Conclusion We conclude that the new cDNA library is a faithful representation of human ON and EST data provide an initial overview of gene expression patterns in this tissue. The data provide clues for tissue-specific and species-specific properties of human ON that will help in design of therapeutic models. PMID:19778450
Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, J.; Varner, J.E.
1985-07-01
Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-02-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-01-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578
Shiue, Yow-Ling; Chen, Lih-Ren; Chen, Chih-Feng; Chen, Yi-Ling; Ju, Jhy-Phen; Chao, Ching-Hsien; Lin, Yuan-Ping; Kuo, Yu-Ming; Tang, Pin-Chi; Lee, Yen-Pai
2006-09-15
To identify transcripts related to high egg production expressed specifically in the hypothalamus and pituitary gland of the chicken, two subtracted cDNA libraries were constructed. Two divergently selected strains of Taiwan Country Chickens (TCCs), B (sire line) and L2 (dam line) were used; they had originated from a single population and were further subjected (since 1982) to selection for egg production to 40 wk of age and body weight/comb size, respectively. A total of 324 and 370 clones were identified from the L2-B (L2-subtract-B) and the B-L2 subtracted cDNA libraries, respectively. After sequencing and annotation, 175 and 136 transcripts that represented 53 known and 65 unknown non-redundant sequences were characterized in the L2-B subtracted cDNA library. Quantitative reverse-transcription (RT)-PCR was used to screen the mRNA expression levels of 32 randomly selected transcripts in another 78 laying hens from five different strains. These strains included the two original strains (B and L2) used to construct the subtracted cDNA libraries and an additional three commercial strains, i.e., Black- and Red-feather TCCs and Single-Comb White Leghorn (WL) layer. The mRNA expression levels of 16 transcripts were significantly higher in the L2 than in the B strain, whereas the mRNA expression levels of nine transcripts, BDH, NCAM1, PCDHA@, PGDS, PLAG1, PRL, SAR1A, SCG2 and STMN2, were significantly higher in two high egg production strains, L2 and Single-Comb WL; this indicated their usefulness as molecular markers of high egg production.
Soares, Marcelo Bento; Bonaldo, Maria de Fatima
1998-01-01
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.
Soares, M.B.; Fatima Bonaldo, M. de
1998-12-08
This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.
Takahara, Hiroyuki; Dolf, Andreas; Endl, Elmar; O'Connell, Richard
2009-08-01
Generation of stage-specific cDNA libraries is a powerful approach to identify pathogen genes that are differentially expressed during plant infection. Biotrophic pathogens develop specialized infection structures inside living plant cells, but sampling the transcriptome of these structures is problematic due to the low ratio of fungal to plant RNA, and the lack of efficient methods to isolate them from infected plants. Here we established a method, based on fluorescence-activated cell sorting (FACS), to purify the intracellular biotrophic hyphae of Colletotrichum higginsianum from homogenates of infected Arabidopsis leaves. Specific selection of viable hyphae using a fluorescent vital marker provided intact RNA for cDNA library construction. Pilot-scale sequencing showed that the library was enriched with plant-induced and pathogenicity-related fungal genes, including some encoding small, soluble secreted proteins that represent candidate fungal effectors. The high purity of the hyphae (94%) prevented contamination of the library by sequences derived from host cells or other fungal cell types. RT-PCR confirmed that genes identified in the FACS-purified hyphae were also expressed in planta. The method has wide applicability for isolating the infection structures of other plant pathogens, and will facilitate cell-specific transcriptome analysis via deep sequencing and microarray hybridization, as well as proteomic analyses.
Bushakra, Jill M; Lewers, Kim S; Staton, Margaret E; Zhebentyayeva, Tetyana; Saski, Christopher A
2015-10-26
Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed sequence tags (ESTs) are a source of SSRs that can be used to develop markers to facilitate plant breeding and for more basic research across genera and higher plant orders. Leaf and meristem tissue from 'Heritage' red raspberry (Rubus idaeus) and 'Bristol' black raspberry (R. occidentalis) were utilized for RNA extraction. After conversion to cDNA and library construction, ESTs were sequenced, quality verified, assembled and scanned for SSRs. Primers flanking the SSRs were designed and a subset tested for amplification, polymorphism and transferability across species. ESTs containing SSRs were functionally annotated using the GenBank non-redundant (nr) database and further classified using the gene ontology database. To accelerate development of EST-SSRs in the genus Rubus (Rosaceae), 1149 and 2358 cDNA sequences were generated from red raspberry and black raspberry, respectively. The cDNA sequences were screened using rigorous filtering criteria which resulted in the identification of 121 and 257 SSR loci for red and black raspberry, respectively. Primers were designed from the surrounding sequences resulting in 131 and 288 primer pairs, respectively, as some sequences contained more than one SSR locus. Sequence analysis revealed that the SSR-containing genes span a diversity of functions and share more sequence identity with strawberry genes than with other Rosaceous species. This resource of Rubus-specific, gene-derived markers will facilitate the construction of linkage maps composed of transferable markers for studying and manipulating important traits in this economically important genus.
USDA-ARS?s Scientific Manuscript database
Oocyte-specific genes play critical roles in oogenesis, folliculogenesis and early embryonic development. Through analysis of expressed sequence tags (ESTs) from a rainbow trout oocyte cDNA library, we identified a novel transcript which is represented by ESTs only from the oocyte library. The novel...
Fiermonte, G; Runswick, M J; Walker, J E; Palmieri, F
1992-01-01
A human cDNA has been isolated previously from a thyroid library with the aid of serum from a patient with Grave's disease. It encodes a protein belonging to the mitochondrial metabolite carrier family, referred to as the Grave's disease carrier protein (GDC). Using primers based on this sequence, overlapping cDNAs encoding the bovine homologue of the GDC have been isolated from total bovine heart poly(A)+ cDNA. The bovine protein is 18 amino acids shorter than the published human sequence, but if a frame shift requiring the removal of one nucleotide is introduced into the human cDNA sequence, the human and bovine proteins become identical in their C-terminal regions, and 308 out of 330 amino acids are conserved over their entire sequences. The bovine cDNA has been used to investigate the expression of the GDC in various bovine tissues. In the tissues that were examined, the GDC is most strongly expressed in the thyroid, but substantial amounts of its mRNA were also detected in liver, lung and kidney, and lesser amounts in heart and skeletal muscle.
Comparison of next generation sequencing technologies for transcriptome characterization
2009-01-01
Background We have developed a simulation approach to help determine the optimal mixture of sequencing methods for most complete and cost effective transcriptome sequencing. We compared simulation results for traditional capillary sequencing with "Next Generation" (NG) ultra high-throughput technologies. The simulation model was parameterized using mappings of 130,000 cDNA sequence reads to the Arabidopsis genome (NCBI Accession SRA008180.19). We also generated 454-GS20 sequences and de novo assemblies for the basal eudicot California poppy (Eschscholzia californica) and the magnoliid avocado (Persea americana) using a variety of methods for cDNA synthesis. Results The Arabidopsis reads tagged more than 15,000 genes, including new splice variants and extended UTR regions. Of the total 134,791 reads (13.8 MB), 119,518 (88.7%) mapped exactly to known exons, while 1,117 (0.8%) mapped to introns, 11,524 (8.6%) spanned annotated intron/exon boundaries, and 3,066 (2.3%) extended beyond the end of annotated UTRs. Sequence-based inference of relative gene expression levels correlated significantly with microarray data. As expected, NG sequencing of normalized libraries tagged more genes than non-normalized libraries, although non-normalized libraries yielded more full-length cDNA sequences. The Arabidopsis data were used to simulate additional rounds of NG and traditional EST sequencing, and various combinations of each. Our simulations suggest a combination of FLX and Solexa sequencing for optimal transcriptome coverage at modest cost. We have also developed ESTcalc http://fgp.huck.psu.edu/NG_Sims/ngsim.pl, an online webtool, which allows users to explore the results of this study by specifying individualized costs and sequencing characteristics. Conclusion NG sequencing technologies are a highly flexible set of platforms that can be scaled to suit different project goals. In terms of sequence coverage alone, the NG sequencing is a dramatic advance over capillary-based sequencing, but NG sequencing also presents significant challenges in assembly and sequence accuracy due to short read lengths, method-specific sequencing errors, and the absence of physical clones. These problems may be overcome by hybrid sequencing strategies using a mixture of sequencing methodologies, by new assemblers, and by sequencing more deeply. Sequencing and microarray outcomes from multiple experiments suggest that our simulator will be useful for guiding NG transcriptome sequencing projects in a wide range of organisms. PMID:19646272
Chong, Cheong-Meng; Leung, Siu Wai; Prieto-da-Silva, Álvaro R. B.; Havt, Alexandre; Quinet, Yves P.; Martins, Alice M. C.; Lee, Simon M. Y.; Rádis-Baptista, Gandhi
2014-01-01
Background Dinoponera quadriceps is a predatory giant ant that inhabits the Neotropical region and subdues its prey (insects) with stings that deliver a toxic cocktail of molecules. Human accidents occasionally occur and cause local pain and systemic symptoms. A comprehensive study of the D. quadriceps venom gland transcriptome is required to advance our knowledge about the toxin repertoire of the giant ant venom and to understand the physiopathological basis of Hymenoptera envenomation. Results We conducted a transcriptome analysis of a cDNA library from the D. quadriceps venom gland with Sanger sequencing in combination with whole-transcriptome shotgun deep sequencing. From the cDNA library, a total of 420 independent clones were analyzed. Although the proportion of dinoponeratoxin isoform precursors was high, the first giant ant venom inhibitor cysteine-knot (ICK) toxin was found. The deep next generation sequencing yielded a total of 2,514,767 raw reads that were assembled into 18,546 contigs. A BLAST search of the assembled contigs against non-redundant and Swiss-Prot databases showed that 6,463 contigs corresponded to BLASTx hits and indicated an interesting diversity of transcripts related to venom gene expression. The majority of these venom-related sequences code for a major polypeptide core, which comprises venom allergens, lethal-like proteins and esterases, and a minor peptide framework composed of inter-specific structurally conserved cysteine-rich toxins. Both the cDNA library and deep sequencing yielded large proportions of contigs that showed no similarities with known sequences. Conclusions To our knowledge, this is the first report of the venom gland transcriptome of the New World giant ant D. quadriceps. The glandular venom system was dissected, and the toxin arsenal was revealed; this process brought to light novel sequences that included an ICK-folded toxins, allergen proteins, esterases (phospholipases and carboxylesterases), and lethal-like toxins. These findings contribute to the understanding of the ecology, behavior and venomics of hymenopterans. PMID:24498135
Wang, Ning; Kinoshita, Shigeharu; Nomura, Naoko; Riho, Chihiro; Maeyama, Kaoru; Nagai, Kiyohito; Watabe, Shugo
2012-04-01
Recent researches revealed the regional preference of biomineralization gene transcription in the pearl oyster Pinctada fucata: it transcribed mainly the genes responsible for nacre secretion in mantle pallial, whereas the ones regulating calcite shells expressed in mantle edge. This study took use of this character and constructed the forward and reverse suppression subtractive hybridization (SSH) cDNA libraries. A total of 669 cDNA clones were sequenced and 360 expressed sequence tags (ESTs) greater than 100 bp were generated. Functional annotation associated 95 ESTs with specific functions, and 79 among them were identified from P. fucata at the first time. In the forward SSH cDNA library, it recognized mass amount of nacre protein genes, biomineralization genes dominantly expressed in the mantle pallial, calcium-ion-binding genes, and other biomineralization-related genes important for pearl formation. Real-time PCR showed that all the examined genes were distributed in oyster mantle tissues with a consistence to the SSH design. The detection of their RNA transcripts in pearl sac confirmed that the identified genes were certainly involved in pearl formation. Therefore, the data from this work will initiate a new round of pearl formation gene study and shed new insights into molluscan biomineralization.
Vettore, André L.; da Silva, Felipe R.; Kemper, Edson L.; Souza, Glaucia M.; da Silva, Aline M.; Ferro, Maria Inês T.; Henrique-Silva, Flavio; Giglioti, Éder A.; Lemos, Manoel V.F.; Coutinho, Luiz L.; Nobrega, Marina P.; Carrer, Helaine; França, Suzelei C.; Bacci, Maurício; Goldman, Maria Helena S.; Gomes, Suely L.; Nunes, Luiz R.; Camargo, Luis E.A.; Siqueira, Walter J.; Van Sluys, Marie-Anne; Thiemann, Otavio H.; Kuramae, Eiko E.; Santelli, Roberto V.; Marino, Celso L.; Targon, Maria L.P.N.; Ferro, Jesus A.; Silveira, Henrique C.S.; Marini, Danyelle C.; Lemos, Eliana G.M.; Monteiro-Vitorello, Claudia B.; Tambor, José H.M.; Carraro, Dirce M.; Roberto, Patrícia G.; Martins, Vanderlei G.; Goldman, Gustavo H.; de Oliveira, Regina C.; Truffi, Daniela; Colombo, Carlos A.; Rossi, Magdalena; de Araujo, Paula G.; Sculaccio, Susana A.; Angella, Aline; Lima, Marleide M.A.; de Rosa, Vicente E.; Siviero, Fábio; Coscrato, Virginia E.; Machado, Marcos A.; Grivet, Laurent; Di Mauro, Sonia M.Z.; Nobrega, Francisco G.; Menck, Carlos F.M.; Braga, Marilia D.V.; Telles, Guilherme P.; Cara, Frank A.A.; Pedrosa, Guilherme; Meidanis, João; Arruda, Paulo
2003-01-01
To contribute to our understanding of the genome complexity of sugarcane, we undertook a large-scale expressed sequence tag (EST) program. More than 260,000 cDNA clones were partially sequenced from 26 standard cDNA libraries generated from different sugarcane tissues. After the processing of the sequences, 237,954 high-quality ESTs were identified. These ESTs were assembled into 43,141 putative transcripts. Of the assembled sequences, 35.6% presented no matches with existing sequences in public databases. A global analysis of the whole SUCEST data set indicated that 14,409 assembled sequences (33% of the total) contained at least one cDNA clone with a full-length insert. Annotation of the 43,141 assembled sequences associated almost 50% of the putative identified sugarcane genes with protein metabolism, cellular communication/signal transduction, bioenergetics, and stress responses. Inspection of the translated assembled sequences for conserved protein domains revealed 40,821 amino acid sequences with 1415 Pfam domains. Reassembling the consensus sequences of the 43,141 transcripts revealed a 22% redundancy in the first assembling. This indicated that possibly 33,620 unique genes had been identified and indicated that >90% of the sugarcane expressed genes were tagged. PMID:14613979
Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis.
Kong, Hee Jeong; Cho, Hyun Kook; Park, Eun-Mi; Hong, Gyeong-Eun; Kim, Young-Ok; Nam, Bo-Hye; Kim, Woo-Jin; Lee, Sang-Jun; Han, Hyon Sob; Jang, In-Kwon; Lee, Chang Hoon; Cheong, Jaehun; Choi, Tae-Jin
2009-01-01
Proteinase inhibitors play important roles in host defence systems involving blood coagulation and pathogen digestion. We isolated and characterized a cDNA clone for a Kazal-type proteinase inhibitor (KPI) from a hemocyte cDNA library of the oriental white shrimp Fenneropenaeus chinensis. The KPI gene consists of three exons and two introns. KPI cDNA contains an open reading frame of 396 bp, a polyadenylation signal sequence AATAAA, and a poly (A) tail. KPI cDNA encodes a polypeptide of 131 amino acids with a putative signal peptide of 21 amino acids. The deduced amino acid sequence of KPI contains two homologous Kazal domains, each with six conserved cysteine residues. The mRNA of KPI is expressed in the hemocytes of healthy shrimp, and the higher expression of KPI transcript is observed in shrimp infected with the white spot syndrome virus (WSSV), suggesting a potential role for KPI in host defence mechanisms.
Lu, L; Komada, M; Kitamura, N
1998-06-15
Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.
Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J
1993-01-01
A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506
Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.
Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T
1993-01-01
A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829
Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain
2011-01-01
cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.
Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K
1990-01-01
Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342
2013-01-01
Background Olive cDNA libraries to isolate candidate genes that can help enlightening the molecular mechanism of periodicity and / or fruit production were constructed and analyzed. For this purpose, cDNA libraries from the leaves of trees in “on year” and in “off year” in July (when fruits start to appear) and in November (harvest time) were constructed. Randomly selected 100 positive clones from each library were analyzed with respect to sequence and size. A fruit-flesh cDNA library was also constructed and characterized to confirm the reliability of each library’s temporal and spatial properties. Results Quantitative real-time RT-PCR (qRT-PCR) analyses of the cDNA libraries confirmed cDNA molecules that are associated with different developmental stages (e. g. “on year” leaves in July, “off year” leaves in July, leaves in November) and fruits. Hence, a number of candidate cDNAs associated with “on year” and “off year” were isolated. Comparison of the detected cDNAs to the current EST database of GenBank along with other non - redundant databases of NCBI revealed homologs of previously described genes along with several unknown cDNAs. Of around 500 screened cDNAs, 48 cDNA elements were obtained after eliminating ribosomal RNA sequences. These independent transcripts were analyzed using BLAST searches (cutoff E-value of 1.0E-5) against the KEGG and GenBank nucleotide databases and 37 putative transcripts corresponding to known gene functions were annotated with gene names and Gene Ontology (GO) terms. Transcripts in the biological process were found to be related with metabolic process (27%), cellular process (23%), response to stimulus (17%), localization process (8.5%), multicellular organismal process (6.25%), developmental process (6.25%) and reproduction (4.2%). Conclusions A putative P450 monooxigenase expressed fivefold more in the “on year” than that of “off year” leaves in July. Two putative dehydrins expressed significantly more in “on year” leaves than that of “off year” leaves in November. Homologs of UDP – glucose epimerase, acyl - CoA binding protein, triose phosphate isomerase and a putative nuclear core anchor protein were significant in fruits only, while a homolog of an embryo binding protein / small GTPase regulator was detected in “on year” leaves only. One of the two unknown cDNAs was specific to leaves in July while the other was detected in all of the libraries except fruits. KEGG pathway analyses for the obtained sequences correlated with essential metabolisms such as galactose metabolism, amino sugar and nucleotide sugar metabolisms and photosynthesis. Detailed analysis of the results presents candidate cDNAs that can be used to dissect further the genetic basis of fruit production and / or alternate bearing which causes significant economical loss for olive growers. PMID:23552171
HUNT: launch of a full-length cDNA database from the Helix Research Institute.
Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y
2001-01-01
The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.
Yao, Lin; Yang, Qian; Song, Jinzhu; Tan, Chong; Guo, Changhong; Wang, Li; Qu, Lianhai; Wang, Yun
2013-04-01
Trichoderma harzianum 88, a filamentous soil fungus, is an effective biocontrol agent against several plant pathogens. High-throughput sequencing was used here to study the mycoparasitism mechanisms of T. harzianum 88. Plate confrontation tests of T. harzianum 88 against plant pathogens were conducted, and a cDNA library was constructed from T. harzianum 88 mycelia in the presence of plant pathogen cell walls. Randomly selected transcripts from the cDNA library were compared with eukaryotic plant and fungal genomes. Of the 1,386 transcripts sequenced, the most abundant Gene Ontology (GO) classification group was "physiological process". Differential expression of 19 genes was confirmed by real-time RT-PCR at different mycoparasitism stages against plant pathogens. Gene expression analysis revealed the transcription of various genes involved in mycoparasitism of T. harzianum 88. Our study provides helpful insights into the mechanisms of T. harzianum 88-plant pathogen interactions.
Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L
1992-01-01
cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046
NASA Astrophysics Data System (ADS)
Sun, S. M.; Slightom, J. L.; Hall, T. C.
1981-01-01
A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.
Milnthorpe, Andrew T; Soloviev, Mikhail
2011-04-15
The Cancer Genome Anatomy Project (CGAP) xProfiler and cDNA Digital Gene Expression Displayer (DGED) have been made available to the scientific community over a decade ago and since then were used widely to find genes which are differentially expressed between cancer and normal tissues. The tissue types are usually chosen according to the ontology hierarchy developed by NCBI. The xProfiler uses an internally available flat file database to determine the presence or absence of genes in the chosen libraries, while cDNA DGED uses the publicly available UniGene Expression and Gene relational databases to count the sequences found for each gene in the presented libraries. We discovered that the CGAP approach often includes libraries from dependent or irrelevant tissues (one third of libraries were incorrect on average, with some tissue searches no correct libraries being selected at all). We also discovered that the CGAP approach reported genes from outside the selected libraries and may omit genes found within the libraries. Other errors include the incorrect estimation of the significance values and inaccurate settings for the library size cut-off values. We advocated a revised approach to finding libraries associated with tissues. In doing so, libraries from dependent or irrelevant tissues do not get included in the final library pool. We also revised the method for determining the presence or absence of a gene by searching the UniGene relational database, revised calculation of statistical significance and sorted the library cut-off filter. Our results justify re-evaluation of all previously reported results where NCBI CGAP expression data and tools were used.
2011-01-01
Background The Cancer Genome Anatomy Project (CGAP) xProfiler and cDNA Digital Gene Expression Displayer (DGED) have been made available to the scientific community over a decade ago and since then were used widely to find genes which are differentially expressed between cancer and normal tissues. The tissue types are usually chosen according to the ontology hierarchy developed by NCBI. The xProfiler uses an internally available flat file database to determine the presence or absence of genes in the chosen libraries, while cDNA DGED uses the publicly available UniGene Expression and Gene relational databases to count the sequences found for each gene in the presented libraries. Results We discovered that the CGAP approach often includes libraries from dependent or irrelevant tissues (one third of libraries were incorrect on average, with some tissue searches no correct libraries being selected at all). We also discovered that the CGAP approach reported genes from outside the selected libraries and may omit genes found within the libraries. Other errors include the incorrect estimation of the significance values and inaccurate settings for the library size cut-off values. We advocated a revised approach to finding libraries associated with tissues. In doing so, libraries from dependent or irrelevant tissues do not get included in the final library pool. We also revised the method for determining the presence or absence of a gene by searching the UniGene relational database, revised calculation of statistical significance and sorted the library cut-off filter. Conclusion Our results justify re-evaluation of all previously reported results where NCBI CGAP expression data and tools were used. PMID:21496233
RICD: a rice indica cDNA database resource for rice functional genomics.
Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin
2008-11-26
The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.
Construction of a cDNA library for miniature pig mandibular deciduous molars
2014-01-01
Background The miniature pig provides an excellent experimental model for tooth morphogenesis because its diphyodont and heterodont dentition resembles that of humans. However, little information is available on the process of tooth development or the exact molecular mechanisms controlling tooth development in miniature pigs or humans. Thus, the analysis of gene expression related to each stage of tooth development is very important. Results In our study, after serial sections were made, the development of the crown of the miniature pigs’ mandibular deciduous molar could be divided into five main phases: dental lamina stage (E33-E35), bud stage (E35-E40), cap stage (E40-E50), early bell stage (E50-E60), and late bell stage (E60-E65). Total RNA was isolated from the tooth germ of miniature pig embryos at E35, E45, E50, and E60, and a cDNA library was constructed. Then, we identified cDNA sequences on a large scale screen for cDNA profiles in the developing mandibular deciduous molars (E35, E45, E50, and E60) of miniature pigs using Illumina Solexa deep sequencing. Microarray assay was used to detect the expression of genes. Lastly, through Unigene sequence analysis and cDNA expression pattern analysis at E45 and E60, we found that 12 up-regulated and 15 down-regulated genes during the four periods are highly conserved genes homologous with known Homo sapiens genes. Furthermore, there were 6 down-regulated and 2 up-regulated genes in the miniature pig that were highly homologous to Homo sapiens genes compared with those in the mouse. Conclusion Our results not only identify the specific transcriptome and cDNA profile in developing mandibular deciduous molars of the miniature pig, but also provide useful information for investigating the molecular mechanism of tooth development in the miniature pig. PMID:24750690
Hou, Q; Chen, K; Shan, Z
2015-01-01
To construct the cDNA library of the ascites tumor cells of ovarian cancer, which can be used to screen the related antigen for the early diagnosis of ovarian cancer and therapeutic targets of immune treatment. Four cases of ovarian serous cystadenocarcinoma, two cases of ovarian mucinous cystadenocarcinoma, and two cases of ovarian endometrial carcinoma in patients with ascitic tumor cells which were used to construct the cDNA library. To screen the ovarian cancer antigen gene, evaluate the enzyme, and analyze nucleotide sequence, serological analysis of recombinant tumor cDNA expression libraries (SEREX) and suppression subtractive hybridization technique (SSH) techniques were utilized. The detection method of recombinant expression-based serological mini-arrays (SMARTA) was used to detect the ovarian cancer antigen and the positive reaction of 105 cases of ovarian cancer patients and 105 normal women's autoantibodies correspondingly in serum. After two rounds of serologic screening and glycosides sequencing analysis, 59 candidates of ovarian cancer antigen gene fragments were finally identified, which corresponded to 50 genes. They were then divided into six categories: (1) the homologous genes which related to the known ovarian cancer genes, such as BARD 1 gene, etc; (2) the homologous genes which were associated with other tumors, such as TM4SFI gene, etc; (3) the genes which were expressed in a special organization, such as ILF3, FXR1 gene, etc; (4) the genes which were the same with some protein genes of special function, such as TIZ, ClD gene; (5) the homologous genes which possessed the same source with embryonic genes, such as PKHD1 gene, etc; (6) the remaining genes were the unknown genes without the homologous sequence in the gene pool, such as OV-189 genes. SEREX technology combined with SSH method is an effective research strategy which can filter tumor antigen with high specific character; the corresponding autoantibodies of TM4SFl, ClD, TIZ, BARDI, FXRI, and OV-189 gene's recombinant antigen in serum can be regarded as the biomarkers which are used to diagnose ovarian cancer. The combination of multiple antigen detection can improve diagnostic efficiency.
NASA Astrophysics Data System (ADS)
Zhou, Jun; Hou, Fujing; Li, Ye; Su, Xiurong; Li, Taiwu; Jin, Chunhua
2016-07-01
Acaudina leucoprocta is an edible sea cucumber of economic interest that is widely distributed in China. Little information is available concerning the molecular genetics of this species although such knowledge would contribute to a better understanding of the optimal conditions for its aquaculture and its mechanisms of defense against disease. Therefore, we constructed a cDNA library and, based on bioinformatics analysis of the sequences, the functions of 75% of the cDNAs were identified, including those involved in cell structure, energy metabolism, mitochondrial function, and signal transduction pathways. Approximately 25% of genes in the library were unmatched. The gene for A. leucoprocta ferritin was also cloned. The predicted amino-acid sequence of ferritin displayed significant homology with other sea-cucumber counterparts but indicated that it was a new member of the ferritin family. Semiquantitative real-time RT-PCR indicated the highest levels of ferritin mRNA expression in the intestine. A polyclonal antibody of ferritin was also produced. These data provide a set of molecular tools essential for further studies of the functions of ferritin protein in A. leucoprocta.
Walker, M D; Park, C W; Rosen, A; Aronheim, A
1990-01-01
Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401
Construction of C35 gene bait recombinants and T47D cell cDNA library.
Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge
2017-11-20
C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.
Digital transcriptome profiling using selective hexamer priming for cDNA synthesis.
Armour, Christopher D; Castle, John C; Chen, Ronghua; Babak, Tomas; Loerch, Patrick; Jackson, Stuart; Shah, Jyoti K; Dey, John; Rohl, Carol A; Johnson, Jason M; Raymond, Christopher K
2009-09-01
We developed a procedure for the preparation of whole transcriptome cDNA libraries depleted of ribosomal RNA from only 1 microg of total RNA. The method relies on a collection of short, computationally selected oligonucleotides, called 'not-so-random' (NSR) primers, to obtain full-length, strand-specific representation of nonribosomal RNA transcripts. In this study we validated the technique by profiling human whole brain and universal human reference RNA using ultra-high-throughput sequencing.
Characterization of embryo-specific genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sung, Z.R.
1988-01-01
The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that are not expressed in mature tissues -- the embryogenic genes. In order to isolate these genes, we immunized a rabbit with total extracts of somatic embryos of carrot, and enriched the anti-embryo antiserum for antibodies reacting with extracts of carrot somatic embryos. Using this enriched antiserum, we screened a lambda gt11 cDNA library constructed from embryo poly A{sup +} RNA, and isolated 10 cDNA clones that detect embryogenic mRNAs. Monospecific antibodies have beenmore » purified for proteins corresponding to each cDNA sequence. Four cDNA clones were further characterized in terms of the expression of their corresponding mRNA and protein in somatic embryos of carrot. In some cases, comparable gene sequences or products have been detected in somatic and zygotic embryos of other plant species. The characteristics of these 4 cDNA clones -- clone Nos. 8, 59, and 66 -- are described in this report. 3 figs.« less
2011-01-01
Background Abiotic stresses, such as water deficit and soil salinity, result in changes in physiology, nutrient use, and vegetative growth in vines, and ultimately, yield and flavor in berries of wine grape, Vitis vinifera L. Large-scale expressed sequence tags (ESTs) were generated, curated, and analyzed to identify major genetic determinants responsible for stress-adaptive responses. Although roots serve as the first site of perception and/or injury for many types of abiotic stress, EST sequencing in root tissues of wine grape exposed to abiotic stresses has been extremely limited to date. To overcome this limitation, large-scale EST sequencing was conducted from root tissues exposed to multiple abiotic stresses. Results A total of 62,236 expressed sequence tags (ESTs) were generated from leaf, berry, and root tissues from vines subjected to abiotic stresses and compared with 32,286 ESTs sequenced from 20 public cDNA libraries. Curation to correct annotation errors, clustering and assembly of the berry and leaf ESTs with currently available V. vinifera full-length transcripts and ESTs yielded a total of 13,278 unique sequences, with 2302 singletons and 10,976 mapped to V. vinifera gene models. Of these, 739 transcripts were found to have significant differential expression in stressed leaves and berries including 250 genes not described previously as being abiotic stress responsive. In a second analysis of 16,452 ESTs from a normalized root cDNA library derived from roots exposed to multiple, short-term, abiotic stresses, 135 genes with root-enriched expression patterns were identified on the basis of their relative EST abundance in roots relative to other tissues. Conclusions The large-scale analysis of relative EST frequency counts among a diverse collection of 23 different cDNA libraries from leaf, berry, and root tissues of wine grape exposed to a variety of abiotic stress conditions revealed distinct, tissue-specific expression patterns, previously unrecognized stress-induced genes, and many novel genes with root-enriched mRNA expression for improving our understanding of root biology and manipulation of rootstock traits in wine grape. mRNA abundance estimates based on EST library-enriched expression patterns showed only modest correlations between microarray and quantitative, real-time reverse transcription-polymerase chain reaction (qRT-PCR) methods highlighting the need for deep-sequencing expression profiling methods. PMID:21592389
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki
A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less
Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai
2017-02-16
Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our results provide a cDNA expression library for further screening of T cell stimulating or inhibiting antigens of E. maxima. Moreover, our results provide six candidate protective antigens for developing new vaccines against E. maxima.
Zhao, Yinhe; Wang, Guoying; Zhang, Jinpeng; Yang, Junbo; Peng, Shang; Gao, Lianming; Li, Chengyun; Hu, Jinyong; Li, Dezhu; Gao, Lizhi
2006-07-01
Asarum caudigerum (Aristolochiaceae) is an important species of paleoherb in relation to understanding the origin and evolution of angiosperm flowers, due to its basal position in the angiosperms. The aim of this study was to isolate floral-related genes from A. caudigerum, and to infer evolutionary relationships among florally expression-related genes, to further illustrate the origin and diversification of flowers in angiosperms. A subtracted floral cDNA library was constructed from floral buds using suppression subtractive hybridization (SSH). The cDNA of floral buds and leaves at the seedling stage were used as a tester and a driver, respectively. To further identify the function of putative MADS-box transcription factors, phylogenetic trees were reconstructed in order to infer evolutionary relationships within the MADS-box gene family. In the forward-subtracted floral cDNA library, 1920 clones were randomly sequenced, from which 567 unique expressed sequence tags (ESTs) were obtained. Among them, 127 genes failed to show significant similarity to any published sequences in GenBank and thus are putatively novel genes. Phylogenetic analysis indicated that a total of 29 MADS-box transcription factors were members of the APETALA3(AP3) subfamily, while nine others were putative MADS-box transcription factors that formed a cluster with MADS-box genes isolated from Amborella, the basal-most angiosperm, and those from the gymnosperms. This suggests that the origin of A. caudigerum is intermediate between the angiosperms and gymnosperms.
Gardenia jasminoides Encodes an Inhibitor-2 Protein for Protein Phosphatase Type 1
NASA Astrophysics Data System (ADS)
Gao, Lan; Li, Hao-Ming
2017-08-01
Protein phosphatase-1 (PP1) regulates diverse, essential cellular processes such as cell cycle progression, protein synthesis, muscle contraction, carbohydrate metabolism, transcription and neuronal signaling. Inhibitor-2 (I-2) can inhibit the activity of PP1 and has been found in diverse organisms. In this work, a Gardenia jasminoides fruit cDNA library was constructed, and the GjI-2 cDNA was isolated from the cDNA library by sequencing method. The GjI-2 cDNA contains a predicted 543 bp open reading frame that encodes 180 amino acids. The bioinformatics analysis suggested that the GjI-2 has conserved PP1c binding motif, and contains a conserved phosphorylation site, which is important in regulation of its activity. The three-dimensional model structure of GjI-2 was buite, its similar with the structure of I-2 from mouse. The results suggest that GjI-2 has relatively conserved RVxF, FxxR/KxR/K and HYNE motif, and these motifs are involved in interaction with PP1.
Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries
Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans
2000-01-01
We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641
Deletions of fetal and adult muscle cDNA in Duchenne and Becker muscular dystrophy patients.
Cross, G S; Speer, A; Rosenthal, A; Forrest, S M; Smith, T J; Edwards, Y; Flint, T; Hill, D; Davies, K E
1987-01-01
We have isolated a cDNA molecule from a human adult muscle cDNA library which is deleted in several Duchenne muscular dystrophy patients. Patient deletions have been used to map the exons across the Xp21 region of the short arm of the X chromosome. We demonstrate that a very mildly affected 61 year old patient is deleted for at least nine exons of the adult cDNA. We find no evidence for differential exon usage between adult and fetal muscle in this region of the gene. There must therefore be less essential domains of the protein structure which can be removed without complete loss of function. The sequence of 2.0 kb of the adult cDNA shows no homology to any previously described protein listed in the data banks although sequence comparison at the amino acid level suggests that the protein has a structure not dissimilar to rod structures of cytoskeletal proteins such as lamin and myosin. There are single nucleotide differences in the DNA sequence between the adult and fetal cDNAs which result in amino acid changes but none that would be predicted to change the structure of the protein dramatically. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 7. PMID:3428261
Li, Yu-Ping; Xia, Run-Xi; Wang, Huan; Li, Xi-Sheng; Liu, Yan-Qun; Wei, Zhao-Jun; Lu, Cheng; Xiang, Zhong-Huai
2009-06-24
In this study we successfully constructed a full-length cDNA library from Chinese oak silkworm, Antheraea pernyi, the most well-known wild silkworm used for silk production and insect food. Total RNA was extracted from a single fresh female pupa at the diapause stage. The titer of the library was 5 x 10(5) cfu/ml and the proportion of recombinant clones was approximately 95%. Expressed sequence tag (EST) analysis was used to characterize the library. A total of 175 clustered ESTs consisting of 24 contigs and 151 singlets were generated from 250 effective sequences. Of the 175 unigenes, 97 (55.4%) were known genes but only five from A. pernyi, 37 (21.2%) were known ESTs without function annotation, and 41 (23.4%) were novel ESTs. By EST sequencing, a gene coding KK-42-binding protein in A. pernyi (named as ApKK42-BP; GenBank accession no. FJ744151) was identified and characterized. Protein sequence analysis showed that ApKK42-BP was not a membrane protein but an extracellular protein with a signal peptide at position 1-18, and contained two putative conserved domains, abhydro_lipase and abhydrolase_1, suggesting it may be a member of lipase superfamily. Expression analysis based on number of ESTs showed that ApKK42-BP was an abundant gene in the period of diapause stage, suggesting it may also be involved in pupa-diapause termination.
Li, Yu-Ping; Xia, Run-Xi; Wang, Huan; Li, Xi-Sheng; Liu, Yan-Qun; Wei, Zhao-Jun; Lu, Cheng; Xiang, Zhong-Huai
2009-01-01
In this study we successfully constructed a full-length cDNA library from Chinese oak silkworm, Antheraea pernyi, the most well-known wild silkworm used for silk production and insect food. Total RNA was extracted from a single fresh female pupa at the diapause stage. The titer of the library was 5 × 105 cfu/ml and the proportion of recombinant clones was approximately 95%. Expressed sequence tag (EST) analysis was used to characterize the library. A total of 175 clustered ESTs consisting of 24 contigs and 151 singlets were generated from 250 effective sequences. Of the 175 unigenes, 97 (55.4%) were known genes but only five from A. pernyi, 37 (21.2%) were known ESTs without function annotation, and 41 (23.4%) were novel ESTs. By EST sequencing, a gene coding KK-42-binding protein in A. pernyi (named as ApKK42-BP; GenBank accession no. FJ744151) was identified and characterized. Protein sequence analysis showed that ApKK42-BP was not a membrane protein but an extracellular protein with a signal peptide at position 1-18, and contained two putative conserved domains, abhydro_lipase and abhydrolase_1, suggesting it may be a member of lipase superfamily. Expression analysis based on number of ESTs showed that ApKK42-BP was an abundant gene in the period of diapause stage, suggesting it may also be involved in pupa-diapause termination. PMID:19564928
Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin
2016-04-01
Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, W.; Emanuel, B.S.; Siegert, J.
1994-09-01
DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less
Langevin, Stanley A.; Bent, Zachary W.; Solberg, Owen D.; Curtis, Deanna J.; Lane, Pamela D.; Williams, Kelly P.; Schoeniger, Joseph S.; Sinha, Anupama; Lane, Todd W.; Branda, Steven S.
2013-01-01
Use of second generation sequencing (SGS) technologies for transcriptional profiling (RNA-Seq) has revolutionized transcriptomics, enabling measurement of RNA abundances with unprecedented specificity and sensitivity and the discovery of novel RNA species. Preparation of RNA-Seq libraries requires conversion of the RNA starting material into cDNA flanked by platform-specific adaptor sequences. Each of the published methods and commercial kits currently available for RNA-Seq library preparation suffers from at least one major drawback, including long processing times, large starting material requirements, uneven coverage, loss of strand information and high cost. We report the development of a new RNA-Seq library preparation technique that produces representative, strand-specific RNA-Seq libraries from small amounts of starting material in a fast, simple and cost-effective manner. Additionally, we have developed a new quantitative PCR-based assay for precisely determining the number of PCR cycles to perform for optimal enrichment of the final library, a key step in all SGS library preparation workflows. PMID:23558773
van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov
2002-01-01
Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264
Knutzon, D S; Lardizabal, K D; Nelsen, J S; Bleibaum, J L; Davies, H M; Metz, J G
1995-01-01
Immature coconut (Cocos nucifera) endosperm contains a 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) activity that shows a preference for medium-chain-length fatty acyl-coenzyme A substrates (H.M. Davies, D.J. Hawkins, J.S. Nelsen [1995] Phytochemistry 39:989-996). Beginning with solubilized membrane preparations, we have used chromatographic separations to identify a polypeptide with an apparent molecular mass of 29 kD, whose presence in various column fractions correlates with the acyltransferase activity detected in those same fractions. Amino acid sequence data obtained from several peptides generated from this protein were used to isolate a full-length clone from a coconut endosperm cDNA library. Clone pCGN5503 contains a 1325-bp cDNA insert with an open reading frame encoding a 308-amino acid protein with a calculated molecular mass of 34.8 kD. Comparison of the deduced amino acid sequence of pCGN5503 to sequences in the data banks revealed significant homology to other putative LPAAT sequences. Expression of the coconut cDNA in Escherichia coli conferred upon those cells a novel LPAAT activity whose substrate activity profile matched that of the coconut enzyme. PMID:8552723
Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.
Newsome, A L; McLean, J W; Lively, M O
1992-01-01
Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959
Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting
2014-09-01
Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.
Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y
1996-08-01
The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.
cDNA encoding a polypeptide including a hevein sequence
Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil
1999-05-04
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.
cDNA encoding a polypeptide including a hev ein sequence
Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil
2000-07-04
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.
cDNA encoding a polypeptide including a hevein sequence
Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.
1999-05-04
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.
CDNA encoding a polypeptide including a hevein sequence
Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil
1995-03-21
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.
cDNA encoding a polypeptide including a hevein sequence
Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.
1995-03-21
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.
Guo, Baozhu; Chen, Xiaoping; Dang, Phat; Scully, Brian T; Liang, Xuanqiang; Holbrook, C Corley; Yu, Jiujiang; Culbreath, Albert K
2008-01-01
Background Peanut (Arachis hypogaea L.) is an important crop economically and nutritionally, and is one of the most susceptible host crops to colonization of Aspergillus parasiticus and subsequent aflatoxin contamination. Knowledge from molecular genetic studies could help to devise strategies in alleviating this problem; however, few peanut DNA sequences are available in the public database. In order to understand the molecular basis of host resistance to aflatoxin contamination, a large-scale project was conducted to generate expressed sequence tags (ESTs) from developing seeds to identify resistance-related genes involved in defense response against Aspergillus infection and subsequent aflatoxin contamination. Results We constructed six different cDNA libraries derived from developing peanut seeds at three reproduction stages (R5, R6 and R7) from a resistant and a susceptible cultivated peanut genotypes, 'Tifrunner' (susceptible to Aspergillus infection with higher aflatoxin contamination and resistant to TSWV) and 'GT-C20' (resistant to Aspergillus with reduced aflatoxin contamination and susceptible to TSWV). The developing peanut seed tissues were challenged by A. parasiticus and drought stress in the field. A total of 24,192 randomly selected cDNA clones from six libraries were sequenced. After removing vector sequences and quality trimming, 21,777 high-quality EST sequences were generated. Sequence clustering and assembling resulted in 8,689 unique EST sequences with 1,741 tentative consensus EST sequences (TCs) and 6,948 singleton ESTs. Functional classification was performed according to MIPS functional catalogue criteria. The unique EST sequences were divided into twenty-two categories. A similarity search against the non-redundant protein database available from NCBI indicated that 84.78% of total ESTs showed significant similarity to known proteins, of which 165 genes had been previously reported in peanuts. There were differences in overall expression patterns in different libraries and genotypes. A number of sequences were expressed throughout all of the libraries, representing constitutive expressed sequences. In order to identify resistance-related genes with significantly differential expression, a statistical analysis to estimate the relative abundance (R) was used to compare the relative abundance of each gene transcripts in each cDNA library. Thirty six and forty seven unique EST sequences with threshold of R > 4 from libraries of 'GT-C20' and 'Tifrunner', respectively, were selected for examination of temporal gene expression patterns according to EST frequencies. Nine and eight resistance-related genes with significant up-regulation were obtained in 'GT-C20' and 'Tifrunner' libraries, respectively. Among them, three genes were common in both genotypes. Furthermore, a comparison of our EST sequences with other plant sequences in the TIGR Gene Indices libraries showed that the percentage of peanut EST matched to Arabidopsis thaliana, maize (Zea mays), Medicago truncatula, rapeseed (Brassica napus), rice (Oryza sativa), soybean (Glycine max) and wheat (Triticum aestivum) ESTs ranged from 33.84% to 79.46% with the sequence identity ≥ 80%. These results revealed that peanut ESTs are more closely related to legume species than to cereal crops, and more homologous to dicot than to monocot plant species. Conclusion The developed ESTs can be used to discover novel sequences or genes, to identify resistance-related genes and to detect the differences among alleles or markers between these resistant and susceptible peanut genotypes. Additionally, this large collection of cultivated peanut EST sequences will make it possible to construct microarrays for gene expression studies and for further characterization of host resistance mechanisms. It will be a valuable genomic resource for the peanut community. The 21,777 ESTs have been deposited to the NCBI GenBank database with accession numbers ES702769 to ES724546. PMID:18248674
Clark, D P; Durell, S; Maloy, W L; Zasloff, M
1994-04-08
Antimicrobial peptides comprise a diverse class of molecules used in host defense by plants, insects, and animals. In this study we have isolated a novel antimicrobial peptide from the skin of the bullfrog, Rana catesbeiana. This 20 amino acid peptide, which we have termed Ranalexin, has the amino acid sequence: NH2-Phe-Leu-Gly-Gly-Leu-Ile-Lys-Ile-Val-Pro-Ala-Met-Ile-Cys-Ala-Val-Thr- Lys-Lys - Cys-COOH, and it contains a single intramolecular disulfide bond which forms a heptapeptide ring within the molecule. Structurally, Ranalexin resembles the bacterial antibiotic, polymyxin, which contains a similar heptapeptide ring. We have also cloned the cDNA for Ranalexin from a metamorphic R. catesbeiana tadpole cDNA library. Based on the cDNA sequence, it appears that Ranalexin is initially synthesized as a propeptide with a putative signal sequence and an acidic amino acid-rich region at its amino-terminal end. Interestingly, the putative signal sequence of the Ranalexin cDNA is strikingly similar to the signal sequence of opioid peptide precursors isolated from the skin of the South American frogs Phyllomedusa sauvagei and Phyllomedusa bicolor. Northern blot analysis and in situ hybridization experiments demonstrated that Ranalexin mRNA is first expressed in R. catesbeiana skin at metamorphosis and continues to be expressed into adulthood.
Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru
2013-01-01
In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti, Reticulitermes speratus and Nasutitermes takasagoensis. We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H. sjostedti library, while all except dnmt3 were found in R. speratus and N. takasagoensis. The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation.
Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru
2013-01-01
In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti , Reticulitermessperatus and Nasutitermestakasagoensis . We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H . sjostedti library, while all except dnmt3 were found in R . speratus and N . takasagoensis . The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation. PMID:24098800
Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong
2003-07-01
Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.
NASA Astrophysics Data System (ADS)
Liu, Hongzhan; Zheng, Fengrong; Sun, Xiuqin; Cai, Yimei
2012-06-01
The aquaculture of sea cucumber Apostichopus japonicus (Echinodermata, Holothuroidea) has grown rapidly during recent years and has become an important sector of the marine industry in Northern China. However, with the rapid growth of the industry and the use of non-standard culture techniques, epidemic diseases of A. japonicus now pose increasing problems to the industry. To screen the genes with stress response to bacterial infection in sea cucumber at a genome wide level, we constructed a cDNA library from A. japonicus Selenka (Aspidochirotida: Stichopodidae) after infecting them with Vibrio sp. for 48 h. Total RNA was extracted from the intestine, mesentery and coelomocyte of infected sea cucumber using Trizol and mRNA was isolated by Oligotex mRNA Kits. The ligated cDNAs were transformed into DH5α, and a library of 3.24×105 clones (3.24×105 cfu mL-1) was obtained with the sizes of inserted fragments ranging from 0.8 to 2.5 kb. Sequencing the cDNA clones resulted in a total of 1106 ESTs that passed the quality control. BlastX and BlastN searches have identified 168 (31.5%) ESTs sharing significant homology with known sequences in NCBI protein or nucleotide databases. Among a panel of 25 putative immunity-related genes, serum lectin isoform, complement component 3, complement component 3-like genes were further studied by real-time PCR and they all increased more than 5 fold in response to Vibrio sp. challenge. Our library provides a valuable molecular tool for future study of invertebrate immunity against bacterial infection and our gene expression data indicates the importance of the immune system in the evolution and development of sea cucumber.
Capsicum annuum dehydrin, an osmotic-stress gene in hot pepper plants.
Chung, Eunsook; Kim, Soo-Yong; Yi, So Young; Choi, Doil
2003-06-30
Osmotic stress-related genes were selected from an EST database constructed from 7 cDNA libraries from different tissues of the hot pepper. A full-length cDNA of Capsicum annuum dehydrin (Cadhn), a late embryogenesis abundant (lea) gene, was selected from the 5' single pass sequenced cDNA clones and sequenced. The deduced polypeptide has 87% identity with potato dehydrin C17, but very little identity with the dehydrin genes of other organisms. It contains a serine-tract (S-segment) and 3 conserved lysine-rich domains (K-segments). Southern blot analysis showed that 2 copies are present in the hot pepper genome. Cadhn was induced by osmotic stress in leaf tissues as well as by the application of abscisic acid. The RNA was most abundant in green fruit. The expression of several osmotic stress-related genes was examined and Cadhn proved to be the most abundantly expressed of these in response to osmotic stress.
Rapid in silico cloning of genes using expressed sequence tags (ESTs).
Gill, R W; Sanseau, P
2000-01-01
Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.
An insight into the sialome of the blood-sucking bug Triatoma infestans, a vector of Chagas' disease
Assumpção, Teresa C. F.; Francischetti, Ivo M. B.; Andersen, John F.; Schwarz, Alexandra; Santana, Jaime M.; Ribeiro, José M. C.
2008-01-01
Triatoma infestans is a hemiptera, vector of Chagas’ disease, that feeds exclusively on vertebrate blood in all life stages. Hematophagous insects’ salivary glands (SG) produce potent pharmacological compounds that counteract host hemostasis, including anti-clotting, anti-platelet, and vasodilatory molecules. To obtain a further insight into the salivary biochemical and pharmacological complexity of this insect, a cDNA library from its salivary glands was randomly sequenced. Also, salivary proteins were submitted to two dimentional gel (2D-gel) electrophoresis followed by MS analysis. We present the analysis of a set of 1,534 (SG) cDNA sequences, 645 of which coded for proteins of a putative secretory nature. Most salivary proteins described as lipocalins matched peptide sequences obtained from proteomic results. PMID:18207082
Grant, Susan; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun
2006-01-01
Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at -20 degrees C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes.
Robust Sub-nanomolar Library Preparation for High Throughput Next Generation Sequencing.
Wu, Wells W; Phue, Je-Nie; Lee, Chun-Ting; Lin, Changyi; Xu, Lai; Wang, Rong; Zhang, Yaqin; Shen, Rong-Fong
2018-05-04
Current library preparation protocols for Illumina HiSeq and MiSeq DNA sequencers require ≥2 nM initial library for subsequent loading of denatured cDNA onto flow cells. Such amounts are not always attainable from samples having a relatively low DNA or RNA input; or those for which a limited number of PCR amplification cycles is preferred (less PCR bias and/or more even coverage). A well-tested sub-nanomolar library preparation protocol for Illumina sequencers has however not been reported. The aim of this study is to provide a much needed working protocol for sub-nanomolar libraries to achieve outcomes as informative as those obtained with the higher library input (≥ 2 nM) recommended by Illumina's protocols. Extensive studies were conducted to validate a robust sub-nanomolar (initial library of 100 pM) protocol using PhiX DNA (as a control), genomic DNA (Bordetella bronchiseptica and microbial mock community B for 16S rRNA gene sequencing), messenger RNA, microRNA, and other small noncoding RNA samples. The utility of our protocol was further explored for PhiX library concentrations as low as 25 pM, which generated only slightly fewer than 50% of the reads achieved under the standard Illumina protocol starting with > 2 nM. A sub-nanomolar library preparation protocol (100 pM) could generate next generation sequencing (NGS) results as robust as the standard Illumina protocol. Following the sub-nanomolar protocol, libraries with initial concentrations as low as 25 pM could also be sequenced to yield satisfactory and reproducible sequencing results.
Paramyosin from the parasitic mite Sarcoptes scabiei: cDNA cloning and heterologous expression.
Mattsson, J G; Ljunggren, E L; Bergström, K
2001-05-01
The burrowing mite Sarcoptes scabiei is the causative agent of the highly contagious disease sarcoptic mange or scabies. So far, there is no in vitro propagation system for S. scabiei available, and mites used for various purposes must be isolated from infected hosts. Lack of parasite-derived material has limited the possibilities to study several aspects of scabies, including pathogenesis and immunity. It has also hampered the development of high performance serological assays. We have now constructed an S. scabiei cDNA expression library with mRNA purified from mites isolated from red foxes. Immunoscreening of the library enabled us to clone a full-length cDNA coding for a 102.5 kDa protein. Sequence similarity searches identified the protein as a paramyosin. Recombinant S. scabiei paramyosin expressed in Escherichia coli was recognized by sera from dogs and swine infected with S. scabiei. We also designed a small paramyosin construct of about 17 kDa that included the N-terminal part, an evolutionary variable part of the helical core, and the C-terminal part of the molecule. The miniaturized protein was efficiently expressed in E. coli and was recognized by sera from immunized rabbits. These data demonstrate that the cDNA library can assist in the isolation of important S. scabiei antigens and that recombinant proteins can be useful for the study of scabies.
Sequence, molecular properties, and chromosomal mapping of mouse lumican
NASA Technical Reports Server (NTRS)
Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)
1995-01-01
PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.
Molecular cloning and characterization of Hymenolepis diminuta alpha-tubulin gene.
Mohajer-Maghari, Behrokh; Amini-Bavil-Olyaee, Samad; Webb, Rodney A; Coe, Imogen R
2007-02-01
To isolate a full-length alpha-tubulin cDNA from an eucestode, Hymenolepis diminuta, a lambda phage cDNA library was constructed. The alpha-tubulin gene was cloned, sequenced and characterized. The H. diminuta alpha-tubulin consisted of 450 amino acids. This protein contained putative sites for all posttranslational modifications as detyrosination/tyrosination at the carboxyl-terminal of protien, phosphorylation at residues R79 and K336, glycylation/glutamylation at residue G445 and acetylation at residue K40. Comparisons of H. diminuta alpha-tubulin with all full-length alpha-tubulin proteins revealed that H. diminuta alpha-tubulin possesses 10 distinctive residues, which are not found in any other alpha-tubulins. Phylogenetic analysis showed that H. diminuta alpha-tubulin has grouped in a separated branch adjacent eucestode and trematodes branch with 92% bootstrap value (1000 replicates). In conclusion, this is the first report of H. diminuta cDNA library construction, cloning and characterization of H. diminuta alpha-tubulin gene.
Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K
1999-09-01
We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.
Woods, D E; Edge, M D; Colten, H R
1984-01-01
Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718
Hurrelbrink, R J; Nestorowicz, A; McMinn, P C
1999-12-01
An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under the control of a T7 RNA polymerase promoter. The clone was constructed by using existing components of a cDNA library, in addition to cDNA of the 3' terminus derived by RT-PCR of poly(A)-tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined sequence of the 3' UTR was found to contain elements conserved throughout the genus FLAVIVIRUS: RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of CDV-1-51 and MVE-1-51 (LD(50) values and mortality profiles) were found to be identical in vivo in the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a valuable tool for investigating the molecular determinants of virulence in MVE virus.
Zhu, Ziguo; Shi, Jiangli; Cao, Jiangling; He, Mingyang; Wang, Yuejin
2012-11-01
Chinese wild grapevine Vitis pseudoreticulata accession 'Baihe-35-1' is identified as the precious resource with multiple resistances to pathogens. A directional cDNA library was constructed from the young leaves inoculated with Erysiphe necator. A total of 3,500 clones were sequenced, yielding 1,727 unigenes. Among them, 762 unigenes were annotated and classified into three classes, respectively, using Gene Ontology, including 22 ESTs related to transcription regulator activity. A novel WRKY transcription factor was isolated from the library, and designated as VpWRKY3 (GenBank Accession No. JF500755). The full-length cDNA is 1,280 bp, encoding a WRKY protein of 320 amino acids. VpWRKY3 is localized to nucleus and functions as a transcriptional activator. QRT-PCR analysis showed that the VpWRKY3 specifically accumulated in response to pathogen, salicylic acid, ethylene and drought stress. Overexpression of VpWRKY3 in tobacco increased the resistance to Ralstonia solanacearum, indicating that VpWRKY3 participates in defense response. Furthermore, VpWRKY3 is also involved in abscisic acid signal pathway and salt stress. This experiment provided an important basis for understanding the defense mechanisms mediated by WRKY genes in China wild grapevine. Generation of the EST collection from the cDNA library provided valuable information for the grapevine breeding. Key message We constructed a cDNA library from Chinese wild grapevine leaves inoculated with powdery mildew. VpWRKY3 was isolated and demonstrated that it was involved in biotic and abiotic stress responses.
Daytime soybean transcriptome fluctuations during water deficit stress
USDA-ARS?s Scientific Manuscript database
Since drought can seriously affect plant growth and development and little is known about how the oscillations of gene expression during the drought stress-acclimation response in soybean is affected, we applied Illumina technology to sequence 36 cDNA libraries synthesized from control and drought-s...
Langevin, Stanley A; Bent, Zachary W; Solberg, Owen D; Curtis, Deanna J; Lane, Pamela D; Williams, Kelly P; Schoeniger, Joseph S; Sinha, Anupama; Lane, Todd W; Branda, Steven S
2013-04-01
Use of second generation sequencing (SGS) technologies for transcriptional profiling (RNA-Seq) has revolutionized transcriptomics, enabling measurement of RNA abundances with unprecedented specificity and sensitivity and the discovery of novel RNA species. Preparation of RNA-Seq libraries requires conversion of the RNA starting material into cDNA flanked by platform-specific adaptor sequences. Each of the published methods and commercial kits currently available for RNA-Seq library preparation suffers from at least one major drawback, including long processing times, large starting material requirements, uneven coverage, loss of strand information and high cost. We report the development of a new RNA-Seq library preparation technique that produces representative, strand-specific RNA-Seq libraries from small amounts of starting material in a fast, simple and cost-effective manner. Additionally, we have developed a new quantitative PCR-based assay for precisely determining the number of PCR cycles to perform for optimal enrichment of the final library, a key step in all SGS library preparation workflows.
Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M
1991-01-01
Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338
Structure and chromosomal localization of the human PD-1 gene (PDCD1)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shinohara, T.; Ishida, Y.; Kawaichi, M.
1994-10-01
A cDNA encoding mouse PD-1, a member of the immunoglobulin superfamily, was previously isolated from apoptosis-induced cells by subtractive hybridization. To determine the structure and chromosomal location of the human PD-1 gene, we screened a human T cell cDNA library by mouse PD-1 probe and isolated a cDNA coding for the human PD-1 protein. The deduced amino acid sequence of human PD-1 was 60% identical to the mouse counterpart, and a putative tyrosine kinase-association motif was well conserved. The human PD-1 gene was mapped to 2q37.3 by chromosomal in situ hybridization. 7 refs., 3 figs.
Booman, Marije; Borza, Tudor; Feng, Charles Y; Hori, Tiago S; Higgins, Brent; Culf, Adrian; Léger, Daniel; Chute, Ian C; Belkaid, Anissa; Rise, Marlies; Gamperl, A Kurt; Hubert, Sophie; Kimball, Jennifer; Ouellette, Rodney J; Johnson, Stewart C; Bowman, Sharen; Rise, Matthew L
2011-08-01
The collapse of Atlantic cod (Gadus morhua) wild populations strongly impacted the Atlantic cod fishery and led to the development of cod aquaculture. In order to improve aquaculture and broodstock quality, we need to gain knowledge of genes and pathways involved in Atlantic cod responses to pathogens and other stressors. The Atlantic Cod Genomics and Broodstock Development Project has generated over 150,000 expressed sequence tags from 42 cDNA libraries representing various tissues, developmental stages, and stimuli. We used this resource to develop an Atlantic cod oligonucleotide microarray containing 20,000 unique probes. Selection of sequences from the full range of cDNA libraries enables application of the microarray for a broad spectrum of Atlantic cod functional genomics studies. We included sequences that were highly abundant in suppression subtractive hybridization (SSH) libraries, which were enriched for transcripts responsive to pathogens or other stressors. These sequences represent genes that potentially play an important role in stress and/or immune responses, making the microarray particularly useful for studies of Atlantic cod gene expression responses to immune stimuli and other stressors. To demonstrate its value, we used the microarray to analyze the Atlantic cod spleen response to stimulation with formalin-killed, atypical Aeromonas salmonicida, resulting in a gene expression profile that indicates a strong innate immune response. These results were further validated by quantitative PCR analysis and comparison to results from previous analysis of an SSH library. This study shows that the Atlantic cod 20K oligonucleotide microarray is a valuable new tool for Atlantic cod functional genomics research.
Lange, T; Hedden, P; Graebe, J E
1994-01-01
In the biosynthetic pathway to the gibberellins (GAs), carbon-20 is removed by oxidation to give the C19-GAs, which include the biologically active plant hormones. We report the isolation of a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing) EC 1.14.11.-] by screening a cDNA library from developing cotyledons of pumpkin (Cucurbita maxima L.) for expression of this enzyme. When mRNA from either the cotyledons or the endosperm was translated in vitro using rabbit reticulocyte lysates, the products contained GA12 20-oxidase activity. A polyclonal antiserum was raised against the amino acid sequence of a peptide released by tryptic digestion of purified GA 20-oxidase from the endosperm. A cDNA expression library in lambda gt11 was prepared from cotyledon mRNA and screened with the antiserum. The identity of positive clones was confirmed by the demonstration of GA12 20-oxidase activity in single bacteriophage plaques. Recombinant protein from a selected clone catalyzed the three-step conversions of GA12 to GA25 and of GA53 to GA17, as well as the formation of the C19-GAs, GA1, GA9, and GA20, from their respective aldehyde precursors, GA23, GA24, and GA19. The nucleotide sequence of the cDNA insert contains an open reading frame of 1158 nt encoding a protein of 386 amino acid residues. The predicted M(r) (43,321) and pI (5.3) are similar to those determined experimentally for the native GA 20-oxidase. Furthermore, the derived amino acid sequence includes sequences obtained from the N terminus and two tryptic peptides from the native enzyme. It also contains regions that are highly conserved in a group of non-heme Fe-containing dioxygenases. Images PMID:8078921
Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent
2011-09-01
Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.
[Primary culture of cat intestinal epithelial cell and construction of its cDNA library].
Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C
2017-04-12
Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.
Duan, Zhigui; Cao, Rui; Jiang, Liping; Liang, Songping
2013-01-14
In past years, spider venoms have attracted increasing attention due to their extraordinary chemical and pharmacological diversity. The recently popularized proteomic method highly improved our ability to analyze the proteins in the venom. However, the lack of information about isolated venom proteins sequences dramatically limits the ability to confidently identify venom proteins. In the present paper, the venom from Araneus ventricosus was analyzed using two complementary approaches: 2-DE/Shotgun-LC-MS/MS coupled to MASCOT search and 2-DE/Shotgun-LC-MS/MS coupled to manual de novo sequencing followed by local venom protein database (LVPD) search. The LVPD was constructed with toxin-like protein sequences obtained from the analysis of cDNA library from A. ventricosus venom glands. Our results indicate that a total of 130 toxin-like protein sequences were unambiguously identified by manual de novo sequencing coupled to LVPD search, accounting for 86.67% of all toxin-like proteins in LVPD. Thus manual de novo sequencing coupled to LVPD search was proved an extremely effective approach for the analysis of venom proteins. In addition, the approach displays impeccable advantage in validating mutant positions of isoforms from the same toxin-like family. Intriguingly, methyl esterifcation of glutamic acid was discovered for the first time in animal venom proteins by manual de novo sequencing. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.
Human somatostatin I: sequence of the cDNA.
Shen, L P; Pictet, R L; Rutter, W J
1982-01-01
RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875
Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert
2008-12-01
Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.
Cloning of precursors for two MIH/VIH-related peptides in the prawn, Macrobrachium rosenbergii.
Yang, W J; Rao, K R
2001-11-30
Two cDNA clones (634 and 1366 bp) encoding MIH/VIH (molt-inhibiting hormone/vitellogenesis-inhibiting hormone)-related peptides were isolated and sequenced from a Macrobrachium rosenbergii eyestalk ganglia cDNA library. The clones contain a 360 and 339 bp open-reading frame, and their conceptually translated peptides consist of a 41 and 34 amino acid signal peptide, respectively, and a 78 amino acid residue mature peptide hormone. The amino acid sequences of the peptides exhibit higher identities with other known MIHs and VIH (44-69%) than with CHHs (28-33%). This is the first report describing the cloning and sequencing of two MIH/VIH-related peptides in a single crustacean species. Transcription of these mRNAs was detected in the eyestalk ganglia, but not in the thoracic ganglia, hepatopancreas, gut, gill, heart, or muscle.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.
1987-06-01
To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less
Jensen, Sigmund; Fortunato, Sofia A V; Hoffmann, Friederike; Hoem, Solveig; Rapp, Hans Tore; Øvreås, Lise; Torsvik, Vigdis L
2017-04-01
During the last decades, our knowledge about the activity of sponge-associated microorganisms and their contribution to biogeochemical cycling has gradually increased. Functional groups involved in carbon and nitrogen metabolism are well documented, whereas knowledge about microorganisms involved in the sulfur cycle is still limited. Both sulfate reduction and sulfide oxidation has been detected in the cold water sponge Geodia barretti from Korsfjord in Norway, and with specimens from this site, the present study aims to identify extant versus active sponge-associated microbiota with focus on sulfur metabolism. Comparative analysis of small subunit ribosomal RNA (16S rRNA) gene (DNA) and transcript (complementary DNA (cDNA)) libraries revealed profound differences. The transcript library was predominated by Chloroflexi despite their low abundance in the gene library. An opposite result was found for Acidobacteria. Proteobacteria were detected in both libraries with representatives of the Alpha- and Gammaproteobacteria related to clades with presumably thiotrophic bacteria from sponges and other marine invertebrates. Sequences that clustered with sponge-associated Deltaproteobacteria were remotely related to cultivated sulfate-reducing bacteria. The microbes involved in sulfur cycling were identified by the functional gene aprA (adenosine-5'-phosphosulfate reductase) and its transcript. Of the aprA sequences (DNA and cDNA), 87 % affiliated with sulfur-oxidizing bacteria. They clustered with Alphaproteobacteria and with clades of deep-branching Gammaproteobacteria. The remaining sequences clustered with sulfate-reducing Archaea of the phylum Euryarchaeota. These results indicate an active role of yet uncharacterized Bacteria and Archaea in the sponge's sulfur cycle.
Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P
1993-03-31
Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.
Allison, J; Hall, L; MacIntyre, I; Craig, R K
1981-01-01
(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146
Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation.
Bhat, P V; Labrecque, J; Boutin, J M; Lacroix, A; Yoshida, A
1995-12-12
Retinoic acid (RA), an important regulator of cell differentiation, is biosynthesized from retinol via retinal by a two-step oxidation process. We previously reported the purification and partial amino acid (aa) sequence of a rat kidney aldehyde dehydrogenase (ALDH) isozyme that catalyzed the oxidation of 9-cis and all-trans retinal to corresponding RA with high efficiency [Labrecque et al. Biochem. J. 305 (1995) 681-684]. A rat kidney cDNA library was screened using a 291-bp PCR product generated from total kidney RNA using a pair of oligodeoxyribonucleotide primers matched with the aa sequence. The full-length rat kidney ALDH cDNA contains a 2315-bp (501 aa) open reading frame (ORF). The aa sequence of rat kidney ALDH is 89, 96 and 87% identical to that of the rat cytosolic ALDH, the mouse cytosolic ALDH and human cytosolic ALDH, respectively. Northern blot and RT-PCR-mediated analysis demonstrated that rat kidney ALDH is strongly expressed in kidney, lung, testis, intestine, stomach and trachea, but weakly in the liver.
Kim, Dong Hyun; Patnaik, Bharat Bhusan; Seo, Gi Won; Kang, Seong Min; Lee, Yong Seok; Lee, Bok Luel; Han, Yeon Soo
2013-11-01
We have identified novel ricin-type (R-type) lectin by sequencing of random clones from cDNA library of the coleopteran beetle, Tenebrio molitor. The cDNA sequence is comprised of 495 bp encoding a protein of 164 amino acid residues and shows 49% identity with galectin of Tribolium castaneum. Bioinformatics analysis shows that the amino acid residues from 35 to 162 belong to ricin-type beta-trefoil structure. The transcript was significantly upregulated after early hours of injection with peptidoglycans derived from Gram (+) and Gram (-) bacteria, beta-1, 3 glucan from fungi and an intracellular pathogen, Listeria monocytogenes suggesting putative function in innate immunity. Copyright © 2013 Elsevier Inc. All rights reserved.
Deep sampling of the Palomero maize transcriptome by a high throughput strategy of pyrosequencing.
Vega-Arreguín, Julio C; Ibarra-Laclette, Enrique; Jiménez-Moraila, Beatriz; Martínez, Octavio; Vielle-Calzada, Jean Philippe; Herrera-Estrella, Luis; Herrera-Estrella, Alfredo
2009-07-06
In-depth sequencing analysis has not been able to determine the overall complexity of transcriptional activity of a plant organ or tissue sample. In some cases, deep parallel sequencing of Expressed Sequence Tags (ESTs), although not yet optimized for the sequencing of cDNAs, has represented an efficient procedure for validating gene prediction and estimating overall gene coverage. This approach could be very valuable for complex plant genomes. In addition, little emphasis has been given to efforts aiming at an estimation of the overall transcriptional universe found in a multicellular organism at a specific developmental stage. To explore, in depth, the transcriptional diversity in an ancient maize landrace, we developed a protocol to optimize the sequencing of cDNAs and performed 4 consecutive GS20-454 pyrosequencing runs of a cDNA library obtained from 2 week-old Palomero Toluqueño maize plants. The protocol reported here allowed obtaining over 90% of informative sequences. These GS20-454 runs generated over 1.5 Million reads, representing the largest amount of sequences reported from a single plant cDNA library. A collection of 367,391 quality-filtered reads (30.09 Mb) from a single run was sufficient to identify transcripts corresponding to 34% of public maize ESTs databases; total sequences generated after 4 filtered runs increased this coverage to 50%. Comparisons of all 1.5 Million reads to the Maize Assembled Genomic Islands (MAGIs) provided evidence for the transcriptional activity of 11% of MAGIs. We estimate that 5.67% (86,069 sequences) do not align with public ESTs or annotated genes, potentially representing new maize transcripts. Following the assembly of 74.4% of the reads in 65,493 contigs, real-time PCR of selected genes confirmed a predicted correlation between the abundance of GS20-454 sequences and corresponding levels of gene expression. A protocol was developed that significantly increases the number, length and quality of cDNA reads using massive 454 parallel sequencing. We show that recurrent 454 pyrosequencing of a single cDNA sample is necessary to attain a thorough representation of the transcriptional universe present in maize, that can also be used to estimate transcript abundance of specific genes. This data suggests that the molecular and functional diversity contained in the vast native landraces remains to be explored, and that large-scale transcriptional sequencing of a presumed ancestor of the modern maize varieties represents a valuable approach to characterize the functional diversity of maize for future agricultural and evolutionary studies.
Fan, Qing-Jie; Yan, Feng-Xia; Qiao, Guang; Zhang, Bing-Xue; Wen, Xiao-Peng
2014-01-01
Drought is one of the most severe threats to the growth, development and yield of plant. In order to unravel the molecular basis underlying the high tolerance of pitaya (Hylocereus undatus) to drought stress, suppression subtractive hybridization (SSH) and cDNA microarray approaches were firstly combined to identify the potential important or novel genes involved in the plant responses to drought stress. The forward (drought over drought-free) and reverse (drought-free over drought) suppression subtractive cDNA libraries were constructed using in vitro shoots of cultivar 'Zihonglong' exposed to drought stress and drought-free (control). A total of 2112 clones, among which half were from either forward or reverse SSH library, were randomly picked up to construct a pitaya cDNA microarray. Microarray analysis was carried out to verify the expression fluctuations of this set of clones upon drought treatment compared with the controls. A total of 309 expressed sequence tags (ESTs), 153 from forward library and 156 from reverse library, were obtained, and 138 unique ESTs were identified after sequencing by clustering and blast analyses, which included genes that had been previously reported as responsive to water stress as well as some functionally unknown genes. Thirty six genes were mapped to 47 KEGG pathways, including carbohydrate metabolism, lipid metabolism, energy metabolism, nucleotide metabolism, and amino acid metabolism of pitaya. Expression analysis of the selected ESTs by reverse transcriptase polymerase chain reaction (RT-PCR) corroborated the results of differential screening. Moreover, time-course expression patterns of these selected ESTs further confirmed that they were closely responsive to drought treatment. Among the differentially expressed genes (DEGs), many are related to stress tolerances including drought tolerance. Thereby, the mechanism of drought tolerance of this pitaya genotype is a very complex physiological and biochemical process, in which multiple metabolism pathways and many genes were implicated. The data gained herein provide an insight into the mechanism underlying the drought stress tolerance of pitaya, as well as may facilitate the screening of candidate genes for drought tolerance. © 2013 Elsevier B.V. All rights reserved.
Procedure for normalization of cDNA libraries
Bonaldo, Maria DeFatima; Soares, Marcelo Bento
1997-01-01
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.
Habermann, Bianca; Bebin, Anne-Gaelle; Herklotz, Stephan; Volkmer, Michael; Eckelt, Kay; Pehlke, Kerstin; Epperlein, Hans Henning; Schackert, Hans Konrad; Wiebe, Glenis; Tanaka, Elly M
2004-01-01
Background The ambystomatid salamander, Ambystoma mexicanum (axolotl), is an important model organism in evolutionary and regeneration research but relatively little sequence information has so far been available. This is a major limitation for molecular studies on caudate development, regeneration and evolution. To address this lack of sequence information we have generated an expressed sequence tag (EST) database for A. mexicanum. Results Two cDNA libraries, one made from stage 18-22 embryos and the other from day-6 regenerating tail blastemas, generated 17,352 sequences. From the sequenced ESTs, 6,377 contigs were assembled that probably represent 25% of the expressed genes in this organism. Sequence comparison revealed significant homology to entries in the NCBI non-redundant database. Further examination of this gene set revealed the presence of genes involved in important cell and developmental processes, including cell proliferation, cell differentiation and cell-cell communication. On the basis of these data, we have performed phylogenetic analysis of key cell-cycle regulators. Interestingly, while cell-cycle proteins such as the cyclin B family display expected evolutionary relationships, the cyclin-dependent kinase inhibitor 1 gene family shows an unusual evolutionary behavior among the amphibians. Conclusions Our analysis reveals the importance of a comprehensive sequence set from a representative of the Caudata and illustrates that the EST sequence database is a rich source of molecular, developmental and regeneration studies. To aid in data mining, the ESTs have been organized into an easily searchable database that is freely available online. PMID:15345051
Grant, Susan; Grant, William D.; Cowan, Don A.; Jones, Brian E.; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun
2006-01-01
Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at −20°C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes. PMID:16391035
Maruyama, Sandra Regina; Castro-Jorge, Luiza Antunes; Ribeiro, José Marcos Chaves; Gardinassi, Luiz Gustavo; Garcia, Gustavo Rocha; Brandão, Lucinda Giampietro; Rodrigues, Aline Rezende; Okada, Marcos Ituo; Abrão, Emiliana Pereira; Ferreira, Beatriz Rossetti; da Fonseca, Benedito Antonio Lopes; de Miranda-Santos, Isabel Kinney Ferreira
2013-01-01
Transcripts similar to those that encode the nonstructural (NS) proteins NS3 and NS5 from flaviviruses were found in a salivary gland (SG) complementary DNA (cDNA) library from the cattle tick Rhipicephalus microplus. Tick extracts were cultured with cells to enable the isolation of viruses capable of replicating in cultured invertebrate and vertebrate cells. Deep sequencing of the viral RNA isolated from culture supernatants provided the complete coding sequences for the NS3 and NS5 proteins and their molecular characterisation confirmed similarity with the NS3 and NS5 sequences from other flaviviruses. Despite this similarity, phylogenetic analyses revealed that this potentially novel virus may be a highly divergent member of the genus Flavivirus. Interestingly, we detected the divergent NS3 and NS5 sequences in ticks collected from several dairy farms widely distributed throughout three regions of Brazil. This is the first report of flavivirus-like transcripts in R. microplus ticks. This novel virus is a potential arbovirus because it replicated in arthropod and mammalian cells; furthermore, it was detected in a cDNA library from tick SGs and therefore may be present in tick saliva. It is important to determine whether and by what means this potential virus is transmissible and to monitor the virus as a potential emerging tick-borne zoonotic pathogen. PMID:24626302
FragIdent--automatic identification and characterisation of cDNA-fragments.
Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin
2009-03-02
Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.
Pang, Chaoyou; Fan, Shuli; Song, Meizhen; Yu, Shuxun
2013-01-01
Background Cotton (Gossypium hirsutum L.) is one of the world’s most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. Methodology/Principal Findings In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR), which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. Conclusions/Significance These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence assembly and annotation in G. hirsutum and comparative genomics among Gossypium species. PMID:24146870
Tang, Qi; Ma, Xiaojun; Mo, Changming; Wilson, Iain W; Song, Cai; Zhao, Huan; Yang, Yanfang; Fu, Wei; Qiu, Deyou
2011-07-05
Siraitia grosvenorii (Luohanguo) is an herbaceous perennial plant native to southern China and most prevalent in Guilin city. Its fruit contains a sweet, fleshy, edible pulp that is widely used in traditional Chinese medicine. The major bioactive constituents in the fruit extract are the cucurbitane-type triterpene saponins known as mogrosides. Among them, mogroside V is nearly 300 times sweeter than sucrose. However, little is known about mogrosides biosynthesis in S. grosvenorii, especially the late steps of the pathway. In this study, a cDNA library generated from of equal amount of RNA taken from S. grosvenorii fruit at 50 days after flowering (DAF) and 70 DAF were sequenced using Illumina/Solexa platform. More than 48,755,516 high-quality reads from a cDNA library were generated that was assembled into 43,891 unigenes. De novo assembly and gap-filling generated 43,891 unigenes with an average sequence length of 668 base pairs. A total of 26,308 (59.9%) unique sequences were annotated and 11,476 of the unique sequences were assigned to specific metabolic pathways by the Kyoto Encyclopedia of Genes and Genomes. cDNA sequences for all of the known enzymes involved in mogrosides backbone synthesis were identified from our library. Additionally, a total of eighty-five cytochrome P450 (CYP450) and ninety UDP-glucosyltransferase (UDPG) unigenes were identified, some of which appear to encode enzymes responsible for the conversion of the mogroside backbone into the various mogrosides. Digital gene expression profile (DGE) analysis using Solexa sequencing was performed on three important stages of fruit development, and based on their expression pattern, seven CYP450s and five UDPGs were selected as the candidates most likely to be involved in mogrosides biosynthesis. A combination of RNA-seq and DGE analysis based on the next generation sequencing technology was shown to be a powerful method for identifying candidate genes encoding enzymes responsible for the biosynthesis of novel secondary metabolites in a non-model plant. Seven CYP450s and five UDPGs were selected as potential candidates involved in mogrosides biosynthesis. The transcriptome data from this study provides an important resource for understanding the formation of major bioactive constituents in the fruit extract from S. grosvenorii.
Yi, S Y; Hwang, B K
1998-10-31
Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.
Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L
1993-01-01
Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002
Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A
1994-01-01
Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617
The TGA codons are present in the open reading frame of selenoprotein P cDNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hill, K.E.; Lloyd, R.S.; Read, R.
1991-03-11
The TGA codon in DNA has been shown to direct incorporation of selenocysteine into protein. Several proteins from bacteria and animals contain selenocysteine in their primary structures. Each of the cDNA clones of these selenoproteins contains one TGA codon in the open reading frame which corresponds to the selenocysteine in the protein. A cDNA clone for selenoprotein P (SeP), obtained from a {gamma}ZAP rat liver library, was sequenced by the dideoxy termination method. The correct reading frame was determined by comparison of the deduced amino acid sequence with the amino acid sequence of several peptides from SeP. Using SeP labelledmore » with {sup 75}Se in vivo, the selenocysteine content of the peptides was verified by the collection of carboxymethylated {sup 77}Se-selenocysteine as it eluted from the amino acid analyzer and determination of the radioactivity contained in the collected samples. Ten TGA codons are present in the open reading frame of the cDNA. Peptide fragmentation studies and the deduced sequence indicate that selenium-rich regions are located close to the carboxy terminus. Nine of the 10 selenocysteines are located in the terminal 26% of the sequence with four in the terminal 15 amino acids. The deduced sequence codes for a protein of 385 amino acids. Cleavage of the signal peptide gives the mature protein with 366 amino acids and a calculated mol wt of 41,052 Da. Searches of PIR and SWISSPROT protein databases revealed no similarity with glutathione peroxidase or other selenoproteins.« less
Luna-Ramírez, Karen; Quintero-Hernández, Veronica; Vargas-Jaimes, Leonel; Batista, Cesar V F; Winkel, Kenneth D; Possani, Lourival D
2013-03-01
The Urodacidae scorpions are the most widely distributed of the four families in Australia and represent half of the species in the continent, yet their venoms remain largely unstudied. This communication reports the first results of a proteome analysis of the venom of the scorpion Urodacus yaschenkoi performed by mass fingerprinting, after high performance liquid chromatography (HPLC) separation. A total of 74 fractions were obtained by HPLC separation allowing the identification of approximately 274 different molecular masses with molecular weights varying from 287 to 43,437 Da. The most abundant peptides were those from 1 K Da and 4-5 K Da representing antimicrobial peptides and putative potassium channel toxins, respectively. Three such peptides were chemically synthesized and tested against Gram-positive and Gram-negative bacteria showing minimum inhibitory concentration in the low micromolar range, but with moderate hemolytic activity. It also reports a transcriptome analysis of the venom glands of the same scorpion species, undertaken by constructing a cDNA library and conducting random sequencing screening of the transcripts. From the resultant cDNA library 172 expressed sequence tags (ESTs) were analyzed. These transcripts were further clustered into 120 unique sequences (23 contigs and 97 singlets). The identified putative proteins can be assorted in several groups, such as those implicated in common cellular processes, putative neurotoxins and antimicrobial peptides. The scorpion U. yaschenkoi is not known to be dangerous to humans and its venom contains peptides similar to those of Opisthacanthus cayaporum (antibacterial), Scorpio maurus palmatus (maurocalcin), Opistophthalmus carinatus (opistoporines) and Hadrurus gerstchi (scorpine-like molecules), amongst others. Copyright © 2012 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Yu, Shuiyan; Liu, Shicheng; Li, Chunyang; Zhou, Zhigang
2011-01-01
Myrmecia incisa is a green coccoid freshwater microalgae, which is rich in arachidonic acid (ArA, C20: 4ω-6, δ5, 8, 11, 14), a long chain polyunsaturated fatty acid (PUFA), especially under nitrogen starvation stress. A cDNA library of M. incisa was constructed with λ phage vectors and a 545 nt expressed sequence tag (EST) was screened from this library as a putative elongase gene due to its 56% and 49% identity to Marchantia polymorpha L. and Ostreococcus tauri Courties et Chrétiennot-Dinet, respectively. Based upon this EST sequence, an elongase gene designated MiFAE was isolated from M. incisa via 5'/3' rapid amplification of cDNA ends (RACE). The cDNA sequence was 1 331 bp long and included a 33 bp 5'-untranslated region (UTR) and a 431 bp 3'-UTR with a typical poly-A tail. The 867 bp ORF encoded a predicted protein of 288 amino acids. This protein was characterized by a conserved histidine-rich box and a MYxYY motif that was present in other members of the elongase family. The genomic DNA sequence of MiFAE was found to be interrupted by three introns with splicing sites of Introns I (81 bp), II (81 bp), and III (67 bp) that conformed to the GT-AG rule. Quantitative real-time PCR showed that the transcription level of MiFAE in this microalga under nitrogen starvation was higher than that under normal condition. Prior to the ArA content accumulation, the transcription of MiFAE was enhanced, suggesting that it was possibly responsible for the ArA accumulation in this microalga cultured under nitrogen starvation conditions.
Liu, Guan-Jun; Liu, Ming-Kun; Xu, Zhi-Ru; Yan, Xiu-Feng; Wei, Zhi-Gang; Yang, Chuan-Ping
2009-04-01
Using cDNAs prepared from the leaves and stems of Polygonum sibiricum Laxm. treated with NaHCO3 stress for 48 h as testers and cDNAs from unstressed P. sibiricum leaves and stems as drivers library, suppression subtractive hybridization (SSH) was employed to construct a cDNA subtracted library, which contained 2 282 valid sequences including 598 ESTs in the stems forward SSH library and 490 ESTs in the stem reverse SSH library, 627 ESTs in the leaf forward SSH library and 567 in the leaf reverse SSH library. According to the functional catalogue of MIPs and the comparison of the reverse and forward SSH libraries of the stem and leaf, the responses to NaHCO3 stress were different between leaf and stem, except for the same trend in cell rescue defense and transport facilitation. The trend in the metabolism, energy, photosynthesis, protein synthesis, transcription, and signal transduction was opposite. RT-PCR analysis demonstrated that the expression of 12 putative stress related genes in the NaHCO3-treated leaves and stems was different from that in the untreated leaves and stems. This indicated that different mechanisms might be responsible for reactions of leaf and stem in P. sibiricum. The results from this study are useful in understanding the molecular mechanism of saline-alkali tolerance in P. sibiricum.
Guerrero, Consuelo; Martín-Rufián, M; Reina, José J; Heredia, Antonio
2006-01-01
A cDNA encoding an acyl-CoA binding protein (ACBP) homologue has been cloned from a cDNA library made from mRNA isolated from epidermis of young leaves of Agave americana L. The derived amino acid sequence reveals a protein corresponding to the membrane-associated form of ACBPs only previously described in Arabidopsis and rice. Northern blot analysis showed that the A. americana ACBP gene is mainly expressed in the epidermis of mature zone of the leaves. The epidermis of A. americana leaves have a well developed cuticle with the highest amounts of the cuticular components waxes, cutin and cutan suggesting a potential role of the protein in cuticle formation.
2009-01-01
Background Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most destructive diseases of wheat (Triticum aestivum L.) worldwide. In spite of its agricultural importance, the genomics and genetics of the pathogen are poorly characterized. Pst transcripts from urediniospores and germinated urediniospores have been examined previously, but little is known about genes expressed during host infection. Some genes involved in virulence in other rust fungi have been found to be specifically expressed in haustoria. Therefore, the objective of this study was to generate a cDNA library to characterize genes expressed in haustoria of Pst. Results A total of 5,126 EST sequences of high quality were generated from haustoria of Pst, from which 287 contigs and 847 singletons were derived. Approximately 10% and 26% of the 1,134 unique sequences were homologous to proteins with known functions and hypothetical proteins, respectively. The remaining 64% of the unique sequences had no significant similarities in GenBank. Fifteen genes were predicted to be proteins secreted from Pst haustoria. Analysis of ten genes, including six secreted protein genes, using quantitative RT-PCR revealed changes in transcript levels in different developmental and infection stages of the pathogen. Conclusions The haustorial cDNA library was useful in identifying genes of the stripe rust fungus expressed during the infection process. From the library, we identified 15 genes encoding putative secreted proteins and six genes induced during the infection process. These genes are candidates for further studies to determine their functions in wheat-Pst interactions. PMID:20028560
Improving RNA-Seq expression estimates by correcting for fragment bias
2011-01-01
The biochemistry of RNA-Seq library preparation results in cDNA fragments that are not uniformly distributed within the transcripts they represent. This non-uniformity must be accounted for when estimating expression levels, and we show how to perform the needed corrections using a likelihood based approach. We find improvements in expression estimates as measured by correlation with independently performed qRT-PCR and show that correction of bias leads to improved replicability of results across libraries and sequencing technologies. PMID:21410973
USDA-ARS?s Scientific Manuscript database
Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, one of the most important diseases of wheat worldwide. To identify Pst genes involved in infection and sporulation, a custom oligonucleotide Genechip was made using sequences of 442 genes selected from Pst cDNA libraries. Microarray analy...
USDA-ARS?s Scientific Manuscript database
We used an expressed sequence tag and 454 pyrosequencing approach to initiate a study of the genome of the New World Screwworm, Cochliomyia hominivorax (Coquerel). Two normalized cDNA libraries were constructed from RNA isolated from embryos and 2nd instar larvae from the Panama 95 strain. Approxima...
USDA-ARS?s Scientific Manuscript database
As an initial step to explore the transcriptome genetic diversity and to discover single nucleotide polymorphic (SNP)-biomarkers for marker assisted breeding within Pima (Gossypium barbadense L.) cotton, leaves from 25 day plants of three diverse genotypes were used to develop cDNA libraries. Using ...
Jia, P; Zhang, C; Huang, X P; Poda, M; Akbas, F; Lemanski, S L; Erginel-Unaltuna, N; Lemanski, L F
2008-11-01
The discovery of the naturally occurring cardiac non-function (c) animal strain in Ambystoma mexicanum (axolotl) provides a valuable animal model to study cardiomyocyte differentiation. In homozygous mutant animals (c/c), rhythmic contractions of the embryonic heart are absent due to a lack of organized myofibrils. We have previously cloned a partial sequence of a peptide cDNA (N1) from an anterior-endoderm-conditioned-medium RNA library that had been shown to be able to rescue the mutant phenotype. In the current studies we have fully cloned the N1 full length cDNA sequence from the library. N1 protein has been detected in both adult heart and skeletal muscle but not in any other adult tissues. GFP-tagged expression of the N1 protein has revealed localization of the N1 protein in the endoplasmic reticulum (ER). Results from in situ hybridization experiments have confirmed the dramatic decrease of expression of N1 mRNA in mutant (c/c) embryos indicating that the N1 gene is involved in heart development.
Procedure for normalization of cDNA libraries
Bonaldo, M.D.; Soares, M.B.
1997-12-30
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.
Eimeria tenella enolase and pyruvate kinase: a likely role in glycolysis and in others functions.
Labbé, Marie; Péroval, Marylène; Bourdieu, Christiane; Girard-Misguich, Fabienne; Péry, Pierre
2006-12-01
Two cDNA codings for glycolytic enzymes were cloned from a cDNA library constructed from the schizont stage of the avian parasite Eimeria tenella. Enolase and pyruvate kinase cDNA were fully sequenced and compared with sequences of enzymes from other organisms. Although these enzymes were already detected in the sporozoite stage, their expression was enhanced during the first schizogony in accordance with the anaerobic conditions of this part of the life cycle of the parasite. Under activating conditions, microscopic observations suggest that these glycolytic enzymes were relocalised inside sporozoites and moreover were in part secreted. The enzymes were also localised at the apex of the first generation of merozoites. Enolase was partly observed inside the nucleus of sporozoites and schizonts. Taken together, these results suggest that glycolytic enzymes not only have a function in glycolysis during anaerobic intracellular stages but may also participate in the invasion process and, for enolase, in the control of gene regulation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Claffey, K.P.; Herrera, V.L.; Brecher, P.
1987-12-01
A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less
Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao
2005-01-01
We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.
Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W
1997-04-01
A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.
An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.
Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel
2004-01-21
We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.
González-Carranza, Zinnia Haydé; Whitelaw, Catherine Ann; Swarup, Ranjan; Roberts, Jeremy Alan
2002-01-01
During leaf abscission in oilseed rape (Brassica napus), cell wall degradation is brought about by the action of several hydrolytic enzymes. One of these is thought to be polygalacturonase (PG). Degenerate primers were used to isolate a PG cDNA fragment by reverse transcriptase-polymerase chain reaction from RNA extracted from ethylene-promoted leaf abscission zones (AZs), and in turn a full-length clone (CAW471) from an oilseed rape AZ cDNA library. The highest homology of this cDNA (82%) was to an Arabidopsis sequence that was predicted to encode a PG protein. Analysis of expression revealed that CAW471 mRNA accumulated in the AZ of leaves and reached a peak 24 h after ethylene treatment. Ethylene-promoted leaf abscission in oilseed rape was not apparent until 42 h after exposure to the gas, reaching 50% at 48 h and 100% by 56 h. In floral organ abscission, expression of CAW471 correlated with cell separation. Genomic libraries from oilseed rape and Arabidopsis were screened with CAW471 and the respective genomic clones PGAZBRAN and PGAZAT isolated. Characterization of these PG genes revealed that they had substantial homology within both the coding regions and in the 5′-upstream sequences. Fusion of a 1,476-bp 5′-upstream sequence of PGAZAT to β-glucuronidase or green fluorescent protein and transformation of Arabidopsis revealed that this fragment was sufficient to drive expression of these reporter genes in the AZs at the base of the anther filaments, petals, and sepals. PMID:11842157
Horner, W E; Reese, G; Lehrer, S B
1995-01-01
Basidiospores are a prevalent and frequent cause of respiratory allergies, yet their allergens remain poorly defined; thus, we have attempted a molecular characterization of representative basidiomycete allergens. A Psilocybe cubensis mycelial cDNA library was immunoscreened with patient serum. A clone was isolated that expressed a 23-kD recombinant allergen as a fusion protein and inhibited a 16-kD band (Psi c 2) in immunoprints of P. cubenis extract, indicating antigenic identity. Sequence (cDNA) analysis of the clone indicates homology with cyclophilin and the deduced amino acid sequence of Psi c 2 showed 78% identity and 4% similarity with the amino acid sequence of Schizosaccharomyces pombe cyclophilin. This recombinant allergen is a useful model for epitope analysis of basidiospore allergens and fungal allergen cross-reactivity, and may provide an improved reagent for basidiospore allergy diagnosis and treatment.
Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J
1993-01-01
Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss-cDNAs. This strategy is referred to as SLIC for single-strand ligation to ss-cDNA (8).
Burgess, D; Penton, A; Dunsmuir, P; Dooner, H
1997-02-01
Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.
NASA Technical Reports Server (NTRS)
Funderburgh, J. L.; Funderburgh, M. L.; Brown, S. J.; Vergnes, J. P.; Hassell, J. R.; Mann, M. M.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)
1993-01-01
Amino acid sequence from tryptic peptides of three different bovine corneal keratan sulfate proteoglycan (KSPG) core proteins (designated 37A, 37B, and 25) showed similarities to the sequence of a chicken KSPG core protein lumican. Bovine lumican cDNA was isolated from a bovine corneal expression library by screening with chicken lumican cDNA. The bovine cDNA codes for a 342-amino acid protein, M(r) 38,712, containing amino acid sequences identified in the 37B KSPG core protein. The bovine lumican is 68% identical to chicken lumican, with an 83% identity excluding the N-terminal 40 amino acids. Location of 6 cysteine and 4 consensus N-glycosylation sites in the bovine sequence were identical to those in chicken lumican. Bovine lumican had about 50% identity to bovine fibromodulin and 20% identity to bovine decorin and biglycan. About two-thirds of the lumican protein consists of a series of 10 amino acid leucine-rich repeats that occur in regions of calculated high beta-hydrophobic moment, suggesting that the leucine-rich repeats contribute to beta-sheet formation in these proteins. Sequences obtained from 37A and 25 core proteins were absent in bovine lumican, thus predicting a unique primary structure and separate mRNA for each of the three bovine KSPG core proteins.
Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.
Kilimann, M W; DeGennaro, L J
1985-01-01
To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975
Tian, Wenzhi; Chua, Kevin; Strober, Warren; Chu, Charles C.
2002-01-01
BACKGROUND: Identification of differentially expressed genes between normal and diseased states is an area of intense current medical research that can lead to the discovery of new therapeutic targets. However, isolation of differentially expressed genes by subtraction often suffers from unreported contamination of the resulting subtraction library with clones containing DNA sequences not from the original RNA samples. MATERIALS AND METHODS: Subtraction using cDNA representational difference analysis (RDA) was performed on human B cells from normal or common variable immunodeficiency patients. The material remaining after the subtraction was cloned and individual clones were sequenced. The sequence of one clone with similarity to integrases (ILG1, integrase-like gene-1) was used to obtain the full length cDNA sequence and as a probe for the presence of this sequence in RNA or genomic DNA samples. RESULTS: After five rounds of cDNA RDA, 23.3% of the clones from the resulting subtraction library contained Escherichia coli DNA. In addition, three clones contained the sequence of a new integrase, ILG1. The full length cDNA sequence of ILG1 exhibits prokaryotic, but not eukaryotic, features. At the DNA level, ILG1 is not similar to any known gene. At the protein level, ILG1 has 58% similarity to integrases from the cryptic P4 bacteriophage family (S clade). The catalytic domain of ILG1 contains the conserved features found in site-specific recombinases. The critical residues that form the catalytic active site pocket are conserved, including the highly conserved R-H-R-Y hallmark of these recombinases. Interestingly, ILG1 was not present in the original B cell populations. By probing genomic DNA, ILG1 could only be detected in the E. coli TOP10F' strain used in our laboratory for molecular cloning, but not in any of its precursor strains, including TOP10. Furthermore, bacteria cultured from the mouth of the laboratory worker who performed cDNA RDA were also positive for ILG1. CONCLUSIONS: In the course of our studies using cDNA RDA, we have isolated and identified ILG1, a likely active site-specific recombinase and new member of the bacteriophage P4 family of integrases. This family of integrases is implicated in the horizontal DNA transfer of pathogenic genes between bacterial species, such as those found in pathogenic strains of E. coli, Shigella, Yersinia, and Vibrio cholera. Using ILG1 as a marker of our laboratory E. coli strain TOP10F', our evidence suggests that contaminating bacterial DNA in our subtraction experiment is due to this laboratory bacterial strain, which colonized exposed surfaces of the laboratory worker. Thus, identification of differentially expressed genes between normal and diseased states could be dramatically improved by using extra precaution to prevent bacterial contamination of samples. PMID:12393938
Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H
1987-01-01
To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536
Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).
He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun
2004-09-01
Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.
2010-01-01
Background Expressed Sequence Tag (EST) has been a cost-effective tool in molecular biology and represents an abundant valuable resource for genome annotation, gene expression, and comparative genomics in plants. Results In this study, we constructed a cDNA library of Prunus mume flower and fruit, sequenced 10,123 clones of the library, and obtained 8,656 expressed sequence tag (EST) sequences with high quality. The ESTs were assembled into 4,473 unigenes composed of 1,492 contigs and 2,981 singletons and that have been deposited in NCBI (accession IDs: GW868575 - GW873047), among which 1,294 unique ESTs were with known or putative functions. Furthermore, we found 1,233 putative simple sequence repeats (SSRs) in the P. mume unigene dataset. We randomly tested 42 pairs of PCR primers flanking potential SSRs, and 14 pairs were identified as true-to-type SSR loci and could amplify polymorphic bands from 20 individual plants of P. mume. We further used the 14 EST-SSR primer pairs to test the transferability on peach and plum. The result showed that nearly 89% of the primer pairs produced target PCR bands in the two species. A high level of marker polymorphism was observed in the plum species (65%) and low in the peach (46%), and the clustering analysis of the three species indicated that these SSR markers were useful in the evaluation of genetic relationships and diversity between and within the Prunus species. Conclusions We have constructed the first cDNA library of P. mume flower and fruit, and our data provide sets of molecular biology resources for P. mume and other Prunus species. These resources will be useful for further study such as genome annotation, new gene discovery, gene functional analysis, molecular breeding, evolution and comparative genomics between Prunus species. PMID:20626882
Valdez-Velázquez, Laura L; Quintero-Hernández, Verónica; Romero-Gutiérrez, Maria Teresa; Coronas, Fredy I V; Possani, Lourival D
2013-01-01
Centruroides tecomanus is a Mexican scorpion endemic of the State of Colima, that causes human fatalities. This communication describes a proteome analysis obtained from milked venom and a transcriptome analysis from a cDNA library constructed from two pairs of venom glands of this scorpion. High perfomance liquid chromatography separation of soluble venom produced 80 fractions, from which at least 104 individual components were identified by mass spectrometry analysis, showing to contain molecular masses from 259 to 44,392 Da. Most of these components are within the expected molecular masses for Na(+)- and K(+)-channel specific toxic peptides, supporting the clinical findings of intoxication, when humans are stung by this scorpion. From the cDNA library 162 clones were randomly chosen, from which 130 sequences of good quality were identified and were clustered in 28 contigs containing, each, two or more expressed sequence tags (EST) and 49 singlets with only one EST. Deduced amino acid sequence analysis from 53% of the total ESTs showed that 81% (24 sequences) are similar to known toxic peptides that affect Na(+)-channel activity, and 19% (7 unique sequences) are similar to K(+)-channel especific toxins. Out of the 31 sequences, at least 8 peptides were confirmed by direct Edman degradation, using components isolated directly from the venom. The remaining 19%, 4%, 4%, 15% and 5% of the ESTs correspond respectively to proteins involved in cellular processes, antimicrobial peptides, venom components, proteins without defined function and sequences without similarity in databases. Among the cloned genes are those similar to metalloproteinases.
Tong, C G; Reichler, S; Blumenthal, S; Balk, J; Hsieh, H L; Roux, S J
1997-01-01
A cDNA encoding a nucleolar protein was selected from a pea (Pisum sativum) plumule library, cloned, and sequenced. The translated sequence of the cDNA has significant percent identity to Xenopus laevis nucleolin (31%), the alfalfa (Medicago sativa) nucleolin homolog (66%), and the yeast (Saccharomyces cerevisiae) nucleolin homolog (NSR1) (28%). It also has sequence patterns in its primary structure that are characteristic of all nucleolins, including an N-terminal acidic motif, RNA recognition motifs, and a C-terminal Gly- and Arg-rich domain. By immunoblot analysis, the polyclonal antibodies used to select the cDNA bind selectively to a 90-kD protein in purified pea nuclei and nucleoli and to an 88-kD protein in extracts of Escherichia coli expressing the cDNA. In immunolocalization assays of pea plumule cells, the antibodies stained primarily a region surrounding the fibrillar center of nucleoli, where animal nucleolins are typically found. Southern analysis indicated that the pea nucleolin-like protein is encoded by a single gene, and northern analysis showed that the labeled cDNA binds to a single band of RNA, approximately the same size and the cDNA. After irradiation of etiolated pea seedlings by red light, the mRNA level in plumules decreased during the 1st hour and then increased to a peak of six times the 0-h level at 12 h. Far-red light reversed this effect of red light, and the mRNA accumulation from red/far-red light irradiation was equal to that found in the dark control. This indicates that phytochrome may regulate the expression of this gene. PMID:9193096
USDA-ARS?s Scientific Manuscript database
Several biosafety level (BSL)-3/4 pathogens are high consequence, single-stranded RNA viruses and their genomes, when introduced into permissive cells, are infectious. Moreover many of these viruses are Select Agents (SAs), and their genomes are also considered SAs. For this reason cDNAs and/or th...
USDA-ARS?s Scientific Manuscript database
Oocyte-specific genes play critical roles in oogenesis, folliculogenesis and early embryonic development. Through analysis of expressed sequence tags (ESTs) from a rainbow trout oocyte cDNA library, we identified a novel transcript which is represented by multiple ESTs derived only from the oocyte c...
Cloning and Expression of cDNA for Rat Heme Oxygenase
NASA Astrophysics Data System (ADS)
Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi
1985-12-01
Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.
Tartar, Aurélien; Wheeler, Marsha M; Zhou, Xuguo; Coy, Monique R; Boucias, Drion G; Scharf, Michael E
2009-01-01
Background Termite lignocellulose digestion is achieved through a collaboration of host plus prokaryotic and eukaryotic symbionts. In the present work, we took a combined host and symbiont metatranscriptomic approach for investigating the digestive contributions of host and symbiont in the lower termite Reticulitermes flavipes. Our approach consisted of parallel high-throughput sequencing from (i) a host gut cDNA library and (ii) a hindgut symbiont cDNA library. Subsequently, we undertook functional analyses of newly identified phenoloxidases with potential importance as pretreatment enzymes in industrial lignocellulose processing. Results Over 10,000 expressed sequence tags (ESTs) were sequenced from the 2 libraries that aligned into 6,555 putative transcripts, including 171 putative lignocellulase genes. Sequence analyses provided insights in two areas. First, a non-overlapping complement of host and symbiont (prokaryotic plus protist) glycohydrolase gene families known to participate in cellulose, hemicellulose, alpha carbohydrate, and chitin degradation were identified. Of these, cellulases are contributed by host plus symbiont genomes, whereas hemicellulases are contributed exclusively by symbiont genomes. Second, a diverse complement of previously unknown genes that encode proteins with homology to lignase, antioxidant, and detoxification enzymes were identified exclusively from the host library (laccase, catalase, peroxidase, superoxide dismutase, carboxylesterase, cytochrome P450). Subsequently, functional analyses of phenoloxidase activity provided results that were strongly consistent with patterns of laccase gene expression. In particular, phenoloxidase activity and laccase gene expression are mostly restricted to symbiont-free foregut plus salivary gland tissues, and phenoloxidase activity is inducible by lignin feeding. Conclusion To our knowledge, this is the first time that a dual host-symbiont transcriptome sequencing effort has been conducted in a single termite species. This sequence database represents an important new genomic resource for use in further studies of collaborative host-symbiont termite digestion, as well as development of coevolved host and symbiont-derived biocatalysts for use in industrial biomass-to-bioethanol applications. Additionally, this study demonstrates that: (i) phenoloxidase activities are prominent in the R. flavipes gut and are not symbiont derived, (ii) expands the known number of host and symbiont glycosyl hydrolase families in Reticulitermes, and (iii) supports previous models of lignin degradation and host-symbiont collaboration in cellulose/hemicellulose digestion in the termite gut. All sequences in this paper are available publicly with the accession numbers FL634956-FL640828 (Termite Gut library) and FL641015-FL645753 (Symbiont library). PMID:19832970
Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B
1996-06-01
Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.
Celorio-Mancera, Maria de la Paz; Courtiade, Juliette; Muck, Alexander; Heckel, David G.; Musser, Richard O.; Vogel, Heiko
2011-01-01
Although the importance of insect saliva in insect-host plant interactions has been acknowledged, there is very limited information on the nature and complexity of the salivary proteome in lepidopteran herbivores. We inspected the labial salivary transcriptome and proteome of Helicoverpa armigera, an important polyphagous pest species. To identify the majority of the salivary proteins we have randomly sequenced 19,389 expressed sequence tags (ESTs) from a normalized cDNA library of salivary glands. In parallel, a non-cytosolic enriched protein fraction was obtained from labial salivary glands and subjected to two-dimensional gel electrophoresis (2-DE) and de novo peptide sequencing. This procedure allowed comparison of peptides and EST sequences and enabled us to identify 65 protein spots from the secreted labial saliva 2DE proteome. The mass spectrometry analysis revealed ecdysone, glucose oxidase, fructosidase, carboxyl/cholinesterase and an uncharacterized protein previously detected in H. armigera midgut proteome. Consistently, their corresponding transcripts are among the most abundant in our cDNA library. We did find redundancy of sequence identification of saliva-secreted proteins suggesting multiple isoforms. As expected, we found several enzymes responsible for digestion and plant offense. In addition, we identified non-digestive proteins such as an arginine kinase and abundant proteins of unknown function. This identification of secreted salivary gland proteins allows a more comprehensive understanding of insect feeding and poses new challenges for the elucidation of protein function. PMID:22046331
Kock, K; Ahlers, C; Schmale, H
1994-05-01
The rat von Ebner's gland protein 1 (VEGP 1) is a secretory protein, which is abundantly expressed in the small acinar von Ebner's salivary glands of the tongue. Based on the primary structure of this protein we have previously suggested that it is a member of the lipocalin superfamily of lipophilic-ligand carrier proteins. Although the physiological role of VEGP 1 is not clear, it might be involved in sensory or protective functions in the taste epithelium. Here, we report the purification of VEGP 1 and of a closely related secretory polypeptide, VEGP 2, the isolation of a cDNA clone encoding VEGP 2, and the isolation and structural characterization of the genes for both proteins. Protein purification by gel-filtration and anion-exchange chromatography using Mono Q revealed the presence of two different immunoreactive VEGP species. N-terminal sequence determination of peptide fragments isolated after protease Asp-N digestion allowed the identification of a new VEGP, named VEGP 2, in addition to the previously characterized VEGP 1. The complete VEGP 2 sequence was deduced from a cDNA clone isolated from a von Ebner's gland cDNA library. The VEGP 2 cDNA encodes a protein of 177 amino acids and is 94% identical to VEGP 1. DNA sequence analysis of the rat VEGP 1 and 2 genes isolated from rat genomic libraries revealed that both span about 4.5 kb and contain seven exons. The VEGP 1 and 2 genes are non-allelic distinct genes in the rat genome and probably arose by gene duplication. The high degree of nucleotide sequence identity in introns A-C (94-100%) points to a recent gene conversion event that included the 5' part of the genes. The genomic organization of the rat VEGP genes closely resembles that found in other lipocalins such as beta-lactoglobulin, mouse urinary proteins (MUPs) and prostaglandin D synthase, and therefore provides clear evidence that VEGPs belong to this superfamily of proteins.
Blair, Matthew W; Hurtado, Natalia; Chavarro, Carolina M; Muñoz-Torres, Monica C; Giraldo, Martha C; Pedraza, Fabio; Tomkins, Jeff; Wing, Rod
2011-03-22
Sequencing of cDNA libraries for the development of expressed sequence tags (ESTs) as well as for the discovery of simple sequence repeats (SSRs) has been a common method of developing microsatellites or SSR-based markers. In this research, our objective was to further sequence and develop common bean microsatellites from leaf and root cDNA libraries derived from the Andean gene pool accession G19833 and the Mesoamerican gene pool accession DOR364, mapping parents of a commonly used reference map. The root libraries were made from high and low phosphorus treated plants. A total of 3,123 EST sequences from leaf and root cDNA libraries were screened and used for direct simple sequence repeat discovery. From these EST sequences we found 184 microsatellites; the majority containing tri-nucleotide motifs, many of which were GC rich (ACC, AGC and AGG in particular). Di-nucleotide motif microsatellites were about half as common as the tri-nucleotide motif microsatellites but most of these were AGn microsatellites with a moderate number of ATn microsatellites in root ESTs followed by few ACn and no GCn microsatellites. Out of the 184 new SSR loci, 120 new microsatellite markers were developed in the BMc (Bean Microsatellites from cDNAs) series and these were evaluated for their capacity to distinguish bean diversity in a germplasm panel of 18 genotypes. We developed a database with images of the microsatellites and their polymorphism information content (PIC), which averaged 0.310 for polymorphic markers. The present study produced information about microsatellite frequency in root and leaf tissues of two important genotypes for common bean genomics: namely G19833, the Andean genotype selected for whole genome shotgun sequencing from race Peru, and DOR364 a race Mesoamerica subgroup 2 genotype that is a small-red seeded, released variety in Central America. Both race Peru and Mesoamerica subgroup 2 (small red beans) have been understudied in comparison to race Nueva Granada and Mesoamerica subgroup 1 (black beans) both with regards to gene expression and as sources of markers. However, we found few differences between SSR type and frequency between the G19833 leaf and DOR364 root tissue-derived ESTs. Overall, our work adds to the analysis of microsatellite frequency evaluation for common bean and provides a new set of 120 BMc markers which combined with the 248 previously developed BMc markers brings the total in this series to 368 markers. Once we include BMd markers, which are derived from GenBank sequences, the current total of gene-based markers from our laboratory surpasses 500 markers. These markers are basic for studies of the transcriptome of common bean and can form anchor points for genetic mapping studies in the future.
Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney
1998-01-01
Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865
Veiga, Ana B. G.; Ribeiro, José M. C.; Guimarães, Jorge A.; Francischetti, Ivo M.B.
2010-01-01
Accidents with the caterpillar Lonomia obliqua are often associated with a coagulation disorder and hemorrhagic syndrome in humans. In the present study, we have constructed cDNA libraries from two venomous structures of the caterpillar, namely the tegument and the bristle. High-throughput sequencing and bioinformatics analyses were performed in parallel. Over one thousand cDNAs were obtained and clustered to produce a database of 538 contigs and singletons (clusters) for the tegument library and 368 for the bristle library. We have thus identified dozens of full-length cDNAs coding for proteins with sequence homology to snake venom prothrombin activator, trypsin-like enzymes, blood coagulation factors and prophenoloxidase cascade activators. We also report cDNA coding for cysteine proteases, Group III phospholipase A2, C-type lectins, lipocalins, in addition to protease inhibitors including serpins, Kazal-type inhibitors, cystatins and trypsin inhibitor-like molecules. Antibacterial proteins and housekeeping genes are also described. A significant number of sequences were devoid of database matches, suggesting that their biologic function remains to be defined. We also report the N-terminus of the most abundant proteins present in the bristle, tegument, hemolymph, and "cryosecretion". Thus, we have created a catalog that contains the predicted molecular weight, isoelectric point, accession number, and putative function for each selected molecule from the venomous structures of L. obliqua. The role of these molecules in the coagulation disorder and hemorrhagic syndrome caused by envenomation with this caterpillar is discussed. All sequence information and the Supplemental Data, including Figures and Tables with hyperlinks to FASTA-formatted files for each contig and the best match to the Databases, are available at http://www.ncbi.nih.gov/projects/omes. PMID:16023793
Key, Katherine C; Sublette, Kerry L; Duncan, Kathleen; Mackay, Douglas M; Scow, Kate M; Ogles, Dora
2013-01-01
Although the anaerobic biodegradation of methyl tert -butyl ether (MTBE) and tert -butyl alcohol (TBA) has been documented in the laboratory and the field, knowledge of the microorganisms and mechanisms involved is still lacking. In this study, DNA-stable isotope probing (SIP) was used to identify microorganisms involved in anaerobic fuel oxygenate biodegradation in a sulfate-reducing MTBE and TBA plume. Microorganisms were collected in the field using Bio-Sep® beads amended with 13 C 5 -MTBE, 13 C 1 -MTBE (only methoxy carbon labeled), or 13 C 4 -TBA. 13 C-DNA and 12 C-DNA extracted from the Bio-Sep beads were cloned and 16S rRNA gene sequences were used to identify the indigenous microorganisms involved in degrading the methoxy group of MTBE and the tert -butyl group of MTBE and TBA. Results indicated that microorganisms were actively degrading 13 C-labeled MTBE and TBA in situ and the 13 C was incorporated into their DNA. Several sequences related to known MTBE- and TBA-degraders in the Burkholderiales and the Sphingomonadales orders were detected in all three 13 C clone libraries and were likely to be primary degraders at the site. Sequences related to sulfate-reducing bacteria and iron-reducers, such as Geobacter and Geothrix , were only detected in the clone libraries where MTBE and TBA were fully labeled with 13 C, suggesting that they were involved in processing carbon from the tert -butyl group. Sequences similar to the Pseudomonas genus predominated in the clone library where only the methoxy carbon of MTBE was labeled with 13 C. It is likely that members of this genus were secondary degraders cross-feeding on 13 C-labeled metabolites such as acetate.
Key, Katherine C.; Sublette, Kerry L.; Duncan, Kathleen; Mackay, Douglas M.; Scow, Kate M.; Ogles, Dora
2014-01-01
Although the anaerobic biodegradation of methyl tert-butyl ether (MTBE) and tert-butyl alcohol (TBA) has been documented in the laboratory and the field, knowledge of the microorganisms and mechanisms involved is still lacking. In this study, DNA-stable isotope probing (SIP) was used to identify microorganisms involved in anaerobic fuel oxygenate biodegradation in a sulfate-reducing MTBE and TBA plume. Microorganisms were collected in the field using Bio-Sep® beads amended with 13C5-MTBE, 13C1-MTBE (only methoxy carbon labeled), or13C4-TBA. 13C-DNA and 12C-DNA extracted from the Bio-Sep beads were cloned and 16S rRNA gene sequences were used to identify the indigenous microorganisms involved in degrading the methoxy group of MTBE and the tert-butyl group of MTBE and TBA. Results indicated that microorganisms were actively degrading 13C-labeled MTBE and TBA in situ and the 13C was incorporated into their DNA. Several sequences related to known MTBE- and TBA-degraders in the Burkholderiales and the Sphingomonadales orders were detected in all three13C clone libraries and were likely to be primary degraders at the site. Sequences related to sulfate-reducing bacteria and iron-reducers, such as Geobacter and Geothrix, were only detected in the clone libraries where MTBE and TBA were fully labeled with 13C, suggesting that they were involved in processing carbon from the tert-butyl group. Sequences similar to the Pseudomonas genus predominated in the clone library where only the methoxy carbon of MTBE was labeled with 13C. It is likely that members of this genus were secondary degraders cross-feeding on 13C-labeled metabolites such as acetate. PMID:25525320
Frentiu, Francesca D; Adamski, Marcin; McGraw, Elizabeth A; Blows, Mark W; Chenoweth, Stephen F
2009-01-21
The native Australian fly Drosophila serrata belongs to the highly speciose montium subgroup of the melanogaster species group. It has recently emerged as an excellent model system with which to address a number of important questions, including the evolution of traits under sexual selection and traits involved in climatic adaptation along latitudinal gradients. Understanding the molecular genetic basis of such traits has been limited by a lack of genomic resources for this species. Here, we present the first expressed sequence tag (EST) collection for D. serrata that will enable the identification of genes underlying sexually-selected phenotypes and physiological responses to environmental change and may help resolve controversial phylogenetic relationships within the montium subgroup. A normalized cDNA library was constructed from whole fly bodies at several developmental stages, including larvae and adults. Assembly of 11,616 clones sequenced from the 3' end allowed us to identify 6,607 unique contigs, of which at least 90% encoded peptides. Partial transcripts were discovered from a variety of genes of evolutionary interest by BLASTing contigs against the 12 Drosophila genomes currently sequenced. By incorporating into the cDNA library multiple individuals from populations spanning a large portion of the geographical range of D. serrata, we were able to identify 11,057 putative single nucleotide polymorphisms (SNPs), with 278 different contigs having at least one "double hit" SNP that is highly likely to be a real polymorphism. At least 394 EST-associated microsatellite markers, representing 355 different contigs, were also found, providing an additional set of genetic markers. The assembled EST library is available online at http://www.chenowethlab.org/serrata/index.cgi. We have provided the first gene collection and largest set of polymorphic genetic markers, to date, for the fly D. serrata. The EST collection will provide much needed genomic resources for this model species and facilitate comparative evolutionary studies within the montium subgroup of the D. melanogaster lineage.
Takeshita, S; Kikuno, R; Tezuka, K; Amann, E
1993-01-01
A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580
Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F
1991-08-01
1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.
Analysis of cDNA libraries from developing seeds of guar (Cyamopsis tetragonoloba (L.) Taub)
Naoumkina, Marina; Torres-Jerez, Ivone; Allen, Stacy; He, Ji; Zhao, Patrick X; Dixon, Richard A; May, Gregory D
2007-01-01
Background Guar, Cyamopsis tetragonoloba (L.) Taub, is a member of the Leguminosae (Fabaceae) family and is economically the most important of the four species in the genus. The endosperm of guar seed is a rich source of mucilage or gum, which forms a viscous gel in cold water, and is used as an emulsifier, thickener and stabilizer in a wide range of foods and industrial applications. Guar gum is a galactomannan, consisting of a linear (1→4)-β-linked D-mannan backbone with single-unit, (1→6)-linked, α-D-galactopyranosyl side chains. To better understand regulation of guar seed development and galactomannan metabolism we created cDNA libraries and a resulting EST dataset from different developmental stages of guar seeds. Results A database of 16,476 guar seed ESTs was constructed, with 8,163 and 8,313 ESTs derived from cDNA libraries I and II, respectively. Library I was constructed from seeds at an early developmental stage (15–25 days after flowering, DAF), and library II from seeds at 30–40 DAF. Quite different sets of genes were represented in these two libraries. Approximately 27% of the clones were not similar to known sequences, suggesting that these ESTs represent novel genes or may represent non-coding RNA. The high flux of energy into carbohydrate and storage protein synthesis in guar seeds was reflected by a high representation of genes annotated as involved in signal transduction, carbohydrate metabolism, chaperone and proteolytic processes, and translation and ribosome structure. Guar unigenes involved in galactomannan metabolism were identified. Among the seed storage proteins, the most abundant contig represented a conglutin accounting for 3.7% of the total ESTs from both libraries. Conclusion The present EST collection and its annotation provide a resource for understanding guar seed biology and galactomannan metabolism. PMID:18034910
Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan
2017-08-01
Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Li, You-Zhi; Pan, Ying-Hua; Sun, Chang-Bin; Dong, Hai-Tao; Luo, Xing-Lu; Wang, Zhi-Qiang; Tang, Ji-Liang; Chen, Baoshan
2010-12-01
A cDNA library was constructed from the root tissues of cassava variety Huanan 124 at the root bulking stage. A total of 9,600 cDNA clones from the library were sequenced with single-pass from the 5'-terminus to establish a catalogue of expressed sequence tags (ESTs). Assembly of the resulting EST sequences resulted in 2,878 putative unigenes. Blastn analysis showed that 62.6% of the unigenes matched with known cassava ESTs and the rest had no 'hits' against the cassava database in the integrative PlantGDB database. Blastx analysis showed that 1,715 (59.59%) of the unigenes matched with one or more GenBank protein entries and 1,163 (40.41%) had no 'hits'. A cDNA microarray with 2,878 unigenes was developed and used to analyze gene expression profiling of Huanan 124 at key growth stages including seedling, formation of root system, root bulking, and starch maturity. Array data analysis revealed that (1) the higher ratio of up-regulated ribosome-related genes was accompanied by a high ratio of up-regulated ubiquitin, proteasome-related and protease genes in cassava roots; (2) starch formation and degradation simultaneously occur at the early stages of root development but starch degradation is declined partially due to decrease in UDP-glucose dehydrogenase activity with root maturity; (3) starch may also be synthesized in situ in roots; (4) starch synthesis, translocation, and accumulation are also associated probably with signaling pathways that parallel Wnt, LAM, TCS and ErbB signaling pathways in animals; (5) constitutive expression of stress-responsive genes may be due to the adaptation of cassava to harsh environments during long-term evolution.
Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De
2002-03-01
To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.
Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C
1987-01-26
Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.
Upregulated Genes In Sporadic, Idiopathic Pulmonary Arterial Hypertension
Edgar, Alasdair J; Chacón, Matilde R; Bishop, Anne E; Yacoub, Magdi H; Polak, Julia M
2006-01-01
Background To elucidate further the pathogenesis of sporadic, idiopathic pulmonary arterial hypertension (IPAH) and identify potential therapeutic avenues, differential gene expression in IPAH was examined by suppression subtractive hybridisation (SSH). Methods Peripheral lung samples were obtained immediately after removal from patients undergoing lung transplant for IPAH without familial disease, and control tissues consisted of similarly sampled pieces of donor lungs not utilised during transplantation. Pools of lung mRNA from IPAH cases containing plexiform lesions and normal donor lungs were used to generate the tester and driver cDNA libraries, respectively. A subtracted IPAH cDNA library was made by SSH. Clones isolated from this subtracted library were examined for up regulated expression in IPAH using dot blot arrays of positive colony PCR products using both pooled cDNA libraries as probes. Clones verified as being upregulated were sequenced. For two genes the increase in expression was verified by northern blotting and data analysed using Student's unpaired two-tailed t-test. Results We present preliminary findings concerning candidate genes upregulated in IPAH. Twenty-seven upregulated genes were identified out of 192 clones examined. Upregulation in individual cases of IPAH was shown by northern blot for tissue inhibitor of metalloproteinase-3 and decorin (P < 0.01) compared with the housekeeping gene glyceraldehydes-3-phosphate dehydrogenase. Conclusion Four of the up regulated genes, magic roundabout, hevin, thrombomodulin and sucrose non-fermenting protein-related kinase-1 are expressed specifically by endothelial cells and one, muscleblind-1, by muscle cells, suggesting that they may be associated with plexiform lesions and hypertrophic arterial wall remodelling, respectively. PMID:16390543
Akao, Takeshi; Gomi, Katsuya; Goto, Kuniyasu; Okazaki, Naoto; Akita, Osamu
2002-07-01
In solid-state cultures (SC), Aspergillus oryzae shows characteristics such as high-level production and secretion of enzymes and hyphal differentiation with asexual development which are absent in liquid (submerged) culture (LC). It was predicted that many of the genes involved in the characteristics of A. oryzae in SC are differentially expressed between SC and LC. We generated two subtracted cDNA libraries with bi-directional cDNA subtractive hybridizations to isolate and identify such genes. Among them, we identified genes upregulated in or specific to SC, such as the AOS ( A. oryzae SC-specific gene) series, and those downregulated or not expressed in SC, such as the AOL ( A. oryzae LC-specific) series. Sequencing analyses revealed that the AOS series and the AOL series contain genes encoding extra- and intracellular enzymes and transport proteins. However, half were functionally unclassified by nucleotide sequences. Also, by expression profile, the AOS series comprised two groups. These gene products' molecular functions and physiological roles in SC await further investigation.
Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min
2002-09-01
A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.
Gao, Jin-Xin; Jing, Jing; Yu, Chuan-Jin; Chen, Jie
2015-06-01
Curvularia lunata is an important maize foliar fungal pathogen that distributes widely in maize growing area in China, and several key pathogenic factors have been isolated. An yeast two-hybrid (Y2H) library is a very useful platform to further unravel novel pathogenic factors in C. lunata. To construct a high-quality full length-expression cDNA library from the C. lunata for application to pathogenesis-related protein-protein interaction screening, total RNA was extracted. The SMART (Switching Mechanism At 5' end of the RNA Transcript) technique was used for cDNA synthesis. Double-stranded cDNA was ligated into the pGADT7-Rec vector with Herring Testes Carrier DNA using homologous recombination method. The ligation mixture was transformed into competent yeast AH109 cells to construct the primary cDNA library. Eventually, a high qualitative library was successfully established according to an evaluation on quality. The transformation efficiency was about 6.39 ×10(5) transformants/3 μg pGADT7-Rec. The titer of the primary cDNA library was 2.5×10(8) cfu/mL. The numbers for the cDNA library was 2.46×10(5). Randomly picked clones show that the recombination rate was 88.24%. Gel electrophoresis results indicated that the fragments ranged from 0.4 kb to 3.0 kb. Melanin synthesis protein Brn1 (1,3,8-hydroxynaphthalene reductase) was used as a "bait" to test the sufficiency of the Y2H library. As a result, a cDNA clone encoding VelB protein that was known to be involved in the regulation of diverse cellular processes, including control of secondary metabolism containing melanin and toxin production in many filamentous fungi was identified. Further study on the exact role of the VelB gene is underway.
NASA Astrophysics Data System (ADS)
Ma, Deyou; Yang, Hongsheng; Sun, Lina; Chen, Muyan
2014-01-01
Sea cucumbers Apostichopus japonicus are one of the most important aquaculture species in China. Their normal body color is black to fit their surroundings. Wild albinos are rare and hard to breed. To understand the differences between albino and normal (control) sea cucumbers at the transcriptional level, we sequenced the transcriptomes in their body-wall tissues using RNA-Seq high-throughput sequencing. Approximately 4.876 million (M) and 4.884 M 200-nucleotide-long cDNA reads were produced in the cDNA libraries derived from the body walls of albino and control samples, respectively. A total of 9 561 (46.89%) putative genes were identified from among the RNA-Seq reads in both libraries. After filtering, 837 significantly differentially regulated genes were identified in the albino library compared with in the control library, and 3.6% of the differentially expressed genes (DEGs) were found to have changed those more than five-fold. The expression levels of 10 DEGs were checked by real-time PCR and the results were in full accord with the RNA-Seq expression trends, although the amplitude of the differences in expression levels was lower in all cases. A series of pathways were significantly enriched for the DEGs. These pathways were closely related to phagocytosis, the complement and coagulation cascades, apoptosis-related diseases, cytokine-cytokine receptor interaction, and cell adhesion. The differences in gene expression and enriched pathways between the albino and control sea cucumbers offer control targets for cultivating excellent albino A. japonicus strains in the future.
Peters, Linda M.; Belyantseva, Inna A.; Lagziel, Ayala; Battey, James F.; Friedman, Thomas B.; Morell, Robert J.
2007-01-01
Specialization in cell function and morphology is influenced by the differential expression of mRNAs, many of which are expressed at low abundance and restricted to certain cell types. Detecting such transcripts in cDNA libraries may require sequencing millions of clones. Massively parallel signature sequencing (MPSS) is well-suited for identifying transcripts that are expressed in discrete cell types and in low abundance. We have made MPSS libraries from microdissections of three inner ear tissues. By comparing these MPSS libraries to those of 87 other tissues included in the Mouse Reference Transcriptome (MRT) online resource, we have identified genes that are highly enriched in, or specific to, the inner ear. We show by RT-PCR and in situ hybridization that signatures unique to the inner ear libraries identify transcripts with highly specific cell-type localizations. These transcripts serve to illustrate the utility of a resource that is available to the research community. Utilization of these resources will increase the number of known transcription units and expand our knowledge of the tissue-specific regulation of the transcriptome. PMID:17049805
Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio
1995-01-01
We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145
Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.
1994-01-01
The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934
Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L
1994-05-01
The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.
A gene variation of 14-3-3 zeta isoform in rat hippocampus.
Murakami, K; Situ, S Y; Eshete, F
1996-11-14
A variant form of 14-3-3 zeta was isolated from the rat hippocampal cDNA library. The cloned cDNA is 1687 bp in length and it contains an entire ORF (nt = 63-797) with 245 amino acids that is characteristic to 14-3-3 zeta subtype. By comparing with reported sequences of 14-3-3 zeta, we found three nucleotide substitutions within the coding sequence in our clone; C<-->T transition at nt = 325 and G<-->C transversions at nt = 387 and 388. Both are missense mutations, leading ACG (Thr) to ATG (Met) and CGT (Arg) to GCT (Ala) conversions at residue 88 and 109, respectively. Our results show that at least three different genetic variants of 14-3-3 zeta are present in rat species which results in protein variations. Such mutation in the amino acid sequence is an important indication of the diverse functions of this protein and may also contribute to the recent contradictory observations regarding the role of the 14-3-3 zeta subtype.
Savary, Brett J; Vasu, Prasanna; Cameron, Randall G; McCollum, T Gregory; Nuñez, Alberto
2013-12-26
Despite the longstanding importance of the thermally tolerant pectin methylesterase (TT-PME) activity in citrus juice processing and product quality, the unequivocal identification of the protein and its corresponding gene has remained elusive. TT-PME was purified from sweet orange [ Citrus sinensis (L.) Osbeck] finisher pulp (8.0 mg/1.3 kg tissue) with an improved purification scheme that provided 20-fold increased enzyme yield over previous results. Structural characterization of electrophoretically pure TT-PME by MALDI-TOF MS determined molecular masses of approximately 47900 and 53000 Da for two principal glycoisoforms. De novo sequences generated from tryptic peptides by MALDI-TOF/TOF MS matched multiple anonymous Citrus EST cDNA accessions. The complete tt-pme cDNA (1710 base pair) was cloned from a fruit mRNA library using RT- and RLM-RACE PCR. Citrus TT-PME is a novel isoform that showed higher sequence identity with the multiply glycosylated kiwifruit PME than to previously described Citrus thermally labile PME isoforms.
Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.
Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P
2001-08-17
Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.
Edvardsen, Rolf B; Malde, Ketil; Mittelholzer, Christian; Taranger, Geir Lasse; Nilsen, Frank
2011-03-01
The Atlantic cod, Gadus morhua, is an important species both for traditional fishery and increasingly also in fish farming. The Atlantic cod is also under potential threat from various environmental changes such as pollution and climate change, but the biological impact of such changes are not well known, in particular when it comes to sublethal effects that can be difficult to assert. Modern molecular and genomic approaches have revolutionized biological research during the last decade, and offer new avenues to study biological functions and e.g. the impact of anthropogenic activities at different life-stages for a given organism. In order to develop genomic data and genomic tools for Atlantic cod we conducted a program were we constructed 20 cDNA libraries, and produced and analyzed 44006 expressed sequence tags (ESTs) from these. Several tissues are represented in the multiple cDNA libraries, that differ in either sexual maturation or immulogical stimulation. This approach allowed us to identify genes that are expressed in particular tissues, life-stages or in response to specific stimuli, and also gives us information about potential functions of the transcripts. The ESTs were used to construct a 16k cDNA microarray to further investigate the cod transcriptome. Microarray analyses were preformed on pylorus, pituitary gland, spleen and testis of sexually maturing male cod. The four different tissues displayed tissue specific transcriptomes demonstrating that the cDNA array is working as expected and will prove to be a powerful tool in further experiments. Copyright © 2010 Elsevier Inc. All rights reserved.
Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I
1987-01-01
cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.
Mochida, Keiichi; Uehara-Yamaguchi, Yukiko; Takahashi, Fuminori; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo
2013-01-01
A comprehensive collection of full-length cDNAs is essential for correct structural gene annotation and functional analyses of genes. We constructed a mixed full-length cDNA library from 21 different tissues of Brachypodium distachyon Bd21, and obtained 78,163 high quality expressed sequence tags (ESTs) from both ends of ca. 40,000 clones (including 16,079 contigs). We updated gene structure annotations of Brachypodium genes based on full-length cDNA sequences in comparison with the latest publicly available annotations. About 10,000 non-redundant gene models were supported by full-length cDNAs; ca. 6,000 showed some transcription unit modifications. We also found ca. 580 novel gene models, including 362 newly identified in Bd21. Using the updated transcription start sites, we searched a total of 580 plant cis-motifs in the −3 kb promoter regions and determined a genome-wide Brachypodium promoter architecture. Furthermore, we integrated the Brachypodium full-length cDNAs and updated gene structures with available sequence resources in wheat and barley in a web-accessible database, the RIKEN Brachypodium FL cDNA database. The database represents a “one-stop” information resource for all genomic information in the Pooideae, facilitating functional analysis of genes in this model grass plant and seamless knowledge transfer to the Triticeae crops. PMID:24130698
Rampuria, Sakshi; Joshi, Uma; Palit, Paramita; Deokar, Amit A; Meghwal, Raju R; Mohapatra, T; Srinivasan, R; Bhatt, K V; Sharma, Ramavtar
2012-11-01
Moth bean ( Vigna aconitifolia (Jacq.) Marechal) is an important grain legume crop grown in rain fed areas of hot desert regions of Thar, India, under scorching sun rays with very little supplementation of water. An SSH cDNA library was generated from leaf tissues of V. aconitifolia var. RMO-40 exposed to an elevated temperature of 42 °C for 5 min to identify early-induced genes. A total of 488 unigenes (114 contigs and 374 singletons) were derived by cluster assembly and sequence alignment of 738 ESTs; out of 206 ESTs (28%) of unknown proteins, 160 ESTs (14%) were found to be novel to moth bean. Only 578 ESTs (78%) showed significant BLASTX similarity (<1 × 10(-6)) in the NCBI non-redundant database. Gene ontology functional classification terms were retrieved for 479 (65%) sequences, and 339 sequences were annotated with 165 EC codes and mapped to 68 different KEGG pathways. Four hundred and fifty-two ESTs were further annotated with InterProScan (IPS), and no IPS was assigned to 153 ESTs. In addition, the expression level of 27 ESTs in response to heat stress was evaluated through semiquantitative RT-PCR assay. Approximately 20 different signaling genes and 16 different transcription factors have been shown to be associated with heat stress in moth bean for the first time.
Structure, organization and expression of common carp (Cyprinus carpio L.) SLP-76 gene.
Huang, Rong; Sun, Xiao-Feng; Hu, Wei; Wang, Ya-Ping; Guo, Qiong-Lin
2008-05-01
SLP-76 is an important member of the SLP-76 family of adapters, and it plays a key role in TCR signaling and T cell function. Partial cDNA sequence of SLP-76 of common carp (Cyprinus carpio L.) was isolated from thymus cDNA library by the method of suppression subtractive hybridization (SSH). Subsequently, the full length cDNA of carp SLP-76 was obtained by means of 3' RACE and 5' RACE, respectively. The full length cDNA of carp SLP-76 was 2007 bp, consisting of a 5'-terminal untranslated region (UTR) of 285 bp, a 3'-terminal UTR of 240 bp, and an open reading frame of 1482 bp. Sequence comparison showed that the deduced amino acid sequence of carp SLP-76 had an overall similarity of 34-73% to that of other species homologues, and it was composed of an NH2-terminal domain, a central proline-rich domain, and a C-terminal SH2 domain. Amino acid sequence analysis indicated the existence of a Gads binding site R-X-X-K, a 10-aa-long sequence which binds to the SH3 domain of LCK in vitro, and three conserved tyrosine-containing sequence in the NH2-terminal domain. Then we used PCR to obtain a genomic DNA which covers the entire coding region of carp SLP-76. In the 9.2k-long genomic sequence, twenty one exons and twenty introns were identified. RT-PCR results showed that carp SLP-76 was expressed predominantly in hematopoietic tissues, and was upregulated in thymus tissue of four-month carp compared to one-year old carp. RT-PCR and virtual northern hybridization results showed that carp SLP-76 was also upregulated in thymus tissue of GH transgenic carp at the age of four-months. These results suggest that the expression level of SLP-76 gene may be related to thymocyte development in teleosts.
Molecular characterization of an ependymin precursor from goldfish brain.
Königstorfer, A; Sterrer, S; Eckerskorn, C; Lottspeich, F; Schmidt, R; Hoffmann, W
1989-01-01
Ependymins are thought to be implicated in fundamental processes involved in plasticity of the goldfish CNS. Gas-phase sequencing of purified ependymins beta and gamma revealed that they share the same N-terminal sequence. Each sequence displays microheterogeneities at several positions. Based on the protein sequences obtained, we constructed synthetic oligonucleotides and used them as hybridization probes for screening cDNA libraries of goldfish brain. In this article we describe the full-length sequence of a mRNA encoding a precursor of ependymins. A cleavable signal sequence characteristic of secretory proteins is located at the N-terminal end, followed directly by the ependymin sequence. Also, two potential N-glycosylation sites were detected. A computer search revealed that ependymins form a novel family of unique proteins.
Zhang, Yi; Zhao, Yuanyuan; Qiu, Xuehong; Han, Richou
2013-08-01
Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae) termites are harmful social insects to wood constructions. The current control methods heavily depend on the chemical insecticides with increasing resistance. Analysis of the differentially expressed genes mediated by chemical insecticides will contribute to the understanding of the termite resistance to chemicals and to the establishment of alternative control measures. In the present article, a full-length cDNA library was constructed from the termites induced by a mixture of commonly used insecticides (0.01% sulfluramid and 0.01% triflumuron) for 24 h, by using the RNA ligase-mediated Rapid Amplification cDNA End method. Fifty-eight differentially expressed clones were obtained by polymerase chain reaction and confirmed by dot-blot hybridization. Forty-six known sequences were obtained, which clustered into 33 unique sequences grouped in 6 contigs and 27 singlets. Sixty-seven percent (22) of the sequences had counterpart genes from other organisms, whereas 33% (11) were undescribed. A Gene Ontology analysis classified 33 unique sequences into different functional categories. In general, most of the differential expression genes were involved in binding and catalytic activity.
Comparative 454 pyrosequencing of transcripts from two olive genotypes during fruit development
Alagna, Fiammetta; D'Agostino, Nunzio; Torchia, Laura; Servili, Maurizio; Rao, Rosa; Pietrella, Marco; Giuliano, Giovanni; Chiusano, Maria Luisa; Baldoni, Luciana; Perrotta, Gaetano
2009-01-01
Background Despite its primary economic importance, genomic information on olive tree is still lacking. 454 pyrosequencing was used to enrich the very few sequence data currently available for the Olea europaea species and to identify genes involved in expression of fruit quality traits. Results Fruits of Coratina, a widely cultivated variety characterized by a very high phenolic content, and Tendellone, an oleuropein-lacking natural variant, were used as starting material for monitoring the transcriptome. Four different cDNA libraries were sequenced, respectively at the beginning and at the end of drupe development. A total of 261,485 reads were obtained, for an output of about 58 Mb. Raw sequence data were processed using a four step pipeline procedure and data were stored in a relational database with a web interface. Conclusion Massively parallel sequencing of different fruit cDNA collections has provided large scale information about the structure and putative function of gene transcripts accumulated during fruit development. Comparative transcript profiling allowed the identification of differentially expressed genes with potential relevance in regulating the fruit metabolism and phenolic content during ripening. PMID:19709400
Isolation of candidate genes of Friedreich`s ataxia on chromosome 9q13
DOE Office of Scientific and Technical Information (OSTI.GOV)
Montermini, L.; Zara, F.; Pandolfo, M.
1994-09-01
Friedreich`s ataxia (FRDA) is an autosomal recessive degenerative disease involving the central and peripheral nervous system and the heart. The mutated gene in FRDA has recently been localized within a 450 Kb interval on chromosome 9q13 between the markers D9S202/FR1/FR8. We have been able to confirm such localization for the disease gene by analysis of extended haplotype in consanguineous families. Cases of loss of marker homozygosity, which are likely to be due to ancient recombinations, have been found to involve D9S110, D9S15, and D9S111 on the telomeric side, and FR5 on the centromeric side, while homozygosity was always found formore » a core haplotype including D9S5, FD1, and D9S202. We constructed a YAC contig spanning the region between the telomeric markers and FR5, and cosmids have been obtained from the YACs. In order to isolate transcribed sequences from the FRDA candidate region we are utilizing a combination of approaches, including hybridization of YACs and cosmids to an arrayed human heart cDNA library, cDNA direct selection, and exon amplification. A transcribed sequence near the telomeric end of the region has been isolated by cDNA direct selection using pooled cosmids as genomic template and primary human heart, muscle, brain, liver and placenta cDNAs as cDNA source. We have shown this sequence to be the human equivalent of ZO-2, a tight junction protein previously described in the dog. No mutations of this gene have been found in FRDA subjects. Additional cDNA have recently been isolated and they are currently being evaluated.« less
Habenicht, A; Quesada, A; Cerff, R
1997-10-01
A cDNA-library has been constructed from Nicotiana plumbaginifolia seedlings, and the non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GapN, EC 1.2.1.9) was isolated by plaque hybridization using the cDNA from pea as a heterologous probe. The cDNA comprises the entire GapN coding region. A putative polyadenylation signal is identified. Phylogenetic analysis based on the deduced amino acid sequences revealed that the GapN gene family represents a separate ancient branch within the aldehyde dehydrogenase superfamily. It can be shown that the GapN gene family and other distinct branches of the superfamily have its phylogenetic origin before the separation of primary life-forms. This further demonstrates that already very early in evolution, a broad diversification of the aldehyde dehydrogenases led to the formation of the superfamily.
Molecular analysis of the biological bleaching of kraft pulps by Trametes versicolor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dumonceaux, T.J.; Archibald, F.S.
1996-10-01
Biological bleaching of kraft pulps by the fungus Trametes versicolor, based on the biodegradation of the recalcitrant polymer, lignin, could replace chlorine-based bleaching in Canadian pulp and paper mills. Enzymes that may be involved in lignin degradation include manganese peroxidase (MnP), laccase, and cellobiose-quinone oxidoreductase (CBQase). All three of these enzymatic activities are thought to interact extensively in cyclic oxidation/reduction reactions which ultimately bring about the degradation of lignin. We have constructed a cDNA library from T versicolor with the aim of isolating clones encoding factors that are relevant to biobleaching. We first determined the optimum growth conditions for expressionmore » of bleaching-related mRNA. A clear induction of bleaching ability was observed when the fungus was preincubated with 0.25% acid-washed pulp; the augmentation of bleaching was not explained by differences in MnP or laccase levels, suggesting that the expression of either CBQase or unidentified biobleaching factors was responsible for the increased pulp brightness. mRNA isolated from induced cultures was used to construct a cDNA library in a XZAP vector. This library has been probed with a degenerate oligonucleotide probe based upon a peptide sequence derived from purified CBQase, resulting in the identification of several hybridizing cDNA molecules. The CBQase clone will be used to examine in further detail the potential role of this enzyme in pulp biobleaching and lignin degradation.« less
Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.
Wu, S; Kriz, A L; Widholm, J M
1994-01-01
The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that the different chitinase isoforms in maize might have different functions in the plant, since they show differential expression patterns under different conditions. PMID:7972490
Li, Chibo; Ding, Xi-Qin; O’Brien, John; Al-Ubaidi, Muayyad R.
2010-01-01
PURPOSE A great deal of information about functionally significant domains of a protein may be obtained by comparison of primary sequences of gene homologues over a broad phylogenetic base. This study was designed to identify evolutionarily conserved domains of the photoreceptor disc membrane protein peripherin/rds by analysis of the homologue in a primitive vertebrate, the skate. METHODS A skate retinal cDNA library was screened using a mouse peripherin/rds clone. The 5′ and 3′ untranslated regions of the skate peripherin/rds (srds) cDNA were isolated by the rapid amplification of cDNA ends (RACE) approach. The gene structure was characterized by PCR amplification and sequencing of genomic fragments. Northern and Western blot analyses were used to identify srds transcript and protein, respectively. RESULTS A new homologue of peripherin/rds was identified from the skate retinal cDNA library. SRDS is a glycoprotein with a predicted molecular mass of 40.2 kDa. The srds gene consists of two exons and one small intron and transcribes into a single 6-kb message. Phylogenetic analysis places SRDS at the base of peripherin/rds family and near the division of that group and the branch leading to rds-like and rom-1 genes. SRDS protein is 54.5% identical with peripherin/rds across species. Identity is significantly higher (73%) in the intradiscal domains. Sequence comparison revealed the conservation of all residues that have been shown, on mutation, to associate with retinitis pigmentosa and showed conservation of most residues associated with macular dystrophies. Comparison with ROM-1 and other rds-like proteins revealed the presence of a highly conserved domain in the large intradiscal loop. CONCLUSIONS Srds represents the skate orthologue of mammalian peripherin/rds genes. Conservation of most of the residues associated with human retinal diseases indicates that these residues serve important functional roles. The high degree of conservation of a short stretch within the large intradiscal loop also suggests an important function for this domain. PMID:12766040
Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species
Bychenko, Oksana S.; Sukhanova, Lyubov V.; Azhikina, Tatyana L.; Skvortsov, Timofey A.; Belomestnykh, Tuyana V.; Sverdlov, Eugene D.
2014-01-01
The aim of this work was to get deeper insight into genetic factors involved in the adaptive divergence of closely related species, specifically two representatives of Baikal coregonids—Baikal whitefish (Coregonus baicalensis Dybowski) and Baikal omul (Coregonus migratorius Georgi)—that diverged from a common ancestor as recently as 10–20 thousand years ago. Using the Serial Analysis of Gene Expression method, we obtained libraries of short representative cDNA sequences (tags) from the brains of Baikal whitefish and omul. A comparative analysis of the libraries revealed quantitative differences among ~4% tags of the fishes under study. Based on the similarity of these tags with cDNA of known organisms, we identified candidate genes taking part in adaptive divergence. The most important candidate genes related to the adaptation of Baikal whitefish and Baikal omul, identified in this work, belong to the genes of cell metabolism, nervous and immune systems, protein synthesis, and regulatory genes as well as to DTSsa4 Tc1-like transposons which are widespread among fishes. PMID:24719892
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela
To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less
A tick B-cell inhibitory protein from salivary glands of the hard tick, Hyalomma asiaticum asiaticum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu Da; Department of Life Science and Technology, Changshu Institute of Technology, Changshu 215500; Liang Jiangguo
2006-05-05
Some studies done to date suggest that B-cell inhibitory factor occurred in tick saliva. In this study, a novel protein having B-cell inhibitory activity was purified and characterized from the salivary glands of the hard tick, Hyalomma asiaticum asiaticum. This protein was named B-cell inhibitory factor (BIF). The cDNA encoding BIF was cloned by cDNA library screening. The predicted protein from the cDNA sequence is composed of 138 amino acids including the mature BIF. No similarity was found by Blast search. The lipopolysaccharide-induced B-cell proliferation was inhibited by BIF. This is First report of the identification and characterization of B-cellmore » inhibitory protein from tick. The current study facilitates the study of identifying the interaction among tick, Borrelia burgdorferi, the causative agent of Lyme disease, and host.« less
Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P
1997-11-01
Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.
Diversity of Metabolically Active Bacteria in Water-Flooded High-Temperature Heavy Oil Reservoir
Nazina, Tamara N.; Shestakova, Natalya M.; Semenova, Ekaterina M.; Korshunova, Alena V.; Kostrukova, Nadezda K.; Tourova, Tatiana P.; Min, Liu; Feng, Qingxian; Poltaraus, Andrey B.
2017-01-01
The goal of this work was to study the overall genomic diversity of microorganisms of the Dagang high-temperature oilfield (PRC) and to characterize the metabolically active fraction of these populations. At this water-flooded oilfield, the microbial community of formation water from the near-bottom zone of an injection well where the most active microbial processes of oil degradation occur was investigated using molecular, cultural, radiotracer, and physicochemical techniques. The samples of microbial DNA and RNA from back-flushed water were used to obtain the clone libraries for the 16S rRNA gene and cDNA of 16S rRNA, respectively. The DNA-derived clone libraries were found to contain bacterial and archaeal 16S rRNA genes and the alkB genes encoding alkane monooxygenases similar to those encoded by alkB-geo1 and alkB-geo6 of geobacilli. The 16S rRNA genes of methanogens (Methanomethylovorans, Methanoculleus, Methanolinea, Methanothrix, and Methanocalculus) were predominant in the DNA-derived library of Archaea cloned sequences; among the bacterial sequences, the 16S rRNA genes of members of the genus Geobacillus were the most numerous. The RNA-derived library contained only bacterial cDNA of the 16S rRNA sequences belonging to metabolically active aerobic organotrophic bacteria (Tepidimonas, Pseudomonas, Acinetobacter), as well as of denitrifying (Azoarcus, Tepidiphilus, Calditerrivibrio), fermenting (Bellilinea), iron-reducing (Geobacter), and sulfate- and sulfur-reducing bacteria (Desulfomicrobium, Desulfuromonas). The presence of the microorganisms of the main functional groups revealed by molecular techniques was confirmed by the results of cultural, radioisotope, and geochemical research. Functioning of the mesophilic and thermophilic branches was shown for the microbial food chain of the near-bottom zone of the injection well, which included the microorganisms of the carbon, sulfur, iron, and nitrogen cycles. PMID:28487680
Lewers, Kim S; Saski, Chris A; Cuthbertson, Brandon J; Henry, David C; Staton, Meg E; Main, Dorrie S; Dhanaraj, Anik L; Rowland, Lisa J; Tomkins, Jeff P
2008-01-01
Background The recent development of novel repeat-fruiting types of blackberry (Rubus L.) cultivars, combined with a long history of morphological marker-assisted selection for thornlessness by blackberry breeders, has given rise to increased interest in using molecular markers to facilitate blackberry breeding. Yet no genetic maps, molecular markers, or even sequences exist specifically for cultivated blackberry. The purpose of this study is to begin development of these tools by generating and annotating the first blackberry expressed sequence tag (EST) library, designing primers from the ESTs to amplify regions containing simple sequence repeats (SSR), and testing the usefulness of a subset of the EST-SSRs with two blackberry cultivars. Results A cDNA library of 18,432 clones was generated from expanding leaf tissue of the cultivar Merton Thornless, a progenitor of many thornless commercial cultivars. Among the most abundantly expressed of the 3,000 genes annotated were those involved with energy, cell structure, and defense. From individual sequences containing SSRs, 673 primer pairs were designed. Of a randomly chosen set of 33 primer pairs tested with two blackberry cultivars, 10 detected an average of 1.9 polymorphic PCR products. Conclusion This rate predicts that this library may yield as many as 940 SSR primer pairs detecting 1,786 polymorphisms. This may be sufficient to generate a genetic map that can be used to associate molecular markers with phenotypic traits, making possible molecular marker-assisted breeding to compliment existing morphological marker-assisted breeding in blackberry. PMID:18570660
A large-scale full-length cDNA analysis to explore the budding yeast transcriptome
Miura, Fumihito; Kawaguchi, Noriko; Sese, Jun; Toyoda, Atsushi; Hattori, Masahira; Morishita, Shinichi; Ito, Takashi
2006-01-01
We performed a large-scale cDNA analysis to explore the transcriptome of the budding yeast Saccharomyces cerevisiae. We sequenced two cDNA libraries, one from the cells exponentially growing in a minimal medium and the other from meiotic cells. Both libraries were generated by using a vector-capping method that allows the accurate mapping of transcription start sites (TSSs). Consequently, we identified 11,575 TSSs associated with 3,638 annotated genomic features, including 3,599 ORFs, to suggest that most yeast genes have two or more TSSs. In addition, we identified 45 previously undescribed introns, including those affecting current ORF annotations and those spliced alternatively. Furthermore, the analysis revealed 667 transcription units in the intergenic regions and transcripts derived from antisense strands of 367 known features. We also found that 348 ORFs carry TSSs in their 3′-halves to generate sense transcripts starting from inside the ORFs. These results indicate that the budding yeast transcriptome is considerably more complex than previously thought, and it shares many recently revealed characteristics with the transcriptomes of mammals and other higher eukaryotes. Thus, the genome-wide active transcription that generates novel classes of transcripts appears to be an intrinsic feature of the eukaryotic cells. The budding yeast will serve as a versatile model for the studies on these aspects of transcriptome, and the full-length cDNA clones can function as an invaluable resource in such studies. PMID:17101987
Abolhassani, Mohsen; Roux, Kenneth H
2009-06-01
Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.
Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A
1995-07-03
The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Yun-Ling; Li, Li; Wu, Keqiang
1995-07-03
The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less
Loudig, Olivier; Liu, Christina; Rohan, Thomas; Ben-Dov, Iddo Z
2018-05-05
-Archived, clinically classified formalin-fixed paraffin-embedded (FFPE) tissues can provide nucleic acids for retrospective molecular studies of cancer development. By using non-invasive or pre-malignant lesions from patients who later develop invasive disease, gene expression analyses may help identify early molecular alterations that predispose to cancer risk. It has been well described that nucleic acids recovered from FFPE tissues have undergone severe physical damage and chemical modifications, which make their analysis difficult and generally requires adapted assays. MicroRNAs (miRNAs), however, which represent a small class of RNA molecules spanning only up to ~18-24 nucleotides, have been shown to withstand long-term storage and have been successfully analyzed in FFPE samples. Here we present a 3' barcoded complementary DNA (cDNA) library preparation protocol specifically optimized for the analysis of small RNAs extracted from archived tissues, which was recently demonstrated to be robust and highly reproducible when using archived clinical specimens stored for up to 35 years. This library preparation is well adapted to the multiplex analysis of compromised/degraded material where RNA samples (up to 18) are ligated with individual 3' barcoded adapters and then pooled together for subsequent enzymatic and biochemical preparations prior to analysis. All purifications are performed by polyacrylamide gel electrophoresis (PAGE), which allows size-specific selections and enrichments of barcoded small RNA species. This cDNA library preparation is well adapted to minute RNA inputs, as a pilot polymerase chain reaction (PCR) allows determination of a specific amplification cycle to produce optimal amounts of material for next-generation sequencing (NGS). This approach was optimized for the use of degraded FFPE RNA from specimens archived for up to 35 years and provides highly reproducible NGS data.
Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart
2010-07-01
High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.
Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart
2010-01-01
High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users. PMID:20501601
Fan, R; Ling, P; Hao, C Y; Li, F P; Huang, L F; Wu, B D; Wu, H S
2015-10-19
Black pepper is a perennial climbing vine. It is widely cultivated because its berries can be utilized not only as a spice in food but also for medicinal use. This study aimed to construct a standardized, high-quality cDNA library to facilitated identification of new Piper hainanense transcripts. For this, 262 unigenes were used to generate raw reads. The average length of these 262 unigenes was 774.8 bp. Of these, 94 genes (35.9%) were newly identified, according to the NCBI protein database. Thus, identification of new genes may broaden the molecular knowledge of P. hainanense on the basis of Clusters of Orthologous Groups and Gene Ontology categories. In addition, certain basic genes linked to physiological processes, which can contribute to disease resistance and thereby to the breeding of black pepper. A total of 26 unigenes were found to be SSR markers. Dinucleotide SSR was the main repeat motif, accounting for 61.54%, followed by trinucleotide SSR (23.07%). Eight primer pairs successfully amplified DNA fragments and detected significant amounts of polymorphism among twenty-one piper germplasm. These results present a novel sequence information of P. hainanense, which can serve as the foundation for further genetic research on this species.
Hirao, Tomonori; Fukatsu, Eitaro; Watanabe, Atsushi
2012-01-24
Pine wilt disease is caused by the pine wood nematode, Bursaphelenchus xylophilus, which threatens pine forests and forest ecosystems worldwide and causes serious economic losses. In the 40 years since the pathogen was identified, the physiological changes occurring as the disease progresses have been characterized using anatomical and biochemical methods, and resistant trees have been selected via breeding programs. However, no studies have assessed the molecular genetics, e.g. transcriptional changes, associated with infection-induced physiological changes in resistant or susceptible trees. We constructed seven subtractive suppression hybridization (SSH) cDNA libraries using time-course sampling of trees inoculated with pine wood nematode at 1, 3, or 7 days post-inoculation (dpi) in susceptible trees and at 1, 3, 7, or 14 dpi in resistant trees. A total of 3,299 sequences was obtained from these cDNA libraries, including from 138 to 315 non-redundant sequences in susceptible SSH libraries and from 351 to 435 in resistant SSH libraries. Using Gene Ontology hierarchy, those non-redundant sequences were classified into 15 subcategories of the biological process Gene Ontology category and 17 subcategories of the molecular function category. The transcriptional components revealed by the Gene Ontology classification clearly differed between resistant and susceptible libraries. Some transcripts were discriminative: expression of antimicrobial peptide and putative pathogenesis-related genes (e.g., PR-1b, 2, 3, 4, 5, 6) was much higher in susceptible trees than in resistant trees at every time point, whereas expression of PR-9, PR-10, and cell wall-related genes (e.g., for hydroxyproline-rich glycoprotein precursor and extensin) was higher in resistant trees than in susceptible trees at 7 and 14 dpi. Following inoculation with pine wood nematode, there were marked differences between resistant and susceptible trees in transcript diversity and the timing and level of transcripts expressed in common; in particular, expression of stress response and defense genes differed. This study provided new insight into the differences in the physiological changes between resistant and susceptible trees that have been observed in anatomical and biochemical studies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko
1994-07-15
The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less
Targeting a Complex Transcriptome: The Construction of the Mouse Full-Length cDNA Encyclopedia
Carninci, Piero; Waki, Kazunori; Shiraki, Toshiyuki; Konno, Hideaki; Shibata, Kazuhiro; Itoh, Masayoshi; Aizawa, Katsunori; Arakawa, Takahiro; Ishii, Yoshiyuki; Sasaki, Daisuke; Bono, Hidemasa; Kondo, Shinji; Sugahara, Yuichi; Saito, Rintaro; Osato, Naoki; Fukuda, Shiro; Sato, Kenjiro; Watahiki, Akira; Hirozane-Kishikawa, Tomoko; Nakamura, Mari; Shibata, Yuko; Yasunishi, Ayako; Kikuchi, Noriko; Yoshiki, Atsushi; Kusakabe, Moriaki; Gustincich, Stefano; Beisel, Kirk; Pavan, William; Aidinis, Vassilis; Nakagawara, Akira; Held, William A.; Iwata, Hiroo; Kono, Tomohiro; Nakauchi, Hiromitsu; Lyons, Paul; Wells, Christine; Hume, David A.; Fagiolini, Michela; Hensch, Takao K.; Brinkmeier, Michelle; Camper, Sally; Hirota, Junji; Mombaerts, Peter; Muramatsu, Masami; Okazaki, Yasushi; Kawai, Jun; Hayashizaki, Yoshihide
2003-01-01
We report the construction of the mouse full-length cDNA encyclopedia,the most extensive view of a complex transcriptome,on the basis of preparing and sequencing 246 libraries. Before cloning,cDNAs were enriched in full-length by Cap-Trapper,and in most cases,aggressively subtracted/normalized. We have produced 1,442,236 successful 3′-end sequences clustered into 171,144 groups, from which 60,770 clones were fully sequenced cDNAs annotated in the FANTOM-2 annotation. We have also produced 547,149 5′ end reads,which clustered into 124,258 groups. Altogether, these cDNAs were further grouped in 70,000 transcriptional units (TU),which represent the best coverage of a transcriptome so far. By monitoring the extent of normalization/subtraction, we define the tentative equivalent coverage (TEC),which was estimated to be equivalent to >12,000,000 ESTs derived from standard libraries. High coverage explains discrepancies between the very large numbers of clusters (and TUs) of this project,which also include non-protein-coding RNAs,and the lower gene number estimation of genome annotations. Altogether,5′-end clusters identify regions that are potential promoters for 8637 known genes and 5′-end clusters suggest the presence of almost 63,000 transcriptional starting points. An estimate of the frequency of polyadenylation signals suggests that at least half of the singletons in the EST set represent real mRNAs. Clones accounting for about half of the predicted TUs await further sequencing. The continued high-discovery rate suggests that the task of transcriptome discovery is not yet complete. PMID:12819125
Molecular cloning and expression of rat brain endopeptidase 3.4.24.16.
Dauch, P; Vincent, J P; Checler, F
1995-11-10
We have isolated by immunological screening of a lambda ZAPII cDNA library constructed from rat brain mRNAs a cDNA clone encoding endopeptidase 3.4.24.16. The longest open reading frame encodes a 704-amino acid protein with a theoretical molecular mass of 80,202 daltons and bears the consensus sequence of the zinc metalloprotease family. The sequence exhibits a 60.2% homology with those of another zinc metallopeptidase, endopeptidase 3.4.24.15. Northern blot analysis reveals two mRNA species of about 3 and 5 kilobases in rat brain, ileum, kidney, and testis. We have transiently transfected COS-7 cells with pcDNA3 containing the cloned cDNA and established the overexpression of a 70-75-kDa immunoreactive protein. This protein hydrolyzes QFS, a quenched fluorimetric substrate of endopeptidase 3.4.24.16, and cleaves neurotensin at a single peptide bond, leading to the formation of neurotensin (1-10) and neurotensin (11-13). QFS and neurotensin hydrolysis are potently inhibited by the selective endopeptidase 3.4.24.16 dipeptide blocker Pro-Ile and by dithiothreitol, while the enzymatic activity remains unaffected by phosphoramidon and captopril, the specific inhibitors of endopeptidase 3.4.24.11 and angiotensin-converting enzyme, respectively. Altogether, these physicochemical, biochemical, and immunological properties unambiguously identify endopeptidase 3.4.24.16 as the protein encoded by the isolated cDNA clone.
Matthews, R J; Cahir, E D; Thomas, M L
1990-01-01
Protein-tyrosine-phosphatases (protein-tyrosine-phosphate phosphohydrolase, EC 3.13.48) have been implicated in the regulation of cell growth; however, to date few tyrosine phosphatases have been characterized. To identify additional family members, the cDNA for the human tyrosine phosphatase leukocyte common antigen (LCA; CD45) was used to screen, under low stringency, a mouse pre-B-cell cDNA library. Two cDNA clones were isolated and sequence analysis predicts a protein sequence of 793 amino acids. We have named the molecule LRP (LCA-related phosphatase). RNA transfer analysis indicates that the cDNAs were derived from a 3.2-kilobase mRNA. The LRP mRNA is transcribed in a wide variety of tissues. The predicted protein structure can be divided into the following structural features: a short 19-amino acid leader sequence, an exterior domain of 123 amino acids that is predicted to be highly glycosylated, a 24-amino acid membrane-spanning region, and a 627-amino acid cytoplasmic region. The cytoplasmic region contains two approximately 260-amino acid domains, each with homology to the tyrosine phosphatase family. One of the cDNA clones differed in that it had a 108-base-pair insertion that, while preserving the reading frame, would disrupt the first protein-tyrosine-phosphatase domain. Analysis of genomic DNA indicates that the insertion is due to an alternatively spliced exon. LRP appears to be evolutionarily conserved as a putative homologue has been identified in the invertebrate Styela plicata. Images PMID:2162042
Omeroglu Ulu, Zehra; Ulu, Salih; Un, Cemal; Ozdem Oztabak, Kemal; Altunatmaz, Kemal
2017-01-01
Kivircik sheep is an important local Turkish sheep according to its meat quality and milk productivity. The aim of this study was to analyze gene expression profiles of both prenatal and postnatal stages for the Kivircik sheep. Therefore, two different cDNA libraries, which were taken from the same Kivircik sheep mammary gland tissue at prenatal and postnatal stages, were constructed. Total 3072 colonies which were randomly selected from the two libraries were sequenced for developing a sheep ESTs collection. We used Phred/Phrap computer programs for analysis of the raw EST and readable EST sequences were assembled with the CAP3 software. Putative functions of all unique sequences and statistical analysis were determined by Geneious software. Total 422 ESTs have over 80% similarity to known sequences of other organisms in NCBI classified by Panther database for the Gene Ontology (GO) category. By comparing gene expression profiles, we observed some putative genes that may be relative to reproductive performance or play important roles in milk synthesis and secretion. A total of 2414 ESTs have been deposited to the NCBI GenBank database (GW996847–GW999260). EST data in this study have provided a new source of information to functional genome studies of sheep. PMID:28239610
Moser, Lindsey A.; Ramirez-Carvajal, Lisbeth; Puri, Vinita; Pauszek, Steven J.; Matthews, Krystal; Dilley, Kari A.; Mullan, Clancy; McGraw, Jennifer; Khayat, Michael; Beeri, Karen; Yee, Anthony; Dugan, Vivien; Heise, Mark T.; Frieman, Matthew B.; Rodriguez, Luis L.; Bernard, Kristen A.; Wentworth, David E.
2016-01-01
ABSTRACT Several biosafety level 3 and/or 4 (BSL-3/4) pathogens are high-consequence, single-stranded RNA viruses, and their genomes, when introduced into permissive cells, are infectious. Moreover, many of these viruses are select agents (SAs), and their genomes are also considered SAs. For this reason, cDNAs and/or their derivatives must be tested to ensure the absence of infectious virus and/or viral RNA before transfer out of the BSL-3/4 and/or SA laboratory. This tremendously limits the capacity to conduct viral genomic research, particularly the application of next-generation sequencing (NGS). Here, we present a sequence-independent method to rapidly amplify viral genomic RNA while simultaneously abolishing both viral and genomic RNA infectivity across multiple single-stranded positive-sense RNA (ssRNA+) virus families. The process generates barcoded DNA amplicons that range in length from 300 to 1,000 bp, which cannot be used to rescue a virus and are stable to transport at room temperature. Our barcoding approach allows for up to 288 barcoded samples to be pooled into a single library and run across various NGS platforms without potential reconstitution of the viral genome. Our data demonstrate that this approach provides full-length genomic sequence information not only from high-titer virion preparations but it can also recover specific viral sequence from samples with limited starting material in the background of cellular RNA, and it can be used to identify pathogens from unknown samples. In summary, we describe a rapid, universal standard operating procedure that generates high-quality NGS libraries free of infectious virus and infectious viral RNA. IMPORTANCE This report establishes and validates a standard operating procedure (SOP) for select agents (SAs) and other biosafety level 3 and/or 4 (BSL-3/4) RNA viruses to rapidly generate noninfectious, barcoded cDNA amenable for next-generation sequencing (NGS). This eliminates the burden of testing all processed samples derived from high-consequence pathogens prior to transfer from high-containment laboratories to lower-containment facilities for sequencing. Our established protocol can be scaled up for high-throughput sequencing of hundreds of samples simultaneously, which can dramatically reduce the cost and effort required for NGS library construction. NGS data from this SOP can provide complete genome coverage from viral stocks and can also detect virus-specific reads from limited starting material. Our data suggest that the procedure can be implemented and easily validated by institutional biosafety committees across research laboratories. PMID:27822536
Huebner, K; Druck, T; Croce, C M; Thiesen, H J
1991-01-01
cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798
Novel transcripts of the estrogen receptor α gene in channel catfish
Patino, Reynaldo; Xia, Zhenfang; Gale, William L.; Wu, Chunfa; Maule, Alec G.; Chang, Xiaotian
2000-01-01
Complementary DNA libraries from liver and ovary of an immature female channel catfish were screened with a homologous ERα cDNA probe. The hepatic library yielded two new channel catfish ER cDNAs that encode N-terminal ERα variants of different sizes. Relative to the catfish ERα (medium size; 581 residues) previously reported, these new cDNAs encode Long-ERα (36 residues longer) and Short-ERα (389 residues shorter). The 5′-end of Long-ERα cDNA is identical to that of Medium-ERα but has an additional 503-bp segment with an upstream, in-frame translation-start codon. Recombinant Long-ERα binds estrogen with high affinity (Kd = 3.4 nM), similar to that previously reported for Medium-ERα but lower than reported for catfish ERβ. Short-ERα cDNA encodes a protein that lacks most of the receptor protein and does not bind estrogen. Northern hybridization confirmed the existence of multiple hepatic ERα RNAs that include the size range of the ERα cDNAs obtained from the libraries as well as additional sizes. Using primers for RT-PCR that target locations internal to the protein-coding sequence, we also established the presence of several ERα cDNA variants with in-frame insertions in the ligand-binding and DNA-binding domains and in-frame or out-of-frame deletions in the ligand-binding domain. These internal variants showed patterns of expression that differed between the ovary and liver. Further, the ovarian library yielded a full-length, ERα antisense cDNA containing a poly(A) signal and tail. A limited survey of histological preparations from juvenile catfish by in situ hybridization using directionally synthesized cRNA probes also suggested the expression of ERα antisense RNA in a tissue-specific manner. In conclusion, channel catfish seemingly have three broad classes of ERα mRNA variants: those encoding N-terminal truncated variants, those encoding internal variants (including C-terminal truncated variants), and antisense mRNA. The sense variants may encode functional ERα or related proteins that modulate ERα or ERβ activity. The existence of ER antisense mRNA is reported in this study for the first time. Its role may be to participate in the regulation of ER gene expression.
Poojari, Sudarsana; Alabi, Olufemi J.; Fofanov, Viacheslav Y.; Naidu, Rayapati A.
2013-01-01
A graft-transmissible disease displaying red veins, red blotches and total reddening of leaves in red-berried wine grape (Vitis vinifera L.) cultivars was observed in commercial vineyards. Next-generation sequencing technology was used to identify etiological agent(s) associated with this emerging disease, designated as grapevine redleaf disease (GRD). High quality RNA extracted from leaves of grape cultivars Merlot and Cabernet Franc with and without GRD symptoms was used to prepare cDNA libraries. Assembly of highly informative sequence reads generated from Illumina sequencing of cDNA libraries, followed by bioinformatic analyses of sequence contigs resulted in specific identification of taxonomically disparate viruses and viroids in samples with and without GRD symptoms. A single-stranded DNA virus, tentatively named Grapevine redleaf-associated virus (GRLaV), and Grapevine fanleaf virus were detected only in grapevines showing GRD symptoms. In contrast, Grapevine rupestris stem pitting-associated virus, Hop stunt viroid, Grapevine yellow speckle viroid 1, Citrus exocortis viroid and Citrus exocortis Yucatan viroid were present in both symptomatic and non-symptomatic grapevines. GRLaV was transmitted by the Virginia creeper leafhopper (Erythroneura ziczac Walsh) from grapevine-to-grapevine under greenhouse conditions. Molecular and phylogenetic analyses indicated that GRLaV, almost identical to recently reported Grapevine Cabernet Franc-associated virus from New York and Grapevine red blotch-associated virus from California, represents an evolutionarily distinct lineage in the family Geminiviridae with genome characteristics distinct from other leafhopper-transmitted geminiviruses. GRD significantly reduced fruit yield and affected berry quality parameters demonstrating negative impacts of the disease. Higher quantities of carbohydrates were present in symptomatic leaves suggesting their possible role in the expression of redleaf symptoms. PMID:23755117
Bentley, L; Fehrsen, J; Jordaan, F; Huismans, H; du Plessis, D H
2000-04-01
VP2 is an outer capsid protein of African horsesickness virus (AHSV) and is recognized by serotype-discriminatory neutralizing antibodies. With the objective of locating its antigenic regions, a filamentous phage library was constructed that displayed peptides derived from the fragmentation of a cDNA copy of the gene encoding VP2. Peptides ranging in size from approximately 30 to 100 amino acids were fused with pIII, the attachment protein of the display vector, fUSE2. To ensure maximum diversity, the final library consisted of three sub-libraries. The first utilized enzymatically fragmented DNA encoding only the VP2 gene, the second included plasmid sequences, while the third included a PCR step designed to allow different peptide-encoding sequences to recombine before ligation into the vector. The resulting composite library was subjected to immunoaffinity selection with AHSV-specific polyclonal chicken IgY, polyclonal horse immunoglobulins and a monoclonal antibody (MAb) known to neutralize AHSV. Antigenic peptides were located by sequencing the DNA of phages bound by the antibodies. Most antigenic determinants capable of being mapped by this method were located in the N-terminal half of VP2. Important binding areas were mapped with high resolution by identifying the minimum overlapping areas of the selected peptides. The MAb was also used to screen a random 17-mer epitope library. Sequences that may be part of a discontinuous neutralization epitope were identified. The amino acid sequences of the antigenic regions on VP2 of serotype 3 were compared with corresponding regions on three other serotypes, revealing regions with the potential to discriminate AHSV serotypes serologically.
Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)
NASA Technical Reports Server (NTRS)
Shibata, K.; Abe, S.; Davies, E.
2001-01-01
Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.
Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D
1995-03-01
A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.
Chow, C M; Yagüe, E; Raguz, S; Wood, D A; Thurston, C F
1994-01-01
A 52-kDa protein, CEL3, has been separated from the culture filtrate of Agaricus bisporus during growth on cellulose. A PCR-derived probe was made, with a degenerate oligodeoxynucleotide derived from the amino acid sequence of a CEL3 CNBr cleavage product and was used to select cel3 cDNA clones from an A. bisporus cDNA library. Two allelic cDNAs were isolated. They showed 98.8% identity of their nucleotide sequences. The deduced amino acid sequence and domain architecture of CEL3 showed a high degree of similarity to those of cellobiohydrolase II of Trichoderma reesei. Functional expression of cel3 cDNA in Saccharomyces cerevisiae was achieved by placing it under the control of a constitutive promoter and fusing it to the yeast invertase signal sequence. Recombinant CEL3 secreted by yeast showed enzymatic activity towards crystalline cellulose. At long reaction times, CEL3 was also able to degrade carboxymethyl cellulose. Northern (RNA) analysis showed that cel3 gene expression was induced by cellulose and repressed by glucose, fructose, 2-deoxyglucose, and lactose. Glycerol, mannitol, sorbitol, and maltose were neutral carbon sources. Nuclear run-on analysis showed that the rate of synthesis of cel3 mRNA in cellulose-grown cultures was 13 times higher than that in glucose-grown cultures. A low basal rate of cel3 mRNA synthesis was observed in the nuclei isolated from glucose-grown mycelia. Images PMID:8085821
A cDNA clone highly expressed in ripe banana fruit shows homology to pectate lyases.
Dominguez-Puigjaner, E; LLop, I; Vendrell, M; Prat, S
1997-07-01
A cDNA clone (Ban17), encoding a protein homologous to pectate lyase, has been isolated from a cDNA library from climacteric banana fruit by means of differential screening. Northern analysis showed that Ban17 mRNA is first detected in early climacteric fruit, reaches a steady-state maximum at the climacteric peak, and declines thereafter in overripe fruit. Accumulation of the Ban17 transcript can be induced in green banana fruit by exogenous application of ethylene. The demonstrates that expression of this gene is under hormonal control, its induction being regulated by the rapid increase in ethylene production at the onset of ripening. The deduced amino acid sequence derived from the Ban17 cDNA shares significant identity with pectate lyases from pollen and plant pathogenic bacteria of the genus Erwinia. Similarity to bacterial pectate lyases that were proven to break down the pectic substances of the plant cell wall suggest that Ban17 might play a role in the loss of mesocarp firmness during fruit ripening.
Camicia, Federico; Paredes, Rodolfo; Chalar, Cora; Galanti, Norbel; Kamenetzky, Laura; Gutierrez, Ariana; Rosenzvit, Mara C
2008-03-31
We have sequenced and partially characterized an Echinococcus granulosus cDNA, termed egat1, from a protoscolex signal sequence trap (SST) cDNA library. The isolated 1627 bp long cDNA contains an ORF of 489 amino acids and shows an amino acid identity of 30% with neutral and excitatory amino acid transporters members of the Dicarboxylate/Amino Acid Na+ and/or H+ Cation Symporter family (DAACS) (TC 2.A.23). Additional bioinformatics analysis of EgAT1, confirmed the results obtained by similarity searches and showed the presence of 9 to 10 transmembrane domains, consensus sequences for N-glycosylation between the third and fourth transmembrane domain, a highly similar hydropathy profile with ASCT1 (a known member of DAACS family), high score with SDF (Sodium Dicarboxilate Family) and similar motifs with EDTRANSPORT, a fingerprint of excitatory amino acid transporters. The localization of the putative amino acid transporter was analyzed by in situ hybridization and immunofluorescence in protoscoleces and associated germinal layer. The in situ hybridization labelling indicates the distribution of egat1 mRNA throughout the tegument. EgAT1 protein, which showed in Western blots a molecular mass of approximately 60 kD, is localized in the subtegumental region of the metacestode, particularly around suckers and rostellum of protoscoleces and layers from brood capsules. The sequence and expression analyses of EgAT1 pave the way for functional analysis of amino acids transporters of E. granulosus and its evaluation as new drug targets against cystic echinococcosis.
A BIOINFORMATIC STRATEGY TO RAPIDLY CHARACTERIZE CDNA LIBRARIES
A Bioinformatic Strategy to Rapidly Characterize cDNA Libraries
G. Charles Ostermeier1, David J. Dix2 and Stephen A. Krawetz1.
1Departments of Obstetrics and Gynecology, Center for Molecular Medicine and Genetics, & Institute for Scientific Computing, Wayne State Univer...
[Construction of fetal mesenchymal stem cell cDNA subtractive library].
Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao
2002-04-01
To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.
Gadkar, Vijay J; Filion, Martin
2013-06-01
In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Yokozaki, H; Tahara, H; Oue, N; Tahara, E
2000-01-01
A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.
Characterization of defensin gene from abalone Haliotis discus hannai and its deduced protein
NASA Astrophysics Data System (ADS)
Hong, Xuguang; Sun, Xiuqin; Zheng, Minggang; Qu, Lingyun; Zan, Jindong; Zhang, Jinxing
2008-11-01
Defensin is one of preserved ancient host defensive materials formed in biological evolution. As a regulator and effector molecule, it is very important in animals’ acquired immune system. This paper reports the defensin gene from the mixed liver and kidney cDNA library of abalone Haliotis discus hannai Ino. Sequence analysis shows that the gene sequence of full-length cDNA encodes 42 mature peptides (including six Cys), molecular weight of 4 323 Da, and pI of 8.02. Amino acid sequence homology analysis shows that the peptides are highly similar (70% in common) to other insects defensin. Because of a typical insect-defensin structural character of mature peptide in the secondary structure, the polypeptide named Haliotis discus defensin (hd-def), a novel of antimicrobial peptides, belongs to insects defensin subfamily. The RT-PCR result of Haliotis discus defensin shows that the gene can be expressed only in the hepatopancreas by Gram-negative and positive bacteria stimulation, which is ascribed to inducible expression. Therefore, it is revealed that the Haliotis discus defensin gene expression was related to the antibacterial infection of Haliotis discus hannai Ino.
Molecular characterization of a family of ligands for eph-related tyrosine kinase receptors.
Beckmann, M P; Cerretti, D P; Baum, P; Vanden Bos, T; James, L; Farrah, T; Kozlosky, C; Hollingsworth, T; Shilling, H; Maraskovsky, E
1994-01-01
A family of tyrosine kinase receptors related to the product of the eph gene has been described recently. One of these receptors, elk, has been shown to be expressed only in brain and testes. Using a direct expression cloning technique, a ligand for the elk receptor has been isolated by screening a human placenta cDNA library with a fusion protein containing the extracellular domain of the receptor. This isolated cDNA encodes a transmembrane protein. While the sequence of the ligand cDNA is unique, it is related to a previously described sequence known as B61. Northern blot analysis of human tissue mRNA showed that the elk ligand's mRNA is 3.5 kb long and is found in placenta, heart, lung, liver, skeletal muscle, kidney and pancreas. Southern blot analysis showed that the gene is highly conserved in a wide variety of species. Both elk ligand and B61 mRNAs are inducible by tumour necrosis factor in human umbilical vein endothelial cells. In addition, both proteins show promiscuity in binding to the elk and the related hek receptors. Since these two ligand sequences are similar, and since elk and hek are members of a larger family of eph-related receptor molecules, we refer to these ligands as LERKs (ligands for eph-related kinases). Images PMID:8070404
Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B
1987-01-01
The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979
Morin, Ryan D.; Chang, Elbert; Petrescu, Anca; Liao, Nancy; Griffith, Malachi; Kirkpatrick, Robert; Butterfield, Yaron S.; Young, Alice C.; Stott, Jeffrey; Barber, Sarah; Babakaiff, Ryan; Dickson, Mark C.; Matsuo, Corey; Wong, David; Yang, George S.; Smailus, Duane E.; Wetherby, Keith D.; Kwong, Peggy N.; Grimwood, Jane; Brinkley, Charles P.; Brown-John, Mabel; Reddix-Dugue, Natalie D.; Mayo, Michael; Schmutz, Jeremy; Beland, Jaclyn; Park, Morgan; Gibson, Susan; Olson, Teika; Bouffard, Gerard G.; Tsai, Miranda; Featherstone, Ruth; Chand, Steve; Siddiqui, Asim S.; Jang, Wonhee; Lee, Ed; Klein, Steven L.; Blakesley, Robert W.; Zeeberg, Barry R.; Narasimhan, Sudarshan; Weinstein, John N.; Pennacchio, Christa Prange; Myers, Richard M.; Green, Eric D.; Wagner, Lukas; Gerhard, Daniela S.; Marra, Marco A.; Jones, Steven J.M.; Holt, Robert A.
2006-01-01
Sequencing of full-insert clones from full-length cDNA libraries from both Xenopus laevis and Xenopus tropicalis has been ongoing as part of the Xenopus Gene Collection Initiative. Here we present 10,967 full ORF verified cDNA clones (8049 from X. laevis and 2918 from X. tropicalis) as a community resource. Because the genome of X. laevis, but not X. tropicalis, has undergone allotetraploidization, comparison of coding sequences from these two clawed (pipid) frogs provides a unique angle for exploring the molecular evolution of duplicate genes. Within our clone set, we have identified 445 gene trios, each comprised of an allotetraploidization-derived X. laevis gene pair and their shared X. tropicalis ortholog. Pairwise dN/dS, comparisons within trios show strong evidence for purifying selection acting on all three members. However, dN/dS ratios between X. laevis gene pairs are elevated relative to their X. tropicalis ortholog. This difference is highly significant and indicates an overall relaxation of selective pressures on duplicated gene pairs. We have found that the paralogs that have been lost since the tetraploidization event are enriched for several molecular functions, but have found no such enrichment in the extant paralogs. Approximately 14% of the paralogous pairs analyzed here also show differential expression indicative of subfunctionalization. PMID:16672307
Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C
1987-12-01
Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene.
Gene Expression Differences in Infected and Noninfected Middle Ear Complementary DNA Libraries
Kerschner, Joseph E.; Horsey, Edward; Ahmed, Azad; Erbe, Christy; Khampang, Pawjai; Cioffi, Joseph; Hu, Fen Ze; Post, James Christopher; Ehrlich, Garth D.
2010-01-01
Objectives To investigate genetic differences in middle ear mucosa (MEM) with nontypeable Haemophilus influenzae (NTHi) infection. Genetic upregulation and downregulation occurs in MEM during otitis media (OM) pathogenesis. A comprehensive assessment of these genetic differences using the techniques of complementary DNA (cDNA) library creation has not been performed. Design The cDNA libraries were constructed from NTHi-infected and noninfected chinchilla MEM. Random clones were picked, sequenced bidirectionally, and submitted to the National Center for Biotechnology Information (NCBI) Expressed Sequence Tags database, where they were assigned accession numbers. These numbers were used with the basic local alignment search tool (BLAST) to align clones against the nonredundant nucleotide database at NCBI. Results Analysis with the Web-based statistical program FatiGO identified several biological processes with significant differences in numbers of represented genes. Processes involved in immune, stress, and wound responses were more prevalent in the NTHi-infected library. S100 calcium-binding protein A9 (S100A9); secretory leukoprotease inhibitor (SLPI); β2-microglobulin (B2M); ferritin, heavy-chain polypeptide 1 (FTH1); and S100 calcium-binding protein A8 (S100A8) were expressed at significantly higher levels in the NTHi-infected library. Calcium-binding proteins S100A9 and S100A8 serve as markers for inflammation and have antibacterial effects. Secretory leukoprotease inhibitor is an antibacterial protein that inhibits stimuli-induced MUC1, MUC2, and MUC5AC production. Conclusions A number of genes demonstrate changes during the pathogenesis of OM, including SLPI, which has an impact on mucin gene expression; this expression is known to be an important regulator in OM. The techniques described herein provide a framework for future investigations to more thoroughly understand molecular changes in the middle ear, which will likely be important in developing new therapeutic and intervention strategies. PMID:19153305
Popp, Nicole; Schlömann, Michael; Mau, Margit
2006-11-01
Soils contaminated with mineral oil hydrocarbons are often cleaned in off-site bioremediation systems. In order to find out which bacteria are active during the degradation phase in such systems, the diversity of the active microflora in a degrading soil remediation system was investigated by small-subunit (SSU) rRNA analysis. Two sequential RNA extracts from one soil sample were generated by a procedure incorporating bead beating. Both extracts were analysed separately by generating individual SSU rDNA clone libraries from cDNA of the two extracts. The sequencing results showed moderate diversity. The two clone libraries were dominated by Gammaproteobacteria, especially Pseudomonas spp. Alphaproteobacteria and Betaproteobacteria were two other large groups in the clone libraries. Actinobacteria, Firmicutes, Bacteroidetes and Epsilonproteobacteria were detected in lower numbers. The obtained sequences were predominantly related to genera for which cultivated representatives have been described, but were often clustered together in the phylogenetic tree, and the sequences that were most similar were originally obtained from soils and not from pure cultures. Most of the dominant genera in the clone libraries, e.g. Pseudomonas, Acinetobacter, Sphingomonas, Acidovorax and Thiobacillus, had already been detected in (mineral oil hydrocarbon) contaminated environmental samples. The occurrence of the genera Zymomonas and Rhodoferax was novel in mineral oil hydrocarbon-contaminated soil.
Puthoff, D P; Neelam, A; Ehrenfried, M L; Scheffler, B E; Ballard, L; Song, Q; Campbell, K B; Cooper, B; Tucker, M L
2008-10-01
Hyphae, 2 to 8 days postinoculation (dpi), and haustoria, 5 dpi, were isolated from Uromyces appendiculatus infected bean leaves (Phaseolus vulgaris cv. Pinto 111) and a separate cDNA library prepared for each fungal preparation. Approximately 10,000 hyphae and 2,700 haustoria clones were sequenced from both the 5' and 3' ends. Assembly of all of the fungal sequences yielded 3,359 contigs and 927 singletons. The U. appendiculatus sequences were compared with sequence data for other rust fungi, Phakopsora pachyrhizi, Uromyces fabae, and Puccinia graminis. The U. appendiculatus haustoria library included a large number of genes with unknown cellular function; however, summation of sequences of known cellular function suggested that haustoria at 5 dpi had fewer transcripts linked to protein synthesis in favor of energy metabolism and nutrient uptake. In addition, open reading frames in the U. appendiculatus data set with an N-terminal signal peptide were identified and compared with other proteins putatively secreted from rust fungi. In this regard, a small family of putatively secreted RTP1-like proteins was identified in U. appendiculatus and P. graminis.
Bovine mammary gene expression profiling during the onset of lactation.
Gao, Yuanyuan; Lin, Xueyan; Shi, Kerong; Yan, Zhengui; Wang, Zhonghua
2013-01-01
Lactogenesis includes two stages. Stage I begins a few weeks before parturition. Stage II is initiated around the time of parturition and extends for several days afterwards. To better understand the molecular events underlying these changes, genome-wide gene expression profiling was conducted using digital gene expression (DGE) on bovine mammary tissue at three time points (on approximately day 35 before parturition (-35 d), day 7 before parturition (-7 d) and day 3 after parturition (+3 d)). Approximately 6.2 million (M), 5.8 million (M) and 6.1 million (M) 21-nt cDNA tags were sequenced in the three cDNA libraries (-35 d, -7 d and +3 d), respectively. After aligning to the reference sequences, the three cDNA libraries included 8,662, 8,363 and 8,359 genes, respectively. With a fold change cutoff criteria of ≥ 2 or ≤-2 and a false discovery rate (FDR) of ≤ 0.001, a total of 812 genes were significantly differentially expressed at -7 d compared with -35 d (stage I). Gene ontology analysis showed that those significantly differentially expressed genes were mainly associated with cell cycle, lipid metabolism, immune response and biological adhesion. A total of 1,189 genes were significantly differentially expressed at +3 d compared with -7 d (stage II), and these genes were mainly associated with the immune response and cell cycle. Moreover, there were 1,672 genes significantly differentially expressed at +3 d compared with -35 d. Gene ontology analysis showed that the main differentially expressed genes were those associated with metabolic processes. The results suggest that the mammary gland begins to lactate not only by a gain of function but also by a broad suppression of function to effectively push most of the cell's resources towards lactation.
Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi
2004-02-01
To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Potier, M.C.; Dutriaux, A.; Lambolez, B.
1993-03-01
Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less
NASA Technical Reports Server (NTRS)
Wu, L. L.; Mitchell, J. P.; Cohn, N. S.; Kaufman, P. B.
1993-01-01
The invertase (EC 3.2.1.26) purified from cell walls of dwarf pea stems to homogeneity has a molecular mass of 64 kilodaltons (kD). Poly(A)+RNA was isolated from shoots of dwarf pea plants, and a cDNA library was constructed using lambda gt11 as an expression vector. The expression cDNA library was screened with polyclonal antibodies against pea cell wall invertase. One invertase cDNA clone was characterized as a full-length cDNA with 1,863 base pairs. Compared with other known invertases, one homologous region in the amino acid sequence was found. The conserved motif, Asn-Asp-Pro-Asn-Gly, is located near the N-terminal end of invertase. Northern blot analysis showed that the amount of invertase mRNA (1.86 kb) was rapidly induced to a maximal level 4 h after GA3 treatment, then gradually decreased to the control level. The mRNA level at 4 h in GA3-treated peas was fivefold higher than that of the control group. The maximal increase in activity of pea cell wall invertase elicited by GA3 occcured at 8 h after GA3 treatment. This invertase isoform was shown immunocytochemically to be localized in the cell walls, where a 10-fold higher accumulation occurred in GA3-treated tissue compared with control tissue. This study indicates that the expression of the pea shoot cell-wall invertase gene could be regulated by GA3 at transcriptional and/or translational levels.
Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pennacchio, L.A.
1994-05-06
We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.
Cloning of a new member of the insulin gene superfamily (INSL4) expressed in human placenta
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chassin, D.; Laurent, A.; Janneau, J.L.
1995-09-20
A new member of the insulin gene superfamily was identified by screening a subtracted cDNA library of first-trimester human placenta and, hence, was tentatively named early placenta insulin-like peptide (EPIL). In this paper, we report the cloning and sequencing of the EPIL cDNA and the EPIL gene (INSL4). Comparison of the deduced amino acid sequence of the early placenta insulin-like peptide revealed significant overall and structural homologies with members of the insulin-like hormone superfamily. Moreover, the organization of the early placenta insulin-like gene, which is composed of two exons and one intron, is similiar to that of insulin and relaxin.more » By in situ hybridization, the INSL4 gene was assigned to band p24 of the short arm of chromosome 9. RT-PCR analysis of EPIL tissue distribution revealed that its transcripts are expressed in the placenta and uterus. 22 refs., 3 figs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Szoets, H.; Reithmueller, G.; Weiss, E.
1986-03-01
Antigen HLA-B27 is a high-risk genetic factor with respect to a group of rheumatoid disorders, especially ankylosing spondylitis. A cDNA library was constructed from an autozygous B-cell line expressing HLA-B27, HLA-Cw1, and the previously cloned HLA-A2 antigen. Clones detected with an HLA probe were isolated and sorted into homology groups by differential hybridization and restriction maps. Nucleotide sequencing allowed the unambiguous assignment of cDNAs to HLA-A, -B, and -C loci. The HLA-B27 mRNA has the structure features and the codon variability typical of an HLA class I transcript but it specifies two uncommon amino acid replacements: a cysteine in positionmore » 67 and a serine in position 131. The latter substitution may have functional consequences, because it occurs in a conserved region and at a position invariably occupied by a species-specific arginine in humans and lysine in mice. The availability of the complete sequence of HLA-B27 and of the partial sequence of HLA-Cw1 allows the recognition of locus-specific sequence markers, particularly, but not exclusively, in the transmembrane and cytoplasmic domains.« less
Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D
2014-01-01
The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841
Isolation and Identification of miRNAs in Jatropha curcas
Wang, Chun Ming; Liu, Peng; Sun, Fei; Li, Lei; Liu, Peng; Ye, Jian; Yue, Gen Hua
2012-01-01
MicroRNAs (miRNAs) are small noncoding RNAs that play crucial regulatory roles by targeting mRNAs for silencing. To identify miRNAs in Jatropha curcas L, a bioenergy crop, cDNA clones from two small RNA libraries of leaves and seeds were sequenced and analyzed using bioinformatic tools. Fifty-two putative miRNAs were found from the two libraries, among them six were identical to known miRNAs and 46 were novel. Differential expression patterns of 15 miRNAs in root, stem, leave, fruit and seed were detected using quantitative real-time PCR. Ten miRNAs were highly expressed in fruit or seed, implying that they may be involved in seed development or fatty acids synthesis in seed. Moreover, 28 targets of the isolated miRNAs were predicted from a jatropha cDNA library database. The miRNA target genes were predicted to encode a broad range of proteins. Sixteen targets had clear BLASTX hits to the Uniprot database and were associated with genes belonging to the three major gene ontology categories of biological process, cellular component, and molecular function. Four targets were identified for JcumiR004. By silencing JcumiR004 primary miRNA, expressions of the four target genes were up-regulated and oil composition were modulated significantly, indicating diverse functions of JcumiR004. PMID:22419887
Piggott, Andrew M; Kriegel, Alison M; Willows, Robert D; Karuso, Peter
2009-10-01
Reverse chemical proteomics using T7 phage display is a powerful technique for identifying cellular receptors of biologically active small molecules. However, to date this method has generally been limited to cDNA libraries constructed from mRNA isolated from eukaryotes. In this paper, we describe the construction of the first prokaryotic T7 phage display libraries from randomly digested Pseudomonas stutzeri and Vibrio fischeri gDNA, as well as a plant cDNA library from Arabidopsis thaliana. We also describe the use of T7 phage display to identify novel proteins from environmental DNA samples using biotinylated FK506 as a model affinity probe.
Roux, Michelle M.; Pain, Arnab; Klimpel, Kurt R.; Dhar, Arun K.
2002-01-01
Pattern recognition proteins such as lipopolysaccharide and β-1,3-glucan binding protein (LGBP) play an important role in the innate immune response of crustaceans and insects. Random sequencing of cDNA clones from a hepatopancreas cDNA library of white spot virus (WSV)-infected shrimp provided a partial cDNA (PsEST-289) that showed similarity to the LGBP gene of crayfish and insects. Subsequently full-length cDNA was cloned by the 5′-RACE (rapid amplification of cDNA ends) technique and sequenced. The shrimp LGBP gene is 1,352 bases in length and is capable of encoding a polypeptide of 376 amino acids that showed significant similarity to homologous genes from crayfish, insects, earthworms, and sea urchins. Analysis of the shrimp LGBP deduced amino acid sequence identified conserved features of this gene family including a potential recognition motif for β-(1→3) linkage of polysaccharides and putative RGD cell adhesion sites. It is known that LGBP gene expression is upregulated in bacterial and fungal infection and that the binding of lipopolysaccharide and β-1,3-glucan to LGBP activates the prophenoloxidase (proPO) cascade. The temporal expression of LGBP and proPO genes in healthy and WSV-challenged Penaeus stylirostris shrimp was measured by real-time quantitative reverse transcription-PCR, and we showed that LGBP gene expression in shrimp was upregulated as the WSV infection progressed. Interestingly, the proPO expression was upregulated initially after infection followed by a downregulation as the viral infection progressed. The downward trend in the expression of proPO coincided with the detection of WSV in the infected shrimp. Our data suggest that shrimp LGBP is an inducible acute-phase protein that may play a critical role in shrimp-WSV interaction and that the WSV infection regulates the activation and/or activity of the proPO cascade in a novel way. PMID:12072514
Saito, Y; Konnai, S; Yamada, S; Imamura, S; Nishikado, H; Ito, T; Onuma, M; Ohashi, K
2009-08-01
Ixodes persulcatus is the primary vector for human tick-borne diseases in Japan. A cDNA library was constructed from whole body homogenates of fed nymphs of I. persulcatus. From this library, one cDNA encoding defensin-like antimicrobial peptide was identified. The amino-acid sequence showed high similarity to those of the defensins of other ticks and arthropods. I. persulcatus defensin mRNA transcripts were detected at all life cycle stages of fed ticks and found to be predominantly expressed in the midguts of adult female ticks, but not in the salivary glands, a finding corroborated by Western blotting analysis. To investigate the function of I. persulcatus defensin, we examined its antibacterial activity by evaluation of growth of several bacterial strains in the presence of the synthetic peptide. The defensin from I. persulcatus markedly inhibited the growth of Gram-positive bacteria including Staphylococcus aureus, Bacillus subtilis and Corynebacterium renale, but not Gram-negative bacteria except Escherichia coli O157. In conclusion, these results suggest that I. persulcatus defensin may be playing a significant role in the defence against microbes from bloodmeals.
Cloning and characterization of a Candida albicans maltase gene involved in sucrose utilization.
Geber, A; Williamson, P R; Rex, J H; Sweeney, E C; Bennett, J E
1992-01-01
In order to isolate the structural gene involved in sucrose utilization, we screened a sucrose-induced Candida albicans cDNA library for clones expressing alpha-glucosidase activity. The C. albicans maltase structural gene (CAMAL2) was isolated. No other clones expressing alpha-glucosidase activity. were detected. A genomic CAMAL2 clone was obtained by screening a size-selected genomic library with the cDNA clone. DNA sequence analysis reveals that CAMAL2 encodes a 570-amino-acid protein which shares 50% identity with the maltase structural gene (MAL62) of Saccharomyces carlsbergensis. The substrate specificity of the recombinant protein purified from Escherichia coli identifies the enzyme as a maltase. Northern (RNA) analysis reveals that transcription of CAMAL2 is induced by maltose and sucrose and repressed by glucose. These results suggest that assimilation of sucrose in C. albicans relies on an inducible maltase enzyme. The family of genes controlling sucrose utilization in C. albicans shares similarities with the MAL gene family of Saccharomyces cerevisiae and provides a model system for studying gene regulation in this pathogenic yeast. Images PMID:1400249
Li, Xinguo; Wu, Harry X; Dillon, Shannon K; Southerton, Simon G
2009-01-01
Background Wood is a major renewable natural resource for the timber, fibre and bioenergy industry. Pinus radiata D. Don is the most important commercial plantation tree species in Australia and several other countries; however, genomic resources for this species are very limited in public databases. Our primary objective was to sequence a large number of expressed sequence tags (ESTs) from genes involved in wood formation in radiata pine. Results Six developing xylem cDNA libraries were constructed from earlywood and latewood tissues sampled at juvenile (7 yrs), transition (11 yrs) and mature (30 yrs) ages, respectively. These xylem tissues represent six typical development stages in a rotation period of radiata pine. A total of 6,389 high quality ESTs were collected from 5,952 cDNA clones. Assembly of 5,952 ESTs from 5' end sequences generated 3,304 unigenes including 952 contigs and 2,352 singletons. About 97.0% of the 5,952 ESTs and 96.1% of the unigenes have matches in the UniProt and TIGR databases. Of the 3,174 unigenes with matches, 42.9% were not assigned GO (Gene Ontology) terms and their functions are unknown or unclassified. More than half (52.1%) of the 5,952 ESTs have matches in the Pfam database and represent 772 known protein families. About 18.0% of the 5,952 ESTs matched cell wall related genes in the MAIZEWALL database, representing all 18 categories, 91 of all 174 families and possibly 557 genes. Fifteen cell wall-related genes are ranked in the 30 most abundant genes, including CesA, tubulin, AGP, SAMS, actin, laccase, CCoAMT, MetE, phytocyanin, pectate lyase, cellulase, SuSy, expansin, chitinase and UDP-glucose dehydrogenase. Based on the PlantTFDB database 41 of the 64 transcription factor families in the poplar genome were identified as being involved in radiata pine wood formation. Comparative analysis of GO term abundance revealed a distinct transcriptome in juvenile earlywood formation compared to other stages of wood development. Conclusion The first large scale genomic resource in radiata pine was generated from six developing xylem cDNA libraries. Cell wall-related genes and transcription factors were identified. Juvenile earlywood has a distinct transcriptome, which is likely to contribute to the undesirable properties of juvenile wood in radiata pine. The publicly available resource of radiata pine will also be valuable for gene function studies and comparative genomics in forest trees. PMID:19159482
Qin, Xiaobo; Lin, Fanrong; Lii, Yifan; Gou, Chunbao; Chen, Fang
2011-03-01
A cDNA clone designated arf1 was isolated from a physic nut (Jatropha curcas L.) endosperm cDNA library which encodes a small GTP-binding protein and has significant homology to ADP-ribosylation factors (ARF) in plants, animals and microbes. The cDNA contains an open reading frame that encodes a polypeptide of 181 amino acids with a calculated molecular mass of 20.7 kDa. The deduced amino acid sequence showed high homology to known ARFs from other organisms. The products of the arf1 obtained by overexpression in E. coli revealed the specific binding activity toward GTP. The expression of arf1 was observed in flowers, roots, stems and leaves as analyzed by RT-PCR, and its transcriptional level was highest in flowers. In particular, the accumulation of arf1 transcripts was different under various environmental stresses in seedlings. The results suggest that arf1 plays distinct physiological roles in Jatropha curcas cells.
A Plastidial Lysophosphatidic Acid Acyltransferase from Oilseed Rape1
Bourgis, Fabienne; Kader, Jean-Claude; Barret, Pierre; Renard, Michel; Robinson, David; Robinson, Colin; Delseny, Michel; Roscoe, Thomas J.
1999-01-01
The biosynthesis of phosphatidic acid, a key intermediate in the biosynthesis of lipids, is controlled by lysophosphatidic acid (LPA, or 1-acyl-glycerol-3-P) acyltransferase (LPAAT, EC 2.3.1.51). We have isolated a cDNA encoding a novel LPAAT by functional complementation of the Escherichia coli mutant plsC with an immature embryo cDNA library of oilseed rape (Brassica napus). Transformation of the acyltransferase-deficient E. coli strain JC201 with the cDNA sequence BAT2 alleviated the temperature-sensitive phenotype of the plsC mutant and conferred a palmitoyl-coenzyme A-preferring acyltransferase activity to membrane fractions. The BAT2 cDNA encoded a protein of 351 amino acids with a predicted molecular mass of 38 kD and an isoelectric point of 9.7. Chloroplast-import experiments showed processing of a BAT2 precursor protein to a mature protein of approximately 32 kD, which was localized in the membrane fraction. BAT2 is encoded by a minimum of two genes that may be expressed ubiquitously. These data are consistent with the identity of BAT2 as the plastidial enzyme of the prokaryotic glycerol-3-P pathway that uses a palmitoyl-ACP to produce phosphatidic acid with a prokaryotic-type acyl composition. The homologies between the deduced protein sequence of BAT2 with prokaryotic and eukaryotic microsomal LAP acytransferases suggest that seed microsomal forms may have evolved from the plastidial enzyme. PMID:10398728
NASA Technical Reports Server (NTRS)
Balcer-Kubiczek, E. K.; Meltzer, S. J.; Han, L. H.; Zhang, X. F.; Shi, Z. M.; Harrison, G. H.; Abraham, J. M.
1997-01-01
A novel polymerase chain reaction (PCR)-based method was used to identify candidate genes whose expression is altered in cancer cells by ionizing radiation. Transcriptional induction of randomly selected genes in control versus irradiated human HL60 cells was compared. Among several complementary DNA (cDNA) clones recovered by this approach, one cDNA clone (CL68-5) was downregulated in X-irradiated HL60 cells but unaffected by 12-O-tetradecanoyl phorbol-13-acetate, forskolin, or cyclosporin-A. DNA sequencing of the CL68-5 cDNA revealed 100% nucleotide sequence homology to the reported human Csa-19 gene. Northern blot analysis of RNA from control and irradiated cells revealed the expression of a single 0.7-kilobase (kb) messenger RNA (mRNA) transcript. This 0.7-kb Csa-19 mRNA transcript was also expressed in a variety of human adult and corresponding fetal normal tissues. Moreover, when the effect of X- or fission neutron-irradiation on Csa-19 mRNA was compared in cultured human cells differing in p53 gene status (p53-/- versus p53+/+), downregulation of Csa-19 by X-rays or fission neutrons was similar in p53-wild type and p53-null cell lines. Our results provide the first known example of a radiation-responsive gene in human cancer cells whose expression is not associated with p53, adenylate cyclase or protein kinase C.
2014-06-12
Transcriptome, Hydroides elegans, Next Generation Sequencing, Illumina HiSeq, PacBio SMRT, Biofilm , Metamorphosis 16. SECURITY CLASSIFICATION OF: a...to a bacterial cue from a bacterial biofilm . Recently, this cue has been identified to be a phage-tail like bacteriocin produced by the bacterium...submitted to the Huntsman Cancer Institute at the University of Utah and the subsequent isolation of mRNA was used for Illumina HiSeq 101 paired end
Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics
The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).
Xu, Ting; Xie, Jiasong; Li, Jianming; Luo, Ming; Ye, Shigen; Wu, Xinzhong
2012-06-01
A SMARTer™ cDNA library of hemocyte from Rickettsia-like organism (RLO) challenged oyster, Crassostrea ariakensis Gould was constructed. Random clones (400) were selected and single-pass sequenced, resulted in 200 unique sequences containing 96 known genes and 104 unknown genes. The 96 known genes were categorized into 11 groups based on their biological process. Furthermore, we identified and characterized three complement-related fragments (CaC1q1, CaC1q2 and CaC3). Tissue distribution analysis revealed that all of three fragments were ubiquitously expressed in all tissues studied including hemocyte, gills, mantle, digestive glands, gonads and adductor muscle, while the highest level was seen in the hemocyte. Temporal expression profile in the hemocyte monolayers reveled that the mRNA expression levels of three fragments presented huge increase after the RLO incubation at 3 h and 6 h in post-challenge, respectively. And the maximal expression levels at 3 h in post-challenge are about 256, 104 and 64 times higher than the values detected in the control of CaC1q1, CaC1q2 and CaC3, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.
[Screening and identification of anoikis-resistant gene UBCH7 in esophageal cancer cells].
Yang, Yang; Wang, Bo-Shi; Wang, Xiao-Min; Zhang, Yu; Wang, Ming-Rong; Jia, Xue-Mei
2012-02-01
Anoikis is a kind of programmed cell death induced by loss of extracellular matrix (ECM) adhesion, which is one of key factors for homestasis. Resistance to anoikis is required for tumor cell metastasis. We have previously shown several anoikis-resistance genes in esophageal squamous cell carcinoma (ESCC). In order to find novel anoikis-resistant genes in ESCC, we constructed retroviral cDNA library using total RNA from ESCC cell lines. NIH 3T3 cells, which are sensitive to anoikis, were infected with the library constructed. The cells were cultured in soft agar, and the clones which can survive in detached states were selected. The cDNAs inserted into the anoikis-resistant NIH3T3 clones were amplified using retroviral specific primers. Sequencing analysis showed that a cDNA fragment inserted into the anoikis-resistant clone contains full coding sequence (ORF) of human UBCH7/UBE2L3 gene. By infection with retrovirus encoding UBCH7 ORF (pMSCV-UBCH7), forced expression of UBCH7 increased the anoikis-resistance of NIH3T3 cells. More importantly, knockdown of UBCH7 expression by siRNA transfection reduced the anoikis-resistant ability of esophageal cancer MLuC1 cells. The data suggest that UBCH7/UBE2L3 gene would be involved in anoikis-resistance in ESCC.
Candidate gene database and transcript map for peach, a model species for fruit trees.
Horn, Renate; Lecouls, Anne-Claire; Callahan, Ann; Dandekar, Abhaya; Garay, Lilibeth; McCord, Per; Howad, Werner; Chan, Helen; Verde, Ignazio; Main, Doreen; Jung, Sook; Georgi, Laura; Forrest, Sam; Mook, Jennifer; Zhebentyayeva, Tatyana; Yu, Yeisoo; Kim, Hye Ran; Jesudurai, Christopher; Sosinski, Bryon; Arús, Pere; Baird, Vance; Parfitt, Dan; Reighard, Gregory; Scorza, Ralph; Tomkins, Jeffrey; Wing, Rod; Abbott, Albert Glenn
2005-05-01
Peach (Prunus persica) is a model species for the Rosaceae, which includes a number of economically important fruit tree species. To develop an extensive Prunus expressed sequence tag (EST) database for identifying and cloning the genes important to fruit and tree development, we generated 9,984 high-quality ESTs from a peach cDNA library of developing fruit mesocarp. After assembly and annotation, a putative peach unigene set consisting of 3,842 ESTs was defined. Gene ontology (GO) classification was assigned based on the annotation of the single "best hit" match against the Swiss-Prot database. No significant homology could be found in the GenBank nr databases for 24.3% of the sequences. Using core markers from the general Prunus genetic map, we anchored bacterial artificial chromosome (BAC) clones on the genetic map, thereby providing a framework for the construction of a physical and transcript map. A transcript map was developed by hybridizing 1,236 ESTs from the putative peach unigene set and an additional 68 peach cDNA clones against the peach BAC library. Hybridizing ESTs to genetically anchored BACs immediately localized 11.2% of the ESTs on the genetic map. ESTs showed a clustering of expressed genes in defined regions of the linkage groups. [The data were built into a regularly updated Genome Database for Rosaceae (GDR), available at (http://www.genome.clemson.edu/gdr/).].
Parvari, R; Avivi, A; Lentner, F; Ziv, E; Tel-Or, S; Burstein, Y; Schechter, I
1988-03-01
cDNA clones encoding the variable and constant regions of chicken immunoglobulin (Ig) gamma-chains were obtained from spleen cDNA libraries. Southern blots of kidney DNA show that the variable region sequences of eight cDNA clones reveal the same set of bands corresponding to approximately 30 cross-hybridizing VH genes of one subgroup. Since the VH clones were randomly selected, it is likely that the bulk of chicken H-chains are encoded by a single VH subgroup. Nucleotide sequence determinations of two cDNA clones reveal VH, D, JH and the constant region. The VH segments are closely related to each other (83% homology) as expected for VH or the same subgroup. The JHs are 15 residues long and differ by one amino acid. The Ds differ markedly in sequence (20% homology) and size (10 and 20 residues). These findings strongly indicate multiple (at least two) D genes which by a combinatorial joining mechanism diversify the H-chains, a mechanism which is not operative in the chicken L-chain locus. The most notable among the chicken Igs is the so-called 7S IgG because its H-chain differs in many important aspects from any mammalian IgG. The sequence of the C gamma cDNA reported here resolves this issue. The chicken C gamma is 426 residues long with four CH domains (unlike mammalian C gamma which has three CH domains) and it shows 25% homology to the chicken C mu. The chicken C gamma is most related to the mammalian C epsilon in length, the presence of four CH domains and the distribution of cysteines in the CH1 and CH2 domains. We propose that the unique chicken C gamma is the ancestor of the mammalian C epsilon and C gamma subclasses, and discuss the evolution of the H-chain locus from that of chicken with presumably three genes (mu, gamma, alpha) to the mammalian loci with 8-10 H-chain genes.
Liu, Qian; Xu, Xue-Nian; Zhou, Yan; Cheng, Na; Dong, Yu-Ting; Zheng, Hua-Jun; Zhu, Yong-Qiang; Zhu, Yong-Qiang
2013-08-01
To find and clone new antigen genes from the lambda-ZAP cDNA expression library of adult Clonorchis sinensis, and determine the immunological characteristics of the recombinant proteins. The cDNA expression library of adult C. sinensis was screened by pooled sera of clonorchiasis patients. The sequences of the positive phage clones were compared with the sequences in EST database, and the full-length sequence of the gene (Cs22 gene) was obtained by RT-PCR. cDNA fragments containing 2 and 3 times tandem repeat sequences were generated by jumping PCR. The sequence encoding the mature peptide or the tandem repeat sequence was respectively cloned into the prokaryotic expression vector pET28a (+), and then transformed into E. coli Rosetta DE3 cells for expression. The recombinant proteins (rCs22-2r, rCs22-3r, rCs22M-2r, and rCs22M-3r) were purified by His-bind-resin (Ni-NTA) affinity chromatography. The immunogenicity of rCs22-2r and rCs22-3r was identified by ELISA. To evaluate the immunological diagnostic value of rCs22-2r and rCs22-3r, serum samples from 35 clonorchiasis patients, 31 healthy individuals, 15 schistosomiasis patients, 15 paragonimiasis westermani patients and 13 cysticercosis patients were examined by ELISA. To locate antigenic determinants, the pooled sera of clonorchiasis patients and healthy persons were analyzed for specific antibodies by ELISA with recombinant protein rCs22M-2r and rCs22M-3r containing the tandem repeat sequences. The full-length sequence of Cs22 antigen gene of C. sinensis was obtained. It contained 13 times tandem repeat sequences of EQQDGDEEGMGGDGGRGKEKGKVEGEDGAGEQKEQA. Bioinformatics analysis indicated that the protein (Cs22) belonged to GPI-anchored proteins family. The recombinant proteins rCs22-2r and rCs22-3r showed a certain level of immunogenicity. The positive rate by ELISA coated with the purified PrCs22-2r and PrCs22-3r for sera of clonorchiasis patients both were 45.7% (16/35), and 3.2% (1/31) for those of healthy persons. There was no cross reaction with sera of schistosomiasis and cysticercosis patients. The cross reaction with sera of paragonimiasis westermani patients was 1/15. The recombinant proteins rCs22M-2r and rCs22M-3r which only contained tandem repeats were specifically recognized by pooled sera of clonorchiasis patients. The Cs22 antigen gene of Clonorchis sinensis is obtained, and the recombinant proteins have certain diagnostic value. The antigenic determinant is located in tandem repeat sequences.
Bown, David P; Gatehouse, John A
2004-05-01
Carboxypeptidases were purified from guts of larvae of corn earworm (Helicoverpa armigera), a lepidopteran crop pest, by affinity chromatography on immobilized potato carboxypeptidase inhibitor, and characterized by N-terminal sequencing. A larval gut cDNA library was screened using probes based on these protein sequences. cDNA HaCA42 encoded a carboxypeptidase with sequence similarity to enzymes of clan MC [Barrett, A. J., Rawlings, N. D. & Woessner, J. F. (1998) Handbook of Proteolytic Enzymes. Academic Press, London.], but with a novel predicted specificity towards C-terminal acidic residues. This carboxypeptidase was expressed as a recombinant proprotein in the yeast Pichia pastoris. The expressed protein could be activated by treatment with bovine trypsin; degradation of bound pro-region, rather than cleavage of pro-region from mature protein, was the rate-limiting step in activation. Activated HaCA42 carboxypeptidase hydrolysed a synthetic substrate for glutamate carboxypeptidases (FAEE, C-terminal Glu), but did not hydrolyse substrates for carboxypeptidase A or B (FAPP or FAAK, C-terminal Phe or Lys) or methotrexate, cleaved by clan MH glutamate carboxypeptidases. The enzyme was highly specific for C-terminal glutamate in peptide substrates, with slow hydrolysis of C-terminal aspartate also observed. Glutamate carboxypeptidase activity was present in larval gut extract from H. armigera. The HaCA42 protein is the first glutamate-specific metallocarboxypeptidase from clan MC to be identified and characterized. The genome of Drosophila melanogaster contains genes encoding enzymes with similar sequences and predicted specificity, and a cDNA encoding a similar enzyme has been isolated from gut tissue in tsetse fly. We suggest that digestive carboxypeptidases with sequence similarity to the classical mammalian enzymes, but with specificity towards C-terminal glutamate, are widely distributed in insects.
Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Fariss, Robert N; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine
2002-06-15
The retinal pigment epithelium (RPE) and choroid comprise a functional unit of the eye that is essential to normal retinal health and function. Here we describe expressed sequence tag (EST) analysis of human RPE/choroid as part of a project for ocular bioinformatics. A cDNA library (cs) was made from human RPE/choroid and sequenced. Data were analyzed and assembled using the program GRIST (GRouping and Identification of Sequence Tags). Complete sequencing, Northern and Western blots, RH mapping, peptide antibody synthesis and immunofluorescence (IF) have been used to examine expression patterns and genome location for selected transcripts and proteins. Ten thousand individual sequence reads yield over 6300 unique gene clusters of which almost half have no matches with named genes. One of the most abundant transcripts is from a gene (named "alpha") that maps to the BBS1 region of chromosome 11. A number of tissue preferred transcripts are common to both RPE/choroid and iris. These include oculoglycan/opticin, for which an alternative splice form is detected in RPE/choroid, and "oculospanin" (Ocsp), a novel tetraspanin that maps to chromosome 17q. Antiserum to Ocsp detects expression in RPE, iris, ciliary body, and retinal ganglion cells by IF. A newly identified gene for a zinc-finger protein (TIRC) maps to 19q13.4. Variant transcripts of several genes were also detected. Most notably, the predominant form of Bestrophin represented in cs contains a longer open reading frame as a result of splice junction skipping. The unamplified cs library gives a view of the transcriptional repertoire of the adult RPE/choroid. A large number of potentially novel genes and splice forms and candidates for genetic diseases are revealed. Clones from this collection are being included in a large, nonredundant set for cDNA microarray construction.
Ulvsbäck, M; Lindström, C; Weiber, H; Abrahamsson, P A; Lilja, H; Lundwall, A
1989-11-15
In order to study the gene expression of the seminal plasma protein beta-microseminoprotein, also known as PSP94 and beta-inhibin, clones encoding this protein were isolated from a cDNA library constructed in lambda gt11. Nucleotide sequencing confirmed the structure of a previously cloned cDNA. By northern blot analysis identical sized transcripts were demonstrated in the prostate, the respiratory (tracheal, bronchial and lung) tissues and the antrum part of the gastric mucosa. Thus, the protein is not primarily associated with male reproductive function. Although probably of no physiological significance, a slight structural similarity to the ovarian inhibin beta-chains was identified in the C-terminal half of the molecule.
Using Phage Display to Create Recombinant Antibodies.
Dasch, James R; Dasch, Amy L
2017-09-01
A variety of phage display technologies have been developed since the approach was first described for antibodies. The most widely used approaches incorporate antibody sequences into the minor coat protein pIII of the nonlytic filamentous phage fd or M13. Libraries of variable gene sequences, encoding either scFv or Fab fragments, are made by incorporating sequences into phagemid vectors. The phagemid is packaged into phage particles with the assistance of a helper phage to produce the antibody display phage. This protocol describes a method for creating a phagemid library. The multiple cloning site (MCS) of the pBluescript KS(-) phagemid vector is replaced by digestion with the restriction enzyme BssHII, followed by the insertion of four overlapping oligonucleotides to create a new MCS within the vector. Next, the 3' portion of gene III (from M13mp18) is amplified and combined with an antibody sequence using overlap extension PCR. This product is inserted into the phagemid vector to create pPDS. Two helper plasmids are also created from the modified pBluescript vector: pLINK provides the linker between the heavy and light chains, and pFABC provides the CH1 domain of the heavy chain. An antibody cDNA library is constructed from the RNA of interest and ligated into pPDS. The phagemid library is electroporated into Escherichia coli cells along with the VCS-M13 helper phage. © 2017 Cold Spring Harbor Laboratory Press.
Jochim, Ryan C; Teixeira, Clarissa R; Laughinghouse, Andre; Mu, Jianbing; Oliveira, Fabiano; Gomes, Regis B; Elnaiem, Dia-Eldin; Valenzuela, Jesus G
2008-01-14
In the life cycle of Leishmania within the alimentary canal of sand flies the parasites have to survive the hostile environment of blood meal digestion, escape the blood bolus and attach to the midgut epithelium before differentiating into the infective metacyclic stages. The molecular interactions between the Leishmania parasites and the gut of the sand fly are poorly understood. In the present work we sequenced five cDNA libraries constructed from midgut tissue from the sand fly Lutzomyia longipalpis and analyzed the transcripts present following sugar feeding, blood feeding and after the blood meal has been processed and excreted, both in the presence and absence of Leishmania infantum chagasi. Comparative analysis of the transcripts from sugar-fed and blood-fed cDNA libraries resulted in the identification of transcripts differentially expressed during blood feeding. This included upregulated transcripts such as four distinct microvillar-like proteins (LuloMVP1, 2, 4 and 5), two peritrophin like proteins, a trypsin like protein (Lltryp1), two chymotrypsin like proteins (LuloChym1A and 2) and an unknown protein. Downregulated transcripts by blood feeding were a microvillar-like protein (LuloMVP3), a trypsin like protein (Lltryp2) and an astacin-like metalloprotease (LuloAstacin). Furthermore, a comparative analysis between blood-fed and Leishmania infected midgut cDNA libraries resulted in the identification of the transcripts that were differentially expressed due to the presence of Leishmania in the gut of the sand fly. This included down regulated transcripts such as four microvillar-like proteins (LuloMVP1,2, 4 and 5), a Chymotrypsin (LuloChym1A) and a carboxypeptidase (LuloCpepA1), among others. Upregulated midgut transcripts in the presence of Leishmania were a peritrophin like protein (LuloPer1), a trypsin-like protein (Lltryp2) and an unknown protein. This transcriptome analysis represents the largest set of sequence data reported from a specific sand fly tissue and provides further information of the transcripts present in the sand fly Lutzomyia longipalpis. This analysis provides the detailed information of molecules present in the midgut of this sand fly and the transcripts potentially modulated by blood feeding and by the presence of the Leishmania parasite. More importantly, this analysis suggests that Leishmania infantum chagasi alters the expression profile of certain midgut transcripts in the sand fly during blood meal digestion and that this modulation may be relevant for the survival and establishment of the parasite in the gut of the fly. Moreover, this analysis suggests that these changes may be occurring during the digestion of the blood meal and not afterwards.
Baird, Fiona J; Su, Xiaopei; Aibinu, Ibukun; Nolan, Matthew J; Sugiyama, Hiromu; Otranto, Domenico; Lopata, Andreas L; Cantacessi, Cinzia
2016-07-01
Food-borne nematodes of the genus Anisakis are responsible for a wide range of illnesses (= anisakiasis), from self-limiting gastrointestinal forms to severe systemic allergic reactions, which are often misdiagnosed and under-reported. In order to enhance and refine current diagnostic tools for anisakiasis, knowledge of the whole spectrum of parasite molecules transcribed and expressed by this parasite, including those acting as potential allergens, is necessary. In this study, we employ high-throughput (Illumina) sequencing and bioinformatics to characterise the transcriptomes of two Anisakis species, A. simplex and A. pegreffii, and utilize this resource to compile lists of potential allergens from these parasites. A total of ~65,000,000 reads were generated from cDNA libraries for each species, and assembled into ~34,000 transcripts (= Unigenes); ~18,000 peptides were predicted from each cDNA library and classified based on homology searches, protein motifs and gene ontology and biological pathway mapping. Using comparative analyses with sequence data available in public databases, 36 (A. simplex) and 29 (A. pegreffii) putative allergens were identified, including sequences encoding 'novel' Anisakis allergenic proteins (i.e. cyclophilins and ABA-1 domain containing proteins). This study represents a first step towards providing the research community with a curated dataset to use as a molecular resource for future investigations of the biology of Anisakis, including molecules putatively acting as allergens, using functional genomics, proteomics and immunological tools. Ultimately, an improved knowledge of the biological functions of these molecules in the parasite, as well as of their immunogenic properties, will assist the development of comprehensive, reliable and robust diagnostic tools.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jensen, B.A.; Hahn, M.E.
1995-12-31
The aryl hydrocarbon receptor (AhR) mediates the effects of many common and potentially toxic organic hydrocarbons, including some polychlorinated biphenyls and dioxins. Since small cetaceans often inhabit industrially polluted coastal waters, comparison of the molecular structure and function of this protein in cetaeans with other marine and mammalian species is important for evaluating the sensitivity of cetaceans to these pollutants. An AhR protein has been identified in beluga liver by photoaffinity labeling. In the present study, the authors sought to clone and sequence an AhR cDNA from beluga as a prelude to studying its structure and function, using reverse-transcription polymerasemore » chain reaction (RT-PCR) and degenerate primers, a 515 base pair fragment was amplified, cloned and sequenced, revealing homology to the PAS domain (ligand binding and dimerization region) of AhRs from terrestrial mammals. This portion of the putative beluga AhR has 82% amino acid and 81% nucleotide sequence identity to the mouse AhR, and 63% amino acid and 64% nucleotide sequence identity to an AhR from the marine fish Fundulus heteroclitus. A beluga cDNA library was synthesized and is currently being screened with the PCR-generated fragment to obtain the complete coding sequence. This is the first molecular evidence of AhR presence in cetaceans.« less
ORF phage display to identify cellular proteins with different functions.
Li, Wei
2012-09-01
Open reading frame (ORF) phage display is a new branch of phage display aimed at improving its efficiency to identify cellular proteins with specific binding or functional activities. Despite the success of phage display with antibody libraries and random peptide libraries, phage display with cDNA libraries of cellular proteins identifies a high percentage of non-ORF clones encoding unnatural short peptides with minimal biological implications. This is mainly because of the uncontrollable reading frames of cellular proteins in conventional cDNA libraries. ORF phage display solves this problem by eliminating non-ORF clones to generate ORF cDNA libraries. Here I summarize the procedures of ORF phage display, discuss the factors influencing its efficiency, present examples of its versatile applications, and highlight evidence of its capability of identifying biologically relevant cellular proteins. ORF phage display coupled with different selection strategies is capable of delineating diverse functions of cellular proteins with unique advantages. Copyright © 2012 Elsevier Inc. All rights reserved.
Takeuchi, Y; Yoshikawa, M; Takeba, G; Tanaka, K; Shibata, D; Horino, O
1990-06-01
Soybean (Glycine max) beta-1,3-endoglucanase (EC 3.2. 1.39) is involved in one of the earliest plant-pathogen interactions that may lead to active disease resistance by releasing elicitor-active carbohydrates from the cell walls of fungal pathogens. Ethylene induced beta-1,3-endoglucanase activity to 2- to 3-fold higher levels in cotyledons of soybean seedlings. A specific polyclonal antiserum raised against purified soybean beta-1,3-endoglucanase was used to immunoprecipitate in vitro translation products, demonstrating that ethylene induction increased translatable beta-1,3-endoglucanase mRNA. Several cDNA clones for the endoglucanase gene were obtained by antibody screening of a lambda-gt11 expression library prepared from soybean cotyledons. Hybrid-select translation experiments indicated that the cloned cDNA encoded a 36-kilodalton precursor protein product that was specifically immunoprecipitated with beta-1,3-endoglucanase antiserum. Escherichia coli cells expressing the cloned cDNA also synthesized an immunologically positive protein. Nucleotide sequence of three independent clones revealed a single uninterrupted open reading frame of 1041 nucleotides, corresponding to a polypeptide of 347 residue long. The primary amino acid sequence of beta-1,3-endoglucanase as deduced from the nucleotide sequence was confirmed by direct amino acid sequencing of trypsin digests of the glucanase. The soybean beta-1,3-endoglucanase exhibited 53% amino acid homology to a beta-1,3-glucanase cloned from cultured tobacco cells and 48% homology to a beta-(1,3-1,4)-glucanase from barley. Utilizing the largest cloned cDNA (pEG488) as a hybridization probe, it was found that the increase in translatable beta-1,3-endoglucanase mRNA seen upon ethylene treatment of soybean seedlings was due to 50- to 100-fold increase in steady state mRNA levels, indicating that ethylene regulates gene expression of this enzyme important in disease resistance at the level of gene transcription.
Wei, Hong-Ying; Huang, Sheng; Wang, Jiang-Yong; Gao, Fang; Jiang, Jing-Zhe
2018-03-01
The emergence and widespread use of high-throughput sequencing technologies have promoted metagenomic studies on environmental or animal samples. Library construction for metagenome sequencing and annotation of the produced sequence reads are important steps in such studies and influence the quality of metagenomic data. In this study, we collected some marine mollusk samples, such as Crassostrea hongkongensis, Chlamys farreri, and Ruditapes philippinarum, from coastal areas in South China. These samples were divided into two batches to compare two library construction methods for shellfish viral metagenome. Our analysis showed that reverse-transcribing RNA into cDNA and then amplifying it simultaneously with DNA by whole genome amplification (WGA) yielded a larger amount of DNA compared to using only WGA or WTA (whole transcriptome amplification). Moreover, higher quality libraries were obtained by agarose gel extraction rather than with AMPure bead size selection. However, the latter can also provide good results if combined with the adjustment of the filter parameters. This, together with its simplicity, makes it a viable alternative. Finally, we compared three annotation tools (BLAST, DIAMOND, and Taxonomer) and two reference databases (NCBI's NR and Uniprot's Uniref). Considering the limitations of computing resources and data transfer speed, we propose the use of DIAMOND with Uniref for annotating metagenomic short reads as its running speed can guarantee a good annotation rate. This study may serve as a useful reference for selecting methods for Shellfish viral metagenome library construction and read annotation.
Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C
1987-01-01
Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene. Images PMID:2825184
Yi, S Y; Yu, S H; Choi, D
1999-06-30
Recent reports revealed that catalase has a role in the plant defense mechanism against a broad range of pathogens through being inhibited by salicylic acid (SA). During an effort to clone disease resistance-responsive genes, a cDNA encoding catalase (Ngcat1; Nicotiana glutinosa cat1) was isolated from a tobacco cDNA library. In N. glutinosa, catalase is encoded by a small gene family. The deduced amino acid sequence of the Ngcat1 cDNA has 98% homology with the cat1 gene of N. plumbaginifolia. The Ngcat1 expression is controlled by the circadian clock, and its mRNA level is the most abundant in leaves. Both the expression of Ngcat1 mRNA and its enzyme activity in the tobacco plant undergoing a hypersensitive response (HR) to TMV infection were repressed. The repression of the mRNA level was also observed following treatment with SA. These results imply that SA may act as an inhibitor of catalase transcription during the HR of tobacco. Cloning and expression of the Ngcat1 in tobacco following pathogen infection and SA treatment are presented.
Brzeziński, K; Janowski, R; Podkowiński, J; Jaskólski, M
2001-01-01
The coding sequences of two S-adenosyl-L-homocysteine hydrolases (SAHases) were identified in yellow lupine by screenig of a cDNA library. One of them, corresponding to the complete protein, was sequenced and compared with 52 other SAHase sequences. Phylogenetic analysis of these proteins identified three groups of the enzymes. Group A comprises only bacterial sequences. Group B is subdivided into two subgroups, one of which (B1) is formed by animal sequences. Subgroup B2 consist of two distinct clusters, B2a and B2b. Cluster B2b comprises all known plant sequences, including the yellow lupine enzyme, which are distinguished by a 50-residue insert. Group C is heterogeneous and contains SAHases from Archaea as well as a new class of animal enzymes, distinctly different from those in group B1.
DOE Office of Scientific and Technical Information (OSTI.GOV)
White, D.A.; Zilinskas, B.A.
1991-08-01
The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less
Tome, Jacob M; Ozer, Abdullah; Pagano, John M; Gheba, Dan; Schroth, Gary P; Lis, John T
2014-06-01
RNA-protein interactions play critical roles in gene regulation, but methods to quantitatively analyze these interactions at a large scale are lacking. We have developed a high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay by adapting a high-throughput DNA sequencer to quantify the binding of fluorescently labeled protein to millions of RNAs anchored to sequenced cDNA templates. Using HiTS-RAP, we measured the affinity of mutagenized libraries of GFP-binding and NELF-E-binding aptamers to their respective targets and identified critical regions of interaction. Mutations additively affected the affinity of the NELF-E-binding aptamer, whose interaction depended mainly on a single-stranded RNA motif, but not that of the GFP aptamer, whose interaction depended primarily on secondary structure.
Update of the Diatom EST Database: a new tool for digital transcriptomics
Maheswari, Uma; Mock, Thomas; Armbrust, E. Virginia; Bowler, Chris
2009-01-01
The Diatom Expressed Sequence Tag (EST) Database was constructed to provide integral access to ESTs from these ecologically and evolutionarily interesting microalgae. It has now been updated with 130 000 Phaeodactylum tricornutum ESTs from 16 cDNA libraries and 77 000 Thalassiosira pseudonana ESTs from seven libraries, derived from cells grown in different nutrient and stress regimes. The updated relational database incorporates results from statistical analyses such as log-likelihood ratios and hierarchical clustering, which help to identify differentially expressed genes under different conditions, and allow similarities in gene expression in different libraries to be investigated in a functional context. The database also incorporates links to the recently sequenced genomes of P. tricornutum and T. pseudonana, enabling an easy cross-talk between the expression pattern of diatom orthologs and the genome browsers. These improvements will facilitate exploration of diatom responses to conditions of ecological relevance and will aid gene function identification of diatom-specific genes and in silico gene prediction in this largely unexplored class of eukaryotes. The updated Diatom EST Database is available at http://www.biologie.ens.fr/diatomics/EST3. PMID:19029140
Gomulski, Ludvik M; Dimopoulos, George; Xi, Zhiyong; Soares, Marcelo B; Bonaldo, Maria F; Malacrida, Anna R; Gasperi, Giuliano
2008-01-01
Background The medfly, Ceratitis capitata, is a highly invasive agricultural pest that has become a model insect for the development of biological control programs. Despite research into the behavior and classical and population genetics of this organism, the quantity of sequence data available is limited. We have utilized an expressed sequence tag (EST) approach to obtain detailed information on transcriptome signatures that relate to a variety of physiological systems in the medfly; this information emphasizes on reproduction, sex determination, and chemosensory perception, since the study was based on normalized cDNA libraries from embryos and adult heads. Results A total of 21,253 high-quality ESTs were obtained from the embryo and head libraries. Clustering analyses performed separately for each library resulted in 5201 embryo and 6684 head transcripts. Considering an estimated 19% overlap in the transcriptomes of the two libraries, they represent about 9614 unique transcripts involved in a wide range of biological processes and molecular functions. Of particular interest are the sequences that share homology with Drosophila genes involved in sex determination, olfaction, and reproductive behavior. The medfly transformer2 (tra2) homolog was identified among the embryonic sequences, and its genomic organization and expression were characterized. Conclusion The sequences obtained in this study represent the first major dataset of expressed genes in a tephritid species of agricultural importance. This resource provides essential information to support the investigation of numerous questions regarding the biology of the medfly and other related species and also constitutes an invaluable tool for the annotation of complete genome sequences. Our study has revealed intriguing findings regarding the transcript regulation of tra2 and other sex determination genes, as well as insights into the comparative genomics of genes implicated in chemosensory reception and reproduction. PMID:18500975
Generation and Analysis of Expressed Sequence Tags from Olea europaea L.
Ozdemir Ozgenturk, Nehir; Oruç, Fatma; Sezerman, Ugur; Kuçukural, Alper; Vural Korkut, Senay; Toksoz, Feriha; Un, Cemal
2010-01-01
Olive (Olea europaea L.) is an important source of edible oil which was originated in Near-East region. In this study, two cDNA libraries were constructed from young olive leaves and immature olive fruits for generation of ESTs to discover the novel genes and search the function of unknown genes of olive. The randomly selected 3840 colonies were sequenced for EST collection from both libraries. Readable 2228 sequences for olive leaf and 1506 sequences for olive fruit were assembled into 205 and 69 contigs, respectively, whereas 2478 were singletons. Putative functions of all 2752 differentially expressed unique sequences were designated by gene homology based on BLAST and annotated using BLAST2GO. While 1339 ESTs show no homology to the database, 2024 ESTs have homology (under 80%) with hypothetical proteins, putative proteins, expressed proteins, and unknown proteins in NCBI-GenBank. 635 EST's unique genes sequence have been identified by over 80% homology to known function in other species which were not previously described in Olea family. Only 3.1% of total EST's was shown similarity with olive database existing in NCBI. This generated EST's data and consensus sequences were submitted to NCBI as valuable source for functional genome studies of olive. PMID:21197085
An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl desaturase homolog
DOE Office of Scientific and Technical Information (OSTI.GOV)
Van De Loo, F.J.; Broun, P.; Turner, S.
1995-07-18
Recent spectroscopic evidence implicating a binuclear iron site at the reaction center of fatty acyl desaturases suggested to us that certain fatty acyl hydroxylases may share significant amino acid sequence similarity with desaturases. To test this theory, we prepared a cDNA library from developing endosperm of the castor-oil plant (Ricinus communis L.) and obtained partial nucleotide sequences for 468 anonymous clones that were not expressed at high levels in leaves, a tissue deficient in 12-hydroxyoleic acid. This resulted in the identification of several cDNA clones encoding a polypeptide of 387 amino acids with a predicted molecular weight of 44,407 andmore » with {approx}67% sequence homology to microsomal oleate desaturase from Arabidopsis. Expression of a full-length clone under control of the cauliflower mosaic virus 35S promoter in transgenic tobacco resulted in the accumulation of low levels of 12-hydroxyoleic acid in seeds, indicating that the clone encodes the castor oleate hydroxylase. These results suggest that fatty acyl desaturases and hydroxylases share similar reaction mechanisms and provide an example of enzyme evolution. 26 refs., 6 figs., 1 tab.« less
Mining the enzymes involved in the detoxification of reactive oxygen species (ROS) in sugarcane.
Kurama, Eiko E; Fenille, Roseli C; Rosa, Vicente E; Rosa, Daniel D; Ulian, Eugenio C
2002-07-01
Summary Adopting the sequencing of expressed sequence tags (ESTs) of a sugarcane database derived from libraries induced and not induced by pathogens, we identified EST clusters homologous to genes corresponding to enzymes involved in the detoxification of reactive oxygen species. The predicted amino acids of these enzymes are superoxide dismutases (SODs), glutathione-S-transferase (GST), glutathione peroxidase (GPX), and catalases. Three MnSOD mitochondrial precursors and 10 CuZnSOD were identified in sugarcane: the MnSOD mitochondrial precursor is 96% similar to the maize MnSOD mitochondrial precursor and, of the 10 CuZnSOD identified, seven were 98% identical to maize cytosolic CuZnSOD4 and one was 67% identical to putative peroxisomal CuZnSOD from Arabidopsis. Three homologues to class Phi GST were 87-88% identical to GST III from maize. Five GPX homologues were identified: three were homologous to cytosolic GPX from barley, one was 88% identical to phospholipid hydroperoxide glutathione peroxidase (PHGPX) from rice, and the last was 71% identical to GPX from A. thaliana. Three enzymes similar to maize catalase were identified in sugarcane: two were similar to catalase isozyme 3 and catalase chain 3 from maize, which are mitochondrial, and one was similar to catalase isozyme 1 from maize, whose location is peroxisomal subcellular. All enzymes were induced in all sugarcane libraries (flower, seed, root, callus, leaves) and also in the pathogen-induced libraries, except for CuZnSOD whose cDNA was detected in none of the libraries induced by pathogens (Acetobacter diazotroficans and Herbaspirillum rubrisubalbicans). The expression of the enzymes SOD, GST, GPX, and catalases involved in the detoxification was examined using reverse transcriptase-polymerase chain reaction in cDNA from leaves of sugarcane under biotic stress conditions, inoculated with Puccinia melanocephala, the causal agent of sugarcane rust disease.
Primary culture of cat intestinal epithelial cells in vitro and the cDNA library construction.
Zhao, Gui Hua; Liu, Ye; Cheng, Yun Tang; Zhao, Qing Song; Qiu, Xiao; Xu, Chao; Xiao, Ting; Zhu, Song; Liu, Gong Zhen; Yin, Kun
2018-06-26
Felids are the only definitive hosts of Toxoplasma gondii. To lay a foundation for screening the T. gondii-felids interaction factors, we have developed a reproducible primary culture method for cat intestinal epithelial cells (IECs). The primary IECs were isolated from a new born cat's small intestine jejunum region without food ingress, and respectively in vitro cultured by tissue cultivation and combined digestion method with collagenase XI and dispase I, then purified by trypsinization. After identification, the ds cDNA of cat IECs was synthesized for constructing pGADT7 homogenization three-frame plasmid, and transformed into the yeast Y187 for generating the cDNA library. Our results indicated that cultivation of primary cat IECs relays on combined digestion to form polarized and confluent monolayers within 3 days with typical features of normal epithelial cells. The purified cells cultured by digestion method were identified to be nature intestinal epithelial cells using immunohistochemical analysis and were able to maintain viability for at least 15 passages. The homogenizable ds cDNA, which is synthesized from the total RNA extracted from our cultured IECs, distributed among 0.5-2.0 kb, and generated satisfying three-frame cDNA library with the capacity of 1.2 × 106 and the titer of 5.2 × 107 pfu/mL. Our results established an optimal method for the culturing and passage of cat IECs model in vitro, and laid a cDNA library foundation for the subsequent interaction factors screening by yeast two-hybrid.
Loit, Evelin; Melnyk, Charles W; MacFarlane, Amanda J; Scott, Fraser W; Altosaar, Illimar
2009-01-01
Background Exposure to dietary wheat proteins in genetically susceptible individuals has been associated with increased risk for the development of Type 1 diabetes (T1D). Recently, a wheat protein encoded by cDNA WP5212 has been shown to be antigenic in mice, rats and humans with autoimmune T1D. To investigate the genomic origin of the identified wheat protein cDNA, a hexaploid wheat genomic library from Glenlea cultivar was screened. Results Three unique wheat globulin genes, Glo-3A, Glo3-B and Glo-3C, were identified. We describe the genomic structure of these genes and their expression pattern in wheat seeds. The Glo-3A gene shared 99% identity with the cDNA of WP5212 at the nucleotide and deduced amino acid level, indicating that we have identified the gene(s) encoding wheat protein WP5212. Southern analysis revealed the presence of multiple copies of Glo-3-like sequences in all wheat samples, including hexaploid, tetraploid and diploid species wheat seed. Aleurone and embryo tissue specificity of WP5212 gene expression, suggested by promoter region analysis, which demonstrated an absence of endosperm specific cis elements, was confirmed by immunofluorescence microscopy using anti-WP5212 antibodies. Conclusion Taken together, the results indicate that a diverse group of globulins exists in wheat, some of which could be associated with the pathogenesis of T1D in some susceptible individuals. These data expand our knowledge of specific wheat globulins and will enable further elucidation of their role in wheat biology and human health. PMID:19615078
Construction and application of EST library from Setaria italica in response to dehydration stress.
Zhang, Jinpeng; Liu, Tingsong; Fu, Junjie; Zhu, Yun; Jia, Jinping; Zheng, Jun; Zhao, Yinhe; Zhang, Ying; Wang, Guoying
2007-07-01
Foxtail millet is a gramineous crop with low water requirement. Despite its high water use efficiency, less attention has been paid to the molecular genetics of foxtail millet. This article reports the construction of subtracted cDNA libraries from foxtail millet seedlings under dehydration stress and the expression profile analysis of 1947 UniESTs from the subtracted cDNA libraries by a cDNA microarray. The results showed that 95 and 57 ESTs were upregulated by dehydration stress, respectively, in roots and shoots of seedlings and that 10 and 27 ESTs were downregulated, respectively, in roots and shoots. The expression profile analysis showed that genes induced in foxtail millet roots were different from those in shoots during dehydration stress and that the early response to dehydration stress in foxtail millet roots was the activation of the glycolysis metabolism. Moreover, protein degradation pathway may also play a pivotal role in drought-tolerant responses of foxtail millet. Finally, Northern blot analysis validated well the cDNA microarray data.
High-throughput sequencing: a failure mode analysis.
Yang, George S; Stott, Jeffery M; Smailus, Duane; Barber, Sarah A; Balasundaram, Miruna; Marra, Marco A; Holt, Robert A
2005-01-04
Basic manufacturing principles are becoming increasingly important in high-throughput sequencing facilities where there is a constant drive to increase quality, increase efficiency, and decrease operating costs. While high-throughput centres report failure rates typically on the order of 10%, the causes of sporadic sequencing failures are seldom analyzed in detail and have not, in the past, been formally reported. Here we report the results of a failure mode analysis of our production sequencing facility based on detailed evaluation of 9,216 ESTs generated from two cDNA libraries. Two categories of failures are described; process-related failures (failures due to equipment or sample handling) and template-related failures (failures that are revealed by close inspection of electropherograms and are likely due to properties of the template DNA sequence itself). Preventative action based on a detailed understanding of failure modes is likely to improve the performance of other production sequencing pipelines.
Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang
2006-05-01
Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.
Travis, G H; Sutcliffe, J G
1988-01-01
To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033
Assignment of the human caltractin gene (CALT) to Xq28 by fluorescence in situ hybridization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanaka, Tanaka; Okui, Keiko; Nakamura, Yusuke
1994-12-01
The centrosome is the major microtubule-organizing center of interphase eukaryotic cells, an its duplication is essential to eukaryotic cell division. Caltractin, a structural component of centrosomes, is highly homologous in amino acid sequence to the product of the CDC31 gene of Saccharomyces cerevisiae. In S. cerevisiae, an important role for CDC31 in duplication of the spindle pole body (SPB), a kind of microtubule-organizing center, has been demonstrated by an experiment in which mutant CDC31 prevented SPB duplication and led to formation of a monopolar spindle. In view of the localization of human caltractin in centrosomes and the sequence homology itmore » bears to yeast CDC31, it is reasonable to assume that caltractin functions in humans as CDC31 does in yeast. As a part of the Human Genome Project, we have been determining nucleotide sequences of DNA clones randomly selected from a directionally cloned cDNA library constructed from fetal brain mRNA obtained from Clontech (La Jolla, CA). By comparing 5{prime} partial DNA sequences of these cDNA clones with known DNA sequences in the database, we found one clone that was highly homologous to the caltractin gene of Chlamydomonas, which turned out to be the same as a human gene identified recently. 4 refs., 1 fig.« less
Differential cDNA cloning by enzymatic degrading subtraction (EDS).
Zeng, J; Gorski, R A; Hamer, D
1994-01-01
We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268
Brulle, Franck; Jeffroy, Fanny; Madec, Stéphanie; Nicolas, Jean-Louis; Paillard, Christine
2012-10-01
The Manila clam, Ruditapes philippinarum, is an economically-important, commercial shellfish; harvests are diminished in some European waters by a pathogenic bacterium, Vibrio tapetis, that causes Brown Ring disease. To identify molecular characteristics associated with susceptibility or resistance to Brown Ring disease, Suppression Subtractive Hybridization (SSH) analyzes were performed to construct cDNA libraries enriched in up- or down-regulated transcripts from clam immune cells, hemocytes, after a 3-h in vitro challenge with cultured V. tapetis. Nine hundred and ninety eight sequences from the two libraries were sequenced, and an in silico analysis identified 235 unique genes. BLAST and "Gene ontology" classification analyzes revealed that 60.4% of the Expressed Sequence Tags (ESTs) have high similarities with genes involved in various physiological functions, such as immunity, apoptosis and cytoskeleton organization; whereas, 39.6% remain unidentified. From the 235 unique genes, we selected 22 candidates based upon physiological function and redundancy in the libraries. Then, Real-Time PCR analysis identified 3 genes related to cytoskeleton organization showing significant variation in expression attributable to V. tapetis exposure. Disruption in regulation of these genes is consistent with the etiologic agent of Brown Ring disease in Manila clams. Copyright © 2012 Elsevier Ltd. All rights reserved.
Yang, Bing-Yan; Huo, Xiu-Ai; Li, Peng-Fei; Wang, Cui-Xia; Duan, Hui-Jun
2014-08-01
Full-length cDNAs are very important for genome annotation and functional analysis of genes. The number of full-length cDNAs from watermelon remains limited. Here we report first the construction of a full-length enriched cDNA library from Fusarium wilt stressed watermelon (Citrullus lanatus Thunb.) cultivar PI296341 root tissues using the SMART method. The titer of primary cDNA library and amplified library was 2.21 x 10(6) and 2.0 x 10(10) pfu/ml, respectively and the rate of recombinant was above 85%. The size of insert fragment ranged from 0.3 to 2.0 kb. In this study, we first cloned a gene named ClWRKY1, which was 1981 bp long and encoded a protein consisting of 394 amino acids. It contained two characteristic WRKY domains and two zinc finger motifs. Quantitative real-time PCR showed that ClWRKY1 expression levels reached maximum level at 12 h after inoculation with Fusarium oxysporum f. sp. niveum. The full-length cDNA library of watermelon root tissues is not only essential for the cloning of genes which are known, but also an initial key for the screening and cloning of new genes that might be involved in resistance to Fusarium wilt.
Sugai, Kyoko; Setsuko, Suzuki; Uchiyama, Kentaro; Murakami, Noriaki; Kato, Hidetoshi; Yoshimaru, Hiroshi
2012-02-01
Expressed sequence tag (EST)-derived microsatellite markers were developed for Elaeocarpus photiniifolia, an endemic taxon of the Bonin Islands. Initially, a complementary DNA (cDNA) library was constructed by de novo pyrosequencing of total RNA extracted from a seedling. A total of 267 primer pairs were designed from the library. Of the 48 tested loci, 25 loci were polymorphic among 41 individuals representing the entire geographical range of the species, with the number of alleles per locus and expected heterozygosity ranging from two to 14 and 0.09 to 0.86, respectively. Most loci were transferable to a related species, E. sylvestris. The developed markers will be useful for evaluating the genetic structure of E. photiniifolia.
Medina-Suárez, R; Manning, K; Fletcher, J; Aked, J; Bird, C R; Seymour, G B
1997-01-01
mRNA was extracted from the pulp and peel of preclimacteric (d 0) bananas (Musa AAA group, cv Grand Nain) and those exposed to ethylene gas for 24 h and stored in air alone for a further 1 (d 2) and 4 d (d 5). Two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis of in vitro translation products from the pulp and peel of these fruits revealed significant up-regulation of numerous transcripts during ripening. The majority of the changes were initiated by d 2, with the level of these messages increasing during the remainder of the ripening period. Pulp tissue from d 2 was used for the construction of a cDNA library. This library was differentially screened for ripening-related clones using cDNA from d-0 and d-2 pulp by a novel microtiter plate method. In the primary screen 250 up- and down-regulated clones were isolated. Of these, 59 differentially expressed clones were obtained from the secondary screen. All of these cDNAs were partially sequenced and grouped into families after database searches. Twenty-five nonredundant groups of pulp clones were identified. These encoded enzymes were involved in ethylene biosynthesis, respiration, starch metabolism, cell wall degradation, and several other key metabolic events. We describe the analysis of these clones and their possible involvement in ripening. PMID:9342865
NaderiSoorki, Maryam; Galehdari, Hamid; Baradaran, Masomeh; Jalali, Amir
2016-09-15
Scorpion venom contains mixture of biologic molecules including selective toxins with medical capability. Odonthubuthus doriae (O. doriae) belonged to Buthidae family of scorpions and gained more interest among Iranian dangerous scorpion since 2005. We constructed the first cDNA library to explore the transcriptomic composition of this Iranian scorpiontelson. Then by used of bioinformatic software each expression sequence taq (EST) from the library analyzed and its quiddity was clear. Analysis showed that toxins (42%) had more venom transcript than other component such as antimicrobial peptides, venom peptides and cell proteins. Over 16% of transcripts didn't have any open reading frames (ORF), however their sequences showed similarity by other scorpion sequences. One EST didn't have any similarity by known scorpion peptides. For the first time; we report a comprehensive study of an Iranian scorpion with interesting and novel findings. We characterized a new putative sodium channel modifier in scorpions by some bioinformatics software, and then predicted its structure and function. Copyright © 2016. Published by Elsevier Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jing Chen; Cairney, J.; Newton, R.J.
1991-05-01
Atriplex canescens (Pursh.) Nutt. is known to have a high degree of morphological and physiological drought-tolerance, which appears to be related to molecular responses. A cDNA library, constructed from drought-induced messenger RNA, was differentially screened with radioactively labelled cDNA probes synthesized from mRNA extracted from stressed and non-stressed Atriplex. Two clones named 19-3 and 27-3, whose expression is induced by drought-stress, have been characterized. Sequence analysis shows that they are more than 96% homologous. Each clone has an open reading frame which specifies a protein of 95 amino acids (12.77 kDa and 12.74 kDa respectively.) In vitro transcription and translationmore » of each clone results in a single protein of apparent molecular weight 8.6 kDa. The disparity in size may be due to secondary structure, dictated, at least in part, by a highly charged carboxy terminus which may be important for the function of these proteins in drought tolerance.« less
Eucalypt NADP-Dependent Isocitrate Dehydrogenase1
Boiffin, Vincent; Hodges, Michael; Gálvez, Susana; Balestrini, Raffaella; Bonfante, Paola; Gadal, Pierre; Martin, Francis
1998-01-01
NADP-dependent isocitrate dehydrogenase (NADP-ICDH) activity is increased in roots of Eucalyptus globulus subsp. bicostata ex Maiden Kirkp. during colonization by the ectomycorrhizal fungus Pisolithus tinctorius Coker and Couch. To investigate the regulation of the enzyme expression, a cDNA (EgIcdh) encoding the NADP-ICDH was isolated from a cDNA library of E. globulus-P. tinctorius ectomycorrhizae. The putative polypeptide sequence of EgIcdh showed a high amino acid similarity with plant NADP-ICDHs. Because the deduced EgICDH protein lacks an amino-terminal targeting sequence and shows highest similarity to plant cytosolic ICDHs, it probably represents a cytoplasmic isoform. RNA analysis showed that the steady-state level of EgIcdh transcripts was enhanced nearly 2-fold in ectomycorrhizal roots compared with nonmycorrhizal roots. Increased accumulation of NADP-ICDH transcripts occurred as early as 2 d after contact and likely led to the observed increased enzyme activity. Indirect immunofluorescence microscopy indicated that NADP-ICDH was preferentially accumulated in the epidermis and stele parenchyma of nonmycorrhizal and ectomycorrhizal lateral roots. The putative role of cytosolic NADP-ICDH in ectomycorrhizae is discussed. PMID:9662536
Identification of a novel box C/D snoRNA from mouse nucleolar cDNA library.
Zhou, Hui; Zhao, Jin; Yu, Chuan-He; Luo, Qing-Jun; Chen, Yue-Qin; Xiao, Yu; Qu, Liang-Hu
2004-02-18
By construction and screen of mouse nucleolar cDNA library, a novel mammalian small nucleolar RNAs (snoRNA) was identified. The novel snoRNA, 70 nt in length, displays structural features typical of C/D box snoRNA family. The snoRNA possesses an 11-nt-long rRNA antisense element and is predicted to guide the 2'-O-methylation of mouse 28S rRNA at G4043, a site unknown so far to be modified in vertebrates. The comparison of functional element of snoRNA guides among eukaryotes reveals that the novel snoRNA is a mammalian counterpart of yeast snR38 despite highly divergent sequence between them. Mouse and human snR38 and other cognates in distant vertebrates were positively detected with slight length variability. As expected, the rRNA ribose-methylation site predicted by mouse snR38 was precisely mapped by specific-primer extension assay. Furthermore, our analyses show that mouse and human snR38 gene have multiple variants and are nested in the introns of different host genes with unknown function. Thus, snR38 is a phylogenetically conserved methylation guide but exhibits different genomic organization in eukaryotes.
Baird, Fiona J.; Su, Xiaopei; Aibinu, Ibukun; Nolan, Matthew J.; Sugiyama, Hiromu; Otranto, Domenico
2016-01-01
Background Food-borne nematodes of the genus Anisakis are responsible for a wide range of illnesses (= anisakiasis), from self-limiting gastrointestinal forms to severe systemic allergic reactions, which are often misdiagnosed and under-reported. In order to enhance and refine current diagnostic tools for anisakiasis, knowledge of the whole spectrum of parasite molecules transcribed and expressed by this parasite, including those acting as potential allergens, is necessary. Methodology/Principal Findings In this study, we employ high-throughput (Illumina) sequencing and bioinformatics to characterise the transcriptomes of two Anisakis species, A. simplex and A. pegreffii, and utilize this resource to compile lists of potential allergens from these parasites. A total of ~65,000,000 reads were generated from cDNA libraries for each species, and assembled into ~34,000 transcripts (= Unigenes); ~18,000 peptides were predicted from each cDNA library and classified based on homology searches, protein motifs and gene ontology and biological pathway mapping. Using comparative analyses with sequence data available in public databases, 36 (A. simplex) and 29 (A. pegreffii) putative allergens were identified, including sequences encoding ‘novel’ Anisakis allergenic proteins (i.e. cyclophilins and ABA-1 domain containing proteins). Conclusions/Significance This study represents a first step towards providing the research community with a curated dataset to use as a molecular resource for future investigations of the biology of Anisakis, including molecules putatively acting as allergens, using functional genomics, proteomics and immunological tools. Ultimately, an improved knowledge of the biological functions of these molecules in the parasite, as well as of their immunogenic properties, will assist the development of comprehensive, reliable and robust diagnostic tools. PMID:27472517
Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.
Judelson, H S; Michelmore, R W
1990-01-01
Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.
Cioffi, Anna Valentina; Ferrara, Diana; Cubellis, Maria Vittoria; Aniello, Francesco; Corrado, Marcella; Liguori, Francesca; Amoroso, Alessandro; Fucci, Laura; Branno, Margherita
2002-08-01
Analysis of the genome structure of the Paracentrotus lividus (sea urchin) DNA methyltransferase (DNA MTase) gene showed the presence of an open reading frame, named METEX, in intron 7 of the gene. METEX expression is developmentally regulated, showing no correlation with DNA MTase expression. In fact, DNA MTase transcripts are present at high concentrations in the early developmental stages, while METEX is expressed at late stages of development. Two METEX cDNA clones (Met1 and Met2) that are different in the 3' end have been isolated in a cDNA library screening. The putative translated protein from Met2 cDNA clone showed similarity with Escherichia coli endonuclease III on the basis of sequence and predictive three-dimensional structure. The protein, overexpressed in E. coli and purified, had functional properties similar to the endonuclease specific for apurinic/apyrimidinic (AP) sites on the basis of the lyase activity. Therefore the open reading frame, present in intron 7 of the P. lividus DNA MTase gene, codes for a functional AP endonuclease designated SuAP1.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zezza, D.J.; Stewart, S.E.; Steiner, L.A.
1992-12-15
Xenopus laevis Ig contain two distinct types of L chains, designated [rho] or L1 and [sigma] or L2. The authors have analyzed Xenopus genomic DNA by Southern blotting with cDNA probes specific for L1 V and C regions. Many fragments hybridized to the V probe, but only one or two fragments hybridized to the C probe. Corresponding C, J, and V gene segments were identified on clones isolated from a genomic library prepared from the same DNA. One clone contains a C gene segment separated from a J gene segment by an intron of 3.4 kb. The J and Cmore » gene segments are nearly identical in sequence to cDNA clones analyzed previously. The C segment is somewhat more similar and the J segment considerably more similar in sequence to the corresponding segments of mammalian [kappa] chains than to those of mammalian [lambda] chains. Upstream of the J segment is a typical recombination signal sequence with a spacer of 23 bp, as in J[kappa]. A second clone from the library contains four V gene segments, separated by 2.1 to 3.6 kb. Two of these, V1 and V3, have the expected structural and regulatory features of V genes, and are very similar in sequence to each other and to mammalian V[kappa]. A third gene segment, V2, resembles V1 and V3 in its coding region and nearby 5[prime]-flanking region, but diverges in sequence 5[prime] to position [minus]95 with loss of the octamer promoter element. The fourth V-like segment is similar to the others at the 3[prime]-end, but upstream of codon 64 bears no resemblance in sequence to any Ig V region. All four V segments have typical recombination signal sequences with 12-bp spacers at their 3[prime]-ends, as in V[kappa]. Taken together, the data suggest that Xenopus L1 L chain genes are members of the [kappa] gene family. 80 refs., 9 figs.« less
Prospecting for viral natural enemies of the fire ant Solenopsis invicta in Argentina.
Valles, Steven M; Porter, Sanford D; Calcaterra, Luis A
2018-01-01
Metagenomics and next generation sequencing were employed to discover new virus natural enemies of the fire ant, Solenopsis invicta Buren in its native range (i.e., Formosa, Argentina) with the ultimate goal of testing and releasing new viral pathogens into U.S. S. invicta populations to provide natural, sustainable control of this ant. RNA was purified from worker ants from 182 S. invicta colonies, which was pooled into 4 groups according to location. A library was created from each group and sequenced using Illumina Miseq technology. After a series of winnowing methods to remove S. invicta genes, known S. invicta virus genes, and all other non-virus gene sequences, 61,944 unique singletons were identified with virus identity. These were assembled de novo yielding 171 contiguous sequences with significant identity to non-plant virus genes. Fifteen contiguous sequences exhibited very high expression rates and were detected in all four gene libraries. One contig (Contig_29) exhibited the highest expression level overall and across all four gene libraries. Random amplification of cDNA ends analyses expanded this contiguous sequence yielding a complete virus genome, which we have provisionally named Solenopsis invicta virus 5 (SINV-5). SINV-5 is a positive-sense, single-stranded RNA virus with genome characteristics consistent with insect-infecting viruses from the family Dicistroviridae. Moreover, the replicative genome strand of SINV-5 was detected in worker ants indicating that S. invicta serves as host for the virus. Many additional sequences were identified that are likely of viral origin. These sequences await further investigation to determine their origins and relationship with S. invicta. This study expands knowledge of the RNA virome diversity found within S. invicta populations.
Prospecting for viral natural enemies of the fire ant Solenopsis invicta in Argentina
Porter, Sanford D.; Calcaterra, Luis A.
2018-01-01
Metagenomics and next generation sequencing were employed to discover new virus natural enemies of the fire ant, Solenopsis invicta Buren in its native range (i.e., Formosa, Argentina) with the ultimate goal of testing and releasing new viral pathogens into U.S. S. invicta populations to provide natural, sustainable control of this ant. RNA was purified from worker ants from 182 S. invicta colonies, which was pooled into 4 groups according to location. A library was created from each group and sequenced using Illumina Miseq technology. After a series of winnowing methods to remove S. invicta genes, known S. invicta virus genes, and all other non-virus gene sequences, 61,944 unique singletons were identified with virus identity. These were assembled de novo yielding 171 contiguous sequences with significant identity to non-plant virus genes. Fifteen contiguous sequences exhibited very high expression rates and were detected in all four gene libraries. One contig (Contig_29) exhibited the highest expression level overall and across all four gene libraries. Random amplification of cDNA ends analyses expanded this contiguous sequence yielding a complete virus genome, which we have provisionally named Solenopsis invicta virus 5 (SINV-5). SINV-5 is a positive-sense, single-stranded RNA virus with genome characteristics consistent with insect-infecting viruses from the family Dicistroviridae. Moreover, the replicative genome strand of SINV-5 was detected in worker ants indicating that S. invicta serves as host for the virus. Many additional sequences were identified that are likely of viral origin. These sequences await further investigation to determine their origins and relationship with S. invicta. This study expands knowledge of the RNA virome diversity found within S. invicta populations. PMID:29466388
Zhu, Ling; Song, Linsheng; Zhang, Huan; Zhao, Jianmin; Li, Chenghua; Xu, Wei
2008-06-01
Apoptosis is an active process of cell death, which is an integral part of growth and development in multicellular organisms. The defender against cell death 1 (DAD1), the regulatory protein to inhibit the apoptosis process, was first cloned from the bay scallop Argopecten irradians by randomly sequencing a whole tissue cDNA library and rapid amplification of cDNA end (RACE). The full-length cDNA of the A. irradians DAD1 was 607 bp, consist of a 5'-terminal untranslated region (UTR) of 63 bp, a 3'-terminal UTR of 205 bp with a canonical polyadenylation signal sequence AATAAA and a poly (A) tail, and an open reading frame of 339 bp. The deduced amino acid sequence of the A. irradians DAD1 showed 75.5% identity to Araneus ventricosus, 74.5% to Drosophila melanogaster, and 73.6% to Homo sapiens, Sus scrofa, Mesocricetus auratus, Rattus norvegicus and Mus musculus. Excluding the Saccharomyces cerevisiae DAD1 homologue, all animal DAD1 including A. irradians DAD1 homologue formed a subgroup and all plant DAD1 proteins formed another subgroup in the phylogenetic analysis. The A. irradians DAD1 was expressed in all examined tissues including adductor muscle, mantle, gills, digestive gland, gonad and hemolymph, suggesting that A. irradians DAD1 is expressed in most body tissues. Furthermore, the mRNA expression levels of A. irradians DAD1 gene of hemolymph were particularly high after injury, suggesting that the gene is responsive to injury stimuli.
Ling, Juan; Lin, Xiancheng; Zhang, Yanying; Zhou, Weiguo; Yang, Qingsong; Lin, Liyun; Zeng, Siquan; Zhang, Ying; Wang, Cong; Ahmad, Manzoor; Long, Lijuan; Dong, Junde
2018-01-01
Seagrasses in coral reef ecosystems play important ecological roles by enhancing coral reef resilience under ocean acidification. However, seagrass primary productivity is typically constrained by limited nitrogen availability. Ammonia oxidation is an important process conducted by ammonia-oxidizing archaea (AOA) and bacteria (AOB), yet little information is available concerning the community structure and potential activity of seagrass AOA and AOB. Therefore, this study investigated the variations in the abundance, diversity and transcriptional activity of AOA and AOB at the DNA and transcript level from four sample types: the leaf, root, rhizosphere sediment and bulk sediment of seagrass Thalassia hemprichii in three coral reef ecosystems. DNA and complementary DNA (cDNA) were used to prepare clone libraries and DNA and cDNA quantitative PCR ( q PCR) assays, targeting the ammonia monooxygenase-subunit ( amo A) genes as biomarkers. Our results indicated that the closest relatives of the obtained archaeal and bacterial amo A gene sequences recovered from DNA and cDNA libraries mainly originated from the marine environment. Moreover, all the obtained AOB sequences belong to the Nitrosomonadales cluster. Nearly all the AOA communities exhibited higher diversity than the AOB communities at the DNA level, but the q PCR data demonstrated that the abundances of AOB communities were higher than that of AOA communities based on both DNA and RNA transcripts. Collectively, most of the samples shared greater community composition similarity with samples from the same location rather than sample type. Furthermore, the abundance of archaeal amo A gene in rhizosphere sediments showed significant relationships with the ammonium concentration of sediments and the nitrogen content of plant tissue (leaf and root) at the DNA level ( P < 0.05). Conversely, no such relationships were found for the AOB communities. This work provides new insight into the nitrogen cycle, particularly nitrification of seagrass meadows in coral reef ecosystems.
Wang, Li Ke; Niu, Xiao Wei; Lv, Yan Hui; Zhang, Tian Zhen; Guo, Wang Zhen
2010-10-01
Annexins constitute a family of multifunction and structurally related proteins. These proteins are ubiquitous in the plant kingdom, and are important calcium-dependent membrane-binding proteins that participate in the polar development of different plant regions such as rhizoids, root caps, and pollen tube tips. In this study, a novel cotton annexin gene (designated as GhFAnnx) was isolated from a fiber cDNA library of cotton (Gossypium hirsutum). The full-length cDNA of GhFAnnx comprises an open reading frame of 945 bp that encodes a 314-amino acid protein with a calculated molecular mass of 35.7 kDa and an isoelectric point of 6.49. Genomic GhFAnnx sequences from different cotton species, TM-1, Hai7124 and two diploid progenitor cottons, G. herbaceum (A-genome) and G. raimondii (D-genome) showed that at least two copies of the GhFAnnx gene, each with six exons and five introns in the coding region, were identified in the allotetraploid cotton genome. The GhFAnnx gene cloned from the cDNA library in this study was mapped to the chromosome 10 of the A-subgenome of the tetraploid cotton. Sequence alignment revealed that GhFAnnx contained four repeats of 70 amino acids. Semi-quantitative reverse transcriptase-polymerase chain reaction revealed that GhFAnnx is preferentially expressed in different developmental fibers but its expression is low in roots, stems, and leaves. Subcellular localization of GhFAnnx in onion epidermal cells and cotton fibers suggests that this protein is ubiquitous in the epidermal cells of onion, but assembles at the edge and the inner side of the apex of the cotton fiber tips with brilliant spots. In summary, GhFAnnx influences fiber development and is associated with the polar expansion of the cotton fiber during elongation stages.
Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta
2012-01-01
Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917
Creager, Hannah M; Becker, Ericka A; Sandman, Kelly K; Karl, Julie A; Lank, Simon M; Bimber, Benjamin N; Wiseman, Roger W; Hughes, Austin L; O'Connor, Shelby L; O'Connor, David H
2011-09-01
In recent years, the use of cynomolgus macaques in biomedical research has increased greatly. However, with the exception of the Mauritian population, knowledge of the MHC class II genetics of the species remains limited. Here, using cDNA cloning and Sanger sequencing, we identified 127 full-length MHC class II alleles in a group of 12 Indonesian and 12 Vietnamese cynomolgus macaques. Forty two of these were completely novel to cynomolgus macaques while 61 extended the sequence of previously identified alleles from partial to full length. This more than doubles the number of full-length cynomolgus macaque MHC class II alleles available in GenBank, significantly expanding the allele library for the species and laying the groundwork for future evolutionary and functional studies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Livi, G.P.; McHale, M.J.; Sathe, G.M.
1990-06-01
The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less
Li, Jingtao; Sun, Xinhua; Yu, Gang; Jia, Chengguo; Liu, Jinliang; Pan, Hongyu
2014-01-01
Little information is available on gene expression profiling of halophyte A. canescens. To elucidate the molecular mechanism for stress tolerance in A. canescens, a full-length complementary DNA library was generated from A. canescens exposed to 400 mM NaCl, and provided 343 high-quality ESTs. In an evaluation of 343 valid EST sequences in the cDNA library, 197 unigenes were assembled, among which 190 unigenes (83.1% ESTs) were identified according to their significant similarities with proteins of known functions. All the 343 EST sequences have been deposited in the dbEST GenBank under accession numbers JZ535802 to JZ536144. According to Arabidopsis MIPS functional category and GO classifications, we identified 193 unigenes of the 311 annotations EST, representing 72 non-redundant unigenes sharing similarities with genes related to the defense response. The sets of ESTs obtained provide a rich genetic resource and 17 up-regulated genes related to salt stress resistance were identified by qRT-PCR. Six of these genes may contribute crucially to earlier and later stage salt stress resistance. Additionally, among the 343 unigenes sequences, 22 simple sequence repeats (SSRs) were also identified contributing to the study of A. canescens resources. PMID:24960361
Complementation of a Fanconi anemia group A cell line by UbA{sup 52}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moses, R.E.; Heina, J.A.; Jakobs, P.M.
1994-09-01
Cells from patients with Fanconi anemia (FA) display chromosomal instability and increased sensitivity to mitomycin C (MMC) and diepoxybutane (DEB) relative to normal cells. Several genes act in this pathway of DNA damage processing based upon four known complementation groups in FA. We have made a cDNA expression library in a vector with a G418 selectable marker to identify FA genes other than the FA-C group. Approximately 1 x 10{sup 6} independent cDNA clones were isolated with an average cDNA size of 1.5 kb. Five cell lines resistant to MMC and DEB were isolated from 6 x 10{sup 6} G418-resistantmore » transfectants from 65 individual transfections of the FA-A fibroblast line GM6914. The isolated cell lines also showed normal chromosome stability. The same cDNA (600 bp) was recovered from three independent cell lines by PCR using flanking sequence primers. The gene has sequence identity with a known gene, the ubiquitin fusion gene, UbA{sub 52}. Interestingly, each of the cDNAs were inserted in antisense orientation relative to the cytomegalovirus (CMV) promoter as determined by sequencing and PCR using UbA{sub 52}-specific internal primers. Southern blot analysis indicated the cell lines had distinct chromosomal insertion sites. Mutation analysis by chemical cleavage showed no reading frame mutations, indicating that UbA{sub 52} is not the FA-A gene. Re-transfection with the UbA{sub 52} gene in antisense gave complementation for MMC, DEB and chromosome stability to varying degrees. Re-transfection of the antisense construct with the CMV promotor removed or with a sense construct did not alter the MMC sensitivity. We conclude that the antisense UbA{sub 52} gene has a non-specific effect, perhaps acting by altering the cell cycle or susceptibility to apoptosis.« less
Xia, Z.; Patino, R.; Gale, W.L.; Maule, A.G.; Densmore, L.D.
1999-01-01
We obtained two channel catfish estrogen receptor (ccER) cDNA from liver of female fish using RT–PCR. The two fragments were identical in sequence except that the smaller one had an out-of-frame deletion in the E domain, suggesting the existence of ccER splice variants. The larger fragment was used to screen a cDNA library from liver of a prepubescent female. A cDNA was obtained that encoded a 581-amino-acid ER with a deduced molecular weight of 63.8 kDa. Extracts of COS-7 cells transfected with ccER cDNA bound estrogen with high affinity (Kd = 4.7 nM) and specificity. Maximum parsimony and Neighbor Joining analyses were used to generate a phylogenetic classification of ccER on the basis of 18 full-length ER sequences. The tree suggested the existence of two major ER branches. One branch contained two clearly divergent clades which included all piscine ER (except Japanese eel ER) and all tetrapod ERα, respectively. The second major branch contained the eel ER and the mammalian ERβ. The high degree of divergence between the eel ER and mammalian ERβ suggested that they also represent distinct piscine and tetrapod ER. These data suggest that ERα and ERβ are present throughout vertebrates and that these two major ER types evolved by duplication of an ancestral ER gene. Sequence alignments with other members of the nuclear hormone receptor superfamily indicated the presence of 8 amino acids in the E domain that align exclusively among ER. Four of these amino acids have not received prior research attention and their function is unknown. The novel finding of putative ER splice variants in a nonmammalian vertebrate and the novel phylogenetic classification of ER offer new perspectives in understanding the diversification and function of ER.
Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide
2011-09-01
Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.
Abuqarn, Mehtap; Allmeling, Christina; Amshoff, Inga; Menger, Bjoern; Nasser, Inas; Vogt, Peter M; Reimers, Kerstin
2011-07-01
Urodele amphibians are exceptional in their ability to regenerate complex body structures such as limbs. Limb regeneration depends on a process called dedifferentiation. Under an inductive wound epidermis terminally differentiated cells transform to pluripotent progenitor cells that coordinately proliferate and eventually redifferentiate to form the new appendage. Recent studies have developed molecular models integrating a set of genes that might have important functions in the control of regenerative cellular plasticity. Among them is Msx1, which induced dedifferentiation in mammalian myotubes in vitro. Herein, we screened for interaction partners of axolotl Msx1 using a yeast two hybrid system. A two hybrid cDNA library of 5-day-old wound epidermis and underlying tissue containing more than 2×10⁶ cDNAs was constructed and used in the screen. 34 resulting cDNA clones were isolated and sequenced. We then compared sequences of the isolated clones to annotated EST contigs of the Salamander EST database (BLASTn) to identify presumptive orthologs. We subsequently searched all no-hit clone sequences against non redundant NCBI sequence databases using BLASTx. It is the first time, that the yeast two hybrid system was adapted to the axolotl animal model and successfully used in a screen for proteins interacting with Msx1 in the context of amphibian limb regeneration. 2011 Elsevier B.V. All rights reserved.
Abdel-Rahman, Mohamed A; Quintero-Hernandez, Veronica; Possani, Lourival D
2013-11-01
Proteomic analysis of the scorpion venom Scorpio maurus palmatus was performed using reverse-phase HPLC separation followed by mass spectrometry determination. Sixty five components were identified with molecular masses varying from 413 to 14,009 Da. The high percentage of peptides (41.5%) was from 3 to 5 KDa which may represent linear antimicrobial peptides and KScTxs. Also, 155 expressed sequence tags (ESTs) were analyzed through construction the cDNA library prepared from a pair of venomous gland. About 77% of the ESTs correspond to toxin-like peptides and proteins with definite open reading frames. The cDNA sequencing results also show the presence of sequences whose putative products have sequence similarity with antimicrobial peptides (24%), insecticidal toxins, β-NaScTxs, κ-KScTxs, α-KScTxs, calcines and La1-like peptides. Also, we have obtained 23 atypical types of venom molecules not recorded in other scorpion species. Moreover, 9% of the total ESTs revealed significant similarities with proteins involved in the cellular processes of these scorpion venomous glands. This is the first set of molecular masses and transcripts described from this species, in which various venom molecules have been identified. They belong to either known or unassigned types of scorpion venom peptides and proteins, and provide valuable information for evolutionary analysis and venomics. Copyright © 2013 Elsevier Ltd. All rights reserved.
Feng, X; Happ, G M
1996-11-14
The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.
Isolation and Characterization of the PKAr Gene From a Plant Pathogen, Curvularia lunata.
Liu, T; Ma, B C; Hou, J M; Zuo, Y H
2014-09-01
By using EST database from a full-length cDNA library of Curvularia lunata, we have isolated a 2.9 kb cDNA, termed PKAr. An ORF of 1,383 bp encoding a polypeptide of 460 amino acids with molecular weight 50.1 kDa, (GeneBank Acc. No. KF675744) was cloned. The deduced amino acid sequence of the PKAr shows 90 and 88 % identity with cAMP-dependent protein kinase A regulatory subunit from Alternaria alternate and Pyrenophora tritici-repentis Pt-1C-BFP, respectively. Database analysis revealed that the deduced amino acid sequence of PKAr shares considerable similarity with that of PKA regulatory subunits in other organisms, particularly in the conserved regions. No introns were identified within the 1,383 bp of ORF compared with PKAr genomic DNA sequence. Southern blot indicated that PKAr existed as a single copy per genome. The mRNA expression level of PKAr in different development stages were demonstrated using real-time quantitative PCR. The results showed that the level of PKAr expression was highest in vegetative growth mycelium, which indicated it might play an important role in the vegetative growth of C. lunata. These results provided a fundamental supporting research on the function of PKAr in plant pathogen, C. lunata.
Isolation of nine gene sequences induced by silica in murine macrophages
DOE Office of Scientific and Technical Information (OSTI.GOV)
Segade, F.; Claudio, E.; Wrobel, K.
1995-03-01
Macrophage activation by silica is the initial step in the development of silicosis. To identify genes that might be involved in silica-mediated activation, RAW 264.7 mouse macrophages were treated with silica for 48 h, and a subtracted cDNA library enriched for silica-induced genes (SIG) was constructed and differently screened. Nine cDNA clones (designated SIG-12, -14, -20, -41, -61, -81, -91, and -111) were partially sequenced and compared with sequences in GenBank/EMBL databases. SIG-12, -14, and -20 corresponded to the genes for ribosomal proteins L13A, L32, and L26, respectively. SIG-61 is the mouse homologue of p21 RhoC. SIG-91 is identical tomore » the 67-kDa high-affinity laminin receptor. Four genes were not identified and are novel. All of the mRNAs corresponding to the nine cloned cDNAs were inducible by silica. Steady-state levels of mRNAs in RAW 264.7 cells treated with various macrophage activators and inducers of signal transduction pathways were determined. A complex pattern of induction and repression was found, indicating that upon phagocytosis of silica particles, many regulatory mechanisms of genes expression are simultaneously triggered. 55 refs., 4 figs., 1 tab.« less
Lamm, Ayelet T; Stadler, Michael R; Zhang, Huibin; Gent, Jonathan I; Fire, Andrew Z
2011-02-01
We have used a combination of three high-throughput RNA capture and sequencing methods to refine and augment the transcriptome map of a well-studied genetic model, Caenorhabditis elegans. The three methods include a standard (non-directional) library preparation protocol relying on cDNA priming and foldback that has been used in several previous studies for transcriptome characterization in this species, and two directional protocols, one involving direct capture of single-stranded RNA fragments and one involving circular-template PCR (CircLigase). We find that each RNA-seq approach shows specific limitations and biases, with the application of multiple methods providing a more complete map than was obtained from any single method. Of particular note in the analysis were substantial advantages of CircLigase-based and ssRNA-based capture for defining sequences and structures of the precise 5' ends (which were lost using the double-strand cDNA capture method). Of the three methods, ssRNA capture was most effective in defining sequences to the poly(A) junction. Using data sets from a spectrum of C. elegans strains and stages and the UCSC Genome Browser, we provide a series of tools, which facilitate rapid visualization and assignment of gene structures.
Expression and permeation properties of the K(+) channel Kir7.1 in the retinal pigment epithelium.
Shimura, M; Yuan, Y; Chang, J T; Zhang, S; Campochiaro, P A; Zack, D J; Hughes, B A
2001-03-01
Bovine Kir7.1 clones were obtained from a retinal pigment epithelium (RPE)-subtracted cDNA library. Human RPE cDNA library screening resulted in clones encoding full-length human Kir7.1. Northern blot analysis indicated that bovine Kir7.1 is highly expressed in the RPE. Human Kir7.1 channels were expressed in Xenopus oocytes and studied using the two-electrode voltage-clamp technique. The macroscopic Kir7.1 conductance exhibited mild inward rectification and an inverse dependence on extracellular K+ concentration ([K+]o). The selectivity sequence based on permeability ratios was K+ (1.0) approximately Rb+ (0.89) > Cs+ (0.013) > Na+ (0.003) approximately Li+ (0.001) and the sequence based on conductance ratios was Rb+ (9.5) > K+ (1.0) > Na+ (0.458) > Cs+ (0.331) > Li+ (0.139). Non-stationary noise analysis of Rb+ currents in cell-attached patches yielded a unitary conductance for Kir7.1 of approximately 2 pS. In whole-cell recordings from freshly isolated bovine RPE cells, the predominant current was a mild inwardly rectifying K+ current that exhibited an inverse dependence of conductance on [K+]o. The selectivity sequence based on permeability ratios was K+ (1.0) approximately Rb+ (0.89) > Cs+ (0.021) > Na+ (0.003) approximately Li+ (0.002) and the sequence based on conductance ratios was Rb+ (8.9) > K+ (1.0) > Na+ (0.59) > Cs+ (0.23) > Li+ (0.08). In cell-attached recordings with Rb+ in the pipette, inwardly rectifying currents were observed in nine of 12 patches of RPE apical membrane but in only one of 13 basolateral membrane patches. Non-stationary noise analysis of Rb+ currents in cell-attached apical membrane patches yielded a unitary conductance for RPE Kir of approximately 2 pS. On the basis of this molecular and electrophysiological evidence, we conclude that Kir7.1 channel subunits comprise the K+ conductance of the RPE apical membrane.
Wu, Zhencai; Burns, Jacqueline K
2004-07-01
beta-galactosidases have been detected in a wide range of plants and are characterized by their ability to hydrolyse terminal non-reducing beta-D-galactosyl residues from beta-D-galactosides. These enzymes have been detected in a wide range of plant organs and tissues. In a search for differentially expressed genes during the abscission process in citrus, sequences encoding beta-galactosidase were identified. Three cDNA fragments of a beta-galactosidase gene were isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after the application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-1H-pyrazole (CMN-pyrazole). Based on sequence information derived from these fragments, a full-length cDNA of 2847 nucleotides (GenBank accession number AY029198) encoding beta-galactosidase was isolated from mature fruit abscission zones by 5'- and 3'-RACE approaches. The beta-galactosidase cDNA encoded a protein of 737 amino acid residues with a calculated molecular weight of 82 kDa. The deduced protein was highly homologous to plant beta-galactosidases expressed in fruit ripening. Southern blot analysis demonstrated that at least two closely related beta-galactosidase genes were present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones indicated beta-galactosidase mRNA was detected 48 h after treatment of CMN-pyrazole and ethephon in mature fruit abscission zones. beta-galactosidase transcripts were detected in leaf abscission zones only after ethephon application. The citrus beta-galactosidase was expressed in stamens and petals of fully opened flowers and young fruitlets. The results suggest that this beta-galactosidase may play a role during abscission as well as early growth and development processes in flowers and fruitlets.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reilly, D.S.; Nussbaum, R.L.
1994-09-01
The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less
Freije, J M; Díez-Itza, I; Balbín, M; Sánchez, L M; Blasco, R; Tolivia, J; López-Otín, C
1994-06-17
A cDNA coding for a new human matrix metalloproteinase (MMP) has been cloned from a cDNA library derived from a breast tumor. The isolated cDNA contains an open reading frame coding for a polypeptide of 471 amino acids. The predicted protein sequence displays extensive similarity to the previously known MMPs and presents all the structural features characteristic of the members of this protein family, including the well conserved PRCGXPD motif, involved in the latency of the enzyme and the zinc-binding domain (HEXGHXXXXXHS). In addition, this novel human MMP contains in its amino acid sequence several residues specific to the collagenase subfamily (Tyr-214, Asp-235, and Gly-237) and lacks the 9-residue insertion present in the stromelysins. According to these structural characteristics, the MMP described herein has been tentatively called collagenase-3, since it represents the third member of this subfamily, composed at present of fibroblast and neutrophil collagenases. The collagenase-3 cDNA was expressed in a vaccinia virus system, and the recombinant protein was able to degrade fibrillar collagens, providing support to the hypothesis that the isolated cDNA codes for an authentic collagenase. Northern blot analysis of RNA from normal and pathological tissues demonstrated the existence in breast tumors of three different mRNA species, which seem to be the result of the utilization of different polyadenylation sites present in the 3'-noncoding region of the gene. By contrast, no collagenase-3 mRNA was detected either by Northern blot or RNA polymerase chain reaction analysis with RNA from other human tissues, including normal breast, mammary fibroadenomas, liver, placenta, ovary, uterus, prostate, and parotid gland. On the basis of the increased expression of collagenase-3 in breast carcinomas and the absence of detectable expression in normal tissues, a possible role for this metalloproteinase in the tumoral process is proposed.
2010-01-01
Background The Fagaceae family comprises about 1,000 woody species worldwide. About half belong to the Quercus family. These oaks are often a source of raw material for biomass wood and fiber. Pedunculate and sessile oaks, are among the most important deciduous forest tree species in Europe. Despite their ecological and economical importance, very few genomic resources have yet been generated for these species. Here, we describe the development of an EST catalogue that will support ecosystem genomics studies, where geneticists, ecophysiologists, molecular biologists and ecologists join their efforts for understanding, monitoring and predicting functional genetic diversity. Results We generated 145,827 sequence reads from 20 cDNA libraries using the Sanger method. Unexploitable chromatograms and quality checking lead us to eliminate 19,941 sequences. Finally a total of 125,925 ESTs were retained from 111,361 cDNA clones. Pyrosequencing was also conducted for 14 libraries, generating 1,948,579 reads, from which 370,566 sequences (19.0%) were eliminated, resulting in 1,578,192 sequences. Following clustering and assembly using TGICL pipeline, 1,704,117 EST sequences collapsed into 69,154 tentative contigs and 153,517 singletons, providing 222,671 non-redundant sequences (including alternative transcripts). We also assembled the sequences using MIRA and PartiGene software and compared the three unigene sets. Gene ontology annotation was then assigned to 29,303 unigene elements. Blast search against the SWISS-PROT database revealed putative homologs for 32,810 (14.7%) unigene elements, but more extensive search with Pfam, Refseq_protein, Refseq_RNA and eight gene indices revealed homology for 67.4% of them. The EST catalogue was examined for putative homologs of candidate genes involved in bud phenology, cuticle formation, phenylpropanoids biosynthesis and cell wall formation. Our results suggest a good coverage of genes involved in these traits. Comparative orthologous sequences (COS) with other plant gene models were identified and allow to unravel the oak paleo-history. Simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs) were searched, resulting in 52,834 SSRs and 36,411 SNPs. All of these are available through the Oak Contig Browser http://genotoul-contigbrowser.toulouse.inra.fr:9092/Quercus_robur/index.html. Conclusions This genomic resource provides a unique tool to discover genes of interest, study the oak transcriptome, and develop new markers to investigate functional diversity in natural populations. PMID:21092232
Lee, Je Hyuk; Daugharthy, Evan R.; Scheiman, Jonathan; Kalhor, Reza; Ferrante, Thomas C.; Terry, Richard; Turczyk, Brian M.; Yang, Joyce L.; Lee, Ho Suk; Aach, John; Zhang, Kun; Church, George M.
2014-01-01
RNA sequencing measures the quantitative change in gene expression over the whole transcriptome, but it lacks spatial context. On the other hand, in situ hybridization provides the location of gene expression, but only for a small number of genes. Here we detail a protocol for genome-wide profiling of gene expression in situ in fixed cells and tissues, in which RNA is converted into cross-linked cDNA amplicons and sequenced manually on a confocal microscope. Unlike traditional RNA-seq our method enriches for context-specific transcripts over house-keeping and/or structural RNA, and it preserves the tissue architecture for RNA localization studies. Our protocol is written for researchers experienced in cell microscopy with minimal computing skills. Library construction and sequencing can be completed within 14 d, with image analysis requiring an additional 2 d. PMID:25675209
Baek, Ji Hyeong; Lee, Si Hyeock
2010-06-01
To search for novel transcripts encoding biologically active venom components, a subtractive cDNA library specific to the venom gland and sac (gland/sac) of a solitary hunting wasp species, Eumenes pomiformis Fabricius (1781), was constructed by suppression subtractive hybridization. A total of 541 expressed sequence tags (ESTs) were clustered and assembled into 102 contigs (31 multiple sequences and 71 singletons). In total, 37 cDNAs were found in the library via BLASTx searching and manual annotation. Eight contigs (337 ESTs) encoding short venom peptides (10 to 16 amino acids) occupied 62% of the library. The deduced amino acid sequence (78 amino acids) of a novel venom peptide transcript shared sequence similarity with trypsin inhibitors and dendrotoxin-like venom peptides known to be K(+) channel blockers, implying that this novel peptide may play a role in the paralysis of prey. In addition to phospholipase A2 and hyaluronidase, which are known to be the main components of wasp venoms, several transcripts encoding enzymes, including three metallopeptidases and a decarboxylase likely involved in the processing and activation of venomous proteins, peptides, amines, and neurotransmitters, were also isolated from the library. The presence of a transcript encoding a putative insulin/insulin-like peptide binding protein suggests that solitary hunting wasps use their venom to control their prey, leading to larval growth cessation. The abundance of these venom components in the venom gland/sac and in the alimentary canal was confirmed by quantitative real-time PCR. Discovery of venom gland/sac-specific transcripts should promote further studies on biologically active components in the venom of solitary hunting wasps. Copyright 2010 Elsevier Ltd. All rights reserved.
Garcia-Reyero, Natàlia; Griffitt, Robert J.; Liu, Li; Kroll, Kevin J.; Farmerie, William G.; Barber, David S.; Denslow, Nancy D.
2009-01-01
A novel custom microarray for largemouth bass (Micropterus salmoides) was designed with sequences obtained from a normalized cDNA library using the 454 Life Sciences GS-20 pyrosequencer. This approach yielded in excess of 58 million bases of high-quality sequence. The sequence information was combined with 2,616 reads obtained by traditional suppressive subtractive hybridizations to derive a total of 31,391 unique sequences. Annotation and coding sequences were predicted for these transcripts where possible. 16,350 annotated transcripts were selected as target sequences for the design of the custom largemouth bass oligonucleotide microarray. The microarray was validated by examining the transcriptomic response in male largemouth bass exposed to 17β-œstradiol. Transcriptomic responses were assessed in liver and gonad, and indicated gene expression profiles typical of exposure to œstradiol. The results demonstrate the potential to rapidly create the tools necessary to assess large scale transcriptional responses in non-model species, paving the way for expanded impact of toxicogenomics in ecotoxicology. PMID:19936325
Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oshima, A.; Kyle, J.W.; Miller, R.D.
1987-02-01
The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less
Xu, Li; Ding, Zhi-Shan; Zhou, Yun-Kai; Tao, Xue-Fen
2009-06-01
To obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis by RACE PCR,then investigate the character of Secoisolariciresinol Dehydrogenase gene. The full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene was obtained by 3'-RACE and 5'-RACE from Dysosma versipellis. We first reported the full cDNA sequences of Secoisolariciresinol Dehydrogenase in Dysosma versipellis. The acquired gene was 991bp in full length, including 5' untranslated region of 42bp, 3' untranslated region of 112bp with Poly (A). The open reading frame (ORF) encoding 278 amino acid with molecular weight 29253.3 Daltons and isolectric point 6.328. The gene accession nucleotide sequence number in GeneBank was EU573789. Semi-quantitative RT-PCR analysis revealed that the Secoisolariciresinol Dehydrogenase gene was highly expressed in stem. Alignment of the amino acid sequence of Secoisolariciresinol Dehydrogenase indicated there may be some significant amino acid sequence difference among different species. Obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis.
Guo, Deyin; Spetz, Carl; Saarma, Mart; Valkonen, Jari P T
2003-05-01
Potyviral helper-component proteinase (HCpro) is a multifunctional protein exerting its cellular functions in interaction with putative host proteins. In this study, cellular protein partners of the HCpro encoded by Potato virus A (PVA) (genus Potyvirus) were screened in a potato leaf cDNA library using a yeast two-hybrid system. Two cellular proteins were obtained that interact specifically with PVA HCpro in yeast and in the two in vitro binding assays used. Both proteins are encoded by single-copy genes in the potato genome. Analysis of the deduced amino acid sequences revealed that one (HIP1) of the two HCpro interactors is a novel RING finger protein. The sequence of the other protein (HIP2) showed no resemblance to the protein sequences available from databanks and has known biological functions.
Wu, Youjia; Wang, Lei; Zhou, Mei; Ma, Chengbang; Chen, Xiaole; Bai, Bing; Chen, Tianbao; Shaw, Chris
2011-06-01
Amphibian skin secretions are rich sources of biologically-active peptides with antimicrobial peptides predominating in many species. Several studies involving molecular cloning of biosynthetic precursor-encoding cDNAs from skin or skin secretions have revealed that these exhibit highly-conserved domain architectures with an unusually high degree of conserved nucleotide and resultant amino acid sequences within the signal peptides. This high degree of nucleotide sequence conservation has permitted the design of primers complementary to such sites facilitating "shotgun" cloning of skin or skin secretion-derived cDNA libraries from hitherto unstudied species. Here we have used such an approach using a skin secretion-derived cDNA library from an unstudied species of Chinese frog - the Fujian large-headed frog, Limnonectes fujianensis - and have discovered two 16-mer peptides of novel primary structures, named limnonectin-1Fa (SFPFFPPGICKRLKRC) and limnonectin-1Fb (SFHVFPPWMCKSLKKC), that represent the prototypes of a new class of amphibian skin antimicrobial peptide. Unusually these limnonectins display activity only against a Gram-negative bacterium (MICs of 35 and 70 μM) and are devoid of haemolytic activity at concentrations up to 160 μM. Thus the "shotgun" cloning approach described can exploit the unusually high degree of nucleotide conservation in signal peptide-encoding domains of amphibian defensive skin secretion peptide precursor-encoding cDNAs to rapidly expedite the discovery of novel and functional defensive peptides in a manner that circumvents specimen sacrifice without compromising robustness of data. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.
1999-01-01
Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geraghty, M.T.; Stetten, G.; Kearns, W.
1994-09-01
X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less
Wang, L; Eriksson, S
2000-01-01
The subcellular localization of mitochondrial thymidine kinase (TK2) has been questioned, since no mitochondrial targeting sequences have been found in cloned human TK2 cDNAs. Here we report the cloning of mouse TK2 cDNA from a mouse full-length enriched cDNA library. The mouse TK2 cDNA codes for a protein of 270 amino acids, with a 40-amino-acid presumed N-terminal mitochondrial targeting signal. In vitro translation and translocation experiments with purified rat mitochondria confirmed that the N-terminal sequence directed import of the precursor TK2 into the mitochondrial matrix. A single 2.4 kb mRNA transcript was detected in most tissues examined, except in liver, where an additional shorter (1.0 kb) transcript was also observed. There was no correlation between the tissue distribution of TK2 activity and the expression of TK2 mRNA. Full-length mouse TK2 protein and two N-terminally truncated forms, one of which corresponds to the mitochondrial form of TK2 and a shorter form corresponding to the previously characterized recombinant human TK2, were expressed in Escherichia coli and affinity purified. All three forms of TK2 phosphorylated thymidine, deoxycytidine and 2'-deoxyuridine, but with different kinetic efficiencies. A number of cytostatic pyrimidine nucleoside analogues were also tested and shown to be good substrates for the various forms of TK2. The active form of full-length mouse TK2 was a dimer, as judged by Superdex 200 chromatography. These results enhance our understanding of the structure and function of TK2, and may help to explain the mitochondrial disorder, mitochondrial neurogastrointestinal encephalomyopathy. PMID:11023833
Dangoudoubiyam, Sriveny; Vemulapalli, Ramesh; Hancock, Kathy; Kazacos, Kevin R.
2010-01-01
Larva migrans caused by Baylisascaris procyonis is an important zoonotic disease. Current serological diagnostic assays for this disease depend on the use of the parasite's larval excretory-secretory (ES) antigens. In order to identify genes encoding ES antigens and to generate recombinant antigens for use in diagnostic assays, construction and immunoscreening of a B. procyonis third-stage larva cDNA expression library was performed and resulted in identification of a partial-length cDNA clone encoding an ES antigen, designated repeat antigen 1 (RAG1). The full-length rag1 cDNA contained a 753-bp open reading frame that encoded a protein of 250 amino acids with 12 tandem repeats of a 12-amino-acid long sequence. The rag1 genomic DNA revealed a single intron of 837 bp that separated the 753-bp coding sequence into two exons delimited by canonical splice sites. No nucleotide or amino acid sequences present in the GenBank databases had significant similarity with those of RAG1. We have cloned, expressed, and purified the recombinant RAG1 (rRAG1) and analyzed its diagnostic potential by enzyme-linked immunosorbent assay. Anti-Baylisascaris species-specific rabbit serum showed strong reactivity to rRAG1, while only minimal to no reactivity was observed with sera against the related ascarids Toxocara canis and Ascaris suum, strongly suggesting the specificity of rRAG1. On the basis of these results, the identified RAG1 appears to be a promising diagnostic antigen for the development of serological assays for specific detection of B. procyonis larva migrans. PMID:20926699
A Calcium-Dependent Protein Kinase Is Systemically Induced upon Wounding in Tomato Plants1
Chico, José Manuel; Raíces, Marcela; Téllez-Iñón, María Teresa; Ulloa, Rita María
2002-01-01
A full-length cDNA clone (LeCDPK1) from tomato (Lycopersicon esculentum) encoding a calcium-dependent protein kinase (CDPK) was isolated by screening a cDNA library from tomato cell cultures exposed to Cladosporium fulvum elicitor preparations. The predicted amino acid sequence of the cDNA reveals a high degree of similarity with other members of the CDPK family. LeCDPK1 has a putative N-terminal myristoylation sequence and presents a possible palmitoylation site. The in vitro translated protein conserves the biochemical properties of a member of the CDPK family. In addition, CDPK activity was detected in soluble and particulate extracts of tomato leaves. Basal levels of LeCDPK1 mRNA were detected by northern-blot analysis in roots, stems, leaves, and flowers of tomato plants. The expression of LeCDPK1 was rapidly and transiently enhanced in detached tomato leaves treated with pathogen elicitors and H2O2. Moreover, when tomato greenhouse plants were subjected to mechanical wounding, a transient increase of LeCDPK1 steady-state mRNA levels was detected locally at the site of the injury and systemically in distant non-wounded leaves. The increase observed in LeCDPK1 mRNA upon wounding correlates with an increase in the amount and in the activity of a soluble CDPK detected in extracts of tomato leaves, suggesting that this kinase is part of physiological plant defense mechanisms against biotic or abiotic attacks. PMID:11788771
Kurtz, Brian M.; Singletary, Lauren B.; Kelly, Sean D.; Frampton, Arthur R.
2010-01-01
In this study, Equus caballus major histocompatibility complex class I (MHC-I) was identified as a cellular entry receptor for the alphaherpesvirus equine herpesvirus type 1 (EHV-1). This novel EHV-1 receptor was discovered using a cDNA library from equine macrophages. cDNAs from this EHV-1-susceptible cell type were inserted into EHV-1-resistant B78H1 murine melanoma cells, these cells were infected with an EHV-1 lacZ reporter virus, and cells that supported virus infection were identified by X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) staining. Positive cells were subjected to several rounds of purification to obtain homogeneous cell populations that were shown to be uniformly infected with EHV-1. cDNAs from these cell populations were amplified by PCR and then sequenced. The sequence data revealed that the EHV-1-susceptible cells had acquired an E. caballus MHC-I cDNA. Cell surface expression of this receptor was verified by confocal immunofluorescence microscopy. The MHC-I cDNA was cloned into a mammalian expression vector, and stable B78H1 cell lines were generated that express this receptor. These cell lines were susceptible to EHV-1 infection while the parental B78H1 cells remained resistant to infection. In addition, EHV-1 infection of the B78H1 MHC-I-expressing cell lines was inhibited in a dose-dependent manner by an anti-MHC-I antibody. PMID:20610718
Lü, Guodong; Zhang, Wenbao; Wang, Jianhua; Xiao, Yunfeng; Zhao, Jun; Zhao, Jianqin; Sun, Yimin; Zhang, Chuanshan; Wang, Junhua; Lin, Renyong; Liu, Hui; Zhang, Fuchun; Wen, Hao
2014-12-01
Cystic echinoccocosis (CE) is a neglected zoonosis that is caused by the dog-tapeworm Echinococcus granulosus. The disease is endemic worldwide. There is an urgent need for searching effective drug for the treatment of the disease. In this study, we sequenced a cDNA library constructed using RNA isolated from oncospheres, protoscoleces, cyst membrane and adult worms of E. granulosus. A total of 9065 non-redundant or unique sequences were obtained and spotted on chips as uniEST probes to profile the gene expression in protoscoleces of E. granulosus treated with the anthelmintic drugs albendazole and artemisinin, respectively. The results showed that 7 genes were up-regulated and 38 genes were down-regulated in the protoscoleces treated with albendazole. Gene analysis showed that these genes are responsible for energy metabolism, cell cycle and assembly of cell structure. We also identified 100 genes up-regulated and 6 genes down-regulated in the protoscoleces treated with artemisinin. These genes play roles in the transduction of environmental signals, and metabolism. Albendazole appeared its drug efficacy in damaging cell structure, while artemisinin was observed to increase the formation of the heterochromatin in protoscolex cells. Our results highlight the utility of using cDNA microarray methods to detect gene expression profiles of E. granulosus and, in particular, to understand the pharmacologic mechanism of anti-echinococcosis drugs. Copyright © 2014 Elsevier B.V. All rights reserved.
Cloning and sequence analysis of Hemonchus contortus HC58cDNA.
Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li
2007-06-01
The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.
ESTree db: a Tool for Peach Functional Genomics
Lazzari, Barbara; Caprera, Andrea; Vecchietti, Alberto; Stella, Alessandra; Milanesi, Luciano; Pozzi, Carlo
2005-01-01
Background The ESTree db represents a collection of Prunus persica expressed sequenced tags (ESTs) and is intended as a resource for peach functional genomics. A total of 6,155 successful EST sequences were obtained from four in-house prepared cDNA libraries from Prunus persica mesocarps at different developmental stages. Another 12,475 peach EST sequences were downloaded from public databases and added to the ESTree db. An automated pipeline was prepared to process EST sequences using public software integrated by in-house developed Perl scripts and data were collected in a MySQL database. A php-based web interface was developed to query the database. Results The ESTree db version as of April 2005 encompasses 18,630 sequences representing eight libraries. Contig assembly was performed with CAP3. Putative single nucleotide polymorphism (SNP) detection was performed with the AutoSNP program and a search engine was implemented to retrieve results. All the sequences and all the contig consensus sequences were annotated both with blastx against the GenBank nr db and with GOblet against the viridiplantae section of the Gene Ontology db. Links to NiceZyme (Expasy) and to the KEGG metabolic pathways were provided. A local BLAST utility is available. A text search utility allows querying and browsing the database. Statistics were provided on Gene Ontology occurrences to assign sequences to Gene Ontology categories. Conclusion The resulting database is a comprehensive resource of data and links related to peach EST sequences. The Sequence Report and Contig Report pages work as the web interface core structures, giving quick access to data related to each sequence/contig. PMID:16351742
ESTree db: a tool for peach functional genomics.
Lazzari, Barbara; Caprera, Andrea; Vecchietti, Alberto; Stella, Alessandra; Milanesi, Luciano; Pozzi, Carlo
2005-12-01
The ESTree db http://www.itb.cnr.it/estree/ represents a collection of Prunus persica expressed sequenced tags (ESTs) and is intended as a resource for peach functional genomics. A total of 6,155 successful EST sequences were obtained from four in-house prepared cDNA libraries from Prunus persica mesocarps at different developmental stages. Another 12,475 peach EST sequences were downloaded from public databases and added to the ESTree db. An automated pipeline was prepared to process EST sequences using public software integrated by in-house developed Perl scripts and data were collected in a MySQL database. A php-based web interface was developed to query the database. The ESTree db version as of April 2005 encompasses 18,630 sequences representing eight libraries. Contig assembly was performed with CAP3. Putative single nucleotide polymorphism (SNP) detection was performed with the AutoSNP program and a search engine was implemented to retrieve results. All the sequences and all the contig consensus sequences were annotated both with blastx against the GenBank nr db and with GOblet against the viridiplantae section of the Gene Ontology db. Links to NiceZyme (Expasy) and to the KEGG metabolic pathways were provided. A local BLAST utility is available. A text search utility allows querying and browsing the database. Statistics were provided on Gene Ontology occurrences to assign sequences to Gene Ontology categories. The resulting database is a comprehensive resource of data and links related to peach EST sequences. The Sequence Report and Contig Report pages work as the web interface core structures, giving quick access to data related to each sequence/contig.
Ramond, J-B; Makhalanyane, T P; Tuffin, M I; Cowan, D A
2015-04-01
Normalization is a procedure classically employed to detect rare sequences in cellular expression profiles (i.e. cDNA libraries). Here, we present a normalization protocol involving the direct treatment of extracted environmental metagenomic DNA with S1 nuclease, referred to as normalization of metagenomic DNA: NmDNA. We demonstrate that NmDNA, prior to post hoc PCR-based experiments (16S rRNA gene T-RFLP fingerprinting and clone library), increased the diversity of sequences retrieved from environmental microbial communities by detection of rarer sequences. This approach could be used to enhance the resolution of detection of ecologically relevant rare members in environmental microbial assemblages and therefore is promising in enabling a better understanding of ecosystem functioning. This study is the first testing 'normalization' on environmental metagenomic DNA (mDNA). The aim of this procedure was to improve the identification of rare phylotypes in environmental communities. Using hypoliths as model systems, we present evidence that this post-mDNA extraction molecular procedure substantially enhances the detection of less common phylotypes and could even lead to the discovery of novel microbial genotypes within a given environment. © 2014 The Society for Applied Microbiology.
Xin, Haiping; Zhu, Wei; Wang, Lina; Xiang, Yue; Fang, Linchuan; Li, Jitao; Sun, Xiaoming; Wang, Nian; Londo, Jason P.; Li, Shaohua
2013-01-01
Grape is one of the most important fruit crops worldwide. The suitable geographical locations and productivity of grapes are largely limited by temperature. Vitis amurensis is a wild grapevine species with remarkable cold-tolerance, exceeding that of Vitis vinifera, the dominant cultivated species of grapevine. However, the molecular mechanisms that contribute to the enhanced freezing tolerance of V. amurensis remain unknown. Here we used deep sequencing data from restriction endonuclease-generated cDNA fragments to evaluate the whole genome wide modification of transcriptome of V. amurensis under cold treatment. Vitis vinifera cv. Muscat of Hamburg was used as control to help investigate the distinctive features of V. amruensis in responding to cold stress. Approximately 9 million tags were sequenced from non-cold treatment (NCT) and cold treatment (CT) cDNA libraries in each species of grapevine sampled from shoot apices. Alignment of tags into V. vinifera cv. Pinot noir (PN40024) annotated genome identified over 15,000 transcripts in each library in V. amruensis and more than 16,000 in Muscat of Hamburg. Comparative analysis between NCT and CT libraries indicate that V. amurensis has fewer differential expressed genes (DEGs, 1314 transcripts) than Muscat of Hamburg (2307 transcripts) when exposed to cold stress. Common DEGs (408 transcripts) suggest that some genes provide fundamental roles during cold stress in grapes. The most robust DEGs (more than 20-fold change) also demonstrated significant differences between two kinds of grapevine, indicating that cold stress may trigger species specific pathways in V. amurensis. Functional categories of DEGs indicated that the proportion of up-regulated transcripts related to metabolism, transport, signal transduction and transcription were more abundant in V. amurensis. Several highly expressed transcripts that were found uniquely accumulated in V. amurensis are discussed in detail. This subset of unique candidate transcripts may contribute to the excellent cold-hardiness of V. amurensis. PMID:23516547
Identification of antigens by monoclonal antibody PD4 and its expression in Escherichia coli
Ning, Jin-Ying; Sun, Guo-Xun; Huang, Su; Ma, Hong; An, Ping; Meng, Lin; Song, Shu-Mei; Wu, Jian; Shou, Cheng-Chao
2003-01-01
AIM: To clone and express the antigen of monoclonal antibody (MAb) PD4 for further investigation of its function. METHODS: MGC803 cDNA expression library was constructed and screened with PD4 as probes to clone the antigen. After failed in the library screening, immunoprecipitation and SDS-polyacrylamide gel electrophoresis were applied to purify the antigen for sequence analysis. The antigen coming from Mycoplasma hyorhinis (M. hyorhinis) was further confirmed with Western blot analysis by infecting M. hyorhinis -free HeLa cells and eliminating the M. hyorhinis from MGC803 cells. The full p37 gene was cloned by PCR and expressed successfully in Escherichia coli after site-directed mutations. Immunofluorescence assay was used to demonstrate if p37 protein could directly bind to gastric tumor cell AGS. RESULTS: The cDNA library constructed with MGC803 cells was screened by MAb PD4 as probes. Unfortunately, the positive clones identified with MAb PD4 were also reacted with unrelated antibodies. Then, immunoprecipitation was performed and the purified antigen was identified to be a membrane protein of Mycoplasma hyorhinis (M. hyorhinis) by sequencing of N-terminal amino acid residues. The membrane protein was intensively verified with Western blot by eliminating M. hyorhinis from MGC803 cells and by infecting M. hyorhinis-free HeLa cells. The full p37 gene was cloned and expressed successfully in Escherichia coli after site-directed mutations. Immunofluorescence demonstrated that p37 protein could directly bind to gastric tumor cell AGS. CONCLUSION: The antigen recognized by MAb PD4 is from M. hyorhinis, which suggests the actions involved in MAb PD4 is possibly mediated by p37 protein or M. hyorhinis. As p37 protein can bind directly to tumor cells, the pathogenic role of p37 involved in tumorigenesis justifies further investigation. PMID:14562370
Rat PPAR delta contains a CGG triplet repeat and is prominently expressed in the thalamic nuclei.
Xing, G; Zhang, L; Zhang, L; Heynen, T; Yoshikawa, T; Smith, M; Weiss, S; Detera-Wadleigh, S
1995-12-26
We have isolated a new rat sequence containing motifs of a nuclear hormone receptor from a brain cDNA library. The deduced amino acid sequence encoded by the cDNA clone showed a strong homology to the human NUCI and the mouse peroxisome proliferator activated receptor delta (PPAR delta). We therefore refer to this new clone as rat PPAR delta (rPPAR delta). The new feature of rPPAR delta is a 14 CGG triplet repeat on the 5' untranslated region, not previously reported in either NUCI or mPPAR delta. We found that rPPAR delta was expressed as a 3.5-kb transcript which showed a wide distribution in adult rat tissues. Abundant expression was detected in brain, heart, skeletal muscle, kidney and lung. Weaker expression was noted in the liver, spleen and testis. To determine the specific brain localization of rPPAR delta we performed in situ hybridization analysis. Prominent expression was observed in the thalamus, particularly in the posterior part of the ventral medial nucleus, a site responsive to pain and cold stress. These results raise the possibility that PPAR delta might play a role in modulating response to thermal and pain sensations.
Huang, T S; Law, J H; Söderhäll, K
1996-03-01
Ferritin was purified from the hepatopancreas of the freshwater crayfish Pacifastacus leniusculus after injection of iron. It has the same size as horse spleen ferritin (440 kDa) and migrates as two bands, 19 kDa and 20 kDa, respectively, in SDS/PAGE under reducing conditions. Crayfish ferritin (20 kDa) was cloned from a hepatopancreas cDNA library. The deduced amino acid sequence of the crayfish ferritin shows a closer relationship to vertebrate ferritin heavy chains than to insect ferritin and contains the conserved H-specific residues for the ferroxidase centre found in vertebrate ferritin heavy chain. An IRE(iron-responsive element)-like sequence with a predicted stem-loop structure was present in the 5' untranslated region of the crayfish ferritin mRNA. Crayfish ferritin does not share the atypical properties of insect ferritins, such as high molecular mass of intact protein, abundance in hemolymph, and export into vacuoles. We suggest that there are two different types of ferritins distributed in different species: insect-type or secretory ferritins which are predominant in the snail oocyte and insects, and vertebrate (crustacean)-type or cytosolic ferritins which are predominant in vertebrates and crustacea.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mullinax, R.L.; Gross, E.A.; Amberg, J.R.
1990-10-01
The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and {kappa} light-chain variable and constant region domains, were inserted into modified bacteriophase {lambda} expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2{percent} in the library. These humanmore » antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen.« less
Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka
2005-01-01
We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.
Reddy, B A; Kloc, M; Etkin, L D
1992-12-01
We have cloned a cDNA (xlan4) from a Xenopus laevis oocyte cDNA library whose cognate mRNA is localized in the animal pole region of full grown oocytes. The cDNA can be translated in vitro to produce a predicted size protein of 35 kDa and, is also expressed in E. coli as a fusion protein. The conceptual protein encoded by the xlan4 cDNA is 17.5% proline rich and possesses several PEST sequences found in proteins with short half-lives. The xlan4 mRNA is 2.6 kb and during early development its titer decreases until the neurula stage after which it begins to reaccumulate. Northern blots on dissected embryos and in situ hybridization revealed that the zygotic expression is limited to the dorsal axial structures consisting primarily of the CNS. UV irradiation of the vegetal pole region immediately following fertilization that produces ventralized embryos results in a loss of zygotic xlan4 expression. In the adult, xlan4 mRNA is limited primarily to the brain. The presence of this mRNA in animal pole region which contributes to the future neural cell lineages suggests that this gene product may function either in the specification of neural cell types or in a neural specific function.
The construction of an EST database for Bombyx mori and its application
Mita, Kazuei; Morimyo, Mitsuoki; Okano, Kazuhiro; Koike, Yoshiko; Nohata, Junko; Kawasaki, Hideki; Kadono-Okuda, Keiko; Yamamoto, Kimiko; Suzuki, Masataka G.; Shimada, Toru; Goldsmith, Marian R.; Maeda, Susumu
2003-01-01
To build a foundation for the complete genome analysis of Bombyx mori, we have constructed an EST database. Because gene expression patterns deeply depend on tissues as well as developmental stages, we analyzed many cDNA libraries prepared from various tissues and different developmental stages to cover the entire set of Bombyx genes. So far, the Bombyx EST database contains 35,000 ESTs from 36 cDNA libraries, which are grouped into ≈11,000 nonredundant ESTs with the average length of 1.25 kb. The comparison with FlyBase suggests that the present EST database, SilkBase, covers >55% of all genes of Bombyx. The fraction of library-specific ESTs in each cDNA library indicates that we have not yet reached saturation, showing the validity of our strategy for constructing an EST database to cover all genes. To tackle the coming saturation problem, we have checked two methods, subtraction and normalization, to increase coverage and decrease the number of housekeeping genes, resulting in a 5–11% increase of library-specific ESTs. The identification of a number of genes and comprehensive cloning of gene families have already emerged from the SilkBase search. Direct links of SilkBase with FlyBase and WormBase provide ready identification of candidate Lepidoptera-specific genes. PMID:14614147
Dlugosch, Katrina M.; Lai, Zhao; Bonin, Aurélie; Hierro, José; Rieseberg, Loren H.
2013-01-01
Transcriptome sequences are becoming more broadly available for multiple individuals of the same species, providing opportunities to derive population genomic information from these datasets. Using the 454 Life Science Genome Sequencer FLX and FLX-Titanium next-generation platforms, we generated 11−430 Mbp of sequence for normalized cDNA for 40 wild genotypes of the invasive plant Centaurea solstitialis, yellow starthistle, from across its worldwide distribution. We examined the impact of sequencing effort on transcriptome recovery and overlap among individuals. To do this, we developed two novel publicly available software pipelines: SnoWhite for read cleaning before assembly, and AllelePipe for clustering of loci and allele identification in assembled datasets with or without a reference genome. AllelePipe is designed specifically for cases in which read depth information is not appropriate or available to assist with disentangling closely related paralogs from allelic variation, as in transcriptome or previously assembled libraries. We find that modest applications of sequencing effort recover most of the novel sequences present in the transcriptome of this species, including single-copy loci and a representative distribution of functional groups. In contrast, the coverage of variable sites, observation of heterozygosity, and overlap among different libraries are all highly dependent on sequencing effort. Nevertheless, the information gained from overlapping regions was informative regarding coarse population structure and variation across our small number of population samples, providing the first genetic evidence in support of hypothesized invasion scenarios. PMID:23390612
Deng, Youping; Dong, Yinghua; Thodima, Venkata; Clem, Rollie J; Passarelli, A Lorena
2006-01-01
Background Little is known about the genome sequences of lepidopteran insects, although this group of insects has been studied extensively in the fields of endocrinology, development, immunity, and pathogen-host interactions. In addition, cell lines derived from Spodoptera frugiperda and other lepidopteran insects are routinely used for baculovirus foreign gene expression. This study reports the results of an expressed sequence tag (EST) sequencing project in cells from the lepidopteran insect S. frugiperda, the fall armyworm. Results We have constructed an EST database using two cDNA libraries from the S. frugiperda-derived cell line, SF-21. The database consists of 2,367 ESTs which were assembled into 244 contigs and 951 singlets for a total of 1,195 unique sequences. Conclusion S. frugiperda is an agriculturally important pest insect and genomic information will be instrumental for establishing initial transcriptional profiling and gene function studies, and for obtaining information about genes manipulated during infections by insect pathogens such as baculoviruses. PMID:17052344
Saito, T; Ochiai, H
1999-10-01
cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.
Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J
1996-02-01
There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.
Tanaka, Takeshi; Shima, Yasuyuki; Ogawa, Naoki; Nagayama, Koki; Yoshida, Takashi; Ohmachi, Tetsuo
2011-01-01
Acetoacetyl-CoA thiolase (AT) is an enzyme that catalyses the CoA-dependent thiolytic cleavage of acetoacetyl-CoA to yield 2 molecules of acetyl-CoA, or the reverse condensation reaction. A full-length cDNA clone pBSGT-3, which has homology to known thiolases, was isolated from Dictyostelium cDNA library. Expression of the protein encoded in pBSGT-3 in Escherichia coli, its thiolase enzyme activity, and the amino acid sequence homology search revealed that pBSGT-3 encodes an AT. The recombinant AT (r-thiolase) was expressed in an active form in an E. coli expression system, and purified to homogeneity by selective ammonium sulfate fractionation and two steps of column chromatography. The purified enzyme exhibited a specific activity of 4.70 mU/mg protein. Its N-terminal sequence was (NH2)-Arg-Met-Tyr-Thr-Thr-Ala-Lys-Asn-Leu-Glu-, which corresponds to the sequence from positions 15 to 24 of the amino acid sequence deduced from pBSGT-3 clone. The r-thiolase in the inclusion body expressed highly in E. coli was the precursor form, which is slightly larger than the purified r-thiolase. When incubated with the cell-free extract of Dictyostelium cells, the precursor was converted to the same size to the purified r-thiolase, suggesting that the presequence at the N-terminus is removed by a Dictyostelium processing peptidase. PMID:21209787
Ghangal, Rajesh; Raghuvanshi, Saurabh; Sharma, Prakash C
2012-02-01
A cDNA library was constructed from the mature leaves of seabuckthorn (Hippophae rhamnoides). Expressed Sequence Tags (ESTs) were generated by single pass sequencing of 4500 cDNA clones. We submitted 3412 ESTs to dbEST of NCBI. Clustering of these ESTs yielded 1665 unigenes comprising of 345 contigs and 1320 singletons. Out of 1665 unigenes, 1278 unigenes were annotated by similarity search while the remaining 387 unannotated unigenes were considered as organism specific. Gene Ontology (GO) analysis of the unigene dataset showed 691 unigenes related to biological processes, 727 to molecular functions and 588 to cellular component category. On the basis of similarity search and GO annotation, 43 unigenes were found responsive to biotic and abiotic stresses. To validate this observation, 13 genes that are known to be associated with cold stress tolerance from previous studies in Arabidopsis and 3 novel transcripts were examined by Real time RT-PCR to understand the change in expression pattern under cold/freeze stress. In silico study of occurrence of microsatellites in these ESTs revealed the presence of 62 Simple Sequence Repeats (SSRs), some of which are being explored to assess genetic diversity among seabuckthorn collections. This is the first report of generation of transcriptome data providing information about genes involved in managing plant abiotic stress in seabuckthorn, a plant known for its enormous medicinal and ecological value. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Urade, Y; Oberdick, J; Molinar-Rode, R; Morgan, J I
1991-01-01
The cerebellum contains a hexadecapeptide, termed cerebellin, that is conserved in sequence from human to chicken. Three independent, overlapping cDNA clones have been isolated from a human cerebellum cDNA library that encode the cerebellin sequence. The longest clone codes for a protein of 193 amino acids that we term precerebellin. This protein has a significant similarity (31.3% identity, 52.2% similarity) to the globular (non-collagen-like) region of the B chain of human complement component C1q. The region of relatedness extends over approximately 145 amino acids located in the carboxyl terminus of both proteins. Unlike C1q B chain, no collagen-like motifs are present in the amino-terminal regions of precerebellin. The amino terminus of precerebellin contains three possible N-linked glycosylation sites. Although hydrophobic amino acids are clustered at the amino terminus, they do not conform to the classical signal-peptide motif, and no other obvious membrane-spanning domains are predicted from the cDNA sequence. The cDNA predicts that the cerebellin peptide is flanked by Val-Arg and Glu-Pro residues. Therefore, cerebellin is not liberated from precerebellin by the classical dibasic amino acid proteolytic-cleavage mechanism seen in many neuropeptide precursors. In Northern (RNA) blots, precerebellin transcripts, with four distinct sizes (1.8, 2.3, 2.7, and 3.0 kilobases), are abundant in cerebellum. These transcripts are present at either very low or undetectable levels in other brain areas and extraneural structures. A similar pattern of cerebellin precursor transcripts are seen in rat, mouse, and human cerebellum. Furthermore, a partial genomic fragment from mouse shows the same bands in Northern blots as the human cDNA clone. During rat development, precerebellin transcripts mirror the level of cerebellin peptide. Low levels of precerebellin mRNA are seen at birth. Levels increase modestly from postpartum day 1 to 8, then increase more dramatically between day 5 and 15, and eventually reach peak values between day 21 and 56. Because cerebellin-like immunoreactivity is associated with Purkinje cell postsynaptic structures, these data raise interesting possibilities concerning the function of the cerebellin precursor in synaptic physiology. Images PMID:1704129
Non-biased and efficient global amplification of a single-cell cDNA library
Huang, Huan; Goto, Mari; Tsunoda, Hiroyuki; Sun, Lizhou; Taniguchi, Kiyomi; Matsunaga, Hiroko; Kambara, Hideki
2014-01-01
Analysis of single-cell gene expression promises a more precise understanding of molecular mechanisms of a living system. Most techniques only allow studies of the expressions for limited numbers of gene species. When amplification of cDNA was carried out for analysing more genes, amplification biases were frequently reported. A non-biased and efficient global-amplification method, which uses a single-cell cDNA library immobilized on beads, was developed for analysing entire gene expressions for single cells. Every step in this analysis from reverse transcription to cDNA amplification was optimized. By removing degrading excess primers, the bias due to the digestion of cDNA was prevented. Since the residual reagents, which affect the efficiency of each subsequent reaction, could be removed by washing beads, the conditions for uniform and maximized amplification of cDNAs were achieved. The differences in the amplification rates for randomly selected eight genes were within 1.5-folds, which could be negligible for most of the applications of single-cell analysis. The global amplification gives a large amount of amplified cDNA (>100 μg) from a single cell (2-pg mRNA), and that amount is enough for downstream analysis. The proposed global-amplification method was used to analyse transcript ratios of multiple cDNA targets (from several copies to several thousand copies) quantitatively. PMID:24141095
Bag, Sudeep; Al Rwahnih, Maher; Li, Ashley; Gonzalez, Asaul; Rowhani, Adib; Uyemoto, Jerry K; Sudarshana, Mysore R
2015-06-01
In spring 2013, 5-year-old nectarine (Prunus persica) trees, grafted on peach rootstock Nemaguard, were found stunted in a propagation block in California. These trees had been propagated from budwood of three nectarine cultivars imported from France and cleared through the post-entry quarantine procedure. Examination of the canopy failed to reveal any obvious symptoms. However, examination of the trunks, after stripping the bark, revealed extensive pitting on the woody cylinder. To investigate the etiological agent, double-stranded RNA was extracted from bark scrapings from the scion and rootstock portions, and a cDNA library was prepared and sequenced using the Illumina platform. BLAST analysis of the contigs generated by the de novo assembly of sequence reads indicated the presence of a novel luteovirus. Complete sequence of the viral genome was determined by sequencing of three overlapping cDNA clones generated by reverse transcription-polymerase chain reaction (RT-PCR) and by rapid amplification of the 5'- and 3'-termini. The virus genome was comprised of 4,991 nucleotides with a gene organization similar to members of the genus Luteovirus (family Luteoviridae). The presence of the virus, tentatively named Nectarine stem pitting-associated virus, was confirmed in symptomatic trees by RT-PCR. Discovery of a new virus in nectarine trees after post-entry quarantine indicates the importance of including (i) metagenomic analysis by next-generation sequencing approach as an essential tool to assess the plant health status, and (ii) examination of the woody cylinders as part of the indexing process.
Koch, P J; Goldschmidt, M D; Walsh, M J; Zimbelmann, R; Schmelz, M; Franke, W W
1991-05-01
Desmosomes are cell-type-specific intercellular junctions found in epithelium, myocardium and certain other tissues. They consist of assemblies of molecules involved in the adhesion of specific cell types and in the anchorage of cell-type-specific cytoskeletal elements, the intermediate-size filaments, to the plasma membrane. To explore the individual desmosomal components and their functions we have isolated DNA clones encoding the desmosomal glycoprotein, desmocollin, using antibodies and a cDNA expression library from bovine muzzle epithelium. The cDNA-deduced amino-acid sequence of desmocollin (presently we cannot decide to which of the two desmocollins, DC I or DC II, this clone relates) defines a polypeptide with a calculated molecular weight of 85,000, with a single candidate sequence of 24 amino acids sufficiently long for a transmembrane arrangement, and an extracellular aminoterminal portion of 561 amino acid residues, compared to a cytoplasmic part of only 176 amino acids. Amino acid sequence comparisons have revealed that desmocollin is highly homologous to members of the cadherin family of cell adhesion molecules, including the previously sequenced desmoglein, another desmosome-specific cadherin. Using riboprobes derived from cDNAs for Northern-blot analyses, we have identified an mRNA of approximately 6 kb in stratified epithelia such as muzzle epithelium and tongue mucosa but not in two epithelial cell culture lines containing desmosomes and desmoplakins. The difference may indicate drastic differences in mRNA concentration or the existence of cell-type-specific desmocollin subforms. The molecular topology of desmocollin(s) is discussed in relation to possible functions of the individual molecular domains.
Microfluidic single-cell whole-transcriptome sequencing.
Streets, Aaron M; Zhang, Xiannian; Cao, Chen; Pang, Yuhong; Wu, Xinglong; Xiong, Liang; Yang, Lu; Fu, Yusi; Zhao, Liang; Tang, Fuchou; Huang, Yanyi
2014-05-13
Single-cell whole-transcriptome analysis is a powerful tool for quantifying gene expression heterogeneity in populations of cells. Many techniques have, thus, been recently developed to perform transcriptome sequencing (RNA-Seq) on individual cells. To probe subtle biological variation between samples with limiting amounts of RNA, more precise and sensitive methods are still required. We adapted a previously developed strategy for single-cell RNA-Seq that has shown promise for superior sensitivity and implemented the chemistry in a microfluidic platform for single-cell whole-transcriptome analysis. In this approach, single cells are captured and lysed in a microfluidic device, where mRNAs with poly(A) tails are reverse-transcribed into cDNA. Double-stranded cDNA is then collected and sequenced using a next generation sequencing platform. We prepared 94 libraries consisting of single mouse embryonic cells and technical replicates of extracted RNA and thoroughly characterized the performance of this technology. Microfluidic implementation increased mRNA detection sensitivity as well as improved measurement precision compared with tube-based protocols. With 0.2 M reads per cell, we were able to reconstruct a majority of the bulk transcriptome with 10 single cells. We also quantified variation between and within different types of mouse embryonic cells and found that enhanced measurement precision, detection sensitivity, and experimental throughput aided the distinction between biological variability and technical noise. With this work, we validated the advantages of an early approach to single-cell RNA-Seq and showed that the benefits of combining microfluidic technology with high-throughput sequencing will be valuable for large-scale efforts in single-cell transcriptome analysis.
Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining
2013-08-01
Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.
The arbuscular mycorrhizal fungal protein glomalin is a putative homolog of heat shock protein 60.
Gadkar, Vijay; Rillig, Matthias C
2006-10-01
Work on glomalin-related soil protein produced by arbuscular mycorrhizal (AM) fungi (AMF) has been limited because of the unknown identity of the protein. A protein band cross-reactive with the glomalin-specific antibody MAb32B11 from the AM fungus Glomus intraradices was partially sequenced using tandem liquid chromatography-mass spectrometry. A 17 amino acid sequence showing similarity to heat shock protein 60 (hsp 60) was obtained. Based on degenerate PCR, a full-length cDNA of 1773 bp length encoding the hsp 60 gene was isolated from a G. intraradices cDNA library. The ORF was predicted to encode a protein of 590 amino acids. The protein sequence had three N-terminal glycosylation sites and a string of GGM motifs at the C-terminal end. The GiHsp 60 ORF had three introns of 67, 76 and 131 bp length. The GiHsp 60 was expressed using an in vitro translation system, and the protein was purified using the 6xHis-tag system. A dot-blot assay on the purified protein showed that it was highly cross-reactive with the glomalin-specific antibody MAb32B11. The present work provides the first evidence for the identity of the glomalin protein in the model AMF G. intraradices, thus facilitating further characterization of this protein, which is of great interest in soil ecology.
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
A Multi-Omics Approach to Evaluate the Quality of Milk Whey Used in Ricotta Cheese Production
Sattin, Eleonora; Andreani, Nadia A.; Carraro, Lisa; Lucchini, Rosaria; Fasolato, Luca; Telatin, Andrea; Balzan, Stefania; Novelli, Enrico; Simionati, Barbara; Cardazzo, Barbara
2016-01-01
In the past, milk whey was only a by-product of cheese production, but currently, it has a high commercial value for use in the food industries. However, the regulation of whey management (i.e., storage and hygienic properties) has not been updated, and as a consequence, its microbiological quality is very challenging for food safety. The Next Generation Sequencing (NGS) technique was applied to several whey samples used for Ricotta production to evaluate the microbial community composition in depth using both RNA and DNA as templates for NGS library construction. Whey samples demonstrating a high microbial and aerobic spore load contained mostly Firmicutes; although variable, some samples contained a relevant amount of Gammaproteobacteria. Several lots of whey acquired as raw material for Ricotta production presented defective organoleptic properties. To define the volatile compounds in normal and defective whey samples, a headspace gas chromatography/mass spectrometry (GC/MS) analysis was conducted. The statistical analysis demonstrated that different microbial communities resulted from DNA or cDNA library sequencing, and distinguishable microbiota composed the communities contained in the organoleptic-defective whey samples. PMID:27582735
Transcriptome Analysis at the Single-Cell Level Using SMART Technology.
Fish, Rachel N; Bostick, Magnolia; Lehman, Alisa; Farmer, Andrew
2016-10-10
RNA sequencing (RNA-seq) is a powerful method for analyzing cell state, with minimal bias, and has broad applications within the biological sciences. However, transcriptome analysis of seemingly homogenous cell populations may in fact overlook significant heterogeneity that can be uncovered at the single-cell level. The ultra-low amount of RNA contained in a single cell requires extraordinarily sensitive and reproducible transcriptome analysis methods. As next-generation sequencing (NGS) technologies mature, transcriptome profiling by RNA-seq is increasingly being used to decipher the molecular signature of individual cells. This unit describes an ultra-sensitive and reproducible protocol to generate cDNA and sequencing libraries directly from single cells or RNA inputs ranging from 10 pg to 10 ng. Important considerations for working with minute RNA inputs are given. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.
Matsunaga, Hiroko; Goto, Mari; Arikawa, Koji; Shirai, Masataka; Tsunoda, Hiroyuki; Huang, Huan; Kambara, Hideki
2015-02-15
Analyses of gene expressions in single cells are important for understanding detailed biological phenomena. Here, a highly sensitive and accurate method by sequencing (called "bead-seq") to obtain a whole gene expression profile for a single cell is proposed. A key feature of the method is to use a complementary DNA (cDNA) library on magnetic beads, which enables adding washing steps to remove residual reagents in a sample preparation process. By adding the washing steps, the next steps can be carried out under the optimal conditions without losing cDNAs. Error sources were carefully evaluated to conclude that the first several steps were the key steps. It is demonstrated that bead-seq is superior to the conventional methods for single-cell gene expression analyses in terms of reproducibility, quantitative accuracy, and biases caused during sample preparation and sequencing processes. Copyright © 2014 Elsevier Inc. All rights reserved.
Molecular and Physiological Analysis of a Heat-Shock Response in Wheat 1
McElwain, Elizabeth F.; Spiker, Steven
1992-01-01
We have isolated two cDNA clones from wheat (Triticum aestivum L. var Stephens), designated WHSP16.8 and WHSP16.9, that are highly similar in sequence to the low molecular weight heat-shock protein genes previously isolated from soybean. RNA blot analysis confirms that these sequences are present in heat-shocked wheat seedlings, but not in control tissues. The WHSP16.8 and WHSP16.9 cDNAs were isolated by screening a lambda gt11 expression library with antibodies to HMGc (a chromosomal protein of wheat). Immunoblot analysis has demonstrated that the antibodies raised against HMGc also recognize a group of proteins that are induced by heat shock and have molecular weights (estimated by sodium dodecyl sulfate electrophoresis) consistent with the molecular weights of the proteins deduced from the sequences of the cDNAs. ImagesFigure 3Figure 4Figure 5 PMID:16669058
ESTuber db: an online database for Tuber borchii EST sequences.
Lazzari, Barbara; Caprera, Andrea; Cosentino, Cristian; Stella, Alessandra; Milanesi, Luciano; Viotti, Angelo
2007-03-08
The ESTuber database (http://www.itb.cnr.it/estuber) includes 3,271 Tuber borchii expressed sequence tags (EST). The dataset consists of 2,389 sequences from an in-house prepared cDNA library from truffle vegetative hyphae, and 882 sequences downloaded from GenBank and representing four libraries from white truffle mycelia and ascocarps at different developmental stages. An automated pipeline was prepared to process EST sequences using public software integrated by in-house developed Perl scripts. Data were collected in a MySQL database, which can be queried via a php-based web interface. Sequences included in the ESTuber db were clustered and annotated against three databases: the GenBank nr database, the UniProtKB database and a third in-house prepared database of fungi genomic sequences. An algorithm was implemented to infer statistical classification among Gene Ontology categories from the ontology occurrences deduced from the annotation procedure against the UniProtKB database. Ontologies were also deduced from the annotation of more than 130,000 EST sequences from five filamentous fungi, for intra-species comparison purposes. Further analyses were performed on the ESTuber db dataset, including tandem repeats search and comparison of the putative protein dataset inferred from the EST sequences to the PROSITE database for protein patterns identification. All the analyses were performed both on the complete sequence dataset and on the contig consensus sequences generated by the EST assembly procedure. The resulting web site is a resource of data and links related to truffle expressed genes. The Sequence Report and Contig Report pages are the web interface core structures which, together with the Text search utility and the Blast utility, allow easy access to the data stored in the database.
Transcriptome analysis of zebrafish embryos exposed to deltamethrin.
Chueh, Tsung-Cheng; Hsu, Li-Sung; Kao, Chin-Ming; Hsu, Tung-Wei; Liao, Hung-Yu; Wang, Kuan-Yi; Chen, Ssu Ching
2017-05-01
Deltamethrin (DTM), a type II pyrethroid, is one of the most commonly used insecticides. The increased use of pyrethroid leads to potential adverse effects, particularly in sensitive populations such as children and pregnant women. None of the related studies was focused on the transcriptome responses in zebrafish embryos after treatment with DTM; therefore, RNA-seq, a high-throughput method, was performed to analyze the global expression of differential expressed genes (DEGs) in zebrafish embryos treated with DTM (40 and 80 μg/L) from fertilization to 48 h postfertilization (hpf) as compared with that in the control group (without DTM treatment). Two cDNA libraries were generated from treated embryos and one cDNA library from nontreated embryos, respectively. Over 92% of reads mapped to the reference in these three libraries. It was observed that many differential genes were expressed in comparison with embryos before and after DTM. The 20 most differentially expressed upregulated or downregulated genes were majorly involved in the signaling transduction. Validation of selected nine genes expression using qRT-PCR confirmed RNA-seq results. The transcriptome sequences were further subjected to gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis, showing G-protein-coupled receptor signaling pathway and neuroactive ligand-receptor interaction, respectively, were most enriched. The data from this study contributed to a better understanding of the potential consequences of fish exposed to DTM, to an evaluation of the potential threat of DTM to fish populations in aquatic environments. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 1548-1557, 2017. © 2016 Wiley Periodicals, Inc.
A deletion mutation at the ep locus causes low seed coat peroxidase activity in soybean.
Gijzen, M
1997-11-01
The Ep locus severely affects the amount of peroxidase enzyme in soybean seed coats. Plants containing the dominant Ep allele accumulate large amounts of peroxidase in the hourglass cells of the sub-epidermis. Homozygous recessive epep genotypes do not accumulate peroxidase in the hourglass cells and are much reduced in total seed coat peroxidase activity. To isolate the gene encoding the seed coat peroxidase and to determine whether it corresponds to the Ep locus, a cDNA library was constructed from developing seed coats and an abundant 1.3 kb peroxidase transcript was cloned. The corresponding structural gene was also isolated from a genomic library. Sequence analysis shows that the seed coat peroxidase is translated as a 352 amino acid precursor protein of 38 kDa. Processing of a putative 26 amino acid signal sequence results in a mature protein of 326 residues with a calculated mass of 35 kDa and a pl of 4.4. Using probes derived from the cDNA, genomic DNA blot hybridization and polymerase chain reaction analysis detected polymorphisms that distinguished EpEp and epep genotypes. Co-segregation of the polymorphisms in an F2 population from a cross of EpEp and epep plants shows that the Ep locus encodes the seed coat peroxidase protein. Comparison of Ep and ep alleles indicates that the recessive gene lacks 87 bp of sequence encompassing the translation start codon. Analysis by RNA blot hybridization shows that epep plants have drastically reduced amounts of peroxidase transcript compared with EpEp plants. The peroxidase mRNA is abundant in seed coat tissues of EpEp plants during the late stages of seed maturation, and could also be detected in root tissues, but not in the flower, embryo, pod or leaf. The results indicate that the lack of peroxidase accumulation in seed coats of homozygous recessive epep plants is due to a mutation of the structural gene that reduces transcript abundance.
Wang, Yue-qi; Zhou, Yan; Cheng, Na; Chen, Mu-xin; Ai, Lin; Liu, Yu-hua; Zhang, Jian-guo; Luo, Jia-jun; Xu, Xue-nian
2015-04-01
To immunoscreen the gene encoding thioredoxin peroxidase (TPx) from a cDNA library made from adult Fasciola gigantica worms, clone and express the gene, and evaluate the immunodiagnostic value of TPx recombinant protein. The A ZAP cDNA library was immunoscreened with pooled serum of fascioliasis gigantica patients. The obtained positive clones were sequenced and analyzed by multiple sequence alignment. The full-length (rFgTPx) and N-termianal truncated (rFgTPx_nt) sequence of FgTPx was subcloned into prokaryotic plasmid pET28a(+) with a non-fusion expression technique, respectively. The recombinant proteins of rFgTPx and rFgTPx_nt were purified by His-bind affinity column (Ni-NTA). rFgTPx and rFgTPx_nt were used in indirect ELISA to test the antibody response of the serum samples. Sera of 27 fascioliasis gigantica patients, 15 patients with schistosomaisis japonica, 15 clonorchiasis sinensis patients, and 32 healthy donors were tested by using the recombinant protein based ELISA. The TPx recombinant proteins were obtained through expression, purification and renaturation, the relative molecular mass of rFgTPx and rFgTPx_nt were Mr 30,000 and Mr 26,000, respectively. The total diagnostic coincidence rate, sensitivity and specificity of rFgTPx_nt-based ELISA was 87.6% (78/89), 66.7% (18/27), and 96.8% (60/62), respectively. The cross reaction with Schistosoma japonicum and Clonorchis sinensis was 0 and 1/15 for rFgTPx_nt, respectively. Before and after treatment, A450 value of the serum samples from fascioliasis patients was 0.233 ± 0.088 and 0.129 ± 0.072, respectively (t = 4.27, P < 0.01). The gene encoding TPx is expressed in the prokaryotic expression system. The recombinant protein shows proper sensitivity and high specificity for the serodiagnosis of Fasciola gigantica infection.
Starcevic, Antonio; Dunlap, Walter C; Cullum, John; Shick, J Malcolm; Hranueli, Daslav; Long, Paul F
2010-11-12
The success of tropical reef-building corals depends on the metabolic co-operation between the animal host and the photosynthetic performance of endosymbiotic algae residing within its cells. To examine the molecular response of the coral Acropora microphthalma to high levels of solar irradiance, a cDNA library was constructed by PCR-based suppression subtractive hybridisation (PCR-SSH) from mRNA obtained by transplantation of a colony from a depth of 12.7 m to near-surface solar irradiance, during which the coral became noticeably paler from loss of endosymbionts in sun-exposed tissues. A novel approach to sequence annotation of the cDNA library gave genetic evidence for a hypothetical biosynthetic pathway branching from the shikimic acid pathway that leads to the formation of 4-deoxygadusol. This metabolite is a potent antioxidant and expected precursor of the UV-protective mycosporine-like amino acids (MAAs), which serve as sunscreens in coral phototrophic symbiosis. Empirical PCR based evidence further upholds the contention that the biosynthesis of these MAA sunscreens is a 'shared metabolic adaptation' between the symbiotic partners. Additionally, gene expression induced by enhanced solar irradiance reveals a cellular mechanism of light-induced coral bleaching that invokes a Ca(2+)-binding synaptotagmin-like regulator of SNARE protein assembly of phagosomal exocytosis, whereby algal partners are lost from the symbiosis. Bioinformatics analyses of DNA sequences obtained by differential gene expression of a coral exposed to high solar irradiance has revealed the identification of putative genes encoding key steps of the MAA biosynthetic pathway. Revealed also by this treatment are genes that implicate exocytosis as a cellular process contributing to a breakdown in the metabolically essential partnership between the coral host and endosymbiotic algae, which manifests as coral bleaching.
Bent, Zachary W.; Poorey, Kunal; LaBauve, Annette E.; ...
2016-12-21
When analyzing pathogen transcriptomes during the infection of host cells, the signal-to-background (pathogen-to-host) ratio of nucleic acids (NA) in infected samples is very small. Despite the advancements in next-generation sequencing, the minute amount of pathogen NA makes standard RNA-seq library preps inadequate for effective gene-level analysis of the pathogen in cases with low bacterial loads. In order to provide a more complete picture of the pathogen transcriptome during an infection, we developed a novel pathogen enrichment technique, which can enrich for transcripts from any cultivable bacteria or virus, using common, readily available laboratory equipment and reagents. To evenly enrich formore » pathogen transcripts, we generate biotinylated pathogen-targeted capture probes in an enzymatic process using the entire genome of the pathogen as a template. The capture probes are hybridized to a strand-specific cDNA library generated from an RNA sample. The biotinylated probes are captured on a monomeric avidin resin in a miniature spin column, and enriched pathogen-specific cDNA is eluted following a series of washes. To test this method, we performed an in vitro time-course infection using Klebsiella pneumoniae to infect murine macrophage cells. K. pneumoniae transcript enrichment efficiency was evaluated using RNA-seq. Bacterial transcripts were enriched up to ~400-fold, and allowed the recovery of transcripts from ~2000–3600 genes not observed in untreated control samples. These additional transcripts revealed interesting aspects of K. pneumoniae biology including the expression of putative virulence factors and the expression of several genes responsible for antibiotic resistance even in the absence of drugs.« less
Priyanka, B; Sekhar, K; Sunita, T; Reddy, V D; Rao, Khareedu Venkateswara
2010-03-01
Pigeonpea, a major grain legume crop with remarkable drought tolerance traits, has been used for the isolation of stress-responsive genes. Herein, we report generation of ESTs, transcript profiles of selected genes and validation of candidate genes obtained from the subtracted cDNA libraries of pigeonpea plants subjected to PEG/water-deficit stress conditions. Cluster analysis of 124 selected ESTs yielded 75 high-quality ESTs. Homology searches disclosed that 55 ESTs share significant similarity with the known/putative proteins or ESTs available in the databases. These ESTs were characterized and genes relevant to the specific physiological processes were identified. Of the 75 ESTs obtained from the cDNA libraries of drought-stressed plants, 20 ESTs proved to be unique to the pigeonpea. These sequences are envisaged to serve as a potential source of stress-inducible genes of the drought stress-response transcriptome, and hence may be used for deciphering the mechanism of drought tolerance of the pigeonpea. Expression profiles of selected genes revealed increased levels of m-RNA transcripts in pigeonpea plants subjected to different abiotic stresses. Transgenic Arabidopsis lines, expressing Cajanus cajan hybrid-proline-rich protein (CcHyPRP), C. cajan cyclophilin (CcCYP) and C. cajan cold and drought regulatory (CcCDR) genes, exhibited marked tolerance, increased plant biomass and enhanced photosynthetic rates under PEG/NaCl/cold/heat stress conditions. This study represents the first report dealing with the isolation of drought-specific ESTs, transcriptome analysis and functional validation of drought-responsive genes of the pigeonpea. These genes, as such, hold promise for engineering crop plants bestowed with tolerance to major abiotic stresses.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bent, Zachary W.; Poorey, Kunal; LaBauve, Annette E.
When analyzing pathogen transcriptomes during the infection of host cells, the signal-to-background (pathogen-to-host) ratio of nucleic acids (NA) in infected samples is very small. Despite the advancements in next-generation sequencing, the minute amount of pathogen NA makes standard RNA-seq library preps inadequate for effective gene-level analysis of the pathogen in cases with low bacterial loads. In order to provide a more complete picture of the pathogen transcriptome during an infection, we developed a novel pathogen enrichment technique, which can enrich for transcripts from any cultivable bacteria or virus, using common, readily available laboratory equipment and reagents. To evenly enrich formore » pathogen transcripts, we generate biotinylated pathogen-targeted capture probes in an enzymatic process using the entire genome of the pathogen as a template. The capture probes are hybridized to a strand-specific cDNA library generated from an RNA sample. The biotinylated probes are captured on a monomeric avidin resin in a miniature spin column, and enriched pathogen-specific cDNA is eluted following a series of washes. To test this method, we performed an in vitro time-course infection using Klebsiella pneumoniae to infect murine macrophage cells. K. pneumoniae transcript enrichment efficiency was evaluated using RNA-seq. Bacterial transcripts were enriched up to ~400-fold, and allowed the recovery of transcripts from ~2000–3600 genes not observed in untreated control samples. These additional transcripts revealed interesting aspects of K. pneumoniae biology including the expression of putative virulence factors and the expression of several genes responsible for antibiotic resistance even in the absence of drugs.« less
Hosseini, R; Benton, D C; Dunn, P M; Jenkinson, D H; Moss, G W
2001-09-01
1. Our aim was to identify the small-conductance Ca(2+)-activated K(+) channel(s) (SK) underlying the apamin-sensitive afterhyperpolarization (AHP) in rat superior cervical ganglion (SCG) neurones. 2. Degenerate oligonucleotide primers designed to the putative calmodulin-binding domain conserved in all mammalian SK channel sequences were employed to detect SK DNA in a cDNA library from rat SCG. Only a single band, corresponding to a fragment of the rSK3 gene, was amplified. 3. Northern blot analysis employing a PCR-generated rSK3 fragment showed the presence of mRNA coding for SK3 in SCG as well in other rat peripheral tissues including adrenal gland and liver. 4. The same rSK3 fragment enabled the isolation of a full-length rSK3 cDNA from the library. Its sequence was closely similar to, but not identical with, that of the previously reported rSK3 gene. 5. Expression of the rSK3 gene in mammalian cell lines (CHO, HEK cells) caused the appearance of a K(+) conductance with SK channel properties. 6. The application of selective SK blocking agents (including apamin, scyllatoxin and newer non-peptidic compounds) showed these homomeric SK3 channels to have essentially the same pharmacological characteristics as the SCG afterhyperpolarization, but to differ from those of homomeric SK1 and SK2 channels. 7. Immunohistochemistry using a rSK3 antipeptide antibody revealed the presence of SK3 protein in the cell bodies and processes of cultured SCG neurones. 8. Taken together, these results identify SK3 as a major component of the SK channels responsible for the afterhyperpolarization of cultured rat SCG neurones.
Jackson, S; Gascón, J; Carrera, E; Monte, E; Prat, S
1997-01-01
Differential screening of a potato leaf cDNA library with cDNA probes made from tuberizing and non-tuberizing Solanum demissum plants led to the identification of a clone that is upregulated in leaves and other tissues upon tuberization. This clone was also shown to have a high level of expression in green tomato fruit, its expression falling off as the fruit turns red. No sucrose or hormonal regulation of the expression of this clone was observed and it did not respond to wounding or heat stress. Clone 32B is 532 bp long and contains an open reading frame encoding a small protein of 98 amino acids. The deduced protein sequence has a putative signal peptide for ER transport and a 10 amino acid domain in the C-terminal region of the protein, both of which are also found in the cotton LEA5, Arabidopsis Di21 and the mungbean Arg2 proteins.
Human Neoplasms Elicit Multiple Specific Immune Responses in the Autologous Host
NASA Astrophysics Data System (ADS)
Sahin, Ugur; Tureci, Ozlem; Schmitt, Holger; Cochlovius, Bjorn; Johannes, Thomas; Schmits, Rudolf; Stenner, Frank; Luo, Guorong; Schobert, Ingrid; Pfreundschuh, Michael
1995-12-01
Expression of cDNA libraries from human melanoma, renal cancer, astrocytoma, and Hodgkin disease in Escherichia coli and screening for clones reactive with high-titer IgG antibodies in autologous patient serum lead to the discovery of at least four antigens with a restricted expression pattern in each tumor. Besides antigens known to elicit T-cell responses, such as MAGE-1 and tyrosinase, numerous additional antigens that were overexpressed or specifically expressed in tumors of the same type were identified. Sequence analyses suggest that many of these molecules, besides being the target of a specific immune response, might be of relevance for tumor growth. Antibodies to a given antigen were usually confined to patients with the same tumor type. The unexpected frequency of human tumor antigens, which can be readily defined at the molecular level by the serological analysis of autologous tumor cDNA expression cloning, indicates that human neoplasms elicit multiple specific immune responses in the autologous host and provides diagnostic and therapeutic approaches to human cancer.
Somatic hypermutation and junctional diversification at Ig heavy chain loci in the nurse shark.
Malecek, Karolina; Brandman, Julie; Brodsky, Jennie E; Ohta, Yuko; Flajnik, Martin F; Hsu, Ellen
2005-12-15
We estimate there are approximately 15 IgM H chain loci in the nurse shark genome and have characterized one locus. It consists of one V, two D, and one J germline gene segments, and the constant (C) region can be distinguished from all of the others by a unique combination of restriction endonuclease sites in Cmu2. On the basis of these Cmu2 markers, 22 cDNA clones were selected from an epigonal organ cDNA library from the same individual; their C region sequences proved to be the same up to the polyadenylation site. With the identification of the corresponding germline gene segments, CDR3 from shark H chain rearrangements could be analyzed precisely, for the first time. Considerable diversity was generated by trimming and N addition at the three junctions and by varied recombination patterns of the two D gene segments. The cDNA sequences originated from independent rearrangements events, and most carried both single and contiguous substitutions. The 53 point mutations occurred with a bias for transition changes (53%), whereas the 78 tandem substitutions, mostly 2-4 bp long, do not (36%). The nature of the substitution patterns is the same as for mutants from six loci of two nurse shark L chain isotypes, showing that somatic hypermutation events are very similar at both H and L chain genes in this early vertebrate. The cis-regulatory elements targeting somatic hypermutation must have already existed in the ancestral Ig gene, before H and L chain divergence.
Su, Y; Feng, J; Sun, X; Guo, Z; Xu, L; Jiang, J
2013-01-01
Chemokines are small, secreted cytokine peptides, known principally for their ability to induce migration and activation of leukocyte populations under both pathological and physiological conditions. On the basis of previously constructed express sequence tags (ESTs) of the head kidney and spleen cDNA library of the perciform marine fish Rachycentron canadum (common name cobia). We used bi-directional rapid amplification of cDNA ends (RACE) and obtained a full-length cDNA of a new CC chemokine gene (designated RcCC3). The RcCC3 putative peptide exhibits sequence similarity to the group of CCL19/21/25 CC chemokines. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used in transcript expression studies of RcCC3. We examined the constitutive expression of the transcripts in 12 tissues of non-stressed cobia; RcCC3 transcripts were detected in all tissues examined, with the highest expression in gill and liver, following by head kidney, kidney, spleen, skin, intestine, muscle, stomach, heart, blood and brain. Transcript expression of RcCC3 was examined in immune-related organs, including head kidney, spleen and liver, following intraperitoneal injection of phosphate-buffered saline control, polyriboinosinic polyribocytidylic acid (poly(I:C)) and formalin-killed Vibrio carchariae (bacterial vaccine). The transcripts in these tissues were quickly up-regulated by the injection of poly(I:C) and bacterial vaccine at early time points, although with different expression profiles. These results indicate RcCC3 represents an important component of innate immunity in cobia.
NASA Astrophysics Data System (ADS)
Xue, Zhuang; Li, Hui; Liu, Yang; Zhou, Wei; Sun, Jing; Wang, Xiuli
2017-12-01
As a `living fossil' of species origin and `rich treasure' of food and nutrition development, sea cucumber has received a lot of attentions from researchers. The cDNA library construction and EST sequencing of blood had been conducted previously in our lab. The bioinformatic analysis provided a gene fragment which is highly homologous with the genes of lectin family, named AjL ( Apostichopus japonicus lectin). To characterize and determine the phylogeny of AjL genes in early evolution, we isolated a full-length cDNA of lectin gene from the body wall of A. japonicus. The open reading frame of this gene contained 489 bp and encoded a 163 amino acids secretory protein being homologous to lectins of mammals and aquatic organisms. The deduced protein included a lectin-like domain. SDS-PAGE analysis showed that AjL migrated as a specific band (about 36.09 kDa under reducing), and agglutinated against rabbit red blood cells. AjL was similar to chain A of CEL-IV in space structure. We predicted that AjL may play the same role of CEL-IV. Our results suggested that more than one lectin gene functioned in sea cucumber and most of other species, which was fused by uncertain sequences during the evolution and encoded different proteins with diverse functions. Our findings provided the insights into the function and characteristics of lectin genes invertebrates. The results will also be helpful for the identification and structural, functional, and evolutionary analyses of lectin genes.
2013-01-01
Background Although banana (Musa sp.) is an important edible crop, contributing towards poverty alleviation and food security, limited transcriptome datasets are available for use in accelerated molecular-based breeding in this genus. 454 GS-FLX Titanium technology was employed to determine the sequence of gene transcripts in genotypes of Musa acuminata ssp. burmannicoides Calcutta 4 and M. acuminata subgroup Cavendish cv. Grande Naine, contrasting in resistance to the fungal pathogen Mycosphaerella musicola, causal organism of Sigatoka leaf spot disease. To enrich for transcripts under biotic stress responses, full length-enriched cDNA libraries were prepared from whole plant leaf materials, both uninfected and artificially challenged with pathogen conidiospores. Results The study generated 846,762 high quality sequence reads, with an average length of 334 bp and totalling 283 Mbp. De novo assembly generated 36,384 and 35,269 unigene sequences for M. acuminata Calcutta 4 and Cavendish Grande Naine, respectively. A total of 64.4% of the unigenes were annotated through Basic Local Alignment Search Tool (BLAST) similarity analyses against public databases. Assembled sequences were functionally mapped to Gene Ontology (GO) terms, with unigene functions covering a diverse range of molecular functions, biological processes and cellular components. Genes from a number of defense-related pathways were observed in transcripts from each cDNA library. Over 99% of contig unigenes mapped to exon regions in the reference M. acuminata DH Pahang whole genome sequence. A total of 4068 genic-SSR loci were identified in Calcutta 4 and 4095 in Cavendish Grande Naine. A subset of 95 potential defense-related gene-derived simple sequence repeat (SSR) loci were validated for specific amplification and polymorphism across M. acuminata accessions. Fourteen loci were polymorphic, with alleles per polymorphic locus ranging from 3 to 8 and polymorphism information content ranging from 0.34 to 0.82. Conclusions A large set of unigenes were characterized in this study for both M. acuminata Calcutta 4 and Cavendish Grande Naine, increasing the number of public domain Musa ESTs. This transcriptome is an invaluable resource for furthering our understanding of biological processes elicited during biotic stresses in Musa. Gene-based markers will facilitate molecular breeding strategies, forming the basis of genetic linkage mapping and analysis of quantitative trait loci. PMID:23379821
Mapping the miRNA interactome by crosslinking ligation and sequencing of hybrids (CLASH)
Helwak, Aleksandra; Tollervey, David
2014-01-01
RNA-RNA interactions play critical roles in many cellular processes but studying them is difficult and laborious. Here, we describe an experimental procedure, termed crosslinking ligation and sequencing of hybrids (CLASH), which allows high-throughput identification of sites of RNA-RNA interaction. During CLASH, a tagged bait protein is UV crosslinked in vivo to stabilise RNA interactions and purified under denaturing conditions. RNAs associated with the bait protein are partially truncated, and the ends of RNA-duplexes are ligated together. Following linker addition, cDNA library preparation and high-throughput sequencing, the ligated duplexes give rise to chimeric cDNAs, which unambiguously identify RNA-RNA interaction sites independent of bioinformatic predictions. This protocol is optimized for studying miRNA targets bound by Argonaute proteins, but should be easily adapted for other RNA-binding proteins and classes of RNA. The protocol requires around 5 days to complete, excluding the time required for high-throughput sequencing and bioinformatic analyses. PMID:24577361
2010-01-01
Background Cutaneous mycoses are common human infections among healthy and immunocompromised hosts, and the anthropophilic fungus Trichophyton rubrum is the most prevalent microorganism isolated from such clinical cases worldwide. The aim of this study was to determine the transcriptional profile of T. rubrum exposed to various stimuli in order to obtain insights into the responses of this pathogen to different environmental challenges. Therefore, we generated an expressed sequence tag (EST) collection by constructing one cDNA library and nine suppression subtractive hybridization libraries. Results The 1388 unigenes identified in this study were functionally classified based on the Munich Information Center for Protein Sequences (MIPS) categories. The identified proteins were involved in transcriptional regulation, cellular defense and stress, protein degradation, signaling, transport, and secretion, among other functions. Analysis of these unigenes revealed 575 T. rubrum sequences that had not been previously deposited in public databases. Conclusion In this study, we identified novel T. rubrum genes that will be useful for ORF prediction in genome sequencing and facilitating functional genome analysis. Annotation of these expressed genes revealed metabolic adaptations of T. rubrum to carbon sources, ambient pH shifts, and various antifungal drugs used in medical practice. Furthermore, challenging T. rubrum with cytotoxic drugs and ambient pH shifts extended our understanding of the molecular events possibly involved in the infectious process and resistance to antifungal drugs. PMID:20144196
Construction, database integration, and application of an Oenothera EST library.
Mrácek, Jaroslav; Greiner, Stephan; Cho, Won Kyong; Rauwolf, Uwe; Braun, Martha; Umate, Pavan; Altstätter, Johannes; Stoppel, Rhea; Mlcochová, Lada; Silber, Martina V; Volz, Stefanie M; White, Sarah; Selmeier, Renate; Rudd, Stephen; Herrmann, Reinhold G; Meurer, Jörg
2006-09-01
Coevolution of cellular genetic compartments is a fundamental aspect in eukaryotic genome evolution that becomes apparent in serious developmental disturbances after interspecific organelle exchanges. The genus Oenothera represents a unique, at present the only available, resource to study the role of the compartmentalized plant genome in diversification of populations and speciation processes. An integrated approach involving cDNA cloning, EST sequencing, and bioinformatic data mining was chosen using Oenothera elata with the genetic constitution nuclear genome AA with plastome type I. The Gene Ontology system grouped 1621 unique gene products into 17 different functional categories. Application of arrays generated from a selected fraction of ESTs revealed significantly differing expression profiles among closely related Oenothera species possessing the potential to generate fertile and incompatible plastid/nuclear hybrids (hybrid bleaching). Furthermore, the EST library provides a valuable source of PCR-based polymorphic molecular markers that are instrumental for genotyping and molecular mapping approaches.
Trumbić, Željka; Bekaert, Michaël; Taggart, John B; Bron, James E; Gharbi, Karim; Mladineo, Ivona
2015-11-25
The largest of the tuna species, Atlantic bluefin tuna (Thunnus thynnus), inhabits the North Atlantic Ocean and the Mediterranean Sea and is considered to be an endangered species, largely a consequence of overfishing. T. thynnus aquaculture, referred to as fattening or farming, is a capture based activity dependent on yearly renewal from the wild. Thus, the development of aquaculture practices independent of wild resources can provide an important contribution towards ensuring security and sustainability of this species in the longer-term. The development of such practices is today greatly assisted by large scale transcriptomic studies. We have used pyrosequencing technology to sequence a mixed-tissue normalised cDNA library, derived from adult T. thynnus. A total of 976,904 raw sequence reads were assembled into 33,105 unique transcripts having a mean length of 893 bases and an N50 of 870. Of these, 33.4% showed similarity to known proteins or gene transcripts and 86.6% of them were matched to the congeneric Pacific bluefin tuna (Thunnus orientalis) genome, compared to 70.3% for the more distantly related Nile tilapia (Oreochromis niloticus) genome. Transcript sequences were used to develop a novel 15 K Agilent oligonucleotide DNA microarray for T. thynnus and comparative tissue gene expression profiles were inferred for gill, heart, liver, ovaries and testes. Functional contrasts were strongest between gills and ovaries. Gills were particularly associated with immune system, signal transduction and cell communication, while ovaries displayed signatures of glycan biosynthesis, nucleotide metabolism, transcription, translation, replication and repair. Sequence data generated from a novel mixed-tissue T. thynnus cDNA library provide an important transcriptomic resource that can be further employed for study of various aspects of T. thynnus ecology and genomics, with strong applications in aquaculture. Tissue-specific gene expression profiles inferred through the use of novel oligo-microarray can serve in the design of new and more focused transcriptomic studies for future research of tuna physiology and assessment of the welfare in a production environment.
Generation, annotation and analysis of ESTs from Trichoderma harzianum CECT 2413
Vizcaíno, Juan Antonio; González, Francisco Javier; Suárez, M Belén; Redondo, José; Heinrich, Julian; Delgado-Jarana, Jesús; Hermosa, Rosa; Gutiérrez, Santiago; Monte, Enrique; Llobell, Antonio; Rey, Manuel
2006-01-01
Background The filamentous fungus Trichoderma harzianum is used as biological control agent of several plant-pathogenic fungi. In order to study the genome of this fungus, a functional genomics project called "TrichoEST" was developed to give insights into genes involved in biological control activities using an approach based on the generation of expressed sequence tags (ESTs). Results Eight different cDNA libraries from T. harzianum strain CECT 2413 were constructed. Different growth conditions involving mainly different nutrient conditions and/or stresses were used. We here present the analysis of the 8,710 ESTs generated. A total of 3,478 unique sequences were identified of which 81.4% had sequence similarity with GenBank entries, using the BLASTX algorithm. Using the Gene Ontology hierarchy, we performed the annotation of 51.1% of the unique sequences and compared its distribution among the gene libraries. Additionally, the InterProScan algorithm was used in order to further characterize the sequences. The identification of the putatively secreted proteins was also carried out. Later, based on the EST abundance, we examined the highly expressed genes and a hydrophobin was identified as the gene expressed at the highest level. We compared our collection of ESTs with the previous collections obtained from Trichoderma species and we also compared our sequence set with different complete eukaryotic genomes from several animals, plants and fungi. Accordingly, the presence of similar sequences in different kingdoms was also studied. Conclusion This EST collection and its annotation provide a significant resource for basic and applied research on T. harzianum, a fungus with a high biotechnological interest. PMID:16872539
The spermatogenic cell-specific variant of glyceraldehyde 3-phosphate dehydrogenase (GAPDS) has been cloned from a rat testis cDNA library and its pattern of expression determined. A 1417 nucleotide cDNA has been found to encode an enzyme with substantial homology to mouse GAPDS...
2010-01-01
Background Suppression subtractive hybridization is a popular technique for gene discovery from non-model organisms without an annotated genome sequence, such as cowpea (Vigna unguiculata (L.) Walp). We aimed to use this method to enrich for genes expressed during drought stress in a drought tolerant cowpea line. However, current methods were inefficient in screening libraries and management of the sequence data, and thus there was a need to develop software tools to facilitate the process. Results Forward and reverse cDNA libraries enriched for cowpea drought response genes were screened on microarrays, and the R software package SSHscreen 2.0.1 was developed (i) to normalize the data effectively using spike-in control spot normalization, and (ii) to select clones for sequencing based on the calculation of enrichment ratios with associated statistics. Enrichment ratio 3 values for each clone showed that 62% of the forward library and 34% of the reverse library clones were significantly differentially expressed by drought stress (adjusted p value < 0.05). Enrichment ratio 2 calculations showed that > 88% of the clones in both libraries were derived from rare transcripts in the original tester samples, thus supporting the notion that suppression subtractive hybridization enriches for rare transcripts. A set of 118 clones were chosen for sequencing, and drought-induced cowpea genes were identified, the most interesting encoding a late embryogenesis abundant Lea5 protein, a glutathione S-transferase, a thaumatin, a universal stress protein, and a wound induced protein. A lipid transfer protein and several components of photosynthesis were down-regulated by the drought stress. Reverse transcriptase quantitative PCR confirmed the enrichment ratio values for the selected cowpea genes. SSHdb, a web-accessible database, was developed to manage the clone sequences and combine the SSHscreen data with sequence annotations derived from BLAST and Blast2GO. The self-BLAST function within SSHdb grouped redundant clones together and illustrated that the SSHscreen plots are a useful tool for choosing anonymous clones for sequencing, since redundant clones cluster together on the enrichment ratio plots. Conclusions We developed the SSHscreen-SSHdb software pipeline, which greatly facilitates gene discovery using suppression subtractive hybridization by improving the selection of clones for sequencing after screening the library on a small number of microarrays. Annotation of the sequence information and collaboration was further enhanced through a web-based SSHdb database, and we illustrated this through identification of drought responsive genes from cowpea, which can now be investigated in gene function studies. SSH is a popular and powerful gene discovery tool, and therefore this pipeline will have application for gene discovery in any biological system, particularly non-model organisms. SSHscreen 2.0.1 and a link to SSHdb are available from http://microarray.up.ac.za/SSHscreen. PMID:20359330
Cao, Shuanghe; Siriwardana, Chamindika L; Kumimoto, Roderick W; Holt, Ben F
2011-05-19
Monocots, especially the temperate grasses, represent some of the most agriculturally important crops for both current food needs and future biofuel development. Because most of the agriculturally important grass species are difficult to study (e.g., they often have large, repetitive genomes and can be difficult to grow in laboratory settings), developing genetically tractable model systems is essential. Brachypodium distachyon (hereafter Brachypodium) is an emerging model system for the temperate grasses. To fully realize the potential of this model system, publicly accessible discovery tools are essential. High quality cDNA libraries that can be readily adapted for multiple downstream purposes are a needed resource. Additionally, yeast two-hybrid (Y2H) libraries are an important discovery tool for protein-protein interactions and are not currently available for Brachypodium. We describe the creation of two high quality, publicly available Gateway™ cDNA entry libraries and their derived Y2H libraries for Brachypodium. The first entry library represents cloned cDNA populations from both short day (SD, 8/16-h light/dark) and long day (LD, 20/4-h light/dark) grown plants, while the second library was generated from hormone treated tissues. Both libraries have extensive genome coverage (~5 × 107 primary clones each) and average clone lengths of ~1.5 Kb. These entry libraries were then used to create two recombination-derived Y2H libraries. Initial proof-of-concept screens demonstrated that a protein with known interaction partners could readily re-isolate those partners, as well as novel interactors. Accessible community resources are a hallmark of successful biological model systems. Brachypodium has the potential to be a broadly useful model system for the grasses, but still requires many of these resources. The Gateway™ compatible entry libraries created here will facilitate studies for multiple user-defined purposes and the derived Y2H libraries can be immediately applied to large scale screening and discovery of novel protein-protein interactions. All libraries are freely available for distribution to the research community.