Differences in brain gene expression between sleep and waking as revealed by mRNA differential display and cDNA microarray technology.

PubMed

Cirelli, C; Tononi, G

1999-06-01

The consequences of sleep and sleep deprivation at the molecular level are largely unexplored. Knowledge of such molecular events is essential to understand the restorative processes occurring during sleep as well as the cellular mechanisms of sleep regulation. Here we review the available data about changes in neural gene expression across different behavioural states using candidate gene approaches such as in situ hybridization and immunocytochemistry. We then describe new techniques for systematic screening of gene expression in the brain, such as subtractive hybridization, mRNA differential display, and cDNA microarray technology, outlining advantages and disadvantages of these methods. Finally, we summarize our initial results of a systematic screening of gene expression in the rat brain across behavioural states using mRNA differential display and cDNA microarray technology. The expression pattern of approximately 7000 genes was analysed in the cerebral cortex of rats after 3 h of spontaneous sleep, 3 h of spontaneous waking, or 3 h of sleep deprivation. While the majority of transcripts were expressed at the same level among these three conditions, 14 mRNAs were modulated by sleep and waking. Six transcripts, four more expressed in waking and two more expressed in sleep, corresponded to novel genes. The eight known transcripts were all expressed at higher levels in waking than in sleep and included transcription factors and mitochondrial genes. A possible role for these known transcripts in mediating neural plasticity during waking is discussed.

Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

PubMed

Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

2013-04-01

The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

Comparison of global brain gene expression profiles between inbred long-sleep and inbred short-sleep mice by high-density gene array hybridization.

PubMed

Xu, Y; Ehringer, M; Yang, F; Sikela, J M

2001-06-01

Inbred long-sleep (ILS) and short-sleep (ISS) mice show significant central nervous system-mediated differences in sleep time for sedative dose of ethanol and are frequently used as a rodent model for ethanol sensitivity. In this study, we have used complementary DNA (cDNA) array hybridization methodology to identify genes that are differentially expressed between the brains of ILS and ISS mice. To carry out this analysis, we used both the gene discovery array (GDA) and the Mouse GEM 1 Microarray. GDA consists of 18,378 nonredundant mouse cDNA clones on a single nylon filter. Complex probes were prepared from total brain mRNA of ILS or ISS mice by using reverse transcription and 33P labeling. The labeled probes were hybridized in parallel to the gene array filters. Data from GDA experiments were analyzed with SQL-Plus and Oracle 8. The GEM microarray includes 8,730 sequence-verified clones on a glass chip. Two fluorescently labeled probes were used to hybridize a microarray simultaneously. Data from GEM experiments were analyzed by using the GEMTools software package (Incyte). Differentially expressed genes identified from each method were confirmed by relative quantitative reverse transcription-polymerase chain reaction (RT-PCR). A total of 41 genes or expressed sequence tags (ESTs) display significant expression level differences between brains of ILS and ISS mice after GDA, GEM1 hybridization, and quantitative RT-PCR confirmation. Among them, 18 clones were expressed higher in ILS mice, and 23 clones were expressed higher in ISS mice. The individual gene or EST's function and mapping information have been analyzed. This study identified 41 genes that are differentially expressed between brains of ILS and ISS mice. Some of them may have biological relevance in mediation of phenotypic variation between ILS and ISS mice for ethanol sensitivity. This study also demonstrates that parallel gene expression comparison with high-density cDNA arrays is a rapid and efficient way to discover potential genes and pathways involved in alcoholism and alcohol-related physiologic processes.

Gene expression profiling of whole blood: Comparison of target preparation methods for accurate and reproducible microarray analysis

PubMed Central

Vartanian, Kristina; Slottke, Rachel; Johnstone, Timothy; Casale, Amanda; Planck, Stephen R; Choi, Dongseok; Smith, Justine R; Rosenbaum, James T; Harrington, Christina A

2009-01-01

Background Peripheral blood is an accessible and informative source of transcriptomal information for many human disease and pharmacogenomic studies. While there can be significant advantages to analyzing RNA isolated from whole blood, particularly in clinical studies, the preparation of samples for microarray analysis is complicated by the need to minimize artifacts associated with highly abundant globin RNA transcripts. The impact of globin RNA transcripts on expression profiling data can potentially be reduced by using RNA preparation and labeling methods that remove or block globin RNA during the microarray assay. We compared four different methods for preparing microarray hybridization targets from human whole blood collected in PAXGene tubes. Three of the methods utilized the Affymetrix one-cycle cDNA synthesis/in vitro transcription protocol but varied treatment of input RNA as follows: i. no treatment; ii. treatment with GLOBINclear; or iii. treatment with globin PNA oligos. In the fourth method cDNA targets were prepared with the Ovation amplification and labeling system. Results We find that microarray targets generated with labeling methods that reduce globin mRNA levels or minimize the impact of globin transcripts during hybridization detect more transcripts in the microarray assay compared with the standard Affymetrix method. Comparison of microarray results with quantitative PCR analysis of a panel of genes from the NF-kappa B pathway shows good correlation of transcript measurements produced with all four target preparation methods, although method-specific differences in overall correlation were observed. The impact of freezing blood collected in PAXGene tubes on data reproducibility was also examined. Expression profiles show little or no difference when RNA is extracted from either fresh or frozen blood samples. Conclusion RNA preparation and labeling methods designed to reduce the impact of globin mRNA transcripts can significantly improve the sensitivity of the DNA microarray expression profiling assay for whole blood samples. While blockage of globin transcripts during first strand cDNA synthesis with globin PNAs resulted in the best overall performance in this study, we conclude that selection of a protocol for expression profiling studies in blood should depend on several factors, including implementation requirements of the method and study design. RNA isolated from either freshly collected or frozen blood samples stored in PAXGene tubes can be used without altering gene expression profiles. PMID:19123946

Characterization and simulation of cDNA microarray spots using a novel mathematical model

PubMed Central

Kim, Hye Young; Lee, Seo Eun; Kim, Min Jung; Han, Jin Il; Kim, Bo Kyung; Lee, Yong Sung; Lee, Young Seek; Kim, Jin Hyuk

2007-01-01

Background The quality of cDNA microarray data is crucial for expanding its application to other research areas, such as the study of gene regulatory networks. Despite the fact that a number of algorithms have been suggested to increase the accuracy of microarray gene expression data, it is necessary to obtain reliable microarray images by improving wet-lab experiments. As the first step of a cDNA microarray experiment, spotting cDNA probes is critical to determining the quality of spot images. Results We developed a governing equation of cDNA deposition during evaporation of a drop in the microarray spotting process. The governing equation included four parameters: the surface site density on the support, the extrapolated equilibrium constant for the binding of cDNA molecules with surface sites on glass slides, the macromolecular interaction factor, and the volume constant of a drop of cDNA solution. We simulated cDNA deposition from the single model equation by varying the value of the parameters. The morphology of the resulting cDNA deposit can be classified into three types: a doughnut shape, a peak shape, and a volcano shape. The spot morphology can be changed into a flat shape by varying the experimental conditions while considering the parameters of the governing equation of cDNA deposition. The four parameters were estimated by fitting the governing equation to the real microarray images. With the results of the simulation and the parameter estimation, the phenomenon of the formation of cDNA deposits in each type was investigated. Conclusion This study explains how various spot shapes can exist and suggests which parameters are to be adjusted for obtaining a good spot. This system is able to explore the cDNA microarray spotting process in a predictable, manageable and descriptive manner. We hope it can provide a way to predict the incidents that can occur during a real cDNA microarray experiment, and produce useful data for several research applications involving cDNA microarrays. PMID:18096047

Identification of differentially-expressed genes potentially implicated in drought response in pitaya (Hylocereus undatus) by suppression subtractive hybridization and cDNA microarray analysis.

PubMed

Fan, Qing-Jie; Yan, Feng-Xia; Qiao, Guang; Zhang, Bing-Xue; Wen, Xiao-Peng

2014-01-01

Drought is one of the most severe threats to the growth, development and yield of plant. In order to unravel the molecular basis underlying the high tolerance of pitaya (Hylocereus undatus) to drought stress, suppression subtractive hybridization (SSH) and cDNA microarray approaches were firstly combined to identify the potential important or novel genes involved in the plant responses to drought stress. The forward (drought over drought-free) and reverse (drought-free over drought) suppression subtractive cDNA libraries were constructed using in vitro shoots of cultivar 'Zihonglong' exposed to drought stress and drought-free (control). A total of 2112 clones, among which half were from either forward or reverse SSH library, were randomly picked up to construct a pitaya cDNA microarray. Microarray analysis was carried out to verify the expression fluctuations of this set of clones upon drought treatment compared with the controls. A total of 309 expressed sequence tags (ESTs), 153 from forward library and 156 from reverse library, were obtained, and 138 unique ESTs were identified after sequencing by clustering and blast analyses, which included genes that had been previously reported as responsive to water stress as well as some functionally unknown genes. Thirty six genes were mapped to 47 KEGG pathways, including carbohydrate metabolism, lipid metabolism, energy metabolism, nucleotide metabolism, and amino acid metabolism of pitaya. Expression analysis of the selected ESTs by reverse transcriptase polymerase chain reaction (RT-PCR) corroborated the results of differential screening. Moreover, time-course expression patterns of these selected ESTs further confirmed that they were closely responsive to drought treatment. Among the differentially expressed genes (DEGs), many are related to stress tolerances including drought tolerance. Thereby, the mechanism of drought tolerance of this pitaya genotype is a very complex physiological and biochemical process, in which multiple metabolism pathways and many genes were implicated. The data gained herein provide an insight into the mechanism underlying the drought stress tolerance of pitaya, as well as may facilitate the screening of candidate genes for drought tolerance. © 2013 Elsevier B.V. All rights reserved.

Fish and chips: Various methodologies demonstrate utility of a 16,006-gene salmonid microarray

PubMed Central

von Schalburg, Kristian R; Rise, Matthew L; Cooper, Glenn A; Brown, Gordon D; Gibbs, A Ross; Nelson, Colleen C; Davidson, William S; Koop, Ben F

2005-01-01

Background We have developed and fabricated a salmonid microarray containing cDNAs representing 16,006 genes. The genes spotted on the array have been stringently selected from Atlantic salmon and rainbow trout expressed sequence tag (EST) databases. The EST databases presently contain over 300,000 sequences from over 175 salmonid cDNA libraries derived from a wide variety of tissues and different developmental stages. In order to evaluate the utility of the microarray, a number of hybridization techniques and screening methods have been developed and tested. Results We have analyzed and evaluated the utility of a microarray containing 16,006 (16K) salmonid cDNAs in a variety of potential experimental settings. We quantified the amount of transcriptome binding that occurred in cross-species, organ complexity and intraspecific variation hybridization studies. We also developed a methodology to rapidly identify and confirm the contents of a bacterial artificial chromosome (BAC) library containing Atlantic salmon genomic DNA. Conclusion We validate and demonstrate the usefulness of the 16K microarray over a wide range of teleosts, even for transcriptome targets from species distantly related to salmonids. We show the potential of the use of the microarray in a variety of experimental settings through hybridization studies that examine the binding of targets derived from different organs and tissues. Intraspecific variation in transcriptome expression is evaluated and discussed. Finally, BAC hybridizations are demonstrated as a rapid and accurate means to identify gene content. PMID:16164747

Identification of novel and known oocyte-specific genes using complementary DNA subtraction and microarray analysis in three different species.

PubMed

Vallée, Maud; Gravel, Catherine; Palin, Marie-France; Reghenas, Hélène; Stothard, Paul; Wishart, David S; Sirard, Marc-André

2005-07-01

The main objective of the present study was to identify novel oocyte-specific genes in three different species: bovine, mouse, and Xenopus laevis. To achieve this goal, two powerful technologies were combined: a polymerase chain reaction (PCR)-based cDNA subtraction, and cDNA microarrays. Three subtractive libraries consisting of 3456 clones were established and enriched for oocyte-specific transcripts. Sequencing analysis of the positive insert-containing clones resulted in the following classification: 53% of the clones corresponded to known cDNAs, 26% were classified as uncharacterized cDNAs, and a final 9% were classified as novel sequences. All these clones were used for cDNA microarray preparation. Results from these microarray analyses revealed that in addition to already known oocyte-specific genes, such as GDF9, BMP15, and ZP, known genes with unknown function in the oocyte were identified, such as a MLF1-interacting protein (MLF1IP), B-cell translocation gene 4 (BTG4), and phosphotyrosine-binding protein (xPTB). Furthermore, 15 novel oocyte-specific genes were validated by reverse transcription-PCR to confirm their preferential expression in the oocyte compared to somatic tissues. The results obtained in the present study confirmed that microarray analysis is a robust technique to identify true positives from the suppressive subtractive hybridization experiment. Furthermore, obtaining oocyte-specific genes from three species simultaneously allowed us to look at important genes that are conserved across species. Further characterization of these novel oocyte-specific genes will lead to a better understanding of the molecular mechanisms related to the unique functions found in the oocyte.

Optimization of cDNA microarrays procedures using criteria that do not rely on external standards.

PubMed

Bruland, Torunn; Anderssen, Endre; Doseth, Berit; Bergum, Hallgeir; Beisvag, Vidar; Laegreid, Astrid

2007-10-18

The measurement of gene expression using microarray technology is a complicated process in which a large number of factors can be varied. Due to the lack of standard calibration samples such as are used in traditional chemical analysis it may be a problem to evaluate whether changes done to the microarray procedure actually improve the identification of truly differentially expressed genes. The purpose of the present work is to report the optimization of several steps in the microarray process both in laboratory practices and in data processing using criteria that do not rely on external standards. We performed a cDNA microarry experiment including RNA from samples with high expected differential gene expression termed "high contrasts" (rat cell lines AR42J and NRK52E) compared to self-self hybridization, and optimized a pipeline to maximize the number of genes found to be differentially expressed in the "high contrasts" RNA samples by estimating the false discovery rate (FDR) using a null distribution obtained from the self-self experiment. The proposed high-contrast versus self-self method (HCSSM) requires only four microarrays per evaluation. The effects of blocking reagent dose, filtering, and background corrections methodologies were investigated. In our experiments a dose of 250 ng LNA (locked nucleic acid) dT blocker, no background correction and weight based filtering gave the largest number of differentially expressed genes. The choice of background correction method had a stronger impact on the estimated number of differentially expressed genes than the choice of filtering method. Cross platform microarray (Illumina) analysis was used to validate that the increase in the number of differentially expressed genes found by HCSSM was real. The results show that HCSSM can be a useful and simple approach to optimize microarray procedures without including external standards. Our optimizing method is highly applicable to both long oligo-probe microarrays which have become commonly used for well characterized organisms such as man, mouse and rat, as well as to cDNA microarrays which are still of importance for organisms with incomplete genome sequence information such as many bacteria, plants and fish.

Optimization of cDNA microarrays procedures using criteria that do not rely on external standards

PubMed Central

Bruland, Torunn; Anderssen, Endre; Doseth, Berit; Bergum, Hallgeir; Beisvag, Vidar; Lægreid, Astrid

2007-01-01

Background The measurement of gene expression using microarray technology is a complicated process in which a large number of factors can be varied. Due to the lack of standard calibration samples such as are used in traditional chemical analysis it may be a problem to evaluate whether changes done to the microarray procedure actually improve the identification of truly differentially expressed genes. The purpose of the present work is to report the optimization of several steps in the microarray process both in laboratory practices and in data processing using criteria that do not rely on external standards. Results We performed a cDNA microarry experiment including RNA from samples with high expected differential gene expression termed "high contrasts" (rat cell lines AR42J and NRK52E) compared to self-self hybridization, and optimized a pipeline to maximize the number of genes found to be differentially expressed in the "high contrasts" RNA samples by estimating the false discovery rate (FDR) using a null distribution obtained from the self-self experiment. The proposed high-contrast versus self-self method (HCSSM) requires only four microarrays per evaluation. The effects of blocking reagent dose, filtering, and background corrections methodologies were investigated. In our experiments a dose of 250 ng LNA (locked nucleic acid) dT blocker, no background correction and weight based filtering gave the largest number of differentially expressed genes. The choice of background correction method had a stronger impact on the estimated number of differentially expressed genes than the choice of filtering method. Cross platform microarray (Illumina) analysis was used to validate that the increase in the number of differentially expressed genes found by HCSSM was real. Conclusion The results show that HCSSM can be a useful and simple approach to optimize microarray procedures without including external standards. Our optimizing method is highly applicable to both long oligo-probe microarrays which have become commonly used for well characterized organisms such as man, mouse and rat, as well as to cDNA microarrays which are still of importance for organisms with incomplete genome sequence information such as many bacteria, plants and fish. PMID:17949480

cDNA Microarray Screening in Food Safety

PubMed Central

ROY, SASHWATI; SEN, CHANDAN K

2009-01-01

The cDNA microarray technology and related bioinformatics tools presents a wide range of novel application opportunities. The technology may be productively applied to address food safety. In this mini-review article, we present an update highlighting the late breaking discoveries that demonstrate the vitality of cDNA microarray technology as a tool to analyze food safety with reference to microbial pathogens and genetically modified foods. In order to bring the microarray technology to mainstream food safety, it is important to develop robust user-friendly tools that may be applied in a field setting. In addition, there needs to be a standardized process for regulatory agencies to interpret and act upon microarray-based data. The cDNA microarray approach is an emergent technology in diagnostics. Its values lie in being able to provide complimentary molecular insight when employed in addition to traditional tests for food safety, as part of a more comprehensive battery of tests. PMID:16466843

Multiplex cDNA quantification method that facilitates the standardization of gene expression data

PubMed Central

Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

2011-01-01

Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

Construction of a cDNA microarray derived from the ascidian Ciona intestinalis.

PubMed

Azumi, Kaoru; Takahashi, Hiroki; Miki, Yasufumi; Fujie, Manabu; Usami, Takeshi; Ishikawa, Hisayoshi; Kitayama, Atsusi; Satou, Yutaka; Ueno, Naoto; Satoh, Nori

2003-10-01

A cDNA microarray was constructed from a basal chordate, the ascidian Ciona intestinalis. The draft genome of Ciona has been read and inferred to contain approximately 16,000 protein-coding genes, and cDNAs for transcripts of 13,464 genes have been characterized and compiled as the "Ciona intestinalis Gene Collection Release I". In the present study, we constructed a cDNA microarray of these 13,464 Ciona genes. A preliminary experiment with Cy3- and Cy5-labeled probes showed extensive differential gene expression between fertilized eggs and larvae. In addition, there was a good correlation between results obtained by the present microarray analysis and those from previous EST analyses. This first microarray of a large collection of Ciona intestinalis cDNA clones should facilitate the analysis of global gene expression and gene networks during the embryogenesis of basal chordates.

Fabrication of high quality cDNA microarray using a small amount of cDNA.

PubMed

Park, Chan Hee; Jeong, Ha Jin; Jung, Jae Jun; Lee, Gui Yeon; Kim, Sang-Chul; Kim, Tae Soo; Yang, Sang Hwa; Chung, Hyun Cheol; Rha, Sun Young

2004-05-01

DNA microarray technology has become an essential part of biological research. It enables the genome-scale analysis of gene expression in various types of model systems. Manufacturing high quality cDNA microarrays of microdeposition type depends on some key factors including a printing device, spotting pins, glass slides, spotting solution, and humidity during spotting. UsingEthe Microgrid II TAS model printing device, this study defined the optimal conditions for producing high density, high quality cDNA microarrays with the least amount of cDNA product. It was observed that aminosilane-modified slides were superior to other types of surface modified-slides. A humidity of 30+/-3% in a closed environment and the overnight drying of the spotted slides gave the best conditions for arraying. In addition, the cDNA dissolved in 30% DMSO gave the optimal conditions for spotting compared to the 1X ArrayIt, 3X SSC and 50% DMSO. Lastly, cDNA in the concentration range of 100-300 ng/ micro l was determined to be best for arraying and post-processing. Currently, the printing system in this study yields reproducible 9000 spots with a spot size 150 mm diameter, and a 200 nm spot spacing.

NHE10, a novel osteoclast-specific member of the Na{sup +}/H{sup +} exchanger family, regulates osteoclast differentiation and survival

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Seoung Hoon; Kim, Taesoo; Park, Eui-Soon

2008-05-02

Bone homeostasis is tightly regulated by the balanced actions of osteoblasts (OBs) and osteoclasts (OCs). We previously analyzed the gene expression profile of OC differentiation using a cDNA microarray, and identified a novel osteoclastogenic gene candidate, clone OCL-1-E7 [J. Rho, C.R. Altmann, N.D. Socci, L. Merkov, N. Kim, H. So, O. Lee, M. Takami, A.H. Brivanlou, Y. Choi, Gene expression profiling of osteoclast differentiation by combined suppression subtractive hybridization (SSH) and cDNA microarray analysis, DNA Cell Biol. 21 (2002) 541-549]. In this study, we have isolated full-length cDNAs corresponding to this clone from mice and humans to determine the functionalmore » roles of this gene in osteoclastogenesis. The full-length cDNA of OCL-1-E7 encodes 12 membrane-spanning domains that are typical of isoforms of the Na{sup +}/H{sup +} exchangers (NHEs), indicating that this clone is a novel member of the NHE family (hereafter referred to as NHE10). Here, we show that NHE10 is highly expressed in OCs in response to receptor activator of nuclear factor-{kappa}B ligand signaling and is required for OC differentiation and survival.« less

Development and experimental validation of a 20K Atlantic cod (Gadus morhua) oligonucleotide microarray based on a collection of over 150,000 ESTs.

PubMed

Booman, Marije; Borza, Tudor; Feng, Charles Y; Hori, Tiago S; Higgins, Brent; Culf, Adrian; Léger, Daniel; Chute, Ian C; Belkaid, Anissa; Rise, Marlies; Gamperl, A Kurt; Hubert, Sophie; Kimball, Jennifer; Ouellette, Rodney J; Johnson, Stewart C; Bowman, Sharen; Rise, Matthew L

2011-08-01

The collapse of Atlantic cod (Gadus morhua) wild populations strongly impacted the Atlantic cod fishery and led to the development of cod aquaculture. In order to improve aquaculture and broodstock quality, we need to gain knowledge of genes and pathways involved in Atlantic cod responses to pathogens and other stressors. The Atlantic Cod Genomics and Broodstock Development Project has generated over 150,000 expressed sequence tags from 42 cDNA libraries representing various tissues, developmental stages, and stimuli. We used this resource to develop an Atlantic cod oligonucleotide microarray containing 20,000 unique probes. Selection of sequences from the full range of cDNA libraries enables application of the microarray for a broad spectrum of Atlantic cod functional genomics studies. We included sequences that were highly abundant in suppression subtractive hybridization (SSH) libraries, which were enriched for transcripts responsive to pathogens or other stressors. These sequences represent genes that potentially play an important role in stress and/or immune responses, making the microarray particularly useful for studies of Atlantic cod gene expression responses to immune stimuli and other stressors. To demonstrate its value, we used the microarray to analyze the Atlantic cod spleen response to stimulation with formalin-killed, atypical Aeromonas salmonicida, resulting in a gene expression profile that indicates a strong innate immune response. These results were further validated by quantitative PCR analysis and comparison to results from previous analysis of an SSH library. This study shows that the Atlantic cod 20K oligonucleotide microarray is a valuable new tool for Atlantic cod functional genomics research.

Construction of a robust microarray from a non-model species (largemouth bass) using pyrosequencing technology

PubMed Central

Garcia-Reyero, Natàlia; Griffitt, Robert J.; Liu, Li; Kroll, Kevin J.; Farmerie, William G.; Barber, David S.; Denslow, Nancy D.

2009-01-01

A novel custom microarray for largemouth bass (Micropterus salmoides) was designed with sequences obtained from a normalized cDNA library using the 454 Life Sciences GS-20 pyrosequencer. This approach yielded in excess of 58 million bases of high-quality sequence. The sequence information was combined with 2,616 reads obtained by traditional suppressive subtractive hybridizations to derive a total of 31,391 unique sequences. Annotation and coding sequences were predicted for these transcripts where possible. 16,350 annotated transcripts were selected as target sequences for the design of the custom largemouth bass oligonucleotide microarray. The microarray was validated by examining the transcriptomic response in male largemouth bass exposed to 17β-œstradiol. Transcriptomic responses were assessed in liver and gonad, and indicated gene expression profiles typical of exposure to œstradiol. The results demonstrate the potential to rapidly create the tools necessary to assess large scale transcriptional responses in non-model species, paving the way for expanded impact of toxicogenomics in ecotoxicology. PMID:19936325

Assessment of data processing to improve reliability of microarray experiments using genomic DNA reference.

PubMed

Yang, Yunfeng; Zhu, Mengxia; Wu, Liyou; Zhou, Jizhong

2008-09-16

Using genomic DNA as common reference in microarray experiments has recently been tested by different laboratories. Conflicting results have been reported with regard to the reliability of microarray results using this method. To explain it, we hypothesize that data processing is a critical element that impacts the data quality. Microarray experiments were performed in a gamma-proteobacterium Shewanella oneidensis. Pair-wise comparison of three experimental conditions was obtained either with two labeled cDNA samples co-hybridized to the same array, or by employing Shewanella genomic DNA as a standard reference. Various data processing techniques were exploited to reduce the amount of inconsistency between both methods and the results were assessed. We discovered that data quality was significantly improved by imposing the constraint of minimal number of replicates, logarithmic transformation and random error analyses. These findings demonstrate that data processing significantly influences data quality, which provides an explanation for the conflicting evaluation in the literature. This work could serve as a guideline for microarray data analysis using genomic DNA as a standard reference.

Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

PubMed

Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2005-04-01

The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

APPLICATION OF CDNA MICROARRAY TO THE STUDY OF ARSENIC TOXICOLOGY AND CARCINOGENESIS

EPA Science Inventory

Arsenic (As) is a common environmental toxicant and known human carcinogen. Epidemiological studies link As exposure to various disorders and cancers. However, the molecular mechanisms for As toxicity and carcinogenicity are not completely known. The cDNA microarray, a high-th...

APPLICATION OF CDNA MICROARRAY TECHNOLOGY TO IN VITRO TOXICOLOGY AND THE SELECTION OF GENES FOR A REAL TIME RT-PCR-BASED SCREEN FOR OXIDATIVE STRESS IN HEP-G2 CELLS

EPA Science Inventory

Large-scale analysis of gene expression using cDNA microarrays promises the
rapid detection of the mode of toxicity for drugs and other chemicals. cDNA
microarrays were used to examine chemically-induced alterations of gene
expression in HepG2 cells exposed to oxidative ...

Expression profiling suggests a regulatory role of gallbladder in lipid homeostasis

PubMed Central

Yuan, Zuo-Biao; Han, Tian-Quan; Jiang, Zhao-Yan; Fei, Jian; Zhang, Yi; Qin, Jian; Tian, Zhi-Jie; Shang, Jun; Jiang, Zhi-Hong; Cai, Xing-Xing; Jiang, Yu; Zhang, Sheng-Dao; Jin, Gang

2005-01-01

AIM: To examine expression profile of gallbladder using microarray and to investigate the role of gallbladder in lipid homeostasis. METHODS: 33P-labelled cDNA derived from total RNA of gallbladder tissue was hybridized to a cDNA array representing 17000 cDNA clusters. Genes with intensities ≥2 and variation <0.33 between two samples were considered as positive signals with subtraction of background chosen from an area where no cDNA was spotted. The average gray level of two gallbladders was adopted to analyze its bioinformatics. Identified target genes were confirmed by touch-down polymerase chain reaction and sequencing. RESULTS: A total of 11 047 genes expressed in normal gallbladder, which was more than that predicted by another author, and the first 10 genes highly expressed (high gray level in hybridization image), e.g., ARPC5 (2225.88±90.46), LOC55972 (2220.32±446.51) and SLC20A2 (1865.21±98.02), were related to the function of smooth muscle contraction and material transport. Meanwhile, 149 lipid-related genes were expressed in the gallbladder, 89 of which were first identified (with gray level in hybridization image), e.g., FASN (11.42±2.62), APOD (92.61±8.90) and CYP21A2 (246.11±42.36), and they were involved in each step of lipid metabolism pathway. In addition, 19 of those 149 genes were gallstone candidate susceptibility genes (with gray level in hybridization image), e.g., HMGCR (10.98±0.31), NPC1 (34.88±12.12) and NR1H4 (16.8±0.65), which were previously thought to be expressed in the liver and/or intestine tissue only. CONCLUSION: Gallbladder expresses 11 047 genes and takes part in lipid homeostasis. PMID:15810076

[Differentially expressed genes of cell signal transduction associated with benzene poisoning by cDNA microarray].

PubMed

Wang, Hong; Bi, Yongyi; Tao, Ning; Wang, Chunhong

2005-08-01

To detect the differential expression of cell signal transduction genes associated with benzene poisoning, and to explore the pathogenic mechanisms of blood system damage induced by benzene. Peripheral white blood cell gene expression profile of 7 benzene poisoning patients, including one aplastic anemia, was determined by cDNA microarray. Seven chips from normal workers were served as controls. Cluster analysis of gene expression profile was performed. Among the 4265 target genes, 176 genes associated with cell signal transduction were differentially expressed. 35 up-regulated genes including PTPRC, STAT4, IFITM1 etc were found in at least 6 pieces of microarray; 45 down-regulated genes including ARHB, PPP3CB, CDC37 etc were found in at least 5 pieces of microarray. cDNA microarray technology is an effective technique for screening the differentially expressed genes of cell signal transduction. Disorder in cell signal transduction may play certain role in the pathogenic mechanism of benzene poisoning.

MASQOT: a method for cDNA microarray spot quality control

PubMed Central

Bylesjö, Max; Eriksson, Daniel; Sjödin, Andreas; Sjöström, Michael; Jansson, Stefan; Antti, Henrik; Trygg, Johan

2005-01-01

Background cDNA microarray technology has emerged as a major player in the parallel detection of biomolecules, but still suffers from fundamental technical problems. Identifying and removing unreliable data is crucial to prevent the risk of receiving illusive analysis results. Visual assessment of spot quality is still a common procedure, despite the time-consuming work of manually inspecting spots in the range of hundreds of thousands or more. Results A novel methodology for cDNA microarray spot quality control is outlined. Multivariate discriminant analysis was used to assess spot quality based on existing and novel descriptors. The presented methodology displays high reproducibility and was found superior in identifying unreliable data compared to other evaluated methodologies. Conclusion The proposed methodology for cDNA microarray spot quality control generates non-discrete values of spot quality which can be utilized as weights in subsequent analysis procedures as well as to discard spots of undesired quality using the suggested threshold values. The MASQOT approach provides a consistent assessment of spot quality and can be considered an alternative to the labor-intensive manual quality assessment process. PMID:16223442

arrayCGHbase: an analysis platform for comparative genomic hybridization microarrays

PubMed Central

Menten, Björn; Pattyn, Filip; De Preter, Katleen; Robbrecht, Piet; Michels, Evi; Buysse, Karen; Mortier, Geert; De Paepe, Anne; van Vooren, Steven; Vermeesch, Joris; Moreau, Yves; De Moor, Bart; Vermeulen, Stefan; Speleman, Frank; Vandesompele, Jo

2005-01-01

Background The availability of the human genome sequence as well as the large number of physically accessible oligonucleotides, cDNA, and BAC clones across the entire genome has triggered and accelerated the use of several platforms for analysis of DNA copy number changes, amongst others microarray comparative genomic hybridization (arrayCGH). One of the challenges inherent to this new technology is the management and analysis of large numbers of data points generated in each individual experiment. Results We have developed arrayCGHbase, a comprehensive analysis platform for arrayCGH experiments consisting of a MIAME (Minimal Information About a Microarray Experiment) supportive database using MySQL underlying a data mining web tool, to store, analyze, interpret, compare, and visualize arrayCGH results in a uniform and user-friendly format. Following its flexible design, arrayCGHbase is compatible with all existing and forthcoming arrayCGH platforms. Data can be exported in a multitude of formats, including BED files to map copy number information on the genome using the Ensembl or UCSC genome browser. Conclusion ArrayCGHbase is a web based and platform independent arrayCGH data analysis tool, that allows users to access the analysis suite through the internet or a local intranet after installation on a private server. ArrayCGHbase is available at . PMID:15910681

Quality Control of RNA Preservation and Extraction from Paraffin-Embedded Tissue: Implications for RT-PCR and Microarray Analysis

PubMed Central

Pichler, Martin; Zatloukal, Kurt

2013-01-01

Analysis of RNA isolated from fixed and paraffin-embedded tissues is widely used in biomedical research and molecular pathological diagnostics. We have performed a comprehensive and systematic investigation of the impact of factors in the pre-analytical workflow, such as different fixatives, fixation time, RNA extraction method and storage of tissues in paraffin blocks, on several downstream reactions including complementary DNA (cDNA) synthesis, quantitative reverse transcription polymerase chain reaction (qRT-PCR) and microarray hybridization. We compared the effects of routine formalin fixation with the non-crosslinking, alcohol-based Tissue Tek Xpress Molecular Fixative (TTXMF, Sakura Finetek), and cryopreservation as gold standard for molecular analyses. Formalin fixation introduced major changes into microarray gene expression data and led to marked gene-to-gene variations in delta-ct values of qRT-PCR. We found that qRT-PCR efficiency and gene-to-gene variations were mainly attributed to differences in the efficiency of cDNA synthesis as the most sensitive step. These differences could not be reliably detected by quality assessment of total RNA isolated from formalin-fixed tissues by electrophoresis or spectrophotometry. Although RNA from TTXMF fixed samples was as fragmented as RNA from formalin fixed samples, much higher cDNA yield and lower ct-values were obtained in qRT-PCR underlining the negative impact of crosslinking by formalin. In order to better estimate the impact of pre-analytical procedures such as fixation on the reliability of downstream analysis, we applied a qRT-PCR-based assay using amplicons of different length and an assay measuring the efficiency of cDNA generation. Together these two assays allowed better quality assessment of RNA extracted from fixed and paraffin-embedded tissues and should be used to supplement quality scores derived from automated electrophoresis. A better standardization of the pre-analytical workflow, application of additional quality controls and detailed sample information would markedly improve the comparability and reliability of molecular studies based on formalin-fixed and paraffin-embedded tissue samples. PMID:23936242

Hybrid genetic algorithm-neural network: feature extraction for unpreprocessed microarray data.

PubMed

Tong, Dong Ling; Schierz, Amanda C

2011-09-01

Suitable techniques for microarray analysis have been widely researched, particularly for the study of marker genes expressed to a specific type of cancer. Most of the machine learning methods that have been applied to significant gene selection focus on the classification ability rather than the selection ability of the method. These methods also require the microarray data to be preprocessed before analysis takes place. The objective of this study is to develop a hybrid genetic algorithm-neural network (GANN) model that emphasises feature selection and can operate on unpreprocessed microarray data. The GANN is a hybrid model where the fitness value of the genetic algorithm (GA) is based upon the number of samples correctly labelled by a standard feedforward artificial neural network (ANN). The model is evaluated by using two benchmark microarray datasets with different array platforms and differing number of classes (a 2-class oligonucleotide microarray data for acute leukaemia and a 4-class complementary DNA (cDNA) microarray dataset for SRBCTs (small round blue cell tumours)). The underlying concept of the GANN algorithm is to select highly informative genes by co-evolving both the GA fitness function and the ANN weights at the same time. The novel GANN selected approximately 50% of the same genes as the original studies. This may indicate that these common genes are more biologically significant than other genes in the datasets. The remaining 50% of the significant genes identified were used to build predictive models and for both datasets, the models based on the set of genes extracted by the GANN method produced more accurate results. The results also suggest that the GANN method not only can detect genes that are exclusively associated with a single cancer type but can also explore the genes that are differentially expressed in multiple cancer types. The results show that the GANN model has successfully extracted statistically significant genes from the unpreprocessed microarray data as well as extracting known biologically significant genes. We also show that assessing the biological significance of genes based on classification accuracy may be misleading and though the GANN's set of extra genes prove to be more statistically significant than those selected by other methods, a biological assessment of these genes is highly recommended to confirm their functionality. Copyright © 2011 Elsevier B.V. All rights reserved.

GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN CDNA MICROARRAY ANALYSES

EPA Science Inventory

GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN cDNA MICROARRAY ANALYSES

B.S. Pukazhenthi1, J. C. Rockett2, M. Ouyang3, D.J. Dix2, J.G. Howard1, P. Georgopoulos4, W.J. J. Welsh3 and D. E. Wildt1

1Department of Reproductiv...

[Differential gene expression in incompatible interaction between Lilium regale Wilson and Fusarium oxysporum f. sp. lilii revealed by combined SSH and microarray analysis].

PubMed

Rao, J; Liu, D; Zhang, N; He, H; Ge, F; Chen, C

2014-01-01

Fusarium wilt, caused by a soilborne pathogen Fusarium oxysporum f. sp. lilii, is the major disease of lily (Lilium L.). In order to isolate the genes differentially expressed in a resistant reaction to F. oxysporum in L. regale Wilson, a cDNA library was constructed with L. regale root during F. oxysporum infection using the suppression subtractive hybridization (SSH), and a total of 585 unique expressed sequence tags (ESTs) were obtained. Furthermore, the gene expression profiles in the incompatible interaction between L. regale and F. oxysporum were revealed by oligonucleotide microarray analysis of 585 unique ESTs comparison to the compatible interaction between a susceptible Lilium Oriental Hybrid 'Siberia' and F. oxysporum. The result of expression profile analysis indicated that the genes encoding pathogenesis-related proteins (PRs), antioxidative stress enzymes, secondary metabolism enzymes, transcription factors, signal transduction proteins as well as a large number of unknown genes were involved in early defense response of L. regale to F. oxysporum infection. Moreover, the following quantitative reverse transcription PCR (QRT-PCR) analysis confirmed reliability of the oligonucleotide microarray data. In the present study, isolation of differentially expressed genes in L. regale during response to F. oxysporum helped to uncover the molecular mechanism associated with the resistance of L. regale against F. oxysporum.

Universal Oligonucleotide Microarray for Sub-Typing of Influenza A Virus

PubMed Central

Ryabinin, Vladimir A.; Kostina, Elena V.; Maksakova, Galiya A.; Neverov, Alexander A.; Chumakov, Konstantin M.; Sinyakov, Alexander N.

2011-01-01

A universal microchip was developed for genotyping Influenza A viruses. It contains two sets of oligonucleotide probes allowing viruses to be classified by the subtypes of hemagglutinin (H1–H13, H15, H16) and neuraminidase (N1–N9). Additional sets of probes are used to detect H1N1 swine influenza viruses. Selection of probes was done in two steps. Initially, amino acid sequences specific to each subtype were identified, and then the most specific and representative oligonucleotide probes were selected. Overall, between 19 and 24 probes were used to identify each subtype of hemagglutinin (HA) and neuraminidase (NA). Genotyping included preparation of fluorescently labeled PCR amplicons of influenza virus cDNA and their hybridization to microarrays of specific oligonucleotide probes. Out of 40 samples tested, 36 unambiguously identified HA and NA subtypes of Influenza A virus. PMID:21559081

Influence of age, sex, and strength training on human muscle gene expression determined by microarray

PubMed Central

ROTH, STEPHEN M.; FERRELL, ROBERT E.; PETERS, DAVID G.; METTER, E. JEFFREY; HURLEY, BEN F.; ROGERS, MARC A.

2010-01-01

The purpose of this study was to determine the influence of age, sex, and strength training (ST) on large-scale gene expression patterns in vastus lateralis muscle biopsies using high-density cDNA microarrays and quantitative PCR. Muscle samples from sedentary young (20–30 yr) and older (65–75 yr) men and women (5 per group) were obtained before and after a 9-wk unilateral heavy resistance ST program. RNA was hybridized to cDNA filter microarrays representing ~4,000 known human genes and comparisons were made among arrays to determine differential gene expression as a result of age and sex differences, and/or response to ST. Sex had the strongest influence on muscle gene expression, with differential expression (>1.7-fold) observed for ~200 genes between men and women (~75% with higher expression in men). Age contributed to differential expression as well, as ~50 genes were identified as differentially expressed (>1.7-fold) in relation to age, representing structural, metabolic, and regulatory gene classes. Sixty-nine genes were identified as being differentially expressed (>1.7-fold) in all groups in response to ST, and the majority of these were downregulated. Quantitative PCR was employed to validate expression levels for caldesmon, SWI/SNF (BAF60b), and four-and-a-half LIM domains 1. These significant differences suggest that in the analysis of skeletal muscle gene expression issues of sex, age, and habitual physical activity must be addressed, with sex being the most critical variable. PMID:12209020

Genomic Analysis of Vaccine-Derived Poliovirus Strains in Stool Specimens by Combination of Full-Length PCR and Oligonucleotide Microarray Hybridization

PubMed Central

Laassri, Majid; Dragunsky, Eugenia; Enterline, Joan; Eremeeva, Tatiana; Ivanova, Olga; Lottenbach, Kathleen; Belshe, Robert; Chumakov, Konstantin

2005-01-01

Sabin strains of poliovirus used in the manufacture of oral poliovirus vaccine (OPV) are prone to genetic variations that occur during growth in cell cultures and the organisms of vaccine recipients. Such derivative viruses often have increased neurovirulence and transmissibility, and in some cases they can reestablish chains of transmission in human populations. Monitoring for vaccine-derived polioviruses is an important part of the worldwide campaign to eradicate poliomyelitis. Analysis of vaccine-derived polioviruses requires, as a first step, their isolation in cell cultures, which takes significant time and may yield viral stocks that are not fully representative of the strains present in the original sample. Here we demonstrate that full-length viral cDNA can be PCR amplified directly from stool samples and immediately subjected to genomic analysis by oligonucleotide microarray hybridization and nucleotide sequencing. Most fecal samples from healthy children who received OPV were found to contain variants of Sabin vaccine viruses. Sequence changes in the 5′ untranslated region were common, as were changes in the VP1-coding region, including changes in a major antigenic site. Analysis of stool samples taken from cases of acute flaccid paralysis revealed the presence of mixtures of recombinant polioviruses, in addition to the emergence of new sequence variants. Avoiding the need for cell culture isolation dramatically shortened the time needed for identification and analysis of vaccine-derived polioviruses and could be useful for preliminary screening of clinical samples. The amplified full-length viral cDNA can be archived and used to recover live virus for further virological studies. PMID:15956413

Sequence verification as quality-control step for production of cDNA microarrays.

PubMed

Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

2001-07-01

To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

Transcriptomic data analysis and differential gene expression of antioxidant pathways in king penguin juveniles (Aptenodytes patagonicus) before and after acclimatization to marine life.

PubMed

Rey, Benjamin; Dégletagne, Cyril; Duchamp, Claude

2016-12-01

In this article, we present differentially expressed gene profiles in the pectoralis muscle of wild juvenile king penguins that were either naturally acclimated to cold marine environment or experimentally immersed in cold water as compared with penguin juveniles that never experienced cold water immersion. Transcriptomic data were obtained by hybridizing penguins total cDNA on Affymetrix GeneChip Chicken Genome arrays and analyzed using maxRS algorithm , " Transcriptome analysis in non-model species: a new method for the analysis of heterologous hybridization on microarrays " (Dégletagne et al., 2010) [1] . We focused on genes involved in multiple antioxidant pathways. For better clarity, these differentially expressed genes were clustered into six functional groups according to their role in controlling redox homeostasis. The data are related to a comprehensive research study on the ontogeny of antioxidant functions in king penguins, "Hormetic response triggers multifaceted anti-oxidant strategies in immature king penguins (Aptenodytes patagonicus)" (Rey et al., 2016) [2] . The raw microarray dataset supporting the present analyses has been deposited at the Gene Expression Omnibus (GEO) repository under accessions GEO: GSE17725 and GEO: GSE82344.

MIGS-GPU: Microarray Image Gridding and Segmentation on the GPU.

PubMed

Katsigiannis, Stamos; Zacharia, Eleni; Maroulis, Dimitris

2017-05-01

Complementary DNA (cDNA) microarray is a powerful tool for simultaneously studying the expression level of thousands of genes. Nevertheless, the analysis of microarray images remains an arduous and challenging task due to the poor quality of the images that often suffer from noise, artifacts, and uneven background. In this study, the MIGS-GPU [Microarray Image Gridding and Segmentation on Graphics Processing Unit (GPU)] software for gridding and segmenting microarray images is presented. MIGS-GPU's computations are performed on the GPU by means of the compute unified device architecture (CUDA) in order to achieve fast performance and increase the utilization of available system resources. Evaluation on both real and synthetic cDNA microarray images showed that MIGS-GPU provides better performance than state-of-the-art alternatives, while the proposed GPU implementation achieves significantly lower computational times compared to the respective CPU approaches. Consequently, MIGS-GPU can be an advantageous and useful tool for biomedical laboratories, offering a user-friendly interface that requires minimum input in order to run.

Importing MAGE-ML format microarray data into BioConductor.

PubMed

Durinck, Steffen; Allemeersch, Joke; Carey, Vincent J; Moreau, Yves; De Moor, Bart

2004-12-12

The microarray gene expression markup language (MAGE-ML) is a widely used XML (eXtensible Markup Language) standard for describing and exchanging information about microarray experiments. It can describe microarray designs, microarray experiment designs, gene expression data and data analysis results. We describe RMAGEML, a new Bioconductor package that provides a link between cDNA microarray data stored in MAGE-ML format and the Bioconductor framework for preprocessing, visualization and analysis of microarray experiments. http://www.bioconductor.org. Open Source.

Species differences in brain gene expression profiles associated with adult behavioral maturation in honey bees.

PubMed

Sen Sarma, Moushumi; Whitfield, Charles W; Robinson, Gene E

2007-06-29

Honey bees are known for several striking social behaviors, including a complex pattern of behavioral maturation that gives rise to an age-related colony division of labor and a symbolic dance language, by which successful foragers communicate the location of attractive food sources to their nestmates. Our understanding of honey bees is mostly based on studies of the Western honey bee, Apis mellifera, even though there are 9-10 other members of genus Apis, showing interesting variations in social behavior relative to A. mellifera. To facilitate future in-depth genomic and molecular level comparisons of behavior across the genus, we performed a microarray analysis of brain gene expression for A. mellifera and three key species found in Asia, A. cerana, A. florea and A. dorsata. For each species we compared brain gene expression patterns between foragers and adult one-day-old bees on an A. mellifera cDNA microarray and calculated within-species gene expression ratios to facilitate cross-species analysis. The number of cDNA spots showing hybridization fluorescence intensities above the experimental threshold was reduced by an average of 16% in the Asian species compared to A. mellifera, but an average of 71% of genes on the microarray were available for analysis. Brain gene expression profiles between foragers and one-day-olds showed differences that are consistent with a previous study on A. mellifera and were comparable across species. Although 1772 genes showed significant differences in expression between foragers and one-day-olds, only 218 genes showed differences in forager/one-day-old expression between species (p < 0.001). Principal Components Analysis revealed dominant patterns of expression that clearly distinguished between the four species but did not reflect known differences in behavior and ecology. There were species differences in brain expression profiles for functionally related groups of genes. We conclude that the A. mellifera cDNA microarray can be used effectively for cross-species comparisons within the genus. Our results indicate that there is a widespread conservation of the molecular processes in the honey bee brain underlying behavioral maturation. Species differences in brain expression profiles for functionally related groups of genes provide possible clues to the basis of behavioral variation in the genus.

cDNA microarray analysis of esophageal cancer: discoveries and prospects.

PubMed

Shimada, Yutaka; Sato, Fumiaki; Shimizu, Kazuharu; Tsujimoto, Gozoh; Tsukada, Kazuhiro

2009-07-01

Recent progress in molecular biology has revealed many genetic and epigenetic alterations that are involved in the development and progression of esophageal cancer. Microarray analysis has also revealed several genetic networks that are involved in esophageal cancer. However, clinical application of microarray techniques and use of microarray data have not yet occurred. In this review, we focus on the recent developments and problems with microarray analysis of esophageal cancer.

A meta-data based method for DNA microarray imputation.

PubMed

Jörnsten, Rebecka; Ouyang, Ming; Wang, Hui-Yu

2007-03-29

DNA microarray experiments are conducted in logical sets, such as time course profiling after a treatment is applied to the samples, or comparisons of the samples under two or more conditions. Due to cost and design constraints of spotted cDNA microarray experiments, each logical set commonly includes only a small number of replicates per condition. Despite the vast improvement of the microarray technology in recent years, missing values are prevalent. Intuitively, imputation of missing values is best done using many replicates within the same logical set. In practice, there are few replicates and thus reliable imputation within logical sets is difficult. However, it is in the case of few replicates that the presence of missing values, and how they are imputed, can have the most profound impact on the outcome of downstream analyses (e.g. significance analysis and clustering). This study explores the feasibility of imputation across logical sets, using the vast amount of publicly available microarray data to improve imputation reliability in the small sample size setting. We download all cDNA microarray data of Saccharomyces cerevisiae, Arabidopsis thaliana, and Caenorhabditis elegans from the Stanford Microarray Database. Through cross-validation and simulation, we find that, for all three species, our proposed imputation using data from public databases is far superior to imputation within a logical set, sometimes to an astonishing degree. Furthermore, the imputation root mean square error for significant genes is generally a lot less than that of non-significant ones. Since downstream analysis of significant genes, such as clustering and network analysis, can be very sensitive to small perturbations of estimated gene effects, it is highly recommended that researchers apply reliable data imputation prior to further analysis. Our method can also be applied to cDNA microarray experiments from other species, provided good reference data are available.

MADGE: scalable distributed data management software for cDNA microarrays.

PubMed

McIndoe, Richard A; Lanzen, Aaron; Hurtz, Kimberly

2003-01-01

The human genome project and the development of new high-throughput technologies have created unparalleled opportunities to study the mechanism of diseases, monitor the disease progression and evaluate effective therapies. Gene expression profiling is a critical tool to accomplish these goals. The use of nucleic acid microarrays to assess the gene expression of thousands of genes simultaneously has seen phenomenal growth over the past five years. Although commercial sources of microarrays exist, investigators wanting more flexibility in the genes represented on the array will turn to in-house production. The creation and use of cDNA microarrays is a complicated process that generates an enormous amount of information. Effective data management of this information is essential to efficiently access, analyze, troubleshoot and evaluate the microarray experiments. We have developed a distributable software package designed to track and store the various pieces of data generated by a cDNA microarray facility. This includes the clone collection storage data, annotation data, workflow queues, microarray data, data repositories, sample submission information, and project/investigator information. This application was designed using a 3-tier client server model. The data access layer (1st tier) contains the relational database system tuned to support a large number of transactions. The data services layer (2nd tier) is a distributed COM server with full database transaction support. The application layer (3rd tier) is an internet based user interface that contains both client and server side code for dynamic interactions with the user. This software is freely available to academic institutions and non-profit organizations at http://www.genomics.mcg.edu/niddkbtc.

Histological staining methods preparatory to laser capture microdissection significantly affect the integrity of the cellular RNA.

PubMed

Wang, Hongyang; Owens, James D; Shih, Joanna H; Li, Ming-Chung; Bonner, Robert F; Mushinski, J Frederic

2006-04-27

Gene expression profiling by microarray analysis of cells enriched by laser capture microdissection (LCM) faces several technical challenges. Frozen sections yield higher quality RNA than paraffin-imbedded sections, but even with frozen sections, the staining methods used for histological identification of cells of interest could still damage the mRNA in the cells. To study the contribution of staining methods to degradation of results from gene expression profiling of LCM samples, we subjected pellets of the mouse plasma cell tumor cell line TEPC 1165 to direct RNA extraction and to parallel frozen sectioning for LCM and subsequent RNA extraction. We used microarray hybridization analysis to compare gene expression profiles of RNA from cell pellets with gene expression profiles of RNA from frozen sections that had been stained with hematoxylin and eosin (H&E), Nissl Stain (NS), and for immunofluorescence (IF) as well as with the plasma cell-revealing methyl green pyronin (MGP) stain. All RNAs were amplified with two rounds of T7-based in vitro transcription and analyzed by two-color expression analysis on 10-K cDNA microarrays. The MGP-stained samples showed the least introduction of mRNA loss, followed by H&E and immunofluorescence. Nissl staining was significantly more detrimental to gene expression profiles, presumably owing to an aqueous step in which RNA may have been damaged by endogenous or exogenous RNAases. RNA damage can occur during the staining steps preparatory to laser capture microdissection, with the consequence of loss of representation of certain genes in microarray hybridization analysis. Inclusion of RNAase inhibitor in aqueous staining solutions appears to be important in protecting RNA from loss of gene transcripts.

Histological staining methods preparatory to laser capture microdissection significantly affect the integrity of the cellular RNA

PubMed Central

Wang, Hongyang; Owens, James D; Shih, Joanna H; Li, Ming-Chung; Bonner, Robert F; Mushinski, J Frederic

2006-01-01

Background Gene expression profiling by microarray analysis of cells enriched by laser capture microdissection (LCM) faces several technical challenges. Frozen sections yield higher quality RNA than paraffin-imbedded sections, but even with frozen sections, the staining methods used for histological identification of cells of interest could still damage the mRNA in the cells. To study the contribution of staining methods to degradation of results from gene expression profiling of LCM samples, we subjected pellets of the mouse plasma cell tumor cell line TEPC 1165 to direct RNA extraction and to parallel frozen sectioning for LCM and subsequent RNA extraction. We used microarray hybridization analysis to compare gene expression profiles of RNA from cell pellets with gene expression profiles of RNA from frozen sections that had been stained with hematoxylin and eosin (H&E), Nissl Stain (NS), and for immunofluorescence (IF) as well as with the plasma cell-revealing methyl green pyronin (MGP) stain. All RNAs were amplified with two rounds of T7-based in vitro transcription and analyzed by two-color expression analysis on 10-K cDNA microarrays. Results The MGP-stained samples showed the least introduction of mRNA loss, followed by H&E and immunofluorescence. Nissl staining was significantly more detrimental to gene expression profiles, presumably owing to an aqueous step in which RNA may have been damaged by endogenous or exogenous RNAases. Conclusion RNA damage can occur during the staining steps preparatory to laser capture microdissection, with the consequence of loss of representation of certain genes in microarray hybridization analysis. Inclusion of RNAase inhibitor in aqueous staining solutions appears to be important in protecting RNA from loss of gene transcripts. PMID:16643667

Optimization and evaluation of T7 based RNA linear amplification protocols for cDNA microarray analysis

PubMed Central

Zhao, Hongjuan; Hastie, Trevor; Whitfield, Michael L; Børresen-Dale, Anne-Lise; Jeffrey, Stefanie S

2002-01-01

Background T7 based linear amplification of RNA is used to obtain sufficient antisense RNA for microarray expression profiling. We optimized and systematically evaluated the fidelity and reproducibility of different amplification protocols using total RNA obtained from primary human breast carcinomas and high-density cDNA microarrays. Results Using an optimized protocol, the average correlation coefficient of gene expression of 11,123 cDNA clones between amplified and unamplified samples is 0.82 (0.85 when a virtual array was created using repeatedly amplified samples to minimize experimental variation). Less than 4% of genes show changes in expression level by 2-fold or greater after amplification compared to unamplified samples. Most changes due to amplification are not systematic both within one tumor sample and between different tumors. Amplification appears to dampen the variation of gene expression for some genes when compared to unamplified poly(A)+ RNA. The reproducibility between repeatedly amplified samples is 0.97 when performed on the same day, but drops to 0.90 when performed weeks apart. The fidelity and reproducibility of amplification is not affected by decreasing the amount of input total RNA in the 0.3–3 micrograms range. Adding template-switching primer, DNA ligase, or column purification of double-stranded cDNA does not improve the fidelity of amplification. The correlation coefficient between amplified and unamplified samples is higher when total RNA is used as template for both experimental and reference RNA amplification. Conclusion T7 based linear amplification reproducibly generates amplified RNA that closely approximates original sample for gene expression profiling using cDNA microarrays. PMID:12445333

Plastic Polymers for Efficient DNA Microarray Hybridization: Application to Microbiological Diagnostics▿

PubMed Central

Zhao, Zhengshan; Peytavi, Régis; Diaz-Quijada, Gerardo A.; Picard, Francois J.; Huletsky, Ann; Leblanc, Éric; Frenette, Johanne; Boivin, Guy; Veres, Teodor; Dumoulin, Michel M.; Bergeron, Michel G.

2008-01-01

Fabrication of microarray devices using traditional glass slides is not easily adaptable to integration into microfluidic systems. There is thus a need for the development of polymeric materials showing a high hybridization signal-to-background ratio, enabling sensitive detection of microbial pathogens. We have developed such plastic supports suitable for highly sensitive DNA microarray hybridizations. The proof of concept of this microarray technology was done through the detection of four human respiratory viruses that were amplified and labeled with a fluorescent dye via a sensitive reverse transcriptase PCR (RT-PCR) assay. The performance of the microarray hybridization with plastic supports made of PMMA [poly(methylmethacrylate)]-VSUVT or Zeonor 1060R was compared to that with high-quality glass slide microarrays by using both passive and microfluidic hybridization systems. Specific hybridization signal-to-background ratios comparable to that obtained with high-quality commercial glass slides were achieved with both polymeric substrates. Microarray hybridizations demonstrated an analytical sensitivity equivalent to approximately 100 viral genome copies per RT-PCR, which is at least 100-fold higher than the sensitivities of previously reported DNA hybridizations on plastic supports. Testing of these plastic polymers using a microfluidic microarray hybridization platform also showed results that were comparable to those with glass supports. In conclusion, PMMA-VSUVT and Zeonor 1060R are both suitable for highly sensitive microarray hybridizations. PMID:18784318

Molecular Differentiation of Risk for Disease Progression: Delineating Stage-Specific Therapeutic Targets for Disease Management in Breast Cancer

DTIC Science & Technology

2006-07-01

Jeffrey S. S., Botstein D ., Brown P . O. Genome-wide analysis of DNA copy-number changes using cDNA microarrays. Nat. Genet., 23: 41-46, 1999 3...Duggan D . J., Bittner M., Chen Y., Meltzer P ., Trent J. M. Expression profiling using cDNA microarrays. Nat. Genet., 21: 10-14, 1999 4. Oh J. M...1999 5. Golub T. R., Slonim D . K., Tamayo P ., Huard C., Gaasenbeek M., Mesirov J. P ., Coller H., Loh M. L., Downing J. R., Caligiuri M. A

Clustering-based spot segmentation of cDNA microarray images.

PubMed

Uslan, Volkan; Bucak, Ihsan Ömür

2010-01-01

Microarrays are utilized as that they provide useful information about thousands of gene expressions simultaneously. In this study segmentation step of microarray image processing has been implemented. Clustering-based methods, fuzzy c-means and k-means, have been applied for the segmentation step that separates the spots from the background. The experiments show that fuzzy c-means have segmented spots of the microarray image more accurately than the k-means.

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farahani, Poupak; Chiu, Sally; Bowlus, Christopher L.

Obesity is a complex disease. To date, over 100 chromosomal loci for body weight, body fat, regional white adipose tissue weight, and other obesity-related traits have been identified in humans and in animal models. For most loci, the underlying genes are not yet identified; some of these chromosomal loci will be alleles of known obesity genes, whereas many will represent alleles of unknown genes. Microarray analysis allows simultaneous multiple gene and pathway discovery. cDNA and oligonucleotide arrays are commonly used to identify differentially expressed genes by surveys of large numbers of known and unnamed genes. Two papers previously identified genesmore » differentially expressed in adipose tissue of mouse models of obesity and diabetes by analysis of hybridization to Affymetrix oligonucleotide chips.« less

Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

PubMed Central

Kilimann, M W; DeGennaro, L J

1985-01-01

To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

A pilot study of gene expression analysis in workers with hand-arm vibration syndrome.

PubMed

Maeda, Setsuo; Yu, Xiaozhong; Wang, Rui-Sheng; Sakakibara, Hisataka

2008-04-01

The purpose of this pilot study was to examine differences in gene expressions by cDNA microarray analysis of hand-arm vibration syndrome (HAVS) patients. Vein blood samples were collected and total RNA was extracted. All blood samples were obtained in the morning in one visit after a standard light breakfast. We performed microarray analysis with the labeled cDNA prepared by reverse transcription from RNA samples, using the Human CHIP version 1 (DNA Chip Research Inc, Yokohama, Japan). There are 2,976 genes on the chip, and these genes were selected from a cDNA library prepared with human peripheral white blood cells (WBC). Different gene levels between the HAVS patients and controls, and between groups of HAVS with different levels of symptoms, were indicated by the randomized variance model. The most up-regulated genes were analyzed for their possible functions and association with the occurrence of HAVS. From the results of this pilot study, although the results were obtained a limited number of subjects, it would appear that cDNA microarray analysis of HAVS patients has potential as a new objective method of HAVS diagnosis. Further research is needed to examine the gene expression with increased numbers of patients at different stages of HAVS.

An evaluation of tyramide signal amplification and archived fixed and frozen tissue in microarray gene expression analysis

PubMed Central

Karsten, Stanislav L.; Van Deerlin, Vivianna M. D.; Sabatti, Chiara; Gill, Lisa H.; Geschwind, Daniel H.

2002-01-01

Archival formalin-fixed, paraffin-embedded and ethanol-fixed tissues represent a potentially invaluable resource for gene expression analysis, as they are the most widely available material for studies of human disease. Little data are available evaluating whether RNA obtained from fixed (archival) tissues could produce reliable and reproducible microarray expression data. Here we compare the use of RNA isolated from human archival tissues fixed in ethanol and formalin to frozen tissue in cDNA microarray experiments. Since an additional factor that can limit the utility of archival tissue is the often small quantities available, we also evaluate the use of the tyramide signal amplification method (TSA), which allows the use of small amounts of RNA. Detailed analysis indicates that TSA provides a consistent and reproducible signal amplification method for cDNA microarray analysis, across both arrays and the genes tested. Analysis of this method also highlights the importance of performing non-linear channel normalization and dye switching. Furthermore, archived, fixed specimens can perform well, but not surprisingly, produce more variable results than frozen tissues. Consistent results are more easily obtainable using ethanol-fixed tissues, whereas formalin-fixed tissue does not typically provide a useful substrate for cDNA synthesis and labeling. PMID:11788730

Informatic selection of a neural crest-melanocyte cDNA set for microarray analysis

PubMed Central

Loftus, S. K.; Chen, Y.; Gooden, G.; Ryan, J. F.; Birznieks, G.; Hilliard, M.; Baxevanis, A. D.; Bittner, M.; Meltzer, P.; Trent, J.; Pavan, W.

1999-01-01

With cDNA microarrays, it is now possible to compare the expression of many genes simultaneously. To maximize the likelihood of finding genes whose expression is altered under the experimental conditions, it would be advantageous to be able to select clones for tissue-appropriate cDNA sets. We have taken advantage of the extensive sequence information in the dbEST expressed sequence tag (EST) database to identify a neural crest-derived melanocyte cDNA set for microarray analysis. Analysis of characterized genes with dbEST identified one library that contained ESTs representing 21 neural crest-expressed genes (library 198). The distribution of the ESTs corresponding to these genes was biased toward being derived from library 198. This is in contrast to the EST distribution profile for a set of control genes, characterized to be more ubiquitously expressed in multiple tissues (P < 1 × 10−9). From library 198, a subset of 852 clustered ESTs were selected that have a library distribution profile similar to that of the 21 neural crest-expressed genes. Microarray analysis demonstrated the majority of the neural crest-selected 852 ESTs (Mel1 array) were differentially expressed in melanoma cell lines compared with a non-neural crest kidney epithelial cell line (P < 1 × 10−8). This was not observed with an array of 1,238 ESTs that was selected without library origin bias (P = 0.204). This study presents an approach for selecting tissue-appropriate cDNAs that can be used to examine the expression profiles of developmental processes and diseases. PMID:10430933

Construction and application of EST library from Setaria italica in response to dehydration stress.

PubMed

Zhang, Jinpeng; Liu, Tingsong; Fu, Junjie; Zhu, Yun; Jia, Jinping; Zheng, Jun; Zhao, Yinhe; Zhang, Ying; Wang, Guoying

2007-07-01

Foxtail millet is a gramineous crop with low water requirement. Despite its high water use efficiency, less attention has been paid to the molecular genetics of foxtail millet. This article reports the construction of subtracted cDNA libraries from foxtail millet seedlings under dehydration stress and the expression profile analysis of 1947 UniESTs from the subtracted cDNA libraries by a cDNA microarray. The results showed that 95 and 57 ESTs were upregulated by dehydration stress, respectively, in roots and shoots of seedlings and that 10 and 27 ESTs were downregulated, respectively, in roots and shoots. The expression profile analysis showed that genes induced in foxtail millet roots were different from those in shoots during dehydration stress and that the early response to dehydration stress in foxtail millet roots was the activation of the glycolysis metabolism. Moreover, protein degradation pathway may also play a pivotal role in drought-tolerant responses of foxtail millet. Finally, Northern blot analysis validated well the cDNA microarray data.

Best practices for hybridization design in two-colour microarray analysis.

PubMed

Knapen, Dries; Vergauwen, Lucia; Laukens, Kris; Blust, Ronny

2009-07-01

Two-colour microarrays are a popular platform of choice in gene expression studies. Because two different samples are hybridized on a single microarray, and several microarrays are usually needed in a given experiment, there are many possible ways to combine samples on different microarrays. The actual combination employed is commonly referred to as the 'hybridization design'. Different types of hybridization designs have been developed, all aimed at optimizing the experimental setup for the detection of differentially expressed genes while coping with technical noise. Here, we first provide an overview of the different classes of hybridization designs, discussing their advantages and limitations, and then we illustrate the current trends in the use of different hybridization design types in contemporary research.

Virtual Northern analysis of the human genome.

PubMed

Hurowitz, Evan H; Drori, Iddo; Stodden, Victoria C; Donoho, David L; Brown, Patrick O

2007-05-23

We applied the Virtual Northern technique to human brain mRNA to systematically measure human mRNA transcript lengths on a genome-wide scale. We used separation by gel electrophoresis followed by hybridization to cDNA microarrays to measure 8,774 mRNA transcript lengths representing at least 6,238 genes at high (>90%) confidence. By comparing these transcript lengths to the Refseq and H-Invitational full-length cDNA databases, we found that nearly half of our measurements appeared to represent novel transcript variants. Comparison of length measurements determined by hybridization to different cDNAs derived from the same gene identified clones that potentially correspond to alternative transcript variants. We observed a close linear relationship between ORF and mRNA lengths in human mRNAs, identical in form to the relationship we had previously identified in yeast. Some functional classes of protein are encoded by mRNAs whose untranslated regions (UTRs) tend to be longer or shorter than average; these functional classes were similar in both human and yeast. Human transcript diversity is extensive and largely unannotated. Our length dataset can be used as a new criterion for judging the completeness of cDNAs and annotating mRNA sequences. Similar relationships between the lengths of the UTRs in human and yeast mRNAs and the functions of the proteins they encode suggest that UTR sequences serve an important regulatory role among eukaryotes.

EST resources and establishment and validation of a 16k cDNA microarray from Atlantic cod (Gadus morhua).

PubMed

Edvardsen, Rolf B; Malde, Ketil; Mittelholzer, Christian; Taranger, Geir Lasse; Nilsen, Frank

2011-03-01

The Atlantic cod, Gadus morhua, is an important species both for traditional fishery and increasingly also in fish farming. The Atlantic cod is also under potential threat from various environmental changes such as pollution and climate change, but the biological impact of such changes are not well known, in particular when it comes to sublethal effects that can be difficult to assert. Modern molecular and genomic approaches have revolutionized biological research during the last decade, and offer new avenues to study biological functions and e.g. the impact of anthropogenic activities at different life-stages for a given organism. In order to develop genomic data and genomic tools for Atlantic cod we conducted a program were we constructed 20 cDNA libraries, and produced and analyzed 44006 expressed sequence tags (ESTs) from these. Several tissues are represented in the multiple cDNA libraries, that differ in either sexual maturation or immulogical stimulation. This approach allowed us to identify genes that are expressed in particular tissues, life-stages or in response to specific stimuli, and also gives us information about potential functions of the transcripts. The ESTs were used to construct a 16k cDNA microarray to further investigate the cod transcriptome. Microarray analyses were preformed on pylorus, pituitary gland, spleen and testis of sexually maturing male cod. The four different tissues displayed tissue specific transcriptomes demonstrating that the cDNA array is working as expected and will prove to be a powerful tool in further experiments. Copyright © 2010 Elsevier Inc. All rights reserved.

Dose-response relationships in gene expression profiles in rainbow trout, Oncorhyncus mykiss, exposed to ethynylestradiol.

PubMed

Hook, Sharon E; Skillman, Ann D; Small, Jack A; Schultz, Irvin R

2006-07-01

Determining how gene expression profiles change with toxicant dose will improve the utility of arrays in identifying biomarkers and modes of toxic action. Isogenic rainbow trout, Oncorhyncus mykiss,were exposed to 10, 50 or 100 ng/L ethynylestradiol (a xeno-estrogen) for 7 days. Following exposure hepatic RNA was extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNAs. Transcript expression in treated vs control fish was analyzed via Genespring (Silicon Genetics) to identify genes with altered expression, as well as to determine gene clustering patterns that can be used as "expression signatures". Array results were confirmed via qRT PCR. Our analysis indicates that gene expression profiles varied somewhat with dose. Established biomarkers of exposure to estrogenic chemicals, such as vitellogenin, vitelline envelope proteins, and the estrogen receptor alpha, were induced at every dose. Other genes were dose specific, suggesting that different doses induce distinct physiological responses. These findings demonstrate that cDNA microarrays could be used to identify both toxicant class and relative dose.

[Expression of cell adhesion molecules in acute leukemia cell].

PubMed

Ju, Xiaoping; Peng, Min; Xu, Xiaoping; Lu, Shuqing; Li, Yao; Ying, Kang; Xie, Yi; Mao, Yumin; Xia, Fang

2002-11-01

To investigate the role of cell adhesion molecule in the development and extramedullary infiltration (EI) of acute leukemia. The expressions of neural cell adhesion molecule (NCAM) gene, intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule (VCAM-1) genes in 25 acute leukemia patients bone marrow cells were detected by microarray and reverse transcriptase-polymerase chain reaction (RT-PCR). The expressions of NCAM, ICAM-1 and VCAM-1 gene were significantly higher in acute leukemia cells and leukemia cells with EI than in normal tissues and leukemia cells without EI, respectively, both by cDNA microarray and by RT-PCR. The cDNA microarray is a powerful technique in analysis of acute leukemia cells associated genes. High expressions of cell adhesion molecule genes might be correlated with leukemia pathogenesis and infiltration of acute leukemia cell.

Microarray expression profiling identifies genes with altered expression in HDL-deficient mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Callow, Matthew J.; Dudoit, Sandrine; Gong, Elaine L.

2000-05-05

Based on the assumption that severe alterations in the expression of genes known to be involved in HDL metabolism may affect the expression of other genes we screened an array of over 5000 mouse expressed sequence tags (ESTs) for altered gene expression in the livers of two lines of mice with dramatic decreases in HDL plasma concentrations. Labeled cDNA from livers of apolipoprotein AI (apo AI) knockout mice, Scavenger Receptor BI (SR-BI) transgenic mice and control mice were co-hybridized to microarrays. Two-sample t-statistics were used to identify genes with altered expression levels in the knockout or transgenic mice compared withmore » the control mice. In the SR-BI group we found 9 array elements representing at least 5 genes to be significantly altered on the basis of an adjusted p value of less than 0.05. In the apo AI knockout group 8 array elements representing 4 genes were altered compared with the control group (p < 0.05). Several of the genes identified in the SR-BI transgenic suggest altered sterol metabolism and oxidative processes. These studies illustrate the use of multiple-testing methods for the identification of genes with altered expression in replicated microarray experiments of apo AI knockout and SR-BI transgenic mice.« less

Global monitoring of autumn gene expression within and among phenotypically divergent populations of Sitka spruce (Picea sitchensis).

PubMed

Holliday, Jason A; Ralph, Steven G; White, Richard; Bohlmann, Jörg; Aitken, Sally N

2008-01-01

Cold acclimation in conifers is a complex process, the timing and extent of which reflects local adaptation and varies widely along latitudinal gradients for many temperate and boreal tree species. Despite their ecological and economic importance, little is known about the global changes in gene expression that accompany autumn cold acclimation in conifers. Using three populations of Sitka spruce (Picea sitchensis) spanning the species range, and a Picea cDNA microarray with 21,840 unique elements, within- and among-population gene expression was monitored during the autumn. Microarray data were validated for selected genes using real-time PCR. Similar numbers of genes were significantly twofold upregulated (1257) and downregulated (967) between late summer and early winter. Among those upregulated were dehydrins, pathogenesis-related/antifreeze genes, carbohydrate and lipid metabolism genes, and genes involved in signal transduction and transcriptional regulation. Among-population microarray hybridizations at early and late autumn time points revealed substantial variation in the autumn transcriptome, some of which may reflect local adaptation. These results demonstrate the complexity of cold acclimation in conifers, highlight similarities and differences to cold tolerance in annual plants, and provide a solid foundation for functional and genetic studies of this important adaptive process.

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, J.; Varner, J.E.

1985-07-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

Multiple primer extension by DNA polymerase on a novel plastic DNA array coated with a biocompatible polymer

PubMed Central

Kinoshita, Kenji; Fujimoto, Kentaro; Yakabe, Toru; Saito, Shin; Hamaguchi, Yuzo; Kikuchi, Takayuki; Nonaka, Ken; Murata, Shigenori; Masuda, Daisuke; Takada, Wataru; Funaoka, Sohei; Arai, Susumu; Nakanishi, Hisao; Yokoyama, Kanehisa; Fujiwara, Kazuhiko; Matsubara, Kenichi

2007-01-01

DNA microarrays are routinely used to monitor gene expression profiling and single nucleotide polymorphisms (SNPs). However, for practically useful high performance, the detection sensitivity is still not adequate, leaving low expression genes undetected. To resolve this issue, we have developed a new plastic S-BIO® PrimeSurface® with a biocompatible polymer; its surface chemistry offers an extraordinarily stable thermal property for a lack of pre-activated glass slide surface. The oligonucleotides immobilized on this substrate are robust in boiling water and show no significant loss of hybridization activity during dissociation treatment. This allowed us to hybridize the templates, extend the 3′ end of the immobilized DNA primers on the S-Bio® by DNA polymerase using deoxynucleotidyl triphosphates (dNTP) as extender units, release the templates by denaturalization and use the same templates for a second round of reactions similar to that of the PCR method. By repeating this cycle, the picomolar concentration range of the template oligonucleotide can be detected as stable signals via the incorporation of labeled dUTP into primers. This method of Multiple Primer EXtension (MPEX) could be further extended as an alternative route for producing DNA microarrays for SNP analyses via simple template preparation such as reverse transcript cDNA or restriction enzyme treatment of genome DNA. PMID:17135189

APPLICATION OF DNA MICROARRAYS TO REPRODUCTIVE TOXICOLOGY AND THE DEVELOPMENT OF A TESTIS ARRAY

EPA Science Inventory

With the advent of sequence information for entire mammalian genomes, it is now possible to analyze gene expression and gene polymorphisms on a genomic scale. The primary tool for analysis of gene expression is the DNA microarray. We have used commercially available cDNA micro...

BIOMONITORING THE TOXICOGENOMIC RESPONSE TO ENDOCRINE DISRUPTING CHEMICALS IN HUMANS, LABORATORY SPECIES AND WILDLIFE

EPA Science Inventory

With the advent of sequence information for entire eukaryotic genomes, it is now possible to analyze gene expression on a genomic scale. The primary tool for genomic analysis of gene expression is the gene microarray. We have used commercially available and custom cDNA microarray...

CLOFIBRATE-INDUCED GENE EXPRESSION CHANGES IN RAT LIVER: A CROSS-LABORATORY ANALYSIS USING MEMBRANE CDNA ARRAYS

EPA Science Inventory

Microarrays have the potential to significantly impact our ability to identify toxic hazards by the identification of mechanistically-relevant markers of toxicity. To be useful for risk assessment however, microarray data must be challenged to determine its reliability and inter...

A highly oriented hybrid microarray modified electrode fabricated by a template-free method for ultrasensitive electrochemical DNA recognition

NASA Astrophysics Data System (ADS)

Shi, Lei; Chu, Zhenyu; Dong, Xueliang; Jin, Wanqin; Dempsey, Eithne

2013-10-01

Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors.Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors. Electronic supplementary information (ESI) available: Four-probe method for determining the conductivity of the hybrid crystal (Fig. S1); stability comparisons of the hybrid films (Fig. S2); FESEM images of the hybrid microarray (Fig. S3); electrochemical characterizations of the hybrid films (Fig. S4); DFT simulations (Fig. S5); cross-sectional FESEM image of the hybrid microarray (Fig. S6); regeneration and stability tests of the DNA biosensor (Fig. S7). See DOI: 10.1039/c3nr03097k

A molecular analysis by gene expression profiling reveals Bik/NBK overexpression in sporadic breast tumor samples of Mexican females

PubMed Central

García, Normand; Salamanca, Fabio; Astudillo-de la Vega, Horacio; Curiel-Quesada, Everardo; Alvarado, Isabel; Peñaloza, Rosenda; Arenas, Diego

2005-01-01

Background Breast cancer is one of the most frequent causes of death in Mexican women over 35 years of age. At molecular level, changes in many genetic networks have been reported as associated with this neoplasia. To analyze these changes, we determined gene expression profiles of tumors from Mexican women with breast cancer at different stages and compared these with those of normal breast tissue samples. Methods 32P-radiolabeled cDNA was synthesized by reverse transcription of mRNA from fresh sporadic breast tumor biopsies, as well as normal breast tissue. cDNA probes were hybridized to microarrays and expression levels registered using a phosphorimager. Expression levels of some genes were validated by real time RT-PCR and immunohistochemical assays. Results We identified two subgroups of tumors according to their expression profiles, probably related with cancer progression. Ten genes, unexpressed in normal tissue, were turned on in some tumors. We found consistent high expression of Bik gene in 14/15 tumors with predominant cytoplasmic distribution. Conclusion Recently, the product of the Bik gene has been associated with tumoral reversion in different neoplasic cell lines, and was proposed as therapy to induce apoptosis in cancers, including breast tumors. Even though a relationship among genes, for example those from a particular pathway, can be observed through microarrays, this relationship might not be sufficient to assign a definitive role to Bik in development and progression of the neoplasia. The findings herein reported deserve further investigation. PMID:16060964

Systematic spatial bias in DNA microarray hybridization is caused by probe spot position-dependent variability in lateral diffusion.

PubMed

Steger, Doris; Berry, David; Haider, Susanne; Horn, Matthias; Wagner, Michael; Stocker, Roman; Loy, Alexander

2011-01-01

The hybridization of nucleic acid targets with surface-immobilized probes is a widely used assay for the parallel detection of multiple targets in medical and biological research. Despite its widespread application, DNA microarray technology still suffers from several biases and lack of reproducibility, stemming in part from an incomplete understanding of the processes governing surface hybridization. In particular, non-random spatial variations within individual microarray hybridizations are often observed, but the mechanisms underpinning this positional bias remain incompletely explained. This study identifies and rationalizes a systematic spatial bias in the intensity of surface hybridization, characterized by markedly increased signal intensity of spots located at the boundaries of the spotted areas of the microarray slide. Combining observations from a simplified single-probe block array format with predictions from a mathematical model, the mechanism responsible for this bias is found to be a position-dependent variation in lateral diffusion of target molecules. Numerical simulations reveal a strong influence of microarray well geometry on the spatial bias. Reciprocal adjustment of the size of the microarray hybridization chamber to the area of surface-bound probes is a simple and effective measure to minimize or eliminate the diffusion-based bias, resulting in increased uniformity and accuracy of quantitative DNA microarray hybridization.

Systematic Spatial Bias in DNA Microarray Hybridization Is Caused by Probe Spot Position-Dependent Variability in Lateral Diffusion

PubMed Central

Haider, Susanne; Horn, Matthias; Wagner, Michael; Stocker, Roman; Loy, Alexander

2011-01-01

Background The hybridization of nucleic acid targets with surface-immobilized probes is a widely used assay for the parallel detection of multiple targets in medical and biological research. Despite its widespread application, DNA microarray technology still suffers from several biases and lack of reproducibility, stemming in part from an incomplete understanding of the processes governing surface hybridization. In particular, non-random spatial variations within individual microarray hybridizations are often observed, but the mechanisms underpinning this positional bias remain incompletely explained. Methodology/Principal Findings This study identifies and rationalizes a systematic spatial bias in the intensity of surface hybridization, characterized by markedly increased signal intensity of spots located at the boundaries of the spotted areas of the microarray slide. Combining observations from a simplified single-probe block array format with predictions from a mathematical model, the mechanism responsible for this bias is found to be a position-dependent variation in lateral diffusion of target molecules. Numerical simulations reveal a strong influence of microarray well geometry on the spatial bias. Conclusions Reciprocal adjustment of the size of the microarray hybridization chamber to the area of surface-bound probes is a simple and effective measure to minimize or eliminate the diffusion-based bias, resulting in increased uniformity and accuracy of quantitative DNA microarray hybridization. PMID:21858215

Screening and identification of gastric adenocarcinoma metastasis-related genes by using cDNA microarray coupled to FDD-PCR.

PubMed

Wang, Jian-Hua; Chen, Shi-Shu

2002-07-01

To clone gastric adenocarcinoma metastasis related genes, RF-1 cell line (primary tumor of a gastric adenocarcinoma patient ) and RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by reverse transcription method. The two color probes were then mixed and hybridized to the cDNA chip constructed by double-dots of 4 096 human genes, and scanned at two wavelengths. The experiment was repeated for 2 times. Differential expression genes from the above two cells were analyzed using the computer. 138 in all genes (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81(2.1%) genes revealed apparent up-regulation, and 56(1.3%) genes revealed down-regulation. 45 genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including 3 novel genes. There were 7 differential expression genes that agreed with each other in two detection methods. The possible roles of some differential expressed genes, which maybe involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large scale manner, in combination with FDD-PCR for cloning unknown novel genes. In conclusion, some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis.

Microarray analysis identified Puccinia striiformis f. sp. tritici genes involved in infection and sporulation.

USDA-ARS?s Scientific Manuscript database

Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, one of the most important diseases of wheat worldwide. To identify Pst genes involved in infection and sporulation, a custom oligonucleotide Genechip was made using sequences of 442 genes selected from Pst cDNA libraries. Microarray analy...

A cDNA microarray gene expression data classifier for clinical diagnostics based on graph theory.

PubMed

Benso, Alfredo; Di Carlo, Stefano; Politano, Gianfranco

2011-01-01

Despite great advances in discovering cancer molecular profiles, the proper application of microarray technology to routine clinical diagnostics is still a challenge. Current practices in the classification of microarrays' data show two main limitations: the reliability of the training data sets used to build the classifiers, and the classifiers' performances, especially when the sample to be classified does not belong to any of the available classes. In this case, state-of-the-art algorithms usually produce a high rate of false positives that, in real diagnostic applications, are unacceptable. To address this problem, this paper presents a new cDNA microarray data classification algorithm based on graph theory and is able to overcome most of the limitations of known classification methodologies. The classifier works by analyzing gene expression data organized in an innovative data structure based on graphs, where vertices correspond to genes and edges to gene expression relationships. To demonstrate the novelty of the proposed approach, the authors present an experimental performance comparison between the proposed classifier and several state-of-the-art classification algorithms.

Virtual Northern Analysis of the Human Genome

PubMed Central

Hurowitz, Evan H.; Drori, Iddo; Stodden, Victoria C.; Donoho, David L.; Brown, Patrick O.

2007-01-01

Background We applied the Virtual Northern technique to human brain mRNA to systematically measure human mRNA transcript lengths on a genome-wide scale. Methodology/Principal Findings We used separation by gel electrophoresis followed by hybridization to cDNA microarrays to measure 8,774 mRNA transcript lengths representing at least 6,238 genes at high (>90%) confidence. By comparing these transcript lengths to the Refseq and H-Invitational full-length cDNA databases, we found that nearly half of our measurements appeared to represent novel transcript variants. Comparison of length measurements determined by hybridization to different cDNAs derived from the same gene identified clones that potentially correspond to alternative transcript variants. We observed a close linear relationship between ORF and mRNA lengths in human mRNAs, identical in form to the relationship we had previously identified in yeast. Some functional classes of protein are encoded by mRNAs whose untranslated regions (UTRs) tend to be longer or shorter than average; these functional classes were similar in both human and yeast. Conclusions/Significance Human transcript diversity is extensive and largely unannotated. Our length dataset can be used as a new criterion for judging the completeness of cDNAs and annotating mRNA sequences. Similar relationships between the lengths of the UTRs in human and yeast mRNAs and the functions of the proteins they encode suggest that UTR sequences serve an important regulatory role among eukaryotes. PMID:17520019

PNA-PEG modified silicon platforms as functional bio-interfaces for applications in DNA microarrays and biosensors.

PubMed

Cattani-Scholz, Anna; Pedone, Daniel; Blobner, Florian; Abstreiter, Gerhard; Schwartz, Jeffrey; Tornow, Marc; Andruzzi, Luisa

2009-03-09

The synthesis and characterization of two types of silicon-based biofunctional interfaces are reported; each interface bonds a dense layer of poly(ethylene glycol) (PEG(n)) and peptide nucleic acid (PNA) probes. Phosphonate self-assembled monolayers were derivatized with PNA using a maleimido-terminated PEG(45). Similarly, siloxane monolayers were functionalized with PNA using a maleimido-terminated PEG(45) spacer and were subsequently modified with a shorter methoxy-terminated PEG(12) ("back-filling"). The long PEG(45) spacer was used to distance the PNA probe from the surface and to minimize undesirable nonspecific adsorption of DNA analyte. The short PEG(12) "back-filler" was used to provide additional passivation of the surface against nonspecific DNA adsorption. X-ray photoelectron spectroscopic (XPS) analysis near the C 1s and N 1s ionization edges was done to characterize chemical groups formed in the near-surface region, which confirmed binding of PEG and PNA to the phosphonate and silane films. XPS also indicated that additional PEG chains were tethered to the surface during the back-filling process. Fluorescence hybridization experiments were carried out with complementary and noncDNA strands; both phosphonate and siloxane biofunctional surfaces were effective for hybridization of cDNA strands and significantly reduced nonspecific adsorption of the analyte. Spatial patterns were prepared by polydimethylsiloxane (PDMS) micromolding on the PNA-functionalized surfaces; selective hybridization of fluorescently labeled DNA was shown at the PNA functionalized regions, and physisorption at the probe-less PEG-functionalized regions was dramatically reduced. These results show that PNA-PEG derivatized phosphonate monolayers hold promise for the smooth integration of device surface chemistry with semiconductor technology for the fabrication of DNA biosensors. In addition, our results confirm that PNA-PEG derivatized self-assembled carboxyalkylsiloxane films are promising substrates for DNA microarray applications.

Unique Chemokine Profiles of Lung Tissues Distinguish Post-chemotherapeutic Persistent and Chronic Tuberculosis in a Mouse Model.

PubMed

Park, Soomin; Baek, Seung-Hun; Cho, Sang-Nae; Jang, Young-Saeng; Kim, Ahreum; Choi, In-Hong

2017-01-01

There is a substantial need for biomarkers to distinguish latent stage from active Mycobacterium tuberculosis infections, for predicting disease progression. To induce the reactivation of tuberculosis, we present a new experimental animal model modified based on the previous model established by our group. In the new model, the reactivation of tuberculosis is induced without administration of immunosuppressive agents, which might disturb immune responses. To identify the immunological status of the persistent and chronic stages, we analyzed immunological genes in lung tissues from mice infected with M. tuberculosis . Gene expression was screened using cDNA microarray analysis and confirmed by quantitative RT-PCR. Based on the cDNA microarray results, 11 candidate cytokines genes, which were obviously up-regulated during the chronic stage compared with those during the persistent stage, were selected and clustered into three groups: (1) chemokine genes, except those of monocyte chemoattractant proteins (MCPs; CXCL9, CXCL10, CXCL11, CCL5, CCL19); (2) MCP genes (CCL2, CCL7, CCL8, CCL12); and (3) TNF and IFN-γ genes. Results from the cDNA microarray and quantitative RT-PCR analyses revealed that the mRNA expression of the selected cytokine genes was significantly higher in lung tissues of the chronic stage than of the persistent stage. Three chemokines (CCL5, CCL19, and CXCL9) and three MCPs (CCL7, CCL2, and CCL12) were noticeably increased in the chronic stage compared with the persistent stage by cDNA microarray ( p < 0.01, except CCL12) or RT-PCR ( p < 0.01). Therefore, these six significantly increased cytokines in lung tissue from the mouse tuberculosis model might be candidates for biomarkers to distinguish the two disease stages. This information can be combined with already reported potential biomarkers to construct a network of more efficient tuberculosis markers.

The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika

2010-01-27

Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set ofmore » tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in EST library sequencing approaches, and thus represent a rich resource for studies of environmental genomics.« less

Extending Immunological Profiling in the Gilthead Sea Bream, Sparus aurata, by Enriched cDNA Library Analysis, Microarray Design and Initial Studies upon the Inflammatory Response to PAMPs.

PubMed

Boltaña, Sebastian; Castellana, Barbara; Goetz, Giles; Tort, Lluis; Teles, Mariana; Mulero, Victor; Novoa, Beatriz; Figueras, Antonio; Goetz, Frederick W; Gallardo-Escarate, Cristian; Planas, Josep V; Mackenzie, Simon

2017-02-03

This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ) to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST) from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS) and peptidoglycan (PGN)). Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO) showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs), carrier proteins/membrane transport (approximately 15%), effectors/modulators and cell communication (approximately 11%), nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5%) and intracellular transducers/signal transduction (approximately 5%). Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ) that provides a platform enriched for the study of gene expression in S. aurata with an emphasis upon immunity and the immune response.

Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray

PubMed Central

Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

2003-01-01

AIM: To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. METHODS: The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. RESULTS: Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. CONCLUSION: Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators. PMID:12632483

Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray.

PubMed

Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

2003-03-01

To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators.

Genetic Heterogeneity in Streptococcus mutans1

PubMed Central

Coykendall, Alan L.

1971-01-01

The genetic homogeneity among eight cariogenic strains of Streptococcus mutans was assessed by deoxyribonucleic acid (DNA)-DNA reassociation experiments. DNA species were extracted from strains GS5, Ingbritt, 10449, FAl, BHT, E49, SLl, and KlR. Labeled DNA (14C-DNA) was extracted from strains 10449, FAl, and SLl. Denatured 14C-DNA fragments were allowed to reassociate, i.e., form hybrid duplexes, with denatured DNA immobilized on membrane filters incubated in 0.45 m NaCl-0.045 m sodium citrate at 67 or 75 C. At 67 C, 10449 14C-DNA reassociated extensively only with GS5 and Ingbritt DNA. FAl 14C-DNA hybridized extensively only with BHT DNA, and SLl 14C-DNA reassociated with KlR and E49 DNA. DNA which hybridized extensively at 67 C also reassociated to a high degree at 75 C. Thermal elution of 14C-FAl-BHT duplexes showed that the hybrid duplexes were thermostable. The results indicate that S. mutans is a genetically heterogeneous species. The strains studied can be divided into three (possibly four) genetic groups, and these groups closely parallel antigenic groups. PMID:5551636

Dose–response relationships in gene expression profiles in rainbow trout, Oncorhyncus mykiss, exposed to ethynylestradiol

PubMed Central

Hook, Sharon E.; Skillman, Ann D.; Small, Jack A.; Schultz, Irvin R.

2008-01-01

Determining how gene expression profiles change with toxicant dose will improve the utility of arrays in identifying biomarkers and modes of toxic action. Isogenic rainbow trout, Oncorhyncus mykiss, were exposed to 10, 50 or 100 ng/L ethynylestradiol (a xeno-estrogen) for 7 days. Following exposure hepatic RNA was extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNAs. Transcript expression in treated vs control fish was analyzed via Genespring (Silicon Genetics) to identify genes with altered expression, as well as to determine gene clustering patterns that can be used as “expression signatures”. Array results were confirmed via qRT PCR. Our analysis indicates that gene expression profiles varied somewhat with dose. Established biomarkers of exposure to estrogenic chemicals, such as vitellogenin, vitelline envelope proteins, and the estrogen receptor alpha, were induced at every dose. Other genes were dose specific, suggesting that diffierent doses induce distinct physiological responses. These findings demonstrate that cDNA microarrays could be used to identify both toxicant class and relative dose. PMID:16725192

Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

PubMed

Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

2015-06-01

Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

Latent Herpes Simplex Virus Infection of Sensory Neurons Alters Neuronal Gene Expression

PubMed Central

Kramer, Martha F.; Cook, W. James; Roth, Frederick P.; Zhu, Jia; Holman, Holly; Knipe, David M.; Coen, Donald M.

2003-01-01

The persistence of herpes simplex virus (HSV) and the diseases that it causes in the human population can be attributed to the maintenance of a latent infection within neurons in sensory ganglia. Little is known about the effects of latent infection on the host neuron. We have addressed the question of whether latent HSV infection affects neuronal gene expression by using microarray transcript profiling of host gene expression in ganglia from latently infected versus mock-infected mouse trigeminal ganglia. 33P-labeled cDNA probes from pooled ganglia harvested at 30 days postinfection or post-mock infection were hybridized to nylon arrays printed with 2,556 mouse genes. Signal intensities were acquired by phosphorimager. Mean intensities (n = 4 replicates in each of three independent experiments) of signals from mock-infected versus latently infected ganglia were compared by using a variant of Student's t test. We identified significant changes in the expression of mouse neuronal genes, including several with roles in gene expression, such as the Clk2 gene, and neurotransmission, such as genes encoding potassium voltage-gated channels and a muscarinic acetylcholine receptor. We confirmed the neuronal localization of some of these transcripts by using in situ hybridization. To validate the microarray results, we performed real-time reverse transcriptase PCR analyses for a selection of the genes. These studies demonstrate that latent HSV infection can alter neuronal gene expression and might provide a new mechanism for how persistent viral infection can cause chronic disease. PMID:12915567

[Primary culture of cat intestinal epithelial cell and construction of its cDNA library].

PubMed

Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C

2017-04-12

Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.

Determining miRNA Expression Levels in Degraded RNA Samples Using Real-Time RT-qPCR and Microarray Technologies

PubMed Central

Tighe, S.; Holbrook, J.; Nadella, V.; Carmical, R.; Sol-Church, K.; Yueng, A.T.; Chittur, S.

2011-01-01

The Nucleic Acid Research Group (NARG) has previously conducted studies evaluating the impact of RNA integrity and priming strategies on cDNA synthesis and real-time RT-qPCR. The results of last year's field study as it relates to degraded RNA will be presented. In continuation of the RNA integrity theme, this year's study was designed to evaluate the impact of RNA integrity on the analysis of miRNA expression using real-time RT-qPCR. Target section was based on data obtained by the Microarray Research Group (MARG) and other published data from next gen sequencing. These 9 miRNAs represent three groups of miRNA that are expressed at low, medium or high levels in the First Choice human brain reference RNA sample. Two popular RT priming strategies tested in this study include the Megaplex miRNA TaqMan assay (ABI) and the RT2 miRNA qPCR assay (Qiagen/SA Biosciences). The basis for the ABI assay design is a target-specific stem-loop structure and reverse-transcription primer, while the Qiagen design combines poly(A) tailing and a universal reverse transcription in one cDNA synthesis reaction. For this study, the human brain reference RNA was subject to controlled degradation using RNase A to RIN (RNA Integrity Number) values of 7 (good), 4 (moderately degraded), and 2 (severely degraded).These templates were then used to assess both RT methods. In addition to this real-time RT-qPCR data, the same RNA templates were further analyzed using universal poly(A) tailing and hybridization to Affymetrix miRNA GeneChips. This talk will provide insights into RT priming strategies for miRNA and contrast the qPCR results obtained using different technologies.

Microarray-Based Mapping for the Detection of Molecular Markers in Response to Aspergillus flavus Infection in Susceptible and Resistant Maize Lines

USDA-ARS?s Scientific Manuscript database

The objectives of this study were (1) to evaluate differential gene expression levels for resistance to A. flavus kernel infection in susceptible (Va35) and resistant (Mp313E) maize lines using Oligonucleotide and cDNA microarray analysis, (2) to evaluate differences in A. flavus accumulation betwee...

Screening and identification of gastric adenocarcinoma metastasis-related genes using cDNA microarray coupled to FDD-PCR.

PubMed

Wang, Jianhua; Chen, Shishu

2002-10-01

To identify certain gastric adenocarcinoma metastasis-related genes, an RF-1 cell line (primary tumor from a gastric adenocarcinoma patient) and an RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by the reverse transcription method. The two color probes were then mixed and hybridized to a cDNA chip constructed with double-dots from 4,096 human genes, and scanned at two wavelengths. The experiment was repeated twice. Differentially expressedn genes from the above two cells were analyzed by use of computer. Of the total genes, 138 (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81 (2.1%) genes revealed apparent up-regulation, and 56 (1.3%) genes revealed down-regulation. Forty-five genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including three novel genes. There were seven differentially expressed genes that presented the same behaviour under both detection methods. The possible roles of some differentially expressed genes, which may be involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large-scale manner in combination with FDD-PCR for cloning unknown novel genes. Some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis and provide new targets for therapeutic intervention.

A DNA microarray-based methylation-sensitive (MS)-AFLP hybridization method for genetic and epigenetic analyses.

PubMed

Yamamoto, F; Yamamoto, M

2004-07-01

We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Combined analysis of transcriptome and proteome data as a tool for the identification of candidate biomarkers in renal cell carcinoma

PubMed Central

Seliger, Barbara; Dressler, Sven P.; Wang, Ena; Kellner, Roland; Recktenwald, Christian V.; Lottspeich, Friedrich; Marincola, Francesco M.; Baumgärtner, Maja; Atkins, Derek; Lichtenfels, Rudolf

2012-01-01

Results obtained from expression profilings of renal cell carcinoma using different “ome”-based approaches and comprehensive data analysis demonstrated that proteome-based technologies and cDNA microarray analyses complement each other during the discovery phase for disease-related candidate biomarkers. The integration of the respective data revealed the uniqueness and complementarities of the different technologies. While comparative cDNA microarray analyses though restricted to upregulated targets largely revealed genes involved in controlling gene/protein expression (19%) and signal transduction processes (13%), proteomics/PROTEOMEX-defined candidate biomarkers include enzymes of the cellular metabolism (36%), transport proteins (12%) and cell motility/structural molecules (10%). Candidate biomarkers defined by proteomics and PROTEOMEX are frequently shared, whereas the sharing rate between cDNA microarray and proteome-based profilings is limited. Putative candidate biomarkers provide insights into their cellular (dys)function and their diagnostic/prognostic value but still warrant further validation in larger patient numbers. Based on the fact that merely 3 candidate biomarkers were shared by all applied technologies, namely annexin A4, tubulin alpha-1A chain and ubiquitin carboxyl-terminal hydrolase L1 the analysis at a single hierarchical level of biological regulation seems to provide only limited results thus emphasizing the importance and benefit of performing rather combinatorial screenings which can complement the standard clinical predictors. PMID:19235166

Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

PubMed

Schuetz, J D; Guzelian, P S

1995-03-14

We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

Gene expression analysis of rheumatoid arthritis synovial lining regions by cDNA microarray combined with laser microdissection: up-regulation of inflammation-associated STAT1, IRF1, CXCL9, CXCL10, and CCL5

PubMed Central

Yoshida, S; Arakawa, F; Higuchi, F; Ishibashi, Y; Goto, M; Sugita, Y; Nomura, Y; Niino, D; Shimizu, K; Aoki, R; Hashikawa, K; Kimura, Y; Yasuda, K; Tashiro, K; Kuhara, S; Nagata, K; Ohshima, K

2012-01-01

Objectives The main histological change in rheumatoid arthritis (RA) is the villous proliferation of synovial lining cells, an important source of cytokines and chemokines, which are associated with inflammation. The aim of this study was to evaluate gene expression in the microdissected synovial lining cells of RA patients, using those of osteoarthritis (OA) patients as the control. Methods Samples were obtained during total joint replacement from 11 RA and five OA patients. Total RNA from the synovial lining cells was derived from selected specimens by laser microdissection (LMD) for subsequent cDNA microarray analysis. In addition, the expression of significant genes was confirmed immunohistochemically. Results The 14 519 genes detected by cDNA microarray were used to compare gene expression levels in synovial lining cells from RA with those from OA patients. Cluster analysis indicated that RA cells, including low- and high-expression subgroups, and OA cells were stored in two main clusters. The molecular activity of RA was statistically consistent with its clinical and histological activity. Expression levels of signal transducer and activator of transcription 1 (STAT1), interferon regulatory factor 1 (IRF1), and the chemokines CXCL9, CXCL10, and CCL5 were statistically significantly higher in the synovium of RA than in that of OA. Immunohistochemically, the lining synovium of RA, but not that of OA, clearly expressed STAT1, IRF1, and chemokines, as was seen in microarray analysis combined with LMD. Conclusions Our findings indicate an important role for lining synovial cells in the inflammatory and proliferative processes of RA. Further understanding of the local signalling in structural components is important in rheumatology. PMID:22401175

cDNA microarrays as a tool for identification of biomineralization proteins in the coccolithophorid Emiliania huxleyi (Haptophyta).

PubMed

Quinn, Patrick; Bowers, Robert M; Zhang, Xiaoyu; Wahlund, Thomas M; Fanelli, Michael A; Olszova, Daniela; Read, Betsy A

2006-08-01

Marine unicellular coccolithophore algae produce species-specific calcite scales otherwise known as coccoliths. While the coccoliths and their elaborate architecture have attracted the attention of investigators from various scientific disciplines, our knowledge of the underpinnings of the process of biomineralization in this alga is still in its infancy. The processes of calcification and coccolithogenesis are highly regulated and likely to be complex, requiring coordinated expression of many genes and pathways. In this study, we have employed cDNA microarrays to investigate changes in gene expression associated with biomineralization in the most abundant coccolithophorid, Emiliania huxleyi. Expression profiling of cultures grown under calcifying and noncalcifying conditions has been carried out using cDNA microarrays corresponding to approximately 2,300 expressed sequence tags. A total of 127 significantly up- or down-regulated transcripts were identified using a P value of 0.01 and a change of >2.0-fold. Real-time reverse transcriptase PCR was used to test the overall validity of the microarray data, as well as the relevance of many of the proteins predicted to be associated with biomineralization, including a novel gamma-class carbonic anhydrase (A. R. Soto, H. Zheng, D. Shoemaker, J. Rodriguez, B. A. Read, and T. M. Wahlund, Appl. Environ. Microbiol. 72:5500-5511, 2006). Differentially regulated genes include those related to cellular metabolism, ion channels, transport proteins, vesicular trafficking, and cell signaling. The putative function of the vast majority of candidate transcripts could not be defined. Nonetheless, the data described herein represent profiles of the transcription changes associated with biomineralization-related pathways in E. huxleyi and have identified novel and potentially useful targets for more detailed analysis.

cDNA Microarrays as a Tool for Identification of Biomineralization Proteins in the Coccolithophorid Emiliania huxleyi (Haptophyta)

PubMed Central

Quinn, Patrick; Bowers, Robert M.; Zhang, Xiaoyu; Wahlund, Thomas M.; Fanelli, Michael A.; Olszova, Daniela; Read, Betsy A.

2006-01-01

Marine unicellular coccolithophore algae produce species-specific calcite scales otherwise known as coccoliths. While the coccoliths and their elaborate architecture have attracted the attention of investigators from various scientific disciplines, our knowledge of the underpinnings of the process of biomineralization in this alga is still in its infancy. The processes of calcification and coccolithogenesis are highly regulated and likely to be complex, requiring coordinated expression of many genes and pathways. In this study, we have employed cDNA microarrays to investigate changes in gene expression associated with biomineralization in the most abundant coccolithophorid, Emiliania huxleyi. Expression profiling of cultures grown under calcifying and noncalcifying conditions has been carried out using cDNA microarrays corresponding to approximately 2,300 expressed sequence tags. A total of 127 significantly up- or down-regulated transcripts were identified using a P value of 0.01 and a change of >2.0-fold. Real-time reverse transcriptase PCR was used to test the overall validity of the microarray data, as well as the relevance of many of the proteins predicted to be associated with biomineralization, including a novel gamma-class carbonic anhydrase (A. R. Soto, H. Zheng, D. Shoemaker, J. Rodriguez, B. A. Read, and T. M. Wahlund, Appl. Environ. Microbiol. 72:5500-5511, 2006). Differentially regulated genes include those related to cellular metabolism, ion channels, transport proteins, vesicular trafficking, and cell signaling. The putative function of the vast majority of candidate transcripts could not be defined. Nonetheless, the data described herein represent profiles of the transcription changes associated with biomineralization-related pathways in E. huxleyi and have identified novel and potentially useful targets for more detailed analysis. PMID:16885305

Expanding probe repertoire and improving reproducibility in human genomic hybridization

PubMed Central

Dorman, Stephanie N.; Shirley, Ben C.; Knoll, Joan H. M.; Rogan, Peter K.

2013-01-01

Diagnostic DNA hybridization relies on probes composed of single copy (sc) genomic sequences. Sc sequences in probe design ensure high specificity and avoid cross-hybridization to other regions of the genome, which could lead to ambiguous results that are difficult to interpret. We examine how the distribution and composition of repetitive sequences in the genome affects sc probe performance. A divide and conquer algorithm was implemented to design sc probes. With this approach, sc probes can include divergent repetitive elements, which hybridize to unique genomic targets under higher stringency experimental conditions. Genome-wide custom probe sets were created for fluorescent in situ hybridization (FISH) and microarray genomic hybridization. The scFISH probes were developed for detection of copy number changes within small tumour suppressor genes and oncogenes. The microarrays demonstrated increased reproducibility by eliminating cross-hybridization to repetitive sequences adjacent to probe targets. The genome-wide microarrays exhibited lower median coefficients of variation (17.8%) for two HapMap family trios. The coefficients of variations of commercial probes within 300 nt of a repetitive element were 48.3% higher than the nearest custom probe. Furthermore, the custom microarray called a chromosome 15q11.2q13 deletion more consistently. This method for sc probe design increases probe coverage for FISH and lowers variability in genomic microarrays. PMID:23376933

The Diagnostic Yield of Array Comparative Genomic Hybridization Is High Regardless of Severity of Intellectual Disability/Developmental Delay in Children.

PubMed

D'Arrigo, Stefano; Gavazzi, Francesco; Alfei, Enrico; Zuffardi, Orsetta; Montomoli, Cristina; Corso, Barbara; Buzzi, Erika; Sciacca, Francesca L; Bulgheroni, Sara; Riva, Daria; Pantaleoni, Chiara

2016-05-01

Microarray-based comparative genomic hybridization is a method of molecular analysis that identifies chromosomal anomalies (or copy number variants) that correlate with clinical phenotypes. The aim of the present study was to apply a clinical score previously designated by de Vries to 329 patients with intellectual disability/developmental disorder (intellectual disability/developmental delay) referred to our tertiary center and to see whether the clinical factors are associated with a positive outcome of aCGH analyses. Another goal was to test the association between a positive microarray-based comparative genomic hybridization result and the severity of intellectual disability/developmental delay. Microarray-based comparative genomic hybridization identified structural chromosomal alterations responsible for the intellectual disability/developmental delay phenotype in 16% of our sample. Our study showed that causative copy number variants are frequently found even in cases of mild intellectual disability (30.77%). We want to emphasize the need to conduct microarray-based comparative genomic hybridization on all individuals with intellectual disability/developmental delay, regardless of the severity, because the degree of intellectual disability/developmental delay does not predict the diagnostic yield of microarray-based comparative genomic hybridization. © The Author(s) 2015.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

Differential expression of hepatic genes with embryonic exposure to an environmentally relevant PCB mixture in Japanese quail (Coturnix japonica).

PubMed

Bohannon, Meredith E; Porter, Tom E; Lavoie, Emma T; Ottinger, Mary Ann

2018-06-22

The upper Hudson River was contaminated with polychlorinated biphenyls (PCB) Aroclor mixtures from the 1940s until the late 1970s. Several well-established biomarkers, such as induction of hepatic cytochrome P450 monooxygenases, were used to measure exposure to PCBs and similar contaminants in birds. In the present study, Japanese quail eggs were injected with a PCB mixture based upon a congener profile found in spotted sandpiper eggs at the upper Hudson River and subsequently, RNA was extracted from hatchling liver tissue for hybridization to a customized chicken cDNA microarray. Nominal concentrations of the mixture used for microarray hybridization were 0, 6, 12, or 49 μg/g egg. Hepatic gene expression profiles were analyzed using cluster and pathway analyses. Results showed potentially useful biomarkers of both exposure and effect attributed to PCB mixture. Biorag and Ingenuity Pathway Analysis® analyses revealed differentially expressed genes including those involved in glycolysis, xenobiotic metabolism, replication, protein degradation, and tumor regulation. These genes included cytochrome P450 1A5 (CYP1A5), cytochrome b5 (CYB5), NADH-cytochrome b5 reductase, glutathione S-transferase (GSTA), fructose bisphosphate aldolase (ALDOB), glycogen phosphorylase, carbonic anhydrase, and DNA topoisomerase II. CYP1A5, CYB5, GSTA, and ALDOB were chosen for quantitative real-time polymerase chain reaction confirmation, as these genes exhibited a clear dose response on the array. Data demonstrated that an initial transcriptional profile associated with an environmentally relevant PCB mixture in Japanese quail occurred.

Constitutive expression of a grapevine polygalacturonase-inhibiting protein affects gene expression and cell wall properties in uninfected tobacco

PubMed Central

2011-01-01

Background Polygalacturonase-inhibiting proteins (PGIPs) directly limit the effective ingress of fungal pathogens by inhibiting cell wall-degrading endopolygalacturonases (ePGs). Transgenic tobacco plants over-expressing grapevine (Vitis vinifera) Vvpgip1 have previously been shown to be resistant to Botrytis infection. In this study we characterized two of these PGIP over-expressing lines with known resistance phenotypes by gene expression and hormone profiling in the absence of pathogen infection. Results Global gene expression was performed by a cross-species microarray approach using a potato cDNA microarray. The degree of potential cross-hybridization between probes was modeled by a novel computational workflow designed in-house. Probe annotations were updated by predicting probe-to-transcript hybridizations and combining information derived from other plant species. Comparing uninfected Vvpgip1-overexpressing lines to wild-type (WT), 318 probes showed significant change in expression. Functional groups of genes involved in metabolism and associated to the cell wall were identified and consequent cell wall analysis revealed increased lignin-levels in the transgenic lines, but no major differences in cell wall-derived polysaccharides. GO enrichment analysis also identified genes responsive to auxin, which was supported by elevated indole-acetic acid (IAA) levels in the transgenic lines. Finally, a down-regulation of xyloglucan endotransglycosylase/hydrolases (XTHs), which are important in cell wall remodeling, was linked to a decrease in total XTH activity. Conclusions This evaluation of PGIP over-expressing plants performed under pathogen-free conditions to exclude the classical PGIP-ePG inhibition interaction indicates additional roles for PGIPs beyond the inhibition of ePGs. PMID:22078230

Transcriptome analysis in non-model species: a new method for the analysis of heterologous hybridization on microarrays

PubMed Central

2010-01-01

Background Recent developments in high-throughput methods of analyzing transcriptomic profiles are promising for many areas of biology, including ecophysiology. However, although commercial microarrays are available for most common laboratory models, transcriptome analysis in non-traditional model species still remains a challenge. Indeed, the signal resulting from heterologous hybridization is low and difficult to interpret because of the weak complementarity between probe and target sequences, especially when no microarray dedicated to a genetically close species is available. Results We show here that transcriptome analysis in a species genetically distant from laboratory models is made possible by using MAXRS, a new method of analyzing heterologous hybridization on microarrays. This method takes advantage of the design of several commercial microarrays, with different probes targeting the same transcript. To illustrate and test this method, we analyzed the transcriptome of king penguin pectoralis muscle hybridized to Affymetrix chicken microarrays, two organisms separated by an evolutionary distance of approximately 100 million years. The differential gene expression observed between different physiological situations computed by MAXRS was confirmed by real-time PCR on 10 genes out of 11 tested. Conclusions MAXRS appears to be an appropriate method for gene expression analysis under heterologous hybridization conditions. PMID:20509979

Differential gene expression related to Nora virus infection of Drosophila melanogaster

PubMed Central

Cordes, Ethan J.; Licking-Murray, Kellie D; Carlson, Kimberly A.

2013-01-01

Nora virus is a recently discovered RNA picorna-like virus that produces a persistent infection in Drosophila melanogaster, but the antiviral pathway or change in gene expression is unknown. We performed cDNA microarray analysis comparing the gene expression profiles of Nora virus infected and uninfected wild-type D. melanogaster. This analysis yielded 58 genes exhibiting a 1.5-fold change or greater and p-value less than 0.01. Of these genes, 46 were up-regulated and 12 down-regulated in response to infection. To validate the microarray results, qRT-PCR was performed with probes for Chorion protein 16 and Troponin C isoform 4, which show good correspondence with cDNA microarray results. Differential regulation of genes associated with Toll and immune-deficient pathways, cytoskeletal development, Janus Kinase-Signal Transducer and Activator of Transcription interactions, and a potential gut-specific innate immune response were found. This genome-wide expression profile of Nora virus infection of D. melanogaster can pinpoint genes of interest for further investigation of antiviral pathways employed, genetic mechanisms, sites of replication, viral persistence, and developmental effects. PMID:23603562

Flow cytometric purification of Colletotrichum higginsianum biotrophic hyphae from Arabidopsis leaves for stage-specific transcriptome analysis.

PubMed

Takahara, Hiroyuki; Dolf, Andreas; Endl, Elmar; O'Connell, Richard

2009-08-01

Generation of stage-specific cDNA libraries is a powerful approach to identify pathogen genes that are differentially expressed during plant infection. Biotrophic pathogens develop specialized infection structures inside living plant cells, but sampling the transcriptome of these structures is problematic due to the low ratio of fungal to plant RNA, and the lack of efficient methods to isolate them from infected plants. Here we established a method, based on fluorescence-activated cell sorting (FACS), to purify the intracellular biotrophic hyphae of Colletotrichum higginsianum from homogenates of infected Arabidopsis leaves. Specific selection of viable hyphae using a fluorescent vital marker provided intact RNA for cDNA library construction. Pilot-scale sequencing showed that the library was enriched with plant-induced and pathogenicity-related fungal genes, including some encoding small, soluble secreted proteins that represent candidate fungal effectors. The high purity of the hyphae (94%) prevented contamination of the library by sequences derived from host cells or other fungal cell types. RT-PCR confirmed that genes identified in the FACS-purified hyphae were also expressed in planta. The method has wide applicability for isolating the infection structures of other plant pathogens, and will facilitate cell-specific transcriptome analysis via deep sequencing and microarray hybridization, as well as proteomic analyses.

Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization

PubMed Central

Girard, Laurie D.; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G.

2014-01-01

The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have a high complexity cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotidesequence-dependent segment and a unique “target sequence-independent” 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets. PMID:25489607

Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

PubMed

Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

2015-02-07

The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets.

Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

PubMed Central

Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

1991-01-01

Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Complementation of non-tumorigenicity of HPV18-positive cervical carcinoma cells involves differential mRNA expression of cellular genes including potential tumor suppressor genes on chromosome 11q13.

PubMed

Kehrmann, Angela; Truong, Ha; Repenning, Antje; Boger, Regina; Klein-Hitpass, Ludger; Pascheberg, Ulrich; Beckmann, Alf; Opalka, Bertram; Kleine-Lowinski, Kerstin

2013-01-01

The fusion between human tumorigenic cells and normal human diploid fibroblasts results in non-tumorigenic hybrid cells, suggesting a dominant role for tumor suppressor genes in the generated hybrid cells. After long-term cultivation in vitro, tumorigenic segregants may arise. The loss of tumor suppressor genes on chromosome 11q13 has been postulated to be involved in the induction of the tumorigenic phenotype of human papillomavirus (HPV)18-positive cervical carcinoma cells and their derived tumorigenic hybrid cells after subcutaneous injection in immunocompromised mice. The aim of this study was the identification of novel cellular genes that may contribute to the suppression of the tumorigenic phenotype of non-tumorigenic hybrid cells in vivo. We used cDNA microarray technology to identify differentially expressed cellular genes in tumorigenic HPV18-positive hybrid and parental HeLa cells compared to non-tumorigenic HPV18-positive hybrid cells. We detected several as yet unknown cellular genes that play a role in cell differentiation, cell cycle progression, cell-cell communication, metastasis formation, angiogenesis, antigen presentation, and immune response. Apart from the known differentially expressed genes on 11q13 (e.g., phosphofurin acidic cluster sorting protein 1 (PACS1) and FOS ligand 1 (FOSL1 or Fra-1)), we detected novel differentially expressed cellular genes located within the tumor suppressor gene region (e.g., EGF-containing fibulin-like extracellular matrix protein 2 (EFEMP2) and leucine rich repeat containing 32 (LRRC32) (also known as glycoprotein-A repetitions predominant (GARP)) that may have potential tumor suppressor functions in this model system of non-tumorigenic and tumorigenic HeLa x fibroblast hybrid cells. Copyright © 2013 Elsevier Inc. All rights reserved.

Functionalization of poly(methyl methacrylate) (PMMA) as a substrate for DNA microarrays

PubMed Central

Fixe, F.; Dufva, M.; Telleman, P.; Christensen, C. B. V.

2004-01-01

A chemical procedure was developed to functionalize poly(methyl methacrylate) (PMMA) substrates. PMMA is reacted with hexamethylene diamine to yield an aminated surface for immobilizing DNA in microarrays. The density of primary NH2 groups was 0.29 nmol/cm2. The availability of these primary amines was confirmed by the immobilization of DNA probes and hybridization with a complementary DNA strand. The hybridization signal and the hybridization efficiency of the chemically aminated PMMA slides were comparable to the hybridization signal and the hybridization efficiency obtained from differently chemically modified PMMA slides, silanized glass, commercial silylated glass and commercial plastic Euray™ slides. Immobilized and hybridized densities of 10 and 0.75 pmol/cm2, respectively, were observed for microarrays on chemically aminated PMMA. The immobilized probes were heat stable since the hybridization performance of microarrays subjected to 20 PCR heat cycles was only reduced by 4%. In conclusion, this new strategy to modify PMMA provides a robust procedure to immobilize DNA, which is a very useful substrate for fabricating single use diagnostics devices with integrated functions, like sample preparation, treatment and detection using microfabrication and microelectronic techniques. PMID:14718554

Application of Whole Genome Expression Analysis to Assess Bacterial Responses to Environmental Conditions

NASA Astrophysics Data System (ADS)

Vukanti, R. V.; Mintz, E. M.; Leff, L. G.

2005-05-01

Bacterial responses to environmental signals are multifactorial and are coupled to changes in gene expression. An understanding of bacterial responses to environmental conditions is possible using microarray expression analysis. In this study, the utility of microarrays for examining changes in gene expression in Escherichia coli under different environmental conditions was assessed. RNA was isolated, hybridized to Affymetrix E. coli Genome 2.0 chips and analyzed using Affymetrix GCOS and Genespring software. Major limiting factors were obtaining enough quality RNA (107-108 cells to get 10μg RNA)and accounting for differences in growth rates under different conditions. Stabilization of RNA prior to isolation and taking extreme precautions while handling RNA were crucial. In addition, use of this method in ecological studies is limited by availability and cost of commercial arrays; choice of primers for cDNA synthesis, reproducibility, complexity of results generated and need to validate findings. This method may be more widely applicable with the development of better approaches for RNA recovery from environmental samples and increased number of available strain-specific arrays. Diligent experimental design and verification of results with real-time PCR or northern blots is needed. Overall, there is a great potential for use of this technology to discover mechanisms underlying organisms' responses to environmental conditions.

Integration of Multiplexed Microfluidic Electrokinetic Concentrators with a Morpholino Microarray via Reversible Surface Bonding for Enhanced DNA Hybridization.

PubMed

Martins, Diogo; Wei, Xi; Levicky, Rastislav; Song, Yong-Ak

2016-04-05

We describe a microfluidic concentration device to accelerate the surface hybridization reaction between DNA and morpholinos (MOs) for enhanced detection. The microfluidic concentrator comprises a single polydimethylsiloxane (PDMS) microchannel onto which an ion-selective layer of conductive polymer poly(3,4-ethylenedioxythiophene)-poly(styrenesulfonate) ( PSS) was directly printed and then reversibly surface bonded onto a morpholino microarray for hybridization. Using this electrokinetic trapping concentrator, we could achieve a maximum concentration factor of ∼800 for DNA and a limit of detection of 10 nM within 15 min. In terms of the detection speed, it enabled faster hybridization by around 10-fold when compared to conventional diffusion-based hybridization. A significant advantage of our approach is that the fabrication of the microfluidic concentrator is completely decoupled from the microarray; by eliminating the need to deposit an ion-selective layer on the microarray surface prior to device integration, interfacing between both modules, the PDMS chip for electrokinetic concentration and the substrate for DNA sensing are easier and applicable to any microarray platform. Furthermore, this fabrication strategy facilitates a multiplexing of concentrators. We have demonstrated the proof-of-concept for multiplexing by building a device with 5 parallel concentrators connected to a single inlet/outlet and applying it to parallel concentration and hybridization. Such device yielded similar concentration and hybridization efficiency compared to that of a single-channel device without adding any complexity to the fabrication and setup. These results demonstrate that our concentrator concept can be applied to the development of a highly multiplexed concentrator-enhanced microarray detection system for either genetic analysis or other diagnostic assays.

Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

PubMed Central

Travis, G H; Sutcliffe, J G

1988-01-01

To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadano, S.; Ishida, Y.; Tomiyasu, H.

1994-09-01

To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

Exploring the mechanisms of DNA hybridization on a surface

NASA Astrophysics Data System (ADS)

Schmitt, Terry J.; Rogers, J. Brandon; Knotts, Thomas A.

2013-01-01

DNA microarrays are a potentially disruptive technology in the medical field, but their use in such settings is limited by poor reliability. Microarrays work on the principle of hybridization and can only be as reliable as this process is robust, yet little is known at the molecular level about how the surface affects the hybridization process. This work uses advanced molecular simulation techniques and an experimentally parameterized coarse-grain model to determine the mechanism by which hybridization occurs on surfaces. The results show that hybridization proceeds through a mechanism where the untethered (target) strand often flips orientation. For evenly lengthed strands, the surface stabilizes hybridization (compared to the bulk system) by reducing the barriers involved in the flipping event. For unevenly lengthed strands, the surface destabilizes hybridization compared to the bulk, but the degree of destabilization is dependent on the location of the matching sequence. Taken as a whole, the results offer an unprecedented view into the hybridization process on surfaces and provide some insights as to the poor reproducibility exhibited by microarrays.

Factorial microarray analysis of zebra mussel (Dreissena polymorpha: Dreissenidae, Bivalvia) adhesion

PubMed Central

2010-01-01

Background The zebra mussel (Dreissena polymorpha) has been well known for its expertise in attaching to substances under the water. Studies in past decades on this underwater adhesion focused on the adhesive protein isolated from the byssogenesis apparatus of the zebra mussel. However, the mechanism of the initiation, maintenance, and determination of the attachment process remains largely unknown. Results In this study, we used a zebra mussel cDNA microarray previously developed in our lab and a factorial analysis to identify the genes that were involved in response to the changes of four factors: temperature (Factor A), current velocity (Factor B), dissolved oxygen (Factor C), and byssogenesis status (Factor D). Twenty probes in the microarray were found to be modified by one of the factors. The transcription products of four selected genes, DPFP-BG20_A01, EGP-BG97/192_B06, EGP-BG13_G05, and NH-BG17_C09 were unique to the zebra mussel foot based on the results of quantitative reverse transcription PCR (qRT-PCR). The expression profiles of these four genes under the attachment and non-attachment were also confirmed by qRT-PCR and the result is accordant to that from microarray assay. The in situ hybridization with the RNA probes of two identified genes DPFP-BG20_A01 and EGP-BG97/192_B06 indicated that both of them were expressed by a type of exocrine gland cell located in the middle part of the zebra mussel foot. Conclusions The results of this study suggested that the changes of D. polymorpha byssogenesis status and the environmental factors can dramatically affect the expression profiles of the genes unique to the foot. It turns out that the factorial design and analysis of the microarray experiment is a reliable method to identify the influence of multiple factors on the expression profiles of the probesets in the microarray; therein it provides a powerful tool to reveal the mechanism of zebra mussel underwater attachment. PMID:20509938

A hybrid approach to device integration on a genetic analysis platform

NASA Astrophysics Data System (ADS)

Brennan, Des; Jary, Dorothee; Kurg, Ants; Berik, Evgeny; Justice, John; Aherne, Margaret; Macek, Milan; Galvin, Paul

2012-10-01

Point-of-care (POC) systems require significant component integration to implement biochemical protocols associated with molecular diagnostic assays. Hybrid platforms where discrete components are combined in a single platform are a suitable approach to integration, where combining multiple device fabrication steps on a single substrate is not possible due to incompatible or costly fabrication steps. We integrate three devices each with a specific system functionality: (i) a silicon electro-wetting-on-dielectric (EWOD) device to move and mix sample and reagent droplets in an oil phase, (ii) a polymer microfluidic chip containing channels and reservoirs and (iii) an aqueous phase glass microarray for fluorescence microarray hybridization detection. The EWOD device offers the possibility of fully integrating on-chip sample preparation using nanolitre sample and reagent volumes. A key challenge is sample transfer from the oil phase EWOD device to the aqueous phase microarray for hybridization detection. The EWOD device, waveguide performance and functionality are maintained during the integration process. An on-chip biochemical protocol for arrayed primer extension (APEX) was implemented for single nucleotide polymorphism (SNiP) analysis. The prepared sample is aspirated from the EWOD oil phase to the aqueous phase microarray for hybridization. A bench-top instrumentation system was also developed around the integrated platform to drive the EWOD electrodes, implement APEX sample heating and image the microarray after hybridization.

Gene expression signature of benign prostatic hyperplasia revealed by cDNA microarray analysis.

PubMed

Luo, Jun; Dunn, Thomas; Ewing, Charles; Sauvageot, Jurga; Chen, Yidong; Trent, Jeffrey; Isaacs, William

2002-05-15

Despite the high prevalence of benign prostatic hyperplasia (BPH) in the aging male, little is known regarding the etiology of this disease. A better understanding of the molecular etiology of BPH would be facilitated by a comprehensive analysis of gene expression patterns that are characteristic of benign growth in the prostate gland. Since genes differentially expressed between BPH and normal prostate tissues are likely to reflect underlying pathogenic mechanisms involved in the development of BPH, we performed comparative gene expression analysis using cDNA microarray technology to identify candidate genes associated with BPH. Total RNA was extracted from a set of 9 BPH specimens from men with extensive hyperplasia and a set of 12 histologically normal prostate tissues excised from radical prostatectomy specimens. Each of these 21 RNA samples was labeled with Cy3 in a reverse transcription reaction and cohybridized with a Cy5 labeled common reference sample to a cDNA microarray containing 6,500 human genes. Normalized fluorescent intensity ratios from each hybridization experiment were extracted to represent the relative mRNA abundance for each gene in each sample. Weighted gene and random permutation analyses were performed to generate a subset of genes with statistically significant differences in expression between BPH and normal prostate tissues. Semi-quantitative PCR analysis was performed to validate differential expression. A subset of 76 genes involved in a wide range of cellular functions was identified to be differentially expressed between BPH and normal prostate tissues. Semi-quantitative PCR was performed on 10 genes and 8 were validated. Genes consistently upregulated in BPH when compared to normal prostate tissues included: a restricted set of growth factors and their binding proteins (e.g. IGF-1 and -2, TGF-beta3, BMP5, latent TGF-beta binding protein 1 and -2); hydrolases, proteases, and protease inhibitors (e.g. neuropathy target esterase, MMP2, alpha-2-macroglobulin); stress response enzymes (e.g. COX2, GSTM5); and extracellular matrix molecules (e.g. laminin alpha 4 and beta 1, chondroitin sulfate proteoglycan 2, lumican). Genes consistently expressing less mRNA in BPH than in normal prostate tissues were less commonly observed and included the transcription factor KLF4, thrombospondin 4, nitric oxide synthase 2A, transglutaminase 3, and gastrin releasing peptide. We identified a diverse set of genes that are potentially related to benign prostatic hyperplasia, including genes both previously implicated in BPH pathogenesis as well as others not previously linked to this disease. Further targeted validation and investigations of these genes at the DNA, mRNA, and protein levels are warranted to determine the clinical relevance and possible therapeutic utility of these genes. Copyright 2002 Wiley-Liss, Inc.

Characterization of human septic sera induced gene expression modulation in human myocytes

PubMed Central

Hussein, Shaimaa; Michael, Paul; Brabant, Danielle; Omri, Abdelwahab; Narain, Ravin; Passi, Kalpdrum; Ramana, Chilakamarti V.; Parrillo, Joseph E.; Kumar, Anand; Parissenti, Amadeo; Kumar, Aseem

2009-01-01

To gain a better understanding of the gene expression changes that occurs during sepsis, we have performed a cDNA microarray study utilizing a tissue culture model that mimics human sepsis. This study utilized an in vitro model of cultured human fetal cardiac myocytes treated with 10% sera from septic patients or 10% sera from healthy volunteers. A 1700 cDNA expression microarray was used to compare the transcription profile from human cardiac myocytes treated with septic sera vs normal sera. Septic sera treatment of myocytes resulted in the down-regulation of 178 genes and the up-regulation of 4 genes. Our data indicate that septic sera induced cell cycle, metabolic, transcription factor and apoptotic gene expression changes in human myocytes. Identification and characterization of gene expression changes that occur during sepsis may lead to the development of novel therapeutics and diagnostics. PMID:19684886

Genome-Wide Screening of Genes Showing Altered Expression in Liver Metastases of Human Colorectal Cancers by cDNA Microarray1

PubMed Central

Yanagawa, Rempei; Furukawa, Yoichi; Tsunoda, Tatsuhiko; Kitahara, Osamu; Kameyama, Masao; Murata, Kohei; Ishikawa, Osamu; Nakamura, Yusuke

2001-01-01

Abstract In spite of intensive and increasingly successful attempts to determine the multiple steps involved in colorectal carcinogenesis, the mechanisms responsible for metastasis of colorectal tumors to the liver remain to be clarified. To identify genes that are candidates for involvement in the metastatic process, we analyzed genome-wide expression profiles of 10 primary colorectal cancers and their corresponding metastatic lesions by means of a cDNA microarray consisting of 9121 human genes. This analysis identified 40 genes whose expression was commonly upregulated in metastatic lesions, and 7 that were commonly downregulated. The upregulated genes encoded proteins involved in cell adhesion, or remodeling of the actin cytoskeleton. Investigation of the functions of more of the altered genes should improve our understanding of metastasis and may identify diagnostic markers and/or novel molecular targets for prevention or therapy of metastatic lesions. PMID:11687950

Dendrimeric coating of glass slides for sensitive DNA microarrays analysis

PubMed Central

Le Berre, Véronique; Trévisiol, Emmanuelle; Dagkessamanskaia, Adilia; Sokol, Serguei; Caminade, Anne-Marie; Majoral, Jean Pierre; Meunier, Bernard; François, Jean

2003-01-01

Successful use and reliability of microarray technology is highly dependent on several factors, including surface chemistry parameters and accessibility of cDNA targets to the DNA probes fixed onto the surface. Here, we show that functionalisation of glass slides with homemade dendrimers allow production of more sensitive and reliable DNA microarrays. The dendrimers are nanometric structures of size-controlled diameter with aldehyde function at their periphery. Covalent attachment of these spherical reactive chemical structures on amino-silanised glass slides generates a reactive ∼100 Å layer onto which amino-modified DNA probes are covalently bound. This new grafting chemistry leads to the formation of uniform and homogenous spots. More over, probe concentration before spotting could be reduced from 0.2 to 0.02 mg/ml with PCR products and from 20 to 5 µM with 70mer oligonucleotides without affecting signal intensities after hybridisation with Cy3- and Cy5-labelled targets. More interestingly, while the binding capacity of captured probes on dendrimer-activated glass surface (named dendrislides) is roughly similar to other functionalised glass slides from commercial sources, detection sensitivity was 2-fold higher than with other available DNA microarrays. This detection limit was estimated to 0.1 pM of cDNA targets. Altogether, these features make dendrimer-activated slides ideal for manufacturing cost-effective DNA arrays applicable for gene expression and detection of mutations. PMID:12907740

Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

PubMed

Ozsolak, Fatih

2016-01-01

With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

Genomic resources for Myzus persicae: EST sequencing, SNP identification, and microarray design

PubMed Central

Ramsey, John S; Wilson, Alex CC; de Vos, Martin; Sun, Qi; Tamborindeguy, Cecilia; Winfield, Agnese; Malloch, Gaynor; Smith, Dawn M; Fenton, Brian; Gray, Stewart M; Jander, Georg

2007-01-01

Background The green peach aphid, Myzus persicae (Sulzer), is a world-wide insect pest capable of infesting more than 40 plant families, including many crop species. However, despite the significant damage inflicted by M. persicae in agricultural systems through direct feeding damage and by its ability to transmit plant viruses, limited genomic information is available for this species. Results Sequencing of 16 M. persicae cDNA libraries generated 26,669 expressed sequence tags (ESTs). Aphids for library construction were raised on Arabidopsis thaliana, Nicotiana benthamiana, Brassica oleracea, B. napus, and Physalis floridana (with and without Potato leafroll virus infection). The M. persicae cDNA libraries include ones made from sexual and asexual whole aphids, guts, heads, and salivary glands. In silico comparison of cDNA libraries identified aphid genes with tissue-specific expression patterns, and gene expression that is induced by feeding on Nicotiana benthamiana. Furthermore, 2423 genes that are novel to science and potentially aphid-specific were identified. Comparison of cDNA data from three aphid lineages identified single nucleotide polymorphisms that can be used as genetic markers and, in some cases, may represent functional differences in the protein products. In particular, non-conservative amino acid substitutions in a highly expressed gut protease may be of adaptive significance for M. persicae feeding on different host plants. The Agilent eArray platform was used to design an M. persicae oligonucleotide microarray representing over 10,000 unique genes. Conclusion New genomic resources have been developed for M. persicae, an agriculturally important insect pest. These include previously unknown sequence data, a collection of expressed genes, molecular markers, and a DNA microarray that can be used to study aphid gene expression. These resources will help elucidate the adaptations that allow M. persicae to develop compatible interactions with its host plants, complementing ongoing work illuminating plant molecular responses to phloem-feeding insects. PMID:18021414

Differentiation of respiratory syncytial virus subgroups with cDNA probes in a nucleic acid hybridization assay.

PubMed Central

Sullender, W M; Anderson, L J; Anderson, K; Wertz, G W

1990-01-01

A new approach to respiratory syncytial (RS) virus subgroup determination was developed by using a simple nucleic acid filter hybridization technique. By this method, virus-infected cells are bound and fixed in a single step, and the viral RNA in the fixed-cell preparation is characterized directly by its ability to hybridize to cDNA probes specific for either the A or B subgroups of RS virus. The subgroup-specific probes were constructed from cDNA clones that corresponded to a portion of the extracellular domain of the RS virus G protein of either a subgroup B RS virus (8/60) or a subgroup A RS virus (A2). The cDNA probes were labeled with 32P and used to analyze RS virus isolates collected over a period of three decades. Replicate templates of infected cell preparations were hybridized with either the subgroup A or B probe. The subgroup assignments of 40 viruses tested by nucleic acid hybridization were in agreement with the results of subgroup determinations based on their reactivities with monoclonal antibodies, which previously has been the only method available for determining the subgroup classification of RS virus isolates. The nucleic acid hybridization assay has the advantage of providing broad-based discrimination of the two subgroups on the basis of nucleic acid homology, irrespective of minor antigenic differences that are detected in assays in which monoclonal antibodies are used. The nucleic acid hybridization technique provides a reliable method for RS virus subgroup characterization. Images PMID:2118548

Differential cDNA cloning by enzymatic degrading subtraction (EDS).

PubMed Central

Zeng, J; Gorski, R A; Hamer, D

1994-01-01

We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268

A low-density cDNA microarray with a unique reference RNA: pattern recognition analysis for IFN efficacy prediction to HCV as a model.

PubMed

Daiba, Akito; Inaba, Niro; Ando, Satoshi; Kajiyama, Naoki; Yatsuhashi, Hiroshi; Terasaki, Hiroshi; Ito, Atsushi; Ogasawara, Masanori; Abe, Aki; Yoshioka, Junichi; Hayashida, Kazuhiro; Kaneko, Shuichi; Kohara, Michinori; Ito, Satoru

2004-03-19

We have designed and established a low-density (295 genes) cDNA microarray for the prediction of IFN efficacy in hepatitis C patients. To obtain a precise and consistent microarray data, we collected a data set from three spots for each gene (mRNA) and using three different scanning conditions. We also established an artificial reference RNA representing pseudo-inflammatory conditions from established hepatocyte cell lines supplemented with synthetic RNAs to 48 inflammatory genes. We also developed a novel algorithm that replaces the standard hierarchical-clustering method and allows handling of the large data set with ease. This algorithm utilizes a standard space database (SSDB) as a key scale to calculate the Mahalanobis distance (MD) from the center of gravity in the SSDB. We further utilized sMD (divided by parameter k: MD/k) to reduce MD number as a predictive value. The efficacy prediction of conventional IFN mono-therapy was 100% for non-responder (NR) vs. transient responder (TR)/sustained responder (SR) (P < 0.0005). Finally, we show that this method is acceptable for clinical application.

Differential gene expression related to Nora virus infection of Drosophila melanogaster.

PubMed

Cordes, Ethan J; Licking-Murray, Kellie D; Carlson, Kimberly A

2013-08-01

Nora virus is a recently discovered RNA picorna-like virus that produces a persistent infection in Drosophila melanogaster, but the antiviral pathway or change in gene expression is unknown. We performed cDNA microarray analysis comparing the gene expression profiles of Nora virus infected and uninfected wild-type D. melanogaster. This analysis yielded 58 genes exhibiting a 1.5-fold change or greater and p-value less than 0.01. Of these genes, 46 were up-regulated and 12 down-regulated in response to infection. To validate the microarray results, qRT-PCR was performed with probes for Chorion protein 16 and Troponin C isoform 4, which show good correspondence with cDNA microarray results. Differential regulation of genes associated with Toll and immune-deficient pathways, cytoskeletal development, Janus Kinase-Signal Transducer and Activator of Transcription interactions, and a potential gut-specific innate immune response were found. This genome-wide expression profile of Nora virus infection of D. melanogaster can pinpoint genes of interest for further investigation of antiviral pathways employed, genetic mechanisms, sites of replication, viral persistence, and developmental effects. Copyright © 2013. Published by Elsevier B.V.

cDNA microarray analysis of human keratinocytes cells of patients submitted to chemoradiotherapy and oral photobiomodulation therapy: pilot study.

PubMed

Antunes, Heliton S; Wajnberg, Gabriel; Pinho, Marcos B; Jorge, Natasha Andressa Nogueira; de Moraes, Joyce Luana Melo; Stefanoff, Claudio Gustavo; Herchenhorn, Daniel; Araújo, Carlos M M; Viégas, Celia Maria Pais; Rampini, Mariana P; Dias, Fernando L; de Araujo-Souza, Patricia Savio; Passetti, Fabio; Ferreira, Carlos G

2018-01-01

Oral mucositis is an acute toxicity that occurs in patients submitted to chemoradiotherapy to treat head and neck squamous cell carcinoma. In this study, we evaluated differences in gene expression in the keratinocytes of the oral mucosa of patients treated with photobiomodulation therapy and tried to associate the molecular mechanisms with clinical findings. From June 2009 to December 2010, 27 patients were included in a randomized double-blind pilot study. Buccal smears from 13 patients were obtained at days 1 and 10 of chemoradiotherapy, and overall gene expression of samples from both dates were analyzed by complementary DNA (cDNA) microarray. In addition, samples from other 14 patients were also collected at D1 and D10 of chemoradiotherapy for subsequent validation of cDNA microarray findings by qPCR. The expression array analysis identified 105 upregulated and 60 downregulated genes in our post-treatment samples when compared with controls. Among the upregulated genes with the highest fold change, it was interesting to observe the presence of genes related to keratinocyte differentiation. Among downregulated genes were observed genes related to cytotoxicity and immune response. The results indicate that genes known to be induced during differentiation of human epidermal keratinocytes were upregulated while genes associated with cytotoxicity and immune response were downregulated in the laser group. These results support previous clinical findings indicating that the lower incidence of oral mucositis associated with photobiomodulation therapy might be correlated to the activation of genes involved in keratinocyte differentiation.

Molecular characterization of Coriolus versicolor PSP-induced apoptosis in human promyelotic leukemic HL-60 cells using cDNA microarray.

PubMed

Zeng, Fanya; Hon, Chung-Chau; Sit, Wai-Hung; Chow, Ken Yan-Ching; Hui, Raymond Kin-Hi; Law, Ivy Ka-Man; Ng, Victor Wai-Lap; Yang, Xiao-Tong; Leung, Frederick Chi-Ching; Wan, Jennifer Man-Fan

2005-08-01

Proteins and peptide bound polysaccharides (PSP) extracted from Basidiomycetous fungi are widely used in cancer immunotherapy and recently demonstrated to induce apoptosis in cancer cells in vitro. In order to provide the molecular pharmacological mechanisms of PSP on human cancer cells, we investigated the gene expression profiles of PSP-treated apoptotic human promyelotic leukemic HL-60 cells using ResGen 40k IMAGE printed cDNA microarray. In total 378 and 111 transcripts were identified as differentially expressed in the apoptotic cells by at least a factor of 2 or 3, respectively. Our data show that PSP-induced apoptosis in HL-60 cells might be mediated by up-regulation of early transcription factors such as AP-1, EGR1, IER2 and IER5, and down-regulation of NF-kappaB transcription pathways. Other gene expression changes, including the increase of several apoptotic or anti-proliferation genes, such as GADD45A/B and TUSC2, and the decrease of a batch of phosphatase and kinase genes, may also provide further evidences in supporting the process of PSP induced apoptosis in cancer cells. Some of the well-characterized carcinogenesis-related gene transcripts such as SAT, DCT, Melan-A, uPA and cyclin E1 were also alternated by PSP in the HL-60 cells. These transcripts can be employed as markers for quality control of PSP products on functional levels. The present study provides new insight into the molecular mechanisms involved in PSP-induced apoptosis in leukemic HL-60 cells analyzed by cDNA microarray.

Evaluation of normalization methods for cDNA microarray data by k-NN classification

PubMed Central

Wu, Wei; Xing, Eric P; Myers, Connie; Mian, I Saira; Bissell, Mina J

2005-01-01

Background Non-biological factors give rise to unwanted variations in cDNA microarray data. There are many normalization methods designed to remove such variations. However, to date there have been few published systematic evaluations of these techniques for removing variations arising from dye biases in the context of downstream, higher-order analytical tasks such as classification. Results Ten location normalization methods that adjust spatial- and/or intensity-dependent dye biases, and three scale methods that adjust scale differences were applied, individually and in combination, to five distinct, published, cancer biology-related cDNA microarray data sets. Leave-one-out cross-validation (LOOCV) classification error was employed as the quantitative end-point for assessing the effectiveness of a normalization method. In particular, a known classifier, k-nearest neighbor (k-NN), was estimated from data normalized using a given technique, and the LOOCV error rate of the ensuing model was computed. We found that k-NN classifiers are sensitive to dye biases in the data. Using NONRM and GMEDIAN as baseline methods, our results show that single-bias-removal techniques which remove either spatial-dependent dye bias (referred later as spatial effect) or intensity-dependent dye bias (referred later as intensity effect) moderately reduce LOOCV classification errors; whereas double-bias-removal techniques which remove both spatial- and intensity effect reduce LOOCV classification errors even further. Of the 41 different strategies examined, three two-step processes, IGLOESS-SLFILTERW7, ISTSPLINE-SLLOESS and IGLOESS-SLLOESS, all of which removed intensity effect globally and spatial effect locally, appear to reduce LOOCV classification errors most consistently and effectively across all data sets. We also found that the investigated scale normalization methods do not reduce LOOCV classification error. Conclusion Using LOOCV error of k-NNs as the evaluation criterion, three double-bias-removal normalization strategies, IGLOESS-SLFILTERW7, ISTSPLINE-SLLOESS and IGLOESS-SLLOESS, outperform other strategies for removing spatial effect, intensity effect and scale differences from cDNA microarray data. The apparent sensitivity of k-NN LOOCV classification error to dye biases suggests that this criterion provides an informative measure for evaluating normalization methods. All the computational tools used in this study were implemented using the R language for statistical computing and graphics. PMID:16045803

Evaluation of normalization methods for cDNA microarray data by k-NN classification.

PubMed

Wu, Wei; Xing, Eric P; Myers, Connie; Mian, I Saira; Bissell, Mina J

2005-07-26

Non-biological factors give rise to unwanted variations in cDNA microarray data. There are many normalization methods designed to remove such variations. However, to date there have been few published systematic evaluations of these techniques for removing variations arising from dye biases in the context of downstream, higher-order analytical tasks such as classification. Ten location normalization methods that adjust spatial- and/or intensity-dependent dye biases, and three scale methods that adjust scale differences were applied, individually and in combination, to five distinct, published, cancer biology-related cDNA microarray data sets. Leave-one-out cross-validation (LOOCV) classification error was employed as the quantitative end-point for assessing the effectiveness of a normalization method. In particular, a known classifier, k-nearest neighbor (k-NN), was estimated from data normalized using a given technique, and the LOOCV error rate of the ensuing model was computed. We found that k-NN classifiers are sensitive to dye biases in the data. Using NONRM and GMEDIAN as baseline methods, our results show that single-bias-removal techniques which remove either spatial-dependent dye bias (referred later as spatial effect) or intensity-dependent dye bias (referred later as intensity effect) moderately reduce LOOCV classification errors; whereas double-bias-removal techniques which remove both spatial- and intensity effect reduce LOOCV classification errors even further. Of the 41 different strategies examined, three two-step processes, IGLOESS-SLFILTERW7, ISTSPLINE-SLLOESS and IGLOESS-SLLOESS, all of which removed intensity effect globally and spatial effect locally, appear to reduce LOOCV classification errors most consistently and effectively across all data sets. We also found that the investigated scale normalization methods do not reduce LOOCV classification error. Using LOOCV error of k-NNs as the evaluation criterion, three double-bias-removal normalization strategies, IGLOESS-SLFILTERW7, ISTSPLINE-SLLOESS and IGLOESS-SLLOESS, outperform other strategies for removing spatial effect, intensity effect and scale differences from cDNA microarray data. The apparent sensitivity of k-NN LOOCV classification error to dye biases suggests that this criterion provides an informative measure for evaluating normalization methods. All the computational tools used in this study were implemented using the R language for statistical computing and graphics.

Development and application of a microarray meter tool to optimize microarray experiments

PubMed Central

Rouse, Richard JD; Field, Katrine; Lapira, Jennifer; Lee, Allen; Wick, Ivan; Eckhardt, Colleen; Bhasker, C Ramana; Soverchia, Laura; Hardiman, Gary

2008-01-01

Background Successful microarray experimentation requires a complex interplay between the slide chemistry, the printing pins, the nucleic acid probes and targets, and the hybridization milieu. Optimization of these parameters and a careful evaluation of emerging slide chemistries are a prerequisite to any large scale array fabrication effort. We have developed a 'microarray meter' tool which assesses the inherent variations associated with microarray measurement prior to embarking on large scale projects. Findings The microarray meter consists of nucleic acid targets (reference and dynamic range control) and probe components. Different plate designs containing identical probe material were formulated to accommodate different robotic and pin designs. We examined the variability in probe quality and quantity (as judged by the amount of DNA printed and remaining post-hybridization) using three robots equipped with capillary printing pins. Discussion The generation of microarray data with minimal variation requires consistent quality control of the (DNA microarray) manufacturing and experimental processes. Spot reproducibility is a measure primarily of the variations associated with printing. The microarray meter assesses array quality by measuring the DNA content for every feature. It provides a post-hybridization analysis of array quality by scoring probe performance using three metrics, a) a measure of variability in the signal intensities, b) a measure of the signal dynamic range and c) a measure of variability of the spot morphologies. PMID:18710498

Comparison of next generation sequencing technologies for transcriptome characterization

PubMed Central

2009-01-01

Background We have developed a simulation approach to help determine the optimal mixture of sequencing methods for most complete and cost effective transcriptome sequencing. We compared simulation results for traditional capillary sequencing with "Next Generation" (NG) ultra high-throughput technologies. The simulation model was parameterized using mappings of 130,000 cDNA sequence reads to the Arabidopsis genome (NCBI Accession SRA008180.19). We also generated 454-GS20 sequences and de novo assemblies for the basal eudicot California poppy (Eschscholzia californica) and the magnoliid avocado (Persea americana) using a variety of methods for cDNA synthesis. Results The Arabidopsis reads tagged more than 15,000 genes, including new splice variants and extended UTR regions. Of the total 134,791 reads (13.8 MB), 119,518 (88.7%) mapped exactly to known exons, while 1,117 (0.8%) mapped to introns, 11,524 (8.6%) spanned annotated intron/exon boundaries, and 3,066 (2.3%) extended beyond the end of annotated UTRs. Sequence-based inference of relative gene expression levels correlated significantly with microarray data. As expected, NG sequencing of normalized libraries tagged more genes than non-normalized libraries, although non-normalized libraries yielded more full-length cDNA sequences. The Arabidopsis data were used to simulate additional rounds of NG and traditional EST sequencing, and various combinations of each. Our simulations suggest a combination of FLX and Solexa sequencing for optimal transcriptome coverage at modest cost. We have also developed ESTcalc http://fgp.huck.psu.edu/NG_Sims/ngsim.pl, an online webtool, which allows users to explore the results of this study by specifying individualized costs and sequencing characteristics. Conclusion NG sequencing technologies are a highly flexible set of platforms that can be scaled to suit different project goals. In terms of sequence coverage alone, the NG sequencing is a dramatic advance over capillary-based sequencing, but NG sequencing also presents significant challenges in assembly and sequence accuracy due to short read lengths, method-specific sequencing errors, and the absence of physical clones. These problems may be overcome by hybrid sequencing strategies using a mixture of sequencing methodologies, by new assemblers, and by sequencing more deeply. Sequencing and microarray outcomes from multiple experiments suggest that our simulator will be useful for guiding NG transcriptome sequencing projects in a wide range of organisms. PMID:19646272

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

Enhancing Results of Microarray Hybridizations Through Microagitation

PubMed Central

Toegl, Andreas; Kirchner, Roland; Gauer, Christoph; Wixforth, Achim

2003-01-01

Protein and DNA microarrays have become a standard tool in proteomics/genomics research. In order to guarantee fast and reproducible hybridization results, the diffusion limit must be overcome. Surface acoustic wave (SAW) micro-agitation chips efficiently agitate the smallest sample volumes (down to 10 μL and below) without introducing any dead volume. The advantages are reduced reaction time, increased signal-to-noise ratio, improved homogeneity across the microarray, and better slide-to-slide reproducibility. The SAW micromixer chips are the heart of the Advalytix ArrayBooster, which is compatible with all microarrays based on the microscope slide format. PMID:13678150

Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

PubMed

Lu, L; Komada, M; Kitamura, N

1998-06-15

Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

Characterization of Citrus sinensis transcription factors closely associated with the non-host response to Xanthomonas campestris pv. vesicatoria.

PubMed

Daurelio, Lucas D; Romero, María S; Petrocelli, Silvana; Merelo, Paz; Cortadi, Adriana A; Talón, Manuel; Tadeo, Francisco R; Orellano, Elena G

2013-07-01

Plants, when exposed to certain pathogens, may display a form of genotype-independent resistance, known as non-host response. In this study, the response of Citrus sinensis (sweet orange) leaves to Xanthomonas campestris pv. vesicatoria (Xcv), a pepper and tomato pathogenic bacterium, was analyzed through biochemical assays and cDNA microarray hybridization and compared with Asiatic citrus canker infection caused by Xanthomonas citri subsp. citri. Citrus leaves exposed to the non-host bacterium Xcv showed hypersensitive response (HR) symptoms (cell death), a defense mechanism common in plants but poorly understood in citrus. The HR response was accompanied by differentially expressed genes that are associated with biotic stress and cell death. Moreover, 58 transcription factors (TFs) were differentially regulated by Xcv in citrus leaves, including 26 TFs from the stress-associated families AP2-EREBP, bZip, Myb and WRKY. Remarkably, in silico analysis of the distribution of expressed sequence tags revealed that 10 of the 58 TFs, belonging to C2C2-GATA, C2H2, CCAAT, HSF, NAC and WRKY gene families, were specifically over-represented in citrus stress cDNA libraries. This study identified candidate TF genes for the regulation of key steps during the citrus non-host HR. Furthermore, these TFs might be useful in future strategies of molecular breeding for citrus disease resistance. Copyright © 2013 Elsevier GmbH. All rights reserved.

SSHscreen and SSHdb, generic software for microarray based gene discovery: application to the stress response in cowpea

PubMed Central

2010-01-01

Background Suppression subtractive hybridization is a popular technique for gene discovery from non-model organisms without an annotated genome sequence, such as cowpea (Vigna unguiculata (L.) Walp). We aimed to use this method to enrich for genes expressed during drought stress in a drought tolerant cowpea line. However, current methods were inefficient in screening libraries and management of the sequence data, and thus there was a need to develop software tools to facilitate the process. Results Forward and reverse cDNA libraries enriched for cowpea drought response genes were screened on microarrays, and the R software package SSHscreen 2.0.1 was developed (i) to normalize the data effectively using spike-in control spot normalization, and (ii) to select clones for sequencing based on the calculation of enrichment ratios with associated statistics. Enrichment ratio 3 values for each clone showed that 62% of the forward library and 34% of the reverse library clones were significantly differentially expressed by drought stress (adjusted p value < 0.05). Enrichment ratio 2 calculations showed that > 88% of the clones in both libraries were derived from rare transcripts in the original tester samples, thus supporting the notion that suppression subtractive hybridization enriches for rare transcripts. A set of 118 clones were chosen for sequencing, and drought-induced cowpea genes were identified, the most interesting encoding a late embryogenesis abundant Lea5 protein, a glutathione S-transferase, a thaumatin, a universal stress protein, and a wound induced protein. A lipid transfer protein and several components of photosynthesis were down-regulated by the drought stress. Reverse transcriptase quantitative PCR confirmed the enrichment ratio values for the selected cowpea genes. SSHdb, a web-accessible database, was developed to manage the clone sequences and combine the SSHscreen data with sequence annotations derived from BLAST and Blast2GO. The self-BLAST function within SSHdb grouped redundant clones together and illustrated that the SSHscreen plots are a useful tool for choosing anonymous clones for sequencing, since redundant clones cluster together on the enrichment ratio plots. Conclusions We developed the SSHscreen-SSHdb software pipeline, which greatly facilitates gene discovery using suppression subtractive hybridization by improving the selection of clones for sequencing after screening the library on a small number of microarrays. Annotation of the sequence information and collaboration was further enhanced through a web-based SSHdb database, and we illustrated this through identification of drought responsive genes from cowpea, which can now be investigated in gene function studies. SSH is a popular and powerful gene discovery tool, and therefore this pipeline will have application for gene discovery in any biological system, particularly non-model organisms. SSHscreen 2.0.1 and a link to SSHdb are available from http://microarray.up.ac.za/SSHscreen. PMID:20359330

Heterologous Array Analysis in Pinaceae: Hybridization of Pinus Taeda cDNA Arrays With cDNA From Needles and Embryogenic Cultures of P. Taeda, P. Sylvestris or Picea Abies

PubMed Central

van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov

2002-01-01

Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264

Gene expression patterns during the larval development of European sea bass (dicentrarchus labrax) by microarray analysis.

PubMed

Darias, M J; Zambonino-Infante, J L; Hugot, K; Cahu, C L; Mazurais, D

2008-01-01

During the larval period, marine teleosts undergo very fast growth and dramatic changes in morphology, metabolism, and behavior to accomplish their metamorphosis into juvenile fish. Regulation of gene expression is widely thought to be a key mechanism underlying the management of the biological processes required for harmonious development over this phase of life. To provide an overall analysis of gene expression in the whole body during sea bass larval development, we monitored the expression of 6,626 distinct genes at 10 different points in time between 7 and 43 days post-hatching (dph) by using heterologous hybridization of a rainbow trout cDNA microarray. The differentially expressed genes (n = 485) could be grouped into two categories: genes that were generally up-expressed early, between 7 and 23 dph, and genes up-expressed between 25 and 43 dph. Interestingly, among the genes regulated during the larval period, those related to organogenesis, energy pathways, biosynthesis, and digestion were over-represented compared with total set of analyzed genes. We discuss the quantitative regulation of whole-body contents of these specific transcripts with regard to the ontogenesis and maturation of essential functions that take place over larval development. Our study is the first utilization of a transcriptomic approach in sea bass and reveals dynamic changes in gene expression patterns in relation to marine finfish larval development.

The Use of Atomic Force Microscopy for 3D Analysis of Nucleic Acid Hybridization on Microarrays.

PubMed

Dubrovin, E V; Presnova, G V; Rubtsova, M Yu; Egorov, A M; Grigorenko, V G; Yaminsky, I V

2015-01-01

Oligonucleotide microarrays are considered today to be one of the most efficient methods of gene diagnostics. The capability of atomic force microscopy (AFM) to characterize the three-dimensional morphology of single molecules on a surface allows one to use it as an effective tool for the 3D analysis of a microarray for the detection of nucleic acids. The high resolution of AFM offers ways to decrease the detection threshold of target DNA and increase the signal-to-noise ratio. In this work, we suggest an approach to the evaluation of the results of hybridization of gold nanoparticle-labeled nucleic acids on silicon microarrays based on an AFM analysis of the surface both in air and in liquid which takes into account of their three-dimensional structure. We suggest a quantitative measure of the hybridization results which is based on the fraction of the surface area occupied by the nanoparticles.

cDNA cloning of the human monocarboxylate transporter 1 and chromosomal localization of the SLC16A1 locus to 1p13.2-p12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia, C.K.; Li, X.; Luna, J.

1994-09-15

Lactate and pyruvate are transported across cell membranes by monocarboxylate transporters (MCTs). Here, the authors use the recently cloned cDNA for hamster MCT1 to isolate cDNA and genomic clones for human MCT1. Comparison of the human and hamster amino acid sequences revealed that the proteins are 86% identical. The gene for human MCT1 (gene symbol, SLC16A1) was localized to human chromosome bands 1p13.2-p12 by PCR analysis of panels of human X rodent cell hybrid lines and by fluorescence chromosomal in situ hybridization. 9 refs., 2 figs.

Structure and chromosomal localization of the human PD-1 gene (PDCD1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shinohara, T.; Ishida, Y.; Kawaichi, M.

1994-10-01

A cDNA encoding mouse PD-1, a member of the immunoglobulin superfamily, was previously isolated from apoptosis-induced cells by subtractive hybridization. To determine the structure and chromosomal location of the human PD-1 gene, we screened a human T cell cDNA library by mouse PD-1 probe and isolated a cDNA coding for the human PD-1 protein. The deduced amino acid sequence of human PD-1 was 60% identical to the mouse counterpart, and a putative tyrosine kinase-association motif was well conserved. The human PD-1 gene was mapped to 2q37.3 by chromosomal in situ hybridization. 7 refs., 3 figs.

Coral Reef Genomics: Developing tools for functional genomics ofcoral symbiosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwarz, Jodi; Brokstein, Peter; Manohar, Chitra

Symbioses between cnidarians and dinoflagellates in the genus Symbiodinium are widespread in the marine environment. The importance of this symbiosis to reef-building corals and reef nutrient and carbon cycles is well documented, but little is known about the mechanisms by which the partners establish and regulate the symbiosis. Because the dinoflagellate symbionts live inside the cells of their host coral, the interactions between the partners occur on cellular and molecular levels, as each partner alters the expression of genes and proteins to facilitate the partnership. These interactions can examined using high-throughput techniques that allow thousands of genes to be examinedmore » simultaneously. We are developing the groundwork so that we can use DNA microarray profiling to identify genes involved in the Montastraea faveolata and Acropora palmata symbioses. Here we report results from the initial steps in this microarray initiative, that is, the construction of cDNA libraries from 4 of 16 target stages, sequencing of 3450 cDNA clones to generate Expressed Sequenced Tags (ESTs), and annotation of the ESTs to identify candidate genes to include in the microarrays. An understanding of how the coral-dinoflagellate symbiosis is regulated will have implications for atmospheric and ocean sciences, conservation biology, the study and diagnosis of coral bleaching and disease, and comparative studies of animal-protest interactions.« less

[DNA microarray reveals changes in gene expression of endothelial cells under shear stress].

PubMed

Cheng, Min; Zhang, Wensheng; Chen, Huaiqing; Wu, Wenchao; Huang, Hua

2004-04-01

cDNA microarray technology is used as a powerful tool for rapid, comprehensive, and quantitative analysis of gene profiles of cultured human umbilical vein endothelial cells(HUVECs) in the normal static group and the shear stressed (4.20 dyne/cm2, 2 h) group. The total RNA from normal static cultured HUVECs was labeled by Cy3-dCTP, and total RNA of HUVECs from the paired shear stressed experiment was labeled by Cy5-dCTP. The expression ratios reported are the average from the two separate experiments. After bioinformatics analysis, we identified a total of 108 genes (approximately 0.026%) revealing differential expression. Of these 53 genes expressions were up-regulated, the most enhanced ones being human homolog of yeast IPP isomerase, human low density lipoprotein receptor gene, Squalene epoxidase gene, 7-dehydrocholesterol reductase, and 55 were down-regulated, the most decreased ones being heat shock 70 kD protein 1, TCB gene encoding cytosolic thyroid hormone-binding protein in HUVECs exposed to low shear stress. These results indicate that the cDNA microarray technique is effective in screening the differentially expressed genes in endothelial cells induced by various experimental conditions and the data may serve as stimuli to further researches.

Constitutional downregulation of SEMA5A expression in autism.

PubMed

Melin, M; Carlsson, B; Anckarsater, H; Rastam, M; Betancur, C; Isaksson, A; Gillberg, C; Dahl, N

2006-01-01

There is strong evidence for the importance of genetic factors in idiopathic autism. The results from independent twin and family studies suggest that the disorder is caused by the action of several genes, possibly acting epistatically. We have used cDNA microarray technology for the identification of constitutional changes in the gene expression profile associated with idiopathic autism. Samples were obtained and analyzed from 6 affected subjects belonging to multiplex autism families and from 6 healthy controls. We assessed the expression levels for approximately 7,700 genes by cDNA microarrays using mRNA derived from Epstein-Barr virus-transformed B lymphocytes. The microarray data were analyzed in order to identify up- or downregulation of specific genes. A common pattern with nine downregulated genes was identified among samples derived from individuals with autism when compared to controls. Four of these nine genes encode proteins involved in biological processes associated with brain function or the immune system, and are consequently considered as candidates for genes associated with autism. Quantitative real-time PCR confirms the downregulation of the gene encoding SEMA5A, a protein involved in axonal guidance. Epstein-Barr virus should be considered as a possible source for altered expression, but our consistent results make us suggest SEMA5A as a candidate gene in the etiology of idiopathic autism.

Constitutional downregulation of SEMA5A expression in autism

PubMed Central

Melin, Malin; Carlsson, Birgit; Anckarsäter, Henrik; Rastam, Maria; Betancur, Catalina; Isaksson, Anders; Gillberg, Christopher; Dahl, Niklas

2006-01-01

There is strong evidence for the importance of genetic factors in idiopathic autism. The results from independent twin and family studies suggest that the disorder is caused by the action of several genes, possibly acting epistatically. We have used cDNA microarray technology for the identification of constitutional changes in the gene expression profile associated with idiopathic autism. Samples were obtained and analyzed from six affected subjects belonging to multiplex autism families and from six healthy controls. We assessed the expression levels for approximately 7,700 genes by cDNA microarrays using mRNA derived from Epstein Barr virus (EBV)-transformed B-lymphocytes. The microarray data was analyzed in order to identify up- or down-regulation of specific genes. A common pattern with nine down-regulated genes was identified among samples derived from individuals with autism when compared to controls. Four of these nine genes encode proteins involved in biological processes associated with brain function or the immune system, and are consequently considered as candidates for genes associated with autism. Quantitative realtime PCR confirms the down-regulation of the gene encoding SEMA5A, a protein involved in axonal guidance. EBV should be considered as a possible source for altered expression but our consistent results make us suggest SEMA5A a candidate gene in the etiology of idiopathic autism. PMID:17028446

Up-regulation of microtubule-associated protein 2 accompanying the filial imprinting of domestic chicks (Gallus gallus domesticus).

PubMed

Yamaguchi, Shinji; Fujii-Taira, Ikuko; Murakami, Akio; Hirose, Naoki; Aoki, Naoya; Izawa, Ei-Ichi; Fujimoto, Yasuyuki; Takano, Tatsuya; Matsushima, Toshiya; Homma, Koichi J

2008-06-15

Using cDNA microarrays, we have identified elsewhere the genes of microtubule-associated proteins as a group up-regulated in newly hatched chick brains after filial imprinting training. Here we show by in situ hybridization that the mRNA for the microtubule-associated protein 2 (MAP2) gene was enriched in the mesopallium and the hippocampus in the trained chick brain. The regionally specific enrichments of MAP2 mRNA were not observed in the brain of dark-reared or light-exposed chick as controls, implying an association between the degree of expression and the strength of the learned preference. In agreement with the gene expression, MAP2 protein was accumulated in the mesopallium of the trained chick brain, but not in the brains of the controls. The accumulation of MAP2 was found in the cytosol of neurons and co-localized with beta-tubulin, suggesting a change in microtubule assembly. Our results suggest a postnatal reorganization of cytoskeleton following filial imprinting.

Cross-Study Homogeneity of Psoriasis Gene Expression in Skin across a Large Expression Range

PubMed Central

Kerkof, Keith; Timour, Martin; Russell, Christopher B.

2013-01-01

Background In psoriasis, only limited overlap between sets of genes identified as differentially expressed (psoriatic lesional vs. psoriatic non-lesional) was found using statistical and fold-change cut-offs. To provide a framework for utilizing prior psoriasis data sets we sought to understand the consistency of those sets. Methodology/Principal Findings Microarray expression profiling and qRT-PCR were used to characterize gene expression in PP and PN skin from psoriasis patients. cDNA (three new data sets) and cRNA hybridization (four existing data sets) data were compared using a common analysis pipeline. Agreement between data sets was assessed using varying qualitative and quantitative cut-offs to generate a DEG list in a source data set and then using other data sets to validate the list. Concordance increased from 67% across all probe sets to over 99% across more than 10,000 probe sets when statistical filters were employed. The fold-change behavior of individual genes tended to be consistent across the multiple data sets. We found that genes with <2-fold change values were quantitatively reproducible between pairs of data-sets. In a subset of transcripts with a role in inflammation changes detected by microarray were confirmed by qRT-PCR with high concordance. For transcripts with both PN and PP levels within the microarray dynamic range, microarray and qRT-PCR were quantitatively reproducible, including minimal fold-changes in IL13, TNFSF11, and TNFRSF11B and genes with >10-fold changes in either direction such as CHRM3, IL12B and IFNG. Conclusions/Significance Gene expression changes in psoriatic lesions were consistent across different studies, despite differences in patient selection, sample handling, and microarray platforms but between-study comparisons showed stronger agreement within than between platforms. We could use cut-offs as low as log10(ratio) = 0.1 (fold-change = 1.26), generating larger gene lists that validate on independent data sets. The reproducibility of PP signatures across data sets suggests that different sample sets can be productively compared. PMID:23308107

Oligonucleotide microarray chip for the quantification of MS2, ΦX174, and adenoviruses on the multiplex analysis platform MCR 3.

PubMed

Lengger, Sandra; Otto, Johannes; Elsässer, Dennis; Schneider, Oliver; Tiehm, Andreas; Fleischer, Jens; Niessner, Reinhard; Seidel, Michael

2014-05-01

Pathogenic viruses are emerging contaminants in water which should be analyzed for water safety to preserve public health. A strategy was developed to quantify RNA and DNA viruses in parallel on chemiluminescence flow-through oligonucleotide microarrays. In order to show the proof of principle, bacteriophage MS2, ΦX174, and the human pathogenic adenovirus type 2 (hAdV2) were analyzed in spiked tap water samples on the analysis platform MCR 3. The chemiluminescence microarray imaging unit was equipped with a Peltier heater for a controlled heating of the flow cell. The efficiency and selectivity of DNA hybridization could be increased resulting in higher signal intensities and lower cross-reactivities of polymerase chain reaction (PCR) products from other viruses. The total analysis time for DNA/RNA extraction, cDNA synthesis for RNA viruses, polymerase chain reaction, single-strand separation, and oligonucleotide microarray analysis was performed in 4-4.5 h. The parallel quantification was possible in a concentration range of 9.6 × 10(5)-1.4 × 10(10) genomic units (GU)/mL for bacteriophage MS2, 1.4 × 10(5)-3.7 × 10(8) GU/mL for bacteriophage ΦX174, and 6.5 × 10(3)-1.2 × 10(5) for hAdV2, respectively, by using a measuring temperature of 40 °C. Detection limits could be calculated to 6.6 × 10(5) GU/mL for MS2, 5.3 × 10(3) GU/mL for ΦX174, and 1.5 × 10(2) GU/mL for hAdV2, respectively. Real samples of surface water and treated wastewater were tested. Generally, found concentrations of hAdV2, bacteriophage MS2, and ΦX174 were at the detection limit. Nevertheless, bacteriophages could be identified with similar results by means of quantitative PCR and oligonucleotide microarray analysis on the MCR 3.

Adaptable gene-specific dye bias correction for two-channel DNA microarrays.

PubMed

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank C P

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available.

Adaptable gene-specific dye bias correction for two-channel DNA microarrays

PubMed Central

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank CP

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available. PMID:19401678

Detection of Helicobacter Pylori Genome with an Optical Biosensor Based on Hybridization of Urease Gene with a Gold Nanoparticles-Labeled Probe

NASA Astrophysics Data System (ADS)

Shahrashoob, M.; Mohsenifar, A.; Tabatabaei, M.; Rahmani-Cherati, T.; Mobaraki, M.; Mota, A.; Shojaei, T. R.

2016-05-01

A novel optics-based nanobiosensor for sensitive determination of the Helicobacter pylori genome using a gold nanoparticles (AuNPs)-labeled probe is reported. Two specific thiol-modified capture and signal probes were designed based on a single-stranded complementary DNA (cDNA) region of the urease gene. The capture probe was immobilized on AuNPs, which were previously immobilized on an APTES-activated glass, and the signal probe was conjugated to different AuNPs as well. The presence of the cDNA in the reaction mixture led to the hybridization of the AuNPs-labeled capture probe and the signal probe with the cDNA, and consequently the optical density of the reaction mixture (AuNPs) was reduced proportionally to the cDNA concentration. The limit of detection was measured at 0.5 nM.

Dynamics of 17alpha-ethynylestradiol exposure in rainbow trout (Oncorhynchus mykiss): absorption, tissue distribution, and hepatic gene expression pattern.

PubMed

Skillman, Ann D; Nagler, James J; Hook, Sharon E; Small, Jack A; Schultz, Irvin R

2006-11-01

17alpha-Ethynylestradiol (EE2) is a synthetic estrogen identified in sewage effluents. To understand better the absorption kinetics of EE2 and the induction of vitellogenin (VTG) and estrogen receptor alpha (ERalpha) mRNA, we subjected male rainbow trout (Onchorynchus mykiss) to continuous water exposures of 125 ng/L of EE2 for up to 61 d. Trout were either repetitively sampled for blood plasma or serially killed at selected time intervals. Vitellogenin, ERalpha mRNA, and EE2 were measured using enzyme-linked immunosorbent assay and using quantitative polymerase chain reaction and gas chromatography-mass spectrometry, respectively. In separate experiments, trout were exposed to EE2 for 7 d, and hepatic gene expression was assessed using a low- and high-density cDNA microarray. The EE2 was rapidly absorbed by the trout, with an apparent equilibrium at 16 h in plasma and liver. The ERalpha mRNA levels also increased rapidly, reaching near-peak levels by 48 h. In contrast, plasma levels of VTG continuously increased for 19 d. After 61 d, tissues with the highest levels of VTG were the liver, kidney, and testes. Microarray-based gene expression studies provided unexpected results. In some cases, known estrogen-responsive genes (e.g., ERalpha) were unresponsive, whereas many of the genes that have no apparent link to estrogen function or EE2 toxicity were significantly altered in expression. Of the two microarray approaches tested in the present study, the high-density array appeared to be superior because of the improved quality of the hybridization signal and the robustness of the response in terms of the number of genes identified as being EE2 responsive.

DYNAMICS OF 17α-ETHYNYLESTRADIOL EXPOSURE IN RAINBOW TROUT (ONCORHYNCHUS MYKISS): ABSORPTION, TISSUE DISTRIBUTION, AND HEPATIC GENE EXPRESSION PATTERN

PubMed Central

Skillman, Ann D.; Nagler, James J.; Hook, Sharon E.; Small, Jack A.; Schultz, Irvin R.

2008-01-01

17α-Ethynylestradiol (EE2) is a synthetic estrogen identified in sewage effluents. To understand better the absorption kinetics of EE2 and the induction of vitellogenin (VTG) and estrogen receptor α (ERα) mRNA, we subjected male rainbow trout (Onchorynchus mykiss) to continuous water exposures of 125 ng/L of EE2 for up to 61 d. Trout were either repetitively sampled for blood plasma or serially killed at selected time intervals. Vitellogenin, ERα mRNA, and EE2 were measured using enzyme-linked immunosorbent assay and using quantitative polymerase chain reaction and gas chromatography–mass spectrometry, respectively. In separate experiments, trout were exposed to EE2 for 7 d, and hepatic gene expression was assessed using a low- and high-density cDNA microarray. The EE2 was rapidly absorbed by the trout, with an apparent equilibrium at 16 h in plasma and liver. The ERα mRNA levels also increased rapidly, reaching near-peak levels by 48 h. In contrast, plasma levels of VTG continuously increased for 19 d. After 61 d, tissues with the highest levels of VTG were the liver, kidney, and testes. Microarray-based gene expression studies provided unexpected results. In some cases, known estrogen-responsive genes (e.g., ERα) were unresponsive, whereas many of the genes that have no apparent link to estrogen function or EE2 toxicity were significantly altered in expression. Of the two microarray approaches tested in the present study, the high-density array appeared to be superior because of the improved quality of the hybridization signal and the robustness of the response in terms of the number of genes identified as being EE2 responsive. PMID:17089724

The Changes of Gene Expression on Human Hair during Long-Spaceflight

NASA Astrophysics Data System (ADS)

Terada, Masahiro; Mukai, Chiaki; Ishioka, Noriaki; Majima, Hideyuki J.; Yamada, Shin; Seki, Masaya; Takahashi, Rika; Higashibata, Akira; Ohshima, Hiroshi; Sudoh, Masamichi; Minamisawa, Susumu

Hair has many advantages as the experimental sample. In a hair follicle, hair matrix cells actively divide and these active changes sensitively reflect physical condition on human body. The hair shaft records the metabolic conditions of mineral elements in our body. From human hairs, we can detect physiological informations about the human health. Therefore, we focused on using hair root analysis to understand the effects of spaceflight on astronauts. In 2009, we started a research program focusing on the analysis of astronauts’ hairs to examine the effects of long-term spaceflight on the gene expression in the human body. We want to get basic information to invent the effectivly diagnostic methods to detect the health situations of astronauts during space flight by analyzing human hair. We extracted RNA form the collected samples. Then, these extracted RNA was amplified. Amplified RNA was processed and hybridized to the Whole Human Genome (4×44K) Oligo Microarray (Agilent Technologies) according to the manufacturer’s protocol. Slide scanning was performed using the Agilent DNA Microarray Scanner. Scanning data were normalized with Agilent’s Feature Extraction software. Data preprocessing and analysis were performed using GeneSpring software 11.0.1. Next, Synthesis of cDNA (1 mg) was carried out using the PrimeScript RT reagent Kit (TaKaRa Bio) following the manufacturer’s instructions. The qRT-PCR experiment was performed with SYBR Premix Ex Taq (TaKaRa Bio) using the 7500 Real-Time PCR system (Applied Biosystems). We detected the changes of some gene expressions during spaceflight from both microarray and qRT-PCR data. These genes seems to be related with the hair proliferation. We believe that these results will lead to the discovery of the important factor effected during space flight on the hair.

Human placental lactogen mRNA and its structural genes during pregnancy: quantitation with a complementary DNA.

PubMed Central

McWilliams, D; Callahan, R C; Boime, I

1977-01-01

A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681

Improved microarray methods for profiling the yeast knockout strain collection

PubMed Central

Yuan, Daniel S.; Pan, Xuewen; Ooi, Siew Loon; Peyser, Brian D.; Spencer, Forrest A.; Irizarry, Rafael A.; Boeke, Jef D.

2005-01-01

A remarkable feature of the Yeast Knockout strain collection is the presence of two unique 20mer TAG sequences in almost every strain. In principle, the relative abundances of strains in a complex mixture can be profiled swiftly and quantitatively by amplifying these sequences and hybridizing them to microarrays, but TAG microarrays have not been widely used. Here, we introduce a TAG microarray design with sophisticated controls and describe a robust method for hybridizing high concentrations of dye-labeled TAGs in single-stranded form. We also highlight the importance of avoiding PCR contamination and provide procedures for detection and eradication. Validation experiments using these methods yielded false positive (FP) and false negative (FN) rates for individual TAG detection of 3–6% and 15–18%, respectively. Analysis demonstrated that cross-hybridization was the chief source of FPs, while TAG amplification defects were the main cause of FNs. The materials, protocols, data and associated software described here comprise a suite of experimental resources that should facilitate the use of TAG microarrays for a wide variety of genetic screens. PMID:15994458

A model of binding on DNA microarrays: understanding the combined effect of probe synthesis failure, cross-hybridization, DNA fragmentation and other experimental details of affymetrix arrays

PubMed Central

2012-01-01

Background DNA microarrays are used both for research and for diagnostics. In research, Affymetrix arrays are commonly used for genome wide association studies, resequencing, and for gene expression analysis. These arrays provide large amounts of data. This data is analyzed using statistical methods that quite often discard a large portion of the information. Most of the information that is lost comes from probes that systematically fail across chips and from batch effects. The aim of this study was to develop a comprehensive model for hybridization that predicts probe intensities for Affymetrix arrays and that could provide a basis for improved microarray analysis and probe development. The first part of the model calculates probe binding affinities to all the possible targets in the hybridization solution using the Langmuir isotherm. In the second part of the model we integrate details that are specific to each experiment and contribute to the differences between hybridization in solution and on the microarray. These details include fragmentation, wash stringency, temperature, salt concentration, and scanner settings. Furthermore, the model fits probe synthesis efficiency and target concentration parameters directly to the data. All the parameters used in the model have a well-established physical origin. Results For the 302 chips that were analyzed the mean correlation between expected and observed probe intensities was 0.701 with a range of 0.88 to 0.55. All available chips were included in the analysis regardless of the data quality. Our results show that batch effects arise from differences in probe synthesis, scanner settings, wash strength, and target fragmentation. We also show that probe synthesis efficiencies for different nucleotides are not uniform. Conclusions To date this is the most complete model for binding on microarrays. This is the first model that includes both probe synthesis efficiency and hybridization kinetics/cross-hybridization. These two factors are sequence dependent and have a large impact on probe intensity. The results presented here provide novel insight into the effect of probe synthesis errors on Affymetrix microarrays; furthermore, the algorithms developed in this work provide useful tools for the analysis of cross-hybridization, probe synthesis efficiency, fragmentation, wash stringency, temperature, and salt concentration on microarray intensities. PMID:23270536

Comparison of Global Transcriptional Responses of Chicken Following Primary and Secondary Eimeria acervulina Infections

USDA-ARS?s Scientific Manuscript database

In the current study, we compared chicken gene transcriptional profiles following primary and secondary infections with Eimeria acervulina using a 9.6K avian intestinal intraepithelial lymphocyte cDNA microarray (AVIELA). Gene Ontology analysis showed that primary infection significantly modulated ...

Biologically relevant effects of mRNA amplification on gene expression profiles.

PubMed

van Haaften, Rachel I M; Schroen, Blanche; Janssen, Ben J A; van Erk, Arie; Debets, Jacques J M; Smeets, Hubert J M; Smits, Jos F M; van den Wijngaard, Arthur; Pinto, Yigal M; Evelo, Chris T A

2006-04-11

Gene expression microarray technology permits the analysis of global gene expression profiles. The amount of sample needed limits the use of small excision biopsies and/or needle biopsies from human or animal tissues. Linear amplification techniques have been developed to increase the amount of sample derived cDNA. These amplified samples can be hybridised on microarrays. However, little information is available whether microarrays based on amplified and unamplified material yield comparable results. In the present study we compared microarray data obtained from amplified mRNA derived from biopsies of rat cardiac left ventricle and non-amplified mRNA derived from the same organ. Biopsies were linearly amplified to acquire enough material for a microarray experiment. Both amplified and unamplified samples were hybridized to the Rat Expression Set 230 Array of Affymetrix. Analysis of the microarray data showed that unamplified material of two different left ventricles had 99.6% identical gene expression. Gene expression patterns of two biopsies obtained from the same parental organ were 96.3% identical. Similarly, gene expression pattern of two biopsies from dissimilar organs were 92.8% identical to each other.Twenty-one percent of reporters called present in parental left ventricular tissue disappeared after amplification in the biopsies. Those reporters were predominantly seen in the low intensity range. Sequence analysis showed that reporters that disappeared after amplification had a GC-content of 53.7+/-4.0%, while reporters called present in biopsy- and whole LV-samples had an average GC content of 47.8+/-5.5% (P <0.001). Those reporters were also predicted to form significantly more (0.76+/-0.07 versus 0.38+/-0.1) and longer (9.4+/-0.3 versus 8.4+/-0.4) hairpins as compared to representative control reporters present before and after amplification. This study establishes that the gene expression profile obtained after amplification of mRNA of left ventricular biopsies is representative for the whole left ventricle of the rat heart. However, specific gene transcripts present in parental tissues were undetectable in the minute left ventricular biopsies. Transcripts that were lost due to the amplification process were not randomly distributed, but had higher GC-content and hairpins in the sequence and were mainly found in the lower intensity range which includes many transcription factors from specific signalling pathways.

Biologically relevant effects of mRNA amplification on gene expression profiles

PubMed Central

van Haaften, Rachel IM; Schroen, Blanche; Janssen, Ben JA; van Erk, Arie; Debets, Jacques JM; Smeets, Hubert JM; Smits, Jos FM; van den Wijngaard, Arthur; Pinto, Yigal M; Evelo, Chris TA

2006-01-01

Background Gene expression microarray technology permits the analysis of global gene expression profiles. The amount of sample needed limits the use of small excision biopsies and/or needle biopsies from human or animal tissues. Linear amplification techniques have been developed to increase the amount of sample derived cDNA. These amplified samples can be hybridised on microarrays. However, little information is available whether microarrays based on amplified and unamplified material yield comparable results. In the present study we compared microarray data obtained from amplified mRNA derived from biopsies of rat cardiac left ventricle and non-amplified mRNA derived from the same organ. Biopsies were linearly amplified to acquire enough material for a microarray experiment. Both amplified and unamplified samples were hybridized to the Rat Expression Set 230 Array of Affymetrix. Results Analysis of the microarray data showed that unamplified material of two different left ventricles had 99.6% identical gene expression. Gene expression patterns of two biopsies obtained from the same parental organ were 96.3% identical. Similarly, gene expression pattern of two biopsies from dissimilar organs were 92.8% identical to each other. Twenty-one percent of reporters called present in parental left ventricular tissue disappeared after amplification in the biopsies. Those reporters were predominantly seen in the low intensity range. Sequence analysis showed that reporters that disappeared after amplification had a GC-content of 53.7+/-4.0%, while reporters called present in biopsy- and whole LV-samples had an average GC content of 47.8+/-5.5% (P <0.001). Those reporters were also predicted to form significantly more (0.76+/-0.07 versus 0.38+/-0.1) and longer (9.4+/-0.3 versus 8.4+/-0.4) hairpins as compared to representative control reporters present before and after amplification. Conclusion This study establishes that the gene expression profile obtained after amplification of mRNA of left ventricular biopsies is representative for the whole left ventricle of the rat heart. However, specific gene transcripts present in parental tissues were undetectable in the minute left ventricular biopsies. Transcripts that were lost due to the amplification process were not randomly distributed, but had higher GC-content and hairpins in the sequence and were mainly found in the lower intensity range which includes many transcription factors from specific signalling pathways. PMID:16608515

Comparison of dkgB-linked intergenic sequence ribotyping to DNA microarray hybridization for assigning serotype to Salmonella enterica

PubMed Central

Guard, Jean; Sanchez-Ingunza, Roxana; Morales, Cesar; Stewart, Tod; Liljebjelke, Karen; Kessel, JoAnn; Ingram, Kim; Jones, Deana; Jackson, Charlene; Fedorka-Cray, Paula; Frye, Jonathan; Gast, Richard; Hinton, Arthur

2012-01-01

Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research. PMID:22998607

[Typing and subtyping avian influenza virus using DNA microarrays].

PubMed

Yang, Zhongping; Wang, Xiurong; Tian, Lina; Wang, Yu; Chen, Hualan

2008-07-01

Outbreaks of highly pathogenic avian influenza (HPAI) virus has caused great economic loss to the poultry industry and resulted in human deaths in Thailand and Vietnam since 2004. Rapid typing and subtyping of viruses, especially HPAI from clinical specimens, are desirable for taking prompt control measures to prevent spreading of the disease. We described a simultaneous approach using microarray to detect and subtype avian influenza virus (AIV). We designed primers of probe genes and used reverse transcriptase PCR to prepare cDNAs of AIV M gene, H5, H7, H9 subtypes haemagglutinin genes and N1, N2 subtypes neuraminidase genes. They were cloned, sequenced, reamplified and spotted to form a glass-bound microarrays. We labeled samples using Cy3-dUTP by RT-PCR, hybridized and scanned the microarrays to typing and subtyping AIV. The hybridization pattern agreed perfectly with the known grid location of each probe, no cross hybridization could be detected. Examinating of HA subtypes 1 through 15, 30 infected samples and 21 field samples revealed the DNA microarray assay was more sensitive and specific than RT-PCR test and chicken embryo inoculation. It can simultaneously detect and differentiate the main epidemic AIV. The results show that DNA microarray technology is a useful diagnostic method.

Direct profiling of environmental microbial populations by thermal dissociation analysis of native rRNAs hybridized to oligonucleotide microarrays

NASA Technical Reports Server (NTRS)

El Fantroussi, Said; Urakawa, Hidetoshi; Bernhard, Anne E.; Kelly, John J.; Noble, Peter A.; Smidt, H.; Yershov, G. M.; Stahl, David A.

2003-01-01

Oligonucleotide microarrays were used to profile directly extracted rRNA from environmental microbial populations without PCR amplification. In our initial inspection of two distinct estuarine study sites, the hybridization patterns were reproducible and varied between estuarine sediments of differing salinities. The determination of a thermal dissociation curve (i.e., melting profile) for each probe-target duplex provided information on hybridization specificity, which is essential for confirming adequate discrimination between target and nontarget sequences.

Normal uniform mixture differential gene expression detection for cDNA microarrays

PubMed Central

Dean, Nema; Raftery, Adrian E

2005-01-01

Background One of the primary tasks in analysing gene expression data is finding genes that are differentially expressed in different samples. Multiple testing issues due to the thousands of tests run make some of the more popular methods for doing this problematic. Results We propose a simple method, Normal Uniform Differential Gene Expression (NUDGE) detection for finding differentially expressed genes in cDNA microarrays. The method uses a simple univariate normal-uniform mixture model, in combination with new normalization methods for spread as well as mean that extend the lowess normalization of Dudoit, Yang, Callow and Speed (2002) [1]. It takes account of multiple testing, and gives probabilities of differential expression as part of its output. It can be applied to either single-slide or replicated experiments, and it is very fast. Three datasets are analyzed using NUDGE, and the results are compared to those given by other popular methods: unadjusted and Bonferroni-adjusted t tests, Significance Analysis of Microarrays (SAM), and Empirical Bayes for microarrays (EBarrays) with both Gamma-Gamma and Lognormal-Normal models. Conclusion The method gives a high probability of differential expression to genes known/suspected a priori to be differentially expressed and a low probability to the others. In terms of known false positives and false negatives, the method outperforms all multiple-replicate methods except for the Gamma-Gamma EBarrays method to which it offers comparable results with the added advantages of greater simplicity, speed, fewer assumptions and applicability to the single replicate case. An R package called nudge to implement the methods in this paper will be made available soon at . PMID:16011807

A robust two-way semi-linear model for normalization of cDNA microarray data

PubMed Central

Wang, Deli; Huang, Jian; Xie, Hehuang; Manzella, Liliana; Soares, Marcelo Bento

2005-01-01

Background Normalization is a basic step in microarray data analysis. A proper normalization procedure ensures that the intensity ratios provide meaningful measures of relative expression values. Methods We propose a robust semiparametric method in a two-way semi-linear model (TW-SLM) for normalization of cDNA microarray data. This method does not make the usual assumptions underlying some of the existing methods. For example, it does not assume that: (i) the percentage of differentially expressed genes is small; or (ii) the numbers of up- and down-regulated genes are about the same, as required in the LOWESS normalization method. We conduct simulation studies to evaluate the proposed method and use a real data set from a specially designed microarray experiment to compare the performance of the proposed method with that of the LOWESS normalization approach. Results The simulation results show that the proposed method performs better than the LOWESS normalization method in terms of mean square errors for estimated gene effects. The results of analysis of the real data set also show that the proposed method yields more consistent results between the direct and the indirect comparisons and also can detect more differentially expressed genes than the LOWESS method. Conclusions Our simulation studies and the real data example indicate that the proposed robust TW-SLM method works at least as well as the LOWESS method and works better when the underlying assumptions for the LOWESS method are not satisfied. Therefore, it is a powerful alternative to the existing normalization methods. PMID:15663789

DNA microarray-based PCR ribotyping of Clostridium difficile.

PubMed

Schneeberg, Alexander; Ehricht, Ralf; Slickers, Peter; Baier, Vico; Neubauer, Heinrich; Zimmermann, Stefan; Rabold, Denise; Lübke-Becker, Antina; Seyboldt, Christian

2015-02-01

This study presents a DNA microarray-based assay for fast and simple PCR ribotyping of Clostridium difficile strains. Hybridization probes were designed to query the modularly structured intergenic spacer region (ISR), which is also the template for conventional and PCR ribotyping with subsequent capillary gel electrophoresis (seq-PCR) ribotyping. The probes were derived from sequences available in GenBank as well as from theoretical ISR module combinations. A database of reference hybridization patterns was set up from a collection of 142 well-characterized C. difficile isolates representing 48 seq-PCR ribotypes. The reference hybridization patterns calculated by the arithmetic mean were compared using a similarity matrix analysis. The 48 investigated seq-PCR ribotypes revealed 27 array profiles that were clearly distinguishable. The most frequent human-pathogenic ribotypes 001, 014/020, 027, and 078/126 were discriminated by the microarray. C. difficile strains related to 078/126 (033, 045/FLI01, 078, 126, 126/FLI01, 413, 413/FLI01, 598, 620, 652, and 660) and 014/020 (014, 020, and 449) showed similar hybridization patterns, confirming their genetic relatedness, which was previously reported. A panel of 50 C. difficile field isolates was tested by seq-PCR ribotyping and the DNA microarray-based assay in parallel. Taking into account that the current version of the microarray does not discriminate some closely related seq-PCR ribotypes, all isolates were typed correctly. Moreover, seq-PCR ribotypes without reference profiles available in the database (ribotype 009 and 5 new types) were correctly recognized as new ribotypes, confirming the performance and expansion potential of the microarray. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

cDNA microarray analyses reveal candidate marker genes for the detection of ascidian disease in Korea.

PubMed

Azumi, Kaoru; Usami, Takeshi; Kamimura, Akiko; Sabau, Sorin V; Miki, Yasufumi; Fujie, Manabu; Jung, Sung-Ju; Kitamura, Shin-Ichi; Suzuki, Satoru; Yokosawa, Hideyoshi

2007-12-01

A serious disease of the ascidian Halocynthia roretzi has been spread extensively among Korean aquaculture sites. To reveal the cause of the disease and establish a monitoring system for it, we constructed a cDNA microarray spotted with 2,688 cDNAs derived from H. roretzi hemocyte cDNA libraries to detect genes differentially expressed in hemocytes between diseased and non-diseased ascidians. We detected 21 genes showing increased expression and 16 genes showing decreased expression in hemocytes from diseased ascidians compared with those from non-diseased ascidians. RT-PCR analyses confirmed that the expression levels of genes encoding astacin, lysozyme, ribosomal protein PO, and ubiquitin-ribosomal protein L40e fusion protein were increased in hemocytes from diseased ascidians, while those of genes encoding HSP40, HSP70, fibronectin, carboxypeptidase and lactate dehydrogenase were decreased. These genes were expressed not only in hemocytes but also in various other tissues in ascidians. Furthermore, the expression of glutathione-S transferase omega, which is known to be up-regulated in H. roretzi hemocytes during inflammatory responses, was strongly increased in hemocytes from diseased ascidians. These gene expression profiles suggest that immune and inflammatory reactions occur in the hemocytes of diseased ascidians. These genes will be good markers for detecting and monitoring this disease of ascidians in Korean aquaculture sites.

Variance stabilization and normalization for one-color microarray data using a data-driven multiscale approach.

PubMed

Motakis, E S; Nason, G P; Fryzlewicz, P; Rutter, G A

2006-10-15

Many standard statistical techniques are effective on data that are normally distributed with constant variance. Microarray data typically violate these assumptions since they come from non-Gaussian distributions with a non-trivial mean-variance relationship. Several methods have been proposed that transform microarray data to stabilize variance and draw its distribution towards the Gaussian. Some methods, such as log or generalized log, rely on an underlying model for the data. Others, such as the spread-versus-level plot, do not. We propose an alternative data-driven multiscale approach, called the Data-Driven Haar-Fisz for microarrays (DDHFm) with replicates. DDHFm has the advantage of being 'distribution-free' in the sense that no parametric model for the underlying microarray data is required to be specified or estimated; hence, DDHFm can be applied very generally, not just to microarray data. DDHFm achieves very good variance stabilization of microarray data with replicates and produces transformed intensities that are approximately normally distributed. Simulation studies show that it performs better than other existing methods. Application of DDHFm to real one-color cDNA data validates these results. The R package of the Data-Driven Haar-Fisz transform (DDHFm) for microarrays is available in Bioconductor and CRAN.

Caryoscope: An Open Source Java application for viewing microarray data in a genomic context

PubMed Central

Awad, Ihab AB; Rees, Christian A; Hernandez-Boussard, Tina; Ball, Catherine A; Sherlock, Gavin

2004-01-01

Background Microarray-based comparative genome hybridization experiments generate data that can be mapped onto the genome. These data are interpreted more easily when represented graphically in a genomic context. Results We have developed Caryoscope, which is an open source Java application for visualizing microarray data from array comparative genome hybridization experiments in a genomic context. Caryoscope can read General Feature Format files (GFF files), as well as comma- and tab-delimited files, that define the genomic positions of the microarray reporters for which data are obtained. The microarray data can be browsed using an interactive, zoomable interface, which helps users identify regions of chromosomal deletion or amplification. The graphical representation of the data can be exported in a number of graphic formats, including publication-quality formats such as PostScript. Conclusion Caryoscope is a useful tool that can aid in the visualization, exploration and interpretation of microarray data in a genomic context. PMID:15488149

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants.

PubMed

Hook, Sharon E; Skillman, Ann D; Small, Jack A; Schultz, Irvin R

2006-05-25

The increased availability and use of DNA microarrays has allowed the characterization of gene expression patterns associated with exposure to different toxicants. An important question is whether toxicant induced changes in gene expression in fish are sufficiently diverse to allow for identification of specific modes of action and/or specific contaminants. In theory, each class of toxicant may generate a gene expression profile unique to its mode of toxic action. In this study, isogenic (cloned) rainbow trout Oncorhynchus mykiss were exposed to sublethal levels of a series of model toxicants with varying modes of action, including ethynylestradiol (xeno-estrogen), 2,2,4,4'-tetrabromodiphenyl ether (BDE-47, thyroid active), diquat (oxidant stressor), chromium VI, and benzo[a]pyrene (BaP) for a period of 1-3 weeks. An additional experiment measured trenbolone (anabolic steroid; model androgen) induced gene expression changes in sexually mature female trout. Following exposure, fish were euthanized, livers removed and RNA extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNA's. The slides were scanned to measure abundance of a given transcript in each sample relative to controls. Data were analyzed via Genespring (Silicon Genetics) to identify a list of up- and downregulated genes, as well as to determine gene clustering patterns that can be used as "expression signatures". The results indicate each toxicant exposure caused between 64 and 222 genes to be significantly altered in expression. Most genes exhibiting altered expression responded to only one of the toxicants and relatively few were co-expressed in multiple treatments. For example, BaP and Diquat, both of which exert toxicity via oxidative stress, upregulated 28 of the same genes, of over 100 genes altered by either treatment. Other genes associated with steroidogenesis, p450 and estrogen responsive genes appear to be useful for selectively identifying toxicant mode of action in fish, suggesting a link between gene expression profile and mode of toxicity. Our array results showed good agreement with quantitative real time polymerase chain reaction (qRT PCR), which demonstrates that the arrays are an accurate measure of gene expression. The specificity of the gene expression profile in response to a model toxicant, the link between genes with altered expression and mode of toxic action, and the consistency between array and qRT PCR results all suggest that cDNA microarrays have the potential to screen environmental contaminants for biomarkers and mode of toxic action.

Massive Collection of Full-Length Complementary DNA Clones and Microarray Analyses:. Keys to Rice Transcriptome Analysis

NASA Astrophysics Data System (ADS)

Kikuchi, Shoshi

2009-02-01

Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.

Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

PubMed

Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

2005-01-01

We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

PubMed

Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

2008-03-15

This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

Temperature-controlled microintaglio printing for high-resolution micropatterning of RNA molecules.

PubMed

Kobayashi, Ryo; Biyani, Manish; Ueno, Shingo; Kumal, Subhashini Raj; Kuramochi, Hiromi; Ichiki, Takanori

2015-05-15

We have developed an advanced microintaglio printing method for fabricating fine and high-density micropatterns and applied it to the microarraying of RNA molecules. The microintaglio printing of RNA reported here is based on the hybridization of RNA with immobilized complementary DNA probes. The hybridization was controlled by switching the RNA conformation via the temperature, and an RNA microarray with a diameter of 1.5 µm and a density of 40,000 spots/mm(2) with high contrast was successfully fabricated. Specifically, no size effects were observed in the uniformity of patterned signals over a range of microarray feature sizes spanning one order of magnitude. Additionally, we have developed a microintaglio printing method for transcribed RNA microarrays on demand using DNA-immobilized magnetic beads. The beads were arrayed on wells fabricated on a printing mold and the wells were filled with in vitro transcription reagent and sealed with a DNA-immobilized glass substrate. Subsequently, RNA was in situ synthesized using the bead-immobilized DNA as a template and printed onto the substrate via hybridization. Since the microintaglio printing of RNA using DNA-immobilized beads enables the fabrication of a microarray of spots composed of multiple RNA sequences, it will be possible to screen or analyze RNA functions using an RNA microarray fabricated by temperature-controlled microintaglio printing (TC-µIP). Copyright © 2014 Elsevier B.V. All rights reserved.

Assignment of Alzheimer's presenilin-2 (PS-2) gene to 1q42.1 by fluorescence in situ hybridization.

PubMed

Takano, T; Sahara, N; Yamanouchi, Y; Mori, H

1997-01-17

Presenilin-2 (PS-2) was suggested to be localized on 1q31-42 based on linkage analysis and cDNA cloning. The final identification of PS-2 as the causal gene for early-onset familial Alzheimer's disease in Voga-German pedigrees was concluded based on the point mutation found in the candidate cDNA isolated from this familial AD. We present evidence of its physical genome mapping of PS-2 on chromosome 1q42.1 by fluorescence in situ hybridization method.

Analysis of large-scale gene expression data.

PubMed

Sherlock, G

2000-04-01

The advent of cDNA and oligonucleotide microarray technologies has led to a paradigm shift in biological investigation, such that the bottleneck in research is shifting from data generation to data analysis. Hierarchical clustering, divisive clustering, self-organizing maps and k-means clustering have all been recently used to make sense of this mass of data.

Microarrays

ERIC Educational Resources Information Center

Plomin, Robert; Schalkwyk, Leonard C.

2007-01-01

Microarrays are revolutionizing genetics by making it possible to genotype hundreds of thousands of DNA markers and to assess the expression (RNA transcripts) of all of the genes in the genome. Microarrays are slides the size of a postage stamp that contain millions of DNA sequences to which single-stranded DNA or RNA can hybridize. This…

Profiling the transcriptome of Gracilaria changii (Rhodophyta) in response to light deprivation.

PubMed

Ho, Chai-Ling; Teoh, Seddon; Teo, Swee-Sen; Rahim, Raha Abdul; Phang, Siew-Moi

2009-01-01

Light regulates photosynthesis, growth and reproduction, yield and properties of phycocolloids, and starch contents in seaweeds. Despite its importance as an environmental cue that regulates many developmental, physiological, and biochemical processes, the network of genes involved during light deprivation are obscure. In this study, we profiled the transcriptome of Gracilaria changii at two different irradiance levels using a cDNA microarray containing more than 3,000 cDNA probes. Microarray analysis revealed that 93 and 105 genes were up- and down-regulated more than 3-fold under light deprivation, respectively. However, only 50% of the transcripts have significant matches to the nonredundant peptide sequences in the database. The transcripts that accumulated under light deprivation include vanadium chloroperoxidase, thioredoxin, ferredoxin component, and reduced nicotinamide adenine dinucleotide dehydrogenase. Among the genes that were down-regulated under light deprivation were genes encoding light harvesting protein, light harvesting complex I, phycobilisome 7.8 kDa linker polypeptide, low molecular weight early light-inducible protein, and vanadium bromoperoxidase. Our findings also provided important clues to the functions of many unknown sequences that could not be annotated using sequence comparison.

Analysis of sensitivity and rapid hybridization of a multiplexed Microbial Detection Microarray

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thissen, James B.; McLoughlin, Kevin; Gardner, Shea

Microarrays have proven to be useful in rapid detection of many viruses and bacteria. Pathogen detection microarrays have been used to diagnose viral and bacterial infections in clinical samples and to evaluate the safety of biological drug materials. A multiplexed version of the Lawrence Livermore Microbial Detection Array (LLMDA) was developed and evaluated with minimum detectable concentrations for pure unamplified DNA viruses, along with mixtures of viral and bacterial DNA subjected to different whole genome amplification protocols. In addition the performance of the array was tested when hybridization time was reduced from 17 h to 1 h. The LLMDA wasmore » able to detect unamplified vaccinia virus DNA at a concentration of 14 fM, or 100,000 genome copies in 12 μL of sample. With amplification, positive identification was made with only 100 genome copies of input material. When tested against human stool samples from patients with acute gastroenteritis, the microarray detected common gastroenteritis viral and bacterial infections such as rotavirus and E. coli. Accurate detection was found but with a 4-fold drop in sensitivity for a 1 h compared to a 17 h hybridization. The array detected 2 ng (equivalent concentration of 15.6 fM) of labeled DNA from a virus with 1 h hybridization without any amplification, and was able to identify the components of a mixture of viruses and bacteria at species and in some cases strain level resolution. Sensitivity improved by three orders of magnitude with random whole genome amplification prior to hybridization; for instance, the array detected a DNA virus with only 20 fg or 100 genome copies as input. This multiplexed microarray is an efficient tool to analyze clinical and environmental samples for the presence of multiple viral and bacterial pathogens rapidly.« less

Analysis of sensitivity and rapid hybridization of a multiplexed Microbial Detection Microarray

DOE PAGES

Thissen, James B.; McLoughlin, Kevin; Gardner, Shea; ...

2014-06-01

Microarrays have proven to be useful in rapid detection of many viruses and bacteria. Pathogen detection microarrays have been used to diagnose viral and bacterial infections in clinical samples and to evaluate the safety of biological drug materials. A multiplexed version of the Lawrence Livermore Microbial Detection Array (LLMDA) was developed and evaluated with minimum detectable concentrations for pure unamplified DNA viruses, along with mixtures of viral and bacterial DNA subjected to different whole genome amplification protocols. In addition the performance of the array was tested when hybridization time was reduced from 17 h to 1 h. The LLMDA wasmore » able to detect unamplified vaccinia virus DNA at a concentration of 14 fM, or 100,000 genome copies in 12 μL of sample. With amplification, positive identification was made with only 100 genome copies of input material. When tested against human stool samples from patients with acute gastroenteritis, the microarray detected common gastroenteritis viral and bacterial infections such as rotavirus and E. coli. Accurate detection was found but with a 4-fold drop in sensitivity for a 1 h compared to a 17 h hybridization. The array detected 2 ng (equivalent concentration of 15.6 fM) of labeled DNA from a virus with 1 h hybridization without any amplification, and was able to identify the components of a mixture of viruses and bacteria at species and in some cases strain level resolution. Sensitivity improved by three orders of magnitude with random whole genome amplification prior to hybridization; for instance, the array detected a DNA virus with only 20 fg or 100 genome copies as input. This multiplexed microarray is an efficient tool to analyze clinical and environmental samples for the presence of multiple viral and bacterial pathogens rapidly.« less

An automated microfluidic DNA microarray platform for genetic variant detection in inherited arrhythmic diseases.

PubMed

Huang, Shu-Hong; Chang, Yu-Shin; Juang, Jyh-Ming Jimmy; Chang, Kai-Wei; Tsai, Mong-Hsun; Lu, Tzu-Pin; Lai, Liang-Chuan; Chuang, Eric Y; Huang, Nien-Tsu

2018-03-12

In this study, we developed an automated microfluidic DNA microarray (AMDM) platform for point mutation detection of genetic variants in inherited arrhythmic diseases. The platform allows for automated and programmable reagent sequencing under precise conditions of hybridization flow and temperature control. It is composed of a commercial microfluidic control system, a microfluidic microarray device, and a temperature control unit. The automated and rapid hybridization process can be performed in the AMDM platform using Cy3 labeled oligonucleotide exons of SCN5A genetic DNA, which produces proteins associated with sodium channels abundant in the heart (cardiac) muscle cells. We then introduce a graphene oxide (GO)-assisted DNA microarray hybridization protocol to enable point mutation detection. In this protocol, a GO solution is added after the staining step to quench dyes bound to single-stranded DNA or non-perfectly matched DNA, which can improve point mutation specificity. As proof-of-concept we extracted the wild-type and mutant of exon 12 and exon 17 of SCN5A genetic DNA from patients with long QT syndrome or Brugada syndrome by touchdown PCR and performed a successful point mutation discrimination in the AMDM platform. Overall, the AMDM platform can greatly reduce laborious and time-consuming hybridization steps and prevent potential contamination. Furthermore, by introducing the reciprocating flow into the microchannel during the hybridization process, the total assay time can be reduced to 3 hours, which is 6 times faster than the conventional DNA microarray. Given the automatic assay operation, shorter assay time, and high point mutation discrimination, we believe that the AMDM platform has potential for low-cost, rapid and sensitive genetic testing in a simple and user-friendly manner, which may benefit gene screening in medical practice.

A probabilistic framework for microarray data analysis: fundamental probability models and statistical inference.

PubMed

Ogunnaike, Babatunde A; Gelmi, Claudio A; Edwards, Jeremy S

2010-05-21

Gene expression studies generate large quantities of data with the defining characteristic that the number of genes (whose expression profiles are to be determined) exceed the number of available replicates by several orders of magnitude. Standard spot-by-spot analysis still seeks to extract useful information for each gene on the basis of the number of available replicates, and thus plays to the weakness of microarrays. On the other hand, because of the data volume, treating the entire data set as an ensemble, and developing theoretical distributions for these ensembles provides a framework that plays instead to the strength of microarrays. We present theoretical results that under reasonable assumptions, the distribution of microarray intensities follows the Gamma model, with the biological interpretations of the model parameters emerging naturally. We subsequently establish that for each microarray data set, the fractional intensities can be represented as a mixture of Beta densities, and develop a procedure for using these results to draw statistical inference regarding differential gene expression. We illustrate the results with experimental data from gene expression studies on Deinococcus radiodurans following DNA damage using cDNA microarrays. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Pattern Triggered Immunity (PTI) in Tobacco: Isolation of Activated Genes Suggests Role of the Phenylpropanoid Pathway in Inhibition of Bacterial Pathogens

PubMed Central

Szatmári, Ágnes; Zvara, Ágnes; Móricz, Ágnes M.; Besenyei, Eszter; Szabó, Erika; Ott, Péter G.; Puskás, László G.; Bozsó, Zoltán

2014-01-01

Background Pattern Triggered Immunity (PTI) or Basal Resistance (BR) is a potent, symptomless form of plant resistance. Upon inoculation of a plant with non-pathogens or pathogenicity-mutant bacteria, the induced PTI will prevent bacterial proliferation. Developed PTI is also able to protect the plant from disease or HR (Hypersensitive Response) after a challenging infection with pathogenic bacteria. Our aim was to reveal those PTI-related genes of tobacco (Nicotiana tabacum) that could possibly play a role in the protection of the plant from disease. Methodology/Principal Findings Leaves were infiltrated with Pseudomonas syringae pv. syringae hrcC- mutant bacteria to induce PTI, and samples were taken 6 and 48 hours later. Subtraction Suppressive Hybridization (SSH) resulted in 156 PTI-activated genes. A cDNA microarray was generated from the SSH clone library. Analysis of hybridization data showed that in the early (6 hpi) phase of PTI, among others, genes of peroxidases, signalling elements, heat shock proteins and secondary metabolites were upregulated, while at the late phase (48 hpi) the group of proteolysis genes was newly activated. Microarray data were verified by real time RT-PCR analysis. Almost all members of the phenyl-propanoid pathway (PPP) possibly leading to lignin biosynthesis were activated. Specific inhibition of cinnamic-acid-4-hydroxylase (C4H), rate limiting enzyme of the PPP, decreased the strength of PTI - as shown by the HR-inhibition and electrolyte leakage tests. Quantification of cinnamate and p-coumarate by thin-layer chromatography (TLC)-densitometry supported specific changes in the levels of these metabolites upon elicitation of PTI. Conclusions/Significance We believe to provide first report on PTI-related changes in the levels of these PPP metabolites. Results implicated an actual role of the upregulation of the phenylpropanoid pathway in the inhibition of bacterial pathogenic activity during PTI. PMID:25101956

The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

PubMed Central

2013-01-01

Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

ExprAlign - the identification of ESTs in non-model species by alignment of cDNA microarray expression profiles

PubMed Central

2009-01-01

Background Sequence identification of ESTs from non-model species offers distinct challenges particularly when these species have duplicated genomes and when they are phylogenetically distant from sequenced model organisms. For the common carp, an environmental model of aquacultural interest, large numbers of ESTs remained unidentified using BLAST sequence alignment. We have used the expression profiles from large-scale microarray experiments to suggest gene identities. Results Expression profiles from ~700 cDNA microarrays describing responses of 7 major tissues to multiple environmental stressors were used to define a co-expression landscape. This was based on the Pearsons correlation coefficient relating each gene with all other genes, from which a network description provided clusters of highly correlated genes as 'mountains'. We show that these contain genes with known identities and genes with unknown identities, and that the correlation constitutes evidence of identity in the latter. This procedure has suggested identities to 522 of 2701 unknown carp ESTs sequences. We also discriminate several common carp genes and gene isoforms that were not discriminated by BLAST sequence alignment alone. Precision in identification was substantially improved by use of data from multiple tissues and treatments. Conclusion The detailed analysis of co-expression landscapes is a sensitive technique for suggesting an identity for the large number of BLAST unidentified cDNAs generated in EST projects. It is capable of detecting even subtle changes in expression profiles, and thereby of distinguishing genes with a common BLAST identity into different identities. It benefits from the use of multiple treatments or contrasts, and from the large-scale microarray data. PMID:19939286

COMPARISON OF COMPARATIVE GENOMIC HYBRIDIZATIONS TECHNOLOGIES ACROSS MICROARRAY PLATFORMS

EPA Science Inventory

Comparative Genomic Hybridization (CGH) measures DNA copy number differences between a reference genome and a test genome. The DNA samples are differentially labeled and hybridized to an immobilized substrate. In early CGH experiments, the DNA targets were hybridized to metaphase...

Assignment of xeroderma pigmentosum group C(XPC) gene to chromosome 3p25

DOE Office of Scientific and Technical Information (OSTI.GOV)

Legerski, R.J.; Liu, P.; Li, L.

1994-05-01

The human gene XPC (formerly designated XPCC), which corrects the repair deficiency of xeroderma pigmentosum (XP) group C cells, was mapped to 3p25. A cDNA probe for Southern blot hybridization and diagnostic PCR analyses of hybrid clone panels informative for human chromosomes in general and portions of chromosome 3 in particular produced the initial results. Fluorescence in situ hybridization utilizing both a yeast artificial chromosome DNA containing the gene and XPC cDNA as probes provided verification and specific regional assignment. A conflicting assignment of XPC to chromosome 5 is discussed in light of inadequacies in the exclusive use of microcell-mediatedmore » chromosome transfer for gene mapping. 12 refs., 3 figs.« less

Detection of Alicyclobacillus species in fruit juice using a random genomic DNA microarray chip.

PubMed

Jang, Jun Hyeong; Kim, Sun-Joong; Yoon, Bo Hyun; Ryu, Jee-Hoon; Gu, Man Bock; Chang, Hyo-Ihl

2011-06-01

This study describes a method using a DNA microarray chip to rapidly and simultaneously detect Alicyclobacillus species in orange juice based on the hybridization of genomic DNA with random probes. Three food spoilage bacteria were used in this study: Alicyclobacillus acidocaldarius, Alicyclobacillus acidoterrestris, and Alicyclobacillus cycloheptanicus. The three Alicyclobacillus species were adjusted to 2 × 10(3) CFU/ml and inoculated into pasteurized 100% pure orange juice. Cy5-dCTP labeling was used for reference signals, and Cy3-dCTP was labeled for target genomic DNA. The molar ratio of 1:1 of Cy3-dCTP and Cy5-dCTP was used. DNA microarray chips were fabricated using randomly fragmented DNA of Alicyclobacillus spp. and were hybridized with genomic DNA extracted from Bacillus spp. Genomic DNA extracted from Alicyclobacillus spp. showed a significantly higher hybridization rate compared with DNA of Bacillus spp., thereby distinguishing Alicyclobacillus spp. from Bacillus spp. The results showed that the microarray DNA chip containing randomly fragmented genomic DNA was specific and clearly identified specific food spoilage bacteria. This microarray system is a good tool for rapid and specific detection of thermophilic spoilage bacteria, mainly Alicyclobacillus spp., and is useful and applicable to the fruit juice industry.

Design of 240,000 orthogonal 25mer DNA barcode probes.

PubMed

Xu, Qikai; Schlabach, Michael R; Hannon, Gregory J; Elledge, Stephen J

2009-02-17

DNA barcodes linked to genetic features greatly facilitate screening these features in pooled formats using microarray hybridization, and new tools are needed to design large sets of barcodes to allow construction of large barcoded mammalian libraries such as shRNA libraries. Here we report a framework for designing large sets of orthogonal barcode probes. We demonstrate the utility of this framework by designing 240,000 barcode probes and testing their performance by hybridization. From the test hybridizations, we also discovered new probe design rules that significantly reduce cross-hybridization after their introduction into the framework of the algorithm. These rules should improve the performance of DNA microarray probe designs for many applications.

Design of 240,000 orthogonal 25mer DNA barcode probes

PubMed Central

Xu, Qikai; Schlabach, Michael R.; Hannon, Gregory J.; Elledge, Stephen J.

2009-01-01

DNA barcodes linked to genetic features greatly facilitate screening these features in pooled formats using microarray hybridization, and new tools are needed to design large sets of barcodes to allow construction of large barcoded mammalian libraries such as shRNA libraries. Here we report a framework for designing large sets of orthogonal barcode probes. We demonstrate the utility of this framework by designing 240,000 barcode probes and testing their performance by hybridization. From the test hybridizations, we also discovered new probe design rules that significantly reduce cross-hybridization after their introduction into the framework of the algorithm. These rules should improve the performance of DNA microarray probe designs for many applications. PMID:19171886

Human brain factor 1, a new member of the fork head gene family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murphy, D.B.; Wiese, S.; Burfeind, P.

1994-06-01

Analysis of cDNA clones that cross-hybridized with the fork head domain of the rat HNF-3 gene family revealed 10 cDNAs from human fetal brain and human testis cDNA libraries containing this highly conserved DNA-binding domain. Three of these cDNAs (HFK1, HFK2, and HFK3) were further analyzed. The cDNA HFK1 has a length of 2557 nucleotides and shows strong homology at the nucleotide level (91.2%) to brain factor 1 (BF-1) from rat. The HFK1 cDNA codes for a putative 476 amino acid protein. The homology to BF-1 from rat in the coding region at the amino acid level is 87.5%. Themore » fork head homologous region includes 111 amino acids starting at amino acid 160 and has a 97.5% homology to BF-1. Southern hybridization revealed that HFK1 is highly conserved among mammalian species and possibly birds. Northern analysis with total RNA from human tissues and poly(A)-rich RNA from mouse revealed a 3.2-kb transcript that is present in human and mouse fetal brain and in adult mouse brain. In situ hybridization with sections of mouse embryo and human fetal brain reveals that HFK1 expression is restricted to the neuronal cells in the telencepthalon, with strong expression being observed in the developing dentate gyrus and hippocampus. HFK1 was chromosomally localized by in situ hybridization to 14q12. The cDNA clones HFK2 and HFK3 were analyzed by restriction analysis and sequencing. HFK2 and HFK3 were found to be closely related but different from HFK1. Therefore, it would appear that HFK1, HFK2, HFK3, and BF-1 form a new fork head related subfamily. 33 refs., 6 figs.« less

Characterization of transformation related genes in oral cancer cells.

PubMed

Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M

1998-04-16

A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.

Application of a cDNA microarray for profiling the gene expression of Echinococcus granulosus protoscoleces treated with albendazole and artemisinin.

PubMed

Lü, Guodong; Zhang, Wenbao; Wang, Jianhua; Xiao, Yunfeng; Zhao, Jun; Zhao, Jianqin; Sun, Yimin; Zhang, Chuanshan; Wang, Junhua; Lin, Renyong; Liu, Hui; Zhang, Fuchun; Wen, Hao

2014-12-01

Cystic echinoccocosis (CE) is a neglected zoonosis that is caused by the dog-tapeworm Echinococcus granulosus. The disease is endemic worldwide. There is an urgent need for searching effective drug for the treatment of the disease. In this study, we sequenced a cDNA library constructed using RNA isolated from oncospheres, protoscoleces, cyst membrane and adult worms of E. granulosus. A total of 9065 non-redundant or unique sequences were obtained and spotted on chips as uniEST probes to profile the gene expression in protoscoleces of E. granulosus treated with the anthelmintic drugs albendazole and artemisinin, respectively. The results showed that 7 genes were up-regulated and 38 genes were down-regulated in the protoscoleces treated with albendazole. Gene analysis showed that these genes are responsible for energy metabolism, cell cycle and assembly of cell structure. We also identified 100 genes up-regulated and 6 genes down-regulated in the protoscoleces treated with artemisinin. These genes play roles in the transduction of environmental signals, and metabolism. Albendazole appeared its drug efficacy in damaging cell structure, while artemisinin was observed to increase the formation of the heterochromatin in protoscolex cells. Our results highlight the utility of using cDNA microarray methods to detect gene expression profiles of E. granulosus and, in particular, to understand the pharmacologic mechanism of anti-echinococcosis drugs. Copyright © 2014 Elsevier B.V. All rights reserved.

BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE.

PubMed

Rao, Archana N; Grainger, David W

2014-04-01

Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA's persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools.

BIOPHYSICAL PROPERTIES OF NUCLEIC ACIDS AT SURFACES RELEVANT TO MICROARRAY PERFORMANCE

PubMed Central

Rao, Archana N.; Grainger, David W.

2014-01-01

Both clinical and analytical metrics produced by microarray-based assay technology have recognized problems in reproducibility, reliability and analytical sensitivity. These issues are often attributed to poor understanding and control of nucleic acid behaviors and properties at solid-liquid interfaces. Nucleic acid hybridization, central to DNA and RNA microarray formats, depends on the properties and behaviors of single strand (ss) nucleic acids (e.g., probe oligomeric DNA) bound to surfaces. ssDNA’s persistence length, radius of gyration, electrostatics, conformations on different surfaces and under various assay conditions, its chain flexibility and curvature, charging effects in ionic solutions, and fluorescent labeling all influence its physical chemistry and hybridization under assay conditions. Nucleic acid (e.g., both RNA and DNA) target interactions with immobilized ssDNA strands are highly impacted by these biophysical states. Furthermore, the kinetics, thermodynamics, and enthalpic and entropic contributions to DNA hybridization reflect global probe/target structures and interaction dynamics. Here we review several biophysical issues relevant to oligomeric nucleic acid molecular behaviors at surfaces and their influences on duplex formation that influence microarray assay performance. Correlation of biophysical aspects of single and double-stranded nucleic acids with their complexes in bulk solution is common. Such analysis at surfaces is not commonly reported, despite its importance to microarray assays. We seek to provide further insight into nucleic acid-surface challenges facing microarray diagnostic formats that have hindered their clinical adoption and compromise their research quality and value as genomics tools. PMID:24765522

Plant-pathogen interactions: what microarray tells about it?

PubMed

Lodha, T D; Basak, J

2012-01-01

Plant defense responses are mediated by elementary regulatory proteins that affect expression of thousands of genes. Over the last decade, microarray technology has played a key role in deciphering the underlying networks of gene regulation in plants that lead to a wide variety of defence responses. Microarray is an important tool to quantify and profile the expression of thousands of genes simultaneously, with two main aims: (1) gene discovery and (2) global expression profiling. Several microarray technologies are currently in use; most include a glass slide platform with spotted cDNA or oligonucleotides. Till date, microarray technology has been used in the identification of regulatory genes, end-point defence genes, to understand the signal transduction processes underlying disease resistance and its intimate links to other physiological pathways. Microarray technology can be used for in-depth, simultaneous profiling of host/pathogen genes as the disease progresses from infection to resistance/susceptibility at different developmental stages of the host, which can be done in different environments, for clearer understanding of the processes involved. A thorough knowledge of plant disease resistance using successful combination of microarray and other high throughput techniques, as well as biochemical, genetic, and cell biological experiments is needed for practical application to secure and stabilize yield of many crop plants. This review starts with a brief introduction to microarray technology, followed by the basics of plant-pathogen interaction, the use of DNA microarrays over the last decade to unravel the mysteries of plant-pathogen interaction, and ends with the future prospects of this technology.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

Comparative transcriptional profiling of human Merkel cells and Merkel cell carcinoma.

PubMed

Mouchet, Nicolas; Coquart, Nolwenn; Lebonvallet, Nicolas; Le Gall-Ianotto, Christelle; Mogha, Ariane; Fautrel, Alain; Boulais, Nicholas; Dréno, Brigitte; Martin, Ludovic; Hu, Weiguo; Galibert, Marie-Dominique; Misery, Laurent

2014-12-01

Merkel cell carcinoma is believed to be derived from Merkel cells after infection by Merkel cell polyomavirus (MCPyV) and other poorly understood events. Transcriptional profiling using cDNA microarrays was performed on cells from MCPy-negative and MCPy-positive Merkel cell carcinomas and isolated normal Merkel cells. This microarray revealed numerous significantly upregulated genes and some downregulated genes. The extensive list of genes that were identified in these experiments provides a large body of potentially valuable information of Merkel cell carcinoma carcinogenesis and could represent a source of potential targets for cancer therapy. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

PubMed Central

Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

2005-01-01

AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

Hematopoietic Lineage Transcriptome Stability and Representation in PAXgene™ Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

PubMed Central

Kennedy, Laura; Vass, J. Keith; Haggart, D. Ross; Moore, Steve; Burczynski, Michael E.; Crowther, Dan; Miele, Gino

2008-01-01

Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgene™ RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2™ enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgene™ blood samples also advocate a short, fixed room temperature storage time for all PAXgene™ blood samples collected for the purposes of global transcriptional profiling in clinical studies. PMID:19578521

Identification of Differentially Expressed IGFBP5-Related Genes in Breast Cancer Tumor Tissues Using cDNA Microarray Experiments.

PubMed

Akkiprik, Mustafa; Peker, İrem; Özmen, Tolga; Amuran, Gökçe Güllü; Güllüoğlu, Bahadır M; Kaya, Handan; Özer, Ayşe

2015-11-10

IGFBP5 is an important regulatory protein in breast cancer progression. We tried to identify differentially expressed genes (DEGs) between breast tumor tissues with IGFBP5 overexpression and their adjacent normal tissues. In this study, thirty-eight breast cancer and adjacent normal breast tissue samples were used to determine IGFBP5 expression by qPCR. cDNA microarrays were applied to the highest IGFBP5 overexpressed tumor samples compared to their adjacent normal breast tissue. Microarray analysis revealed that a total of 186 genes were differentially expressed in breast cancer compared with normal breast tissues. Of the 186 genes, 169 genes were downregulated and 17 genes were upregulated in the tumor samples. KEGG pathway analyses showed that protein digestion and absorption, focal adhesion, salivary secretion, drug metabolism-cytochrome P450, and phenylalanine metabolism pathways are involved. Among these DEGs, the prominent top two genes (MMP11 and COL1A1) which potentially correlated with IGFBP5 were selected for validation using real time RT-qPCR. Only COL1A1 expression showed a consistent upregulation with IGFBP5 expression and COL1A1 and MMP11 were significantly positively correlated. We concluded that the discovery of coordinately expressed genes related with IGFBP5 might contribute to understanding of the molecular mechanism of the function of IGFBP5 in breast cancer. Further functional studies on DEGs and association with IGFBP5 may identify novel biomarkers for clinical applications in breast cancer.

Single Cell Transcriptomics of Hypothalamic Warm Sensitive Neurons that Control Core Body Temperature and Fever Response

PubMed Central

Eberwine, James; Bartfai, Tamas

2011-01-01

We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451

Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges

PubMed Central

Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht

2008-01-01

Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387

A low density microarray method for the identification of human papillomavirus type 18 variants.

PubMed

Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C

2013-09-26

We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings.

A Low Density Microarray Method for the Identification of Human Papillomavirus Type 18 Variants

PubMed Central

Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B.; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C.

2013-01-01

We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings. PMID:24077317

Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

PubMed

Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

2014-09-01

Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

Extremely High Peak Power Pulsed RF and UWB EMR Effects on Genomic Transcription - Microarray Assessment

DTIC Science & Technology

2008-06-26

Homo sapiens decorin variant C mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA...mRNA, complete cds. 2.117 PKNOX2 HUM408A08B Human fetal brain (TFujiwara) Homo sapiens cDNA clone GEN -408A08 5’, mRNA sequence. 2.076 SEC23B...RAS oncogene family ; RAB33B, member RAS oncogene family 205300_s_at 0.37 U1SNRNPBP U11/U12 snRNP 35K 220728_at 0.349 218689_at 0.342 FANCF Fanconi

LS-CAP: an algorithm for identifying cytogenetic aberrations in hepatocellular carcinoma using microarray data.

PubMed

He, Xianmin; Wei, Qing; Sun, Meiqian; Fu, Xuping; Fan, Sichang; Li, Yao

2006-05-01

Biological techniques such as Array-Comparative genomic hybridization (CGH), fluorescent in situ hybridization (FISH) and affymetrix single nucleotide pleomorphism (SNP) array have been used to detect cytogenetic aberrations. However, on genomic scale, these techniques are labor intensive and time consuming. Comparative genomic microarray analysis (CGMA) has been used to identify cytogenetic changes in hepatocellular carcinoma (HCC) using gene expression microarray data. However, CGMA algorithm can not give precise localization of aberrations, fails to identify small cytogenetic changes, and exhibits false negatives and positives. Locally un-weighted smoothing cytogenetic aberrations prediction (LS-CAP) based on local smoothing and binomial distribution can be expected to address these problems. LS-CAP algorithm was built and used on HCC microarray profiles. Eighteen cytogenetic abnormalities were identified, among them 5 were reported previously, and 12 were proven by CGH studies. LS-CAP effectively reduced the false negatives and positives, and precisely located small fragments with cytogenetic aberrations.

Parallel characterization of anaerobic toluene- and ethylbenzene-degrading microbial consortia by PCR-denaturing gradient gel electrophoresis, RNA-DNA membrane hybridization, and DNA microarray technology

NASA Technical Reports Server (NTRS)

Koizumi, Yoshikazu; Kelly, John J.; Nakagawa, Tatsunori; Urakawa, Hidetoshi; El-Fantroussi, Said; Al-Muzaini, Saleh; Fukui, Manabu; Urushigawa, Yoshikuni; Stahl, David A.

2002-01-01

A mesophilic toluene-degrading consortium (TDC) and an ethylbenzene-degrading consortium (EDC) were established under sulfate-reducing conditions. These consortia were first characterized by denaturing gradient gel electrophoresis (DGGE) fingerprinting of PCR-amplified 16S rRNA gene fragments, followed by sequencing. The sequences of the major bands (T-1 and E-2) belonging to TDC and EDC, respectively, were affiliated with the family Desulfobacteriaceae. Another major band from EDC (E-1) was related to an uncultured non-sulfate-reducing soil bacterium. Oligonucleotide probes specific for the 16S rRNAs of target organisms corresponding to T-1, E-1, and E-2 were designed, and hybridization conditions were optimized for two analytical formats, membrane and DNA microarray hybridization. Both formats were used to characterize the TDC and EDC, and the results of both were consistent with DGGE analysis. In order to assess the utility of the microarray format for analysis of environmental samples, oil-contaminated sediments from the coast of Kuwait were analyzed. The DNA microarray successfully detected bacterial nucleic acids from these samples, but probes targeting specific groups of sulfate-reducing bacteria did not give positive signals. The results of this study demonstrate the limitations and the potential utility of DNA microarrays for microbial community analysis.

Parallel Characterization of Anaerobic Toluene- and Ethylbenzene-Degrading Microbial Consortia by PCR-Denaturing Gradient Gel Electrophoresis, RNA-DNA Membrane Hybridization, and DNA Microarray Technology

PubMed Central

Koizumi, Yoshikazu; Kelly, John J.; Nakagawa, Tatsunori; Urakawa, Hidetoshi; El-Fantroussi, Saïd; Al-Muzaini, Saleh; Fukui, Manabu; Urushigawa, Yoshikuni; Stahl, David A.

2002-01-01

A mesophilic toluene-degrading consortium (TDC) and an ethylbenzene-degrading consortium (EDC) were established under sulfate-reducing conditions. These consortia were first characterized by denaturing gradient gel electrophoresis (DGGE) fingerprinting of PCR-amplified 16S rRNA gene fragments, followed by sequencing. The sequences of the major bands (T-1 and E-2) belonging to TDC and EDC, respectively, were affiliated with the family Desulfobacteriaceae. Another major band from EDC (E-1) was related to an uncultured non-sulfate-reducing soil bacterium. Oligonucleotide probes specific for the 16S rRNAs of target organisms corresponding to T-1, E-1, and E-2 were designed, and hybridization conditions were optimized for two analytical formats, membrane and DNA microarray hybridization. Both formats were used to characterize the TDC and EDC, and the results of both were consistent with DGGE analysis. In order to assess the utility of the microarray format for analysis of environmental samples, oil-contaminated sediments from the coast of Kuwait were analyzed. The DNA microarray successfully detected bacterial nucleic acids from these samples, but probes targeting specific groups of sulfate-reducing bacteria did not give positive signals. The results of this study demonstrate the limitations and the potential utility of DNA microarrays for microbial community analysis. PMID:12088997

Microarray Analysis of Tomato Plants Exposed to the Nonviruliferous or Viruliferous Whitefly Vector Harboring Pepper golden mosaic virus

PubMed Central

Musser, Richard O.; Hum-Musser, Sue M.; Gallucci, Matthew; DesRochers, Brittany; Brown, Judith K.

2014-01-01

Abstract Plants are routinely exposed to biotic and abiotic stresses to which they have evolved by synthesizing constitutive and induced defense compounds. Induced defense compounds are usually made, initially, at low levels; however, following further stimulation by specific kinds of biotic and abiotic stresses, they can be synthesized in relatively large amounts to abate the particular stress. cDNA microarray hybridization was used to identify an array of genes that were differentially expressed in tomato plants 15 d after they were exposed to feeding by nonviruliferous whiteflies or by viruliferous whiteflies carrying Pepper golden mosaic virus (PepGMV) ( Begomovirus, Geminiviridae ). Tomato plants inoculated by viruliferous whiteflies developed symptoms characteristic of PepGMV, whereas plants exposed to nonviruliferous whitefly feeding or nonwounded (negative) control plants exhibited no disease symptoms. The microarray analysis yielded over 290 spotted probes, with significantly altered expression of 161 putative annotated gene targets, and 129 spotted probes of unknown identities. The majority of the differentially regulated “known” genes were associated with the plants exposed to viruliferous compared with nonviruliferous whitefly feeding. Overall, significant differences in gene expression were represented by major physiological functions including defense-, pathogen-, photosynthesis-, and signaling-related responses and were similar to genes identified for other insect–plant systems. Viruliferous whitefly-stimulated gene expression was validated by real-time quantitative polymerase chain reaction of selected, representative candidate genes (messenger RNA): arginase, dehydrin, pathogenesis-related proteins 1 and -4, polyphenol oxidase, and several protease inhibitors. This is the first comparative profiling of the expression of tomato plants portraying different responses to biotic stress induced by viruliferous whitefly feeding (with resultant virus infection) compared with whitefly feeding only and negative control nonwounded plants exposed to neither. These results may be applicable to many other plant–insect–pathogen system interactions. PMID:25525099

Identification of genes related to high royal jelly production in the honey bee (Apis mellifera) using microarray analysis

PubMed Central

Nie, Hongyi; Liu, Xiaoyan; Pan, Jiao; Li, Wenfeng; Li, Zhiguo; Zhang, Shaowu; Chen, Shenglu; Miao, Xiaoqing; Zheng, Nenggan; Su, Songkun

2017-01-01

Abstract China is the largest royal jelly producer and exporter in the world, and high royal jelly-yielding strains have been bred in the country for approximately three decades. However, information on the molecular mechanism underlying high royal jelly production is scarce. Here, a cDNA microarray was used to screen and identify differentially expressed genes (DEGs) to obtain an overview on the changes in gene expression levels between high and low royal jelly producing bees. We developed a honey bee gene chip that covered 11,689 genes, and this chip was hybridised with cDNA generated from RNA isolated from heads of nursing bees. A total of 369 DEGs were identified between high and low royal jelly producing bees. Amongst these DEGs, 201 (54.47%) genes were up-regulated, whereas 168 (45.53%) were down-regulated in high royal jelly-yielding bees. Gene ontology (GO) analyses showed that they are mainly involved in four key biological processes, and pathway analyses revealed that they belong to a total of 46 biological pathways. These results provide a genetic basis for further studies on the molecular mechanisms involved in high royal jelly production. PMID:28981563

Noninvasive electromagnetic fields on keratinocyte growth and migration.

PubMed

Huo, Ran; Ma, Qianli; Wu, James J; Chin-Nuke, Kayla; Jing, Yuqi; Chen, Juan; Miyar, Maria E; Davis, Stephen C; Li, Jie

2010-08-01

Although evidence has shown that very small electrical currents produce a beneficial therapeutic result for wounds, noninvasive electromagnetic field (EMF) therapy has consisted mostly of anecdotal clinical reports, with very few well-controlled laboratory mechanistic studies. In this study, we evaluate the effects and potential mechanisms of a noninvasive EMF device on skin wound repair. The effects of noninvasive EMF on keratinocytes and fibroblasts were assessed via proliferation and incisional wound model migration assays. cDNA microarray and RT-PCR were utilized to assess genetic expression changes in keratinocytes after noninvasive EMF treatment. In vitro analyses with human skin keratinocyte cultures demonstrated that noninvasive EMFs have a strong effect on accelerating keratinocyte migration and a relatively weaker effect on promoting keratinocyte proliferation. The positive effects of noninvasive EMFs on cell migration and proliferation seem keratinocyte-specific without such effects seen on dermal fibroblasts. cDNA microarray and RT-PCR performed revealed increased expression of CRK7 and HOXC8 genes in treated keratinocytes. This study suggests that a noninvasive EMF accelerates wound re-epithelialization through a mechanism of promoting keratinocyte migration and proliferation, possibly due to upregulation of CRK7 and HOXC8 genes. Copyright 2010 Elsevier Inc. All rights reserved.

Identification of genes related to high royal jelly production in the honey bee (Apis mellifera) using microarray analysis.

PubMed

Nie, Hongyi; Liu, Xiaoyan; Pan, Jiao; Li, Wenfeng; Li, Zhiguo; Zhang, Shaowu; Chen, Shenglu; Miao, Xiaoqing; Zheng, Nenggan; Su, Songkun

2017-01-01

China is the largest royal jelly producer and exporter in the world, and high royal jelly-yielding strains have been bred in the country for approximately three decades. However, information on the molecular mechanism underlying high royal jelly production is scarce. Here, a cDNA microarray was used to screen and identify differentially expressed genes (DEGs) to obtain an overview on the changes in gene expression levels between high and low royal jelly producing bees. We developed a honey bee gene chip that covered 11,689 genes, and this chip was hybridised with cDNA generated from RNA isolated from heads of nursing bees. A total of 369 DEGs were identified between high and low royal jelly producing bees. Amongst these DEGs, 201 (54.47%) genes were up-regulated, whereas 168 (45.53%) were down-regulated in high royal jelly-yielding bees. Gene ontology (GO) analyses showed that they are mainly involved in four key biological processes, and pathway analyses revealed that they belong to a total of 46 biological pathways. These results provide a genetic basis for further studies on the molecular mechanisms involved in high royal jelly production.

Soybean defense responses to the soybean aphid.

PubMed

Li, Yan; Zou, Jijun; Li, Min; Bilgin, Damla D; Vodkin, Lila O; Hartman, Glen L; Clough, Steven J

2008-01-01

Transcript profiles in aphid (Aphis glycines)-resistant (cv. Dowling) and -susceptible (cv. Williams 82) soybean (Glycine max) cultivars using soybean cDNA microarrays were investigated. Large-scale soybean cDNA microarrays representing approx. 18 000 genes or c. 30% of the soybean genome were compared at 6 and 12 h post-application of aphids. In a separate experiment utilizing clip cages, expression of three defense-related genes were examined at 6, 12, 24, 48, and 72 h in both cultivars by quantitative real-time PCR. One hundred and forty genes showed specific responses for resistance; these included genes related to cell wall, defense, DNA/RNA, secondary metabolism, signaling and other processes. When an extended time period of sampling was investigated, earlier and greater induction of three defense-related genes was observed in the resistant cultivar; however, the induction declined after 24 or 48 h in the resistant cultivar but continued to increase in the susceptible cultivar after 24 h. Aphid-challenged resistant plants showed rapid differential gene expression patterns similar to the incompatible response induced by avirulent Pseudomonas syringae. Five genes were identified as differentially expressed between the two genotypes in the absence of aphids.

Detection of clonal evolution in hematopoietic malignancies by combining comparative genomic hybridization and single nucleotide polymorphism arrays.

PubMed

Hartmann, Luise; Stephenson, Christine F; Verkamp, Stephanie R; Johnson, Krystal R; Burnworth, Bettina; Hammock, Kelle; Brodersen, Lisa Eidenschink; de Baca, Monica E; Wells, Denise A; Loken, Michael R; Zehentner, Barbara K

2014-12-01

Array comparative genomic hybridization (aCGH) has become a powerful tool for analyzing hematopoietic neoplasms and identifying genome-wide copy number changes in a single assay. aCGH also has superior resolution compared with fluorescence in situ hybridization (FISH) or conventional cytogenetics. Integration of single nucleotide polymorphism (SNP) probes with microarray analysis allows additional identification of acquired uniparental disomy, a copy neutral aberration with known potential to contribute to tumor pathogenesis. However, a limitation of microarray analysis has been the inability to detect clonal heterogeneity in a sample. This study comprised 16 samples (acute myeloid leukemia, myelodysplastic syndrome, chronic lymphocytic leukemia, plasma cell neoplasm) with complex cytogenetic features and evidence of clonal evolution. We used an integrated manual peak reassignment approach combining analysis of aCGH and SNP microarray data for characterization of subclonal abnormalities. We compared array findings with results obtained from conventional cytogenetic and FISH studies. Clonal heterogeneity was detected in 13 of 16 samples by microarray on the basis of log2 values. Use of the manual peak reassignment analysis approach improved resolution of the sample's clonal composition and genetic heterogeneity in 10 of 13 (77%) patients. Moreover, in 3 patients, clonal disease progression was revealed by array analysis that was not evident by cytogenetic or FISH studies. Genetic abnormalities originating from separate clonal subpopulations can be identified and further characterized by combining aCGH and SNP hybridization results from 1 integrated microarray chip by use of the manual peak reassignment technique. Its clinical utility in comparison to conventional cytogenetic or FISH studies is demonstrated. © 2014 American Association for Clinical Chemistry.

MicroArray Facility: a laboratory information management system with extended support for Nylon based technologies.

PubMed

Honoré, Paul; Granjeaud, Samuel; Tagett, Rebecca; Deraco, Stéphane; Beaudoing, Emmanuel; Rougemont, Jacques; Debono, Stéphane; Hingamp, Pascal

2006-09-20

High throughput gene expression profiling (GEP) is becoming a routine technique in life science laboratories. With experimental designs that repeatedly span thousands of genes and hundreds of samples, relying on a dedicated database infrastructure is no longer an option.GEP technology is a fast moving target, with new approaches constantly broadening the field diversity. This technology heterogeneity, compounded by the informatics complexity of GEP databases, means that software developments have so far focused on mainstream techniques, leaving less typical yet established techniques such as Nylon microarrays at best partially supported. MAF (MicroArray Facility) is the laboratory database system we have developed for managing the design, production and hybridization of spotted microarrays. Although it can support the widely used glass microarrays and oligo-chips, MAF was designed with the specific idiosyncrasies of Nylon based microarrays in mind. Notably single channel radioactive probes, microarray stripping and reuse, vector control hybridizations and spike-in controls are all natively supported by the software suite. MicroArray Facility is MIAME supportive and dynamically provides feedback on missing annotations to help users estimate effective MIAME compliance. Genomic data such as clone identifiers and gene symbols are also directly annotated by MAF software using standard public resources. The MAGE-ML data format is implemented for full data export. Journalized database operations (audit tracking), data anonymization, material traceability and user/project level confidentiality policies are also managed by MAF. MicroArray Facility is a complete data management system for microarray producers and end-users. Particular care has been devoted to adequately model Nylon based microarrays. The MAF system, developed and implemented in both private and academic environments, has proved a robust solution for shared facilities and industry service providers alike.

MicroArray Facility: a laboratory information management system with extended support for Nylon based technologies

PubMed Central

Honoré, Paul; Granjeaud, Samuel; Tagett, Rebecca; Deraco, Stéphane; Beaudoing, Emmanuel; Rougemont, Jacques; Debono, Stéphane; Hingamp, Pascal

2006-01-01

Background High throughput gene expression profiling (GEP) is becoming a routine technique in life science laboratories. With experimental designs that repeatedly span thousands of genes and hundreds of samples, relying on a dedicated database infrastructure is no longer an option. GEP technology is a fast moving target, with new approaches constantly broadening the field diversity. This technology heterogeneity, compounded by the informatics complexity of GEP databases, means that software developments have so far focused on mainstream techniques, leaving less typical yet established techniques such as Nylon microarrays at best partially supported. Results MAF (MicroArray Facility) is the laboratory database system we have developed for managing the design, production and hybridization of spotted microarrays. Although it can support the widely used glass microarrays and oligo-chips, MAF was designed with the specific idiosyncrasies of Nylon based microarrays in mind. Notably single channel radioactive probes, microarray stripping and reuse, vector control hybridizations and spike-in controls are all natively supported by the software suite. MicroArray Facility is MIAME supportive and dynamically provides feedback on missing annotations to help users estimate effective MIAME compliance. Genomic data such as clone identifiers and gene symbols are also directly annotated by MAF software using standard public resources. The MAGE-ML data format is implemented for full data export. Journalized database operations (audit tracking), data anonymization, material traceability and user/project level confidentiality policies are also managed by MAF. Conclusion MicroArray Facility is a complete data management system for microarray producers and end-users. Particular care has been devoted to adequately model Nylon based microarrays. The MAF system, developed and implemented in both private and academic environments, has proved a robust solution for shared facilities and industry service providers alike. PMID:16987406

Emerging Use of Gene Expression Microarrays in Plant Physiology

DOE PAGES

Wullschleger, Stan D.; Difazio, Stephen P.

2003-01-01

Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology weremore » selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.« less

Method for analyzing microbial communities

DOEpatents

Zhou, Jizhong [Oak Ridge, TN; Wu, Liyou [Oak Ridge, TN

2010-07-20

The present invention provides a method for quantitatively analyzing microbial genes, species, or strains in a sample that contains at least two species or strains of microorganisms. The method involves using an isothermal DNA polymerase to randomly and representatively amplify genomic DNA of the microorganisms in the sample, hybridizing the resultant polynucleotide amplification product to a polynucleotide microarray that can differentiate different genes, species, or strains of microorganisms of interest, and measuring hybridization signals on the microarray to quantify the genes, species, or strains of interest.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

Expressed sequence tag analysis of adult human lens for the NEIBank Project: over 2000 non-redundant transcripts, novel genes and splice variants.

PubMed

Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

2002-06-15

To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.

Gene expression profiles in rainbow trout, Onchorynchus mykiss, exposed to a simple chemical mixture.

PubMed

Hook, Sharon E; Skillman, Ann D; Gopalan, Banu; Small, Jack A; Schultz, Irvin R

2008-03-01

Among proposed uses for microarrays in environmental toxiciology is the identification of key contributors to toxicity within a mixture. However, it remains uncertain whether the transcriptomic profiles resulting from exposure to a mixture have patterns of altered gene expression that contain identifiable contributions from each toxicant component. We exposed isogenic rainbow trout Onchorynchus mykiss, to sublethal levels of ethynylestradiol, 2,2,4,4-tetrabromodiphenyl ether, and chromium VI or to a mixture of all three toxicants Fluorescently labeled complementary DNA (cDNA) were generated and hybridized against a commercially available Salmonid array spotted with 16,000 cDNAs. Data were analyzed using analysis of variance (p<0.05) with a Benjamani-Hochberg multiple test correction (Genespring [Agilent] software package) to identify up and downregulated genes. Gene clustering patterns that can be used as "expression signatures" were determined using hierarchical cluster analysis. The gene ontology terms associated with significantly altered genes were also used to identify functional groups that were associated with toxicant exposure. Cross-ontological analytics approach was used to assign functional annotations to genes with "unknown" function. Our analysis indicates that transcriptomic profiles resulting from the mixture exposure resemble those of the individual contaminant exposures, but are not a simple additive list. However, patterns of altered genes representative of each component of the mixture are clearly discernible, and the functional classes of genes altered represent the individual components of the mixture. These findings indicate that the use of microarrays to identify transcriptomic profiles may aid in the identification of key stressors within a chemical mixture, ultimately improving environmental assessment.

Sentaurus® based modeling and simulation for GFET's characteristic for ssDNA immobilization and hybridization

NASA Astrophysics Data System (ADS)

Yunfang, Jia; Cheng, Ju

2016-01-01

The graphene field effect transistor (GFET) has been widely studied and developed as sensors and functional devices. The first report about GFET sensing simulation on the device level is proposed. The GFET's characteristics, its responding for single strand DNA (ssDNA) and hybridization with the complimentary DNA (cDNA) are simulated based on Sentaurus, a popular CAD tool for electronic devices. The agreement between the simulated blank GFET feature and the reported experimental data suggests the feasibility of the presented simulation method. Then the simulations of ssDNA immobilization on GFET and hybridization with its cDNA are performed, the results are discussed based on the electron transfer (ET) mechanism between DNA and graphene. Project supported by the National Natural Science Foundation of China (No. 61371028) and the Tianjin Natural Science Foundation (No. 12JCZDJC22400).

A multiplex reverse transcription PCR and automated electronic microarray assay for detection and differentiation of seven viruses affecting swine.

PubMed

Erickson, A; Fisher, M; Furukawa-Stoffer, T; Ambagala, A; Hodko, D; Pasick, J; King, D P; Nfon, C; Ortega Polo, R; Lung, O

2018-04-01

Microarray technology can be useful for pathogen detection as it allows simultaneous interrogation of the presence or absence of a large number of genetic signatures. However, most microarray assays are labour-intensive and time-consuming to perform. This study describes the development and initial evaluation of a multiplex reverse transcription (RT)-PCR and novel accompanying automated electronic microarray assay for simultaneous detection and differentiation of seven important viruses that affect swine (foot-and-mouth disease virus [FMDV], swine vesicular disease virus [SVDV], vesicular exanthema of swine virus [VESV], African swine fever virus [ASFV], classical swine fever virus [CSFV], porcine respiratory and reproductive syndrome virus [PRRSV] and porcine circovirus type 2 [PCV2]). The novel electronic microarray assay utilizes a single, user-friendly instrument that integrates and automates capture probe printing, hybridization, washing and reporting on a disposable electronic microarray cartridge with 400 features. This assay accurately detected and identified a total of 68 isolates of the seven targeted virus species including 23 samples of FMDV, representing all seven serotypes, and 10 CSFV strains, representing all three genotypes. The assay successfully detected viruses in clinical samples from the field, experimentally infected animals (as early as 1 day post-infection (dpi) for FMDV and SVDV, 4 dpi for ASFV, 5 dpi for CSFV), as well as in biological material that were spiked with target viruses. The limit of detection was 10 copies/μl for ASFV, PCV2 and PRRSV, 100 copies/μl for SVDV, CSFV, VESV and 1,000 copies/μl for FMDV. The electronic microarray component had reduced analytical sensitivity for several of the target viruses when compared with the multiplex RT-PCR. The integration of capture probe printing allows custom onsite array printing as needed, while electrophoretically driven hybridization generates results faster than conventional microarrays that rely on passive hybridization. With further refinement, this novel, rapid, highly automated microarray technology has potential applications in multipathogen surveillance of livestock diseases. © 2017 Her Majesty the Queen in Right of Canada • Transboundary and Emerging Diseases.

On hydrophilicity improvement of the porous anodic alumina film by hybrid nano/micro structuring

NASA Astrophysics Data System (ADS)

Wang, Weichao; Zhao, Wei; Wang, Kaige; Wang, Lei; Wang, Xuewen; Wang, Shuang; Zhang, Chen; Bai, Jintao

2017-09-01

In both, laboratory and industry, tremendous attention is paid to discover an effective technique to produce uniform, controllable and (super) hydrophilic surfaces over large areas that are useful in a wide range of applications. In this investigation, by combing porous anodic alumina (PAA) film with nano-structures and microarray of aluminum, the hydrophilicity of hybrid nano-micro structure has been significantly improved. It is found some factors can affect the hydrophilicity of film, such as the size and aspect ratio of microarray, the thickness of nano-PAA film etc. Comparing with pure nano-PAA films and microarray, the hybrid nano-micro structure can provide uniform surface with significantly better hydrophilicity. The improvement can be up to 84%. Also, this technique exhibits good stability and repeatability for industrial production. By optimizing the thickness of nano-PAA film and aspect ratio of micro-structures, super-hydrophilicity can be reached. This study has obvious prospect in the fields of chemical industry, biomedical engineering and lab-on-a-chip applications.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feyereisen-Koener, J.M.

Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.

Single cell transcriptomics of hypothalamic warm sensitive neurons that control core body temperature and fever response Signaling asymmetry and an extension of chemical neuroanatomy.

PubMed

Eberwine, James; Bartfai, Tamas

2011-03-01

We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.

Profiling In Situ Microbial Community Structure with an Amplification Microarray

PubMed Central

Knickerbocker, Christopher; Bryant, Lexi; Golova, Julia; Wiles, Cory; Williams, Kenneth H.; Peacock, Aaron D.; Long, Philip E.

2013-01-01

The objectives of this study were to unify amplification, labeling, and microarray hybridization chemistries within a single, closed microfluidic chamber (an amplification microarray) and verify technology performance on a series of groundwater samples from an in situ field experiment designed to compare U(VI) mobility under conditions of various alkalinities (as HCO3−) during stimulated microbial activity accompanying acetate amendment. Analytical limits of detection were between 2 and 200 cell equivalents of purified DNA. Amplification microarray signatures were well correlated with 16S rRNA-targeted quantitative PCR results and hybridization microarray signatures. The succession of the microbial community was evident with and consistent between the two microarray platforms. Amplification microarray analysis of acetate-treated groundwater showed elevated levels of iron-reducing bacteria (Flexibacter, Geobacter, Rhodoferax, and Shewanella) relative to the average background profile, as expected. Identical molecular signatures were evident in the transect treated with acetate plus NaHCO3, but at much lower signal intensities and with a much more rapid decline (to nondetection). Azoarcus, Thaurea, and Methylobacterium were responsive in the acetate-only transect but not in the presence of bicarbonate. Observed differences in microbial community composition or response to bicarbonate amendment likely had an effect on measured rates of U reduction, with higher rates probable in the part of the field experiment that was amended with bicarbonate. The simplification in microarray-based work flow is a significant technological advance toward entirely closed-amplicon microarray-based tests and is generally extensible to any number of environmental monitoring applications. PMID:23160129

Elucidation of the effect of brain cortex tetrapeptide Cortagen on gene expression in mouse heart by microarray.

PubMed

Anisimov, Sergey V; Khavinson, Vladimir Kh; Anisimov, Vladimir N

2004-01-01

Aging is associated with significant alterations in gene expression in numerous organs and tissues. Anti-aging therapy with peptide bioregulators holds much promise for the correction of age-associated changes, making a screening for their molecular targets in tissues an important question of modern gerontology. The synthetic tetrapeptide Cortagen (Ala-Glu-Asp-Pro) was obtained by directed synthesis based on amino acid analysis of natural brain cortex peptide preparation Cortexin. In humans, Cortagen demonstrated a pronounced therapeutic effect upon the structural and functional posttraumatic recovery of peripheral nerve tissue. Importantly, other effects were also observed in cardiovascular and cerebrovascular parameters. Based on these latter observations, we hypothesized that acute course of Cortagen treatment, large-scale transcriptome analysis, and identification of transcripts with altered expression in heart would facilitate our understanding of the mechanisms responsible for this peptide biological effects. We therefore analyzed the expression of 15,247 transcripts in the heart of female 6-months CBA mice receiving injections of Cortagen for 5 consecutive days was studied by cDNA microarrays. Comparative analysis of cDNA microarray hybridisation with heart samples from control and experimental group revealed 234 clones (1,53% of the total number of clones) with significant changes of expression that matched 110 known genes belonging to various functional categories. Maximum up- and down-regulation was +5.42 and -2.86, respectively. Intercomparison of changes in cardiac expression profile induced by synthetic peptides (Cortagen, Vilon, Epitalon) and pineal peptide hormone melatonin revealed both common and specific effects of Cortagen upon gene expression in heart.

Gene Discovery in Bladder Cancer Progression using cDNA Microarrays

PubMed Central

Sanchez-Carbayo, Marta; Socci, Nicholas D.; Lozano, Juan Jose; Li, Wentian; Charytonowicz, Elizabeth; Belbin, Thomas J.; Prystowsky, Michael B.; Ortiz, Angel R.; Childs, Geoffrey; Cordon-Cardo, Carlos

2003-01-01

To identify gene expression changes along progression of bladder cancer, we compared the expression profiles of early-stage and advanced bladder tumors using cDNA microarrays containing 17,842 known genes and expressed sequence tags. The application of bootstrapping techniques to hierarchical clustering segregated early-stage and invasive transitional carcinomas into two main clusters. Multidimensional analysis confirmed these clusters and more importantly, it separated carcinoma in situ from papillary superficial lesions and subgroups within early-stage and invasive tumors displaying different overall survival. Additionally, it recognized early-stage tumors showing gene profiles similar to invasive disease. Different techniques including standard t-test, single-gene logistic regression, and support vector machine algorithms were applied to identify relevant genes involved in bladder cancer progression. Cytokeratin 20, neuropilin-2, p21, and p33ING1 were selected among the top ranked molecular targets differentially expressed and validated by immunohistochemistry using tissue microarrays (n = 173). Their expression patterns were significantly associated with pathological stage, tumor grade, and altered retinoblastoma (RB) expression. Moreover, p33ING1 expression levels were significantly associated with overall survival. Analysis of the annotation of the most significant genes revealed the relevance of critical genes and pathways during bladder cancer progression, including the overexpression of oncogenic genes such as DEK in superficial tumors or immune response genes such as Cd86 antigen in invasive disease. Gene profiling successfully classified bladder tumors based on their progression and clinical outcome. The present study has identified molecular biomarkers of potential clinical significance and critical molecular targets associated with bladder cancer progression. PMID:12875971

Prediction of response to preoperative chemoradiotherapy and establishment of individualized therapy in advanced rectal cancer.

PubMed

Nakao, Toshihiro; Iwata, Takashi; Hotchi, Masanori; Yoshikawa, Kozo; Higashijima, Jun; Nishi, Masaaki; Takasu, Chie; Eto, Shohei; Teraoku, Hiroki; Shimada, Mitsuo

2015-10-01

Preoperative chemoradiotherapy (CRT) has become the standard treatment for patients with locally advanced rectal cancer. However, no specific biomarker has been identified to predict a response to preoperative CRT. The aim of the present study was to assess the gene expression patterns of patients with advanced rectal cancer to predict their responses to preoperative CRT. Fifty-nine rectal cancer patients were subjected to preoperative CRT. Patients were randomly assigned to receive CRT with tegafur/gimeracil/oteracil (S-1 group, n=30) or tegafur-uracil (UFT group, n=29). Gene expression changes were studied with cDNA and miRNA microarray. The association between gene expression and response to CRT was evaluated. cDNA microarray showed that 184 genes were significantly differentially expressed between the responders and the non‑responders in the S-1 group. Comparatively, 193 genes were significantly differentially expressed in the responders in the UFT group. TBX18 upregulation was common to both groups whereas BTNL8, LOC375010, ADH1B, HRASLS2, LOC284232, GCNT3 and ALDH1A2 were significantly differentially lower in both groups when compared with the non-responders. Using miRNA microarray, we found that 7 and 16 genes were significantly differentially expressed between the responders and non-responders in the S-1 and UFT groups, respectively. miR-223 was significantly higher in the responders in the S-1 group and tended to be higher in the responders in the UFT group. The present study identified several genes likely to be useful for establishing individualized therapies for patients with rectal cancer.

Tips on hybridizing, washing, and scanning affymetrix microarrays.

PubMed

Ares, Manuel

2014-02-01

Starting in the late 1990s, Affymetrix, Inc. produced a commercial system for hybridizing, washing, and scanning microarrays that was designed to be easy to operate and reproducible. The system used arrays packaged in a plastic cassette or chamber in which the prefabricated array was mounted and could be filled with fluid through resealable membrane ports either by hand or by an automated "fluidics station" specially designed to handle the arrays. A special rotating hybridization oven and a specially designed scanner were also required. Primarily because of automation and standardization the Affymetrix system was and still remains popular. Here, we provide a skeleton protocol with the potential pitfalls identified. It is designed to augment the protocols provided by Affymetrix.

Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

PubMed Central

Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

1993-01-01

Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

Prostate Cancer Prevention Through Induction of Phase 2 Enzymes

DTIC Science & Technology

2001-04-01

enzymes. During our Phase I Award, we identified sulforaphane as the most potent inducer of carcinogen defenses in the prostate cell. We have...characterized global effects of sulforaphane in prostate cancer cell lines using cDNA microarray technology that allows large-scale determination of changes...of sulforaphane ) and decreased risk of prostate cancer. These findings argue strongly for a preventive intervention trial involving supplementation

Detection of pathogenic Vibrio spp. in shellfish by using multiplex PCR and DNA microarrays.

PubMed

Panicker, Gitika; Call, Douglas R; Krug, Melissa J; Bej, Asim K

2004-12-01

This study describes the development of a gene-specific DNA microarray coupled with multiplex PCR for the comprehensive detection of pathogenic vibrios that are natural inhabitants of warm coastal waters and shellfish. Multiplex PCR with vvh and viuB for Vibrio vulnificus, with ompU, toxR, tcpI, and hlyA for V. cholerae, and with tlh, tdh, trh, and open reading frame 8 for V. parahaemolyticus helped to ensure that total and pathogenic strains, including subtypes of the three Vibrio spp., could be detected and discriminated. For DNA microarrays, oligonucleotide probes for these targeted genes were deposited onto epoxysilane-derivatized, 12-well, Teflon-masked slides by using a MicroGrid II arrayer. Amplified PCR products were hybridized to arrays at 50 degrees C and detected by using tyramide signal amplification with Alexa Fluor 546 fluorescent dye. Slides were imaged by using an arrayWoRx scanner. The detection sensitivity for pure cultures without enrichment was 10(2) to 10(3) CFU/ml, and the specificity was 100%. However, 5 h of sample enrichment followed by DNA extraction with Instagene matrix and multiplex PCR with microarray hybridization resulted in the detection of 1 CFU in 1 g of oyster tissue homogenate. Thus, enrichment of the bacterial pathogens permitted higher sensitivity in compliance with the Interstate Shellfish Sanitation Conference guideline. Application of the DNA microarray methodology to natural oysters revealed the presence of V. vulnificus (100%) and V. parahaemolyticus (83%). However, V. cholerae was not detected in natural oysters. An assay involving a combination of multiplex PCR and DNA microarray hybridization would help to ensure rapid and accurate detection of pathogenic vibrios in shellfish, thereby improving the microbiological safety of shellfish for consumers.

Detection of Pathogenic Vibrio spp. in Shellfish by Using Multiplex PCR and DNA Microarrays

PubMed Central

Panicker, Gitika; Call, Douglas R.; Krug, Melissa J.; Bej, Asim K.

2004-01-01

This study describes the development of a gene-specific DNA microarray coupled with multiplex PCR for the comprehensive detection of pathogenic vibrios that are natural inhabitants of warm coastal waters and shellfish. Multiplex PCR with vvh and viuB for Vibrio vulnificus, with ompU, toxR, tcpI, and hlyA for V. cholerae, and with tlh, tdh, trh, and open reading frame 8 for V. parahaemolyticus helped to ensure that total and pathogenic strains, including subtypes of the three Vibrio spp., could be detected and discriminated. For DNA microarrays, oligonucleotide probes for these targeted genes were deposited onto epoxysilane-derivatized, 12-well, Teflon-masked slides by using a MicroGrid II arrayer. Amplified PCR products were hybridized to arrays at 50°C and detected by using tyramide signal amplification with Alexa Fluor 546 fluorescent dye. Slides were imaged by using an arrayWoRx scanner. The detection sensitivity for pure cultures without enrichment was 102 to 103 CFU/ml, and the specificity was 100%. However, 5 h of sample enrichment followed by DNA extraction with Instagene matrix and multiplex PCR with microarray hybridization resulted in the detection of 1 CFU in 1 g of oyster tissue homogenate. Thus, enrichment of the bacterial pathogens permitted higher sensitivity in compliance with the Interstate Shellfish Sanitation Conference guideline. Application of the DNA microarray methodology to natural oysters revealed the presence of V. vulnificus (100%) and V. parahaemolyticus (83%). However, V. cholerae was not detected in natural oysters. An assay involving a combination of multiplex PCR and DNA microarray hybridization would help to ensure rapid and accurate detection of pathogenic vibrios in shellfish, thereby improving the microbiological safety of shellfish for consumers. PMID:15574946

Optimized Probe Masking for Comparative Transcriptomics of Closely Related Species

PubMed Central

Poeschl, Yvonne; Delker, Carolin; Trenner, Jana; Ullrich, Kristian Karsten; Quint, Marcel; Grosse, Ivo

2013-01-01

Microarrays are commonly applied to study the transcriptome of specific species. However, many available microarrays are restricted to model organisms, and the design of custom microarrays for other species is often not feasible. Hence, transcriptomics approaches of non-model organisms as well as comparative transcriptomics studies among two or more species often make use of cost-intensive RNAseq studies or, alternatively, by hybridizing transcripts of a query species to a microarray of a closely related species. When analyzing these cross-species microarray expression data, differences in the transcriptome of the query species can cause problems, such as the following: (i) lower hybridization accuracy of probes due to mismatches or deletions, (ii) probes binding multiple transcripts of different genes, and (iii) probes binding transcripts of non-orthologous genes. So far, methods for (i) exist, but these neglect (ii) and (iii). Here, we propose an approach for comparative transcriptomics addressing problems (i) to (iii), which retains only transcript-specific probes binding transcripts of orthologous genes. We apply this approach to an Arabidopsis lyrata expression data set measured on a microarray designed for Arabidopsis thaliana, and compare it to two alternative approaches, a sequence-based approach and a genomic DNA hybridization-based approach. We investigate the number of retained probe sets, and we validate the resulting expression responses by qRT-PCR. We find that the proposed approach combines the benefit of sequence-based stringency and accuracy while allowing the expression analysis of much more genes than the alternative sequence-based approach. As an added benefit, the proposed approach requires probes to detect transcripts of orthologous genes only, which provides a superior base for biological interpretation of the measured expression responses. PMID:24260119

Gene amplification of the Hps locus in Glycine max

PubMed Central

Gijzen, Mark; Kuflu, Kuflom; Moy, Pat

2006-01-01

Background Hydrophobic protein from soybean (HPS) is an 8 kD cysteine-rich polypeptide that causes asthma in persons allergic to soybean dust. HPS is synthesized in the pod endocarp and deposited on the seed surface during development. Past evidence suggests that the protein may mediate the adherence or dehiscence of endocarp tissues during maturation and affect the lustre, or glossiness of the seed surface. Results A comparison of soybean germplasm by genomic DNA blot hybridization shows that the copy number and structure of the Hps locus is polymorphic among soybean cultivars and related species. Changes in Hps gene copy number were also detected by comparative genomic DNA hybridization using cDNA microarrays. The Hps copy number polymorphisms co-segregated with seed lustre phenotype and HPS surface protein in a cross between dull- and shiny-seeded soybeans. In soybean cultivar Harosoy 63, a minimum of 27 ± 5 copies of the Hps gene were estimated to be present in each haploid genome. The isolation and analysis of genomic clones indicates that the core Hps locus is comprised of a tandem array of reiterated units, with each 8.6 kb unit containing a single HPS open reading frame. Conclusion This study shows that polymorphisms at the Hps locus arise from changes in the gene copy number via gene amplification. We present a model whereby Hps copy number modulates protein expression levels and seed lustre, and we suggest that gene amplification may result from selection pressures imposed on crop plants. PMID:16536872

Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays.

PubMed

Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua

2016-07-15

Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

Development and Comparison of Two Assay Formats for Parallel Detection of Four Biothreat Pathogens by Using Suspension Microarrays

PubMed Central

Janse, Ingmar; Bok, Jasper M.; Hamidjaja, Raditijo A.; Hodemaekers, Hennie M.; van Rotterdam, Bart J.

2012-01-01

Microarrays provide a powerful analytical tool for the simultaneous detection of multiple pathogens. We developed diagnostic suspension microarrays for sensitive and specific detection of the biothreat pathogens Bacillus anthracis, Yersinia pestis, Francisella tularensis and Coxiella burnetii. Two assay chemistries for amplification and labeling were developed, one method using direct hybridization and the other using target-specific primer extension, combined with hybridization to universal arrays. Asymmetric PCR products for both assay chemistries were produced by using a multiplex asymmetric PCR amplifying 16 DNA signatures (16-plex). The performances of both assay chemistries were compared and their advantages and disadvantages are discussed. The developed microarrays detected multiple signature sequences and an internal control which made it possible to confidently identify the targeted pathogens and assess their virulence potential. The microarrays were highly specific and detected various strains of the targeted pathogens. Detection limits for the different pathogen signatures were similar or slightly higher compared to real-time PCR. Probit analysis showed that even a few genomic copies could be detected with 95% confidence. The microarrays detected DNA from different pathogens mixed in different ratios and from spiked or naturally contaminated samples. The assays that were developed have a potential for application in surveillance and diagnostics. PMID:22355407

Development and comparison of two assay formats for parallel detection of four biothreat pathogens by using suspension microarrays.

PubMed

Janse, Ingmar; Bok, Jasper M; Hamidjaja, Raditijo A; Hodemaekers, Hennie M; van Rotterdam, Bart J

2012-01-01

Microarrays provide a powerful analytical tool for the simultaneous detection of multiple pathogens. We developed diagnostic suspension microarrays for sensitive and specific detection of the biothreat pathogens Bacillus anthracis, Yersinia pestis, Francisella tularensis and Coxiella burnetii. Two assay chemistries for amplification and labeling were developed, one method using direct hybridization and the other using target-specific primer extension, combined with hybridization to universal arrays. Asymmetric PCR products for both assay chemistries were produced by using a multiplex asymmetric PCR amplifying 16 DNA signatures (16-plex). The performances of both assay chemistries were compared and their advantages and disadvantages are discussed. The developed microarrays detected multiple signature sequences and an internal control which made it possible to confidently identify the targeted pathogens and assess their virulence potential. The microarrays were highly specific and detected various strains of the targeted pathogens. Detection limits for the different pathogen signatures were similar or slightly higher compared to real-time PCR. Probit analysis showed that even a few genomic copies could be detected with 95% confidence. The microarrays detected DNA from different pathogens mixed in different ratios and from spiked or naturally contaminated samples. The assays that were developed have a potential for application in surveillance and diagnostics.

Searching for links in the biotic characteristics and abiotic parameters of nine different biogas plants

PubMed Central

Walter, Andreas; Knapp, Brigitte A.; Farbmacher, Theresa; Ebner, Christian; Insam, Heribert; Franke‐Whittle, Ingrid H.

2012-01-01

Summary To find links between the biotic characteristics and abiotic process parameters in anaerobic digestion systems, the microbial communities of nine full‐scale biogas plants in South Tyrol (Italy) and Vorarlberg (Austria) were investigated using molecular techniques and the physical and chemical properties were monitored. DNA from sludge samples was subjected to microarray hybridization with the ANAEROCHIP microarray and results indicated that sludge samples grouped into two main clusters, dominated either by Methanosarcina or by Methanosaeta, both aceticlastic methanogens. Hydrogenotrophic methanogens were hardly detected or if detected, gave low hybridization signals. Results obtained using denaturing gradient gel electrophoresis (DGGE) supported the findings of microarray hybridization. Real‐time PCR targeting Methanosarcina and Methanosaeta was conducted to provide quantitative data on the dominating methanogens. Correlation analysis to determine any links between the microbial communities found by microarray analysis, and the physicochemical parameters investigated was conducted. It was shown that the sludge samples dominated by the genus Methanosarcina were positively correlated with higher concentrations of acetate, whereas sludge samples dominated by representatives of the genus Methanosaeta had lower acetate concentrations. No other correlations between biotic characteristics and abiotic parameters were found. Methanogenic communities in each reactor were highly stable and resilient over the whole year. PMID:22950603

MicroGen: a MIAME compliant web system for microarray experiment information and workflow management.

PubMed

Burgarella, Sarah; Cattaneo, Dario; Pinciroli, Francesco; Masseroli, Marco

2005-12-01

Improvements of bio-nano-technologies and biomolecular techniques have led to increasing production of high-throughput experimental data. Spotted cDNA microarray is one of the most diffuse technologies, used in single research laboratories and in biotechnology service facilities. Although they are routinely performed, spotted microarray experiments are complex procedures entailing several experimental steps and actors with different technical skills and roles. During an experiment, involved actors, who can also be located in a distance, need to access and share specific experiment information according to their roles. Furthermore, complete information describing all experimental steps must be orderly collected to allow subsequent correct interpretation of experimental results. We developed MicroGen, a web system for managing information and workflow in the production pipeline of spotted microarray experiments. It is constituted of a core multi-database system able to store all data completely characterizing different spotted microarray experiments according to the Minimum Information About Microarray Experiments (MIAME) standard, and of an intuitive and user-friendly web interface able to support the collaborative work required among multidisciplinary actors and roles involved in spotted microarray experiment production. MicroGen supports six types of user roles: the researcher who designs and requests the experiment, the spotting operator, the hybridisation operator, the image processing operator, the system administrator, and the generic public user who can access the unrestricted part of the system to get information about MicroGen services. MicroGen represents a MIAME compliant information system that enables managing workflow and supporting collaborative work in spotted microarray experiment production.

The Utility of Chromosomal Microarray Analysis in Developmental and Behavioral Pediatrics

ERIC Educational Resources Information Center

Beaudet, Arthur L.

2013-01-01

Chromosomal microarray analysis (CMA) has emerged as a powerful new tool to identify genomic abnormalities associated with a wide range of developmental disabilities including congenital malformations, cognitive impairment, and behavioral abnormalities. CMA includes array comparative genomic hybridization (CGH) and single nucleotide polymorphism…

Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

PubMed

Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

2006-01-01

To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P < 0.01). Compared with a traditional fluorescence method, the colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

Sequencing ebola and marburg viruses genomes using microarrays.

PubMed

Hardick, Justin; Woelfel, Roman; Gardner, Warren; Ibrahim, Sofi

2016-08-01

Periodic outbreaks of Ebola and Marburg hemorrhagic fevers have occurred in Africa over the past four decades with case fatality rates reaching as high as 90%. The latest Ebola outbreak in West Africa in 2014 raised concerns that these infections can spread across continents and pose serious health risks. Early and accurate identification of the causative agents is necessary to contain outbreaks. In this report, we describe sequencing-by-hybridization (SBH) technique using high density microarrays to identify Ebola and Marburg viruses. The microarrays were designed to interrogate the sequences of entire viral genomes, and were evaluated with three species of Ebolavirus (Reston, Sudan, and Zaire), and three strains of Marburgvirus (Angola, Musoke, and Ravn). The results showed that the consensus sequences generated with four or more hybridizations had 92.1-98.9% accuracy over 95-99% of the genomes. Additionally, with SBH microarrays it was possible to distinguish between different strains of the Lake Victoria Marburgvirus. J. Med. Virol. 88:1303-1308, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Evaluation of chronic lymphocytic leukemia by oligonucleotide-based microarray analysis uncovers novel aberrations not detected by FISH or cytogenetic analysis

PubMed Central

2011-01-01

Background Cytogenetic evaluation is a key component of the diagnosis and prognosis of chronic lymphocytic leukemia (CLL). We performed oligonucleotide-based comparative genomic hybridization microarray analysis on 34 samples with CLL and known abnormal karyotypes previously determined by cytogenetics and/or fluorescence in situ hybridization (FISH). Results Using a custom designed microarray that targets >1800 genes involved in hematologic disease and other malignancies, we identified additional cryptic aberrations and novel findings in 59% of cases. These included gains and losses of genes associated with cell cycle regulation, apoptosis and susceptibility loci on 3p21.31, 5q35.2q35.3, 10q23.31q23.33, 11q22.3, and 22q11.23. Conclusions Our results show that microarray analysis will detect known aberrations, including microscopic and cryptic alterations. In addition, novel genomic changes will be uncovered that may become important prognostic predictors or treatment targets for CLL in the future. PMID:22087757

A universal reference sample derived from clone vector for improved detection of differential gene expression

PubMed Central

Khan, Rishi L; Gonye, Gregory E; Gao, Guang; Schwaber, James S

2006-01-01

Background Using microarrays by co-hybridizing two samples labeled with different dyes enables differential gene expression measurements and comparisons across slides while controlling for within-slide variability. Typically one dye produces weaker signal intensities than the other often causing signals to be undetectable. In addition, undetectable spots represent a large problem for two-color microarray designs and most arrays contain at least 40% undetectable spots even when labeled with reference samples such as Stratagene's Universal Reference RNAs™. Results We introduce a novel universal reference sample that produces strong signal for all spots on the array, increasing the average fraction of detectable spots to 97%. Maximizing detectable spots on the reference image channel also decreases the variability of microarray data allowing for reliable detection of smaller differential gene expression changes. The reference sample is derived from sequence contained in the parental EST clone vector pT7T3D-Pac and is called vector RNA (vRNA). We show that vRNA can also be used for quality control of microarray printing and PCR product quality, detection of hybridization anomalies, and simplification of spot finding and segmentation tasks. This reference sample can be made inexpensively in large quantities as a renewable resource that is consistent across experiments. Conclusion Results of this study show that vRNA provides a useful universal reference that yields high signal for almost all spots on a microarray, reduces variation and allows for comparisons between experiments and laboratories. Further, it can be used for quality control of microarray printing and PCR product quality, detection of hybridization anomalies, and simplification of spot finding and segmentation tasks. This type of reference allows for detection of small changes in differential expression while reference designs in general allow for large-scale multivariate experimental designs. vRNA in combination with reference designs enable systems biology microarray experiments of small physiologically relevant changes. PMID:16677381

Equalizer reduces SNP bias in Affymetrix microarrays.

PubMed

Quigley, David

2015-07-30

Gene expression microarrays measure the levels of messenger ribonucleic acid (mRNA) in a sample using probe sequences that hybridize with transcribed regions. These probe sequences are designed using a reference genome for the relevant species. However, most model organisms and all humans have genomes that deviate from their reference. These variations, which include single nucleotide polymorphisms, insertions of additional nucleotides, and nucleotide deletions, can affect the microarray's performance. Genetic experiments comparing individuals bearing different population-associated single nucleotide polymorphisms that intersect microarray probes are therefore subject to systemic bias, as the reduction in binding efficiency due to a technical artifact is confounded with genetic differences between parental strains. This problem has been recognized for some time, and earlier methods of compensation have attempted to identify probes affected by genome variants using statistical models. These methods may require replicate microarray measurement of gene expression in the relevant tissue in inbred parental samples, which are not always available in model organisms and are never available in humans. By using sequence information for the genomes of organisms under investigation, potentially problematic probes can now be identified a priori. However, there is no published software tool that makes it easy to eliminate these probes from an annotation. I present equalizer, a software package that uses genome variant data to modify annotation files for the commonly used Affymetrix IVT and Gene/Exon platforms. These files can be used by any microarray normalization method for subsequent analysis. I demonstrate how use of equalizer on experiments mapping germline influence on gene expression in a genetic cross between two divergent mouse species and in human samples significantly reduces probe hybridization-induced bias, reducing false positive and false negative findings. The equalizer package reduces probe hybridization bias from experiments performed on the Affymetrix microarray platform, allowing accurate assessment of germline influence on gene expression.

High-density fiber-optic DNA random microsphere array.

PubMed

Ferguson, J A; Steemers, F J; Walt, D R

2000-11-15

A high-density fiber-optic DNA microarray sensor was developed to monitor multiple DNA sequences in parallel. Microarrays were prepared by randomly distributing DNA probe-functionalized 3.1-microm-diameter microspheres in an array of wells etched in a 500-microm-diameter optical imaging fiber. Registration of the microspheres was performed using an optical encoding scheme and a custom-built imaging system. Hybridization was visualized using fluorescent-labeled DNA targets with a detection limit of 10 fM. Hybridization times of seconds are required for nanomolar target concentrations, and analysis is performed in minutes.

Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

PubMed

Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

1997-06-05

We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

[Construction of forward and reverse subtracted cDNA libraries between muscle tissue of Meishan and Landrace pigs].

PubMed

Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong

2003-07-01

Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.

A Customized DNA Microarray for Microbial Source Tracking ...

EPA Pesticide Factsheets

It is estimated that more than 160, 000 miles of rivers and streams in the United States are impaired due to the presence of waterborne pathogens. These pathogens typically originate from human and other animal fecal pollution sources; therefore, a rapid microbial source tracking (MST) method is needed to facilitate water quality assessment and impaired water remediation. We report a novel qualitative DNA microarray technology consisting of 453 probes for the detection of general fecal and host-associated bacteria, viruses, antibiotic resistance, and other environmentally relevant genetic indicators. A novel data normalization and reduction approach is also presented to help alleviate false positives often associated with high-density microarray applications. To evaluate the performance of the approach, DNA and cDNA was isolated from swine, cattle, duck, goose and gull fecal reference samples, as well as soiled poultry liter and raw municipal sewage. Based on nonmetric multidimensional scaling analysis of results, findings suggest that the novel microarray approach may be useful for pathogen detection and identification of fecal contamination in recreational waters. The ability to simultaneously detect a large collection of environmentally important genetic indicators in a single test has the potential to provide water quality managers with a wide range of information in a short period of time. Future research is warranted to measure microarray performance i

Global gene expression analysis in a mouse model for Norrie disease: late involvement of photoreceptor cells.

PubMed

Lenzner, Steffen; Prietz, Sandra; Feil, Silke; Nuber, Ulrike A; Ropers, H-Hilger; Berger, Wolfgang

2002-09-01

Mutations in the NDP gene give rise to a variety of eye diseases, including classic Norrie disease (ND), X-linked exudative vitreoretinopathy (EVRX), retinal telangiectasis (Coats disease), and advanced retinopathy of prematurity (ROP). The gene product is a cystine-knot-containing extracellular signaling molecule of unknown function. In the current study, gene expression was determined in a mouse model of ND, to unravel disease-associated mechanisms at the molecular level. Gene transcription in the eyes of 2-year-old Ndp knockout mice was compared with that in the eyes of age-matched wild-type control animals, by means of cDNA subtraction and microarrays. Clones (n = 3072) from the cDNA subtraction libraries were spotted onto glass slides and hybridized with fluorescently labeled RNA-derived targets. More than 230 differentially expressed clones were sequenced, and their expression patterns were verified by virtual Northern blot analysis. Numerous gene transcripts that are absent or downregulated in the eye of Ndp knockout mice are photoreceptor cell specific. In younger Ndp knockout mice (up to 1 year old), however, all these transcripts were found to be expressed at normal levels. The identification of numerous photoreceptor cell-specific transcripts with a reduced expression in 2-year-old, but not in young, Ndp knockout mice indicates that normal gene expression in these light-sensitive cells of mutant mice is established and maintained over a long period and that rods and cones are affected relatively late in the mouse model of ND. Obviously, the absence of the Ndp gene product is not compatible with long-term survival of photoreceptor cells in the mouse.

Comparison of Comparative Genomic Hybridization Technologies across Microarray Platforms

EPA Science Inventory

In the 2007 Association of Biomolecular Resource Facilities (ABRF) Microarray Research Group (MARG) project, we analyzed HL-60 DNA with five platforms: Agilent, Affymetrix 500K, Affymetrix U133 Plus 2.0, Illumina, and RPCI 19K BAC arrays. Copy number variation (CNV) was analyzed ...

In silico Microarray Probe Design for Diagnosis of Multiple Pathogens

DTIC Science & Technology

2008-10-21

enhancements to an existing single-genome pipeline that allows for efficient design of microarray probes common to groups of target genomes. The...for tens or even hundreds of related genomes in a single run. Hybridization results with an unsequenced B. pseudomallei strain indicate that the

EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries

PubMed Central

Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

2008-01-01

Background Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. Results We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. Conclusion EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects. PMID:18402700

EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries.

PubMed

Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

2008-04-10

Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects.

An improved K-means clustering method for cDNA microarray image segmentation.

PubMed

Wang, T N; Li, T J; Shao, G F; Wu, S X

2015-07-14

Microarray technology is a powerful tool for human genetic research and other biomedical applications. Numerous improvements to the standard K-means algorithm have been carried out to complete the image segmentation step. However, most of the previous studies classify the image into two clusters. In this paper, we propose a novel K-means algorithm, which first classifies the image into three clusters, and then one of the three clusters is divided as the background region and the other two clusters, as the foreground region. The proposed method was evaluated on six different data sets. The analyses of accuracy, efficiency, expression values, special gene spots, and noise images demonstrate the effectiveness of our method in improving the segmentation quality.

Development of a single nucleotide polymorphism DNA microarray for the detection and genotyping of the SARS coronavirus.

PubMed

Guo, Xi; Geng, Peng; Wang, Quan; Cao, Boyang; Liu, Bin

2014-10-01

Severe acute respiratory syndrome (SARS), a disease that spread widely in the world during late 2002 to 2004, severely threatened public health. Although there have been no reported infections since 2004, the extremely pathogenic SARS coronavirus (SARS-CoV), as the causative agent of SARS, has recently been identified in animals, showing the potential for the re-emergence of this disease. Previous studies showed that 27 single nucleotide polymorphism (SNP) mutations among the spike (S) gene of this virus are correlated closely with the SARS pathogenicity and epidemicity. We have developed a SNP DNA microarray in order to detect and genotype these SNPs, and to obtain related information on the pathogenicity and epidemicity of a given strain. The microarray was hybridized with PCR products amplified from cDNAs obtained from different SARS-CoV strains. We were able to detect 24 SNPs and determine the type of a given strain. The hybridization profile showed that 19 samples were detected and genotyped correctly by using our microarray, with 100% accuracy. Our microarray provides a novel method for the detection and epidemiological surveillance of SARS-CoV.

Fluorescent labeling of NASBA amplified tmRNA molecules for microarray applications

PubMed Central

Scheler, Ott; Glynn, Barry; Parkel, Sven; Palta, Priit; Toome, Kadri; Kaplinski, Lauris; Remm, Maido; Maher, Majella; Kurg, Ants

2009-01-01

Background Here we present a novel promising microbial diagnostic method that combines the sensitivity of Nucleic Acid Sequence Based Amplification (NASBA) with the high information content of microarray technology for the detection of bacterial tmRNA molecules. The NASBA protocol was modified to include aminoallyl-UTP (aaUTP) molecules that were incorporated into nascent RNA during the NASBA reaction. Post-amplification labeling with fluorescent dye was carried out subsequently and tmRNA hybridization signal intensities were measured using microarray technology. Significant optimization of the labeled NASBA protocol was required to maintain the required sensitivity of the reactions. Results Two different aaUTP salts were evaluated and optimum final concentrations were identified for both. The final 2 mM concentration of aaUTP Li-salt in NASBA reaction resulted in highest microarray signals overall, being twice as high as the strongest signals with 1 mM aaUTP Na-salt. Conclusion We have successfully demonstrated efficient combination of NASBA amplification technology with microarray based hybridization detection. The method is applicative for many different areas of microbial diagnostics including environmental monitoring, bio threat detection, industrial process monitoring and clinical microbiology. PMID:19445684

Hybrid microarray based on double biomolecular markers of DNA and carbohydrate for simultaneous genotypic and phenotypic detection of cholera toxin-producing Vibrio cholerae.

PubMed

Shin, Hwa Hui; Seo, Jeong Hyun; Kim, Chang Sup; Hwang, Byeong Hee; Cha, Hyung Joon

2016-05-15

Life-threatening diarrheal cholera is usually caused by water or food contaminated with cholera toxin-producing Vibrio cholerae. For the prevention and surveillance of cholera, it is crucial to rapidly and precisely detect and identify the etiological causes, such as V. cholerae and/or its toxin. In the present work, we propose the use of a hybrid double biomolecular marker (DBM) microarray containing 16S rRNA-based DNA capture probe to genotypically identify V. cholerae and GM1 pentasaccharide capture probe to phenotypically detect cholera toxin. We employed a simple sample preparation method to directly obtain genomic DNA and secreted cholera toxin as target materials from bacterial cells. By utilizing the constructed DBM microarray and prepared samples, V. cholerae and cholera toxin were detected successfully, selectively, and simultaneously; the DBM microarray was able to analyze the pathogenicity of the identified V. cholerae regardless of whether the bacteria produces toxin. Therefore, our proposed DBM microarray is a new effective platform for identifying bacteria and analyzing bacterial pathogenicity simultaneously. Copyright © 2015 Elsevier B.V. All rights reserved.

Multihormonal induction of hepatic α2u-globulin mRNA as measured by hybridization to complementary DNA

PubMed Central

Kurtz, David T.; Feigelson, Philip

1977-01-01

A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184

Molecular profiling reveals frequent gain of MYCN and anaplasia-specific loss of 4q and 14q in Wilms tumor.

PubMed

Williams, Richard D; Al-Saadi, Reem; Natrajan, Rachael; Mackay, Alan; Chagtai, Tasnim; Little, Suzanne; Hing, Sandra N; Fenwick, Kerry; Ashworth, Alan; Grundy, Paul; Anderson, James R; Dome, Jeffrey S; Perlman, Elizabeth J; Jones, Chris; Pritchard-Jones, Kathy

2011-12-01

Anaplasia in Wilms tumor, a distinctive histology characterized by abnormal mitoses, is associated with poor patient outcome. While anaplastic tumors frequently harbour TP53 mutations, little is otherwise known about their molecular biology. We have used array comparative genomic hybridization (aCGH) and cDNA microarray expression profiling to compare anaplastic and favorable histology Wilms tumors to determine their common and differentiating features. In addition to changes on 17p, consistent with TP53 deletion, recurrent anaplasia-specific genomic loss and under-expression were noted in several other regions, most strikingly 4q and 14q. Further aberrations, including gain of 1q and loss of 16q were common to both histologies. Focal gain of MYCN, initially detected by high resolution aCGH profiling in 6/61 anaplastic samples, was confirmed in a significant proportion of both tumor types by a genomic quantitative PCR survey of over 400 tumors. Overall, these results are consistent with a model where anaplasia, rather than forming an entirely distinct molecular entity, arises from the general continuum of Wilms tumor by the acquisition of additional genomic changes at multiple loci. Copyright © 2011 Wiley Periodicals, Inc.

Patterns Cancer Prevention Through Induction of Phase 2 Enzymes

DTIC Science & Technology

2003-04-01

2) enzymes. During our Phase I Award, we identified sulforaphane as the most potent inducer of carcinogen defenses in the prostate cell. We have...characterized global effects of sulforaphane in prostate cancer cell lines using cDNA microarray technology that allows large-scale determination of...changes in gene expression. These findings argue strongly for a preventive intervention trial involving with sulforaphane . During our Phase 2 Award, we used

Prostate Cancer Prevention Through Induction of Phase 2 Enzymes

DTIC Science & Technology

1999-10-01

hypothesis. We have identified sulforaphane , a dietary isothiocyanate found in cucifers, as the most potent phase 2 enzyme inducing agent in human prostate...cancer cell lines compared to over 50 other compounds screened in our laboratory. Sulforaphane readily induced increased expression of quinone...characterizing global changes in mRNA expression for nearly 10,000 genes simultaneously using cDNA microarrays after treatment of prostate cells with sulforaphane

Gene Therapy for Fracture Repair

DTIC Science & Technology

2007-05-01

Methods: We have adopted the Agilent rat oligomer chip to analyze our fracture RNA in our microarray analysis. This chip has 20,046 unique gene...signal during fluorescent labeling of the cDNA. This approach is highly advantageous for reducing the RNA input into the system, minimizing the numbers...perform the analysis on these extremely limited samples without pooling the RNA from multiple individuals. We are therefore able to analyze the

IDENTIFICATION OF DIFFERENTIALLY EXPRESSED GENES IN THE KIDNEYS OF GROWTH HORMONE TRANSGENIC MICE

PubMed Central

Coschigano, K.T.; Wetzel, A.N.; Obichere, N.; Sharma, A.; Lee, S.; Rasch, R.; Guigneaux, M.M.; Flyvbjerg, A.; Wood, T.G.; Kopchick, J.J.

2010-01-01

Objective Bovine growth hormone (bGH) transgenic mice develop severe kidney damage. This damage may be due, at least in part, to changes in gene expression. Identification of genes with altered expression in the bGH kidney may identify mechanisms leading to damage in this system that may also be relevant to other models of kidney damage. Design cDNA subtraction libraries, northern blot analyses, microarray analyses and real-time reverse transcription polymerase chain reaction (RT/PCR) assays were used to identify and verify specific genes exhibiting differential RNA expression between kidneys of bGH mice and their non-transgenic (NT) littermates. Results Immunoglobulins were the vast majority of genes identified by the cDNA subtractions and the microarray analyses as being up-regulated in bGH. Several glycoprotein genes and inflammation-related genes also showed increased RNA expression in the bGH kidney. In contrast, only a few genes were identified as being significantly down-regulated in the bGH kidney. The most notable decrease in RNA expression was for the gene encoding kidney androgen-regulated protein. Conclusions A number of genes were identified as being differentially expressed in the bGH kidney. Inclusion of two groups, immunoglobulins and inflammation-related genes, suggests a role of the immune system in bGH kidney damage. PMID:20655258

cDNA Microarray Analysis of Host-Pathogen Interactions in a Porcine In Vitro Model for Toxoplasma gondii Infection†

PubMed Central

Okomo-Adhiambo, Margaret; Beattie, Craig; Rink, Anette

2006-01-01

Toxoplasma gondii induces the expression of proinflammatory cytokines, reorganizes organelles, scavenges nutrients, and inhibits apoptosis in infected host cells. We used a cDNA microarray of 420 annotated porcine expressed sequence tags to analyze the molecular basis of these changes at eight time points over a 72-hour period in porcine kidney epithelial (PK13) cells infected with T. gondii. A total of 401 genes with Cy3 and Cy5 spot intensities of ≥500 were selected for analysis, of which 263 (65.6%) were induced ≥2-fold (expression ratio, ≥2.0; P ≤ 0.05 [t test]) over at least one time point and 48 (12%) were significantly down-regulated. At least 12 functional categories of genes were modulated (up- or down-regulated) by T. gondii. The majority of induced genes were clustered as transcription, signal transduction, host immune response, nutrient metabolism, and apoptosis related. The expression of selected genes altered by T. gondii was validated by quantitative real-time reverse transcription-PCR. These results suggest that significant changes in gene expression occur in response to T. gondii infection in PK13 cells, facilitating further analysis of host-pathogen interactions in toxoplasmosis in a secondary host. PMID:16790800

Isolation and characterization of a cDNA encoding a lipid transfer protein expressed in 'Valencia' orange during abscission.

PubMed

Wu, Zhencai; Burns, Jacqueline K

2003-04-01

The genetics and expression of a lipid transfer protein (LTP) gene was examined during abscission of mature fruit of 'Valencia' orange. A cDNA encoding an LTP, CsLTP, was isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-pyrazole (CMN-pyrazole). A full-length cDNA clone of 652 nucleotides was isolated using 5' and 3' RACE followed by cDNA library screening and PCR amplification. The cDNA clone encoded a protein of 155 amino acid residues with a molecular mass and isoelectric point of 9.18 kDa and 9.12, respectively. A partial genomic clone of 505 nucleotides containing one intron of 101 base pairs was amplified from leaf genomic DNA. Southern blot hybridization demonstrated that at least two closely related CsLTP genes are present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones were examined by northern hybridization. Increased expression of CsLTP mRNA was detected in RNA of mature fruit abscission zones 6, 24, 48, and 72 h after application of a non-specific abscission agent, ethephon. Low expression of CsLTP transcripts was observed after treatment of CMN-pyrazole until 24 h after application. After this time, expression markedly increased. The results suggest that CsLTP has a role in the abscission process, possibly by assisting transport of cutin monomers to the fracture plane of the abscission zone or through its anti-microbial activity by reducing the potential of microbial attack.

Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mencinger, M.; Panagopoulos, I.; Andreasson, P.

1997-05-01

Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

The mining of pearl formation genes in pearl oyster Pinctada fucata by cDNA suppression subtractive hybridization.

PubMed

Wang, Ning; Kinoshita, Shigeharu; Nomura, Naoko; Riho, Chihiro; Maeyama, Kaoru; Nagai, Kiyohito; Watabe, Shugo

2012-04-01

Recent researches revealed the regional preference of biomineralization gene transcription in the pearl oyster Pinctada fucata: it transcribed mainly the genes responsible for nacre secretion in mantle pallial, whereas the ones regulating calcite shells expressed in mantle edge. This study took use of this character and constructed the forward and reverse suppression subtractive hybridization (SSH) cDNA libraries. A total of 669 cDNA clones were sequenced and 360 expressed sequence tags (ESTs) greater than 100 bp were generated. Functional annotation associated 95 ESTs with specific functions, and 79 among them were identified from P. fucata at the first time. In the forward SSH cDNA library, it recognized mass amount of nacre protein genes, biomineralization genes dominantly expressed in the mantle pallial, calcium-ion-binding genes, and other biomineralization-related genes important for pearl formation. Real-time PCR showed that all the examined genes were distributed in oyster mantle tissues with a consistence to the SSH design. The detection of their RNA transcripts in pearl sac confirmed that the identified genes were certainly involved in pearl formation. Therefore, the data from this work will initiate a new round of pearl formation gene study and shed new insights into molluscan biomineralization.

Microarray analyses reveal distinct roles for Rel proteins in the Drosophila immune response

PubMed Central

Pal, Subhamoy; Wu, Junlin; Wu, Louisa P.

2007-01-01

The NF-κB group of transcription factors play an important role in mediating immune responses in organisms as diverse as insects and mammals. The fruit fly Drosophila melanogaster express three closely related NF-κB-like transcription factors: Dorsal, Dif, and Relish. To study their roles in vivo, we used microarrays to determine the effect of null mutations in individual Rel transcription factors on larval immune gene expression. Of the 188 genes that were significantly up-regulated in wildtype larvae upon bacterial challenge, overlapping but distinct groups of genes were affected in the Rel mutants. We also ectopically expressed Dorsal or Dif and used cDNA microarrays to determine the genes that were up-regulated in the presence of these transcription factors. This expression was sufficient to drive expression of some immune genes, suggesting redundancy in the regulation of these genes. Combining this data, we also identified novel genes that may be specific targets of Dif. PMID:17537510

Alteration of gene expression in the colon of colorectal cancer model rat by dietary sodium gluconate.

PubMed

Kameue, Chiyoko; Tsukahara, Takamitsu; Ushida, Kazunari

2006-03-01

Butyrate induces apoptosis of various cancer cell lines in a p53-independent manner and inhibits the proliferation of cancer cells. In a previous report, we reported a significant reduction in tumor incidence in rat colon as a result of dietary sodium gluconate (GNA). The stimulation of apoptosis through enhanced butyrate production in the large intestine was involved in the antitumorigenic effect of GNA. In the present study, a cDNA microarray analysis was performed to investigate the particular mechanism involved in the antitumorigenic effect of GNA. Some up-regulated genes suggested by microarray analysis were further evaluated using real-time PCR. A microarray revealed that GNA regulates the expression of retinoic acid receptor (RAR) and retinoid X receptor (RXR), and several genes known as the target of retinoids in cancer cells. In other words, the antitumorigenic effect of GNA may involve the regulation of the retinoid signaling pathway by butyrate in a retinoid-independent manner.

Linear RNA amplification for the production of microarray hybridization probes.

PubMed

Klebes, Ansgar; Kornberg, Thomas B

2008-01-01

To understand Drosophila development and other genetically controlled processes, it is often desirable to identify differences in gene expression levels. An experimental approach to investigate these processes is to catalog the transcriptome by hybridization of mRNA to DNA microbar-rays. In these experiments mRNA-derived hybridization probes are produced and hybridized to an array of DNA spots on a solid support. The labeled cDNAs of the complex hybridization probe will bind to their complementary sequences and provide quantification of the relative concentration of the corresponding transcript in the starting material. However, such approaches are often limited by the scarcity of the experimental sample because standard methods of probe preparation require microgram quantities of mRNA template. Linear RNA amplification can alleviate such limitations to support the generation of microarray hybridization probes from a few 100 pg of mRNA. These smaller quantities can be isolated from a few 100 cells. Here, we present a linear amplification protocol designed to preserve both the relative abundance of transcripts as well as their sequence complexity.

Construction of a High-Quality Yeast Two-Hybrid Library and Its Application in Identification of Interacting Proteins with Brn1 in Curvularia lunata.

PubMed

Gao, Jin-Xin; Jing, Jing; Yu, Chuan-Jin; Chen, Jie

2015-06-01

Curvularia lunata is an important maize foliar fungal pathogen that distributes widely in maize growing area in China, and several key pathogenic factors have been isolated. An yeast two-hybrid (Y2H) library is a very useful platform to further unravel novel pathogenic factors in C. lunata. To construct a high-quality full length-expression cDNA library from the C. lunata for application to pathogenesis-related protein-protein interaction screening, total RNA was extracted. The SMART (Switching Mechanism At 5' end of the RNA Transcript) technique was used for cDNA synthesis. Double-stranded cDNA was ligated into the pGADT7-Rec vector with Herring Testes Carrier DNA using homologous recombination method. The ligation mixture was transformed into competent yeast AH109 cells to construct the primary cDNA library. Eventually, a high qualitative library was successfully established according to an evaluation on quality. The transformation efficiency was about 6.39 ×10(5) transformants/3 μg pGADT7-Rec. The titer of the primary cDNA library was 2.5×10(8) cfu/mL. The numbers for the cDNA library was 2.46×10(5). Randomly picked clones show that the recombination rate was 88.24%. Gel electrophoresis results indicated that the fragments ranged from 0.4 kb to 3.0 kb. Melanin synthesis protein Brn1 (1,3,8-hydroxynaphthalene reductase) was used as a "bait" to test the sufficiency of the Y2H library. As a result, a cDNA clone encoding VelB protein that was known to be involved in the regulation of diverse cellular processes, including control of secondary metabolism containing melanin and toxin production in many filamentous fungi was identified. Further study on the exact role of the VelB gene is underway.

Fiber-optic microarray for simultaneous detection of multiple harmful algal bloom species.

PubMed

Ahn, Soohyoun; Kulis, David M; Erdner, Deana L; Anderson, Donald M; Walt, David R

2006-09-01

Harmful algal blooms (HABs) are a serious threat to coastal resources, causing a variety of impacts on public health, regional economies, and ecosystems. Plankton analysis is a valuable component of many HAB monitoring and research programs, but the diversity of plankton poses a problem in discriminating toxic from nontoxic species using conventional detection methods. Here we describe a sensitive and specific sandwich hybridization assay that combines fiber-optic microarrays with oligonucleotide probes to detect and enumerate the HAB species Alexandrium fundyense, Alexandrium ostenfeldii, and Pseudo-nitzschia australis. Microarrays were prepared by loading oligonucleotide probe-coupled microspheres (diameter, 3 mum) onto the distal ends of chemically etched imaging fiber bundles. Hybridization of target rRNA from HAB cells to immobilized probes on the microspheres was visualized using Cy3-labeled secondary probes in a sandwich-type assay format. We applied these microarrays to the detection and enumeration of HAB cells in both cultured and field samples. Our study demonstrated a detection limit of approximately 5 cells for all three target organisms within 45 min, without a separate amplification step, in both sample types. We also developed a multiplexed microarray to detect the three HAB species simultaneously, which successfully detected the target organisms, alone and in combination, without cross-reactivity. Our study suggests that fiber-optic microarrays can be used for rapid and sensitive detection and potential enumeration of HAB species in the environment.

Clofibrate-induced gene expression changes in rat liver: a cross-laboratory analysis using membrane cDNA arrays.

PubMed Central

Baker, Valerie A; Harries, Helen M; Waring, Jeff F; Duggan, Colette M; Ni, Hong A; Jolly, Robert A; Yoon, Lawrence W; De Souza, Angus T; Schmid, Judith E; Brown, Roger H; Ulrich, Roger G; Rockett, John C

2004-01-01

Microarrays have the potential to significantly impact our ability to identify toxic hazards by the identification of mechanistically relevant markers of toxicity. To be useful for risk assessment, however, microarray data must be challenged to determine reliability and interlaboratory reproducibility. As part of a series of studies conducted by the International Life Sciences Institute Health and Environmental Science Institute Technical Committee on the Application of Genomics to Mechanism-Based Risk Assessment, the biological response in rats to the hepatotoxin clofibrate was investigated. Animals were treated with high (250 mg/kg/day) or low (25 mg/kg/day) doses for 1, 3, or 7 days in two laboratories. Clinical chemistry parameters were measured, livers removed for histopathological assessment, and gene expression analysis was conducted using cDNA arrays. Expression changes in genes involved in fatty acid metabolism (e.g., acyl-CoA oxidase), cell proliferation (e.g., topoisomerase II-Alpha), and fatty acid oxidation (e.g., cytochrome P450 4A1), consistent with the mechanism of clofibrate hepatotoxicity, were detected. Observed differences in gene expression levels correlated with the level of biological response induced in the two in vivo studies. Generally, there was a high level of concordance between the gene expression profiles generated from pooled and individual RNA samples. Quantitative real-time polymerase chain reaction was used to confirm modulations for a number of peroxisome proliferator marker genes. Though the results indicate some variability in the quantitative nature of the microarray data, this appears due largely to differences in experimental and data analysis procedures used within each laboratory. In summary, this study demonstrates the potential for gene expression profiling to identify toxic hazards by the identification of mechanistically relevant markers of toxicity. PMID:15033592

In-vitro analysis of Quantum Molecular Resonance effects on human mesenchymal stromal cells

PubMed Central

Sella, Sabrina; Adami, Valentina; Amati, Eliana; Bernardi, Martina; Chieregato, Katia; Gatto, Pamela; Menarin, Martina; Pozzato, Alessandro; Pozzato, Gianantonio; Astori, Giuseppe

2018-01-01

Electromagnetic fields play an essential role in cellular functions interfering with cellular pathways and tissue physiology. In this context, Quantum Molecular Resonance (QMR) produces waves with a specific form at high-frequencies (4–64 MHz) and low intensity through electric fields. We evaluated the effects of QMR stimulation on bone marrow derived mesenchymal stromal cells (MSC). MSC were treated with QMR for 10 minutes for 4 consecutive days for 2 weeks at different nominal powers. Cell morphology, phenotype, multilineage differentiation, viability and proliferation were investigated. QMR effects were further investigated by cDNA microarray validated by real-time PCR. After 1 and 2 weeks of QMR treatment morphology, phenotype and multilineage differentiation were maintained and no alteration of cellular viability and proliferation were observed between treated MSC samples and controls. cDNA microarray analysis evidenced more transcriptional changes on cells treated at 40 nominal power than 80 ones. The main enrichment lists belonged to development processes, regulation of phosphorylation, regulation of cellular pathways including metabolism, kinase activity and cellular organization. Real-time PCR confirmed significant increased expression of MMP1, PLAT and ARHGAP22 genes while A2M gene showed decreased expression in treated cells compared to controls. Interestingly, differentially regulated MMP1, PLAT and A2M genes are involved in the extracellular matrix (ECM) remodelling through the fibrinolytic system that is also implicated in embryogenesis, wound healing and angiogenesis. In our model QMR-treated MSC maintained unaltered cell phenotype, viability, proliferation and the ability to differentiate into bone, cartilage and adipose tissue. Microarray analysis may suggest an involvement of QMR treatment in angiogenesis and in tissue regeneration probably through ECM remodelling. PMID:29293552

Global transcriptomic profiling using small volumes of whole blood: a cost-effective method for translational genomic biomarker identification in small animals.

PubMed

Fricano, Meagan M; Ditewig, Amy C; Jung, Paul M; Liguori, Michael J; Blomme, Eric A G; Yang, Yi

2011-01-01

Blood is an ideal tissue for the identification of novel genomic biomarkers for toxicity or efficacy. However, using blood for transcriptomic profiling presents significant technical challenges due to the transcriptomic changes induced by ex vivo handling and the interference of highly abundant globin mRNA. Most whole blood RNA stabilization and isolation methods also require significant volumes of blood, limiting their effective use in small animal species, such as rodents. To overcome these challenges, a QIAzol-based RNA stabilization and isolation method (QSI) was developed to isolate sufficient amounts of high quality total RNA from 25 to 500 μL of rat whole blood. The method was compared to the standard PAXgene Blood RNA System using blood collected from rats exposed to saline or lipopolysaccharide (LPS). The QSI method yielded an average of 54 ng total RNA per μL of rat whole blood with an average RNA Integrity Number (RIN) of 9, a performance comparable with the standard PAXgene method. Total RNA samples were further processed using the NuGEN Ovation Whole Blood Solution system and cDNA was hybridized to Affymetrix Rat Genome 230 2.0 Arrays. The microarray QC parameters using RNA isolated with the QSI method were within the acceptable range for microarray analysis. The transcriptomic profiles were highly correlated with those using RNA isolated with the PAXgene method and were consistent with expected LPS-induced inflammatory responses. The present study demonstrated that the QSI method coupled with NuGEN Ovation Whole Blood Solution system is cost-effective and particularly suitable for transcriptomic profiling of minimal volumes of whole blood, typical of those obtained with small animal species.

Under the influence of the active deodorant ingredient 4-hydroxy-3-methoxybenzyl alcohol, the skin bacterium Corynebacterium jeikeium moderately responds with differential gene expression.

PubMed

Brune, Iris; Becker, Anke; Paarmann, Daniel; Albersmeier, Andreas; Kalinowski, Jörn; Pühler, Alfred; Tauch, Andreas

2006-12-15

A 70mer oligonucleotide microarray was constructed to analyze genome-wide expression profiles of Corynebacterium jeikeium, a skin bacterium that is predominantly present in the human axilla and involved in axillary odor formation. Oligonucleotides representing 100% of the predicted coding regions of the C. jeikeium K411 genome were designed and spotted in quadruplicate onto epoxy-coated glass slides. The quality of the printed microarray was demonstrated by co-hybridization with fluorescently labeled cDNA probes obtained from exponentially growing C. jeikeium cultures. Accordingly, genes detected with different intensities resulting in log(2) transformed ratios greater than 0.8 or smaller than -0.8 can be regarded as differentially expressed with a confidence level greater than 99%. In an application example, we measured global changes of gene expression during growth of C. jeikeium in the presence of different concentrations of the deodorant component 4-hydroxy-3-methoxybenzyl alcohol that is active in preventing body odor formation. Global expression profiling revealed that low concentrations of 4-hydroxy-3-methoxybenzyl alcohol (0.5 and 2.5mg/ml) had almost no detectable effect on the transcriptome of C. jeikeium. A slightly higher concentration of 4-hydroxy-3-methoxybenzyl alcohol (5mg/ml) resulted in differential expression of 95 genes, 86 of which showed an enhanced expression when compared to a control culture. Besides many genes encoding proteins that apparently participate in transcription and translation, the drug resistance determinant cmx and the predicted virulence factors sapA and sapD showed significantly enhanced expression levels. Differential expression of relevant genes was validated by real-time reverse transcription PCR assays.

Tomato Expression Database (TED): a suite of data presentation and analysis tools

PubMed Central

Fei, Zhangjun; Tang, Xuemei; Alba, Rob; Giovannoni, James

2006-01-01

The Tomato Expression Database (TED) includes three integrated components. The Tomato Microarray Data Warehouse serves as a central repository for raw gene expression data derived from the public tomato cDNA microarray. In addition to expression data, TED stores experimental design and array information in compliance with the MIAME guidelines and provides web interfaces for researchers to retrieve data for their own analysis and use. The Tomato Microarray Expression Database contains normalized and processed microarray data for ten time points with nine pair-wise comparisons during fruit development and ripening in a normal tomato variety and nearly isogenic single gene mutants impacting fruit development and ripening. Finally, the Tomato Digital Expression Database contains raw and normalized digital expression (EST abundance) data derived from analysis of the complete public tomato EST collection containing >150 000 ESTs derived from 27 different non-normalized EST libraries. This last component also includes tools for the comparison of tomato and Arabidopsis digital expression data. A set of query interfaces and analysis, and visualization tools have been developed and incorporated into TED, which aid users in identifying and deciphering biologically important information from our datasets. TED can be accessed at . PMID:16381976

Tomato Expression Database (TED): a suite of data presentation and analysis tools.

PubMed

Fei, Zhangjun; Tang, Xuemei; Alba, Rob; Giovannoni, James

2006-01-01

The Tomato Expression Database (TED) includes three integrated components. The Tomato Microarray Data Warehouse serves as a central repository for raw gene expression data derived from the public tomato cDNA microarray. In addition to expression data, TED stores experimental design and array information in compliance with the MIAME guidelines and provides web interfaces for researchers to retrieve data for their own analysis and use. The Tomato Microarray Expression Database contains normalized and processed microarray data for ten time points with nine pair-wise comparisons during fruit development and ripening in a normal tomato variety and nearly isogenic single gene mutants impacting fruit development and ripening. Finally, the Tomato Digital Expression Database contains raw and normalized digital expression (EST abundance) data derived from analysis of the complete public tomato EST collection containing >150,000 ESTs derived from 27 different non-normalized EST libraries. This last component also includes tools for the comparison of tomato and Arabidopsis digital expression data. A set of query interfaces and analysis, and visualization tools have been developed and incorporated into TED, which aid users in identifying and deciphering biologically important information from our datasets. TED can be accessed at http://ted.bti.cornell.edu.

Bacillus subtilis genome diversity.

PubMed

Earl, Ashlee M; Losick, Richard; Kolter, Roberto

2007-02-01

Microarray-based comparative genomic hybridization (M-CGH) is a powerful method for rapidly identifying regions of genome diversity among closely related organisms. We used M-CGH to examine the genome diversity of 17 strains belonging to the nonpathogenic species Bacillus subtilis. Our M-CGH results indicate that there is considerable genetic heterogeneity among members of this species; nearly one-third of Bsu168-specific genes exhibited variability, as measured by the microarray hybridization intensities. The variable loci include those encoding proteins involved in antibiotic production, cell wall synthesis, sporulation, and germination. The diversity in these genes may reflect this organism's ability to survive in diverse natural settings.

Characterization of the translation products of the major mRNA species from rabbit lactating mammary glands and construction of bacterial recombinants containing casein and alpha-lactalbumin complementary DNA.

PubMed Central

Suard, Y M; Tosi, M; Kraehenbuhl, J P

1982-01-01

Total cytoplasmic polyadenylated RNA from lactating rabbit mammary glands was analysed on methylmercury hydroxide-agarose gels. The size of the most abundant mRNA species ranged between 0.5 and 5.0 kb (kilobases), with major bands at 0.55, 0.84, 0.92, 1.18 and 2.4 kb and discrete minor bands of 1.5, 1.7, 3.0 and 3.9 kb. Translation in vitro of total mRNA with [3H]leucine or [35S]methionine as precursor yielded four major bands with apparent Mr values of 16 000, 25 000, 26 000 and 29 000. The four protein bands were identified by immunoprecipitation by using specific antisera as alpha-lactalbumin and x-, kappa- and alpha-caseins, respectively. Labelling with (35S]cysteine followed by immunoprecipitation with anti-transferrin or anti-alpha-lactalbumin sera allowed the identification of two whey proteins. Translated transferrin was resolved as an 80 000-dalton band and alpha-lactalbumin appeared as a 16 000-dalton protein. A library of recombinant plasmids containing cDNA (complementary DNA) sequences representing cytoplasmic polyadenylated RNA was used to isolate clones for the major rabbit caseins and alpha-lactalbumin. A preliminary characterization of these cDNA clones was achieved by colony hybridization with enriched RNA fractions as probes. Positive clones were identified by use of hybrid-promoted translation in vitro and immunoprecipitation of the translation products. The corresponding mRNA species were further identified by hybridizing RNA blots with radioactively labelled cDNA clones. We present the restriction map of alpha-casein and kappa-casein cDNA clones. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:6123313

Ultrasensitive sensing platform for platelet-derived growth factor BB detection based on layered molybdenum selenide-graphene composites and Exonuclease III assisted signal amplification.

PubMed

Huang, Ke-Jing; Shuai, Hong-Lei; Zhang, Ji-Zong

2016-03-15

A highly sensitive and ultrasensitive electrochemical aptasensor for platelet-derived growth factor BB (PDGF-BB) detection is fabricated based on layered molybdenum selenide-graphene (MoSe2-Gr) composites and Exonuclease III (Exo III)-aided signal amplification. MoSe2-Gr is prepared by a simple hydrothermal method and used as a promising sensing platform. Exo III has a specifical exo-deoxyribonuclease activity for duplex DNAs in the direction from 3' to 5' terminus, however its activity is limited on the duplex DNAs with more than 4 mismatched terminal bases at 3' ends. Herein, aptamer and complementary DNA (cDNA) sequences are designed with four thymine bases on 3' ends. In the presence of target protein, the aptamer associates with it and facilitates the formation of duplex DNA between cDNA and signal DNA. The duplex DNA then is digested by Exo III and releases cDNA, which hybridizes with signal DNA to perform a new cleavage process. Nevertheless, in the absence of target protein, the aptamer hybridizes with cDNA will inhibit the Exo III-assisted nucleotides cleavage. The signal DNA then hybridizes with capture DNA on the electrode. Subsequently, horse radish peroxidase is fixed on electrode by avidin-biotin reaction and then catalyzes hydrogen peroxide and hydroquinone to produce electrochemical response. Therefore, a bridge can be established between the concentration of target protein and the degree of the attenuation of the obtained signal, providing a quantitative measure of target protein with a broad detection range of 0.0001-1 nM and a detection limit of 20 fM. Copyright © 2015 Elsevier B.V. All rights reserved.

ASSESSMENT OF THE SWINE PROTEIN-ANNOTATED OLIGONUCLEOTIDE MICROARRAY AND UTILITY OF THE ARRAYS FOR EQTL AND TRANSCRIPTIONAL PROFILING STUDIES

USDA-ARS?s Scientific Manuscript database

We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray (http://www.pigoligoarray.org) by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...

A DNA microarray for identification of selected Korean birds based on mitochondrial cytochrome c oxidase I gene sequences.

PubMed

Chung, In-Hyuk; Yoo, Hye Sook; Eah, Jae-Yong; Yoon, Hyun-Kyu; Jung, Jin-Wook; Hwang, Seung Yong; Kim, Chang-Bae

2010-10-01

DNA barcoding with the gene encoding cytochrome c oxidase I (COI) in the mitochondrial genome has been proposed as a standard marker to identify and discover animal species. Some migratory wild birds are suspected of transmitting avian influenza and pose a threat to aircraft safety because of bird strikes. We have previously reported the COI gene sequences of 92 Korean bird species. In the present study, we developed a DNA microarray to identify 17 selected bird species on the basis of nucleotide diversity. We designed and synthesized 19 specific oligonucleotide probes; these probes were arrayed on a silylated glass slide. The length of the probes was 19-24 bps. The COI sequences amplified from the tissues of the selected birds were labeled with a fluorescent probe for microarray hybridization, and unique hybridization patterns were detected for each selected species. These patterns may be considered diagnostic patterns for species identification. This microarray system will provide a sensitive and a high-throughput method for identification of Korean birds.

The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

PubMed Central

Allison, J; Hall, L; MacIntyre, I; Craig, R K

1981-01-01

(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

Identification and handling of artifactual gene expression profiles emerging in microarray hybridization experiments

PubMed Central

Brodsky, Leonid; Leontovich, Andrei; Shtutman, Michael; Feinstein, Elena

2004-01-01

Mathematical methods of analysis of microarray hybridizations deal with gene expression profiles as elementary units. However, some of these profiles do not reflect a biologically relevant transcriptional response, but rather stem from technical artifacts. Here, we describe two technically independent but rationally interconnected methods for identification of such artifactual profiles. Our diagnostics are based on detection of deviations from uniformity, which is assumed as the main underlying principle of microarray design. Method 1 is based on detection of non-uniformity of microarray distribution of printed genes that are clustered based on the similarity of their expression profiles. Method 2 is based on evaluation of the presence of gene-specific microarray spots within the slides’ areas characterized by an abnormal concentration of low/high differential expression values, which we define as ‘patterns of differentials’. Applying two novel algorithms, for nested clustering (method 1) and for pattern detection (method 2), we can make a dual estimation of the profile’s quality for almost every printed gene. Genes with artifactual profiles detected by method 1 may then be removed from further analysis. Suspicious differential expression values detected by method 2 may be either removed or weighted according to the probabilities of patterns that cover them, thus diminishing their input in any further data analysis. PMID:14999086

Integrated in silico and biological validation of the blocking effect of Cot-1 DNA on Microarray-CGH.

PubMed

Kang, Seung-Hui; Park, Chan Hee; Jeung, Hei Cheul; Kim, Ki-Yeol; Rha, Sun Young; Chung, Hyun Cheol

2007-06-01

In array-CGH, various factors may act as variables influencing the result of experiments. Among them, Cot-1 DNA, which has been used as a repetitive sequence-blocking agent, may become an artifact-inducing factor in BAC array-CGH. To identify the effect of Cot-1 DNA on Microarray-CGH experiments, Cot-1 DNA was labeled directly and Microarray-CGH experiments were performed. The results confirmed that probes which hybridized more completely with Cot-1 DNA had a higher sequence similarity to the Alu element. Further, in the sex-mismatched Microarray-CGH experiments, the variation and intensity in the fluorescent signal were reduced in the high intensity probe group in which probes were better hybridized with Cot-1 DNA. Otherwise, those of the low intensity probe group showed no alterations regardless of Cot-1 DNA. These results confirmed by in silico methods that Cot-1 DNA could block repetitive sequences in gDNA and probes. In addition, it was confirmed biologically that the blocking effect of Cot-1 DNA could be presented via its repetitive sequences, especially Alu elements. Thus, in contrast to BAC-array CGH, the use of Cot-1 DNA is advantageous in controlling experimental variation in Microarray-CGH.

[Technology of analysis of epigenetic and structural changes of epithelial tumors genome with NotI-microarrays by the example of human chromosome].

PubMed

Pavlova, T V; Kashuba, V I; Muravenko, O V; Yenamandra, S P; Ivanova, T A; Zabarovskaia, V I; Rakhmanaliev, E R; Petrenko, L A; Pronina, I V; Loginov, V I; Iurkevich, O Iu; Kiselev, L L; Zelenin, A V; Zabarovskiĭ, E R

2009-01-01

New comparative genome hybridization technology on NotI-microarrays is presented (Karolinska Institute International Patent WO02/086163). The method is based on comparative genome hybridization of NotI-probes from tumor and normal genomic DNA with the principle of new DNA NotI-microarrays. Using this method 181 NotI linking loci from human chromosome 3 were analyzed in 200 malignant tumor samples from different organs: kidney, lung, breast, ovary, cervical, prostate. Most frequently (more than in 30%) aberrations--deletions, methylation,--were identified in NotI-sites located in MINT24, BHLHB2, RPL15, RARbeta1, ITGA9, RBSP3, VHL, ZIC4 genes, that suggests they probably are involved in cancer development. Methylation of these genomic loci was confirmed by methylation-specific PCR and bisulfite sequencing. The results demonstrate perspective of using this method to solve some oncogenomic problems.

Sequence, molecular properties, and chromosomal mapping of mouse lumican

NASA Technical Reports Server (NTRS)

Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

1995-01-01

PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.

PubMed

Judelson, H S; Michelmore, R W

1990-01-01

Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.

Implementation of spectral clustering on microarray data of carcinoma using k-means algorithm

NASA Astrophysics Data System (ADS)

Frisca, Bustamam, Alhadi; Siswantining, Titin

2017-03-01

Clustering is one of data analysis methods that aims to classify data which have similar characteristics in the same group. Spectral clustering is one of the most popular modern clustering algorithms. As an effective clustering technique, spectral clustering method emerged from the concepts of spectral graph theory. Spectral clustering method needs partitioning algorithm. There are some partitioning methods including PAM, SOM, Fuzzy c-means, and k-means. Based on the research that has been done by Capital and Choudhury in 2013, when using Euclidian distance k-means algorithm provide better accuracy than PAM algorithm. So in this paper we use k-means as our partition algorithm. The major advantage of spectral clustering is in reducing data dimension, especially in this case to reduce the dimension of large microarray dataset. Microarray data is a small-sized chip made of a glass plate containing thousands and even tens of thousands kinds of genes in the DNA fragments derived from doubling cDNA. Application of microarray data is widely used to detect cancer, for the example is carcinoma, in which cancer cells express the abnormalities in his genes. The purpose of this research is to classify the data that have high similarity in the same group and the data that have low similarity in the others. In this research, Carcinoma microarray data using 7457 genes. The result of partitioning using k-means algorithm is two clusters.

BABAR: an R package to simplify the normalisation of common reference design microarray-based transcriptomic datasets

PubMed Central

2010-01-01

Background The development of DNA microarrays has facilitated the generation of hundreds of thousands of transcriptomic datasets. The use of a common reference microarray design allows existing transcriptomic data to be readily compared and re-analysed in the light of new data, and the combination of this design with large datasets is ideal for 'systems'-level analyses. One issue is that these datasets are typically collected over many years and may be heterogeneous in nature, containing different microarray file formats and gene array layouts, dye-swaps, and showing varying scales of log2- ratios of expression between microarrays. Excellent software exists for the normalisation and analysis of microarray data but many data have yet to be analysed as existing methods struggle with heterogeneous datasets; options include normalising microarrays on an individual or experimental group basis. Our solution was to develop the Batch Anti-Banana Algorithm in R (BABAR) algorithm and software package which uses cyclic loess to normalise across the complete dataset. We have already used BABAR to analyse the function of Salmonella genes involved in the process of infection of mammalian cells. Results The only input required by BABAR is unprocessed GenePix or BlueFuse microarray data files. BABAR provides a combination of 'within' and 'between' microarray normalisation steps and diagnostic boxplots. When applied to a real heterogeneous dataset, BABAR normalised the dataset to produce a comparable scaling between the microarrays, with the microarray data in excellent agreement with RT-PCR analysis. When applied to a real non-heterogeneous dataset and a simulated dataset, BABAR's performance in identifying differentially expressed genes showed some benefits over standard techniques. Conclusions BABAR is an easy-to-use software tool, simplifying the simultaneous normalisation of heterogeneous two-colour common reference design cDNA microarray-based transcriptomic datasets. We show BABAR transforms real and simulated datasets to allow for the correct interpretation of these data, and is the ideal tool to facilitate the identification of differentially expressed genes or network inference analysis from transcriptomic datasets. PMID:20128918

Wide screening of phage-displayed libraries identifies immune targets in planta.

PubMed

Rioja, Cristina; Van Wees, Saskia C; Charlton, Keith A; Pieterse, Corné M J; Lorenzo, Oscar; García-Sánchez, Susana

2013-01-01

Microbe-Associated Molecular Patterns and virulence effectors are recognized by plants as a first step to mount a defence response against potential pathogens. This recognition involves a large family of extracellular membrane receptors and other immune proteins located in different sub-cellular compartments. We have used phage-display technology to express and select for Arabidopsis proteins able to bind bacterial pathogens. To rapidly identify microbe-bound phage, we developed a monitoring method based on microarrays. This combined strategy allowed for a genome-wide screening of plant proteins involved in pathogen perception. Two phage libraries for high-throughput selection were constructed from cDNA of plants infected with Pseudomonas aeruginosa PA14, or from combined samples of the virulent isolate DC3000 of Pseudomonas syringae pv. tomato and its avirulent variant avrRpt2. These three pathosystems represent different degrees in the specificity of plant-microbe interactions. Libraries cover up to 2 × 10(7) different plant transcripts that can be displayed as functional proteins on the surface of T7 bacteriophage. A number of these were selected in a bio-panning assay for binding to Pseudomonas cells. Among the selected clones we isolated the ethylene response factor ATERF-1, which was able to bind the three bacterial strains in competition assays. ATERF-1 was rapidly exported from the nucleus upon infiltration of either alive or heat-killed Pseudomonas. Moreover, aterf-1 mutants exhibited enhanced susceptibility to infection. These findings suggest that ATERF-1 contains a microbe-recognition domain with a role in plant defence. To identify other putative pathogen-binding proteins on a genome-wide scale, the copy number of selected-vs.-total clones was compared by hybridizing phage cDNAs with Arabidopsis microarrays. Microarray analysis revealed a set of 472 candidates with significant fold change. Within this set defence-related genes, including well-known targets of bacterial effectors, are over-represented. Other genes non-previously related to defence can be associated through this study with general or strain-specific recognition of Pseudomonas.

Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Meisheng; Tran, V.T.; Fong, H.K.W.

1991-05-01

The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha}more » protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.« less

An Efficient Covalent Coating on Glass Slides for Preparation of Optical Oligonucleotide Microarrays

PubMed Central

Pourjahed, Atefeh; Rabiee, Mohammad; Tahriri, Mohammadreza

2013-01-01

Objective(s): Microarrays are potential analyzing tools for genomics and proteomics researches, which is in needed of suitable substrate for coating and also hybridization of biomolecules. Materials and Methods: In this research, a thin film of oxidized agarose was prepared on the glass slides which previously coated with poly-L-lysine (PLL). Some of the aldehyde groups of the activated agarose linked covalently to PLL amine groups; also bound to the amino groups of biomolecules. These linkages were fixed by UV irradiation. The prepared substrates were compared to only agarose-coated and PLL-coated slides. Results: Results on atomic force microscope (AFM) demonstrated that agarose provided three-dimensional surface which had higher loading and bindig capacity for biomolecules than PLL-coated surface which had two-dimensional surface. In addition, the signal-to-noise ratio in hybridization reactions performed on the agarose-PLL coated substrates increased two fold and four fold compared to agarose and PLL coated substrates, respectively. Conclusion: The agarose-PLL microarrays had the highest signal (2546) and lowest background signal (205) in hybridization, suggesting that the prepared slides are suitable in analyzing wide concentration range of analytes. PMID:24570832

Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

PubMed

Hussey, Richard S; Huang, Guozhong; Allen, Rex

2011-01-01

Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

A comparative cDNA microarray analysis reveals a spectrum of genes regulated by Pax6 in mouse lens

PubMed Central

Chauhan, Bharesh K.; Reed, Nathan A.; Yang, Ying; Čermák, Lukáš; Reneker, Lixing; Duncan, Melinda K.; Cvekl, Aleš

2007-01-01

Background Pax6 is a transcription factor that is required for induction, growth, and maintenance of the lens; however, few direct target genes of Pax6 are known. Results In this report, we describe the results of a cDNA microarray analysis of lens transcripts from transgenic mice over-expressing Pax6 in lens fibre cells in order to narrow the field of potential direct Pax6 target genes. This study revealed that the transcript levels were significantly altered for 508 of the 9700 genes analysed, including five genes encoding the cell adhesion molecules β1-integrin, JAM1, L1 CAM, NCAM-140 and neogenin. Notably, comparisons between the genes differentially expressed in Pax6 heterozygous and Pax6 over-expressing lenses identified 13 common genes, including paralemmin, GDIβ, ATF1, Hrp12 and Brg1. Immunohistochemistry and Western blotting demonstrated that Brg1 is expressed in the embryonic and neonatal (2-week-old) but not in 14-week adult lenses, and confirmed altered expression in transgenic lenses over-expressing Pax6. Furthermore, EMSA demonstrated that the BRG1 promoter contains Pax6 binding sites, further supporting the proposition that it is directly regulated by Pax6. Conclusions These results provide a list of genes with possible roles in lens biology and cataracts that are directly or indirectly regulated by Pax6. PMID:12485166

Mutation spectrum and differential gene expression in cystic and solid vestibular schwannoma.

PubMed

Zhang, Zhihua; Wang, Zhaoyan; Sun, Lianhua; Li, Xiaohua; Huang, Qi; Yang, Tao; Wu, Hao

2014-03-01

We sought to characterize the mutation spectrum of NF2 and the differential gene expression in cystic and solid vestibular schwannomas. We collected tumor tissue and blood samples of 31 cystic vestibular schwannomas and 114 solid vestibular schwannomas. Mutation screening of NF2 was performed in both tumor and blood DNA samples of all patients. cDNA microarray was used to analyze the differential gene expression between 11 cystic vestibular schwannomas and 6 solid vestibular schwannomas. Expression levels of top candidate genes were verified by quantitative reverse transcription PCR. NF2 mutations were identified in 34.5% of sporadic vestibular schwannomas, with all mutations being exclusively somatic. No significant difference was found between the mutation detection rates of cystic vestibular schwannoma (35.5%) and solid vestibular schwannoma (34.2%). cDNA microarray analysis detected a total of 46 differentially expressed genes between the cystic vestibular schwannoma and solid vestibular schwannoma samples. The significantly decreased expression of four top candidate genes, C1orf130, CNTF, COL4A3, and COL4A4, was verified by quantitative reverse transcription PCR. NF2 mutations are not directly involved in the cystic formation of vestibular schwannoma. In addition, the differential gene expression of cystic vestibular schwannoma reported in our study may provide useful insights into the molecular mechanism underlying this process.

Effects of chronic restraint stress on body weight, food intake, and hypothalamic gene expressions in mice.

PubMed

Jeong, Joo Yeon; Lee, Dong Hoon; Kang, Sang Soo

2013-12-01

Stress affects body weight and food intake, but the underlying mechanisms are not well understood. We evaluated the changes in body weight and food intake of ICR male mice subjected to daily 2 hours restraint stress for 15 days. Hypothalamic gene expression profiling was analyzed by cDNA microarray. Daily body weight and food intake measurements revealed that both parameters decreased rapidly after initiating daily restraint stress. Body weights of stressed mice then remained significantly lower than the control body weights, even though food intake slowly recovered to 90% of the control intake at the end of the experiment. cDNA microarray analysis revealed that chronic restraint stress affects the expression of hypothalamic genes possibly related to body weight control. Since decreases of daily food intake and body weight were remarkable in days 1 to 4 of restraint, we examined the expression of food intake-related genes in the hypothalamus. During these periods, the expressions of ghrelin and pro-opiomelanocortin mRNA were significantly changed in mice undergoing restraint stress. Moreover, daily serum corticosterone levels gradually increased, while leptin levels significantly decreased. The present study demonstrates that restraint stress affects body weight and food intake by initially modifying canonical food intake-related genes and then later modifying other genes involved in energy metabolism. These genetic changes appear to be mediated, at least in part, by corticosterone.

Amplification of chromosomal DNA in situ

DOEpatents

Christian, Allen T.; Coleman, Matthew A.; Tucker, James D.

2002-01-01

Amplification of chromosomal DNA in situ to increase the amount of DNA associated with a chromosome or chromosome region is described. The amplification of chromosomal DNA in situ provides for the synthesis of Fluorescence in situ Hybridization (FISH) painting probes from single dissected chromosome fragments, the production of cDNA libraries from low copy mRNAs and improved in Comparative Genomic Hybridization (CGH) procedures.

Experimental analysis of oligonucleotide microarray design criteria to detect deletions by comparative genomic hybridization.

PubMed

Flibotte, Stephane; Moerman, Donald G

2008-10-21

Microarray comparative genomic hybridization (CGH) is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans) the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10 degrees C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data quality when varying the oligonucleotide length between 50 and 70, and even when using an isothermal design strategy. We have determined experimentally the effects of varying several key oligonucleotide microarray design criteria for detection of deletions in C. elegans and humans with NimbleGen's CGH technology. Our oligonucleotide design recommendations should be applicable for CGH analysis in most species.

Curation of microarray oligonucleotides and corresponding ESTs/cDNAs used for gene expression analysis in zebra finches.

PubMed

Lovell, Peter V; Huizinga, Nicole A; Getachew, Abel; Mees, Brianna; Friedrich, Samantha R; Wirthlin, Morgan; Mello, Claudio V

2018-05-18

Zebra finches are a major model organism for investigating mechanisms of vocal learning, a trait that enables spoken language in humans. The development of cDNA collections with expressed sequence tags (ESTs) and microarrays has allowed for extensive molecular characterizations of circuitry underlying vocal learning and production. However, poor database curation can lead to errors in transcriptome and bioinformatics analyses, limiting the impact of these resources. Here we used genomic alignments and synteny analysis for orthology verification to curate and reannotate ~ 35% of the oligonucleotides and corresponding ESTs/cDNAs that make-up Agilent microarrays for gene expression analysis in finches. We found that: (1) 5475 out of 43,084 oligos (a) failed to align to the zebra finch genome, (b) aligned to multiple loci, or (c) aligned to Chr_un only, and thus need to be flagged until a better genome assembly is available, or (d) reflect cloning artifacts; (2) Out of 9635 valid oligos examined further, 3120 were incorrectly named, including 1533 with no known orthologs; and (3) 2635 oligos required name update. The resulting curated dataset provides a reference for correcting gene identification errors in previous finch microarrays studies, and avoiding such errors in future studies.

High density DNA microarrays: algorithms and biomedical applications.

PubMed

Liu, Wei-Min

2004-08-01

DNA microarrays are devices capable of detecting the identity and abundance of numerous DNA or RNA segments in samples. They are used for analyzing gene expressions, identifying genetic markers and detecting mutations on a genomic scale. The fundamental chemical mechanism of DNA microarrays is the hybridization between probes and targets due to the hydrogen bonds of nucleotide base pairing. Since the cross hybridization is inevitable, and probes or targets may form undesirable secondary or tertiary structures, the microarray data contain noise and depend on experimental conditions. It is crucial to apply proper statistical algorithms to obtain useful signals from noisy data. After we obtained the signals of a large amount of probes, we need to derive the biomedical information such as the existence of a transcript in a cell, the difference of expression levels of a gene in multiple samples, and the type of a genetic marker. Furthermore, after the expression levels of thousands of genes or the genotypes of thousands of single nucleotide polymorphisms are determined, it is usually important to find a small number of genes or markers that are related to a disease, individual reactions to drugs, or other phenotypes. All these applications need careful data analyses and reliable algorithms.

Development and application of a DNA microarray-based yeast two-hybrid system

PubMed Central

Suter, Bernhard; Fontaine, Jean-Fred; Yildirimman, Reha; Raskó, Tamás; Schaefer, Martin H.; Rasche, Axel; Porras, Pablo; Vázquez-Álvarez, Blanca M.; Russ, Jenny; Rau, Kirstin; Foulle, Raphaele; Zenkner, Martina; Saar, Kathrin; Herwig, Ralf; Andrade-Navarro, Miguel A.; Wanker, Erich E.

2013-01-01

The yeast two-hybrid (Y2H) system is the most widely applied methodology for systematic protein–protein interaction (PPI) screening and the generation of comprehensive interaction networks. We developed a novel Y2H interaction screening procedure using DNA microarrays for high-throughput quantitative PPI detection. Applying a global pooling and selection scheme to a large collection of human open reading frames, proof-of-principle Y2H interaction screens were performed for the human neurodegenerative disease proteins huntingtin and ataxin-1. Using systematic controls for unspecific Y2H results and quantitative benchmarking, we identified and scored a large number of known and novel partner proteins for both huntingtin and ataxin-1. Moreover, we show that this parallelized screening procedure and the global inspection of Y2H interaction data are uniquely suited to define specific PPI patterns and their alteration by disease-causing mutations in huntingtin and ataxin-1. This approach takes advantage of the specificity and flexibility of DNA microarrays and of the existence of solid-related statistical methods for the analysis of DNA microarray data, and allows a quantitative approach toward interaction screens in human and in model organisms. PMID:23275563

Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

PubMed Central

Huebner, K; Druck, T; Croce, C M; Thiesen, H J

1991-01-01

cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Characterization and distribution of a maize cDNA encoding a peptide similar to the catalytic region of second messenger dependent protein kinases

NASA Technical Reports Server (NTRS)

Biermann, B.; Johnson, E. M.; Feldman, L. J.

1990-01-01

Maize (Zea mays) roots respond to a variety of environmental stimuli which are perceived by a specialized group of cells, the root cap. We are studying the transduction of extracellular signals by roots, particularly the role of protein kinases. Protein phosphorylation by kinases is an important step in many eukaryotic signal transduction pathways. As a first phase of this research we have isolated a cDNA encoding a maize protein similar to fungal and animal protein kinases known to be involved in the transduction of extracellular signals. The deduced sequence of this cDNA encodes a polypeptide containing amino acids corresponding to 33 out of 34 invariant or nearly invariant sequence features characteristic of protein kinase catalytic domains. The maize cDNA gene product is more closely related to the branch of serine/threonine protein kinase catalytic domains composed of the cyclic-nucleotide- and calcium-phospholipid-dependent subfamilies than to other protein kinases. Sequence identity is 35% or more between the deduced maize polypeptide and all members of this branch. The high structural similarity strongly suggests that catalytic activity of the encoded maize protein kinase may be regulated by second messengers, like that of all members of this branch whose regulation has been characterized. Northern hybridization with the maize cDNA clone shows a single 2400 base transcript at roughly similar levels in maize coleoptiles, root meristems, and the zone of root elongation, but the transcript is less abundant in mature leaves. In situ hybridization confirms the presence of the transcript in all regions of primary maize root tissue.

Gene expression pattern recognition algorithm inferences to classify samples exposed to chemical agents

NASA Astrophysics Data System (ADS)

Bushel, Pierre R.; Bennett, Lee; Hamadeh, Hisham; Green, James; Ableson, Alan; Misener, Steve; Paules, Richard; Afshari, Cynthia

2002-06-01

We present an analysis of pattern recognition procedures used to predict the classes of samples exposed to pharmacologic agents by comparing gene expression patterns from samples treated with two classes of compounds. Rat liver mRNA samples following exposure for 24 hours with phenobarbital or peroxisome proliferators were analyzed using a 1700 rat cDNA microarray platform. Sets of genes that were consistently differentially expressed in the rat liver samples following treatment were stored in the MicroArray Project System (MAPS) database. MAPS identified 238 genes in common that possessed a low probability (P < 0.01) of being randomly detected as differentially expressed at the 95% confidence level. Hierarchical cluster analysis on the 238 genes clustered specific gene expression profiles that separated samples based on exposure to a particular class of compound.

Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

PubMed

Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

2002-03-01

To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

The oxytocin receptor gene (OXTR) localizes to human chromosome 3p25 by fluorescence in situ hybridization and PCR analysis of somatic cell hybrids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simmons, C.F. Jr.; Clancy, T.E.; Quan, R.

1995-04-10

The human oxytocin receptor regulates parturition and myometrial contractility, breast milk let-down, and reproductive behaviors in the mammalian central nervous system. Kimura et al. recently identified a human oxytocin receptor cDNA by means of expression cloning from a human myometrial cDNA library. To elucidate further the molecular mechanisms that regulate oxytocin receptor gene expression and to define the expected Mendelian inheritance of possible human disease states, we must determine the number of genes, their localization, and their organization and structure. We summarize below our data indicating that the human oxytocin receptor gene is localized to 3p25 and exists as amore » single copy in the haploid genome. 9 refs., 2 figs.« less

Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants

PubMed Central

Hook, Sharon E.; Skillman, Ann D.; Small, Jack A.; Schultz, Irvin R.

2008-01-01

The increased availability and use of DNA microarrays has allowed the characterization of gene expression patterns associated with exposure to different toxicants. An important question is whether toxicant induced changes in gene expression in fish are sufficiently diverse to allow for identification of specific modes of action and/or specific contaminants. In theory, each class of toxicant may generate a gene expression profile unique to its mode of toxic action. In this study, isogenic (cloned) rainbow trout Oncorhynchus mykiss were exposed to sublethal levels of a series of model toxicants with varying modes of action, including ethynylestradiol (xeno-estrogen), 2,2,4,4′-tetrabromodiphenyl ether (BDE-47, thyroid active), diquat (oxidant stressor), chromium VI, and benzo[a]pyrene (BaP) for a period of 1–3 weeks. An additional experiment measured trenbolone (anabolic steroid; model androgen) induced gene expression changes in sexually mature female trout. Following exposure, fish were euthanized, livers removed and RNA extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNA’s. The slides were scanned to measure abundance of a given transcript in each sample relative to controls. Data were analyzed via Genespring (Silicon Genetics) to identify a list of up- and downregulated genes, as well as to determine gene clustering patterns that can be used as “expression signatures”. The results indicate each toxicant exposure caused between 64 and 222 genes to be significantly altered in expression. Most genes exhibiting altered expression responded to only one of the toxicants and relatively few were co-expressed in multiple treatments. For example, BaP and Diquat, both of which exert toxicity via oxidative stress, upregulated 28 of the same genes, of over 100 genes altered by either treatment. Other genes associated with steroidogenesis, p450 and estrogen responsive genes appear to be useful for selectively identifying toxicant mode of action in fish, suggesting a link between gene expression profile and mode of toxicity. Our array results showed good agreement with quantitative real time polymerase chain reaction (qRT PCR), which demonstrates that the arrays are an accurate measure of gene expression. The specificity of the gene expression profile in response to a model toxicant, the link between genes with altered expression and mode of toxic action, and the consistency between array and qRT PCR results all suggest that cDNA microarrays have the potential to screen environmental contaminants for biomarkers and mode of toxic action. PMID:16488489

Temporal patterns in the transcriptomic response of rainbow trout, Oncorhynchus mykiss, to crude oil.

PubMed

Hook, Sharon E; Lampi, Mark A; Febbo, Eric J; Ward, Jeff A; Parkerton, Thomas F

2010-09-01

Time is often not characterized as a variable in ecotoxicogenomic studies. In this study, temporal changes in gene expression were determined during exposure to crude oil and a subsequent recovery period. Juvenile rainbow trout, Oncorhynchus mykiss, were exposed for 96 h to the water accommodated fractions of 0.4, 2 or 10 mgl(-1) crude oil loadings. Following 96 h of exposure, fish were transferred to recovery tanks. Gill and liver samples were collected after 24 and 96 h of exposure, and after 96 h of recovery for RNA extraction and microarray analysis. Fluorescently labeled cDNA was hybridized against matched controls, using salmonid cDNA arrays. Each exposure scenario generated unique patterns of altered gene expression. More genes responded to crude oil in the gill than in the liver. In the gill, 1137 genes had altered expression at 24 h, 2003 genes had altered expression levels at 96 h of exposure, yet by 96 h of recovery, no genes were significantly altered in expression. In the liver at 10 mgl(-1), only five genes were changed at 24 h, yet 192 genes had altered expression after 96 h recovery. At 2 mgl(-1) in the liver, many genes had altered regulation at all three time points. The 0.4 mgl(-1) loading also showed 289 genes upregulated at 24 h after exposure. The Gene Ontology terms associated with altered expression in the liver suggested that the processes of protein synthesis, xenobiotic metabolism, and oxidoreductase activity were altered. The concentration-responsive expression profile of cytochrome P450 1A, a biomarker for oil exposure, did not predict the majority of gene expression profiles in any tissue or dose, since direct relationships with dose were not observed for most genes. While the genes and their associated functions agree with known modes of toxic action for crude oil, the gene lists obtained do not match our previously published work, presumably due to array analysis procedures. These results demonstrate that changes in gene expression with time and dose may be complicated, and should be characterized in controlled laboratory settings before attempts are made to interpret responses in field-collected organisms. Further, processes for analyzing microarray data need to be developed such that standardized gene lists are developed, or that analysis does not rely on lists of significantly altered genes before arrays can be further evaluated as a monitoring tool. Crown Copyright 2010. Published by Elsevier B.V. All rights reserved.

Identification of Early Response Genes in Human Peripheral Leukocytes Infected with Orientia tsutsugamushi: The Emergent of a Unique Gene Expression Profile for Diagnosis of O. tsutsugamush Infection

DTIC Science & Technology

2010-01-01

dynein to move from the cell periphery to the microtubule organizing center [22]. Therefore, the initial interactions between host and intracellular...used to study host-pathogen interactions , mainly by identifying genes from pathogens that may be involved in pathogenecity and by surveying the scope...toward understanding the host-Orientia tsutsugamushi interaction at the molecular level, we used human cDNA microarray technology to examine in detail

Single Cell Characterization of Prostate Cancer-Circulating Tumor Cells

DTIC Science & Technology

2013-09-01

prostate cancer using RT- PCR [8] and EGFR mutations in non-small cell lung cancer [45]. Microarray-based assessments of gene expression have been carried...analysis. DAPI negative putative CTCs were isolated in 1 ul of 10% Superblock/PBS with a pipetteman into a 0.2 ml PCR tube containing 2.5 ul of 5...Sequencing kit (Clontech). cDNA was amplified using the Advantage 2 PCR kit (Clontech) for 18–25 cycles prior to conversion into a Illumina compatible DNA

Electronic hybridization detection in microarray format and DNA genotyping

NASA Astrophysics Data System (ADS)

Blin, Antoine; Cissé, Ismaïl; Bockelmann, Ulrich

2014-02-01

We describe an approach to substituting a fluorescence microarray with a surface made of an arrangement of electrolyte-gated field effect transistors. This was achieved using a dedicated blocking of non-specific interactions and comparing threshold voltage shifts of transistors exhibiting probe molecules of different base sequence. We apply the approach to detection of the 35delG mutation, which is related to non-syndromic deafness and is one of the most frequent mutations in humans. The process involves barcode sequences that are generated by Tas-PCR, a newly developed replication reaction using polymerase blocking. The barcodes are recognized by hybridization to surface attached probes and are directly detected by the semiconductor device.

Electronic hybridization detection in microarray format and DNA genotyping

PubMed Central

Blin, Antoine; Cissé, Ismaïl; Bockelmann, Ulrich

2014-01-01

We describe an approach to substituting a fluorescence microarray with a surface made of an arrangement of electrolyte-gated field effect transistors. This was achieved using a dedicated blocking of non-specific interactions and comparing threshold voltage shifts of transistors exhibiting probe molecules of different base sequence. We apply the approach to detection of the 35delG mutation, which is related to non-syndromic deafness and is one of the most frequent mutations in humans. The process involves barcode sequences that are generated by Tas-PCR, a newly developed replication reaction using polymerase blocking. The barcodes are recognized by hybridization to surface attached probes and are directly detected by the semiconductor device. PMID:24569823

Isolation of epidermal cells and cDNA cloning of TNF decoy receptor 3 of conger eel, Conger myriaster.

PubMed

Tsutsui, Shigeyuki; Yoshino, Yuko; Matsui, Saho; Nakamura, Osamu; Muramoto, Koji; Watanabe, Tasuku

2008-03-01

By using EDTA and a trypsin solution, we established a method for isolating the epidermal cells of the conger eel, Conger myriaster. We then identified TNF decoy receptor (DcR) cDNA in the species from a suppression subtractive hybridization library prepared from the epidermal cells stimulated with LPS. The full-length cDNA of conger TNF DcR (conDcR) consisted of 1479 base pairs, and the protein comprised 286 amino acid residues. Phylogenetic analysis indicated that conDcR was clustered into a DcR3 branch. ConDcR is likely to act as an important immune-regulating factor in inhibiting the apoptosis-inducing effect of TNF in the skin of conger eel.

Molecular genetic analysis of the V kappa Ser group associated with two mouse light chain genetic markers. Complementary DNA cloning and southern hybridization analysis

PubMed Central

1985-01-01

Previous studies (21) have shown that two mouse kappa light (L) chain variable (V) region polymorphisms, the IB-peptide and Efla markers, reflect expression of a characteristic group of V kappa regions, called V kappa Ser, by some inbred strains and not others. Expression of V kappa Ser is controlled by a locus on chromosome 6, the chromosome that contains the kappa locus. To further characterize this V kappa group and begin to analyze the basis for its strain-specific expression, full- length complementary DNA (cDNA) copies were produced of L chain mRNA from the M75 myeloma that had been induced in the C.C58 strain of mice, and which produces a V kappa Ser L chain. The C.C58 strain is congenic with BALB/cAn, differing in the region of chromosome 6 that controls expression of the V kappa polymorphisms and the Lyt-2 and Lyt-3 T cell alloantigens. The complete nucleotide sequence of this cloned cDNA was determined and compared with the nucleotide sequences the most closely related BALB/c myeloma L chains known. Results indicated significant differences throughout the variable region, but particularly toward the 5' portion of the sequence. A probe corresponding to 200 bp of the 5' end of the cloned V kappa Ser cDNA was used in Southern hybridizations of restriction digests of liver DNA from a number of inbred, recombinant, and recombinant inbred strains. Under stringent hybridization conditions, one strongly-hybridizing fragment was observed in Bam HI, Hind III, and Eco RI digests, and based on the size of the fragments, strains could be organized into two groups. The presence of strongly hybridizing Bam HI, Hind III, and Eco RI fragments of 3.2, 2.8, and 2.1 kb, respectively, was found to correlate completely with expression by the strain of the IB-peptide and Efla markers. All nonexpressor strains yielded hybridizing fragments of 7.8, 8.4, and 2.8 kb, respectively. Possible explanations for strain- specific expression of V kappa Ser-associated phenotypic markers are discussed. PMID:3926938

Genetic validation of whole-transcriptome sequencing for mapping expression affected by cis-regulatory variation.

PubMed

Babak, Tomas; Garrett-Engele, Philip; Armour, Christopher D; Raymond, Christopher K; Keller, Mark P; Chen, Ronghua; Rohl, Carol A; Johnson, Jason M; Attie, Alan D; Fraser, Hunter B; Schadt, Eric E

2010-08-13

Identifying associations between genotypes and gene expression levels using microarrays has enabled systematic interrogation of regulatory variation underlying complex phenotypes. This approach has vast potential for functional characterization of disease states, but its prohibitive cost, given hundreds to thousands of individual samples from populations have to be genotyped and expression profiled, has limited its widespread application. Here we demonstrate that genomic regions with allele-specific expression (ASE) detected by sequencing cDNA are highly enriched for cis-acting expression quantitative trait loci (cis-eQTL) identified by profiling of 500 animals in parallel, with up to 90% agreement on the allele that is preferentially expressed. We also observed widespread noncoding and antisense ASE and identified several allele-specific alternative splicing variants. Monitoring ASE by sequencing cDNA from as little as one sample is a practical alternative to expression genetics for mapping cis-acting variation that regulates RNA transcription and processing.

PhylArray: phylogenetic probe design algorithm for microarray.

PubMed

Militon, Cécile; Rimour, Sébastien; Missaoui, Mohieddine; Biderre, Corinne; Barra, Vincent; Hill, David; Moné, Anne; Gagne, Geneviève; Meier, Harald; Peyretaillade, Eric; Peyret, Pierre

2007-10-01

Microbial diversity is still largely unknown in most environments, such as soils. In order to get access to this microbial 'black-box', the development of powerful tools such as microarrays are necessary. However, the reliability of this approach relies on probe efficiency, in particular sensitivity, specificity and explorative power, in order to obtain an image of the microbial communities that is close to reality. We propose a new probe design algorithm that is able to select microarray probes targeting SSU rRNA at any phylogenetic level. This original approach, implemented in a program called 'PhylArray', designs a combination of degenerate and non-degenerate probes for each target taxon. Comparative experimental evaluations indicate that probes designed with PhylArray yield a higher sensitivity and specificity than those designed by conventional approaches. Applying the combined PhyArray/GoArrays strategy helps to optimize the hybridization performance of short probes. Finally, hybridizations with environmental targets have shown that the use of the PhylArray strategy can draw attention to even previously unknown bacteria.

Surface plasmon resonance imaging system with Mach-Zehnder phase-shift interferometry for DNA micro-array hybridization

NASA Astrophysics Data System (ADS)

Hsiu, Feng-Ming; Chen, Shean-Jen; Tsai, Chien-Hung; Tsou, Chia-Yuan; Su, Y.-D.; Lin, G.-Y.; Huang, K.-T.; Chyou, Jin-Jung; Ku, Wei-Chih; Chiu, S.-K.; Tzeng, C.-M.

2002-09-01

Surface plasmon resonance (SPR) imaging system is presented as a novel technique based on modified Mach-Zehnder phase-shifting interferometry (PSI) for biomolecular interaction analysis (BIA), which measures the spatial phase variation of a resonantly reflected light in biomolecular interaction. In this technique, the micro-array SPR biosensors with over a thousand probe NDA spots can be detected simultaneously. Owing to the feasible and swift measurements, the micro-array SPR biosensors can be extensively applied to the nonspecific adsorption of protein, the membrane/protein interactions, and DNA hybridization. The detection sensitivity of the SPR PSI imaging system is improved to about 1 pg/mm2 for each spot over the conventional SPR imaging systems. The SPR PSI imaging system and its SPR sensors have been successfully used to observe slightly index change in consequence of argon gas flow through the nitrogen in real time, with high sensitivity, and at high-throughout screening rates.

Suppression subtractive hybridization as a tool to identify anthocyanin metabolism-related genes in apple skin.

PubMed

Ban, Yusuke; Moriguchi, Takaya

2010-01-01

The pigmentation of anthocyanins is one of the important determinants for consumer preference and marketability in horticultural crops such as fruits and flowers. To elucidate the mechanisms underlying the physiological process leading to the pigmentation of anthocyanins, identification of the genes differentially expressed in response to anthocyanin accumulation is a useful strategy. Currently, microarrays have been widely used to isolate differentially expressed genes. However, the use of microarrays is limited by its high cost of special apparatus and materials. Therefore, availability of microarrays is limited and does not come into common use at present. Suppression subtractive hybridization (SSH) is an alternative tool that has been widely used to identify differentially expressed genes due to its easy handling and relatively low cost. This chapter describes the procedures for SSH, including RNA extraction from polysaccharides and polyphenol-rich samples, poly(A)+ RNA purification, evaluation of subtraction efficiency, and differential screening using reverse northern in apple skin.

Screening of eye-position related genes with DD-RT-PCR and RDA in the hybrids between Japanese flounder Paralichthys olivaceus and stone flounder Kareius bicoloratus

NASA Astrophysics Data System (ADS)

Chen, Yanjie; Zhang, Quanqi; Qi, Jie; Sun, Yeying; Zhong, Qiwang; Wang, Xubo; Wang, Zhigang; Li, Shuo; Li, Chunmei

2009-02-01

Flatfish or flounder moves one eye to change body proportion into vertebral asymmetry during metamorphosis, during which some become sinistral while others dextral. However, the mechanism behinds the eye-position has not been well understood. In this research, hybrids between Japanese flounder(♀) and stone flounder (♂) show mixed eye-location in both dextral type and sinistral type, and thus become good samples for studying the eye-migration. mRNAs from pro-metamorphosis sinistral and dextral hybrids larvae were screened with classical differential display RT-PCR (DD-RT-PCR) and representational difference analysis of cDNA (cDNA-RDA); 30 and 47 putative fragments were isolated, respectively. The cDNA fragments of creatine kinase and trypsinogen 2 precursor genes isolated by cDNA-RDA exhibited eye-position expression patterns during metamorphosis. However, none of the fragments was proved to be related to flatfishes’ eye-position specifically. Therefore, further studies and more sensitive gene isolated methods are needed to solve the problems.

ChIP-chip.

PubMed

Kim, Tae Hoon; Dekker, Job

2018-05-01

ChIP-chip can be used to analyze protein-DNA interactions in a region-wide and genome-wide manner. DNA microarrays contain PCR products or oligonucleotide probes that are designed to represent genomic sequences. Identification of genomic sites that interact with a specific protein is based on competitive hybridization of the ChIP-enriched DNA and the input DNA to DNA microarrays. The ChIP-chip protocol can be divided into two main sections: Amplification of ChIP DNA and hybridization of ChIP DNA to arrays. A large amount of DNA is required to hybridize to DNA arrays, and hybridization to a set of multiple commercial arrays that represent the entire human genome requires two rounds of PCR amplifications. The relative hybridization intensity of ChIP DNA and that of the input DNA is used to determine whether the probe sequence is a potential site of protein-DNA interaction. Resolution of actual genomic sites bound by the protein is dependent on the size of the chromatin and on the genomic distance between the probes on the array. As with expression profiling using gene chips, ChIP-chip experiments require multiple replicates for reliable statistical measure of protein-DNA interactions. © 2018 Cold Spring Harbor Laboratory Press.

Analysis of Protein-DNA Interaction by Chromatin Immunoprecipitation and DNA Tiling Microarray (ChIP-on-chip).

PubMed

Gao, Hui; Zhao, Chunyan

2018-01-01

Chromatin immunoprecipitation (ChIP) has become the most effective and widely used tool to study the interactions between specific proteins or modified forms of proteins and a genomic DNA region. Combined with genome-wide profiling technologies, such as microarray hybridization (ChIP-on-chip) or massively parallel sequencing (ChIP-seq), ChIP could provide a genome-wide mapping of in vivo protein-DNA interactions in various organisms. Here, we describe a protocol of ChIP-on-chip that uses tiling microarray to obtain a genome-wide profiling of ChIPed DNA.

Replication dynamics of the yeast genome.

PubMed

Raghuraman, M K; Winzeler, E A; Collingwood, D; Hunt, S; Wodicka, L; Conway, A; Lockhart, D J; Davis, R W; Brewer, B J; Fangman, W L

2001-10-05

Oligonucleotide microarrays were used to map the detailed topography of chromosome replication in the budding yeast Saccharomyces cerevisiae. The times of replication of thousands of sites across the genome were determined by hybridizing replicated and unreplicated DNAs, isolated at different times in S phase, to the microarrays. Origin activations take place continuously throughout S phase but with most firings near mid-S phase. Rates of replication fork movement vary greatly from region to region in the genome. The two ends of each of the 16 chromosomes are highly correlated in their times of replication. This microarray approach is readily applicable to other organisms, including humans.

Interlaboratory comparison of immunohistochemical testing for HER2: results of the 2004 and 2005 College of American Pathologists HER2 Immunohistochemistry Tissue Microarray Survey.

PubMed

Fitzgibbons, Patrick L; Murphy, Douglas A; Dorfman, David M; Roche, Patrick C; Tubbs, Raymond R

2006-10-01

Correct assessment of human epidermal growth factor receptor 2 (HER2) status is essential in managing patients with invasive breast carcinoma, but few data are available on the accuracy of laboratories performing HER2 testing by immunohistochemistry (IHC). To review the results of the 2004 and 2005 College of American Pathologists HER2 Immunohistochemistry Tissue Microarray Survey. The HER2 survey is designed for laboratories performing immunohistochemical staining and interpretation for HER2. The survey uses tissue microarrays, each consisting of ten 3-mm tissue cores obtained from different invasive breast carcinomas. All cases are also analyzed by fluorescence in situ hybridization. Participants receive 8 tissue microarrays (80 cases) with instructions to perform immunostaining for HER2 using the laboratory's standard procedures. The laboratory interprets the stained slides and returns results to the College of American Pathologists for analysis. In 2004 and 2005, a core was considered "graded" when at least 90% of laboratories agreed on the result--negative (0, 1+) versus positive (2+, 3+). This interlaboratory comparison survey included 102 laboratories in 2004 and 141 laboratories in 2005. Of the 160 cases in both surveys, 111 (69%) achieved 90% consensus (graded). All 43 graded cores scored as IHC-positive were fluorescence in situ hybridization-positive, whereas all but 3 of the 68 IHC-negative graded cores were fluorescence in situ hybridization-negative. Ninety-seven (95%) of 102 laboratories in 2004 and 129 (91%) of 141 laboratories in 2005 correctly scored at least 90% of the graded cores. Performance among laboratories performing HER2 IHC in this tissue microarray-based survey was excellent. Cores found to be IHC-positive or IHC-negative by participant consensus can be used as validated benchmarks for interlaboratory comparison, allowing laboratories to assess their performance and determine if improvements are needed.

Transcriptome profiling of Pinus radiata juvenile wood with contrasting stiffness identifies putative candidate genes involved in microfibril orientation and cell wall mechanics

PubMed Central

2011-01-01

Background The mechanical properties of wood are largely determined by the orientation of cellulose microfibrils in secondary cell walls. Several genes and their allelic variants have previously been found to affect microfibril angle (MFA) and wood stiffness; however, the molecular mechanisms controlling microfibril orientation and mechanical strength are largely uncharacterised. In the present study, cDNA microarrays were used to compare gene expression in developing xylem with contrasting stiffness and MFA in juvenile Pinus radiata trees in order to gain further insights into the molecular mechanisms underlying microfibril orientation and cell wall mechanics. Results Juvenile radiata pine trees with higher stiffness (HS) had lower MFA in the earlywood and latewood of each ring compared to low stiffness (LS) trees. Approximately 3.4 to 14.5% out of 3, 320 xylem unigenes on cDNA microarrays were differentially regulated in juvenile wood with contrasting stiffness and MFA. Greater variation in MFA and stiffness was observed in earlywood compared to latewood, suggesting earlywood contributes most to differences in stiffness; however, 3-4 times more genes were differentially regulated in latewood than in earlywood. A total of 108 xylem unigenes were differentially regulated in juvenile wood with HS and LS in at least two seasons, including 43 unigenes with unknown functions. Many genes involved in cytoskeleton development and secondary wall formation (cellulose and lignin biosynthesis) were preferentially transcribed in wood with HS and low MFA. In contrast, several genes involved in cell division and primary wall synthesis were more abundantly transcribed in LS wood with high MFA. Conclusions Microarray expression profiles in Pinus radiata juvenile wood with contrasting stiffness has shed more light on the transcriptional control of microfibril orientation and the mechanical properties of wood. The identified candidate genes provide an invaluable resource for further gene function and association genetics studies aimed at deepening our understanding of cell wall biomechanics with a view to improving the mechanical properties of wood. PMID:21962175

Male sex interspecies divergence and down regulation of expression of spermatogenesis genes in Drosophila sterile hybrids.

PubMed

Sundararajan, Vignesh; Civetta, Alberto

2011-01-01

Male sex genes have shown a pattern of rapid interspecies divergence at both the coding and gene expression level. A common outcome from crosses between closely-related species is hybrid male sterility. Phenotypic and genetic studies in Drosophila sterile hybrid males have shown that spermatogenesis arrest is postmeiotic with few exceptions, and that most misregulated genes are involved in late stages of spermatogenesis. Comparative studies of gene regulation in sterile hybrids and parental species have mainly used microarrays providing a whole genome representation of regulatory problems in sterile hybrids. Real-time PCR studies can reject or reveal differences not observed in microarray assays. Moreover, differences in gene expression between samples can be dependant on the source of RNA (e.g., whole body vs. tissue). Here we survey expression in D. simulans, D. mauritiana and both intra and interspecies hybrids using a real-time PCR approach for eight genes expressed at the four main stages of sperm development. We find that all genes show a trend toward under expression in the testes of sterile hybrids relative to parental species with only the two proliferation genes (bam and bgcn) and the two meiotic class genes (can and sa) showing significant down regulation. The observed pattern of down regulation for the genes tested can not fully explain hybrid male sterility. We discuss the down regulation of spermatogenesis genes in hybrids between closely-related species within the contest of rapid divergence experienced by the male genome, hybrid sterility and possible allometric changes due to subtle testes-specific developmental abnormalities.

Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins.

PubMed

Shaw, Joseph R; Colbourne, John K; Davey, Jennifer C; Glaholt, Stephen P; Hampton, Thomas H; Chen, Celia Y; Folt, Carol L; Hamilton, Joshua W

2007-12-21

Genomic research tools such as microarrays are proving to be important resources to study the complex regulation of genes that respond to environmental perturbations. A first generation cDNA microarray was developed for the environmental indicator species Daphnia pulex, to identify genes whose regulation is modulated following exposure to the metal stressor cadmium. Our experiments revealed interesting changes in gene transcription that suggest their biological roles and their potentially toxicological features in responding to this important environmental contaminant. Our microarray identified genes reported in the literature to be regulated in response to cadmium exposure, suggested functional attributes for genes that share no sequence similarity to proteins in the public databases, and pointed to genes that are likely members of expanded gene families in the Daphnia genome. Genes identified on the microarray also were associated with cadmium induced phenotypes and population-level outcomes that we experimentally determined. A subset of genes regulated in response to cadmium exposure was independently validated using quantitative-realtime (Q-RT)-PCR. These microarray studies led to the discovery of three genes coding for the metal detoxication protein metallothionein (MT). The gene structures and predicted translated sequences of D. pulex MTs clearly place them in this gene family. Yet, they share little homology with previously characterized MTs. The genomic information obtained from this study represents an important first step in characterizing microarray patterns that may be diagnostic to specific environmental contaminants and give insights into their toxicological mechanisms, while also providing a practical tool for evolutionary, ecological, and toxicological functional gene discovery studies. Advances in Daphnia genomics will enable the further development of this species as a model organism for the environmental sciences.

Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins

PubMed Central

Shaw, Joseph R; Colbourne, John K; Davey, Jennifer C; Glaholt, Stephen P; Hampton, Thomas H; Chen, Celia Y; Folt, Carol L; Hamilton, Joshua W

2007-01-01

Background Genomic research tools such as microarrays are proving to be important resources to study the complex regulation of genes that respond to environmental perturbations. A first generation cDNA microarray was developed for the environmental indicator species Daphnia pulex, to identify genes whose regulation is modulated following exposure to the metal stressor cadmium. Our experiments revealed interesting changes in gene transcription that suggest their biological roles and their potentially toxicological features in responding to this important environmental contaminant. Results Our microarray identified genes reported in the literature to be regulated in response to cadmium exposure, suggested functional attributes for genes that share no sequence similarity to proteins in the public databases, and pointed to genes that are likely members of expanded gene families in the Daphnia genome. Genes identified on the microarray also were associated with cadmium induced phenotypes and population-level outcomes that we experimentally determined. A subset of genes regulated in response to cadmium exposure was independently validated using quantitative-realtime (Q-RT)-PCR. These microarray studies led to the discovery of three genes coding for the metal detoxication protein metallothionein (MT). The gene structures and predicted translated sequences of D. pulex MTs clearly place them in this gene family. Yet, they share little homology with previously characterized MTs. Conclusion The genomic information obtained from this study represents an important first step in characterizing microarray patterns that may be diagnostic to specific environmental contaminants and give insights into their toxicological mechanisms, while also providing a practical tool for evolutionary, ecological, and toxicological functional gene discovery studies. Advances in Daphnia genomics will enable the further development of this species as a model organism for the environmental sciences. PMID:18154678

Transcriptional Analysis of Resistance to Low Temperatures in Bermudagrass Crown Tissues

PubMed Central

Melmaiee, Kalpalatha; Anderson, Michael; Elavarthi, Sathya; Guenzi, Arron; Canaan, Patricia

2015-01-01

Bermudagrass (Cynodon dactylon L pers.) is one of the most geographically adapted and utilized of the warm-season grasses. However, bermudagrass adaptation to the Northern USA is limited by freeze damage and winterkill. Our study provides the first large-scale analyses of gene expression in bermudagrass regenerative crown tissues during cold acclimation. We compared gene expression patterns in crown tissues from highly cold tolerant “MSU” and susceptible “Zebra” genotypes exposed to near-freezing temperatures. Suppressive subtractive hybridization was used to isolate putative cold responsive genes Approximately, 3845 transcript sequences enriched for cold acclimation were deposited in the GenBank. A total of 4589 ESTs (3184 unigenes) including 744 ESTs associated with the bermudagrass disease spring dead spot were printed on microarrays and hybridized with cold acclimated complementary Deoxyribonucleic acid (cDNA). A total of 587 differentially expressed unigenes were identified in this study. Of these only 97 (17%) showed significant NCBI matches. The overall expression pattern revealed 40% more down- than up-regulated genes, which was particularly enhanced in MSU compared to Zebra. Among the up-regulated genes 68% were uniquely expressed in MSU (36%) or Zebra (32%). Among the down-regulated genes 40% were unique to MSU, while only 15% to Zebra. Overall expression intensity was significantly higher in MSU than in Zebra (p value ≤ 0.001) and the overall number of genes expressed at 28 days was 2.7 fold greater than at 2 days. These changes in expression patterns reflect the strong genotypic and temporal response to cold temperatures. Additionally, differentially expressed genes from this study can be utilized for developing molecular markers in bermudagrass and other warm season grasses for enhancing cold hardiness. PMID:26348040

The chorionic gonadotropin alpha-subunit gene is on human chromosome 18 in JEG cells.

PubMed Central

Hardin, J W; Riser, M E; Trent, J M; Kohler, P O

1983-01-01

The gene for the alpha subunit of human chorionic gonadotropin (hCG) has been tentatively assigned to human chromosome 18. This localization was accomplished through the use of Southern blot analysis. A full-length cDNA probe for the hCG alpha subunit and DNA isolated from a series of somatic hybrids between mouse and human cells were utilized to make this assignment. In addition, in situ hybridization with normal human peripheral blood lymphocytes as a source of human chromosomes and with the same cDNA probe confirmed this result. The presence of human chromosome 18 was required for the detection of DNA fragments characteristic of the alpha-hCG gene. These results are consistent with our previous observation that human chromosomes 10 and 18 are required for the production of hCG in cultured cells. Images PMID:6578509

The heterogeneity of human mesenchymal stem cell preparations--evidence from simultaneous analysis of proteomes and transcriptomes.

PubMed

Wagner, Wolfgang; Feldmann, Robert E; Seckinger, Anja; Maurer, Martin H; Wein, Frederik; Blake, Jonathon; Krause, Ulf; Kalenka, Armin; Bürgers, Heinrich F; Saffrich, Rainer; Wuchter, Patrick; Kuschinsky, Wolfgang; Ho, Anthony D

2006-04-01

Mesenchymal stem cells (MSC) raise high hopes in clinical applications. However, the lack of common standards and a precise definition of MSC preparations remains a major obstacle in research and application of MSC. Whereas surface antigen markers have failed to precisely define this population, a combination of proteomic data and microarray data provides a new dimension for the definition of MSC preparations. In our continuing effort to characterize MSC, we have analyzed the differential transcriptome and proteome expression profiles of MSC preparations isolated from human bone marrow under two different expansion media (BM-MSC-M1 and BM-MSC-M2). In proteomics, 136 protein spots were unambiguously identified by MALDI-TOF-MS and corresponding cDNA spots were selected on our "Human Transcriptome cDNA Microarray." Combination of datasets revealed a correlation in differential gene expression and protein expression of BM-MSC-M1 vs BM-MSC-M2. Genes involved in metabolism were more highly expressed in BM-MSC-M1, whereas genes involved in development, morphogenesis, extracellular matrix, and differentiation were more highly expressed in BM-MSC-M2. Interchanging culture conditions for 8 days revealed that differential expression was retained in several genes whereas it was altered in others. Our results have provided evidence that homogeneous BM-MSC preparations can reproducibly be isolated under standardized conditions, whereas culture conditions exert a prominent impact on transcriptome, proteome, and cellular organization of BM-MSC.

Comparison of gene-expression profiles between diffuse- and intestinal-type gastric cancers using a genome-wide cDNA microarray.

PubMed

Jinawath, Natini; Furukawa, Yoichi; Hasegawa, Suguru; Li, Meihua; Tsunoda, Tatsuhiko; Satoh, Seiji; Yamaguchi, Toshiharu; Imamura, Hiroshi; Inoue, Masatomo; Shiozaki, Hitoshi; Nakamura, Yusuke

2004-09-02

Gastric cancer is the fourth leading cause of cancer-related death in the world. Two histologically distinct types of gastric carcinoma, 'intestinal' and 'diffuse', have different epidemiological and pathophysiological features that suggest different mechanisms of carcinogenesis. A number of studies have investigated intestinal-type gastric cancers at the molecular level, but little is known about mechanisms involved in the diffuse type, which has a more invasive phenotype and poorer prognosis. To clarify the mechanisms that underlie its development and/or progression, we compared the expression profiles of 20 laser-microbeam-microdissected diffuse-type gastric-cancer tissues with corresponding noncancerous mucosae by means of a cDNA microarray containing 23,040 genes. We identified 153 genes that were commonly upregulated and more than 1500 that were commonly downregulated in the tumors. We also identified a number of genes related to tumor progression. Furthermore, comparison of the expression profiles of diffuse-type with those of intestinal-type gastric cancers identified 46 genes that may represent distinct molecular signatures of each histological type. The putative signature of diffuse-type cancer exhibited altered expression of genes related to cell-matrix interaction and extracellular-matrix (ECM) components, whereas that of intestinal-type cancer represented enhancement of cell growth. These data provide insight into different mechanisms underlying gastric carcinogenesis and may also serve as a starting point for identifying novel diagnostic markers and/or therapeutic targets for diffuse-type gastric cancers.

Development of a cDNA microarray to identify gene expression of Puccinellia tenuiflora under saline-alkali stress.

PubMed

Wang, Yucheng; Yang, Chuanping; Liu, Guifeng; Jiang, Jing

2007-08-01

Puccinellia tenuiflora is the main grass species growing in the saline-alkali soil of the Songnen plain in northeastern China, suggesting it has a high tolerance to saline stress. In this study, cDNA microarrays containing 1067 clones of P. tenuiflora were constructed to investigate gene expression patterns resulting from saline-alkali (NaHCO(3)) stress. RNA was extracted from P. tenuiflora treated with 400 mmol L(-1) NaHCO(3) for 6, 12, 24 and 48 h. Untreated (no saline-alkali stress) samples were used as control. A total of 95 transcripts were differentially regulated under the conditions studied, and 38, 35, 25 and 49 genes were differentially expressed with NaHCO(3) stress for 6, 12, 24 and 48h, respectively. Among these, approximately 40% were putative novel or functionally unknown genes, and the remainder function in photosynthesis, cell rescue, defense, transport, metabolism, transcription regulation and protein destination, etc. Analysis of the P. tenuiflora genes demonstrated the complexity of, and differences in, gene expression patterns resulting from different NaHCO(3) stress times. The genetic relationship between P. tenuiflora and other plants was investigated by BlastN analysis. The results showed nearly 20% of the expressed sequence tags from P. tenuiflora shared significant similarities with rice Oryza sativa, an important food crop. The close genetic relationship between these two species suggests that P. tenuiflora may be a good plant model for studying saline-alkali tolerance mechanisms in O. sativa.

Studies of the effects of Vilon and Epithalon on gene expression in mouse heart using DNA-microarray technology.

PubMed

Anisimov, S V; Bokheler, K R; Khavinson, V Kh; Anisimov, V N

2002-03-01

Expression of 15,247 clones from a cDNA library in the heart of mice receiving Vilon and Epithalon was studied by DNA-microarray technology. We revealed 300 clones (1.94% of the total count), whose expression changed more than by 2 times. Vilon changed expression of 36 clones, while Epithalon modulated expression of 98 clones. Combined treatment with Vilon and Epithalon changed expression of 144 clones. Vilon alone or in combination with Epithalon activated expression of 157 clones (maximally by 6.13 times) and inhibited expression of 23 clones (maximally by 2.79 times). Epithalon alone or in combination with Vilon activated expression of 194 clones (maximally by 6.61 times) and inhibited expression of 48 clones (maximally by 2.71 times). Our results demonstrate the specific effects of Epithalon and Vilon on gene expression.

Gene expression profiling in respond to TBT exposure in small abalone Haliotis diversicolor.

PubMed

Jia, Xiwei; Zou, Zhihua; Wang, Guodong; Wang, Shuhong; Wang, Yilei; Zhang, Ziping

2011-10-01

In this study, we investigated the gene expression profiling of small abalone, Haliotis diversicolor by tributyltin (TBT) exposure using a cDNA microarray containing 2473 unique transcripts. Totally, 107 up-regulated genes and 41 down-regulated genes were found. For further investigation of candidate genes from microarray data and EST analysis, quantitative real-time PCR was performed at 6 h, 24 h, 48 h, 96 h and 192 h TBT exposure. 26 genes were found to be significantly differentially expressed in different time course, 3 of them were unknown. Some gene homologues like cellulose, endo-beta-1,4-glucanase, ferritin subunit 1 and thiolester containing protein II CG7052-PB might be the good biomarker candidate for TBT monitor. The identification of stress response genes and their expression profiles will permit detailed investigation of the defense responses of small abalone genes. Published by Elsevier Ltd.

Gene transcription in Daphnia magna: effects of acute exposure to a carbamate insecticide and an acetanilide herbicide.

PubMed

Pereira, Joana Luísa; Hill, Christopher J; Sibly, Richard M; Bolshakov, Viacheslav N; Gonçalves, Fernando; Heckmann, Lars-Henrik; Callaghan, Amanda

2010-05-05

Daphnia magna is a key invertebrate in the freshwater environment and is used widely as a model in ecotoxicological measurements and risk assessment. Understanding the genomic responses of D. magna to chemical challenges will be of value to regulatory authorities worldwide. Here we exposed D. magna to the insecticide methomyl and the herbicide propanil to compare phenotypic effects with changes in mRNA expression levels. Both pesticides are found in drainage ditches and surface water bodies standing adjacent to crops. Methomyl, a carbamate insecticide widely used in agriculture, inhibits acetylcholinesterase, a key enzyme in nerve transmission. Propanil, an acetanilide herbicide, is used to control grass and broad-leaf weeds. The phenotypic effects of single doses of each chemical were evaluated using a standard immobilisation assay. Immobilisation was linked to global mRNA expression levels using the previously estimated 48h-EC(1)s, followed by hybridization to a cDNA microarray with more than 13,000 redundant cDNA clones representing >5000 unique genes. Following exposure to methomyl and propanil, differential expression was found for 624 and 551 cDNAs, respectively (one-way ANOVA with Bonferroni correction, P

Improvement in the amine glass platform by bubbling method for a DNA microarray

PubMed Central

Jee, Seung Hyun; Kim, Jong Won; Lee, Ji Hyeong; Yoon, Young Soo

2015-01-01

A glass platform with high sensitivity for sexually transmitted diseases microarray is described here. An amino-silane-based self-assembled monolayer was coated on the surface of a glass platform using a novel bubbling method. The optimized surface of the glass platform had highly uniform surface modifications using this method, as well as improved hybridization properties with capture probes in the DNA microarray. On the basis of these results, the improved glass platform serves as a highly reliable and optimal material for the DNA microarray. Moreover, in this study, we demonstrated that our glass platform, manufactured by utilizing the bubbling method, had higher uniformity, shorter processing time, lower background signal, and higher spot signal than the platforms manufactured by the general dipping method. The DNA microarray manufactured with a glass platform prepared using bubbling method can be used as a clinical diagnostic tool. PMID:26468293

Improvement in the amine glass platform by bubbling method for a DNA microarray.

PubMed

Jee, Seung Hyun; Kim, Jong Won; Lee, Ji Hyeong; Yoon, Young Soo

2015-01-01

A glass platform with high sensitivity for sexually transmitted diseases microarray is described here. An amino-silane-based self-assembled monolayer was coated on the surface of a glass platform using a novel bubbling method. The optimized surface of the glass platform had highly uniform surface modifications using this method, as well as improved hybridization properties with capture probes in the DNA microarray. On the basis of these results, the improved glass platform serves as a highly reliable and optimal material for the DNA microarray. Moreover, in this study, we demonstrated that our glass platform, manufactured by utilizing the bubbling method, had higher uniformity, shorter processing time, lower background signal, and higher spot signal than the platforms manufactured by the general dipping method. The DNA microarray manufactured with a glass platform prepared using bubbling method can be used as a clinical diagnostic tool.

Revisiting adverse effects of cross-hybridization in Affymetrix gene expression data: do they matter for correlation analysis?

PubMed

Klebanov, Lev; Chen, Linlin; Yakovlev, Andrei

2007-11-07

This work was undertaken in response to a recently published paper by Okoniewski and Miller (BMC Bioinformatics 2006, 7: Article 276). The authors of that paper came to the conclusion that the process of multiple targeting in short oligonucleotide microarrays induces spurious correlations and this effect may deteriorate the inference on correlation coefficients. The design of their study and supporting simulations cast serious doubt upon the validity of this conclusion. The work by Okoniewski and Miller drove us to revisit the issue by means of experimentation with biological data and probabilistic modeling of cross-hybridization effects. We have identified two serious flaws in the study by Okoniewski and Miller: (1) The data used in their paper are not amenable to correlation analysis; (2) The proposed simulation model is inadequate for studying the effects of cross-hybridization. Using two other data sets, we have shown that removing multiply targeted probe sets does not lead to a shift in the histogram of sample correlation coefficients towards smaller values. A more realistic approach to mathematical modeling of cross-hybridization demonstrates that this process is by far more complex than the simplistic model considered by the authors. A diversity of correlation effects (such as the induction of positive or negative correlations) caused by cross-hybridization can be expected in theory but there are natural limitations on the ability to provide quantitative insights into such effects due to the fact that they are not directly observable. The proposed stochastic model is instrumental in studying general regularities in hybridization interaction between probe sets in microarray data. As the problem stands now, there is no compelling reason to believe that multiple targeting causes a large-scale effect on the correlation structure of Affymetrix gene expression data. Our analysis suggests that the observed long-range correlations in microarray data are of a biological nature rather than a technological flaw.

Thermodynamically optimal whole-genome tiling microarray design and validation.

PubMed

Cho, Hyejin; Chou, Hui-Hsien

2016-06-13

Microarray is an efficient apparatus to interrogate the whole transcriptome of species. Microarray can be designed according to annotated gene sets, but the resulted microarrays cannot be used to identify novel transcripts and this design method is not applicable to unannotated species. Alternatively, a whole-genome tiling microarray can be designed using only genomic sequences without gene annotations, and it can be used to detect novel RNA transcripts as well as known genes. The difficulty with tiling microarray design lies in the tradeoff between probe-specificity and coverage of the genome. Sequence comparison methods based on BLAST or similar software are commonly employed in microarray design, but they cannot precisely determine the subtle thermodynamic competition between probe targets and partially matched probe nontargets during hybridizations. Using the whole-genome thermodynamic analysis software PICKY to design tiling microarrays, we can achieve maximum whole-genome coverage allowable under the thermodynamic constraints of each target genome. The resulted tiling microarrays are thermodynamically optimal in the sense that all selected probes share the same melting temperature separation range between their targets and closest nontargets, and no additional probes can be added without violating the specificity of the microarray to the target genome. This new design method was used to create two whole-genome tiling microarrays for Escherichia coli MG1655 and Agrobacterium tumefaciens C58 and the experiment results validated the design.

eSensor: an electrochemical detection-based DNA microarray technology enabling sample-to-answer molecular diagnostics

NASA Astrophysics Data System (ADS)

Liu, Robin H.; Longiaru, Mathew

2009-05-01

DNA microarrays are becoming a widespread tool used in life science and drug screening due to its many benefits of miniaturization and integration. Microarrays permit a highly multiplexed DNA analysis. Recently, the development of new detection methods and simplified methodologies has rapidly expanded the use of microarray technologies from predominantly gene expression analysis into the arena of diagnostics. Osmetech's eSensor® is an electrochemical detection platform based on a low-to- medium density DNA hybridization array on a cost-effective printed circuit board substrate. eSensor® has been cleared by FDA for Warfarin sensitivity test and Cystic Fibrosis Carrier Detection. Other genetic-based diagnostic and infectious disease detection tests are under development. The eSensor® platform eliminates the need for an expensive laser-based optical system and fluorescent reagents. It allows one to perform hybridization and detection in a single and small instrument without any fluidic processing and handling. Furthermore, the eSensor® platform is readily adaptable to on-chip sample-to-answer genetic analyses using microfluidics technology. The eSensor® platform provides a cost-effective solution to direct sample-to-answer genetic analysis, and thus have a potential impact in the fields of point-of-care genetic analysis, environmental testing, and biological warfare agent detection.

[Construction of fetal mesenchymal stem cell cDNA subtractive library].

PubMed

Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao

2002-04-01

To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.

Isolation and characterization of a cDNA clone specific for avian vitellogenin II.

PubMed Central

Protter, A A; Wang, S Y; Shelness, G S; Ostapchuk, P; Williams, D L

1982-01-01

A clone for vitellogenin, a major avian, estrogen responsive egg yolk protein, was isolated from the cDNA library of estrogen-induced rooster liver. Two forms of plasma vitellogenin, vitellogenin I (VTG I) and vitellogenin II (VTG II), distinguishable on the basis of their unique partial proteolysis maps, have been characterized and their corresponding hepatic precursor forms identified. We have used this criterion to specifically characterize which vitellogenin protein had been cloned. Partial proteolysis maps of BTG I and VTG II standards, synthesized in vivo, were compared to maps of protein synthesized in vitro using RNA hybrid-selected by the vitellogenin plasmid. Eight major digest fragments were found common to the in vitro synthesized vitellogenin and the VTG II standard while no fragments were observed to correspond to the VTG I map. A restriction map of the VTG II cDNA clone permits comparison to previously described cDNA and genomic vitellogenin clones. Images PMID:6182527

Model-based variance-stabilizing transformation for Illumina microarray data.

PubMed

Lin, Simon M; Du, Pan; Huber, Wolfgang; Kibbe, Warren A

2008-02-01

Variance stabilization is a step in the preprocessing of microarray data that can greatly benefit the performance of subsequent statistical modeling and inference. Due to the often limited number of technical replicates for Affymetrix and cDNA arrays, achieving variance stabilization can be difficult. Although the Illumina microarray platform provides a larger number of technical replicates on each array (usually over 30 randomly distributed beads per probe), these replicates have not been leveraged in the current log2 data transformation process. We devised a variance-stabilizing transformation (VST) method that takes advantage of the technical replicates available on an Illumina microarray. We have compared VST with log2 and Variance-stabilizing normalization (VSN) by using the Kruglyak bead-level data (2006) and Barnes titration data (2005). The results of the Kruglyak data suggest that VST stabilizes variances of bead-replicates within an array. The results of the Barnes data show that VST can improve the detection of differentially expressed genes and reduce false-positive identifications. We conclude that although both VST and VSN are built upon the same model of measurement noise, VST stabilizes the variance better and more efficiently for the Illumina platform by leveraging the availability of a larger number of within-array replicates. The algorithms and Supplementary Data are included in the lumi package of Bioconductor, available at: www.bioconductor.org.

Construction of a cDNA library for miniature pig mandibular deciduous molars

PubMed Central

2014-01-01

Background The miniature pig provides an excellent experimental model for tooth morphogenesis because its diphyodont and heterodont dentition resembles that of humans. However, little information is available on the process of tooth development or the exact molecular mechanisms controlling tooth development in miniature pigs or humans. Thus, the analysis of gene expression related to each stage of tooth development is very important. Results In our study, after serial sections were made, the development of the crown of the miniature pigs’ mandibular deciduous molar could be divided into five main phases: dental lamina stage (E33-E35), bud stage (E35-E40), cap stage (E40-E50), early bell stage (E50-E60), and late bell stage (E60-E65). Total RNA was isolated from the tooth germ of miniature pig embryos at E35, E45, E50, and E60, and a cDNA library was constructed. Then, we identified cDNA sequences on a large scale screen for cDNA profiles in the developing mandibular deciduous molars (E35, E45, E50, and E60) of miniature pigs using Illumina Solexa deep sequencing. Microarray assay was used to detect the expression of genes. Lastly, through Unigene sequence analysis and cDNA expression pattern analysis at E45 and E60, we found that 12 up-regulated and 15 down-regulated genes during the four periods are highly conserved genes homologous with known Homo sapiens genes. Furthermore, there were 6 down-regulated and 2 up-regulated genes in the miniature pig that were highly homologous to Homo sapiens genes compared with those in the mouse. Conclusion Our results not only identify the specific transcriptome and cDNA profile in developing mandibular deciduous molars of the miniature pig, but also provide useful information for investigating the molecular mechanism of tooth development in the miniature pig. PMID:24750690

Fully Automated Complementary DNA Microarray Segmentation using a Novel Fuzzy-based Algorithm.

PubMed

Saberkari, Hamidreza; Bahrami, Sheyda; Shamsi, Mousa; Amoshahy, Mohammad Javad; Ghavifekr, Habib Badri; Sedaaghi, Mohammad Hossein

2015-01-01

DNA microarray is a powerful approach to study simultaneously, the expression of 1000 of genes in a single experiment. The average value of the fluorescent intensity could be calculated in a microarray experiment. The calculated intensity values are very close in amount to the levels of expression of a particular gene. However, determining the appropriate position of every spot in microarray images is a main challenge, which leads to the accurate classification of normal and abnormal (cancer) cells. In this paper, first a preprocessing approach is performed to eliminate the noise and artifacts available in microarray cells using the nonlinear anisotropic diffusion filtering method. Then, the coordinate center of each spot is positioned utilizing the mathematical morphology operations. Finally, the position of each spot is exactly determined through applying a novel hybrid model based on the principle component analysis and the spatial fuzzy c-means clustering (SFCM) algorithm. Using a Gaussian kernel in SFCM algorithm will lead to improving the quality in complementary DNA microarray segmentation. The performance of the proposed algorithm has been evaluated on the real microarray images, which is available in Stanford Microarray Databases. Results illustrate that the accuracy of microarray cells segmentation in the proposed algorithm reaches to 100% and 98% for noiseless/noisy cells, respectively.

A DNA microarray-based assay to detect dual infection with two dengue virus serotypes.

PubMed

Díaz-Badillo, Alvaro; Muñoz, María de Lourdes; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G; Martínez-Muñoz, Jorge P; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

2014-04-25

Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples.

A DNA Microarray-Based Assay to Detect Dual Infection with Two Dengue Virus Serotypes

PubMed Central

Díaz-Badillo, Alvaro; de Lourdes Muñoz, María; Perez-Ramirez, Gerardo; Altuzar, Victor; Burgueño, Juan; Mendoza-Alvarez, Julio G.; Martínez-Muñoz, Jorge P.; Cisneros, Alejandro; Navarrete-Espinosa, Joel; Sanchez-Sinencio, Feliciano

2014-01-01

Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV) serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples. PMID:24776933

Evaluation by microarray of the potential safety of Sarracenia purpurea L. (Sarraceniaceae) a traditional medicine used by the Cree of Eeyou Istchee.

PubMed

Cieniak, Carolina; McDonald, Charlotte; Nash, John; Muhammad, Asim; Badawi, Alaa; Haddad, Pierre S; Cuerrier, Alain; Bennett, Steffany A L; Foster, Brian C; Arnason, John T

2015-01-01

The purpose of this study was to assess safety of the traditional antidiabetic extracts of either S. purpurea or its lead active principle, morroniside at the transcriptional level. The overarching objective was to profile and validate transcriptional changes in the cytochrome P450 family of genes, in response to treatment with S. purpurea ethanolic extract or its lead active, morroniside. Transcriptional activity was profiled using a 19K human cDNA microarray in C2BBe1 cells, clone of Caco-2 intestinal cells, which are a model of first-pass metabolism (1, 2). Cells were treated with S. purpurea extract for 4 and 24 hrs, as well as the pure compound morroniside for 4 hrs, to determine their effects. No evidence of cytochrome P450 transcriptome regulation or of transcriptional activation of other diabetes relevant mRNA was detected after rigorous quantitative-PCR validation of microarray results. Our data do not support a transcriptional mechanism of action for either S. purpurea extract or its lead active, morroniside. This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page.

Reproducibility-optimized test statistic for ranking genes in microarray studies.

PubMed

Elo, Laura L; Filén, Sanna; Lahesmaa, Riitta; Aittokallio, Tero

2008-01-01

A principal goal of microarray studies is to identify the genes showing differential expression under distinct conditions. In such studies, the selection of an optimal test statistic is a crucial challenge, which depends on the type and amount of data under analysis. While previous studies on simulated or spike-in datasets do not provide practical guidance on how to choose the best method for a given real dataset, we introduce an enhanced reproducibility-optimization procedure, which enables the selection of a suitable gene- anking statistic directly from the data. In comparison with existing ranking methods, the reproducibilityoptimized statistic shows good performance consistently under various simulated conditions and on Affymetrix spike-in dataset. Further, the feasibility of the novel statistic is confirmed in a practical research setting using data from an in-house cDNA microarray study of asthma-related gene expression changes. These results suggest that the procedure facilitates the selection of an appropriate test statistic for a given dataset without relying on a priori assumptions, which may bias the findings and their interpretation. Moreover, the general reproducibilityoptimization procedure is not limited to detecting differential expression only but could be extended to a wide range of other applications as well.

Transcriptional profiling of the parr–smolt transformation in Atlantic salmon

USGS Publications Warehouse

Robertson, Laura S.; McCormick, Stephen D.

2012-01-01

The parr–smolt transformation in Atlantic salmon (Salmo salar) is a complex developmental process that culminates in the ability to migrate to and live in seawater. We used GRASP 16K cDNA microarrays to identify genes that are differentially expressed in the liver, gill, hypothalamus, pituitary, and olfactory rosettes of smolts compared to parr. Smolts had higher levels of gill Na+/K+-ATPase activity, plasma cortisol and plasma thyroid hormones relative to parr. Across all five tissues, stringent microarray analyses identified 48 features that were differentially expressed in smolts compared to parr. Using a less stringent method we found 477 features that were differentially expressed at least 1.2-fold in smolts, including 172 features in the gill. Smolts had higher mRNA levels of genes involved in transcription, protein biosynthesis and folding, electron transport, oxygen transport, and sensory perception and lower mRNA levels for genes involved in proteolysis. Quantitative RT-PCR was used to confirm differential expression in select genes identified by microarray analyses and to quantify expression of other genes known to be involved in smolting. This study expands our understanding of the molecular processes that underlie smolting in Atlantic salmon and identifies genes for further investigation.

Identification of genes differentially expressed in association with acquired cisplatin resistance

PubMed Central

Johnsson, A; Zeelenberg, I; Min, Y; Hilinski, J; Berry, C; Howell, S B; Los, G

2000-01-01

The goal of this study was to identify genes whose mRNA levels are differentially expressed in human cells with acquired cisplatin (cDDP) resistance. Using the parental UMSCC10b head and neck carcinoma cell line and the 5.9-fold cDDP-resistant subline, UMSCC10b/Pt-S15, two suppressive subtraction hybridization (SSH) cDNA libraries were prepared. One library represented mRNAs whose levels were increased in the cDDP resistant variant (the UP library), the other one represented mRNAs whose levels were decreased in the resistant cells (the DOWN library). Arrays constructed with inserts recovered from these libraries were hybridized with SSH products to identify truly differentially expressed elements. A total of 51 cDNA fragments present in the UP library and 16 in the DOWN library met the criteria established for differential expression. The sequences of 87% of these cDNA fragments were identified in Genbank. Among the mRNAs in the UP library that were frequently isolated and that showed high levels of differential expression were cytochrome oxidase I, ribosomal protein 28S, elongation factor 1α, α-enolase, stathmin, and HSP70. The approach taken in this study permitted identification of many genes never before linked to the cDDP-resistant phenotype. © 2000 Cancer Research Campaign PMID:10993653

Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

PubMed

Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

2014-01-01

High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

cDNA nucleotide sequence coding for stearoyl-CoA desaturase and its expression in the zebrafish (Danio rerio) embryo.

PubMed

Hsieh, S L; Liu, R W; Wu, C H; Cheng, W T; Kuo, Ching-Ming

2003-12-01

A cDNA sequence of stearoyl-CoA desaturase (SCD) was determined from zebrafish (Danio rerio) and compared to the corresponding genes in several teleosts. Zebrafish SCD cDNA has a size of 1,061 bp, encodes a polypeptide of 325 amino acids, and shares 88, 85, 84, and 83% similarities with tilapia (Oreochromis mossambicus), grass carp (Ctenopharyngodon idella), common carp (Cyprinus carpio), and milkfish (Chanos chanos), respectively. This 1,061 bp sequence specifies a protein that, in common with other fatty acid desaturases, contains three histidine boxes, believed to be involved in catalysis. These observations suggested that SCD genes are highly conserved. In addition, an oligonucleotide probe complementary to zebrafish SCD mRNA was hybridized to mRNA of approximately 396 bases with Northern blot analysis. The Northern blot and RT-PCR analyses showed that the SCD mRNA was expressed predominantly in the liver, intestine, gill, and muscle, while a lower level was found in the brain. Furthermore, we utilized whole-mount in situ hybridization and real-time quantitative RT-PCR to identify expression of the zebrafish SCD gene at five different stages of development. This revealed that very high levels of transcripts were found in zebrafish at all stages during embryogenesis and early development. Copyright 2003 Wiley-Liss, Inc.

Construction and application of a bovine immune-endocrine cDNA microarray.

PubMed

Tao, Wenjing; Mallard, Bonnie; Karrow, Niel; Bridle, Byram

2004-09-01

A variety of commercial DNA arrays specific for humans and rodents are widely available; however, microarrays containing well-characterized genes to study pathway-specific gene expression are not as accessible for domestic animals, such as cattle, sheep and pigs. Therefore, a small-scale application-targeted bovine immune-endocrine cDNA array was developed to evaluate genetic pathways involved in the immune-endocrine axis of cattle during periods of altered homeostasis provoked by physiological or environmental stressors, such as infection, vaccination or disease. For this purpose, 167 cDNA sequences corresponding to immune, endocrine and inflammatory response genes were collected and categorized. Positive controls included 5 housekeeping genes (glyceraldehydes-3-phosphate dehydrogenase, hypoxanthine phosphoribosyltransferase, ribosomal protein L19, beta-actin, beta2-microglobulin) and bovine genomic DNA. Negative controls were a bacterial gene (Rhodococcus equi 17-kDa virulence-associated protein) and a partial sequence of the plasmid pACYC177. In addition, RNA extracted from un-stimulated, as well as superantigen (Staphylococcus aureus enterotoxin-A, S. aureus Cowan Pansorbin Cells) and mitogen-stimulated (LPS, ConA) bovine blood leukocytes was mixed, reverse transcribed and PCR amplified using gene-specific primers. The endocrine-associated genes were amplified from cDNA derived from un-stimulated bovine hypothalamus, pituitary, adrenal and thyroid gland tissues. The array was constructed in 4 repeating grids of 180 duplicated spots by coupling the PCR amplified 213-630 bp gene fragments onto poly-l-lysine coated glass slides. The bovine immune-endocrine arrays were standardized and preliminary gene expression profiles generated using Cy3 and Cy5 labelled cDNA from un-stimulated and ConA (5 microg/ml) stimulated PBMC of 4 healthy Holstein cows (2-4 replicate arrays/cow) in a time course study. Mononuclear cell-derived cytokine and chemokine (IL-2, IL-1alpha, TNFalpha, IFN-gamma, TGFbeta-1, MCP-1, MCP-2 and MIP-3alpha) mRNA exhibited a repeatable and consistently low expression in un-stimulated cells and at least a two-fold increased expression following 6 and 24 h ConA stimulation as compared to 0 h un-stimulated controls. In contrast, expression of antigen presenting molecules, MHC-DR, MHC-DQ and MHC-DY, were consistently at least two-fold lower following 6 and 24 h ConA stimulation. The only endocrine gene with differential expression following ConA stimulation was prolactin. Additionally, due to the high level of genetic homology between ovine, swine and bovine genes, RNA similarly acquired from sheep and pigs was evaluated and similar gene expression patterns were noted. These data demonstrate that this application-targeted array containing a set of well characterized genes can be used to determine the relative gene expression corresponding to immune-endocrine responses of cattle and related species, sheep and pigs.

Biosynthesis of Lipoic Acid in Arabidopsis: Cloning and Characterization of the cDNA for Lipoic Acid Synthase1

PubMed Central

Yasuno, Rie; Wada, Hajime

1998-01-01

Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738

Parallel human genome analysis: microarray-based expression monitoring of 1000 genes.

PubMed Central

Schena, M; Shalon, D; Heller, R; Chai, A; Brown, P O; Davis, R W

1996-01-01

Microarrays containing 1046 human cDNAs of unknown sequence were printed on glass with high-speed robotics. These 1.0-cm2 DNA "chips" were used to quantitatively monitor differential expression of the cognate human genes using a highly sensitive two-color hybridization assay. Array elements that displayed differential expression patterns under given experimental conditions were characterized by sequencing. The identification of known and novel heat shock and phorbol ester-regulated genes in human T cells demonstrates the sensitivity of the assay. Parallel gene analysis with microarrays provides a rapid and efficient method for large-scale human gene discovery. Images Fig. 1 Fig. 2 Fig. 3 PMID:8855227

Questioning the utility of pooling samples in microarray experiments with cell lines.

PubMed

Lusa, L; Cappelletti, V; Gariboldi, M; Ferrario, C; De Cecco, L; Reid, J F; Toffanin, S; Gallus, G; McShane, L M; Daidone, M G; Pierotti, M A

2006-01-01

We describe a microarray experiment using the MCF-7 breast cancer cell line in two different experimental conditions for which the same number of independent pools as the number of individual samples was hybridized on Affymetrix GeneChips. Unexpectedly, when using individual samples, the number of probe sets found to be differentially expressed between treated and untreated cells was about three times greater than that found using pools. These findings indicate that pooling samples in microarray experiments where the biological variability is expected to be small might not be helpful and could even decrease one's ability to identify differentially expressed genes.

Identification and expression analysis of genes involved in early ovary development in diploid gynogenetic hybrids of red crucian carp x common carp.

PubMed

Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun

2010-04-01

Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.

Analysis of differentially expressed genes in two immunologically distinct strains of Eimeria maxima using suppression subtractive hybridization and dot-blot hybridization

PubMed Central

2014-01-01

Background It is well known that different Eimeria maxima strains exhibit significant antigenic variation. However, the genetic basis of these phenotypes remains unclear. Methods Total RNA and mRNA were isolated from unsporulated oocysts of E. maxima strains SH and NT, which were found to have significant differences in immunogenicity in our previous research. Two subtractive cDNA libraries were constructed using suppression subtractive hybridization (SSH) and specific genes were further analyzed by dot-blot hybridization and qRT-PCR analysis. Results A total of 561 clones were selected from both cDNA libraries and the length of the inserted fragments was 0.25–1.0 kb. Dot-blot hybridization revealed a total of 86 differentially expressed clones (63 from strain SH and 23 from strain NT). Nucleotide sequencing analysis of these clones revealed ten specific contigs (six from strain SH and four from strain NT). Further analysis found that six contigs from strain SH and three from strain NT shared significant identities with previously reported proteins, and one contig was presumed to be novel. The specific differentially expressed genes were finally verified by RT-PCR and qRT-PCR analyses. Conclusions The data presented here suggest that specific genes identified between the two strains may be important molecules in the immunogenicity of E. maxima that may present potential new drug targets or vaccine candidates for coccidiosis. PMID:24894832

Physico-chemical foundations underpinning microarray and next-generation sequencing experiments

PubMed Central

Harrison, Andrew; Binder, Hans; Buhot, Arnaud; Burden, Conrad J.; Carlon, Enrico; Gibas, Cynthia; Gamble, Lara J.; Halperin, Avraham; Hooyberghs, Jef; Kreil, David P.; Levicky, Rastislav; Noble, Peter A.; Ott, Albrecht; Pettitt, B. Montgomery; Tautz, Diethard; Pozhitkov, Alexander E.

2013-01-01

Hybridization of nucleic acids on solid surfaces is a key process involved in high-throughput technologies such as microarrays and, in some cases, next-generation sequencing (NGS). A physical understanding of the hybridization process helps to determine the accuracy of these technologies. The goal of a widespread research program is to develop reliable transformations between the raw signals reported by the technologies and individual molecular concentrations from an ensemble of nucleic acids. This research has inputs from many areas, from bioinformatics and biostatistics, to theoretical and experimental biochemistry and biophysics, to computer simulations. A group of leading researchers met in Ploen Germany in 2011 to discuss present knowledge and limitations of our physico-chemical understanding of high-throughput nucleic acid technologies. This meeting inspired us to write this summary, which provides an overview of the state-of-the-art approaches based on physico-chemical foundation to modeling of the nucleic acids hybridization process on solid surfaces. In addition, practical application of current knowledge is emphasized. PMID:23307556

Unique Proteins Expressed by Blood Vessels in Skeletal Sites Colonized by Breast Cancer Cells

DTIC Science & Technology

2006-08-01

fluorescent labeled acetylated LDL at an accelerated rate (3). After one week in culture BVECs and MVECs were harvested. Total RNA was extracted from...both cell types using the Qiagen RNeasy kit (Valencia, CA). Microarray labeling, hybridization and analysis was conducted on the RNA by the Penn...State University DNA Microarray Facility under the direction of Dr. Craig Praul. Briefly, RNA obtained from three separate isolations of BVECs and

Hepatic gene expression of Caucasian and African-American patients with obesity-related non-alcoholic fatty liver disease.

PubMed

Stepanova, Maria; Hossain, Noreen; Afendy, Arian; Perry, Kellie; Goodman, Zachary D; Baranova, Ancha; Younossi, Zobair

2010-05-01

There is increasing data suggesting that African Americans with NAFLD tend to have less progressive liver disease. The aim of this study is to assess differences in the hepatic gene expression of African-American and Caucasian patients with NAFLD who had undergone bariatric surgery. A total of 94 patients (81 NAFLD and 13 weight-matched controls with normal liver biopsy) were included. Of the entire cohort, 73 were Caucasians and 21 were African Americans. All patients were undergoing bariatric surgery. Two liver biopsies were obtained at the time of surgery. One biopsy was snap-frozen for gene expression and the other biopsy was stained for pathologic assessment. Liver biopsy confirmed that 24 patients from our cohort had NASH while 57 had only simple steatosis. Snap-frozen liver biopsy specimens of these patients were then used for the RNA extraction. cDNA probes were hybridized with customized microarray gene chips containing 5,220 relevant genes. Gene expression profiles were compared between groups using significance analysis of microarrays algorithm. In comparison to all Caucasian patients, African-American patients had over-expression of EPB41L1, IGF2, FAH, ACSL4, FUT4, CYP3A (q values < 10(-4)). In comparison to Caucasian NAFLD patients, African-American NAFLD patients showed over-expression of EPB41L1 and ACSL4 genes. Finally, in comparison to Caucasian NASH patients, African-American NASH patients showed over-expression of GSTM 2, GSTM4 and GSTM5 as well as FH and ASCL4 genes. Some genes highlighted by this analysis, particularly cytochrome CYP3A and glutathione transferases GSTM2, 4, 5, were previously implicated in the pathogenesis of NASH. African-American patients with biopsy-proven obesity-related NAFLD and NASH have a specific hepatic gene expression pattern that may explain their differences from Caucasian patients with NAFLD in developing progressive liver disease.

Adaptations to Endosymbiosis in a Cnidarian-Dinoflagellate Association: Differential Gene Expression and Specific Gene Duplications

PubMed Central

Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

2011-01-01

Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K–dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the symbiotic state and in the gastroderm. Our results thus offer new insight into the inter-partner signaling required for the physiological mechanisms of the symbiosis that is crucial for coral health. PMID:21811417

An experimental loop design for the detection of constitutional chromosomal aberrations by array CGH

PubMed Central

2009-01-01

Background Comparative genomic hybridization microarrays for the detection of constitutional chromosomal aberrations is the application of microarray technology coming fastest into routine clinical application. Through genotype-phenotype association, it is also an important technique towards the discovery of disease causing genes and genomewide functional annotation in human. When using a two-channel microarray of genomic DNA probes for array CGH, the basic setup consists in hybridizing a patient against a normal reference sample. Two major disadvantages of this setup are (1) the use of half of the resources to measure a (little informative) reference sample and (2) the possibility that deviating signals are caused by benign copy number variation in the "normal" reference instead of a patient aberration. Instead, we apply an experimental loop design that compares three patients in three hybridizations. Results We develop and compare two statistical methods (linear models of log ratios and mixed models of absolute measurements). In an analysis of 27 patients seen at our genetics center, we observed that the linear models of the log ratios are advantageous over the mixed models of the absolute intensities. Conclusion The loop design and the performance of the statistical analysis contribute to the quick adoption of array CGH as a routine diagnostic tool. They lower the detection limit of mosaicisms and improve the assignment of copy number variation for genetic association studies. PMID:19925645

An experimental loop design for the detection of constitutional chromosomal aberrations by array CGH.

PubMed

Allemeersch, Joke; Van Vooren, Steven; Hannes, Femke; De Moor, Bart; Vermeesch, Joris Robert; Moreau, Yves

2009-11-19

Comparative genomic hybridization microarrays for the detection of constitutional chromosomal aberrations is the application of microarray technology coming fastest into routine clinical application. Through genotype-phenotype association, it is also an important technique towards the discovery of disease causing genes and genomewide functional annotation in human. When using a two-channel microarray of genomic DNA probes for array CGH, the basic setup consists in hybridizing a patient against a normal reference sample. Two major disadvantages of this setup are (1) the use of half of the resources to measure a (little informative) reference sample and (2) the possibility that deviating signals are caused by benign copy number variation in the "normal" reference instead of a patient aberration. Instead, we apply an experimental loop design that compares three patients in three hybridizations. We develop and compare two statistical methods (linear models of log ratios and mixed models of absolute measurements). In an analysis of 27 patients seen at our genetics center, we observed that the linear models of the log ratios are advantageous over the mixed models of the absolute intensities. The loop design and the performance of the statistical analysis contribute to the quick adoption of array CGH as a routine diagnostic tool. They lower the detection limit of mosaicisms and improve the assignment of copy number variation for genetic association studies.

Human HST1 (HSTF1) gene maps to chromosome band 11q13 and coamplifies with the INT2 gene in human cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshida, Michihiro C.; Wada, Makio; Satoh, Hitoshi

1988-07-01

The human HST1 gene, previously designated the hst gene, and now assigned the name HSTF1 for heparin-binding secretory transforming factor in human gene nomenclature, was originally identified as a transforming gene in DNAs from human stomach cancers by transfection assay with mouse NIH 3T3 cells. The amino acid sequence of the product deduced from DNA sequences of the HST1 cDNA and genomic clones had approximately 40% homology to human basic and acidic fibroblast growth factors and mouse Int-2-encoded protein. The authors have mapped the human HST1 gene to chromosome 11 at band q13.3 by Southern blot hybridization analysis of amore » panel of human and mouse somatic cell hybrids and in situ hybridization with an HST1 cDNA probe. The HST1 gene was found to be amplified in DNAs obtained from a stomach cancer and a vulvar carcinoma cell line, A431. In all of these samples of DNA, the INT2 gene, previously mapped to human chromosome 11q13, was also amplified to the same degree as the HST1 gene.« less

An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

PubMed

Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

2011-01-01

cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

Localization of the human tripeptidyl peptidase II gene (TPP2) to 13q32-q33 by nonradioactive in situ hybridization and somatic cell hybrids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinsson, T.; Vujic, M.; Tomkinson, B.

1993-08-01

The authors have assigned the human tripeptidyl peptidase II (TPP2) gene to chromosome region 13q32-q33 using two different methods. First, a full-length TPP2 cDNA was used as a probe on Southern blots of DNA from a panel of human/rodent somatic cell hybrids. The TPP2 sequences were found to segregate with the human chromosome 13. Second, fluorescence in situ hybridization analysis was performed with the same probe. This analysis supported the chromosome 13 localization and further refined it to region 13q32-q33. 20 refs., 2 figs.

Biosensors for DNA sequence detection

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; Akeson, Mark

2002-01-01

DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

Nuclear Matrix Proteins in Disparity of Prostate Cancer

DTIC Science & Technology

2011-07-01

using G3PDH 3’ primer and PCR primer 1 followed by two rounds of hybridization. In the first hybridization, the RsaI-digested driver cDNA was mixed...determined using β-actin to confirm the reduced relative abundance of the housekeeping gene after SSH. The SSH nested PCR products were cloned using pCR®2.1...variability of DNA concentration. Additionally, negative and positive controls ( housekeeping genes) from the Ambion™ ArrayControls™ Set were included

hEcd, A Novel Regulator of Mammary Epithelial Cell Survival

DTIC Science & Technology

2009-09-01

theYeast Two hybrid analysis with human papilloma virus oncogene E6 (the most efficient oncogene to immortalize hMECs in vitro) as a bait and mammary...transformation. We have identified a novel protein us ing the Yeast Two hybrid analysis with human papilloma virus oncogene E6 (the most efficient...epithelial cell cDNA library, we identified hEcd ( human orthologue of Drosophila Ecdysoneless) as a novel E6 binding partner. To study the cellular

The yeast two hybrid system in a screen for proteins interacting with axolotl (Ambystoma mexicanum) Msx1 during early limb regeneration.

PubMed

Abuqarn, Mehtap; Allmeling, Christina; Amshoff, Inga; Menger, Bjoern; Nasser, Inas; Vogt, Peter M; Reimers, Kerstin

2011-07-01

Urodele amphibians are exceptional in their ability to regenerate complex body structures such as limbs. Limb regeneration depends on a process called dedifferentiation. Under an inductive wound epidermis terminally differentiated cells transform to pluripotent progenitor cells that coordinately proliferate and eventually redifferentiate to form the new appendage. Recent studies have developed molecular models integrating a set of genes that might have important functions in the control of regenerative cellular plasticity. Among them is Msx1, which induced dedifferentiation in mammalian myotubes in vitro. Herein, we screened for interaction partners of axolotl Msx1 using a yeast two hybrid system. A two hybrid cDNA library of 5-day-old wound epidermis and underlying tissue containing more than 2×10⁶ cDNAs was constructed and used in the screen. 34 resulting cDNA clones were isolated and sequenced. We then compared sequences of the isolated clones to annotated EST contigs of the Salamander EST database (BLASTn) to identify presumptive orthologs. We subsequently searched all no-hit clone sequences against non redundant NCBI sequence databases using BLASTx. It is the first time, that the yeast two hybrid system was adapted to the axolotl animal model and successfully used in a screen for proteins interacting with Msx1 in the context of amphibian limb regeneration. 2011 Elsevier B.V. All rights reserved.

Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

PubMed

Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-02-06

Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

Identification of Escherichia coli O157 by Using a Novel Colorimetric Detection Method with DNA Microarrays

PubMed Central

Swimley, Michelle S.; Taylor, Amber W.; Dawson, Erica D.

2011-01-01

Abstract Shiga toxin–producing Escherichia coli O157 is a leading cause of foodborne illness worldwide. To evaluate better methods to rapidly detect and genotype E. coli O157 strains, the present study evaluated the use of ampliPHOX, a novel colorimetric detection method based on photopolymerization, for pathogen identification with DNA microarrays. A low-density DNA oligonucleotide microarray was designed to target stx1 and stx2 genes encoding Shiga toxin production, the eae gene coding for adherence membrane protein, and the per gene encoding the O157-antigen perosamine synthetase. Results from the validation experiments demonstrated that the use of ampliPHOX allowed the accurate genotyping of the tested E. coli strains, and positive hybridization signals were observed for only probes targeting virulence genes present in the reference strains. Quantification showed that the average signal-to-noise ratio values ranged from 47.73 ± 7.12 to 76.71 ± 8.33, whereas average signal-to-noise ratio values below 2.5 were determined for probes where no polymer was formed due to lack of specific hybridization. Sensitivity tests demonstrated that the sensitivity threshold for E. coli O157 detection was 100–1000 CFU/mL. Thus, the use of DNA microarrays in combination with photopolymerization allowed the rapid and accurate genotyping of E. coli O157 strains. PMID:21288130

Evaluation of the efficacy of constitutional array-based comparative genomic hybridization in the diagnosis of aneuploidy using genomic and amplified DNA.

PubMed

Tan, Niap H; Palmer, Rodger; Wang, Rubin

2010-02-01

Array-based comparative genomic hybridization (array CGH) is a new molecular technique that has the potential to revolutionize cytogenetics. However, use of high resolution array CGH in the clinical setting is plagued by the problem of widespread copy number variations (CNV) in the human genome. Constitutional microarray, containing only clones that interrogate regions of known constitutional syndromes, may circumvent the dilemma of detecting CNV of unknown clinical significance. The present study investigated the efficacy of constitutional microarray in the diagnosis of trisomy. Test samples included genomic DNA from trisomic cell lines, amplification products of 50 ng of genomic DNA and whole genome amplification products of single cells. DNA amplification was achieved by means of multiple displacement amplification (MDA) over 16 h. The trisomic and sex chromosomes copy number imbalances in the genomic DNA were correctly identified by the constitutional microarrays. However, there was a failure to detect the trisomy in the amplification products of 50 ng of genomic DNA and whole genome amplification products of single cells. Using carefully selected clones, Spectral Genomics constitutional microarray was able to detect the chromosomal copy number imbalances in genomic DNA without the confounding effects of CNV. The diagnostic failure in amplified DNA samples could be attributed to the amplification process. The MDA duration of 16 h generated excessive amount of biases and shortening the duration might minimize the problem.

Improved analytical methods for microarray-based genome-composition analysis

PubMed Central

Kim, Charles C; Joyce, Elizabeth A; Chan, Kaman; Falkow, Stanley

2002-01-01

Background Whereas genome sequencing has given us high-resolution pictures of many different species of bacteria, microarrays provide a means of obtaining information on genome composition for many strains of a given species. Genome-composition analysis using microarrays, or 'genomotyping', can be used to categorize genes into 'present' and 'divergent' categories based on the level of hybridization signal. This typically involves selecting a signal value that is used as a cutoff to discriminate present (high signal) and divergent (low signal) genes. Current methodology uses empirical determination of cutoffs for classification into these categories, but this methodology is subject to several problems that can result in the misclassification of many genes. Results We describe a method that depends on the shape of the signal-ratio distribution and does not require empirical determination of a cutoff. Moreover, the cutoff is determined on an array-to-array basis, accounting for variation in strain composition and hybridization quality. The algorithm also provides an estimate of the probability that any given gene is present, which provides a measure of confidence in the categorical assignments. Conclusions Many genes previously classified as present using static methods are in fact divergent on the basis of microarray signal; this is corrected by our algorithm. We have reassigned hundreds of genes from previous genomotyping studies of Helicobacter pylori and Campylobacter jejuni strains, and expect that the algorithm should be widely applicable to genomotyping data. PMID:12429064

A 3,000-loci transcription map of chromosome 3B unravels the structural and functional features of gene islands in hexaploid wheat.

PubMed

Rustenholz, Camille; Choulet, Frédéric; Laugier, Christel; Safár, Jan; Simková, Hana; Dolezel, Jaroslav; Magni, Federica; Scalabrin, Simone; Cattonaro, Federica; Vautrin, Sonia; Bellec, Arnaud; Bergès, Hélène; Feuillet, Catherine; Paux, Etienne

2011-12-01

To improve our understanding of the organization and regulation of the wheat (Triticum aestivum) gene space, we established a transcription map of a wheat chromosome (3B) by hybridizing a newly developed wheat expression microarray with bacterial artificial chromosome pools from a new version of the 3B physical map as well as with cDNA probes derived from 15 RNA samples. Mapping data for almost 3,000 genes showed that the gene space spans the whole chromosome 3B with a 2-fold increase of gene density toward the telomeres due to an increase in the number of genes in islands. Comparative analyses with rice (Oryza sativa) and Brachypodium distachyon revealed that these gene islands are composed mainly of genes likely originating from interchromosomal gene duplications. Gene Ontology and expression profile analyses for the 3,000 genes located along the chromosome revealed that the gene islands are enriched significantly in genes sharing the same function or expression profile, thereby suggesting that genes in islands acquired shared regulation during evolution. Only a small fraction of these clusters of cofunctional and coexpressed genes was conserved with rice and B. distachyon, indicating a recent origin. Finally, genes with the same expression profiles in remote islands (coregulation islands) were identified suggesting long-distance regulation of gene expression along the chromosomes in wheat.

Genetic validation of whole-transcriptome sequencing for mapping expression affected by cis-regulatory variation

PubMed Central

2010-01-01

Background Identifying associations between genotypes and gene expression levels using microarrays has enabled systematic interrogation of regulatory variation underlying complex phenotypes. This approach has vast potential for functional characterization of disease states, but its prohibitive cost, given hundreds to thousands of individual samples from populations have to be genotyped and expression profiled, has limited its widespread application. Results Here we demonstrate that genomic regions with allele-specific expression (ASE) detected by sequencing cDNA are highly enriched for cis-acting expression quantitative trait loci (cis-eQTL) identified by profiling of 500 animals in parallel, with up to 90% agreement on the allele that is preferentially expressed. We also observed widespread noncoding and antisense ASE and identified several allele-specific alternative splicing variants. Conclusion Monitoring ASE by sequencing cDNA from as little as one sample is a practical alternative to expression genetics for mapping cis-acting variation that regulates RNA transcription and processing. PMID:20707912

RNA-Seq analysis to capture the transcriptome landscape of a single cell

PubMed Central

Tang, Fuchou; Barbacioru, Catalin; Nordman, Ellen; Xu, Nanlan; Bashkirov, Vladimir I; Lao, Kaiqin; Surani, M. Azim

2013-01-01

We describe here a protocol for digital transcriptome analysis in a single mouse blastomere using a deep sequencing approach. An individual blastomere was first isolated and put into lysate buffer by mouth pipette. Reverse transcription was then performed directly on the whole cell lysate. After this, the free primers were removed by Exonuclease I and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase. Then the single cell cDNAs were amplified by 20 plus 9 cycles of PCR. Then 100-200 ng of these amplified cDNAs were used to construct a sequencing library. The sequencing library can be used for deep sequencing using the SOLiD system. Compared with the cDNA microarray technique, our assay can capture up to 75% more genes expressed in early embryos. The protocol can generate deep sequencing libraries within 6 days for 16 single cell samples. PMID:20203668

Single prokaryotic cell isolation and total transcript amplification protocol for transcriptomic analysis.

PubMed

Kang, Yun; McMillan, Ian; Norris, Michael H; Hoang, Tung T

2015-07-01

Until recently, transcriptome analyses of single cells have been confined to eukaryotes. The information obtained from single-cell transcripts can provide detailed insight into spatiotemporal gene expression, and it could be even more valuable if expanded to prokaryotic cells. Transcriptome analysis of single prokaryotic cells is a recently developed and powerful tool. Here we describe a procedure that allows amplification of the total transcript of a single prokaryotic cell for in-depth analysis. This is performed by using a laser-capture microdissection instrument for single-cell isolation, followed by reverse transcription via Moloney murine leukemia virus, degradation of chromosomal DNA with McrBC and DpnI restriction enzymes, single-stranded cDNA (ss-cDNA) ligation using T4 polynucleotide kinase and CircLigase, and polymerization of ss-cDNA to double-stranded cDNA (ds-cDNA) by Φ29 polymerase. This procedure takes ∼5 d, and sufficient amounts of ds-cDNA can be obtained from single-cell RNA template for further microarray analysis.

The Development of Protein Microarrays and Their Applications in DNA-Protein and Protein-Protein Interaction Analyses of Arabidopsis Transcription Factors

PubMed Central

Gong, Wei; He, Kun; Covington, Mike; Dinesh-Kumar, S. P.; Snyder, Michael; Harmer, Stacey L.; Zhu, Yu-Xian; Deng, Xing Wang

2009-01-01

We used our collection of Arabidopsis transcription factor (TF) ORFeome clones to construct protein microarrays containing as many as 802 TF proteins. These protein microarrays were used for both protein-DNA and protein-protein interaction analyses. For protein-DNA interaction studies, we examined AP2/ERF family TFs and their cognate cis-elements. By careful comparison of the DNA-binding specificity of 13 TFs on the protein microarray with previous non-microarray data, we showed that protein microarrays provide an efficient and high throughput tool for genome-wide analysis of TF-DNA interactions. This microarray protein-DNA interaction analysis allowed us to derive a comprehensive view of DNA-binding profiles of AP2/ERF family proteins in Arabidopsis. It also revealed four TFs that bound the EE (evening element) and had the expected phased gene expression under clock-regulation, thus providing a basis for further functional analysis of their roles in clock regulation of gene expression. We also developed procedures for detecting protein interactions using this TF protein microarray and discovered four novel partners that interact with HY5, which can be validated by yeast two-hybrid assays. Thus, plant TF protein microarrays offer an attractive high-throughput alternative to traditional techniques for TF functional characterization on a global scale. PMID:19802365

Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

PubMed

Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

2018-02-15

Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

Principles of gene microarray data analysis.

PubMed

Mocellin, Simone; Rossi, Carlo Riccardo

2007-01-01

The development of several gene expression profiling methods, such as comparative genomic hybridization (CGH), differential display, serial analysis of gene expression (SAGE), and gene microarray, together with the sequencing of the human genome, has provided an opportunity to monitor and investigate the complex cascade of molecular events leading to tumor development and progression. The availability of such large amounts of information has shifted the attention of scientists towards a nonreductionist approach to biological phenomena. High throughput technologies can be used to follow changing patterns of gene expression over time. Among them, gene microarray has become prominent because it is easier to use, does not require large-scale DNA sequencing, and allows for the parallel quantification of thousands of genes from multiple samples. Gene microarray technology is rapidly spreading worldwide and has the potential to drastically change the therapeutic approach to patients affected with tumor. Therefore, it is of paramount importance for both researchers and clinicians to know the principles underlying the analysis of the huge amount of data generated with microarray technology.

Stochastic models for inferring genetic regulation from microarray gene expression data.

PubMed

Tian, Tianhai

2010-03-01

Microarray expression profiles are inherently noisy and many different sources of variation exist in microarray experiments. It is still a significant challenge to develop stochastic models to realize noise in microarray expression profiles, which has profound influence on the reverse engineering of genetic regulation. Using the target genes of the tumour suppressor gene p53 as the test problem, we developed stochastic differential equation models and established the relationship between the noise strength of stochastic models and parameters of an error model for describing the distribution of the microarray measurements. Numerical results indicate that the simulated variance from stochastic models with a stochastic degradation process can be represented by a monomial in terms of the hybridization intensity and the order of the monomial depends on the type of stochastic process. The developed stochastic models with multiple stochastic processes generated simulations whose variance is consistent with the prediction of the error model. This work also established a general method to develop stochastic models from experimental information. 2009 Elsevier Ireland Ltd. All rights reserved.

Automated detection and quantitation of bacterial RNA by using electrical microarrays.

PubMed

Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer

2006-07-15

Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.

Hydrocortisone-induced anti-inflammatory effects in immature human enterocytes depend on the timing of exposure.

PubMed

Rautava, Samuli; Walker, W Allan; Lu, Lei

2016-06-01

The immature human gut has a propensity to exaggerated inflammatory responses that are thought to play a role in the pathogenesis of necrotizing enterocolitis (NEC). Prenatal exposure to corticosteroids has been reported to reduce the risk of NEC, while postnatal dexamethasone treatment is associated with adverse neurodevelopmental outcomes in preterm infants. The aim of this study was to investigate the direct role of hydrocortisone in gene expression patterns and inflammatory responses in immature human enterocytes. Time-dependent hydrocortisone effects in nontransformed primary human fetal intestinal epithelial cell line H4 were investigated by cDNA microarray. Fetal intestinal organ culture and cell culture experiments were conducted. Inflammatory responses were induced by stimulation with IL-1β and TNF-α with and without hydrocortisone. IL-8 and IL-6 expression and secretion were measured as functional readout. Here we report time-dependent hydrocortisone-induced changes in gene expression patterns detected by cDNA microarray. Hydrocortisone significantly attenuated IL-1β-induced inflammatory responses in the immature human gut when administered at the time of the proinflammatory insult: IL-1β-induced IL-8 and IL-6 secretion in the fetal ileum as well as H4 cells were significantly reduced. Hydrocortisone also inhibited IL-8 secretion in response to TNF-α. In contrast, TNF-α-induced IL-8 secretion was not reduced in cells treated with hydrocortisone for 48 h before stimulation. Our observations provide a physiological basis for understanding the differential clinical effects of corticosteroids in the immature human gut depending on the timing of treatment. Copyright © 2016 the American Physiological Society.

Hydrocortisone-induced anti-inflammatory effects in immature human enterocytes depend on the timing of exposure

PubMed Central

Rautava, Samuli; Lu, Lei

2016-01-01

The immature human gut has a propensity to exaggerated inflammatory responses that are thought to play a role in the pathogenesis of necrotizing enterocolitis (NEC). Prenatal exposure to corticosteroids has been reported to reduce the risk of NEC, while postnatal dexamethasone treatment is associated with adverse neurodevelopmental outcomes in preterm infants. The aim of this study was to investigate the direct role of hydrocortisone in gene expression patterns and inflammatory responses in immature human enterocytes. Time-dependent hydrocortisone effects in nontransformed primary human fetal intestinal epithelial cell line H4 were investigated by cDNA microarray. Fetal intestinal organ culture and cell culture experiments were conducted. Inflammatory responses were induced by stimulation with IL-1β and TNF-α with and without hydrocortisone. IL-8 and IL-6 expression and secretion were measured as functional readout. Here we report time-dependent hydrocortisone-induced changes in gene expression patterns detected by cDNA microarray. Hydrocortisone significantly attenuated IL-1β-induced inflammatory responses in the immature human gut when administered at the time of the proinflammatory insult: IL-1β-induced IL-8 and IL-6 secretion in the fetal ileum as well as H4 cells were significantly reduced. Hydrocortisone also inhibited IL-8 secretion in response to TNF-α. In contrast, TNF-α-induced IL-8 secretion was not reduced in cells treated with hydrocortisone for 48 h before stimulation. Our observations provide a physiological basis for understanding the differential clinical effects of corticosteroids in the immature human gut depending on the timing of treatment. PMID:27056727

Ethylene-induced differential gene expression during abscission of citrus leaves

PubMed Central

Merelo, Paz; Cercós, Manuel; Tadeo, Francisco R.; Talón, Manuel

2008-01-01

The main objective of this work was to identify and classify genes involved in the process of leaf abscission in Clementina de Nules (Citrus clementina Hort. Ex Tan.). A 7 K unigene citrus cDNA microarray containing 12 K spots was used to characterize the transcriptome of the ethylene-induced abscission process in laminar abscission zone-enriched tissues and the petiole of debladed leaf explants. In these conditions, ethylene induced 100% leaf explant abscission in 72 h while, in air-treated samples, the abscission period started later and took 240 h. Gene expression monitored during the first 36 h of ethylene treatment showed that out of the 12 672 cDNA microarray probes, ethylene differentially induced 725 probes distributed as follows: 216 (29.8%) probes in the laminar abscission zone and 509 (70.2%) in the petiole. Functional MIPS classification and manual annotation of differentially expressed genes highlighted key processes regulating the activation and progress of the cell separation that brings about abscission. These included cell-wall modification, lipid transport, protein biosynthesis and degradation, and differential activation of signal transduction and transcription control pathways. Expression data associated with the petiole indicated the occurrence of a double defensive strategy mediated by the activation of a biochemical programme including scavenging ROS, defence and PR genes, and a physical response mostly based on lignin biosynthesis and deposition. This work identifies new genes probably involved in the onset and development of the leaf abscission process and suggests a different but co-ordinated and complementary role for the laminar abscission zone and the petiole during the process of abscission. PMID:18515267

Downregulation of connective tissue growth factor by three-dimensional matrix enhances ovarian carcinoma cell invasion.

PubMed

Barbolina, Maria V; Adley, Brian P; Kelly, David L; Shepard, Jaclyn; Fought, Angela J; Scholtens, Denise; Penzes, Peter; Shea, Lonnie D; Stack, M Sharon

2009-08-15

Epithelial ovarian carcinoma (EOC) is a leading cause of death from gynecologic malignancies, due mainly to the prevalence of undetected metastatic disease. The process of cell invasion during intraperitoneal anchoring of metastatic lesions requires concerted regulation of many processes, including modulation of adhesion to the extracellular matrix and localized invasion. Exploratory cDNA microarray analysis of early response genes (altered after 4 hr of 3D collagen culture) coupled with confirmatory real-time reverse-transcriptase polymerase chain reaction, multiple 3D cell culture matrices, Western blot, immunostaining, adhesion, migration and invasion assays were used to identify modulators of adhesion pertinent to EOC progression and metastasis. cDNA microarray analysis indicated a dramatic downregulation of connective tissue growth factor (CTGF) in EOC cells placed in invasion- mimicking conditions (3D Type I collagen). Examination of human EOC specimens revealed that CTGF expression was absent in 46% of the tested samples (n = 41), but was present in 100% of normal ovarian epithelium samples (n = 7). Reduced CTGF expression occurs in many types of cells and may be a general phenomenon displayed by cells encountering a 3D environment. CTGF levels were inversely correlated with invasion such that downregulation of CTGF increased, while its upregulation reduced collagen invasion. Cells adhered preferentially to a surface comprised of both collagen I and CTGF relative to either component alone using alpha6beta1 and alpha3beta1 integrins. Together these data suggest that downregulation of CTGF in EOC cells may be important for cell invasion through modulation of cell-matrix adhesion.

Downregulation of Connective Tissue Growth Factor by Three-Dimensional Matrix Enhances Ovarian Carcinoma Cell Invasion

PubMed Central

Barbolina, Maria V.; Adley, Brian P.; Kelly, David L.; Shepard, Jaclyn; Fought, Angela J.; Scholtens, Denise; Penzes, Peter; Shea, Lonnie D.; Sharon Stack, M

2010-01-01

Epithelial ovarian carcinoma (EOC) is a leading cause of death from gynecologic malignancy, due mainly to the prevalence of undetected metastatic disease. The process of cell invasion during intra-peritoneal anchoring of metastatic lesions requires concerted regulation of many processes, including modulation of adhesion to the extracellular matrix and localized invasion. Exploratory cDNA microarray analysis of early response genes (altered after 4 hours of 3-dimensional collagen culture) coupled with confirmatory real-time RT-PCR, multiple three-dimensional cell culture matrices, Western blot, immunostaining, adhesion, migration, and invasion assays were used to identify modulators of adhesion pertinent to EOC progression and metastasis. cDNA microarray analysis indicated a dramatic downregulation of connective tissue growth factor (CTGF) in EOC cells placed in invasion-mimicking conditions (3-dimensional type I collagen). Examination of human EOC specimens revealed that CTGF expression was absent in 46% of the tested samples (n=41), but was present in 100% of normal ovarian epithelium samples (n=7). Reduced CTGF expression occurs in many types of cells and may be a general phenomenon displayed by cells encountering a 3D environment. CTGF levels were inversely correlated with invasion such that downregulation of CTGF increased, while its upregulation reduced, collagen invasion. Cells adhered preferentially to a surface comprised of both collagen I and CTGF relative to either component alone using α6β1 and α3β1 integrins. Together these data suggest that downregulation of CTGF in EOC cells may be important for cell invasion through modulation of cell-matrix adhesion. PMID:19382180

Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

PubMed Central

Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

PubMed Central

Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

2000-01-01

We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

Brain cDNA clone for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McTiernan, C.; Adkins, S.; Chatonnet, A.

1987-10-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

The proteins interacting with C-terminal of μ receptor are identified by bacterial two-hybrid system from brain cDNA library in morphine-dependent rats.

PubMed

Zhou, Peilan; Jiang, Jiebing; Dong, Zhaoqi; Yan, Hui; You, Zhendong; Su, Ruibin; Gong, Zehui

2015-12-15

Opioid addiction is associated with long-term adaptive changes in the brain that involve protein expression. The carboxyl-terminal of the μ opioid receptor (MOR-C) is important for receptor signal transduction under opioid treatment. However, the proteins that interact with MOR-C after chronic morphine exposure remain unknown. The brain cDNA library of chronic morphine treatment rats was screened using rat MOR-C to investigate the regulator of opioids dependence in the present study. The brain cDNA library from chronic morphine-dependent rats was constructed using the SMART (Switching Mechanism At 5' end of RNA Transcript) technique. Bacterial two-hybrid system was used to screening the rat MOR-C interacting proteins from the cDNA library. RT-qPCR and immunoblotting were used to determine the variation of MOR-C interacting proteins in rat brain after chronic morphine treatment. Column overlay assays, immunocytochemistry and coimmunoprecipitation were used to demonstrate the interaction of MOR-C and p75NTR-associated cell death executor (NADE). 21 positive proteins, including 19 known proteins were screened to interact with rat MOR-C. Expression of several of these proteins was altered in specific rat brain regions after chronic morphine treatment. Among these proteins, NADE was confirmed to interact with rat MOR-C by in vitro protein-protein binding and coimmunoprecipitation in Chinese hamster ovary (CHO) cells and rat brain with or without chronic morphine treatment. Understanding the rat MOR-C interacting proteins and the proteins variation under chronic morphine treatment may be critical for determining the pathophysiological basis of opioid tolerance and addiction. Copyright © 2015. Published by Elsevier Inc.

BIGEL analysis of gene expression in HL60 cells exposed to X rays or 60 Hz magnetic fields

NASA Technical Reports Server (NTRS)

Balcer-Kubiczek, E. K.; Zhang, X. F.; Han, L. H.; Harrison, G. H.; Davis, C. C.; Zhou, X. J.; Ioffe, V.; McCready, W. A.; Abraham, J. M.; Meltzer, S. J.

1998-01-01

We screened a panel of 1,920 randomly selected cDNAs to discover genes that are differentially expressed in HL60 cells exposed to 60 Hz magnetic fields (2 mT) or X rays (5 Gy) compared to unexposed cells. Identification of these clones was accomplished using our two-gel cDNA library screening method (BIGEL). Eighteen cDNAs differentially expressed in X-irradiated compared to control HL60 cells were recovered from a panel of 1,920 clones. Differential expression in experimental compared to control cells was confirmed independently by Northern blotting of paired total RNA samples hybridized to each of the 18 clone-specific cDNA probes. DNA sequencing revealed that 15 of the 18 cDNA clones produced matches with the database for genes related to cell growth, protein synthesis, energy metabolism, oxidative stress or apoptosis (including MYC, neuroleukin, copper zinc-dependent superoxide dismutase, TC4 RAS-like protein, peptide elongation factor 1alpha, BNIP3, GATA3, NF45, cytochrome c oxidase II and triosephosphate isomerase mRNAs). In contrast, BIGEL analysis of the same 1,920 cDNAs revealed no differences greater than 1.5-fold in expression levels in magnetic-field compared to sham-exposed cells. Magnetic-field-exposed and control samples were analyzed further for the presence of mRNA encoding X-ray-responsive genes by hybridization of the 18 specific cDNA probes to RNA from exposed and control HL60 cells. Our results suggest that differential gene expression is induced in approximately 1% of a random pool of cDNAs by ionizing radiation but not by 60 Hz magnetic fields under the present experimental conditions.

Human ESP1/CRP2, a member of the LIM domain protein family: Characterization of the cDNA and assignment of the gene locus to chromosome 14q32.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karim, Mohammad Azharul; Ohta, Kohji; Matsuda, Ichiro

1996-01-15

The LIM domain is present in a wide variety of proteins with diverse functions and exhibits characteristic arrangements of Cys and His residues with a novel zinc-binding motif. LIM domain proteins have been implicated in development, cell regulation, and cell structure. A LIM domain protein was identified by screening a human cDNA library with rat cysteine-rich intestinal protein (CRIP) as a probe, under conditions of low stringency. Comparison of the predicted amino acid sequence with several LIM domain proteins revealed 93% of the residues to be identical to rat LIM domain protein, termed ESP1 or CRP2. Thus, the protein ismore » hereafter referred to as human ESP1/CRP2. The cDNA encompasses a 1171-base region, including 26, 624, and 521 bases in the 5{prime}-noncoding region, coding region, and 3{prime}-noncoding regions, respectively, and encodes the entire ESP1/CRP2 protein has two LIM domains, and each shares 35.1% and 77 or 79% identical residues with human cysteine-rich protein (CRP) and rat CRIP, respectively. Northern blot analysis of ESP1/CRP2 in various human tissues showed distinct tissue distributions compared with CRP and CRIP, suggesting that each might serve related but specific roles in tissue organization or function. Using a panel of human-rodent somatic cell hybrids, the ESP1/CRP2 locus was assigned to chromosome 14. Fluorescence in situ hybridization, using cDNA and a genome DNA fragment of the ESP1/CRP2 as probes, confirms this assignment and relegates regional localization to band 14q32.3 47 refs., 7 figs.« less

A novel cytochrome P450 gene (CYP4G25) of the silkmoth Antheraea yamamai: cloning and expression pattern in pharate first instar larvae in relation to diapause.

PubMed

Yang, Ping; Tanaka, Hiromasa; Kuwano, Eiichi; Suzuki, Koichi

2008-03-01

A new cytochrome P450 gene, CYP4G25, was identified as a differentially expressed gene between the diapausing and post-diapausing pharate first instar larvae of the wild silkmoth Antheraea yamamai, using subtractive cDNA hybridization. The cDNA sequence of CYP4G25 has an open reading frame of 1674 nucleotides encoding 557 amino acid residues. Sequence analysis of the putative CYP4G25 protein disclosed the motif FXXGXRXCXG that is essential for heme binding in P450 cytochromes. Hybridization in situ demonstrated predominant expression of CYP4G25 in the integument of pharate first instar larvae. Northern blotting analysis showed an intensive signal after the initiation of diapause and no or weak expression throughout the periods of pre-diapause and post-diapause, including larval development. These results indicate that CYP4G25 is strongly associated with diapause in pharate first instar larvae.

Effect of C(60) fullerene on the duplex formation of i-motif DNA with complementary DNA in solution.

PubMed

Jin, Kyeong Sik; Shin, Su Ryon; Ahn, Byungcheol; Jin, Sangwoo; Rho, Yecheol; Kim, Heesoo; Kim, Seon Jeong; Ree, Moonhor

2010-04-15

The structural effects of fullerene on i-motif DNA were investigated by characterizing the structures of fullerene-free and fullerene-bound i-motif DNA, in the presence of cDNA and in solutions of varying pH, using circular dichroism and synchrotron small-angle X-ray scattering. To facilitate a direct structural comparison between the i-motif and duplex structures in response to pH stimulus, we developed atomic scale structural models for the duplex and i-motif DNA structures, and for the C(60)/i-motif DNA hybrid associated with the cDNA strand, assuming that the DNA strands are present in an ideal right-handed helical conformation. We found that fullerene shifted the pH-induced conformational transition between the i-motif and the duplex structure, possibly due to the hydrophobic interactions between the terminal fullerenes and between the terminal fullerenes and an internal TAA loop in the DNA strand. The hybrid structure showed a dramatic reduction in cyclic hysteresis.

An alternative method to amplify RNA without loss of signal conservation for expression analysis with a proteinase DNA microarray in the ArrayTube format.

PubMed

Schüler, Susann; Wenz, Ingrid; Wiederanders, B; Slickers, P; Ehricht, R

2006-06-12

Recent developments in DNA microarray technology led to a variety of open and closed devices and systems including high and low density microarrays for high-throughput screening applications as well as microarrays of lower density for specific diagnostic purposes. Beside predefined microarrays for specific applications manufacturers offer the production of custom-designed microarrays adapted to customers' wishes. Array based assays demand complex procedures including several steps for sample preparation (RNA extraction, amplification and sample labelling), hybridization and detection, thus leading to a high variability between several approaches and resulting in the necessity of extensive standardization and normalization procedures. In the present work a custom designed human proteinase DNA microarray of lower density in ArrayTube format was established. This highly economic open platform only requires standard laboratory equipment and allows the study of the molecular regulation of cell behaviour by proteinases. We established a procedure for sample preparation and hybridization and verified the array based gene expression profile by quantitative real-time PCR (QRT-PCR). Moreover, we compared the results with the well established Affymetrix microarray. By application of standard labelling procedures with e.g. Klenow fragment exo-, single primer amplification (SPA) or In Vitro Transcription (IVT) we noticed a loss of signal conservation for some genes. To overcome this problem we developed a protocol in accordance with the SPA protocol, in which we included target specific primers designed individually for each spotted oligomer. Here we present a complete array based assay in which only the specific transcripts of interest are amplified in parallel and in a linear manner. The array represents a proof of principle which can be adapted to other species as well. As the designed protocol for amplifying mRNA starts from as little as 100 ng total RNA, it presents an alternative method for detecting even low expressed genes by microarray experiments in a highly reproducible and sensitive manner. Preservation of signal integrity is demonstrated out by QRT-PCR measurements. The little amounts of total RNA necessary for the analyses make this method applicable for investigations with limited material as in clinical samples from, for example, organ or tumour biopsies. Those are arguments in favour of the high potential of our assay compared to established procedures for amplification within the field of diagnostic expression profiling. Nevertheless, the screening character of microarray data must be mentioned, and independent methods should verify the results.

Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications.

PubMed Central

Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J

1989-01-01

We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997

A Novel Approach to the Elucidation of the Mechanism of Development of Androgen-Independent Growth of Prostate Cancer

DTIC Science & Technology

2001-01-01

with 1.0 with differential hybridization to the two probes. Phage plaques corresponding ml of RIPA buffer with protease inhibitors (PBS, 1% NP40, 0.5...hybridized to radiolabeled probe prepared from plaque-purified phage . at 10,000 X g for 20 min; supernatants were collected and centrifuged again to...Screening. Lambda phage plaques from the primary unamplified Differential expression screening of cDNA libraries constructed CWR22 library were plated

A Label-Free Photoluminescence Genosensor Using Nanostructured Magnesium Oxide for Cholera Detection

NASA Astrophysics Data System (ADS)

Patel, Manoj Kumar; Ali, Md. Azahar; Krishnan, Sadagopan; Agrawal, Ved Varun; Al Kheraif, Abdulaziz A.; Fouad, H.; Ansari, Z. A.; Ansari, S. G.; Malhotra, Bansi D.

2015-11-01

Nanomaterial-based photoluminescence (PL) diagnostic devices offer fast and highly sensitive detection of pesticides, DNA, and toxic agents. Here we report a label-free PL genosensor for sensitive detection of Vibrio cholerae that is based on a DNA hybridization strategy utilizing nanostructured magnesium oxide (nMgO; size >30 nm) particles. The morphology and size of the synthesized nMgO were determined by transmission electron microscopic (TEM) studies. The probe DNA (pDNA) was conjugated with nMgO and characterized by X-ray photoelectron and Fourier transform infrared spectroscopic techniques. The target complementary genomic DNA (cDNA) isolated from clinical samples of V. cholerae was subjected to DNA hybridization studies using the pDNA-nMgO complex and detection of the cDNA was accomplished by measuring changes in PL intensity. The PL peak intensity measured at 700 nm (red emission) increases with the increase in cDNA concentration. A linear range of response in the developed PL genosensor was observed from 100 to 500 ng/μL with a sensitivity of 1.306 emi/ng, detection limit of 3.133 ng/μL and a regression coefficient (R2) of 0.987. These results show that this ultrasensitive PL genosensor has the potential for applications in the clinical diagnosis of cholera.

Analyses of chicken immunoglobulin light chain cDNA clones indicate a few germline V lambda genes and allotypes of the C lambda locus.

PubMed

Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I

1987-01-01

cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.

Use of Trypanosoma equiperdum infected rabbits as a source of splenic mRNA; construction of cDNA clones and identification of a rabbit mu heavy chain clone.

PubMed

Bernstein, K E; Pavirani, A; Alexander, C; Jacobsen, F; Fitzmaurice, L; Mage, R

1983-01-01

Rabbits were infected by Trypanosoma equiperdum and the splenic mRNA was isolated. In vitro translation of this RNA and immunoprecipitation with anti-light chain, anti-heavy chain, anti-mu and anti-VH antibodies demonstrated that T. equiperdum infection elicits large quantities of splenic mRNA encoding mu and kappa chains. The mu and gamma heavy chains and the kappa light chains synthesized in the cell-free translation system were specifically immunoprecipitated by antisera to heavy chain VHa and light chain kappa b allotypes. In vitro labeling of spleen cells from trypanosome-infected animals demonstrated that the biosynthetically labeled IgM has a mu chain of higher molecular weight than the mu chain synthesized by in vitro translation, a difference that is largely abolished when cellular glycosylation is blocked with the antibiotic tunicamycin. Enrichment for heavy chain or light chain mRNA was achieved by fractionating mRNA from trypanosome-infected animals on a sucrose gradient. cDNA clones carrying mu heavy chain sequences were produced using a 'one tube' protocol and identified by cross species hybridization and hybridization selection. Infection of rabbits with T. equiperdum followed by sucrose gradient enrichment of splenic mRNA has provided sufficient quantities of mRNA encoding mu heavy chain suitable for cDNA cloning.

Chromosomal mapping of the human M6 genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Olinsky, S.; Loop, B.T.; DeKosky, A.

1996-05-01

M6 is a neuronal membrane glycoprotein that may have an important role in neural development. This molecule was initially defined by a monoclonal antibody that affected the survival of cultured cerebellar neurons and the outgrowth of neurites. The nature of the antigen was discovered by expression cDNA cloning using this monoclonal antibody. Two distinct murine M6 cDNAs (designated M6a and M6b) whose deduced amino acid sequences were remarkably similar to that of the myelin proteolipid protein human cDNA and genomic clones encoding M6a and M6b and have characterized them by restriction mapping, Southern hybridization with cDNA probes, and sequence analysis.more » We have localized these genes within the human genome by FISH (fluorescence in situ hybridization). The human M6a gene is located at 4q34, and the M6b gene is located at Xp22.2 A number of human neurological disorders have been mapped to the Xp22 region, including Aicardi syndrome (MIM 304050), Rett syndrome (MIM 312750), X-linked Charcot-Marie-Tooth neuropathy (MIM 302801), and X-linked mental retardation syndromes (MRX1, MIM 309530). This raises the possibility that a defect in the M6b gene is responsible for one of these neurological disorders. 8 refs., 3 figs.« less

Minimum information specification for in situ hybridization and immunohistochemistry experiments (MISFISHIE).

PubMed

Deutsch, Eric W; Ball, Catherine A; Berman, Jules J; Bova, G Steven; Brazma, Alvis; Bumgarner, Roger E; Campbell, David; Causton, Helen C; Christiansen, Jeffrey H; Daian, Fabrice; Dauga, Delphine; Davidson, Duncan R; Gimenez, Gregory; Goo, Young Ah; Grimmond, Sean; Henrich, Thorsten; Herrmann, Bernhard G; Johnson, Michael H; Korb, Martin; Mills, Jason C; Oudes, Asa J; Parkinson, Helen E; Pascal, Laura E; Pollet, Nicolas; Quackenbush, John; Ramialison, Mirana; Ringwald, Martin; Salgado, David; Sansone, Susanna-Assunta; Sherlock, Gavin; Stoeckert, Christian J; Swedlow, Jason; Taylor, Ronald C; Walashek, Laura; Warford, Anthony; Wilkinson, David G; Zhou, Yi; Zon, Leonard I; Liu, Alvin Y; True, Lawrence D

2008-03-01

One purpose of the biomedical literature is to report results in sufficient detail that the methods of data collection and analysis can be independently replicated and verified. Here we present reporting guidelines for gene expression localization experiments: the minimum information specification for in situ hybridization and immunohistochemistry experiments (MISFISHIE). MISFISHIE is modeled after the Minimum Information About a Microarray Experiment (MIAME) specification for microarray experiments. Both guidelines define what information should be reported without dictating a format for encoding that information. MISFISHIE describes six types of information to be provided for each experiment: experimental design, biomaterials and treatments, reporters, staining, imaging data and image characterizations. This specification has benefited the consortium within which it was developed and is expected to benefit the wider research community. We welcome feedback from the scientific community to help improve our proposal.

Quantitative real-time polymerase chain reaction for the verification of genomic imbalances detected by microarray-based comparative genomic hybridization.

PubMed

Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D

2009-12-01

The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.

An integrated approach for identifying wrongly labelled samples when performing classification in microarray data.

PubMed

Leung, Yuk Yee; Chang, Chun Qi; Hung, Yeung Sam

2012-01-01

Using hybrid approach for gene selection and classification is common as results obtained are generally better than performing the two tasks independently. Yet, for some microarray datasets, both classification accuracy and stability of gene sets obtained still have rooms for improvement. This may be due to the presence of samples with wrong class labels (i.e. outliers). Outlier detection algorithms proposed so far are either not suitable for microarray data, or only solve the outlier detection problem on their own. We tackle the outlier detection problem based on a previously proposed Multiple-Filter-Multiple-Wrapper (MFMW) model, which was demonstrated to yield promising results when compared to other hybrid approaches (Leung and Hung, 2010). To incorporate outlier detection and overcome limitations of the existing MFMW model, three new features are introduced in our proposed MFMW-outlier approach: 1) an unbiased external Leave-One-Out Cross-Validation framework is developed to replace internal cross-validation in the previous MFMW model; 2) wrongly labeled samples are identified within the MFMW-outlier model; and 3) a stable set of genes is selected using an L1-norm SVM that removes any redundant genes present. Six binary-class microarray datasets were tested. Comparing with outlier detection studies on the same datasets, MFMW-outlier could detect all the outliers found in the original paper (for which the data was provided for analysis), and the genes selected after outlier removal were proven to have biological relevance. We also compared MFMW-outlier with PRAPIV (Zhang et al., 2006) based on same synthetic datasets. MFMW-outlier gave better average precision and recall values on three different settings. Lastly, artificially flipped microarray datasets were created by removing our detected outliers and flipping some of the remaining samples' labels. Almost all the 'wrong' (artificially flipped) samples were detected, suggesting that MFMW-outlier was sufficiently powerful to detect outliers in high-dimensional microarray datasets.

Open-target sparse sensing of biological agents using DNA microarray

PubMed Central

2011-01-01

Background Current biosensors are designed to target and react to specific nucleic acid sequences or structural epitopes. These 'target-specific' platforms require creation of new physical capture reagents when new organisms are targeted. An 'open-target' approach to DNA microarray biosensing is proposed and substantiated using laboratory generated data. The microarray consisted of 12,900 25 bp oligonucleotide capture probes derived from a statistical model trained on randomly selected genomic segments of pathogenic prokaryotic organisms. Open-target detection of organisms was accomplished using a reference library of hybridization patterns for three test organisms whose DNA sequences were not included in the design of the microarray probes. Results A multivariate mathematical model based on the partial least squares regression (PLSR) was developed to detect the presence of three test organisms in mixed samples. When all 12,900 probes were used, the model correctly detected the signature of three test organisms in all mixed samples (mean(R2)) = 0.76, CI = 0.95), with a 6% false positive rate. A sampling algorithm was then developed to sparsely sample the probe space for a minimal number of probes required to capture the hybridization imprints of the test organisms. The PLSR detection model was capable of correctly identifying the presence of the three test organisms in all mixed samples using only 47 probes (mean(R2)) = 0.77, CI = 0.95) with nearly 100% specificity. Conclusions We conceived an 'open-target' approach to biosensing, and hypothesized that a relatively small, non-specifically designed, DNA microarray is capable of identifying the presence of multiple organisms in mixed samples. Coupled with a mathematical model applied to laboratory generated data, and sparse sampling of capture probes, the prototype microarray platform was able to capture the signature of each organism in all mixed samples with high sensitivity and specificity. It was demonstrated that this new approach to biosensing closely follows the principles of sparse sensing. PMID:21801424

Microfluidic extraction and microarray detection of biomarkers from cancer tissue slides

NASA Astrophysics Data System (ADS)

Nguyen, H. T.; Dupont, L. N.; Jean, A. M.; Géhin, T.; Chevolot, Y.; Laurenceau, E.; Gijs, M. A. M.

2018-03-01

We report here a new microfluidic method allowing for the quantification of human epidermal growth factor receptor 2 (HER2) expression levels from formalin-fixed breast cancer tissues. After partial extraction of proteins from the tissue slide, the extract is routed to an antibody (Ab) microarray for HER2 titration by fluorescence. Then the HER2-expressing cell area is evaluated by immunofluorescence (IF) staining of the tissue slide and used to normalize the fluorescent HER2 signal measured from the Ab microarray. The number of HER2 gene copies measured by fluorescence in situ hybridization (FISH) on an adjacent tissue slide is concordant with the normalized HER2 expression signal. This work is the first study implementing biomarker extraction and detection from cancer tissue slides using microfluidics in combination with a microarray system, paving the way for further developments towards multiplex and precise quantification of cancer biomarkers.

DNA microarrays: a powerful genomic tool for biomedical and clinical research

PubMed Central

Trevino, Victor; Falciani, Francesco; Barrera-Saldaña, Hugo A.

2007-01-01

Among the many benefits of the Human Genome Project are new and powerful tools such as the genome-wide hybridization devices referred as microarrays. Initially designed to measure gene transcriptional levels, microarray technologies are now used for comparing other genome features among individuals and their tissues and cells. Results provide valuable information on disease subcategories, disease prognosis, and treatment outcome. Likewise, reveal differences in genetic makeup, regulatory mechanisms and subtle variations are approaching the era of personalized medicine. To understand this powerful tool, its versatility and how it is dramatically changing the molecular approach to biomedical and clinical research, this review describes the technology, its applications, a didactic step-by-step review of a typical microarray protocol, and a real experiment. Finally, it calls the attention of the medical community to integrate multidisciplinary teams, to take advantage of this technology and its expanding applications that in a slide reveals our genetic inheritance and destiny. PMID:17660860

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsia, Chu Chieh; Chizhikov, Vladimir E.; Yang, Amy X.

Hepatitis B virus (HBV), hepatitis C virus (HCV), and human immunodeficiency virus type-1 (HIV-1) are transfusion-transmitted human pathogens that have a major impact on blood safety and public health worldwide. We developed a microarray multiplex assay for the simultaneous detection and discrimination of these three viruses. The microarray consists of 16 oligonucleotide probes, immobilized on a silylated glass slide. Amplicons from multiplex PCR were labeled with Cy-5 and hybridized to the microarray. The assay detected 1 International Unit (IU), 10 IU, 20 IU of HBV, HCV, and HIV-1, respectively, in a single multiplex reaction. The assay also detected and discriminatedmore » the presence of two or three of these viruses in a single sample. Our data represent a proof-of-concept for the possible use of highly sensitive multiplex microarray assay to screen and confirm the presence of these viruses in blood donors and patients.« less

Weighted analysis of paired microarray experiments.

PubMed

Kristiansson, Erik; Sjögren, Anders; Rudemo, Mats; Nerman, Olle

2005-01-01

In microarray experiments quality often varies, for example between samples and between arrays. The need for quality control is therefore strong. A statistical model and a corresponding analysis method is suggested for experiments with pairing, including designs with individuals observed before and after treatment and many experiments with two-colour spotted arrays. The model is of mixed type with some parameters estimated by an empirical Bayes method. Differences in quality are modelled by individual variances and correlations between repetitions. The method is applied to three real and several simulated datasets. Two of the real datasets are of Affymetrix type with patients profiled before and after treatment, and the third dataset is of two-colour spotted cDNA type. In all cases, the patients or arrays had different estimated variances, leading to distinctly unequal weights in the analysis. We suggest also plots which illustrate the variances and correlations that affect the weights computed by our analysis method. For simulated data the improvement relative to previously published methods without weighting is shown to be substantial.

Microarray analysis of differential gene expression elicited in Trametes versicolor during interspecific mycelial interactions.

PubMed

Eyre, Catherine; Muftah, Wafa; Hiscox, Jennifer; Hunt, Julie; Kille, Peter; Boddy, Lynne; Rogers, Hilary J

2010-08-01

Trametes versicolor is an important white rot fungus of both industrial and ecological interest. Saprotrophic basidiomycetes are the major decomposition agents in woodland ecosystems, and rarely form monospecific populations, therefore interspecific mycelial interactions continually occur. Interactions have different outcomes including replacement of one species by the other or deadlock. We have made subtractive cDNA libraries to enrich for genes that are expressed when T. versicolor interacts with another saprotrophic basidiomycete, Stereum gausapatum, an interaction that results in the replacement of the latter. Expressed sequence tags (ESTs) (1920) were used for microarray analysis, and their expression compared during interaction with three different fungi: S. gausapatum (replaced by T. versicolor), Bjerkandera adusta (deadlock) and Hypholoma fasciculare (replaced T. versicolor). Expression of significantly more probes changed in the interaction between T. versicolor and S. gausapatum or B. adusta compared to H. fasciculare, suggesting a relationship between interaction outcome and changes in gene expression. Copyright © 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Gene ARMADA: an integrated multi-analysis platform for microarray data implemented in MATLAB.

PubMed

Chatziioannou, Aristotelis; Moulos, Panagiotis; Kolisis, Fragiskos N

2009-10-27

The microarray data analysis realm is ever growing through the development of various tools, open source and commercial. However there is absence of predefined rational algorithmic analysis workflows or batch standardized processing to incorporate all steps, from raw data import up to the derivation of significantly differentially expressed gene lists. This absence obfuscates the analytical procedure and obstructs the massive comparative processing of genomic microarray datasets. Moreover, the solutions provided, heavily depend on the programming skills of the user, whereas in the case of GUI embedded solutions, they do not provide direct support of various raw image analysis formats or a versatile and simultaneously flexible combination of signal processing methods. We describe here Gene ARMADA (Automated Robust MicroArray Data Analysis), a MATLAB implemented platform with a Graphical User Interface. This suite integrates all steps of microarray data analysis including automated data import, noise correction and filtering, normalization, statistical selection of differentially expressed genes, clustering, classification and annotation. In its current version, Gene ARMADA fully supports 2 coloured cDNA and Affymetrix oligonucleotide arrays, plus custom arrays for which experimental details are given in tabular form (Excel spreadsheet, comma separated values, tab-delimited text formats). It also supports the analysis of already processed results through its versatile import editor. Besides being fully automated, Gene ARMADA incorporates numerous functionalities of the Statistics and Bioinformatics Toolboxes of MATLAB. In addition, it provides numerous visualization and exploration tools plus customizable export data formats for seamless integration by other analysis tools or MATLAB, for further processing. Gene ARMADA requires MATLAB 7.4 (R2007a) or higher and is also distributed as a stand-alone application with MATLAB Component Runtime. Gene ARMADA provides a highly adaptable, integrative, yet flexible tool which can be used for automated quality control, analysis, annotation and visualization of microarray data, constituting a starting point for further data interpretation and integration with numerous other tools.

Methodological study of affine transformations of gene expression data with proposed robust non-parametric multi-dimensional normalization method.

PubMed

Bengtsson, Henrik; Hössjer, Ola

2006-03-01

Low-level processing and normalization of microarray data are most important steps in microarray analysis, which have profound impact on downstream analysis. Multiple methods have been suggested to date, but it is not clear which is the best. It is therefore important to further study the different normalization methods in detail and the nature of microarray data in general. A methodological study of affine models for gene expression data is carried out. Focus is on two-channel comparative studies, but the findings generalize also to single- and multi-channel data. The discussion applies to spotted as well as in-situ synthesized microarray data. Existing normalization methods such as curve-fit ("lowess") normalization, parallel and perpendicular translation normalization, and quantile normalization, but also dye-swap normalization are revisited in the light of the affine model and their strengths and weaknesses are investigated in this context. As a direct result from this study, we propose a robust non-parametric multi-dimensional affine normalization method, which can be applied to any number of microarrays with any number of channels either individually or all at once. A high-quality cDNA microarray data set with spike-in controls is used to demonstrate the power of the affine model and the proposed normalization method. We find that an affine model can explain non-linear intensity-dependent systematic effects in observed log-ratios. Affine normalization removes such artifacts for non-differentially expressed genes and assures that symmetry between negative and positive log-ratios is obtained, which is fundamental when identifying differentially expressed genes. In addition, affine normalization makes the empirical distributions in different channels more equal, which is the purpose of quantile normalization, and may also explain why dye-swap normalization works or fails. All methods are made available in the aroma package, which is a platform-independent package for R.

mRNA expression profiling of laser microbeam microdissected cells from slender embryonic structures.

PubMed

Scheidl, Stefan J; Nilsson, Sven; Kalén, Mattias; Hellström, Mats; Takemoto, Minoru; Håkansson, Joakim; Lindahl, Per

2002-03-01

Microarray hybridization has rapidly evolved as an important tool for genomic studies and studies of gene regulation at the transcriptome level. Expression profiles from homogenous samples such as yeast and mammalian cell cultures are currently extending our understanding of biology, whereas analyses of multicellular organisms are more difficult because of tissue complexity. The combination of laser microdissection, RNA amplification, and microarray hybridization has the potential to provide expression profiles from selected populations of cells in vivo. In this article, we present and evaluate an experimental procedure for global gene expression analysis of slender embryonic structures using laser microbeam microdissection and laser pressure catapulting. As a proof of principle, expression profiles from 1000 cells in the mouse embryonic (E9.5) dorsal aorta were generated and compared with profiles for captured mesenchymal cells located one cell diameter further away from the aortic lumen. A number of genes were overexpressed in the aorta, including 11 previously known markers for blood vessels. Among the blood vessel markers were endoglin, tie-2, PDGFB, and integrin-beta1, that are important regulators of blood vessel formation. This demonstrates that microarray analysis of laser microbeam micro-dissected cells is sufficiently sensitive for identifying genes with regulative functions.

A discrete wavelet based feature extraction and hybrid classification technique for microarray data analysis.

PubMed

Bennet, Jaison; Ganaprakasam, Chilambuchelvan Arul; Arputharaj, Kannan

2014-01-01

Cancer classification by doctors and radiologists was based on morphological and clinical features and had limited diagnostic ability in olden days. The recent arrival of DNA microarray technology has led to the concurrent monitoring of thousands of gene expressions in a single chip which stimulates the progress in cancer classification. In this paper, we have proposed a hybrid approach for microarray data classification based on nearest neighbor (KNN), naive Bayes, and support vector machine (SVM). Feature selection prior to classification plays a vital role and a feature selection technique which combines discrete wavelet transform (DWT) and moving window technique (MWT) is used. The performance of the proposed method is compared with the conventional classifiers like support vector machine, nearest neighbor, and naive Bayes. Experiments have been conducted on both real and benchmark datasets and the results indicate that the ensemble approach produces higher classification accuracy than conventional classifiers. This paper serves as an automated system for the classification of cancer and can be applied by doctors in real cases which serve as a boon to the medical community. This work further reduces the misclassification of cancers which is highly not allowed in cancer detection.

Cloning of the cocaine-sensitive bovine dopamine transporter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usdin, T.B.; Chen, C.; Brownstein, M.J.

1991-12-15

A cDNA encoding the dopamine transporter from bovine brain substantia nigra was identified on the basis of its structural homology to other, recently cloned, neurotransmitter transporters. The sequence of the 693-amino acid protein is quite similar to those of the rat {gamma}-aminobutyric acid, human norepinephrine, and rat serotonin transporters. Dopamine transporter mRNA was detected by in situ hybridization in the substantia nigra but not in the locus coeruleus, raphe, caudate, or other brain areas. ({sup 3}H)Dopamine accumulation in tissue culture cells transfected with the cDNA was inhibited by amphetamine, cocaine, and specific inhibitors of dopamine transports, including GBR12909.

A curated collection of tissue microarray images and clinical outcome data of prostate cancer patients

PubMed Central

Zhong, Qing; Guo, Tiannan; Rechsteiner, Markus; Rüschoff, Jan H.; Rupp, Niels; Fankhauser, Christian; Saba, Karim; Mortezavi, Ashkan; Poyet, Cédric; Hermanns, Thomas; Zhu, Yi; Moch, Holger; Aebersold, Ruedi; Wild, Peter J.

2017-01-01

Microscopy image data of human cancers provide detailed phenotypes of spatially and morphologically intact tissues at single-cell resolution, thus complementing large-scale molecular analyses, e.g., next generation sequencing or proteomic profiling. Here we describe a high-resolution tissue microarray (TMA) image dataset from a cohort of 71 prostate tissue samples, which was hybridized with bright-field dual colour chromogenic and silver in situ hybridization probes for the tumour suppressor gene PTEN. These tissue samples were digitized and supplemented with expert annotations, clinical information, statistical models of PTEN genetic status, and computer source codes. For validation, we constructed an additional TMA dataset for 424 prostate tissues, hybridized with FISH probes for PTEN, and performed survival analysis on a subset of 339 radical prostatectomy specimens with overall, disease-specific and recurrence-free survival (maximum 167 months). For application, we further produced 6,036 image patches derived from two whole slides. Our curated collection of prostate cancer data sets provides reuse potential for both biomedical and computational studies. PMID:28291248

A gene expression signature associated with survival in metastatic melanoma

PubMed Central

Mandruzzato, Susanna; Callegaro, Andrea; Turcatel, Gianluca; Francescato, Samuela; Montesco, Maria C; Chiarion-Sileni, Vanna; Mocellin, Simone; Rossi, Carlo R; Bicciato, Silvio; Wang, Ena; Marincola, Francesco M; Zanovello, Paola

2006-01-01

Background Current clinical and histopathological criteria used to define the prognosis of melanoma patients are inadequate for accurate prediction of clinical outcome. We investigated whether genome screening by means of high-throughput gene microarray might provide clinically useful information on patient survival. Methods Forty-three tumor tissues from 38 patients with stage III and stage IV melanoma were profiled with a 17,500 element cDNA microarray. Expression data were analyzed using significance analysis of microarrays (SAM) to identify genes associated with patient survival, and supervised principal components (SPC) to determine survival prediction. Results SAM analysis revealed a set of 80 probes, corresponding to 70 genes, associated with survival, i.e. 45 probes characterizing longer and 35 shorter survival times, respectively. These transcripts were included in a survival prediction model designed using SPC and cross-validation which allowed identifying 30 predicting probes out of the 80 associated with survival. Conclusion The longer-survival group of genes included those expressed in immune cells, both innate and acquired, confirming the interplay between immunological mechanisms and the natural history of melanoma. Genes linked to immune cells were totally lacking in the poor-survival group, which was instead associated with a number of genes related to highly proliferative and invasive tumor cells. PMID:17129373

Gene stage-specific expression in the microenvironment of pediatric myelodysplastic syndromes.

PubMed

Roela, Rosimeire A; Carraro, Dirce M; Brentani, Helena P; Kaiano, Jane H L; Simão, Daniel F; Guarnieiro, Roberto; Lopes, Luiz Fernando; Borojevic, Radovan; Brentani, M Mitzi

2007-05-01

Using cDNA microarray assays we have observed a clear difference in the gene expression pattern between bone marrow stromal cells obtained from healthy children (CT) and from pediatric patients with either myelodysplastic syndromes (MDS) or acute myeloid leukemia (AML) associated with MDS (MDS-AML). The global gene function profiling analysis indicated that in the pediatric MDS microenvironment the disease stages may be characterized mainly by underexpression of genes associated with biological processes such as transport. Furthermore, a subset of downregulated genes related to endocytosis and protein secretion was able to discriminate MDS from MDS-AML.

Sockeye salmon evolution, ecology, and management

USGS Publications Warehouse

Woody, Carol Ann

2007-01-01

This collection of articles and photographs gives managers a good idea of recent research into what the sockeye salmon is and does, covering such topics as the vulnerability and value of sockeye salmon ecotypes, their homing ability, using new technologies to monitor reproduction, DNA and a founder event in the Lake Clark sockeye salmon, marine-derived nutrients, the exploitation of large prey, dynamic lake spawning migrations by females, variability of sockeye salmon residence, expression profiling using cDNA microarray technology, learning from stable isotropic records of native otolith hatcheries, the amount of data needed to manage sockeye salmon and estimating salmon "escapement." 

A computational neural approach to support the discovery of gene function and classes of cancer.

PubMed

Azuaje, F

2001-03-01

Advances in molecular classification of tumours may play a central role in cancer treatment. Here, a novel approach to genome expression pattern interpretation is described and applied to the recognition of B-cell malignancies as a test set. Using cDNA microarrays data generated by a previous study, a neural network model known as simplified fuzzy ARTMAP is able to identify normal and diffuse large B-cell lymphoma (DLBCL) patients. Furthermore, it discovers the distinction between patients with molecularly distinct forms of DLBCL without previous knowledge of those subtypes.

Development and Use of Integrated Microarray-Based Genomic Technologies for Assessing Microbial Community Composition and Dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, J.; Wu, L.; Gentry, T.

2006-04-05

To effectively monitor microbial populations involved in various important processes, a 50-mer-based oligonucleotide microarray was developed based on known genes and pathways involved in: biodegradation, metal resistance and reduction, denitrification, nitrification, nitrogen fixation, methane oxidation, methanogenesis, carbon polymer decomposition, and sulfate reduction. This array contains approximately 2000 unique and group-specific probes with <85% similarity to their non-target sequences. Based on artificial probes, our results showed that at hybridization conditions of 50 C and 50% formamide, the 50-mer microarray hybridization can differentiate sequences having <88% similarity. Specificity tests with representative pure cultures indicated that the designed probes on the arrays appearedmore » to be specific to their corresponding target genes. Detection limits were about 5-10ng genomic DNA in the absence of background DNA, and 50-100ng ({approx}1.3{sup o} 10{sup 7} cells) in the presence background DNA. Strong linear relationships between signal intensity and target DNA and RNA concentration were observed (r{sup 2} = 0.95-0.99). Application of this microarray to naphthalene-amended enrichments and soil microcosms demonstrated that composition of the microflora varied depending on incubation conditions. While the naphthalene-degrading genes from Rhodococcus-type microorganisms were dominant in enrichments, the genes involved in naphthalene degradation from Gram-negative microorganisms such as Ralstonia, Comamonas, and Burkholderia were most abundant in the soil microcosms (as well as those for polyaromatic hydrocarbon and nitrotoluene degradation). Although naphthalene degradation is widely known and studied in Pseudomonas, Pseudomonas genes were not detected in either system. Real-time PCR analysis of 4 representative genes was consistent with microarray-based quantification (r{sup 2} = 0.95). Currently, we are also applying this microarray to the study of several different microbial communities and processes at the NABIR-FRC in Oak Ridge, TN. One project involves the monitoring of the development and dynamics of the microbial community of a fluidized bed reactor (FBR) used for reducing nitrate and the other project monitors microbial community responses to stimulation of uranium reducing populations via ethanol donor additions in situ and in a model system. Additionally, we are developing novel strategies for increasing microarray hybridization sensitivity. Finally, great improvements to our methods of probe design were made by the development of a new computer program, CommOligo. CommOligo designs unique and group-specific oligo probes for whole-genomes, metagenomes, and groups of environmental sequences and uses a new global alignment algorithm to design single or multiple probes for each gene or group. We are now using this program to design a more comprehensive functional gene array for environmental studies. Overall, our results indicate that the 50mer-based microarray technology has potential as a specific and quantitative tool to reveal the composition of microbial communities and their dynamics important to processes within contaminated environments.« less

Germacrene C synthase from Lycopersicon esculentum cv. VFNT Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase

PubMed Central

Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney

1998-01-01

Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

Oncogene GAEC1 regulates CAPN10 expression which predicts survival in esophageal squamous cell carcinoma

PubMed Central

Chan, Dessy; Tsoi, Miriam Yuen-Tung; Liu, Christina Di; Chan, Sau-Hing; Law, Simon Ying-Kit; Chan, Kwok-Wah; Chan, Yuen-Piu; Gopalan, Vinod; Lam, Alfred King-Yin; Tang, Johnny Cheuk-On

2013-01-01

AIM: To identify the downstream regulated genes of GAEC1 oncogene in esophageal squamous cell carcinoma and their clinicopathological significance. METHODS: The anti-proliferative effect of knocking down the expression of GAEC1 oncogene was studied by using the RNA interference (RNAi) approach through transfecting the GAEC1-overexpressed esophageal carcinoma cell line KYSE150 with the pSilencer vector cloned with a GAEC1-targeted sequence, followed by MTS cell proliferation assay and cell cycle analysis using flow cytometry. RNA was then extracted from the parental, pSilencer-GAEC1-targeted sequence transfected and pSilencer negative control vector transfected KYSE150 cells for further analysis of different patterns in gene expression. Genes differentially expressed with suppressed GAEC1 expression were then determined using Human Genome U133 Plus 2.0 cDNA microarray analysis by comparing with the parental cells and normalized with the pSilencer negative control vector transfected cells. The most prominently regulated genes were then studied by immunohistochemical staining using tissue microarrays to determine their clinicopathological correlations in esophageal squamous cell carcinoma by statistical analyses. RESULTS: The RNAi approach of knocking down gene expression showed the effective suppression of GAEC1 expression in esophageal squamous cell carcinoma cell line KYSE150 that resulted in the inhibition of cell proliferation and increase of apoptotic population. cDNA microarray analysis for identifying differentially expressed genes detected the greatest levels of downregulation of calpain 10 (CAPN10) and upregulation of trinucleotide repeat containing 6C (TNRC6C) transcripts when GAEC1 expression was suppressed. At the tissue level, the high level expression of calpain 10 protein was significantly associated with longer patient survival (month) of esophageal squamous cell carcinoma compared to the patients with low level of calpain 10 expression (37.73 ± 16.33 vs 12.62 ± 12.44, P = 0.032). No significant correction was observed among the TNRC6C protein expression level and the clinocopathologcial features of esophageal squamous cell carcinoma. CONCLUSION: GAEC1 regulates the expression of CAPN10 and TNRC6C downstream. Calpain 10 expression is a potential prognostic marker in patients with esophageal squamous cell carcinoma. PMID:23687414

Development and validation of a mixed-tissue oligonucleotide DNA microarray for Atlantic bluefin tuna, Thunnus thynnus (Linnaeus, 1758).

PubMed

Trumbić, Željka; Bekaert, Michaël; Taggart, John B; Bron, James E; Gharbi, Karim; Mladineo, Ivona

2015-11-25

The largest of the tuna species, Atlantic bluefin tuna (Thunnus thynnus), inhabits the North Atlantic Ocean and the Mediterranean Sea and is considered to be an endangered species, largely a consequence of overfishing. T. thynnus aquaculture, referred to as fattening or farming, is a capture based activity dependent on yearly renewal from the wild. Thus, the development of aquaculture practices independent of wild resources can provide an important contribution towards ensuring security and sustainability of this species in the longer-term. The development of such practices is today greatly assisted by large scale transcriptomic studies. We have used pyrosequencing technology to sequence a mixed-tissue normalised cDNA library, derived from adult T. thynnus. A total of 976,904 raw sequence reads were assembled into 33,105 unique transcripts having a mean length of 893 bases and an N50 of 870. Of these, 33.4% showed similarity to known proteins or gene transcripts and 86.6% of them were matched to the congeneric Pacific bluefin tuna (Thunnus orientalis) genome, compared to 70.3% for the more distantly related Nile tilapia (Oreochromis niloticus) genome. Transcript sequences were used to develop a novel 15 K Agilent oligonucleotide DNA microarray for T. thynnus and comparative tissue gene expression profiles were inferred for gill, heart, liver, ovaries and testes. Functional contrasts were strongest between gills and ovaries. Gills were particularly associated with immune system, signal transduction and cell communication, while ovaries displayed signatures of glycan biosynthesis, nucleotide metabolism, transcription, translation, replication and repair. Sequence data generated from a novel mixed-tissue T. thynnus cDNA library provide an important transcriptomic resource that can be further employed for study of various aspects of T. thynnus ecology and genomics, with strong applications in aquaculture. Tissue-specific gene expression profiles inferred through the use of novel oligo-microarray can serve in the design of new and more focused transcriptomic studies for future research of tuna physiology and assessment of the welfare in a production environment.

16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

PubMed

Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

2009-04-01

For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

DNA Microarray for Rapid Detection and Identification of Food and Water Borne Bacteria: From Dry to Wet Lab.

PubMed

Ranjbar, Reza; Behzadi, Payam; Najafi, Ali; Roudi, Raheleh

2017-01-01

A rapid, accurate, flexible and reliable diagnostic method may significantly decrease the costs of diagnosis and treatment. Designing an appropriate microarray chip reduces noises and probable biases in the final result. The aim of this study was to design and construct a DNA Microarray Chip for a rapid detection and identification of 10 important bacterial agents. In the present survey, 10 unique genomic regions relating to 10 pathogenic bacterial agents including Escherichia coli (E.coli), Shigella boydii, Sh.dysenteriae, Sh.flexneri, Sh.sonnei, Salmonella typhi, S.typhimurium, Brucella sp., Legionella pneumophila, and Vibrio cholera were selected for designing specific long oligo microarray probes. For this reason, the in-silico operations including utilization of the NCBI RefSeq database, Servers of PanSeq and Gview, AlleleID 7.7 and Oligo Analyzer 3.1 was done. On the other hand, the in-vitro part of the study comprised stages of robotic microarray chip probe spotting, bacterial DNAs extraction and DNA labeling, hybridization and microarray chip scanning. In wet lab section, different tools and apparatus such as Nexterion® Slide E, Qarray mini spotter, NimbleGen kit, TrayMix TM S4, and Innoscan 710 were used. A DNA microarray chip including 10 long oligo microarray probes was designed and constructed for detection and identification of 10 pathogenic bacteria. The DNA microarray chip was capable to identify all 10 bacterial agents tested simultaneously. The presence of a professional bioinformatician as a probe designer is needed to design appropriate multifunctional microarray probes to increase the accuracy of the outcomes.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andersen, G.L.; He, Z.; DeSantis, T.Z.

Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

Systematic Validation and Atomic Force Microscopy of Non-Covalent Short Oligonucleotide Barcode Microarrays

PubMed Central

Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-01-01

Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494

A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina.

PubMed

Bidard, Frédérique; Imbeaud, Sandrine; Reymond, Nancie; Lespinet, Olivier; Silar, Philippe; Clavé, Corinne; Delacroix, Hervé; Berteaux-Lecellier, Véronique; Debuchy, Robert

2010-06-18

The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis.

Waveguide-excited fluorescence microarray

NASA Astrophysics Data System (ADS)

Sagarzazu, Gabriel; Bedu, Mélanie; Martinelli, Lucio; Ha, Khoi-Nguyen; Pelletier, Nicolas; Safarov, Viatcheslav I.; Weisbuch, Claude; Gacoin, Thierry; Benisty, Henri

2008-04-01

Signal-to-noise ratio is a crucial issue in microarray fluorescence read-out. Several strategies are proposed for its improvement. First, light collection in conventional microarrays scanners is quite limited. It was recently shown that almost full collection can be achieved in an integrated lens-free biosensor, with labelled species hybridizing practically on the surface of a sensitive silicon detector [L. Martinelli et al. Appl. Phys. Lett. 91, 083901 (2007)]. However, even with such an improvement, the ultimate goal of real-time measurements during hybridization is challenging: the detector is dazzled by the large fluorescence of labelled species in the solution. In the present paper we show that this unwanted signal can effectively be reduced if the excitation light is confined in a waveguide. Moreover, the concentration of excitation light in a waveguide results in a huge signal gain. In our experiment we realized a structure consisting of a high index sol-gel waveguide deposited on a low-index substrate. The fluorescent molecules deposited on the surface of the waveguide were excited by the evanescent part of a wave travelling in the guide. The comparison with free-space excitation schemes confirms a huge gain (by several orders of magnitude) in favour of waveguide-based excitation. An optical guide deposited onto an integrated biosensor thus combines both advantages of ideal light collection and enhanced surface localized excitation without compromising the imaging properties. Modelling predicts a negligible penalty from spatial cross-talk in practical applications. We believe that such a system would bring microarrays to hitherto unattained sensitivities.

Soft Lithography for Oligonucleotide Arrays Fabrication

DTIC Science & Technology

2001-10-25

adenosine; Abbreviated T, C, G, A respectively), the other synthesis reagents and solvents except oxidation agent (seen in Table 1) were purchased...dried by cold blowing before hybridization. Oligonucleotide arrays were hybridized in 200 nM 3’-TCC TCC GAT TCA GAG AGT CC- HEX (PE Biosystems... citrate buffer), 0.1% SDS in 0.1xSSC respectively. The probe array was scanned on the Scanarray Microarray Systems (Packard Biochip Technologies, USA

Identification and expression profiles of multiple genes in Nile tilapia in response to bacterial infections

USDA-ARS?s Scientific Manuscript database

To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...

Genes from the 20Q13 amplicon and their uses

DOEpatents

Gray, Joe; Collins, Colin; Hwang, Soo-in; Godfrey, Tony; Kowbel, David; Rommens, Johanna

1999-01-01

The present invention relates to cDNA sequences from a region of amplification on chromosome 20 associated with disease. The sequences can be used in hybridization methods for the identification of chromosomal abnormalities associated with various diseases. The sequences can also be used for treatment of diseases.

Identifying differentially expressed genes in leaves of Glycine tomentella in the presence of the fungal pathogen Phakopsora pachyrhizi

USDA-ARS?s Scientific Manuscript database

Transcription profiles of Glycine tomentella genotypes having different responses to soybean rust, caused by the fungal pathogen Phakopsora pachyrhizi, were compared using suppression subtractive hybridization (SSH). Four cDNA libraries were constructed from infected and non-infected leaves of resis...

Nucleic Acid Research Group (NARG) 2009-2010 Study : Optimal Priming Strategies for cDNA Synthesis in Real-Time RT-qPCR

PubMed Central

Hunter, T.C.; Knudtson, K.L.; Nadella, V.; Sol-Church, K.; Taylor, W.L.; Tighe, S.; Yueng, A.T.; Chittur, S.

2010-01-01

r1-1 Real-time reverse transcriptase quantitative PCR (RT-qPCR) is a widely used technique for measuring transcript levels. Priming strategy and reverse transcriptase enzyme are key elements that affect sensitivity and variability of RT-qPCR and microarray results. Previously, the Nucleic Acid Research Group (NARG) had conducted preliminary studies within the group to examine the effects of priming strategy on generating cDNA for use with qPCR. This year's study was an open study in which the qPCR community was invited to participate. Participants received the RT primers and RNA template and were asked to perform the RT reaction using their preferred reaction conditions. Each participating laboratory was provided at least two RNA templates of varying quality. The RT products were returned to the NARG and all RT reactions were used in a qPCR reaction. The qPCR assays looked at three genes of varying abundance, b-actin (high copy), b-glucuronidase (medium copy) and TATA binding protein (low copy) as well as varying distance from the 3? end for each transcript. Results from participating laboratories will be evaluated to determine the impact of priming strategy, assay chemistry and experimental setup on the RT step. Additionally, we will address the impact of RNA integrity on cDNA synthesis.

Minimum Information Specification For In Situ Hybridization and Immunohistochemistry Experiments (MISFISHIE)

PubMed Central

Deutsch, Eric W; Ball, Catherine A; Berman, Jules J; Bova, G Steven; Brazma, Alvis; Bumgarner, Roger E; Campbell, David; Causton, Helen C; Christiansen, Jeffrey H; Daian, Fabrice; Dauga, Delphine; Davidson, Duncan R; Gimenez, Gregory; Goo, Young Ah; Grimmond, Sean; Henrich, Thorsten; Herrmann, Bernhard G; Johnson, Michael H; Korb, Martin; Mills, Jason C; Oudes, Asa J; Parkinson, Helen E; Pascal, Laura E; Pollet, Nicolas; Quackenbush, John; Ramialison, Mirana; Ringwald, Martin; Salgado, David; Sansone, Susanna-Assunta; Sherlock, Gavin; Stoeckert, Christian J; Swedlow, Jason; Taylor, Ronald C; Walashek, Laura; Warford, Anthony; Wilkinson, David G; Zhou, Yi; Zon, Leonard I; Liu, Alvin Y; True, Lawrence D

2015-01-01

One purpose of the biomedical literature is to report results in sufficient detail so that the methods of data collection and analysis can be independently replicated and verified. Here we present for consideration a minimum information specification for gene expression localization experiments, called the “Minimum Information Specification For In Situ Hybridization and Immunohistochemistry Experiments (MISFISHIE)”. It is modelled after the MIAME (Minimum Information About a Microarray Experiment) specification for microarray experiments. Data specifications like MIAME and MISFISHIE specify the information content without dictating a format for encoding that information. The MISFISHIE specification describes six types of information that should be provided for each experiment: Experimental Design, Biomaterials and Treatments, Reporters, Staining, Imaging Data, and Image Characterizations. This specification has benefited the consortium within which it was initially developed and is expected to benefit the wider research community. We welcome feedback from the scientific community to help improve our proposal. PMID:18327244

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Molecular Diversity of Macrophages in Allergic Reaction: Comparison between the Allergenic Modes; Th1- and -Th2-Derived Immune Conditions.

PubMed

Bagheri, Mozhdeh; Dong, Yupeng; Ono, Masao

2015-06-01

Activated macrophages have been classified into classical (M1) and alternative (M2) macrophages. We aimed to establish a method to yield enough number of macrophages to analyze their molecular, biological and immunological functions. We used drugs; adjuvant albumin from chicken egg whites--Imject Alum (OVA-Alum) and OVA Complete Freund Adjuvant (OVA-CFA), to induce macrophages to M2 and M1 respectively. We analyzed the phenotype of purified macrophages induced under these immune conditions, using flow cytometry (FACS) to detect cell-surface molecules and the enzyme-linked immunosorbent assay (ELISA) was used to detect cytokines. The cDNA microarray was employed to measure changes in expression level of cell surface protein between M1 and M2 macrophages. Phenotype analysis of purified macrophages, induced under these immune conditions, showed macrophages induced by OVA-Alum was almost M2 while the proportion of M1 macrophages induced by OVA-CFA was significantly higher. The results also showed higher expression level of macrophage galactose N- acetyl-galactosamine specific lectin-2 protein (MGL1/2-PE), a known M2 macrophage marker, on the surface of Alum-induced macrophages. On the basis of these preliminary data, ELISA results revealed that after macrophage stimulation with lipopolysaccharides (LPS), the level of interleukin (IL)-10 produced by Alum- induced macrophages was higher than the level of IL-10 produced by CFA-induced macrophages. In contrast, the level of tumor necrosis factor-alpha (TNF-α) produced by CFA-induced macrophages was higher than Alum-induced macrophages. The cDNA microarray confirmed previous results and suggest immunoglobulin-like type 2 receptor alpha (Pilra) as a new marker for M1, macrophage galactose N-acetylgalactosamine-specific lectin 2 (Mgl2) as M2 macrophages marker.

Isolation and characterization of a J domain protein that interacts with ARC1 from ornamental kale (Brassica oleracea var. acephala).

PubMed

Lan, Xingguo; Yang, Jia; Cao, Mingming; Wang, Yanhong; Kawabata, Saneyuki; Li, Yuhua

2015-05-01

A novel J domain protein, JDP1, was isolated from ornamental kale. The C-terminus of JDP1 specifically interacted with ARC1, which has a conserved role in self-incompatibility signaling. Armadillo (ARM)-repeat containing 1 (ARC1) plays a conserved role in self-incompatibility signaling across the Brassicaceae and functions downstream of the S-locus receptor kinase. Here, we identified a J domain protein 1 (JDP1) that interacts with ARC1 using a yeast two-hybrid screen against a stigma cDNA library from ornamental kale (Brassica oleracea var. acephala). JDP1, a 38.4-kDa protein with 344 amino acids, is a member of the Hsp40 family. Fragment JDP1(57-344), originally isolated from a yeast two-hybrid cDNA library, interacted specifically with ARC1 in yeast two-hybrid assays. The N-terminus of JDP1 (JDP1(1-68)) contains a J domain, and the C-terminus of JDP1 (JDP1(69-344)) contains an X domain of unknown function. However, JDP1(69-344) was required and sufficient for interaction with ARC1 in yeast two-hybrid assays and in vitro binding assays. Moreover, JDP1(69-344) regulated the trafficking of ARC1 from the cytoplasm to the plasma membrane by interacting with ARC1 in Arabidopsis mesophyll protoplasts. Finally, Tyr(8) in the JDP1 N-terminal region was identified to be the specific site for regulating the interaction between JDP1 and BoARC1 in yeast two-hybrid assays. Possible roles of JDP1 as an interactor with ARC1 in Brassica are discussed.

Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

PubMed

Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

2001-10-31

Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

An approach for identification of unknown viruses using sequencing-by-hybridization.

PubMed

Katoski, Sarah E; Meyer, Hermann; Ibrahim, Sofi

2015-09-01

Accurate identification of biological threat agents, especially RNA viruses, in clinical or environmental samples can be challenging because the concentration of viral genomic material in a given sample is usually low, viral genomic RNA is liable to degradation, and RNA viruses are extremely diverse. A two-tiered approach was used for initial identification, then full genomic characterization of 199 RNA viruses belonging to virus families Arenaviridae, Bunyaviridae, Filoviridae, Flaviviridae, and Togaviridae. A Sequencing-by-hybridization (SBH) microarray was used to tentatively identify a viral pathogen then, the identity is confirmed by guided next-generation sequencing (NGS). After optimization and evaluation of the SBH and NGS methodologies with various virus species and strains, the approach was used to test the ability to identify viruses in blinded samples. The SBH correctly identified two Ebola viruses in the blinded samples within 24 hr, and by using guided amplicon sequencing with 454 GS FLX, the identities of the viruses in both samples were confirmed. SBH provides at relatively low-cost screening of biological samples against a panel of viral pathogens that can be custom-designed on a microarray. Once the identity of virus is deduced from the highest hybridization signal on the SBH microarray, guided (amplicon) NGS sequencing can be used not only to confirm the identity of the virus but also to provide further information about the strain or isolate, including a potential genetic manipulation. This approach can be useful in situations where natural or deliberate biological threat incidents might occur and a rapid response is required. © 2015 Wiley Periodicals, Inc.

Strong FANCA/FANCG but weak FANCA/FANCC interaction in the yeast 2-hybrid system.

PubMed

Reuter, T; Herterich, S; Bernhard, O; Hoehn, H; Gross, H J

2000-01-15

Three of at least 8 Fanconi anemia (FA) genes have been cloned (FANCA, FANCC, FANCG), but their functions remain unknown. Using the yeast 2-hybrid system and full-length cDNA, the authors found a strong interaction between FANCA and FANCG proteins. They also obtained evidence for a weak interaction between FANCA and FANCC. Neither FANCA nor FANCC was found to interact with itself. These results support the notion of a functional association between the FA gene products. (Blood. 2000;95:719-720)

Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennacchio, L.A.

1994-05-06

We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.

Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

PubMed

Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

1999-10-06

The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

Combined histochemical staining, RNA amplification, regional, and single cell cDNA analysis within the hippocampus.

PubMed

Ginsberg, Stephen D; Che, Shaoli

2004-08-01

The use of five histochemical stains (cresyl violet, thionin, hematoxylin & eosin, silver stain, and acridine orange) was evaluated in combination with an expression profiling paradigm that included regional and single cell analyses within the hippocampus of post-mortem human brains and adult mice. Adjacent serial sections of human and mouse hippocampus were labeled by histochemistry or neurofilament immunocytochemistry. These tissue sections were used as starting material for regional and single cell microdissection followed by a newly developed RNA amplification procedure (terminal continuation (TC) RNA amplification) and subsequent hybridization to custom-designed cDNA arrays. Results indicated equivalent levels of global hybridization signal intensity and relative expression levels for individual genes for hippocampi stained by cresyl violet, thionin, and hematoxylin & eosin, and neurofilament immunocytochemistry. Moreover, no significant differences existed between the Nissl stains and neurofilament immunocytochemistry for individual CA1 neurons obtained via laser capture microdissection. In contrast, a marked decrement was observed in adjacent hippocampal sections stained for silver stain and acridine orange, both at the level of the regional dissection and at the CA1 neuron population level. Observations made on the cDNA array platform were validated by real-time qPCR using primers directed against beta-actin and glyceraldehyde-3 phosphate dehydrogenase. Thus, this report demonstrated the utility of using specific Nissl stains, but not stains that bind RNA species directly, in both human and mouse brain tissues at the regional and cellular level for state-of-the-art molecular fingerprinting studies.

Primary culture of cat intestinal epithelial cells in vitro and the cDNA library construction.

PubMed

Zhao, Gui Hua; Liu, Ye; Cheng, Yun Tang; Zhao, Qing Song; Qiu, Xiao; Xu, Chao; Xiao, Ting; Zhu, Song; Liu, Gong Zhen; Yin, Kun

2018-06-26

Felids are the only definitive hosts of Toxoplasma gondii. To lay a foundation for screening the T. gondii-felids interaction factors, we have developed a reproducible primary culture method for cat intestinal epithelial cells (IECs). The primary IECs were isolated from a new born cat's small intestine jejunum region without food ingress, and respectively in vitro cultured by tissue cultivation and combined digestion method with collagenase XI and dispase I, then purified by trypsinization. After identification, the ds cDNA of cat IECs was synthesized for constructing pGADT7 homogenization three-frame plasmid, and transformed into the yeast Y187 for generating the cDNA library. Our results indicated that cultivation of primary cat IECs relays on combined digestion to form polarized and confluent monolayers within 3 days with typical features of normal epithelial cells. The purified cells cultured by digestion method were identified to be nature intestinal epithelial cells using immunohistochemical analysis and were able to maintain viability for at least 15 passages. The homogenizable ds cDNA, which is synthesized from the total RNA extracted from our cultured IECs, distributed among 0.5-2.0 kb, and generated satisfying three-frame cDNA library with the capacity of 1.2 × 106 and the titer of 5.2 × 107 pfu/mL. Our results established an optimal method for the culturing and passage of cat IECs model in vitro, and laid a cDNA library foundation for the subsequent interaction factors screening by yeast two-hybrid.

Identification and transcriptional profile of multiple genes in the posterior kidney of Nile tilapia at 6h post bacterial infections

USDA-ARS?s Scientific Manuscript database

To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...

Inheritance of RFLP loci in a loblolly pine three-generation pedigree

Treesearch

M.D. Devey; K.D. Jermstad; C.G. Tauer; D.B. Neale

1991-01-01

A high-density restriction fragment length polymorphism (RFLP) linkage map is being constructed for loblolly pine (Pinus taeda L.). Loblolly pine cDNA and genomic DNA clones were used as probes in hybridizations to genomic DNAs prepared from grandparents, parents, and progeny of a three-generation outbred pedigree. Approximately 200 probes were...

Distribution of cholecystokinin mRNA and peptides in the human brain.

PubMed

Lindefors, N; Brené, S; Kopp, J; Lindén, A; Brodin, E; Sedvall, G; Persson, H

1991-01-01

Expression of preprocholecystokinin mRNA was studied in regions of post mortem human brain using RNA blot analysis (Northern blot) and in situ hybridization. Northern blot analysis using a cDNA probe showed high levels of an approximately 0.8 kb preprocholecystokinin mRNA in all regions of neocortex examined. Lower levels of preprocholecystokinin mRNA were detected in amygdaloid body and thalamus. In situ hybridization analysis using the same cDNA probe revealed numerous weakly labelled neurons in different areas of human neocortex and less numerous neurons in hippocampus and amygdaloid body. High-performance liquid-chromatography and gel-chromatography combined with radioimmunoassay of cholecystokinin-like immunoreactivity from human cerebral cortex and caudate nucleus revealed two major forms, one coeluting with sulphated cholecystokinin-8 and the other coeluting with sulphated cholecystokinin-58. Two minor components coeluting with cholecystokinin-4 and cholecystokinin-5 were also detected. The finding of cholecystokinin-like immunoreactivity corresponding to cholecystokinin-8 and cholecystokinin-58 in caudate nucleus where no preprocholecystokinin mRNA was found, indicates the presence of these peptides in afferent nerve terminals.

Dengue-2 structural proteins associate with human proteins to produce a coagulation and innate immune response biased interactome.

PubMed

Folly, Brenda B; Weffort-Santos, Almeriane M; Fathman, C G; Soares, Luis R B

2011-01-31

Dengue virus infection is a public health threat to hundreds of millions of individuals in the tropical regions of the globe. Although Dengue infection usually manifests itself in its mildest, though often debilitating clinical form, dengue fever, life-threatening complications commonly arise in the form of hemorrhagic shock and encephalitis. The etiological basis for the virus-induced pathology in general, and the different clinical manifestations in particular, are not well understood. We reasoned that a detailed knowledge of the global biological processes affected by virus entry into a cell might help shed new light on this long-standing problem. A bacterial two-hybrid screen using DENV2 structural proteins as bait was performed, and the results were used to feed a manually curated, global dengue-human protein interaction network. Gene ontology and pathway enrichment, along with network topology and microarray meta-analysis, were used to generate hypothesis regarding dengue disease biology. Combining bioinformatic tools with two-hybrid technology, we screened human cDNA libraries to catalogue proteins physically interacting with the DENV2 virus structural proteins, Env, cap and PrM. We identified 31 interacting human proteins representing distinct biological processes that are closely related to the major clinical diagnostic feature of dengue infection: haemostatic imbalance. In addition, we found dengue-binding human proteins involved with additional key aspects, previously described as fundamental for virus entry into cells and the innate immune response to infection. Construction of a DENV2-human global protein interaction network revealed interesting biological properties suggested by simple network topology analysis. Our experimental strategy revealed that dengue structural proteins interact with human protein targets involved in the maintenance of blood coagulation and innate anti-viral response processes, and predicts that the interaction of dengue proteins with a proposed human protein interaction network produces a modified biological outcome that may be behind the hallmark pathologies of dengue infection.

In situ hybridization analysis of the expression of futsch, tau, and MESK2 homologues in the brain of the European honeybee (Apis mellifera L.).

PubMed

Kaneko, Kumi; Hori, Sayaka; Morimoto, Mai M; Nakaoka, Takayoshi; Paul, Rajib Kumar; Fujiyuki, Tomoko; Shirai, Kenichi; Wakamoto, Akiko; Tsuboko, Satomi; Takeuchi, Hideaki; Kubo, Takeo

2010-02-16

The importance of visual sense in Hymenopteran social behavior is suggested by the existence of a Hymenopteran insect-specific neural circuit related to visual processing and the fact that worker honeybee brain changes morphologically according to its foraging experience. To analyze molecular and neural bases that underlie the visual abilities of the honeybees, we used a cDNA microarray to search for gene(s) expressed in a neural cell-type preferential manner in a visual center of the honeybee brain, the optic lobes (OLs). Expression analysis of candidate genes using in situ hybridization revealed two genes expressed in a neural cell-type preferential manner in the OLs. One is a homologue of Drosophila futsch, which encodes a microtubule-associated protein and is preferentially expressed in the monopolar cells in the lamina of the OLs. The gene for another microtubule-associated protein, tau, which functionally overlaps with futsch, was also preferentially expressed in the monopolar cells, strongly suggesting the functional importance of these two microtubule-associated proteins in monopolar cells. The other gene encoded a homologue of Misexpression Suppressor of Dominant-negative Kinase Suppressor of Ras 2 (MESK2), which might activate Ras/MAPK-signaling in Drosophila. MESK2 was expressed preferentially in a subclass of neurons located in the ventral region between the lamina and medulla neuropil in the OLs, suggesting that this subclass is a novel OL neuron type characterized by MESK2-expression. These three genes exhibited similar expression patterns in the worker, drone, and queen brains, suggesting that they function similarly irrespective of the honeybee sex or caste. Here we identified genes that are expressed in a monopolar cell (Amfutsch and Amtau) or ventral medulla-preferential manner (AmMESK2) in insect OLs. These genes may aid in visualizing neurites of monopolar cells and ventral medulla cells, as well as in analyzing the function of these neurons.

Molecular analysis of the effect of topical imiquimod treatment of HPV 2/27/57-induced common warts.

PubMed

Jacobs, S; Grussendorf-Conen, E-I; Rösener, I; Rübben, A

2004-01-01

Imiquimod is effective in the treatment of genital warts and clinical studies suggest activity against common warts as well. We have analyzed the effect of topical imiquimod on gene expression and virus load in human papilloma virus (HPV) 2/27/57-induced common warts. mRNA was extracted from keratinocyte culture, from normal skin, from three untreated common warts and from three common warts treated topically with 5% imiquimod cream twice daily. Differential gene expression was demonstrated by RT-PCR and by cDNA microarray hybridization. We further analyzed viral DNA content in scales from three superficially pared imiquimod-treated warts by real-time PCR. Comparison of normal skin with wart tissue revealed that HPV 2/27/57 infection led to an induction of IL-6, IL-10 and interferon-gamma inducible protein (IP10) and to an up-regulation of TGF-beta. We could further detect expression of PCTAIRE-3, WNT2B, frizzled-3, notch-2, notch-4 and BRCA2 in normal skin and common warts. Analysis of imiquimod-treated warts demonstrated that imiquimod enhanced IL-6 expression and induced IL-8, GM-CSF, MRP-8 and MRP-14. It could also be shown that imiquimod led to an infiltration of wart tissue with macrophages and to a strong decrease of viral copy number in warts within 3 months of treatment. Our data thus provide molecular proof of principle for imiquimod treatment of cutaneous common warts. 2004 S. Karger AG, Basel

Detection and genotyping of Entamoeba histolytica, Entamoeba dispar, Giardia lamblia, and Cryptosporidium parvum by oligonucleotide microarray.

PubMed

Wang, Zheng; Vora, Gary J; Stenger, David A

2004-07-01

Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum are the most frequently identified protozoan parasites causing waterborne disease outbreaks. The morbidity and mortality associated with these intestinal parasitic infections warrant the development of rapid and accurate detection and genotyping methods to aid public health efforts aimed at preventing and controlling outbreaks. In this study, we describe the development of an oligonucleotide microarray capable of detecting and discriminating between E. histolytica, Entamoeba dispar, G. lamblia assemblages A and B, and C. parvum types 1 and 2 in a single assay. Unique hybridization patterns for each selected protozoan were generated by amplifying six to eight diagnostic sequences/organism by multiplex PCR; fluorescent labeling of the amplicons via primer extension; and subsequent hybridization to a set of genus-, species-, and subtype-specific covalently immobilized oligonucleotide probes. The profile-based specificity of this methodology not only permitted for the unequivocal identification of the six targeted species and subtypes, but also demonstrated its potential in identifying related species such as Cryptosporidium meleagridis and Cryptosporidium muris. In addition, sensitivity assays demonstrated lower detection limits of five trophozoites of G. lamblia. Taken together, the specificity and sensitivity of the microarray-based approach suggest that this methodology may provide a promising tool to detect and genotype protozoa from clinical and environmental samples.

mRNA Expression Profiling of Laser Microbeam Microdissected Cells from Slender Embryonic Structures

PubMed Central

Scheidl, Stefan J.; Nilsson, Sven; Kalén, Mattias; Hellström, Mats; Takemoto, Minoru; Håkansson, Joakim; Lindahl, Per

2002-01-01

Microarray hybridization has rapidly evolved as an important tool for genomic studies and studies of gene regulation at the transcriptome level. Expression profiles from homogenous samples such as yeast and mammalian cell cultures are currently extending our understanding of biology, whereas analyses of multicellular organisms are more difficult because of tissue complexity. The combination of laser microdissection, RNA amplification, and microarray hybridization has the potential to provide expression profiles from selected populations of cells in vivo. In this article, we present and evaluate an experimental procedure for global gene expression analysis of slender embryonic structures using laser microbeam microdissection and laser pressure catapulting. As a proof of principle, expression profiles from 1000 cells in the mouse embryonic (E9.5) dorsal aorta were generated and compared with profiles for captured mesenchymal cells located one cell diameter further away from the aortic lumen. A number of genes were overexpressed in the aorta, including 11 previously known markers for blood vessels. Among the blood vessel markers were endoglin, tie-2, PDGFB, and integrin-β1, that are important regulators of blood vessel formation. This demonstrates that microarray analysis of laser microbeam micro-dissected cells is sufficiently sensitive for identifying genes with regulative functions. PMID:11891179

Using Microarrays to Facilitate Positional Cloning: Identification of Tomosyn as an Inhibitor of Neurosecretion

PubMed Central

Dybbs, Michael; Ngai, John; Kaplan, Joshua M

2005-01-01

Forward genetic screens have been used as a powerful strategy to dissect complex biological pathways in many model systems. A significant limitation of this approach has been the time-consuming and costly process of positional cloning and molecular characterization of the mutations isolated in these screens. Here, the authors describe a strategy using microarray hybridizations to facilitate positional cloning. This method relies on the fact that premature stop codons (i.e., nonsense mutations) constitute a frequent class of mutations isolated in screens and that nonsense mutant messenger RNAs are efficiently degraded by the conserved nonsense-mediated decay pathway. They validate this strategy by identifying two previously uncharacterized mutations: (1) tom-1, a mutation found in a forward genetic screen for enhanced acetylcholine secretion in Caenorhabditis elegans, and (2) an apparently spontaneous mutation in the hif-1 transcription factor gene. They further demonstrate the broad applicability of this strategy using other known mutants in C. elegans, Arabidopsis, and mouse. Characterization of tom-1 mutants suggests that TOM-1, the C. elegans ortholog of mammalian tomosyn, functions as an endogenous inhibitor of neurotransmitter secretion. These results also suggest that microarray hybridizations have the potential to significantly reduce the time and effort required for positional cloning. PMID:16103915

Response of sweet orange (Citrus sinensis) to 'Candidatus Liberibacter asiaticus' infection: microscopy and microarray analyses.

PubMed

Kim, Jeong-Soon; Sagaram, Uma Shankar; Burns, Jacqueline K; Li, Jian-Liang; Wang, Nian

2009-01-01

Citrus greening or huanglongbing (HLB) is a devastating disease of citrus. HLB is associated with the phloem-limited fastidious prokaryotic alpha-proteobacterium 'Candidatus Liberibacter spp.' In this report, we used sweet orange (Citrus sinensis) leaf tissue infected with 'Ca. Liberibacter asiaticus' and compared this with healthy controls. Investigation of the host response was examined with citrus microarray hybridization based on 33,879 expressed sequence tag sequences from several citrus species and hybrids. The microarray analysis indicated that HLB infection significantly affected expression of 624 genes whose encoded proteins were categorized according to function. The categories included genes associated with sugar metabolism, plant defense, phytohormone, and cell wall metabolism, as well as 14 other gene categories. The anatomical analyses indicated that HLB bacterium infection caused phloem disruption, sucrose accumulation, and plugged sieve pores. The up-regulation of three key starch biosynthetic genes including ADP-glucose pyrophosphorylase, starch synthase, granule-bound starch synthase and starch debranching enzyme likely contributed to accumulation of starch in HLB-affected leaves. The HLB-associated phloem blockage resulted from the plugged sieve pores rather than the HLB bacterial aggregates since 'Ca. Liberibacter asiaticus' does not form aggregate in citrus. The up-regulation of pp2 gene is related to callose deposition to plug the sieve pores in HLB-affected plants.

Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

PubMed

Hargreaves, Adam D; Mulley, John F

2015-01-01

Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

PubMed Central

Hargreaves, Adam D.

2015-01-01

Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species. PMID:26623194

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform.

PubMed

Salehi, Reza; Tsoi, Stephen C M; Colazo, Marcos G; Ambrose, Divakar J; Robert, Claude; Dyck, Michael K

2017-01-30

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo development due to their similar developmental process. Although genetic factors are known to affect early embryonic development, the discovery of such factors has been a serious challenge. Microarray technology allows quantitative measurement and gene expression profiling of transcript levels on a genome-wide basis. One of the main decisions that have to be made when planning a microarray experiment is whether to use a one- or two-color approach. Two-color design increases technical replication, minimizes variability, improves sensitivity and accuracy as well as allows having loop designs, defining the common reference samples. Although microarray is a powerful biological tool, there are potential pitfalls that can attenuate its power. Hence, in this technical paper we demonstrate an optimized protocol for RNA extraction, amplification, labeling, hybridization of the labeled amplified RNA to the array, array scanning and data analysis using the two-color analysis strategy.

Analysis of developmental gene conservation in the Actinomycetales using DNA/DNA microarray comparisons.

PubMed

Kirby, Ralph; Herron, Paul; Hoskisson, Paul

2011-02-01

Based on available genome sequences, Actinomycetales show significant gene synteny across a wide range of species and genera. In addition, many genera show varying degrees of complex morphological development. Using the presence of gene synteny as a basis, it is clear that an analysis of gene conservation across the Streptomyces and various other Actinomycetales will provide information on both the importance of genes and gene clusters and the evolution of morphogenesis in these bacteria. Genome sequencing, although becoming cheaper, is still relatively expensive for comparing large numbers of strains. Thus, a heterologous DNA/DNA microarray hybridization dataset based on a Streptomyces coelicolor microarray allows a cheaper and greater depth of analysis of gene conservation. This study, using both bioinformatical and microarray approaches, was able to classify genes previously identified as involved in morphogenesis in Streptomyces into various subgroups in terms of conservation across species and genera. This will allow the targeting of genes for further study based on their importance at the species level and at higher evolutionary levels.

A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina

PubMed Central

2010-01-01

Background The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. Findings We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. Conclusions A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis. PMID:20565839

Microarray analysis of gene expression patterns in the leaf during potato tuberization in the potato somatic hybrid Solanum tuberosum and Solanum etuberosum.

PubMed

Tiwari, Jagesh Kumar; Devi, Sapna; Sundaresha, S; Chandel, Poonam; Ali, Nilofer; Singh, Brajesh; Bhardwaj, Vinay; Singh, Bir Pal

2015-06-01

Genes involved in photoassimilate partitioning and changes in hormonal balance are important for potato tuberization. In the present study, we investigated gene expression patterns in the tuber-bearing potato somatic hybrid (E1-3) and control non-tuberous wild species Solanum etuberosum (Etb) by microarray. Plants were grown under controlled conditions and leaves were collected at eight tuber developmental stages for microarray analysis. A t-test analysis identified a total of 468 genes (94 up-regulated and 374 down-regulated) that were statistically significant (p ≤ 0.05) and differentially expressed in E1-3 and Etb. Gene Ontology (GO) characterization of the 468 genes revealed that 145 were annotated and 323 were of unknown function. Further, these 145 genes were grouped based on GO biological processes followed by molecular function and (or) PGSC description into 15 gene sets, namely (1) transport, (2) metabolic process, (3) biological process, (4) photosynthesis, (5) oxidation-reduction, (6) transcription, (7) translation, (8) binding, (9) protein phosphorylation, (10) protein folding, (11) ubiquitin-dependent protein catabolic process, (12) RNA processing, (13) negative regulation of protein, (14) methylation, and (15) mitosis. RT-PCR analysis of 10 selected highly significant genes (p ≤ 0.01) confirmed the microarray results. Overall, we show that candidate genes induced in leaves of E1-3 were implicated in tuberization processes such as transport, carbohydrate metabolism, phytohormones, and transcription/translation/binding functions. Hence, our results provide an insight into the candidate genes induced in leaf tissues during tuberization in E1-3.