Science.gov

Sample records for cdna nucleotide sequence

  1. Nucleotide sequence of equine caspase-1 cDNA.

    PubMed

    Wardlow, S; Penha-Goncalves, M N; Argyle, D J; Onions, D E; Nicolson, L

    1999-01-01

    Caspases are a family of cysteine proteases which have important roles in activation of cytokines and in apoptosis. Caspase-1, or interleukin-1 beta converting enzyme (ICE), promotes maturation of interleukin-1 beta (IL-1 beta) and interleukin-18 (IL-18) by proteolytic cleavage of precursor forms to generate biologically active peptides. We report the cloning and sequencing of equine caspase-1 cDNA. Equine caspase-1 is 405 amino acids in length and has 72% and 63% identity to human and mouse caspase-1, respectively, at the amino acid level. Sites of proteolytic cleavage and catalytic activity as identified in human caspase-1, are conserved. PMID:10376217

  2. Nucleotide sequence of the p53 cDNA of beluga whale (Delphinapterus leucas).

    PubMed

    Xu, Ning; Shiraki, Takashi; Yamada, Tadasu; Nakajima, Masayuki; Gauthier, Julie M; Pfeiffer, Carl J; Sato, Shigeaki

    2002-04-17

    The cDNA (DNA complementary to RNA) of the p53 gene of the beluga whale (Delphinapterus leucas) was sequenced by the method of 5'- and 3'-rapid amplification of cDNA ends (RACE) with the cDNA made for the RNA obtained from fresh peripheral blood leukocytes isolated from two animals. Primers for the RACE method were synthesized based on the sequence of the DNA of beluga whale corresponding to exon 5 of the human p53 gene, which was determined after amplification of the DNA isolated from the liver from a beluga whale by using a pair of primers for the human sequence. The sequenced cDNA had a 2150-nucleotide length and contained the whole region corresponding to human exons 1 through 11. The reading frame was 1164 bp (base pair) long and began in exon 2 and ended in exon 11, coding for a 387-amino acid protein. The nucleotide sequence of the reading frame showed high similarity over 85% with pig, sheep, cow, and human genes. The similarities with the former two animals at the amino acid level were also more than 85%. Lower similarity of the beluga whale p53 gene was also found with those of lower tetrapods, fish and invertebrates.

  3. Cloning and nucleotide sequence of the alpha-galactosidase cDNA from Cyamopsis tetragonoloba (guar).

    PubMed

    Overbeeke, N; Fellinger, A J; Toonen, M Y; van Wassenaar, D; Verrips, C T

    1989-11-01

    Polyadenylated mRNA was purified from the aleurone cells of Cyamopsis tetragonoloba (guar) seeds germinated for 18 h and used for the construction of a cDNA library. Clones with the alpha-galactosidase encoding gene were identified using oligo-nucleotide mixed probes based on the NH2 terminal amino acid sequence and on the sequence of an internal peptide. The nucleotide sequence of the cDNA clone showed that the enzyme is synthesized as a precursor with a 47 amino acid NH2 terminal extension. This pre-sequence most likely functions to target the protein outside the aleurone cells into the endosperm. Based upon structural features, it is proposed to divide the precursor into a pre-(signal sequence) part and a glycosylated pro-part comparable with those of the yeast mat A/alpha factor and killer factor. A comparison of the derived amino acid sequence of this alpha-galactosidase from plant origin revealed significant stretches of homology with respect to the amino acid sequences of the enzymes from Saccharomyces cerevisiae and from human origin but only to a minor extent compared with the alpha-galactosidase from Escherichia coli.

  4. Human secreted carbonic anhydrase: cDNA cloning, nucleotide sequence, and hybridization histochemistry

    SciTech Connect

    Aldred, P.; Fu, Ping; Barrett, G.; Penschow, J.D.; Wright, R.D.; Coghlan, J.P.; Fernley, R.T. )

    1991-01-01

    Complementary DNA clones coding for the human secreted carbonic anhydrase isozyme (CAVI) have been isolated and their nucleotide sequences determined. These clones identify a 1.45-kb mRNA that is present in high levels in parotid submandibular salivary glands but absent in other tissues such as the sublingual gland, kidney, liver, and prostate gland. Hybridization histochemistry of human salivary glands shows mRNA for CA VI located in the acinar cells of these glands. The cDNA clones encode a protein of 308 amino acids that includes a 17 amino acid leader sequence typical of secreted proteins. The mature protein has 291 amino acids compared to 259 or 260 for the cytoplasmic isozymes, with most of the extra amino acids present as a carboxyl terminal extension. In comparison, sheep CA VI has a 45 amino acid extension. Overall the human CA VI protein has a sequence identity of 35 {percent} with human CA II, while residues involved in the active site of the enzymes have been conserved. The human and sheep secreted carbonic anhydrases have a sequence identity of 72 {percent}. This includes the two cysteine residues that are known to be involved in an intramolecular disulfide bond in the sheep CA VI. The enzyme is known to be glycosylated and three potential N-glycosylation sites (Asn-X-Thr/Ser) have been identified. Two of these are known to be glycosylated in sheep CA VI. Southern analysis of human DNA indicates that there is only one gene coding for CA VI.

  5. Guanine nucleotide-binding proteins that enhance choleragen ADP-ribosyltransferase activity: nucleotide and deduced amino acid sequence of an ADP-ribosylation factor cDNA.

    PubMed Central

    Price, S R; Nightingale, M; Tsai, S C; Williamson, K C; Adamik, R; Chen, H C; Moss, J; Vaughan, M

    1988-01-01

    Three (two soluble and one membrane) guanine nucleotide-binding proteins (G proteins) that enhance ADP-ribosylation of the Gs alpha stimulatory subunit of the adenylyl cyclase (EC 4.6.1.1) complex by choleragen have recently been purified from bovine brain. To further define the structure and function of these ADP-ribosylation factors (ARFs), we isolated a cDNA clone (lambda ARF2B) from a bovine retinal library by screening with a mixed heptadecanucleotide probe whose sequence was based on the partial amino acid sequence of one of the soluble ARFs from bovine brain. Comparison of the deduced amino acid sequence of lambda ARF2B with sequences of peptides from the ARF protein (total of 60 amino acids) revealed only two differences. Whether these are cloning artifacts or reflect the existence of more than one ARF protein remains to be determined. Deduced amino acid sequences of ARF, Go alpha (the alpha subunit of a G protein that may be involved in regulation of ion fluxes), and c-Ha-ras gene product p21 show similarities in regions believed to be involved in guanine nucleotide binding and GTP hydrolysis. ARF apparently lacks a site analogous to that ADP-ribosylated by choleragen in G-protein alpha subunits. Although both the ARF proteins and the alpha subunits bind guanine nucleotides and serve as choleragen substrates, they must interact with the toxin A1 peptide in different ways. In addition to serving as an ADP-ribose acceptor, ARF interacts with the toxin in a manner that modifies its catalytic properties. PMID:3135549

  6. Confirming single nucleotide polymorphisms from expressed sequence tag datasets derived from three cattle cDNA libraries.

    PubMed

    Lee, Seung-Hwan; Park, Eung-Woo; Cho, Yong-Min; Lee, Ji-Woong; Kim, Hyoung-Yong; Lee, Jun-Heon; Oh, Sung-Jong; Cheong, Il-Cheong; Yoon, Du-Hak

    2006-03-31

    Using the Phred/Phrap/Polyphred/Consed pipeline established in the National Livestock Research Institute of Korea, we predicted candidate coding single nucleotide polymorphisms (cSNPs) from 7,600 expressed sequence tags (ESTs) derived from three cDNA libraries (liver, M. longissimus dorsi, and intermuscular fat) of Hanwoo (Korean native cattle) steers. From the 7,600 ESTs, 829 contigs comprising more than two EST reads were assembled using the Phrap assembler. Based on the contig analysis, 201 candidate cSNPs were identified in 129 contigs, in which transitions (69%) outnumbered transversions (31%). To verify whether the predicted cSNPs are real, 17 SNPs involved in lipid and energy metabolism were selected from the ESTs. Twelve of these were confirmed to be real while five were identified as artifacts, possibly due to expressed sequence tag sequence error. Further analysis of the 12 verified cSNPs was performed using the program BLASTX. Five were identified as nonsynonymous cSNPs, five were synonymous cSNPs, and two SNPs were located in 3'-UTRs. Our data indicated that a relatively high SNP prediction rate (71%) from a large EST database could produce abundant cSNPs rapidly, which can be used as valuable genetic markers in cattle.

  7. The nucleotide sequence of the mouse embryonic beta-like y-globin messenger RNA as determined from cloned cDNA.

    PubMed

    Vanin, E F; Farace, M G; Gambari, R; Fantoni, A

    1981-12-01

    We have determined the nucleotide sequence of two cloned cDNAs corresponding to the mRNA of mouse embryonic y2 globin. The combined overlapping sequences span a total of 480 bp, beginning at the codon corresponding to amino acido residue 21 and extending to the AATAAA sequence in the 3' untranslated region. Therefore, when the amino acid sequence encoded by the cDNA is combined with the available amino acid sequence, a complete y2 protein sequence can be obtained. Comparisons, at the nucleotide level, between the known beta- and beta-like globin sequences and the y2 sequence show that the embryonic, fetal-adult duplication occurred approx. 160 million years (MY) ago and that the embryonic-fetal duplication occurred approx. 100 MY ago.

  8. Nucleotide sequence of cDNA coding for dianthin 30, a ribosome inactivating protein from Dianthus caryophyllus.

    PubMed

    Legname, G; Bellosta, P; Gromo, G; Modena, D; Keen, J N; Roberts, L M; Lord, J M

    1991-08-27

    Rabbit antibodies raised against dianthin 30, a ribosome inactivating protein from carnation (Dianthus caryophyllus) leaves, were used to identify a full length dianthin precursor cDNA clone from a lambda gt11 expression library. N-terminal amino acid sequencing of purified dianthin 30 and dianthin 32 confirmed that the clone encoded dianthin 30. The cDNA was 1153 basepairs in length and encoded a precursor protein of 293 amino acid residues. The first 23 N-terminal amino acids of the precursor represented the signal sequence. The protein contained a carboxy-terminal region which, by analogy with barley lectin, may contain a vacuolar targeting signal.

  9. Nucleotide and derived amino acid sequences of a cDNA coding for pre-uteroglobin from the lung of the hare (Lepus capensis).

    PubMed Central

    López de Haro, M S; Nieto, A

    1986-01-01

    An almost full-length cDNA coding for pre-uteroglobin from hare lung was cloned and sequenced. The derived amino acid sequence indicated that hare pre-uteroglobin contained 91 amino acids, including a signal peptide of 21 residues. Comparison of the nucleotide sequence of hare pre-uteroglobin cDNA with that previously reported for the rabbit gene indicated five silent point substitutions and six others leading to amino acid changes in the coding region. The untranslated regions of both pre-uteroglobin mRNAs were very similar. The amino acid changes observed are discussed in relation to the different progesterone-binding abilities of both homologous proteins. PMID:3019311

  10. Avocado cellulase: nucleotide sequence of a putative full-length cDNA clone and evidence for a small gene family.

    PubMed

    Tucker, M L; Durbin, M L; Clegg, M T; Lewis, L N

    1987-05-01

    A cDNA library was prepared from ripe avocado fruit (Persea americana Mill. cv. Hass) and screened for clones hybridizing to a 600 bp cDNA clone (pAV5) coding for avocado fruit cellulase. This screening led to the isolation of a clone (pAV363) containing a 2021 nucleotide transcribed sequence and an approximately 150 nucleotide poly(A) tail. Hybridization of pAV363 to a northern blot shows that the length of the homologous message is approximately 2.2 kb. The nucleotide sequence of this putative full-length mRNA clone contains an open reading frame of 1482 nucleotides which codes for a polypeptide of 54.1 kD. The deduced amino acid composition compares favorably with the amino acid composition of native avocado cellulase determined by amino acid analysis. Southern blot analysis of Hind III and Eco RI endonuclease digested genomic DNA indicates a small family of cellulase genes.

  11. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    SciTech Connect

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J. )

    1988-10-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 {times} 10{sup 6} recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria.

  12. Nucleotide sequence and infectious transcripts from a full-length cDNA clone of the carmovirus Melon necrotic spot virus.

    PubMed

    Díaz, J A; Bernal, J J; Moriones, E; Aranda, M A

    2003-03-01

    We have studied the biological and molecular characteristics of a MNSV isolate collected in Spain (MNSV-Malpha5) and generated a full-length cDNA clone from which infectious RNA transcripts can be produced. The host range of MNSV-Malpha5 appeared to be limited to cucurbits and did not differ from that of MNSV-Dutch [4, 21]. However, differences were observed in the type of symptoms that both isolates could induce. A full-length cDNA of MNSV-Malpha5 was directly amplified by reverse-transcription polymerase chain reaction (RT-PCR) using a 5'-end primer anchoring a T7 RNA promoter sequence and a 3'-end primer, and cloned. Uncapped RNAs transcribed from this cDNA clone were infectious and caused symptoms indistinguishable from those caused by viral RNA when mechanically inoculated onto melon, cucumber or watermelon plants. The complete genome sequence of MNSV-Malpha5 was deduced from the full length cDNA clone. It is 4271 nt long and, similarly to MNSV-Dutch, consists of 5' and 3' untranslated regions (UTRs) and five open reading frames (ORFs) coding for 29, 89, 42 and two small 7 kDa proteins. One notable difference between MNSV-Malpha5 and other sequenced MNSV isolates was found, as for MNSV-Malpha5 the first of the two small ORFs, which are contiguous in the genome, terminates with a genuine stop codon, whereas for MNSV-Dutch and other sequenced MNSV isolates it terminates with an amber codon. This suggested that the putative p14 readthrough protein that could be expressed from the MNSV-Dutch and other MNSV genomes could not be expressed from the MNSV-Malpha5 genome. Also, the nucleotide and amino acid sequences comparisons showed a distant relationship of MNSV-Malpha5 with other known MNSV isolates.

  13. Uroporphyrinogen-III synthase: Molecular cloning, nucleotide sequence, expression of a mouse full-length cDNA, and its localization on mouse chromosome 7

    SciTech Connect

    Xu, W.; Desnick, R.J.; Kozak, C.A.

    1995-04-10

    Uroporphyrinogen-III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for the conversion of hydroxymethylbilane to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-S is the enzymatic defect in congenital erythropoietic porphyria (CEP), an autosomal recessive disorder. For the generation of a mouse model of CEP, the human URO-S cDNA was used to screen 2 X 10{sup 6} recombinants from a mouse adult liver cDNA library. Ten positive clones were isolated, and dideoxy sequencing of the entire 1.6-kb insert of clone pmUROS-1 revealed 5{prime} and 3{prime} untranslated sequences of 144 and 623 bp, respectively, and an open reading frame of 798 bp encoding a 265-amino-acid polypeptide with a predicted molecular mass of 28,501 Da. The mouse and human coding sequences had 80.5 and 77.8% nucleotide and amino acid identity, respectively. The authenticity of the mouse cDNA was established by expression of the active monomeric enzyme in Escherichia coli. In addition, the analysis of two multilocus genetic crosses localized the mouse gene on chromosome 7, consistent with the mapping of the human gene to a position of conserved synteny on chromosome 10. The isolation, expression, and chromosomal mapping of this full-length cDNA should facilitate studies of the structure and organization of the mouse genomic sequence and the development of a mouse model of CEP for characterization of the disease pathogenesis and evaluation of gene therapy. 38 refs., 1 tab.

  14. Nucleotide sequence of the cDNA encoding the proenzyme of phenol oxidase A1 of Drosophila melanogaster.

    PubMed Central

    Fujimoto, K; Okino, N; Kawabata, S; Iwanaga, S; Ohnishi, E

    1995-01-01

    Clones encoding pro-phenol oxidase [pro-PO; zymogen of phenol oxidase (monophenol, L-dopa:oxygen oxidoreductase, EC 1.14.18.1)] A1 were isolated from a lambda gt10 library that originated from Drosophila melanogaster strain Oregon-R male adults. The 2294 bp of the cDNA included a 13-bp 5'-noncoding region, a 2070-bp encoding open reading frame of 690 amino acids, and a 211-bp 3'-noncoding region. A hydrophobic NH2-terminal sequence for a signal peptide is absent in the protein. Furthermore, there are six potential N-glycosylation sites in the sequence, but no amino sugar was detected in the purified protein by amino acid analysis, indicating the lack of an N-linked sugar chain. The potential copper-binding sites, amino acids 200-248 and 359-414, are highly homologous to the corresponding sites of hemocyanin of the tarantula Eurypelma californicum, the horseshoe crab Limulus polyphemus, and the spiny lobster Panulirus interruptus. On the basis of the phylogenetic tree constructed by the neighbor-joining method, vertebrate tyrosinases and molluscan hemocyanins constitute one family, whereas pro-POs and arthropod hemocyanins group with another family. It seems, therefore, likely that pro-PO originates from a common ancestor with arthropod hemocyanins, independently to the vertebrate and microbial tyrosinases. PMID:7644493

  15. Molecular cloning and nucleotide sequence of a full-length cDNA for human alpha enolase.

    PubMed Central

    Giallongo, A; Feo, S; Moore, R; Croce, C M; Showe, L C

    1986-01-01

    We previously purified a 48-kDa protein (p48) that specifically reacts with an antiserum directed against the 12 carboxyl-terminal amino acids of the c-myc gene product. Using an antiserum directed against the purified p48, we have cloned a cDNA from a human expression library. This cDNA hybrid-selects an mRNA that translates to a 48-kDa protein that specifically reacts with anti-p48 serum. We have isolated a full-length cDNA that encodes p48 and spans 1755 bases. The coding region is 1299 bases long; 94 bases are 5' noncoding and 359 bases are 3' noncoding. The cDNA encodes a 433 amino acid protein that is 67% homologous to yeast enolase and 94% homologous to the rat non-neuronal enolase. The purified protein has been shown to have enolase activity and has been identified to be of the alpha type by isoenzyme analysis. The transcriptional regulation of enolase expression in response to mitogenic stimulation of peripheral blood lymphocytes and in response to heat shock is also discussed. Images PMID:3529090

  16. Cloning and partial nucleotide sequence of human immunoglobulin mu chain cDNA from B cells and mouse-human hybridomas.

    PubMed Central

    Dolby, T W; Devuono, J; Croce, C M

    1980-01-01

    Purified mRNAs coding for mu and kappa human immunoglobulin polypeptides were translated in vitro and their products were characterized. The mu-specific mRNAs, derived from both human lymphoblastoid cells (GM607) and from a mouse-human somatic cell hybrid secreting human mu chains (alpha D5-H11-BC11), were copied into cDNAs and inserted into the plasmid pBR322. Several recombinant cDNAs that were obtained were identified by a combination of colony hybridization with labeled probes, in vitro translation of plasmid-selected mu mRNAs, and DNA nucleotide sequence determination. One recombinant DNA, for which the sequence has been partially determined, contains the codons for part of the C3 constant region domain through the carboxy-terminal piece (155 amino acids total) as well as the entire 3' noncoding sequence up to the poly(A) site of the human mu mRNA. The sequence A-A-U-A-A occurs 12 nucleotides prior to the poly(A) addition site in the human mu mRNA. Considerable sequence homology is observed in the mouse and human mu mRNA 3' coding and noncoding sequences. Images PMID:6777778

  17. Use of nucleotide sequencing of the genomic cDNA fragments of the capsid/premembrane junction region for molecular epidemiology of dengue type 2 viruses.

    PubMed

    Singh, U B; Seth, P

    2001-06-01

    The recent emergence of dengue hemorrhagic fever/dengue shock syndrome (DHF/ DSS) in India has been a source of concern. In the present study a quantitative comparison of 406 nucleotide long sequence from the capsid-premembrane junction region (C-PrM) of 9 dengue virus type 2 (DEN-2) isolates from Delhi with 10 DEN-2 isolates from diverse geographic areas provided sufficient information for estimating genetic relationships. The data indicated that the 1996 epidemic of DHF in Delhi was caused by genotype IV strains of DEN-2. This genotype, perhaps, displaced genotype V strains of DEN-2, which was circulating genotype in 1967. The period during which this displacement had occurred is not clear from the present study. Nonetheless, similar experience in four countries in Latin America and in Sri Lanka suggest that the introduction of new genotypes of DEN-2 displacing the circulating genotype may be associated with the appearance of DHF/DSS. More work is required to elucidate this hypothesis. Transitions at nucleotide positions 406 and 431 resulted in amino acid substitutions near (aa position 104, methionine --> valine) and at the hinge region (aa position 112, valine --> alanine) of C-PrM, respectively in all/most genotypes of group III and IV DEN-2 viruses analysed. Most of these virus strains have been isolated from DHF/DSS outbreaks. Significance of this observation is discussed. The data presented in this study suggest the utility of C-PrM sequence analysis for molecular epidemiology of dengue viruses.

  18. Isolation and nucleotide sequence of mouse NCAM cDNA that codes for a Mr 79,000 polypeptide without a membrane-spanning region.

    PubMed Central

    Barthels, D; Santoni, M J; Wille, W; Ruppert, C; Chaix, J C; Hirsch, M R; Fontecilla-Camps, J C; Goridis, C

    1987-01-01

    The neural cell adhesion molecule (NCAM) exists in several isoforms which are selectively expressed by different cell types and at different stages of development. In the mouse, three proteins with apparent Mr's of 180,000, 140,000 and 120,000 have been distinguished that are encoded by 4-5 different mRNAs. Here we report the full amino acid sequence of a NCAM protein inferred from the sequences of overlapping cDNA clones. The 706-residue polypeptide contains, towards its N-terminus, 5 domains that share structural homology with members of the immunoglobulin supergene family. The sequence does not encode a typical membrane-spanning segment, but ends with 24 uncharged amino acids followed by two stop codons. This fact, together with size considerations, make it highly likely that our sequence represents NCAM-120, which lacks transmembrane or cytoplasmic domains and is attached to the membrane by phospholipid. Probes from the 5' region detect all four NCAM gene transcripts present in mouse brain consistent with the notion that the extracellular domains are common to most NCAM forms. However, a 3' probe corresponding to the hydrophobic tail and non-coding region hybridizes specifically with the smallest mRNA species. S1 nuclease protection experiments indicate that this region is encoded by exon(s) spliced out from the other mRNAs. Furthermore, our clones that are highly homologous to a published chicken NCAM sequence which codes for putative transmembrane and cytoplasmic domains elsewhere, diverge from it at the presumptive splice junction. It appears thus that alternate use of exons determines whether NCAM proteins with membrane-spanning domains are synthesized.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig. 3. Fig. 4. Fig. 5. PMID:3595563

  19. Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

    PubMed

    Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

    1982-09-01

    We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. PMID:6127673

  20. Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

    PubMed Central

    Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

    1982-01-01

    We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

  1. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  2. The EMBL nucleotide sequence database.

    PubMed Central

    Stoesser, G; Moseley, M A; Sleep, J; McGowran, M; Garcia-Pastor, M; Sterk, P

    1998-01-01

    The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl. html ) constitutes Europe's primary nucleotide sequence resource. DNA and RNA sequences are directly submitted from researchers and genome sequencing groups and collected from the scientific literature and patent applications (Fig. 1). In collaboration with DDBJ and GenBank the database is produced, maintained and distributed at the European Bioinformatics Institute. Database releases are produced quarterly and are distributed on CD-ROM. EBI's network services allow access to the most up-to-date data collection via Internet and World Wide Web interface, providing database searching and sequence similarity facilities plus access to a large number of additional databases. PMID:9399791

  3. Automated Identification of Nucleotide Sequences

    NASA Technical Reports Server (NTRS)

    Osman, Shariff; Venkateswaran, Kasthuri; Fox, George; Zhu, Dian-Hui

    2007-01-01

    STITCH is a computer program that processes raw nucleotide-sequence data to automatically remove unwanted vector information, perform reverse-complement comparison, stitch shorter sequences together to make longer ones to which the shorter ones presumably belong, and search against the user s choice of private and Internet-accessible public 16S rRNA databases. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] In STITCH, a template 16S rRNA sequence is used to position forward and reverse reads. STITCH then automatically searches known 16S rRNA sequences in the user s chosen database(s) to find the sequence most similar to (the sequence that lies at the smallest edit distance from) each spliced sequence. The result of processing by STITCH is the identification of the most similar well-described bacterium. Whereas previously commercially available software for analyzing genetic sequences operates on one sequence at a time, STITCH can manipulate multiple sequences simultaneously to perform the aforementioned operations. A typical analysis of several dozen sequences (length of the order of 103 base pairs) by use of STITCH is completed in a few minutes, whereas such an analysis performed by use of prior software takes hours or days.

  4. The nucleotide sequence of cowpea mosaic virus B RNA

    PubMed Central

    Lomonossoff, G.P.; Shanks, M.

    1983-01-01

    The complete sequence of the bottom component RNA (B RNA) of cowpea mosaic virus (CPMV) has been determined. Restriction enzyme fragments of double-stranded cDNA were cloned in M13 and the sequence of the inserts was determined by a combination of enzymatic and chemical sequencing techniques. Additional sequence information was obtained by primed synthesis on first strand cDNA. The complete sequence deduced is 5889 nucleotides long excluding the 3' poly(A), and contains an open reading frame sufficient to code for a polypeptide of mol. wt. 207 760. The coding region is flanked by a 5' leader sequence of 206 nucleotides and a 3' non-coding region of 82 residues which does not contain a polyadenylation signal. PMID:16453487

  5. Cloning and sequence analysis of a cDNA encoding rat preprocholecystokinin.

    PubMed Central

    Deschenes, R J; Lorenz, L J; Haun, R S; Roos, B A; Collier, K J; Dixon, J E

    1984-01-01

    Poly(A) RNA was isolated from a rat medullary thyroid carcinoma that exhibited high levels of immunoreactive cholecystokinin (CCK). Double-stranded cDNA was synthesized from the poly(A) RNA and inserted into the Pst I site of pBR322. Bacterial colonies containing CCK cDNA were identified using the hybridization probe d(T-C-C-A-T-C-C-A-N-C-C-C-A-T-G-T-A-G-T-C). The sequence of the probe was deduced from the known amino acid sequence of porcine CCK-8, Asp-Tyr-Met-Gly-Trp-Met-Asp-Phe-NH2. The nucleotide sequence of the cDNA complementary to the mRNA of rat preprocholecystokinin was determined. The cDNA contains 33 nucleotides in the 5'-noncoding region, 199 nucleotides in the 3'-noncoding region, and 345 nucleotides coding for a precursor to CCK, which is 115 amino acids (Mr, 12,826). Examination of the rat CCK gene revealed a suggested transcriptional control sequence analogous to the "TATA" sequence located 33 nucleotides upstream from a proposed transcriptional start site. The amino acid sequence of CCK-39 is flanked by both amino-terminal and carboxyl-terminal extensions. Analysis of CCK mRNA showed that it is approximately equal to 750 nucleotides long. CCK mRNA of the rat brain and intestine appeared to be identical in size to the CCK mRNA of the carcinoma. Images PMID:6199787

  6. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  7. CDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  8. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  9. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  10. cDNA encoding a polypeptide including a hevein sequence

    SciTech Connect

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  11. Nucleotide sequence stability of the genome of hepatitis delta virus.

    PubMed Central

    Netter, H J; Wu, T T; Bockol, M; Cywinski, A; Ryu, W S; Tennant, B C; Taylor, J M

    1995-01-01

    Cultured cells were cotransfected with a fully sequenced 1,679-base cDNA clone of human hepatitis delta virus (HDV) RNA genome and a cDNA for the genome of woodchuck hepatitis virus (WHV). The HDV particles released were able to infect a woodchuck that was chronically infected with WHV. The HDV so produced was passaged a total of six times in woodchucks in order to determine the stability of the HDV nucleotide sequence. During a final chronic infection with such virus, liver RNA was extracted, and the HDV nucleotide sequence for the 352-base region, positions 905 to 1256, was obtained. By means of PCR, we obtained double-stranded cDNA both for direct sequencing and also for molecular cloning followed by sequencing. By direct sequencing, we found that a consensus sequence existed and was identical to the original sequence. From the sequences of 31 clones, we found 32% (10 of 31) to be identical to the original single nucleotide sequence. For the remainder, there were neither insertions nor deletions but there was a small number of single-nucleotide changes. These changes were predominantly transitions rather than transversions. Furthermore, the transitions were largely of just two types, uridine to cytidine and adenosine to guanosine. Of the 40 changes detected on HDV, 35% (14 of 40) occurred within an eight-nucleotide region that included position 1012, previously shown to be a site of RNA editing. These findings may have significant implications regarding both the stability of the HDV RNA genome and the mechanism of RNA editing. PMID:7853505

  12. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  13. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  14. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  15. Long-range correlations in nucleotide sequences

    NASA Astrophysics Data System (ADS)

    Peng, C.-K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.

    1992-03-01

    DNA SEQUENCES have been analysed using models, such as an it-step Markov chain, that incorporate the possibility of short-range nucleotide correlations1. We propose here a method for studying the stochastic properties of nucleotide sequences by constructing a 1:1 map of the nucleotide sequence onto a walk, which we term a 'DNA walk'. We then use the mapping to provide a quantitative measure of the correlation between nucleotides over long distances along the DNA chain. Thus we uncover in the nucleotide sequence a remarkably long-range power law correlation that implies a new scale-invariant property of DNA. We find such long-range correlations in intron-containing genes and in nontranscribed regulatory DNA sequences, but not in complementary DNA sequences or intron-less genes.

  16. Long-range correlations in nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.

    1992-01-01

    DNA sequences have been analysed using models, such as an n-step Markov chain, that incorporate the possibility of short-range nucleotide correlations. We propose here a method for studying the stochastic properties of nucleotide sequences by constructing a 1:1 map of the nucleotide sequence onto a walk, which we term a 'DNA walk'. We then use the mapping to provide a quantitative measure of the correlation between nucleotides over long distances along the DNA chain. Thus we uncover in the nucleotide sequence a remarkably long-range power law correlation that implies a new scale-invariant property of DNA. We find such long-range correlations in intron-containing genes and in nontranscribed regulatory DNA sequences, but not in complementary DNA sequences or intron-less genes.

  17. Nucleotide sequence and expression of a Drosophila metallothionein.

    PubMed

    Lastowski-Perry, D; Otto, E; Maroni, G

    1985-02-10

    A Drosophila melanogaster cDNA clone was isolated based on its more intense hybridization to RNA sequences from copper-fed larvae than from control larval RNA. This clone showed strong hybridization to mouse metallothionein I cDNA at reduced stringency. Its nucleotide sequence includes an open reading segment which codes for a 40-amino acid protein; this protein is identified as metallothionein based on its similarity to the amino-terminal portion of mammalian and crab metalloproteins. The 10 cysteine residues present occur in five pairs of near vicinal cysteines (Cys-X-Cys). This cDNA sequence hybridized to a 400-nucleotide polyadenylated RNA whose presence in the cells of the alimentary canal of larvae was stimulated by ingestion of cadmium or copper; in other tissues this RNA was present at much lower levels. Mercury, silver, and zinc induced metallothionein to a lesser extent. The level of metallothionein RNA increased very soon after the initiation of metal treatment and reached a maximum after approximately 36 h. PMID:2578462

  18. Nucleotide Sequence-Based Multitarget Identification

    PubMed Central

    Vinayagamoorthy, T.; Mulatz, Kirk; Hodkinson, Roger

    2003-01-01

    MULTIGEN technology (T. Vinayagamoorthy, U.S. patent 6,197,510, March 2001) is a modification of conventional sequencing technology that generates a single electropherogram consisting of short nucleotide sequences from a mixture of known DNA targets. The target sequences may be present on the same or different nucleic acid molecules. For example, when two DNA targets are sequenced, the first and second sequencing primers are annealed to their respective target sequences, and then a polymerase causes chain extension by the addition of new deoxyribose nucleotides. Since the electrophoretic separation depends on the relative molecular weights of the truncated molecules, the molecular weight of the second sequencing primer was specifically designed to be higher than the combined molecular weight of the first sequencing primer plus the molecular weight of the largest truncated molecule generated from the first target sequence. Thus, the series of truncated molecules produced by the second sequencing primer will have higher molecular weights than those produced by the first sequencing primer. Hence, the truncated molecules produced by these two sequencing primers can be effectively separated in a single lane by standard gel electrophoresis in a single electropherogram without any overlapping of the nucleotide sequences. By using sequencing primers with progressively higher molecular weights, multiple short DNA sequences from a variety of targets can be determined simultaneously. We describe here the basic concept of MULTIGEN technology and three applications: detection of sexually transmitted pathogens (Neisseria gonorrhoeae, Chlamydia trachomatis, and Ureaplasma urealyticum), detection of contaminants in meat samples (coliforms, fecal coliforms, and Escherichia coli O157:H7), and detection of single-nucleotide polymorphisms in the human N-acetyltransferase (NAT1) gene (S. Fronhoffs et al., Carcinogenesis 22:1405-1412, 2001). PMID:12843076

  19. Cloning and sequencing of Indian water buffalo (Bubalus bubalis) interleukin-3 cDNA.

    PubMed

    Thennarasu, S; Harishankar, M; Raj, G Dhinakar

    2012-06-01

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  20. Nucleotide sequence of 3' untranslated portion of human alpha globin mRNA.

    PubMed Central

    Wilson, J T; deRiel, J K; Forget, B G; Marotta, C A; Weissman, S M

    1977-01-01

    We have determined the nucleotide sequence of 75 nucleotides of the 3'-untranslated portion of normal human alpha globin mRNA which corresponds to the elongated amino acid sequence of the chain termination mutant Hb Constant Spring. This was accomplished by sequence analysis of cDNA fragments obtained by restriction endonuclease or T4 endonuclease IV cleavage of human globin cDNA synthesized from globin mRNA by use of viral reverse transcriptase. Analysis of cRNA synthesized from cDNA by use of RNA polymerase provided additional confirmatory sequence information. Possible polymorphism has been identified at one site of the sequence. Our sequence overlaps with, and extends the sequence of 43 nucleotides determined by Proudfood and coworkers for the very 3'-terminal portion of human alpha globin mRNA. The complete 3'-untranslated sequence of human alpha globin mRNA (112 nucleotides including termination codon) shows little homology to that of the human or rabbit beta globin mRNAs except for the presence of the hexanucleotide sequence AAUAAA which is found in most eukaryotic mRNAs near the 3'-terminal poly (A). Images PMID:909779

  1. Cloning and sequence analysis of cDNA for human argininosuccinate lyase.

    PubMed Central

    O'Brien, W E; McInnes, R; Kalumuck, K; Adcock, M

    1986-01-01

    Using antibodies specific for argininosuccinate lyase (EC 4.3.2.1), we isolated two cDNA clones by screening a human liver cDNA library constructed in the lambda gt11 expression vector. The identity of these isolates was confirmed by in vitro translation of plasmid-selected mRNA. One of these isolates was used to rescreen the cDNA library and a 1565-base-pair (bp) clone was identified. The entire nucleotide sequence of this clone was determined. An open reading frame was identified which encoded a protein of 463 amino acids with a predicted molecular weight of 51,663. The clone included 115 bp of 5' untranslated sequence and 46 bp of 3' untranslated sequence. A canonical poly(A) addition site was present in the 3' end, 16 bp from the beginning of the poly(A) tract. Comparison of the deduced amino acid sequence of the human enzyme with that of the yeast enzyme revealed a 56% homology, when conservative amino acid changes were taken into consideration. The yeast protein is also 463 amino acids long, with a molecular weight of 51,944. By use of a genomic DNA panel from human-Chinese hamster somatic cell hybrids, the human gene was mapped to chromosome 7. Another hybridizing region, corresponding to a portion of the 5' end of the cDNA, was found on chromosome 22. Images PMID:3463959

  2. Complete Nucleotide Sequence of Tn10

    PubMed Central

    Chalmers, Ronald; Sewitz, Sven; Lipkow, Karen; Crellin, Paul

    2000-01-01

    The complete nucleotide sequence of Tn10 has been determined. The dinucleotide signature and percent G+C of the sequence had no discontinuities, indicating that Tn10 constitutes a homogeneous unit. The new sequence contained three new open reading frames corresponding to a glutamate permease, repressors of heavy metal resistance operons, and a hypothetical protein in Bacillus subtilis. The glutamate permease was fully functional when expressed, but Tn10 did not protect Escherichia coli from the toxic effects of various metals. PMID:10781570

  3. [Evolution of non-coding nucleotide sequences in Newcastle disease virus genomes ].

    PubMed

    Xu, Huaiying; Qin, Zhuoming; Qi, Lihong; Zhang, Wei; Wang, Youling; Liu, Jinhua

    2014-09-01

    [OBJECTIVE] Although much is done in the coding genes of Newcastle disease virus (NDV) , limited papers can be found with non-coding sequences. In this paper, the evolution tendency of non-coding sequences was studied. [METHODS] NDV strain LC12 isolated from duck with egg drop syndrome in 2012, and others 35 strains genome cDNA of different NDV genotype were sought and obtained from GenBank. Analytical approaches including nucleotide homology, nucleotide alignment and phylogenetic tree were associated with the leading sequences, trailer sequences, intergenic sequences (IGS), and coding gene between 5 'and 3' UTR nucleotide, respectively. [RESULTS] The location and the length of the non-coding sequences highly conserve, and the variation trend of non-coding sequences is synchronous with the entire genomes and coding genes. [ CONCLUSION] The molecular variation of the coding gene was indistinguishable with the non-coding gene in view of the NDV genome. PMID:25522596

  4. Cloning and Sequencing of the cDNA Encoding the Rubber Elongation Factor of Hevea brasiliensis

    PubMed Central

    Goyvaerts, Elisabeth; Dennis, Mark; Light, David; Chua, Nam-Hai

    1991-01-01

    In Hevea brasiliensis, the rubber particle in the laticiferous vessel is the site of rubber (cis-1-4-polyisoprene) biosynthesis. A 14 kilodalton protein, rubber elongation factor (REF), is associated with the rubber particle in a ratio of one REF to one rubber molecule (Dennis M, Henzel W, Bell J, Kohr W, Light D [1989] J Biol Chem 264: 18618-18628; Dennis M, Light D [1989] J Biol Chem 264: 18608-18617). To obtain more information concerning the function of REF and its synthesis and assembly in the rubber particle, we isolated cDNA clones encoding REF. We used antibodies to REF to screen a Hevea leaf γgt11 cDNA expression library and obtained several positive clones. Sequence analysis of the REF cDNA clones showed that the REF mRNA contains 121 nucleotides of 5′-nontranslated sequences and a 205 nucleotide 3′-nontranslated region. The open reading frame encodes the entire 14 kilodalton REF protein without any extra amino acids (Dennis M, Henzel W, Bell J, Kohr W, Light D [1989] J Biol Chem 264: 18618-18628). The REF cDNA was subcloned in pGEM-3Z/-4Z and expressed in vitro. The translation product is a 14 kilodalton protein that can be immunoprecipitated with antibodies to REF. Addition of microsomal membranes to the in vitro translation product did not alter the mobility of the REF protein. This, and the sequence data, indicate that REF is not made as a preprotein. Our results suggest that REF is synthesized on free polysomes in the laticifer cytoplasm and that assembly of the rubber particles is likely to occur in the cytosol. ImagesFigure 2Figure 3 PMID:16668388

  5. cDNA sequences of two apolipoproteins from lamprey

    SciTech Connect

    Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.

    1987-03-24

    The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point.

  6. cDNA encoding a polypeptide including a hev ein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  7. Cloning, characterization, and DNA sequence of a human cDNA encoding neuropeptide tyrosine.

    PubMed Central

    Minth, C D; Bloom, S R; Polak, J M; Dixon, J E

    1984-01-01

    In vitro translation of the RNA isolated from a human pheochromocytoma demonstrated that this tumor contained a mRNA encoding a 10.5-kDa protein, which was immunoprecipitated with antiserum raised against porcine neuropeptide Y. Double-stranded cDNA was synthesized from total RNA and inserted into the Pst I site of pUC8. Transformants containing the neuropeptide Y cDNA were identified using the mixed hybridization probe d[A-(A,G)-(A,G)-T-T-(A,G,T)-A-T-(A,G)-T-A-(A,G)-T-G]. The probe sequences were based on the known amino acid sequence, His-Tyr-Ile-Asn-Leu, found in porcine neuropeptide Y. The nucleotide sequence of the cDNA was determined and contained 86 and 174 bases in the 5'- and 3'-untranslated regions, respectively. The coding sequence consisted of 291 bases, suggesting a precursor to neuropeptide Y that was 97 amino acids long (10,839 Da). The deduced amino acid sequence of the precursor suggested that there were at least two sites of proteolytic processing, which would generate three peptides having 28 (signal peptide), 36 (human neuropeptide Y), and 30 (COOH-terminal peptide) amino acid residues. A partial NH2-terminal sequence obtained by Edman degradation of the immunoprecipitated in vitro translation product identified the positions of methionine and leucine in the first 30 residues of the prepropeptide. A highly sensitive single-stranded complementary mRNA hybridization probe specific for neuropeptide Y mRNA was prepared using the bacteriophage SP6 promoter. This probe was used to identify a mRNA corresponding to neuropeptide Y of approximately 800 bases. Images PMID:6589611

  8. Amino acid and cDNA sequences of lysozyme from Hyalophora cecropia

    PubMed Central

    Engström, Å.; Xanthopoulos, K. G.; Boman, H. G.; Bennich, H.

    1985-01-01

    The amino acid and cDNA sequences of lysozyme from the giant silk moth Hyalophora cecropia have been determined. This enzyme is one of several immune proteins produced by the diapausing pupae after injection of bacteria. Cecropia lysozyme is composed of 120 amino acids, has a mol. wt. of 13.8 kd and shows great similarity with vertebrate lysozymes of the chicken type. The amino acid residues responsible for the catalytic activity and for the binding of substrate are essentially conserved. Three allelic variants of the Cecropia enzyme are identified. A comparison of the chicken and the Cecropia lysozymes shows that there is a 40% identity at both the amino acid and the nucleotide level. Some evolutionary aspects of the sequence data are discussed. PMID:16453632

  9. Secretory pancreatic stone protein messenger RNA. Nucleotide sequence and expression in chronic calcifying pancreatitis.

    PubMed Central

    Giorgi, D; Bernard, J P; Rouquier, S; Iovanna, J; Sarles, H; Dagorn, J C

    1989-01-01

    The pancreatic stone protein and its secretory form (PSP-S) are inhibitors of CaCO3 crystal growth, possibly involved in the stabilization of pancreatic juice. We have established the structure of PSP-S mRNA and monitored its expression in chronic calcifying pancreatitis (CCP). A cDNA encoding pre-PSP-S has been cloned from a human pancreatic cDNA library. Its nucleotide sequence revealed that it comprised all but the 5' end of PSP-S mRNA, which was obtained by sequencing the first exon of the PSP-S gene. The complete mRNA sequence is 775 nucleotides long, including 5'- and 3'- noncoding regions of 80 and 197 nucleotides, respectively, attached to a poly(A) tail of approximately 125 nucleotides. It encodes a preprotein of 166 amino acids, including a prepeptide of 22 amino acids. No overall sequence homology was found between PSP-S and other pancreatic proteins. Some homology with several serine proteases was observed in the COOH-terminal region, however. The mRNA levels of PSP-S, trypsinogen, chymotrypsinogen, and colipase in CCP and control pancreas were compared. PSP-S mRNA was three times lower in CCP than in control, whereas the others were not altered. It was concluded that PSP-S gene expression is specifically reduced in CCP patients. Images PMID:2525567

  10. Insights into corn genes derived from large-scale cDNA sequencing.

    PubMed

    Alexandrov, Nickolai N; Brover, Vyacheslav V; Freidin, Stanislav; Troukhan, Maxim E; Tatarinova, Tatiana V; Zhang, Hongyu; Swaller, Timothy J; Lu, Yu-Ping; Bouck, John; Flavell, Richard B; Feldmann, Kenneth A

    2009-01-01

    We present a large portion of the transcriptome of Zea mays, including ESTs representing 484,032 cDNA clones from 53 libraries and 36,565 fully sequenced cDNA clones, out of which 31,552 clones are non-redundant. These and other previously sequenced transcripts have been aligned with available genome sequences and have provided new insights into the characteristics of gene structures and promoters within this major crop species. We found that although the average number of introns per gene is about the same in corn and Arabidopsis, corn genes have more alternatively spliced isoforms. Examination of the nucleotide composition of coding regions reveals that corn genes, as well as genes of other Poaceae (Grass family), can be divided into two classes according to the GC content at the third position in the amino acid encoding codons. Many of the transcripts that have lower GC content at the third position have dicot homologs but the high GC content transcripts tend to be more specific to the grasses. The high GC content class is also enriched with intronless genes. Together this suggests that an identifiable class of genes in plants is associated with the Poaceae divergence. Furthermore, because many of these genes appear to be derived from ancestral genes that do not contain introns, this evolutionary divergence may be the result of horizontal gene transfer from species not only with different codon usage but possibly that did not have introns, perhaps outside of the plant kingdom. By comparing the cDNAs described herein with the non-redundant set of corn mRNAs in GenBank, we estimate that there are about 50,000 different protein coding genes in Zea. All of the sequence data from this study have been submitted to DDBJ/GenBank/EMBL under accession numbers EU940701-EU977132 (FLI cDNA) and FK944382-FL482108 (EST). PMID:18937034

  11. Complete nucleotide sequences of two adjacent early vaccinia virus genes located within the inverted terminal repetition.

    PubMed

    Venkatesan, S; Gershowitz, A; Moss, B

    1982-11-01

    The proximal part of the 10,000-base pair (bp) inverted terminal repetition of vaccinia virus DNA encodes at least three early mRNAs. A 2,236-bp segment of the repetition was sequenced to characterize two of the genes. This task was facilitated by constructing a series of recombinants containing overlapping deletions; oligonucleotide linkers with synthetic restriction sites provided points for radioactive labeling before sequencing by the chemical degradation method of Maxam and Gilbert (Methods Enzymol. 65:499-560, 1980). The ends of the transcripts were mapped by hybridizing labeled DNA fragments to early viral RNA and resolving nuclease S1-protected fragments in sequencing gels, by sequencing cDNA clones, and from the lengths of the RNAs. The nucleotide sequences for at least 60 bp upstream of both transcriptional initiation sites are more than 80% adenine . thymine rich and contain long runs of adenines and thymines with some homology to procaryotic and eucaryotic consensus sequences. The gene transcribed in the rightward direction encodes an RNA of approximately 530 nucleotides with a single open reading frame of 420 nucleotides. Preceding the first AUG, there is a heptanucleotide that can hybridize to the 3' end of 18S rRNA with only one mismatch. The derived amino acid sequence of the protein indicated a molecular weight of 15,500. The gene transcribed in the leftward direction encodes an RNA 1,000 to 1,100 nucleotides long with an open reading frame of 996 nucleotides and a leader sequence of only 5 to 6 nucleotides. The derived amino acid sequence of this protein indicated a molecular weight of 38,500. The 3' ends of the two transcripts were located within 100 bp of each other. Although there are adenine . thymine-rich clusters near the putative transcriptional termination sites, specific AATAAA polyadenylic acid signal sequences are absent.

  12. cDNA sequence, mRNA expression and genomic DNA of trypsinogen from the indianmeal moth, Plodia interpunctella.

    PubMed

    Zhu, Y C; Oppert, B; Kramer, K J; McGaughey, W H; Dowdy, A K

    2000-02-01

    Trypsin-like enzymes are major insect gut enzymes that digest dietary proteins and proteolytically activate insecticidal proteins produced by the bacterium Bacillus thuringiensis (Bt). Resistance to Bt in a strain of the Indianmeal moth, Plodia interpunctella, was linked to the absence of a major trypsin-like proteinase (Oppert et al., 1997). In this study, trypsin-like proteinases, cDNA sequences, mRNA expression levels and genomic DNAs from Bt-susceptible and -resistant strains of the Indianmeal moth were compared. Proteinase activity blots of gut extracts indicated that the susceptible strain had two major trypsin-like proteinases, whereas the resistant strain had only one. Several trypsinogen-like cDNA clones were isolated and sequenced from cDNA libraries of both strains using a probe deduced from a conserved sequence for a serine proteinase active site. cDNAs of 852 nucleotides from the susceptible strain and 848 nucleotides from the resistant strain contained an open reading frame of 783 nucleotides which encoded a 261-amino acid trypsinogen-like protein. There was a single silent nucleotide difference between the two cDNAs in the open reading frame and the predicted amino acid sequence from the cDNA clones was most similar to sequences of trypsin-like proteinases from the spruce budworm, Choristoneura fumiferana, and the tobacco hornworm, Manduca sexta. The encoded protein included amino acid sequence motifs of serine proteinase active sites, conserved cysteine residues, and both zymogen activation and signal peptides. Northern blotting analysis showed no major difference between the two strains in mRNA expression in fourth-instar larvae, indicating that transcription was similar in the strains. Southern blotting analysis revealed that the restriction sites for the trypsinogen genes from the susceptible and resistant strains were different. Based on an enzyme size comparison, the cDNA isolated in this study corresponded to the gene for the smaller of two

  13. Cataloging of the genes expressed in human keratinocytes: analysis of 607 randomly isolated cDNA sequences.

    PubMed

    Konishi, K; Morishima, Y; Ueda, E; Kibe, Y; Nonomura, K; Yamanishi, K; Yasuno, H

    1994-07-29

    The partial nucleotide sequences of 607 cDNAs randomly isolated from a cDNA library of cultured human epidermal keratinocytes were determined by single pass sequencing. Homology search of the sequences to the non-redundant nucleotide databases revealed that 27% of the cDNAs matched registered human-or non-human genes encoding not only keratinocyte specific genes, but also a variety of functional proteins, the expression of which had not been identified in keratinocytes. Non-matching cDNAs covering 49% of the cDNAs were not homologous even to ESTs from other organs, suggesting that these cDNAs include novel genes expressed in the cells. The large scale sequencing of keratinocyte cDNAs provides a useful molecular source for research into biology and diseases of the skin. PMID:8048971

  14. Molecular cloning and sequencing of zeta-crystallin/quinone reductase cDNA from human liver.

    PubMed

    Gonzalez, P; Rao, P V; Zigler, J S

    1993-03-31

    Zeta-crystallin is an enzyme-crystallin highly expressed in the lens of some hystricomorph rodents and camels. It has been shown to have a novel NADPH: quinone oxidoreductase activity and is present at enzymatic levels in a variety of tissues from various mammals. We report here the cDNA cloning of zeta-crystallin from a human liver library. One clone with the complete open reading frame was obtained. Ten nucleotides of the 5' and 796 of the 3' nontranslated regions are present in the clone including two possible polyadenylation signals. The deduced amino acid sequence is 328 residues long with a calculated molecular mass of 34910 daltons and isoelectric point of 8.73. It shows 84% identity with the guinea pig protein.

  15. Cloning of a human cDNA encoding a putative nucleotide-binding protein related to Escherichia coli MinD.

    PubMed

    Shahrestanifar, M; Saha, D P; Scala, L A; Basu, A; Howells, R D

    1994-09-30

    A novel human cDNA encoding a putative nucleotide-binding protein (NBP) was obtained by screening a human SHSY5Y neuroblastoma library. The deduced protein contains 320 amino acids (aa) with a M(r) of 34,540. NBP displays sequence similarity with the product of the minD gene from Escherichia coli. MinD is involved in the proper placement of the division septum, and has ATPase activity. NBP and MinD contain consensus nucleotide (nt)-binding domains. The NBP mRNA is approx. 1500 nt in length and is expressed in several human cell lines and in all rat tissues examined, with the highest levels in lung and testis.

  16. The complete nucleotide sequence and genome organization of pea streak virus (genus Carlavirus).

    PubMed

    Su, Li; Li, Zhengnan; Bernardy, Mike; Wiersma, Paul A; Cheng, Zhihui; Xiang, Yu

    2015-10-01

    Pea streak virus (PeSV) is a member of the genus Carlavirus in the family Betaflexiviridae. Here, the first complete genome sequence of PeSV was determined by deep sequencing of a cDNA library constructed from dsRNA extracted from a PeSV-infected sample and Rapid Amplification of cDNA Ends (RACE) PCR. The PeSV genome consists of 8041 nucleotides excluding the poly(A) tail and contains six open reading frames (ORFs). The putative peptide encoded by the PeSV ORF6 has an estimated molecular mass of 6.6 kDa and shows no similarity to any known proteins. This differs from typical carlaviruses, whose ORF6 encodes a 12- to 18-kDa cysteine-rich nucleic-acid-binding protein.

  17. cDNA, genomic sequence cloning and overexpression of giant panda (Ailuropoda melanoleuca) mitochondrial ATP synthase ATP5G1.

    PubMed

    Hou, W-R; Hou, Y-L; Ding, X; Wang, T

    2012-09-03

    The ATP5G1 gene is one of the three genes that encode mitochondrial ATP synthase subunit c of the proton channel. We cloned the cDNA and determined the genomic sequence of the ATP5G1 gene from the giant panda (Ailuropoda melanoleuca) using RT-PCR technology and touchdown-PCR, respectively. The cloned cDNA fragment contains an open reading frame of 411 bp encoding 136 amino acids; the length of the genomic sequence is of 1838 bp, containing three exons and two introns. Alignment analysis revealed that the nucleotide sequence and the deduced protein sequence are highly conserved compared to Homo sapiens, Mus musculus, Rattus norvegicus, Bos taurus, and Sus scrofa. The homologies for nucleotide sequences of the giant panda ATP5G1 to those of these species are 93.92, 92.21, 92.46, 93.67, and 92.46%, respectively, and the homologies for amino acid sequences are 90.44, 95.59, 93.38, 94.12, and 91.91%, respectively. Topology prediction showed that there is one protein kinase C phosphorylation site, one casein kinase II phosphorylation site, five N-myristoylation sites, and one ATP synthase c subunit signature in the ATP5G1 protein of the giant panda. The cDNA of ATP5G1 was transfected into Escherichia coli, and the ATP5G1 fused with the N-terminally GST-tagged protein gave rise to accumulation of an expected 40-kDa polypeptide, which had the characteristics of the predicted protein.

  18. cDNA, genomic sequence cloning and overexpression of giant panda (Ailuropoda melanoleuca) mitochondrial ATP synthase ATP5G1.

    PubMed

    Hou, W-R; Hou, Y-L; Ding, X; Wang, T

    2012-01-01

    The ATP5G1 gene is one of the three genes that encode mitochondrial ATP synthase subunit c of the proton channel. We cloned the cDNA and determined the genomic sequence of the ATP5G1 gene from the giant panda (Ailuropoda melanoleuca) using RT-PCR technology and touchdown-PCR, respectively. The cloned cDNA fragment contains an open reading frame of 411 bp encoding 136 amino acids; the length of the genomic sequence is of 1838 bp, containing three exons and two introns. Alignment analysis revealed that the nucleotide sequence and the deduced protein sequence are highly conserved compared to Homo sapiens, Mus musculus, Rattus norvegicus, Bos taurus, and Sus scrofa. The homologies for nucleotide sequences of the giant panda ATP5G1 to those of these species are 93.92, 92.21, 92.46, 93.67, and 92.46%, respectively, and the homologies for amino acid sequences are 90.44, 95.59, 93.38, 94.12, and 91.91%, respectively. Topology prediction showed that there is one protein kinase C phosphorylation site, one casein kinase II phosphorylation site, five N-myristoylation sites, and one ATP synthase c subunit signature in the ATP5G1 protein of the giant panda. The cDNA of ATP5G1 was transfected into Escherichia coli, and the ATP5G1 fused with the N-terminally GST-tagged protein gave rise to accumulation of an expected 40-kDa polypeptide, which had the characteristics of the predicted protein. PMID:23007995

  19. Reading biological processes from nucleotide sequences

    NASA Astrophysics Data System (ADS)

    Murugan, Anand

    Cellular processes have traditionally been investigated by techniques of imaging and biochemical analysis of the molecules involved. The recent rapid progress in our ability to manipulate and read nucleic acid sequences gives us direct access to the genetic information that directs and constrains biological processes. While sequence data is being used widely to investigate genotype-phenotype relationships and population structure, here we use sequencing to understand biophysical mechanisms. We present work on two different systems. First, in chapter 2, we characterize the stochastic genetic editing mechanism that produces diverse T-cell receptors in the human immune system. We do this by inferring statistical distributions of the underlying biochemical events that generate T-cell receptor coding sequences from the statistics of the observed sequences. This inferred model quantitatively describes the potential repertoire of T-cell receptors that can be produced by an individual, providing insight into its potential diversity and the probability of generation of any specific T-cell receptor. Then in chapter 3, we present work on understanding the functioning of regulatory DNA sequences in both prokaryotes and eukaryotes. Here we use experiments that measure the transcriptional activity of large libraries of mutagenized promoters and enhancers and infer models of the sequence-function relationship from this data. For the bacterial promoter, we infer a physically motivated 'thermodynamic' model of the interaction of DNA-binding proteins and RNA polymerase determining the transcription rate of the downstream gene. For the eukaryotic enhancers, we infer heuristic models of the sequence-function relationship and use these models to find synthetic enhancer sequences that optimize inducibility of expression. Both projects demonstrate the utility of sequence information in conjunction with sophisticated statistical inference techniques for dissecting underlying biophysical

  20. cDNA sequences of variant forms of human placenta diamine oxidase

    SciTech Connect

    Zhang, X.; Kim, J.; McIntire, S.

    1995-08-01

    Genes for two forms of human placenta diamine oxidase (dao) were cloned from a cDNA library and sequenced. One gene, pdao1, is identical in length to human kidney dao but differs from it by two bases in the coding region and differs slightly in the 3{prime} - and 5{prime}-noncoding regions. The second gene, pdao2, is nearly identical to these genes in the coding region, except that it has an extra 57-nucleotide coding segment near the 3{prime} end of this region. This segment corresponds to the contiguous sequence of the 3{prime} end of intron 3 of human kidney dao. pdao2 also differs significantly from pdao1 and human kidney dao in a 13-base sequence in the t{prime}-noncoding region. It is proposed that pdao1 and human kidney dao are polymorphic forms of the same allele. Whether pdao2 is a polymorph of these two is not certain, because of the significant differences in the coding and noncoding regions. pdao2 may represent a different allele. 21 refs., 2 figs.

  1. Nucleotide sequence of SHV-2 beta-lactamase gene

    SciTech Connect

    Garbarg-Chenon, A.; Godard, V.; Labia, R.; Nicolas, J.C. )

    1990-07-01

    The nucleotide sequence of plasmid-mediated beta-lactamase SHV-2 from Salmonella typhimurium (SHV-2pHT1) was determined. The gene was very similar to chromosomally encoded beta-lactamase LEN-1 of Klebsiella pneumoniae. Compared with the sequence of the Escherichia coli SHV-2 enzyme (SHV-2E.coli) obtained by protein sequencing, the deduced amino acid sequence of SHV-2pHT1 differed by three amino acid substitutions.

  2. Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

    PubMed Central

    Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

    2010-01-01

    Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

  3. [Tabular excel editor for analysis of aligned nucleotide sequences].

    PubMed

    Demkin, V V

    2010-01-01

    Excel platform was used for transition of results of multiple aligned nucleotide sequences obtained using the BLAST network service to the form appropriate for visual analysis and editing. Two macros operators for MS Excel 2007 were constructed. The array of aligned sequences transformed into Excel table and processed using macros operators is more appropriate for analysis than initial html data.

  4. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-29

    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  5. Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

    SciTech Connect

    Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

    1987-07-01

    Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary lambdagt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/..beta..-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of /sup 125/I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene.

  6. The complete sequence of a full length cDNA for human liver glyceraldehyde-3-phosphate dehydrogenase: evidence for multiple mRNA species.

    PubMed Central

    Arcari, P; Martinelli, R; Salvatore, F

    1984-01-01

    A recombinant M13 clone (O42) containing a 65 b.p. cDNA fragment from human fetal liver mRNA coding for glyceraldehyde-3-phosphate dehydrogenase has been identified and it has been used to isolate from a full-length human adult liver cDNA library a recombinant clone, pG1, which has been subcloned in M13 phage and completely sequenced with the chain terminator method. Besides the coding region of 1008 b.p., the cDNA sequence includes 60 nucleotides at the 5'-end and 204 nucleotides at the 3'-end up to the polyA tail. Hybridization of pG1 to human liver total RNA shows only one band about the size of pG1 cDNA. A much stronger hybridization signal was observed using RNA derived from human hepatocarcinoma and kidney carcinoma cell lines. Sequence homology between clone 042 and the homologous region of clone pG1 is 86%. On the other hand, homology among the translated sequences and the known human muscle protein sequence ranges between 77 and 90%; these data demonstrate the existence of more than one gene coding for G3PD. Southern blot of human DNA, digested with several restriction enzymes, also indicate that several homologous sequences are present in the human genome. Images PMID:6096821

  7. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    SciTech Connect

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  8. Cloning and genomic nucleotide sequence of the matrix attachment region binding protein from the halotolerant alga Dunaliella salina.

    PubMed

    Wang, Peng-Ju; Wang, Tian-Yun; Wang, Ya-Feng; Yang, Rui; Li, Zhao-Xi

    2013-07-01

    In our previous study, the sequence of a matrix attachment region binding protein (MBP) cDNA was cloned from the unicellular green alga Dunaliella salina. However, the nucleotide sequence of this gene has not been reported so far. In this paper, the nucleotide sequence of MBP was cloned and characterized, and its gene copy number was determined. The MBP nucleotide sequence is 5641 bp long, and interrupted by 12 introns ranging from 132 to 562 bp. All the introns in the D. salina MBP gene have orthodox splice sites, exhibiting GT at the 5' end and AG at the 3' end. Southern blot analysis showed that MBP only has one copy in the D. salina genome. PMID:22961592

  9. Cloning and genomic nucleotide sequence of the matrix attachment region binding protein from the halotolerant alga Dunaliella salina.

    PubMed

    Wang, Peng-Ju; Wang, Tian-Yun; Wang, Ya-Feng; Yang, Rui; Li, Zhao-Xi

    2013-07-01

    In our previous study, the sequence of a matrix attachment region binding protein (MBP) cDNA was cloned from the unicellular green alga Dunaliella salina. However, the nucleotide sequence of this gene has not been reported so far. In this paper, the nucleotide sequence of MBP was cloned and characterized, and its gene copy number was determined. The MBP nucleotide sequence is 5641 bp long, and interrupted by 12 introns ranging from 132 to 562 bp. All the introns in the D. salina MBP gene have orthodox splice sites, exhibiting GT at the 5' end and AG at the 3' end. Southern blot analysis showed that MBP only has one copy in the D. salina genome.

  10. Sequence of the cDNA and 5'-flanking region for human acid alpha-glucosidase, detection of an intron in the 5' untranslated leader sequence, definition of 18-bp polymorphisms, and differences with previous cDNA and amino acid sequences.

    PubMed

    Martiniuk, F; Mehler, M; Tzall, S; Meredith, G; Hirschhorn, R

    1990-03-01

    Acid maltase or acid alpha-glucosidase (GAA) is a lysosomal enzyme that hydrolyzes glycogen to glucose and is deficient in glycogen storage disease type II. Previously, we isolated a partial cDNA (1.9 kb) for human GAA; we have now used this cDNA to isolate and determine sequence in longer cDNAs from four additional independent cDNA libraries. Primer extension studies indicated that the mRNA extended approximately 200 bp 5' of the cDNA sequence obtained. Therefore, we isolated a genomic fragment containing 5' cDNA sequences that overlapped the previous cDNA sequence and extended an additional 24 bp to an initiation codon within a Kozak consensus sequence. The sequence of the genomic clone revealed an intron-exon junction 32 bp 5' to the ATG, indicating that the 5' leader sequence was interrupted by an intron. The remaining 186 bp of 5' untranslated sequence was identified approximately 3 kb upstream. The promoter region upstream from the start site of transcription was GC rich and contained areas of homology to Sp1 binding sites but no identifiable CAAT or TATA box. The combined data gave a nucleotide sequence of 2,856 bp for the coding region from the ATG to a stop codon, predicting a protein of 952 amino acids. The 3' untranslated region contained 555 bp with a polyadenylation signal at 3,385 bp followed by 16 bp prior to a poly(A) tail. This sequence of the GAA coding region differs from that reported by Hoefsloot et al. (1988) in three areas that change a total of 42 amino acids. Direct determination of the amino acid sequence in one of these areas confirmed the nucleotide sequence reported here but also disagreed with the directly determined amino acid sequence reported by Hoefsloot et al. (1988). At two other areas, changes in base pairs predicted new restriction sites that were identified in cDNAs from several independent libraries. The amino acid changes in all three ares increased the homology to rabbit-human isomaltase. Therefore, we believe that our

  11. Cloning and sequencing of dolphinfish (Coryphaena hippurus, Coryphaenidae) growth hormone-encoding cDNA.

    PubMed

    Peduel, A D; Elizur, A; Knibb, W

    1994-01-01

    The cDNA encoding the preprotein growth hormone from the dolphinfish (Coryphaena hippurus) has been cloned and sequenced. The cDNA was derived by reverse transcription of RNA from the pituitary of a young fish using the method known as Rapid Amplification of cDNA Ends (RACE). An oligonucleotide primer corresponding to the 5' region of Pagrus major and the universal RACE primer enabled amplification using the Polymerase Chain Reaction (PCR). The dolphinfish and yellow-tail, Seriola quineqeradiata, are both members of the sub-order Percoidei (Perciforme) and their GH sequences show a high level of homology. PMID:7703505

  12. Hamster cytochrome P-450 IA gene family, P-450IA1 and P-450IA2 in lung and liver: cDNA cloning and sequence analysis.

    PubMed

    Sagami, I; Ohmachi, T; Fujii, H; Kikuchi, H; Watanabe, M

    1991-10-01

    Two cDNA clones, 2C19 and 4C1, were isolated from a lung cDNA library of 3-methylcholanthrene (MC)-treated hamster by using rat P-450c cDNA as a probe. The cDNA determined from 2C19 and 4C1 was 2,916 bp long and contained an entire coding region for 524 amino acids with a molecular weight of 59,408. The deduced amino acid sequence showed a 85% identity with that of rat P-450c indicating 2C19 and 4C1 encode the hamster P-450IA1 protein. Another cDNA clone, designated H28, was isolated from a MC-induced hamster liver cDNA library by using the hamster lung 2C19 or 4C1 cDNA clone as a probe. H28 was 1,876 bp long and encoded a polypeptide of 513 amino acids with a molecular weight of 58,079. The N-terminal 20 residues deduced from nucleotide sequence of H28 were identical to those determined by sequence analysis of purified hamster hepatic P-450MCI. The high similarity of the nucleotide and deduced amino acid sequences between H28 and P-450IA2 of other species indicated that H28 encoded a P-450 protein which belongs to the P-450IA2 family. Northern blot analysis revealed that the mRNAs for hamster P-450IA1 and IA2 were about 2.9 and 1.9 kb long, respectively. Hamster P-450IA1 mRNA was induced to the same level in lungs as in livers by MC treatment, whereas hamster P-450IA2 mRNA was induced and expressed only in hamster liver.

  13. Moss Phylogeny Reconstruction Using Nucleotide Pangenome of Complete Mitogenome Sequences.

    PubMed

    Goryunov, D V; Nagaev, B E; Nikolaev, M Yu; Alexeevski, A V; Troitsky, A V

    2015-11-01

    Stability of composition and sequence of genes was shown earlier in 13 mitochondrial genomes of mosses (Rensing, S. A., et al. (2008) Science, 319, 64-69). It is of interest to study the evolution of mitochondrial genomes not only at the gene level, but also on the level of nucleotide sequences. To do this, we have constructed a "nucleotide pangenome" for mitochondrial genomes of 24 moss species. The nucleotide pangenome is a set of aligned nucleotide sequences of orthologous genome fragments covering the totality of all genomes. The nucleotide pangenome was constructed using specially developed new software, NPG-explorer (NPGe). The stable part of the mitochondrial genome (232 stable blocks) is shown to be, on average, 45% of its length. In the joint alignment of stable blocks, 82% of positions are conserved. The phylogenetic tree constructed with the NPGe program is in good correlation with other phylogenetic reconstructions. With the NPGe program, 30 blocks have been identified with repeats no shorter than 50 bp. The maximal length of a block with repeats is 140 bp. Duplications in the mitochondrial genomes of mosses are rare. On average, the genome contains about 500 bp in large duplications. The total length of insertions and deletions was determined in each genome. The losses and gains of DNA regions are rather active in mitochondrial genomes of mosses, and such rearrangements presumably can be used as additional markers in the reconstruction of phylogeny. PMID:26615445

  14. [Amplification, cloning and sequence analysis of spider dragline silk cDNA].

    PubMed

    Zhang, Li-Shu; Ma, He-Wen; Lu, Yi-Ming; Zhang, Yu-Jing

    2002-09-01

    Spider dragline silk is synthesized in special gland named major ampulate (MA) gland. The MA glands were dissected from the abdomen of the spiders Nephila clavata and the total RNA was extracted by the TRIZOL. The cDNA of dragline silk was amplificated by RT-PCR (reverse transcription polymerase chain reaction), multiplex PCR and cloned. PCR identification, restriction analysis and DNA sequence analysis were carried out to verify the recombinant plasmids. The codon usage frequencies of the cloned cDNA were added up, and the predicted amino acid sequence was compared with Spidroin2 of Nephila clavipes. Predicted secondary structure of the predicted amino-acid sequence was analysized by DNAStar software. All results showed that the cloned cDNA we got (GenBank Accession No. AF441245) was the very fragment of spider dragline silk Spidroin2 cDNA.

  15. Information capacity of nucleotide sequences and its applications.

    PubMed

    Sadovsky, M G

    2006-05-01

    The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.

  16. Complete nucleotide sequence and coding strategy of rice hoja blanca virus RNA4.

    PubMed

    Ramirez, B C; Lozano, I; Constantino, L M; Haenni, A L; Calvert, L A

    1993-11-01

    The complete sequence of rice hoja blanca virus (RHBV) RNA4 has been determined, based on the sequence of the corresponding cDNA clones. RNA4 consists of 1991 nucleotides with two open reading frames (ORFs). One putative ORF is located in the 5'-proximal region of the viral RNA4; it encodes a protein of predicted M(r) 20076 which corresponds to the major non-structural protein that accumulates in RHBV-infected rice plants, and which bears limited sequence identity with the helper component of tobacco vein mottling potyvirus. The other ORF is located in the 5'-proximal region of the viral complementary RNA4 and encodes a protein of predicted M(r) 32,469. Between the two ORFs is an intergenic region of 524 nucleotides, part of which can theoretically adopt a stable stem-loop structure; the 5' and 3' ends can potentially base-pair over 16 nucleotides, producing a pan-handle configuration. These characteristics are in favour of an ambisense coding strategy for RHBV RNA4. PMID:8245863

  17. Nucleotide sequence of the tobacco (Nicotiana tabacum) anionic peroxidase gene

    SciTech Connect

    Diaz-De-Leon, F.; Klotz, K.L.; Lagrimini, L.M. )

    1993-03-01

    Peroxidases have been implicated in numerous physiological processes including lignification (Grisebach, 1981), wound-healing (Espelie et al., 1986), phenol oxidation (Lagrimini, 1991), pathogen defense (Ye et al., 1990), and the regulation of cell elongation through the formation of interchain covalent bonds between various cell wall polymers (Fry, 1986; Goldberg et al., 1986; Bradley et al., 1992). However, a complete description of peroxidase action in vivo is not available because of the vast number of potential substrates and the existence of multiple isoenzymes. The tobacco anionic peroxidase is one of the better-characterized isoenzymes. This enzyme has been shown to oxidize a number of significant plant secondary compounds in vitro including cinnamyl alcohols, phenolic acids, and indole-3-acetic acid (Maeder, 1980; Lagrimini, 1991). A cDNA encoding the enzyme has been obtained, and this enzyme was shown to be expressed at the highest levels in lignifying tissues (xylem and tracheary elements) and also in epidermal tissue (Lagrimini et al., 1987). It was shown at this time that there were four distinct copies of the anionic peroxidase gene in tobacco (Nicotiana tabacum). A tobacco genomic DNA library was constructed in the [lambda]-phase EMBL3, from which two unique peroxidase genes were sequenced. One of these clones, [lambda]POD1, was designated as a pseudogene when the exonic sequences were found to differ from the cDNA sequences by 1%, and several frame shifts in the coding sequences indicated a dysfunctional gene (the authors' unpublished results). The other clone, [lambda]POD3, described in this manuscript, was designated as the functional tobacco anionic peroxidase gene because of 100% homology with the cDNA. Significant structural elements include an AS-2 box indicated in shoot-specific expression (Lam and Chua, 1989), a TATA box, and two intervening sequences. 10 refs., 1 tab.

  18. Isolation of a human anti-haemophilic factor IX cDNA clone using a unique 52-base synthetic oligonucleotide probe deduced from the amino acid sequence of bovine factor IX.

    PubMed

    Jaye, M; de la Salle, H; Schamber, F; Balland, A; Kohli, V; Findeli, A; Tolstoshev, P; Lecocq, J P

    1983-04-25

    A unique 52mer oligonucleotide deduced from the amino acid sequence of bovine Factor IX was synthesized and used as a probe to screen a human liver cDNA bank. The Factor IX clone isolated shows 5 differences in nucleotide and deduced amino acid sequence as compared to a previously isolated clone. In addition, precisely one codon has been deleted.Images

  19. Identification, cloning and characterisation of a novel copper-metallothionein in tetrahymena pigmentosa. Sequencing of cDNA and expression.

    PubMed

    Santovito, G; Irato, P; Palermo, S; Boldrin, F; Sack, R; Hunziker, P; Piccinni, E L

    2001-09-01

    The protist Tetrahymena pigmentosa accumulates large amounts of metal ions, particularly cadmium and copper. This capability is linked to the induction of metallothioneins (MTs), cysteine-rich metal-binding proteins found in protists, plants and animals. The present study focuses on a novel inducible MT-isoform isolated from Tetrahymena after exposure to a non-toxic dose of copper. The cDNA sequence was determined utilising the partial peptide sequence of purified protein. The Cu-MT cDNA encodes 96 amino acids containing 28 cysteine residues (29%) arranged in motifs characteristic of the metal-binding regions of vertebrate and invertebrate MTs. Both the amino acid and nucleotide sequences differ, not only from other animal MTs, but also from the previously characterised Tetrahymena Cd-MT. Both MTs contain the structural pattern GTXXXCKCXXCKC, which may be proposed as a conservative sequence of Tetrahymena MTs. Cu-dependent regulation of MT expression was also investigated by measuring MT-mRNA and MT levels. MT synthesis occurs very quickly and MT contents increase with Cu accumulation. The induction of Cu-MT mRNA is very rapid, with no observable lag period, and is characterised by transient fluctuation, similar to that described for Cd-MT mRNA. The data reported here indicate that, also in the unicellular organism Tetrahymena, two very different MT isoforms, which perform different biological functions, are expressed according to the inducing metal, Cu or Cd.

  20. Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)

    PubMed Central

    2011-01-01

    Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the

  1. Method for the detection of specific nucleic acid sequences by polymerase nucleotide incorporation

    DOEpatents

    Castro, Alonso

    2004-06-01

    A method for rapid and efficient detection of a target DNA or RNA sequence is provided. A primer having a 3'-hydroxyl group at one end and having a sequence of nucleotides sufficiently homologous with an identifying sequence of nucleotides in the target DNA is selected. The primer is hybridized to the identifying sequence of nucleotides on the DNA or RNA sequence and a reporter molecule is synthesized on the target sequence by progressively binding complementary nucleotides to the primer, where the complementary nucleotides include nucleotides labeled with a fluorophore. Fluorescence emitted by fluorophores on single reporter molecules is detected to identify the target DNA or RNA sequence.

  2. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    SciTech Connect

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E. ); Flores, B.M. ); Hagen, F.S. )

    1990-08-01

    A {lambda}gt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically {sup 35}S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface-{sup 125}I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4{degree}C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested.

  3. The nucleotide sequence of cloned wheat dwarf virus DNA

    PubMed Central

    MacDowell, S. W.; Macdonald, H.; Hamilton, W. D. O.; Coutts, R. H. A.; Buck, K. W.

    1985-01-01

    Restriction analysis and cloning of virus-specific double-stranded DNA isolated from plants infected with wheat dwarf virus (WDV) indicated that the virus genome, like that of maize streak virus (MSV), consists of a single DNA circle. The complete nucleotide sequence of cloned WDV DNA (2749 nucleotides) has been determined. Comparison of the potential coding regions in WDV DNA with those in the DNA of two strains of MSV suggests that these viruses encode at least two functional proteins, the coat protein read in the virion (+) DNA sense and a composite protein, formed from two open reading regions, in the complementary (−) DNA sense. Although WDV and MSV are serologically unrelated their coat proteins showed 35% direct amino acid sequence and their DNAs showed 46% nucleotide sequence homology. There was too little homology between the DNAs of WDV and those of two geminiviruses with bipartite genomes, cassava latent virus (CLV) and tomato golden mosaic virus (TGMV), to align the sequences. However comparison of the amino acid sequences of predicted proteins of WDV, MSV, TGMV and CLV revealed clear relationships between these viruses and suggested that the monopartite and the bipartite geminiviruses have a common ancestral origin. Four inverted repeat sequences which have the potential to form hairpin structures of △G≥-14 kcal/mol were detected in WDV DNA. The sequence TAATATTAC present in the loop of one of these hairpins is conserved in similar putative structures in MSV DNA and in both DNA components of CLV and TGMV and may function as a recognition sequence for a protein involved in virus DNA replication. PMID:15938050

  4. Expressed sequence tags: normalization and subtraction of cDNA libraries expressed sequence tags\\ normalization and subtraction of cDNA libraries.

    PubMed

    Soares, Marcelo Bento; de Fatima Bonaldo, Maria; Hackett, Jeremiah D; Bhattacharya, Debashish

    2009-01-01

    Expressed Sequence Tags (ESTs) provide a rapid and efficient approach for gene discovery and analysis of gene expression in eukaryotes. ESTs have also become particularly important with recent expanded efforts in complete genome sequencing of understudied, nonmodel eukaryotes such as protists and algae. For these projects, ESTs provide an invaluable source of data for gene identification and prediction of exon-intron boundaries. The generation of EST data, although straightforward in concept, requires nonetheless great care to ensure the highest efficiency and return for the investment in time and funds. To this end, key steps in the process include generation of a normalized cDNA library to facilitate a high gene discovery rate followed by serial subtraction of normalized libraries to maintain the discovery rate. Here we describe in detail, protocols for normalization and subtraction of cDNA libraries followed by an example using the toxic dinoflagellate Alexandrium tamarense.

  5. A compilation of partial sequences of randomly selected cDNA clones from the rat incisor.

    PubMed

    Matsuki, Y; Nakashima, M; Amizuka, N; Warshawsky, H; Goltzman, D; Yamada, K M; Yamada, Y

    1995-01-01

    The formation of tooth organs is regulated by a series of developmental programs. We have initiated a genome project with the ultimate goal of identifying novel genes important for tooth development. As an initial approach, we constructed a unidirectional cDNA library from the non-calcified portion of incisors of 3- to 4-week-old rats, sequenced cDNA clones, and classified their sequences by homology search through the GenBank data base and the PIR protein data base. Here, we report partial DNA sequences obtained by automated DNA sequencing on 400 cDNA clones randomly selected from the library. Of the sequences determined, 51% represented sequences of new genes that were not related to any previously reported gene. Twenty-six percent of the clones strongly matched genes and proteins in the data bases, including amelogenin, alpha 1(I) and alpha 2(I) collagen chains, osteonectin, and decorin. Nine percent of clones revealed partial sequence homology to known genes such as transcription factors and cell surface receptors. A significant number of the previously identified genes were expressed redundantly and were found to encode extracellular matrix proteins. Identification and cataloging of cDNA clones in these tissues are the first step toward identification of markers expressed in a tissue- or stage-specific manner, as well as the genetic linkage study of tooth anomalies. Further characterization of the clones described in this paper should lead to the discovery of novel genes important for tooth development. PMID:7876422

  6. The primary nucleotide sequence of U4 RNA.

    PubMed

    Reddy, R; Henning, D; Busch, H

    1981-04-10

    U4 RNA is one of the "capped" nuclear snRNAs recently found to be precipitable by anti-Sm antibodies as ribonucleoprotein particles. U4 RNA, along with other snRNAs, has been implicated in hnRNA processing, mRNA transport, or both (Lerner, M. R., Boyle, J., Mount, S., Wolin, S., and Steitz, J. A. (1980) Nature 283, 220-224). Since the proteins bound to different snRNAs appear to be the same, the functions of different snRNPs might be dependent on the RNA components. To help understand the function of U4 RNP, the nucleotide sequence of U4 RNA was determined. The sequence is (formula see text) In addition to the modified nucleotides in the "cap," U4 RNA contains Am at position 63 and m6A at position 98. It also exhibited A-C microheterogeneity at position 97. PMID:6162848

  7. Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy.

    PubMed

    Mankos, Marian; Persson, Henrik H J; N'Diaye, Alpha T; Shadman, Khashayar; Schmid, Andreas K; Davis, Ronald W

    2016-01-01

    DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging. PMID:27149617

  8. Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy

    PubMed Central

    Schmid, Andreas K.; Davis, Ronald W.

    2016-01-01

    DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging. PMID:27149617

  9. Molecular cloning and characterization of a new cDNA sequence encoding a venom peptide from the centipede Scolopendra subspinipes mutilans.

    PubMed

    Liu, Wanhong; Luo, Feng; He, Jing; Cao, Zhijian; Miao, Lixia

    2012-01-01

    Many studies have been performed on venomous peptides derived from animals. However, little of this research has focused on peptides from centipede venoms. Here, a venom gland cDNA library was successfully constructed for the centipede Scolopendra subspinipes mutilans. A new cDNA encoding the precursor of a venom peptide, named SsmTx, was cloned from the venomous gland cDNA library of the centipede S. subspinipes mutilans. The full-length SsmTx cDNA sequence is 465 nt, including a 249 nt ORF, a 45 nt 5' UTR and a 171 nt 3' UTR. There is a signal tail AATAAA 31 nt upstream of the poly (A) tail. The precursor nucleotide sequence of SsmTx encodes a signal peptide of 25 residues and a mature peptide of 57 residues, which is bridged by two pairs of disulfide bonds. SsmTx displays a unique cysteine motif that is completely different from that of other venomous animal toxins. This is the first reported cDNA sequence encoding a venom peptide from the centipede S. subspinipes mutilans.

  10. Evolution of vertebrate IgM: complete amino acid sequence of the constant region of Ambystoma mexicanum mu chain deduced from cDNA sequence.

    PubMed

    Fellah, J S; Wiles, M V; Charlemagne, J; Schwager, J

    1992-10-01

    cDNA clones coding for the constant region of the Mexican axolotl (Ambystoma mexicanum) mu heavy immunoglobulin chain were selected from total spleen RNA, using a cDNA polymerase chain reaction technique. The specific 5'-end primer was an oligonucleotide homologous to the JH segment of Xenopus laevis mu chain. One of the clones, JHA/3, corresponded to the complete constant region of the axolotl mu chain, consisting of a 1362-nucleotide sequence coding for a polypeptide of 454 amino acids followed in 3' direction by a 179-nucleotide untranslated region and a polyA+ tail. The axolotl C mu is divided into four typical domains (C mu 1-C mu 4) and can be aligned with the Xenopus C mu with an overall identity of 56% at the nucleotide level. Percent identities were particularly high between C mu 1 (59%) and C mu 4 (71%). The C-terminal 20-amino acid segment which constitutes the secretory part of the mu chain is strongly homologous to the equivalent sequences of chondrichthyans and of other tetrapods, including a conserved N-linked oligosaccharide, the penultimate cysteine and the C-terminal lysine. The four C mu domains of 13 vertebrate species ranging from chondrichthyans to mammals were aligned and compared at the amino acid level. The significant number of mu-specific residues which are conserved into each of the four C mu domains argues for a continuous line of evolution of the vertebrate mu chain. This notion was confirmed by the ability to reconstitute a consistent vertebrate evolution tree based on the phylogenic parsimony analysis of the C mu 4 sequences. PMID:1382992

  11. The complete nucleotide sequence of pelargonium leaf curl virus.

    PubMed

    McGavin, Wendy J; MacFarlane, Stuart A

    2016-05-01

    Investigation of a tombusvirus isolated from tulip plants in Scotland revealed that it was pelargonium leaf curl virus (PLCV) rather than the originally suggested tomato bushy stunt virus. The complete sequence of the PLCV genome was determined for the first time, revealing it to be 4789 nucleotides in size and to have an organization similar to that of the other, previously described tombusviruses. Primers derived from the sequence were used to construct a full-length infectious clone of PLCV that recapitulates the disease symptoms of leaf curling in systemically infected pelargonium plants.

  12. The complete nucleotide sequence of pelargonium leaf curl virus.

    PubMed

    McGavin, Wendy J; MacFarlane, Stuart A

    2016-05-01

    Investigation of a tombusvirus isolated from tulip plants in Scotland revealed that it was pelargonium leaf curl virus (PLCV) rather than the originally suggested tomato bushy stunt virus. The complete sequence of the PLCV genome was determined for the first time, revealing it to be 4789 nucleotides in size and to have an organization similar to that of the other, previously described tombusviruses. Primers derived from the sequence were used to construct a full-length infectious clone of PLCV that recapitulates the disease symptoms of leaf curling in systemically infected pelargonium plants. PMID:26906694

  13. Fluorogenic sequencing using halogen-fluorescein-labeled nucleotides.

    PubMed

    Chen, Zitian; Duan, Haifeng; Qiao, Shuo; Zhou, Wenxiong; Qiu, Haiwei; Kang, Li; Xie, X Sunney; Huang, Yanyi

    2015-05-26

    Fluorogenic sequencing is a sequencing-by-synthesis technology that combines the advantages of pyrosequencing and fluorescence detection. With native duplex DNA as the major product, we employ polymerase to incorporate the complement- arily matched terminal phosphate-labeled fluorogenic nucleotides into the DNA template and release halogen-fluorescein as the reporter. This red-emitting fluorophore successfully avoids spectral overlap with the autofluorescence background of the flow chip. We fully characterized the enzymatic reaction kinetics of the new substrates, and performed a 35-base sequencing experiment with 60 reaction cycles. Our achievement expands the substrate repertoire for fluorogenic sequencing, and extends the spectral range to obtain better signal-to-background performance.

  14. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    SciTech Connect

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.

    1987-04-01

    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone lambdaHB''-1 from a phage lambdagt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone lambdaHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone lambdaHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the lambdaHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone lambdaHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens.

  15. Cloning and sequence analysis of Hemonchus contortus HC58cDNA.

    PubMed

    Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li

    2007-06-01

    The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.

  16. Molecular cloning and sequence analysis of factor C cDNA from the Singapore horseshoe crab, Carcinoscorpius rotundicauda.

    PubMed

    Ding, J L; Navas, M A; Ho, B

    1995-03-01

    Two forms of Factor C cDNAs: CrFC21 (3448 bp) and CrFC26 (4182 bp) have been cloned into lambda gt22. CrFC26 includes 568 nucleotides of 5' untranslated region (5' UTR) containing seven ATGs before the real initiation site, an open reading frame (ORF) of 3249 nucleotides, a stop codon, and 365 nucleotides of 3' untranslated sequence. There are four polyadenylation signals and six potential glycosylation sites. The ORF codes for a signal peptide of 24 amino acids and a Factor C zymogen of 1059 residues. The CrFC21 lacks most of the 5' UTR, and has some base changes in its ORF. The predicted secondary mRNA structures of the 5' end of CrFC26 showed numerous stem-and-loop structures, thus obscuring its real start codon. In contrast, CrFC21 has a well-exposed AUG start site, and expresses Factor C in transcription-translation reactions in vitro. There is a typical serine protease catalytic triad of Asp-His-Ser, which is structurally like prothrombin, but catalytically more similar to trypsin. Although an overall homology of 97.7% was observed in comparison with the Tachypleus tridentatus Factor C (TtFC) cDNA, there were notable differences in the restriction sites and subtle base substitutions in the CrFC cDNA. The high degree of homology between Factor C from T. tridentatus and C. rotundicauda substantiates, at the molecular level, the proximity of these two species in the course of evolution. This finding contravenes the apparent disparities with respect to their morphology, ecological habitat, and taxonomical classification. PMID:7538401

  17. Cloning and sequencing of human intestinal alkaline phosphatase cDNA

    SciTech Connect

    Berger, J.; Garattini, E.; Hua, J.C.; Udenfriend, S.

    1987-02-01

    Partial protein sequence data obtained on intestinal alkaline phosphatase indicated a high degree of homology with the reported sequence of the placental isoenzyme. Accordingly, placental alkaline phosphatase cDNA was cloned and used as a probe to clone intestinal alkaline phosphatase cDNA. The latter is somewhat larger (3.1 kilobases) than the cDNA for the placental isozyme (2.8 kilobases). Although the 3' untranslated regions are quite different, there is almost 90% homology in the translated regions of the two isozymes. There are, however, significant differences at their amino and carboxyl termini and a substitution of an alanine in intestinal alkaline phosphatase for a glycine in the active site of the placental isozyme.

  18. Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

    PubMed Central

    2011-01-01

    Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot

  19. Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

    PubMed

    René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

    2000-01-01

    In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

  20. Comparing compressed sequences for faster nucleotide BLAST searches.

    PubMed

    Cameron, Michael; Williams, Hugh E

    2007-01-01

    Molecular biologists, geneticists, and other life scientists use the BLAST homology search package as their first step for discovery of information about unknown or poorly annotated genomic sequences. There are two main variants of BLAST: BLASTP for searching protein collections and BLASTN for nucleotide collections. Surprisingly, BLASTN has had very little attention; for example, the algorithms it uses do not follow those described in the 1997 BLAST paper and no exact description has been published. It is important that BLASTN is state-of-the-art: Nucleotide collections such as GenBank dwarf the protein collections in size, they double in size almost yearly, and they take many minutes to search on modern general purpose workstations. This paper proposes significant improvements to the BLASTN algorithms. Each of our schemes is based on compressed bytepacked formats that allow queries and collection sequences to be compared four bases at a time, permitting very fast query evaluation using lookup tables and numeric comparisons. Our most significant innovations are two new, fast gapped alignment schemes that allow accurate sequence alignment without decompression of the collection sequences. Overall, our innovations more than double the speed of BLASTN with no effect on accuracy and have been integrated into our new version of BLAST that is freely available for download from http://www.fsa-blast.org/. PMID:17666756

  1. Comparing compressed sequences for faster nucleotide BLAST searches.

    PubMed

    Cameron, Michael; Williams, Hugh E

    2007-01-01

    Molecular biologists, geneticists, and other life scientists use the BLAST homology search package as their first step for discovery of information about unknown or poorly annotated genomic sequences. There are two main variants of BLAST: BLASTP for searching protein collections and BLASTN for nucleotide collections. Surprisingly, BLASTN has had very little attention; for example, the algorithms it uses do not follow those described in the 1997 BLAST paper and no exact description has been published. It is important that BLASTN is state-of-the-art: Nucleotide collections such as GenBank dwarf the protein collections in size, they double in size almost yearly, and they take many minutes to search on modern general purpose workstations. This paper proposes significant improvements to the BLASTN algorithms. Each of our schemes is based on compressed bytepacked formats that allow queries and collection sequences to be compared four bases at a time, permitting very fast query evaluation using lookup tables and numeric comparisons. Our most significant innovations are two new, fast gapped alignment schemes that allow accurate sequence alignment without decompression of the collection sequences. Overall, our innovations more than double the speed of BLASTN with no effect on accuracy and have been integrated into our new version of BLAST that is freely available for download from http://www.fsa-blast.org/.

  2. Bioinformatics comparison of sulfate-reducing metabolism nucleotide sequences

    NASA Astrophysics Data System (ADS)

    Tremberger, G.; Dehipawala, Sunil; Nguyen, A.; Cheung, E.; Sullivan, R.; Holden, T.; Lieberman, D.; Cheung, T.

    2015-09-01

    The sulfate-reducing bacteria can be traced back to 3.5 billion years ago. The thermodynamics details of the sulfur cycle have been well documented. A recent sulfate-reducing bacteria report (Robator, Jungbluth, et al , 2015 Jan, Front. Microbiol) with Genbank nucleotide data has been analyzed in terms of the sulfite reductase (dsrAB) via fractal dimension and entropy values. Comparison to oil field sulfate-reducing sequences was included. The AUCG translational mass fractal dimension versus ATCG transcriptional mass fractal dimension for the low temperature dsrB and dsrA sequences reported in Reference Thirteen shows correlation R-sq ~ 0.79 , with a probably of about 3% in simulation. A recent report of using Cystathionine gamma-lyase sequence to produce CdS quantum dot in a biological method, where the sulfur is reduced just like in the H2S production process, was included for comparison. The AUCG mass fractal dimension versus ATCG mass fractal dimension for the Cystathionine gamma-lyase sequences was found to have R-sq of 0.72, similar to the low temperature dissimilatory sulfite reductase dsr group with 3% probability, in contrary to the oil field group having R-sq ~ 0.94, a high probable outcome in the simulation. The other two simulation histograms, namely, fractal dimension versus entropy R-sq outcome values, and di-nucleotide entropy versus mono-nucleotide entropy R-sq outcome values are also discussed in the data analysis focusing on low probability outcomes.

  3. Conserved nucleotide sequences in the open reading frame and 3' untranslated region of selenoprotein P mRNA.

    PubMed Central

    Hill, K E; Lloyd, R S; Burk, R F

    1993-01-01

    Rat liver selenoprotein P contains 10 selenocysteine residues in its primary structure (deduced). It is the only selenoprotein characterized to date that has more than one selenocysteine residue. Selenoprotein P cDNA has been cloned from human liver and heart cDNA libraries and sequenced. The open reading frames are identical and contain a signal peptide, indicating that the protein is secreted by both organs and is therefore not exclusively produced in the liver. Ten selenocysteine residues (deduced) are present. Comparison of the open reading frame of the human cDNA with the rat cDNA reveals a 69% identity of the nucleotide sequence and 72% identity of the deduced amino acid sequence. Two regions in the 3' untranslated portion have high conservation between human and rat. Each of these regions contains a predicted stable stem-loop structure similar to the single stem-loop structures reported in 3' untranslated regions of type I iodothyronine 5'-deiodinase and glutathione peroxidase. The stem-loop structure of type I iodothyronine 5'-deiodinase has been shown to be necessary for incorporation of the selenocysteine residue at the UGA codon. Because only two stem-loop structures are present in the 3' untranslated region of selenoprotein P mRNA, it can be concluded that a separate stem-loop structure is not required for each selenocysteine residue. Images PMID:8421687

  4. Genes galore: a summary of methods for accessing results from large-scale partial sequencing of anonymous Arabidopsis cDNA clones.

    PubMed Central

    Newman, T; de Bruijn, F J; Green, P; Keegstra, K; Kende, H; McIntosh, L; Ohlrogge, J; Raikhel, N; Somerville, S; Thomashow, M

    1994-01-01

    High-throughput automated partial sequencing of anonymous cDNA clones provides a method to survey the repertoire of expressed genes from an organism. Comparison of the coding capacity of these expressed sequence tags (ESTs) with the sequences in the public data bases results in assignment of putative function to a significant proportion of the ESTs. Thus, the more than 13,400 plant ESTs that are currently available provide a new resource that will facilitate progress in many areas of plant biology. These opportunities are illustrated by a description of the results obtained from analysis of 1500 Arabidopsis ESTs from a cDNA library prepared from equal portions of poly(A+) mRNA from etiolated seedlings, roots, leaves, and flowering inflorescences. More than 900 different sequences were represented, 32% of which showed significant nucleotide or deduced amino acid sequences similarity to previously characterized genes or proteins from a wide range of organisms. At least 165 of the clones had significant deduced amino acid sequence homology to proteins or gene products that have not been previously characterized from higher plants. A summary of methods for accessing the information and materials generated by the Arabidopsis cDNA sequencing project is provided. PMID:7846151

  5. The human mitochondrial elongation factor tu (EF-Tu) gene: cDNA sequence, genomic localization, genomic structure, and identification of a pseudogene.

    PubMed

    Ling, M; Merante, F; Chen, H S; Duff, C; Duncan, A M; Robinson, B H

    1997-09-15

    The human mitochondrial elongation factor Tu (EF-Tu) is nuclear-encoded and functions in the translational apparatus of mitochondria. The complete human EF-Tu cDNA sequence of 1677 base pairs (bp) with a 101 bp 5'-untranslated region, a 1368 bp coding region, and a 207 bp 3'-untranslated region, has been determined and updated. The predicted protein from this cDNA sequence is approximately 49.8 kDa in size and is composed of 455 amino acids (aa) with a putative N-terminal mitochondrial leader sequence of approximately 50 aa residues. The predicted amino acid sequence shows high similarity to other EF-Tu protein sequences from ox, yeast, and bacteria, and also shows limited similarity to human cystolic elongation factor 1 alpha. The complete size of this cDNA (1677 bp) obtained by cloning and sequencing was confirmed by Northern blot analysis, which showed a single transcript (mRNA) of approximately 1.7 kb in human liver. The genomic structure of this EF-Tu gene has been determined for the first time. This gene contains nine introns with a predicted size of approximately 3.6 kilobases (kb) and has been mapped to chromosome 16p11.2. In addition, an intronless pseudogene of approximately 1.7 kb with 92.6% nucleotide sequence similarity to the EF-Tu gene has also been identified and mapped to chromosome 17q11.2. PMID:9332382

  6. Molecular Cloning and Sequencing of Channel Catfish, Ictalurus punctatus, Cathepsin H and L cDNA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cathepsin H and L, a lysosomal cysteine endopeptidase of the papain family, are ubiquitously expressed and involve in antigen processing. In this communication, the channel catfish cathepsin H and L transcripts were sequenced and analyzed. Total RNA from tissues was extracted and cDNA libraries we...

  7. Cytochrome b nucleotide sequence variation among the Atlantic Alcidae.

    PubMed

    Friesen, V L; Montevecchi, W A; Davidson, W S

    1993-01-01

    Analysis of cytochrome b nucleotide sequences of the six extant species of Atlantic alcids and a gull revealed an excess of adenines and cytosines and a deficit of guanines at silent sites on the coding strand. Phylogenetic analyses grouped the sequences of the common (Uria aalge) and Brünnich's (U. lomvia) guillemots, followed by the razorbill (Alca torda) and little auk (Alle alle). The black guillemot (Cepphus grylle) sequence formed a sister taxon, and the puffin (Fratercula arctica) fell outside the other alcids. Phylogenetic comparisons of substitutions indicated that mutabilities of bases did not differ, but that C was much more likely to be incorporated than was G. Imbalances in base composition appear to result from a strand bias in replication errors, which may result from selection on secondary RNA structure and/or the energetics of codon-anticodon interactions. PMID:7916741

  8. Detection of protein similarities using nucleotide sequence databases.

    PubMed

    Henikoff, S; Wallace, J C

    1988-07-11

    A simple procedure is described for finding similarities between proteins using nucleotide sequence databases. The approach is illustrated by several examples of previously unknown correspondences with important biological implications: Drosophila elongation factor Tu is shown to be encoded by two genes that are differently expressed during development; a cluster of three Drosophila genes likely encode maltases; a flesh-fly fat body protein resembles the hypothesized Drosophila alcohol dehydrogenase ancestral protein; an unknown protein encoded at the multifunctional E. coli hisT locus resembles aspartate beta-semialdehyde dehydrogenase; and the E. coli tyrR protein is related to nitrogen regulatory proteins. These and other matches were discovered using a personal computer of the type available in most laboratories collecting DNA sequence data. As relatively few sequences were sampled to find these matches, it is likely that much of the existing data has not been adequately examined.

  9. Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

    SciTech Connect

    White, D.A.; Zilinskas, B.A. )

    1991-08-01

    The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity) with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).

  10. Identification of genomic sequences corresponding to cDNA clones

    SciTech Connect

    Spoerel, N.A.; Kafatos, F.C.

    1987-01-01

    The general methods applicable to the isolation of genomic sequences from phage lambda or cosmid libraries have been described. This chapter presents strategies for the investigation of genes that occur in several identical or nonidentical copies per genome, or that share a common conserved domain with other genes. The methods discussed are applicable both to the identification of the genes in Southern blots and to their isolation from libraries. Furthermore, the methods are well suited for the analysis of homologous genes in different species. A high proportion of genes in eukaryotes are known to be members of multigene families. Carefully controlled hybridization conditions and well-tailored probes are powerful tools in the isolation and analysis of genes which share a common domain or are members of multigene families. This chapter consists of a short review of recommended strategies and relevant parameters, which have been discussed in more detail earlier. Using three examples from the authors' analysis of the silk moth choriun locus, they demonstrate how powerful carefully tailored short single-stranded probes can be in the analysis of closely related gene copies.

  11. Cloning and sequencing of a cDNA encoding a taste-modifying protein, miraculin.

    PubMed

    Masuda, Y; Nirasawa, S; Nakaya, K; Kurihara, Y

    1995-08-19

    A cDNA clone encoding a taste-modifying protein, miraculin (MIR), was isolated and sequenced. The encoded precursor to MIR was composed of 220 amino acid (aa) residues, including a possible signal sequence of 29 aa. Northern blot analysis showed that the mRNA encoding MIR was already expressed in fruits of Richadella dulcifica at 3 weeks after pollination and was present specifically in the pulp. PMID:7665074

  12. Nucleotide sequence of the vaccinia virus hemagglutinin gene.

    PubMed

    Shida, H

    1986-04-30

    Vaccinia virus hemagglutinin (HA) is expressed at late time of infection cycle, and it is nonessential for virus growth. Location of the HA structural gene was determined by hybrid-arrested and hybrid-selected translation methods at the right terminus of the HindIII A fragment. The position of the HA gene was confirmed by the production of the complete HA protein in the cells transfected with the plasmid containing that region. Examination of this nucleotide sequence revealed the positions of cleavage sites for a number of restriction endonucleases. The deduced amino acid sequence revealed that the HA protein is a member of typical surface membrane glycoproteins. Comparison of the nucleotide sequence upstream of the HA coding region with corresponding region of other late genes suggested the existence of the consensus decanucleotides TTCATTTa/tGT between 34 to 18 bp upstream to the initiation codon followed by a cluster of A or T, a unique feature of the late genes of vaccinia virus. These results in conjunction with the ease of isolating HA- mutants provide a basis for a new site suitable for inserting foreign genes.

  13. Cloning and sequencing of Indian water buffalo interleukin-18 cDNA.

    PubMed

    Chaudhury, P; Bera, B C

    2005-04-01

    Summary Full-length cDNA (582 bp) of the interleukin-18 (IL-18) gene of the Indian water buffalo (Bubalus bubalis) was amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) and sequenced. The deduced amino acid sequence has 99% and 95% similarity with the IL-18 sequences of cattle and sheep, respectively. There are two amino acid substitutions at positions 132 and 182 in buffalo IL-18 compared with that of cattle. Phylogenetic analysis showed that the IL-18 sequence of fish forms a different lineage and is most divergent from that of cattle, buffalo, sheep, pig, dog, horse, human, monkey, mouse, rat and chicken.

  14. Nucleotide sequence of the gene for the b subunit of human factor XIII

    SciTech Connect

    Bottenus, R.E.; Ichinose, A.; Davie, E.W. )

    1990-12-01

    Factor XIII (M{sub r} 320 000) is a blood coagulation factor that stabilizes and strengthens the fibrin clot. It circulates in blood as a tetramer composed of two a subunits (M{sub r} 75 000 each) and two b subunits (M{sub r} 80 000 each). The b subunit consists of 641 amino acids and includes 10 tandem repeats of 60 amino acids known as GP-I structures, short consensus repeats (SCR), or sushi domains. In the present study, the human gene for the b subunit has been isolated from three different genomic libraries prepared in {lambda} phage. Fifteen independent phage with inserts coding for the entire gene were isolated and characterized by restriction mapping, Southern blotting, and DNA sequencing. The gene was found to be 28 kilobases in length and consisted of 12 exons (I-XII) separated by 11 intervening sequences. The leader sequence was encoded by exon I, while the carbonyl-terminal region of the protein was encoded by exon XII. Exons II-XI each coded for a single sushi domain, suggesting that the gene evolved through exon shuffling and duplication. The 12 exons in the gene ranged in size from 64 to 222 base pairs, while the introns ranged in size from 87 to 9970 nucleotides and made up 92{percent} of the gene. One nucleotide change was found in the coding region of the gene when its sequence was compared to that of the cDNA. This difference, however, did not result in a change in the amino acid sequence of the protein.

  15. Sorbitol dehydrogenase. Full-length cDNA sequencing reveals a mRNA coding for a protein containing an additional 42 amino acids at the N-terminal end.

    PubMed

    Wen, Y; Bekhor, I

    1993-10-01

    A cDNA clone encoding rat sorbitol dehydrogenase (SDH) was isolated from a rat testis lambda ZAP II cDNA library. The full-length cDNA insert contained 2277 base pairs (bp), starting 182 bp upstream from an ATG codon where translation to the active enzyme SDH is presumed to be initiated. A second ATG codon, however, was found 126 bp upstream, aligned in the same reading frame as that of the active enzyme. Therefore, the coding sequence for SDH can be translated into an additional 42-amino-acid polypeptide linked to the N-terminal amino acid of the enzyme, generating a pre-sorbitol dehydrogenase. The sequence data indicate that the nucleotide environment around this ATG codon is more favorable towards it being the actual open reading frame (ORF) for a pre-SDH than the ATG codon preceding the nucleotide sequence for SDH. Since no known SDH starts with the additional 42 amino acids, it may be that post-translational removal of this polypeptide accompanies the release of the active enzyme. Next, the 3' untranslated region of the cDNA contained a non-coding 1021 bp downstream from the TAA stop codon. The latter sequence included three putative poly(A) signals: one at nucleotides 1362-1367, the second at nucleotides 1465-1470, and the third at nucleotides 2212-2217 [17 bp away from the poly(A) tail]. In addition to the above findings we also report a variance in one of the amino acids in the SDH cDNA sequence. This variance occurs at position 957-960, where threonine is coded for instead of aspartic acid; in the rat testis SDH cDNA, we find the sequence is ACG instead of GAC, as was reported for the rat liver SDH cDNA. Northern-blot hybridization analysis showed that SDH mRNA is a doublet, one band of 4 kb and the other of 2.3-2.4 kb, in both the rat liver and the rat lens, further confirming that the isolated SDH cDNA constituted a full-length cDNA.

  16. Sequence analysis of frog rho-crystallin by cDNA cloning and sequencing: a member of the aldo-keto reductase family.

    PubMed

    Lu, S F; Pan, F M; Chiou, S H

    1995-09-25

    rho-Crystallin is a major enzyme crystallin present in the lenses of amphibian species with a blocked amino terminus. In order to facilitate the determination of the primary sequence of this taxon-specific crystallin, cDNA mixture was synthesized from the poly(A)+mRNA of bullfrog eye lenses. cDNAs encoding rho-crystallin were then amplified by polymerase chain reaction (PCR) using a new protocol of Rapid Amplification of cDNA Ends (RACE). PCR-amplified product corresponding to rho-crystallin was obtained, which was then subcloned into pUC18 vector and then transformed into E. coli strain JM109. Plasmids purified from the positive clones were prepared for nucleotide sequencing by the automatic fluorescence-based dideoxynucleotide chain-termination method. Sequencing more than 15 clones containing DNA inserts coding for rho-crystallin constructed only one unique and complete full-length reading frame of 975 base pairs covering a deduced protein sequence of 324 amino acids including the universal initiating methionine. It shows 96, 59, 46 and 37 percent sequence similarity to another rho-crystallin from European common frog, bovine prostaglandin-F synthase, human aldose reductase and human aldehyde reductase, respectively, revealing the close relationship between rho-crystallins from related amphibian species and its possible evolutionary relatedness with various aldo-keto reductases. In this study a phylogenetic tree for rho-crystallin and related enzymes is constructed based on multiple-sequence alignment program using a combination of distance matrix and approximate parsimony methods. We have thus established the remote phylogenetic relationship between rho-crystallin and some aldehyde/aldose reductases, which may provide a possible link for the recruitment of this crystallin from detoxification-related enzymes and its physiological role in maintaining a transparent and clear lens.

  17. Molecular cloning and characterization of potato spindle tuber viroid cDNA sequences

    PubMed Central

    Owens, Robert A.; Cress, Dean E.

    1980-01-01

    Double-stranded cDNA has been synthesized from a polyadenylylated potato spindle tuber viroid (PSTV) template and inserted in the Pst I endonuclease site of plasmid pBR322 by using the oligo(dC)·oligo(dG)-tailing procedure. Tetracycline-resistant ampicillin-sensitive transformants contained sequences complementary to PSTV [32P]cDNA, and one recombinant clone (pDC-29) contains a 460-base-pair insert. This cloned double-stranded PSTV cDNA contains the cleavage sites for six restriction endonucleases predicted by the published primary sequence of PSTV as well as one additional site each for Ava I, Hae III, Hpa II, and Sma I. The additional Ava I, Hpa II, and Sma I sites are explained by the presence of a second C-C-C-G-G-G sequence in the cloned double-stranded cDNA. The largest fragment released by Hae III digestion contains approximately 360 base pairs. These results suggest that we have cloned almost the entire sequence of PSTV, but the sequence cloned differs slightly from that published. Hybridization probes derived from pDC-29 insert have allowed detection and preliminary characterization of RNA molecules having the same size as PSTV but the opposite polarity. This RNA is present during PSTV replication in infected tomato cells. Images PMID:16592877

  18. Nucleotide sequence of Bacillus phage Nf terminal protein gene.

    PubMed Central

    Leavitt, M C; Ito, J

    1987-01-01

    The nucleotide sequence of Bacillus phage Nf gene E has been determined. Gene E codes for phage terminal protein which is the primer necessary for the initiation of DNA replication. The deduced amino acid sequence of Nf terminal protein is approximately 66% homologous with the terminal proteins of Bacillus phages PZA and luminal diameter 29, and shows similar hydropathy and secondary structure predictions. A serine which has been identified as the residue which covalently links the protein to the 5' end of the genome in luminal diameter 29, is conserved in all three phages. The hydropathic and secondary structural environment of this serine is similar in these phage terminal proteins and also similar to the linking serine of adenovirus terminal protein. PMID:3601672

  19. Genome nucleotide composition shapes variation in simple sequence repeats.

    PubMed

    Tian, Xiangjun; Strassmann, Joan E; Queller, David C

    2011-02-01

    Simple sequence repeats (SSRs) or microsatellites are a common component of genomes but vary greatly across species in their abundance. We tested the hypothesis that this variation is due in part to AT/GC content of genomes, with genomes biased toward either high AT or high CG generating more short random repeats that are long enough to enhance expansion through slippage during replication. To test this hypothesis, we identified repeats with perfect tandem iterations of 1-6 bp from 25 protists with complete or near-complete genome sequences. As expected, the density and the frequency are highly related to genome AT content, with excellent fits to quadratic regressions with minima near a 50% AT content and rising toward both extremes. Within species, the same trends hold, except the limited variation in AT content within each species places each mainly on the descending (GC rich), middle, or ascending (AT rich) part of the curve. The base usages of repeat motifs are also significantly correlated with genome nucleotide compositions: Percentages of AT-rich motifs rise with the increase of genome AT content but vice versa for GC-rich subgroups. Amino acid homopolymer repeats also show the expected quadratic relationship, with higher abundance in species with AT content biased in either direction. Our results show that genome nucleotide composition explains up to half of the variance in the abundance and motif constitution of SSRs.

  20. cDNA sequence of a human skeletal muscle ADP/ATP translocator: lack of a leader peptide, divergence from a fibroblast translocator cDNA, and coevolution with mitochondrial DNA genes

    SciTech Connect

    Neckelmann, N.; Li, K.; Wade, R.P.; Shuster, R.; Wallace, D.C.

    1987-11-01

    The authors have characterized a 1400-nucleotide cDNA for the human skeletal muscle ADP/ATP translocator. The deduced amino acid sequence is 94% homologous to the beef heart ADP/ATP translocator protein and contains only a single additional amino-terminal methionine. This implies that the human translocator lacks an amino-terminal targeting peptide, a conclusion substantiated by measuring the molecular weight of the protein synthesized in vitro. A 1400-nucleotide transcript encoding the skeletal muscle translocator was detected on blots of total RNA from human heart, kidney, skeletal muscle, and HeLa cells by hybridization with oligonucleotide probes homologous to the coding region and 3' noncoding region of the cDNA. However, the level of this mRNA varied substantially among tissues. Comparison of our skeletal muscle translocator sequence with that of a recently published human fibroblast translocator cognate revealed that the two proteins are 88% identical and diverged about 275 million years ago. Hence, tissues vary both in the level of expression of individual translocator genes and in differential expression of cognate translocator genes. Comparison of the base substitution rates of the ADP/ATP translocator and the oxidative phosphorylation genes encoded by mitochondrial DNA revealed that the mitochondrial DNA genes fix 10 times more synonymous substitutions and 12 times more replacement substitutions; yet, these nuclear and cytoplasmic respiration genes experience comparable evolutionary constraints. This suggest that the mitochondrial DNA genes are highly prone to deleterious mutations.

  1. Genome-wide analysis of single-nucleotide polymorphisms in human expressed sequences.

    PubMed

    Irizarry, K; Kustanovich, V; Li, C; Brown, N; Nelson, S; Wong, W; Lee, C J

    2000-10-01

    Single-nucleotide polymorphisms (SNPs) have been explored as a high-resolution marker set for accelerating the mapping of disease genes. Here we report 48,196 candidate SNPs detected by statistical analysis of human expressed sequence tags (ESTs), associated primarily with coding regions of genes. We used Bayesian inference to weigh evidence for true polymorphism versus sequencing error, misalignment or ambiguity, misclustering or chimaeric EST sequences, assessing data such as raw chromatogram height, sharpness, overlap and spacing, sequencing error rates, context-sensitivity and cDNA library origin. Three separate validations-comparison with 54 genes screened for SNPs independently, verification of HLA-A polymorphisms and restriction fragment length polymorphism (RFLP) testing-verified 70%, 89% and 71% of our predicted SNPs, respectively. Our method detects tenfold more true HLA-A SNPs than previous analyses of the EST data. We found SNPs in a large fraction of known disease genes, including some disease-causing mutations (for example, the HbS sickle-cell mutation). Our comprehensive analysis of human coding region polymorphism provides a public resource for mapping of disease genes (available at http://www.bioinformatics.ucla.edu/snp).

  2. Sequencing and comparative genomic analysis of 1227 Felis catus cDNA sequences enriched for developmental, clinical and nutritional phenotypes

    PubMed Central

    2012-01-01

    Background The feline genome is valuable to the veterinary and model organism genomics communities because the cat is an obligate carnivore and a model for endangered felids. The initial public release of the Felis catus genome assembly provided a framework for investigating the genomic basis of feline biology. However, the entire set of protein coding genes has not been elucidated. Results We identified and characterized 1227 protein coding feline sequences, of which 913 map to public sequences and 314 are novel. These sequences have been deposited into NCBI's genbank database and complement public genomic resources by providing additional protein coding sequences that fill in some of the gaps in the feline genome assembly. Through functional and comparative genomic analyses, we gained an understanding of the role of these sequences in feline development, nutrition and health. Specifically, we identified 104 orthologs of human genes associated with Mendelian disorders. We detected negative selection within sequences with gene ontology annotations associated with intracellular trafficking, cytoskeleton and muscle functions. We detected relatively less negative selection on protein sequences encoding extracellular networks, apoptotic pathways and mitochondrial gene ontology annotations. Additionally, we characterized feline cDNA sequences that have mouse orthologs associated with clinical, nutritional and developmental phenotypes. Together, this analysis provides an overview of the value of our cDNA sequences and enhances our understanding of how the feline genome is similar to, and different from other mammalian genomes. Conclusions The cDNA sequences reported here expand existing feline genomic resources by providing high-quality sequences annotated with comparative genomic information providing functional, clinical, nutritional and orthologous gene information. PMID:22257742

  3. cDNA Library Enrichment of Full Length Transcripts for SMRT Long Read Sequencing

    PubMed Central

    Hartwig, Benjamin; Reinhardt, Richard; Schneeberger, Korbinian

    2016-01-01

    The utility of genome assemblies does not only rely on the quality of the assembled genome sequence, but also on the quality of the gene annotations. The Pacific Biosciences Iso-Seq technology is a powerful support for accurate eukaryotic gene model annotation as it allows for direct readout of full-length cDNA sequences without the need for noisy short read-based transcript assembly. We propose the implementation of the TeloPrime Full Length cDNA Amplification kit to the Pacific Biosciences Iso-Seq technology in order to enrich for genuine full-length transcripts in the cDNA libraries. We provide evidence that TeloPrime outperforms the commonly used SMARTer PCR cDNA Synthesis Kit in identifying transcription start and end sites in Arabidopsis thaliana. Furthermore, we show that TeloPrime-based Pacific Biosciences Iso-Seq can be successfully applied to the polyploid genome of bread wheat (Triticum aestivum) not only to efficiently annotate gene models, but also to identify novel transcription sites, gene homeologs, splicing isoforms and previously unidentified gene loci. PMID:27327613

  4. cDNA Library Enrichment of Full Length Transcripts for SMRT Long Read Sequencing.

    PubMed

    Cartolano, Maria; Huettel, Bruno; Hartwig, Benjamin; Reinhardt, Richard; Schneeberger, Korbinian

    2016-01-01

    The utility of genome assemblies does not only rely on the quality of the assembled genome sequence, but also on the quality of the gene annotations. The Pacific Biosciences Iso-Seq technology is a powerful support for accurate eukaryotic gene model annotation as it allows for direct readout of full-length cDNA sequences without the need for noisy short read-based transcript assembly. We propose the implementation of the TeloPrime Full Length cDNA Amplification kit to the Pacific Biosciences Iso-Seq technology in order to enrich for genuine full-length transcripts in the cDNA libraries. We provide evidence that TeloPrime outperforms the commonly used SMARTer PCR cDNA Synthesis Kit in identifying transcription start and end sites in Arabidopsis thaliana. Furthermore, we show that TeloPrime-based Pacific Biosciences Iso-Seq can be successfully applied to the polyploid genome of bread wheat (Triticum aestivum) not only to efficiently annotate gene models, but also to identify novel transcription sites, gene homeologs, splicing isoforms and previously unidentified gene loci. PMID:27327613

  5. Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

    DOEpatents

    McCready, Paula M.; Radnedge, Lyndsay; Andersen, Gary L.; Ott, Linda L.; Slezak, Thomas R.; Kuczmarski, Thomas A.; Motin, Vladinir L.

    2009-02-24

    Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  6. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    SciTech Connect

    McCready, Paula M.; Radnedge, Lyndsay; Andersen, Gary L.; Ott, Linda L.; Slezak, Thomas R.; Kuczmarski, Thomas A.

    2009-02-24

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  7. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

    DOEpatents

    McCready, Paula M.; Radnedge, Lyndsay; Andersen, Gary L.; Ott, Linda L.; Slezak, Thomas R.; Kuczmarski, Thomas A.; Vitalis, Elizabeth A

    2007-02-06

    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  8. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

    DOEpatents

    McCready, Paula M.; Radnedge, Lyndsay; Andersen, Gary L.; Ott, Linda L.; Slezak, Thomas R.; Kuczmarski, Thomas A.; Vitalis, Elizabeth A

    2009-02-24

    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  9. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    PubMed

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source. PMID:18686036

  10. Complete cDNA and derived amino acid sequence of human factor V.

    PubMed Central

    Jenny, R J; Pittman, D D; Toole, J J; Kriz, R W; Aldape, R A; Hewick, R M; Kaufman, R J; Mann, K G

    1987-01-01

    cDNA clones encoding human factor V have been isolated from an oligo(dT)-primed human fetal liver cDNA library prepared with vector Charon 21A. The cDNA sequence of factor V from three overlapping clones includes a 6672-base-pair (bp) coding region, a 90-bp 5' untranslated region, and a 163-bp 3' untranslated region within which is a poly(A) tail. The deduced amino acid sequence consists of 2224 amino acids inclusive of a 28-amino acid leader peptide. Direct comparison with human factor VIII reveals considerable homology between proteins in amino acid sequence and domain structure: a triplicated A domain and duplicated C domain show approximately equal to 40% identity with the corresponding domains in factor VIII. As in factor VIII, the A domains of factor V share approximately 40% amino acid-sequence homology with the three highly conserved domains in ceruloplasmin. The B domain of factor V contains 35 tandem and approximately 9 additional semiconserved repeats of nine amino acids of the form Asp-Leu-Ser-Gln-Thr-Thr/Asn-Leu-Ser-Pro and 2 additional semiconserved repeats of 17 amino acids. Factor V contains 37 potential N-linked glycosylation sites, 25 of which are in the B domain, and a total of 19 cysteine residues. Images PMID:3110773

  11. Complete cDNA and derived amino acid sequence of human factor V

    SciTech Connect

    Jenny, R.J.; Pittman, D.D.; Toole, J.J.; Kriz, R.W.; Aldape, R.A.; Hewick, R.M.; Kaufman, R.J.; Mann, K.G.

    1987-07-01

    cDNA clones encoding human factor V have been isolated from an oligo(dT)-primed human fetal liver cDNA library prepared with vector Charon 21A. The cDNA sequence of factor V from three overlapping clones includes a 6672-base-pair (bp) coding region, a 90-bp 5' untranslated region, and a 163-bp 3' untranslated region within which is a poly(A)tail. The deduced amino acid sequence consists of 2224 amino acids inclusive of a 28-amino acid leader peptide. Direct comparison with human factor VIII reveals considerable homology between proteins in amino acid sequence and domain structure: a triplicated A domain and duplicated C domain show approx. 40% identity with the corresponding domains in factor VIII. As in factor VIII, the A domains of factor V share approx. 40% amino acid-sequence homology with the three highly conserved domains in ceruloplasmin. The B domain of factor V contains 35 tandem and approx. 9 additional semiconserved repeats of nine amino acids of the form Asp-Leu-Ser-Gln-Thr-Thr/Asn-Leu-Ser-Pro and 2 additional semiconserved repeats of 17 amino acids. Factor V contains 37 potential N-linked glycosylation sites, 25 of which are in the B domain, and a total of 19 cysteine residues.

  12. Generalized Levy-walk model for DNA nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Simons, M.; Stanley, H. E.

    1993-01-01

    We propose a generalized Levy walk to model fractal landscapes observed in noncoding DNA sequences. We find that this model provides a very close approximation to the empirical data and explains a number of statistical properties of genomic DNA sequences such as the distribution of strand-biased regions (those with an excess of one type of nucleotide) as well as local changes in the slope of the correlation exponent alpha. The generalized Levy-walk model simultaneously accounts for the long-range correlations in noncoding DNA sequences and for the apparently paradoxical finding of long subregions of biased random walks (length lj) within these correlated sequences. In the generalized Levy-walk model, the lj are chosen from a power-law distribution P(lj) varies as lj(-mu). The correlation exponent alpha is related to mu through alpha = 2-mu/2 if 2 < mu < 3. The model is consistent with the finding of "repetitive elements" of variable length interspersed within noncoding DNA.

  13. Sequence analysis of frog alpha B-crystallin cDNA: sequence homology and evolutionary comparison of alpha A, alpha B and heat shock proteins.

    PubMed

    Lu, S F; Pan, F M; Chiou, S H

    1995-11-22

    alpha-Crystallin is a major lens protein present in the lenses of all vertebrate species. Recent studies have revealed that bovine alpha-crystallins possess genuine chaperone activity similar to small heat-shock proteins. In order to facilitate the determination of the primary sequence of amphibian alpha B-crystallin, cDNA encoding alpha B subunit chain was amplified using a new "Rapid Amplification of cDNA Ends" (RACE) protocol of Polymerase Chain Reaction (PCR). PCR-amplified product corresponding to alpha B subunit was then subcloned into pUC18 vector and transformed into E. coli strain JM109. Plasmids purified from the positive clones were prepared for nucleotide sequencing by the automatic fluorescence-based dideoxynucleotide chain-termination method. Sequencing more than five clones containing DNA inserts coding for alpha B-crystallin subunit constructed only one complete full-length reading frame of 522 base pairs similar to that of alpha A subunit, covering a deduced protein sequence of 173 amino acids including the universal translation-initiating methionine. The frog alpha B crystallin shows 69, 66 and 56% whereas alpha A crystallin shows 83, 81 and 69% sequence similarity to the homologous chains of bovine, chicken and dogfish, respectively, revealing a more divergent structural relationship among these alpha B subunits as compared to alpha A subunits. Structural analysis and comparison of alpha A- and alpha B-crystallin subunits from eye lenses of different classes of vertebrates also shed some light on the evolutionary relatedness between alpha B/alpha A crystallins and the small heat-shock proteins.

  14. Molecular cloning and sequencing of a cDNA encoding partial putative molt-inhibiting hormone from Penaeus chinensis

    NASA Astrophysics Data System (ADS)

    Wang, Zai-Zhao; Xiang, Jian-Hai

    2002-09-01

    Total RNA was extracted from eyestalks of shrimp Penaeus chinensis. Eyestalk cDNA was obtained from total RNA by reverse transcription. Reverse transcriptase-polymerase chain reaction (RT-PCR) was initiated using eyestalk cDNA and degenerate primers designed from the amino acid sequence of molt-inhibiting hormone from shrimp Penaeus japonicus. A specific cDNA was obtained and cloned into a T vector for sequencing. The cDNA consisted of 201 base pairs and encoding for a peptide of 67 amino acid residues. The peptide of P. chinensis had the highest identity with molt-inhibiting hormones of P. japonicus. The cDNA could be a partial gene of molt-inhibiting hormones from P. chinensis. This paper reports for the first time cDNA encoding for neuropeptide of P. chinensis.

  15. cDNA sequence, genomic organization, and evolutionary conservation of a novel gene from the WAGR region

    SciTech Connect

    Schwartz, F.; Eisenman, R.; Knoll, J.; Bruns, G.

    1995-09-20

    A new gene (239FB) with predominant and differential expression in fetal brain has recently been isolated from a chromosome 11p13-p14 boundary area near FSHB. The corresponding mRNA has an open reading frame of 294 amino acids, a 3` untranslated region of 1247 nucleotides, and a highly GC-rich 5` untranslated region. The coding and 3` UT sequence is specified by 6 exons within nearly 87 kb of isolated genomic locus. The 5` end region of the transcript maps adjacent to the only genomically defined CpG island in a chromosomal subregion that may be associated with part of the mental retardation of some WAGR (Wilms tumor, aniridia, genitourinary anomalies, and mental retardation) syndrome patients. In addition to nucleotide and amino acid similarity to an EST from a normalized infant brain cDNA library, the predicted protein has extensive similarity to Caenorhbditis elegans polypeptides of, as yet, unknown function. The 239FB locus is, therefore, likely part of a family of genes with two members expressed in human brain. The extensive conservation of the predicted protein suggests a fundamental function of the gene product and will enable evaluation of the role of the 239FB gene in neurogenesis in model organisms. 48 refs., 4 figs., 1 tab.

  16. Expressed sequence tags from a NaCl-treated Suaeda salsa cDNA library.

    PubMed

    Zhang, L; Ma, X L; Zhang, Q; Ma, C L; Wang, P P; Sun, Y F; Zhao, Y X; Zhang, H

    2001-04-18

    Past efforts to improve plant tolerance to osmotic stress have had limited success owing to the genetic complexity of stress responses. The first step towards cataloging and categorizing genetically complex abotic stress responses is the rapid discovery of genes by the large-scale partial sequencing of randomly selected cDNA clones or expressed sequence tags (ESTs). Suaeda salsa, which can survive seawater-level salinity, is a favorite halophytic model for salt tolerant research. We constructed a NaCl-treated cDNA library of Suaeda salsa and sequenced 1048 randomly selected clones, out of which 1016 clones produced readable sequences (773 showed homology to previously identified genes, 227 matched unknown protein coding regions, 16 anomalous sequences or sequences of bacterial origin were excluded from further analysis). By sequence analysis we identified 492 unique clones: 315 showed homology to previously identified genes, 177 matched unknown protein coding regions (101 of which have been found before in other organisms and 76 are completely novel). All our EST data are available on the Internet. We believe that our dbEST and the associated DNA materials will be a useful source to scientists engaging in stress-tolerance study. PMID:11313146

  17. Crustacean hyperglycemic hormones of two cold water crab species, Chionoecetes opilio and C. japonicus: isolation of cDNA sequences and localization of CHH neuropeptide in eyestalk ganglia.

    PubMed

    Chung, J Sook; Ahn, I S; Yu, O H; Kim, D S

    2015-04-01

    Crustacean hyperglycemic hormone (CHH) is primarily known for its prototypical function in hyperglycemia which is induced by the release of CHH. The CHH release takes place as an adaptive response to the energy demands of the animals experiencing stressful environmental, physiological or behavioral conditions. Although >63 decapod CHH nucleotide sequences are known (GenBank), the majority of them is garnered from the species inhabiting shallow and warm water. In order to understand the adaptive role of CHH in Chionoecetes opilio and Chionoecetes japonicus inhabiting deep water environments, we first aimed for the isolation of the full-length cDNA sequence of CHH from the eyestalk ganglia of C. opilio (ChoCHH) and C. japonicus (ChjCHH) using degenerate PCR and 5' and 3' RACE. Cho- and ChjCHH cDNA sequences are identical in 5' UTR and ORF with 100% sequence identity of the putative 138aa of preproCHHs. The length of 3' UTR ChjCHH cDNA sequence is 39 nucleotides shorter than that of ChoCHH. This is the first report in decapod crustaceans that two different species have the identical sequence of CHH. ChoCHH expression increases during embryogenesis of C. opilio and is significantly higher in adult males and females. C. japonicus males have slightly higher ChjCHH expression than C. opilio males, but no statistical difference. In both species, the immunostaining intensity of CHH is stronger in the sinus gland than that of X-organ cells. Future studies will enable us to gain better understanding of the comparative metabolic physiology and endocrinology of cold, deep water species of Chionoecetes spp.

  18. Interspecies diversity of the occludin sequence: cDNA cloning of human, mouse, dog, and rat-kangaroo homologues.

    PubMed

    Ando-Akatsuka, Y; Saitou, M; Hirase, T; Kishi, M; Sakakibara, A; Itoh, M; Yonemura, S; Furuse, M; Tsukita, S

    1996-04-01

    Occludin has been identified from chick liver as a novel integral membrane protein localizing at tight junctions (Furuse, M., T. Hirase, M. Itoh, A. Nagafuchi, S. Yonemura, Sa. Tsukita, and Sh. Tsukita. 1993. J. Cell Biol. 123:1777-1788). To analyze and modulate the functions of tight junctions, it would be advantageous to know the mammalian homologues of occludin and their genes. Here we describe the nucleotide sequences of full length cDNAs encoding occludin of rat-kangaroo (potoroo), human, mouse, and dog. Rat-kangaroo occludin cDNA was prepared from RNA isolated from PtK2 cell culture, using a mAb against chicken occludin, whereas the others were amplified by polymerase chain reaction based on the sequence found around the human neuronal apoptosis inhibitory protein gene. The amino acid sequences of the three mammalian (human, murine, and canine) occludins were very closely related to each other (approximately 90% identity), whereas they diverged considerably from those of chicken and rat-kangaroo (approximately 50% identity). Implications of these data and novel experimental options in cell biological research are discussed.

  19. Brief report: genome sequence and construction of an infectious cDNA clone of Ribgrass mosaic virus from Chinese cabbage in Korea.

    PubMed

    Ryu, So-Young; Hong, Jin-Sung; Rhee, Sun-Ju; Lee, Gung Pyo

    2012-04-01

    Ribgrass mosaic virus (RMV) has severely decreased the production and lowered quality of Chinese cabbage co-infected with Turnip mosaic virus (63.4%) in Korea. The complete genome sequence of RMV isolated from Brassica rapa ssp. pekinensis was determined. The full genome consisted of 6,304 nucleotides and showed sequence identities of 91.5-94.2% with the corresponding genome of other RMV strains. Full-length cDNA of RMV-Br was amplified by RT-PCR with a 5'-end primer harboring a T7 promoter sequence and a 3'-end RMV specific primer. Subsequently, the full-length cDNA was cloned into plasmid vectors. Capped transcripts synthesized from the cDNA clone were highly infectious and caused characteristic symptoms in B. rapa ssp. pekinensis and several indicator plants, similar to wild type RMV. Since there has not been found RMV resistant Chinese cabbage yet and the virus has been prevalent already throughout the natural fields of Korea, the identification of full sequence and development of infectious clone would help developing breeding program for RMV resistant crops.

  20. Brief report: genome sequence and construction of an infectious cDNA clone of Ribgrass mosaic virus from Chinese cabbage in Korea.

    PubMed

    Ryu, So-Young; Hong, Jin-Sung; Rhee, Sun-Ju; Lee, Gung Pyo

    2012-04-01

    Ribgrass mosaic virus (RMV) has severely decreased the production and lowered quality of Chinese cabbage co-infected with Turnip mosaic virus (63.4%) in Korea. The complete genome sequence of RMV isolated from Brassica rapa ssp. pekinensis was determined. The full genome consisted of 6,304 nucleotides and showed sequence identities of 91.5-94.2% with the corresponding genome of other RMV strains. Full-length cDNA of RMV-Br was amplified by RT-PCR with a 5'-end primer harboring a T7 promoter sequence and a 3'-end RMV specific primer. Subsequently, the full-length cDNA was cloned into plasmid vectors. Capped transcripts synthesized from the cDNA clone were highly infectious and caused characteristic symptoms in B. rapa ssp. pekinensis and several indicator plants, similar to wild type RMV. Since there has not been found RMV resistant Chinese cabbage yet and the virus has been prevalent already throughout the natural fields of Korea, the identification of full sequence and development of infectious clone would help developing breeding program for RMV resistant crops. PMID:22143325

  1. Empirical Bayes Estimation of Coalescence Times from Nucleotide Sequence Data.

    PubMed

    King, Leandra; Wakeley, John

    2016-09-01

    We demonstrate the advantages of using information at many unlinked loci to better calibrate estimates of the time to the most recent common ancestor (TMRCA) at a given locus. To this end, we apply a simple empirical Bayes method to estimate the TMRCA. This method is both asymptotically optimal, in the sense that the estimator converges to the true value when the number of unlinked loci for which we have information is large, and has the advantage of not making any assumptions about demographic history. The algorithm works as follows: we first split the sample at each locus into inferred left and right clades to obtain many estimates of the TMRCA, which we can average to obtain an initial estimate of the TMRCA. We then use nucleotide sequence data from other unlinked loci to form an empirical distribution that we can use to improve this initial estimate. PMID:27440864

  2. Cloning, nucleotide sequence, and expression of Achromobacter protease I gene.

    PubMed

    Ohara, T; Makino, K; Shinagawa, H; Nakata, A; Norioka, S; Sakiyama, F

    1989-12-01

    Achromobacter protease I (API) is a lysine-specific serine protease which hydrolyzes specifically the lysyl peptide bond. A gene coding for API was cloned from Achromobacter lyticus M497-1. Nucleotide sequence of the cloned DNA fragment revealed that the gene coded for a single polypeptide chain of 653 amino acids. The N-terminal 205 amino acids, including signal peptide and the threonine/serine-rich C-terminal 180 amino acids are flanking the 268 amino acid-mature protein which was identified by protein sequencing. Escherichia coli carrying a plasmid containing the cloned API gene overproduced and secreted a protein of Mr 50,000 (API') into the periplasm. This protein exhibited a distinct endopeptidase activity specific for lysyl bonds as well. The N-terminal amino acid sequence of API' was the same as mature API, suggesting that the enzyme retained the C-terminal extended peptide chain. The present experiments indicate that API, an extracellular protease produced by gram-negative bacteria, is synthesized in vivo as a precursor protein bearing long extended peptide chains at both N and C termini. PMID:2684982

  3. Complete nucleotide sequence of Nootka lupine vein-clearing virus.

    PubMed

    Robertson, Nancy L; Côté, Fabien; Paré, Christine; Leblanc, Eric; Bergeron, Michel G; Leclerc, Denis

    2007-12-01

    The complete genome sequence of Nootka lupine vein-clearing virus (NLVCV) was determined to be 4,172 nucleotides in length containing four open reading frames (ORFs) with a similar genetic organization of virus species in the genus Carmovirus, family Tombusviridae. The order and gene product size, starting from the 5'-proximal ORF consisted of: (1) polymerase/replicase gene, ORF1 (p27) and ORF1RT (readthrough) (p87), (2) movement proteins ORF2 (p7) and ORF3 (p9), and, (3) the 3'-proximal coat protein ORF4, (p37). The genomic 5'- and 3'-proximal termini contained a short (59 nt) and a relatively longer 405 nt untranslated region, respectively. The longer replicase gene product contained the GDD motif common to RNA-dependent RNA polymerases. Phylogenetically, NLVCV formed a subgroup with the following four carmoviruses when separately comparing the amino acids of the coat protein or replicase protein: Angelonia flower break virus (AnFBV), Carnation mottle virus (CarMV), Pelargonium flower break virus (PFBV), and Saguaro cactus virus (SgCV). Whole genome nucleotide analysis (percent identities) among the carmoviruses with NLVCV suggested a similar pattern. The species demarcation criteria in the genus Carmovirus for the amino acid sequence identity of the polymerase (<52%) and coat (<41%) protein genes restricted NLVCV as a distinct species, and instead, placed it as a tentative strain of CarMV, PFBV, or SgCV when both the polymerase and CP were used as the determining factors. In contrast, the species criteria that included different host ranges with no overlap and lack of serology relatedness between NLVCV and the carmoviruses, suggested that NLVCV was a distinct species. The relatively low cutoff percentages allowed for the polymerase and CP genes to dictate the inclusion/exclusion of a distinct carmovirus species should be reevaluated. Therefore, at this time we have concluded that NLVCV should be classified as a tentative new species in the genus Carmovirus

  4. Mouse muscle nicotinic acetylcholine receptor gamma subunit: cDNA sequence and gene expression.

    PubMed Central

    Yu, L; LaPolla, R J; Davidson, N

    1986-01-01

    Clones coding for the mouse nicotinic acetylcholine receptor (AChR) gamma subunit precursor have been selected from a cDNA library derived from a mouse myogenic cell line and sequenced. The deduced protein sequence consists of a signal peptide of 22 amino acid residues and a mature gamma subunit of 497 amino acid residues. There is a high degree of sequence conservation between this mouse sequence and published human and calf AChR gamma subunits and, after allowing for functional amino acid substitutions, also to the more distantly related chicken and Torpedo AChR gamma subunits. The degree of sequence conservation is especially high in the four putative hydrophobic membrane spanning regions, supporting the assignment of these domains. RNA blot hybridization showed that the mRNA level of the gamma subunit increases by 30 fold or more upon differentiation of the two mouse myogenic cell lines, BC3H-1 and C2C12, suggesting that the primary controls for changes in gene expression during differentiation are at the level of transcription. One cDNA clone was found to correspond to a partially processed nuclear transcript containing two as yet unspliced intervening sequences. Images PMID:3010242

  5. cDNA sequences of two inducible T-cell genes

    SciTech Connect

    Kwon, B.S. Guthrie Research Institute, Sayre, PA ); Weissman, S.M. )

    1989-03-01

    The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.

  6. Molecular cloning and sequencing of the cDNA of cop1 gene from Pisum sativum.

    PubMed

    Zhao, L; Wang, C; Zhu, Y; Zhao, J; Wu, X

    1998-02-11

    Cop1 protein plays an important role in seedling development of higher plants. The cDNA of cop1 gene from pea (Pisum sativum) was cloned and sequenced. Cop1 protein of pea is predicted to have 672 amino acids and a molecular mass of 76 kDa. Sequence comparison between Cop1 proteins of pea and Arabidopsis thaliana revealed that the two Cop1 proteins were highly homologous in the regions with functional domains and at the C-terminus. Immunoblotting performed with polyclonal antibodies against recombinant Cop1 of pea showed that Cop1 protein was present in seedlings germinated both in light and darkness.

  7. Molecular cloning and sequence determination of cDNAs for alpha subunits of the guanine nucleotide-binding proteins Gs, Gi, and Go from rat brain.

    PubMed Central

    Itoh, H; Kozasa, T; Nagata, S; Nakamura, S; Katada, T; Ui, M; Iwai, S; Ohtsuka, E; Kawasaki, H; Suzuki, K

    1986-01-01

    We have cloned cDNAs encoding alpha subunits of the guanine nucleotide-binding proteins Gs, Gi, and Go and determined their nucleotide sequences. Purified preparations of Gi and Go alpha subunits (Gi alpha and Go alpha) from rat brain were completely digested with trypsin, and peptides were subjected to amino acid sequence analysis. By screening of a cDNA library from rat C6 glioma cells with a synthetic probe corresponding to a 17 amino acid sequence, a clone encoding the sequence of Go alpha was obtained. Then, the library was rescreened with a Go alpha cDNA probe to isolate several strongly or weakly hybridizing clones. cDNAs encoding the complete sequences of Gi alpha and Gs alpha were thus obtained. From nucleotide sequence analysis, the amino acid sequences of Gs alpha and Gi alpha were deduced; they contain 394 and 355 amino acid residues (including the initiator methionine), respectively. The calculated molecular weights for Gs alpha and Gi alpha were 45,663 and 40,499, respectively. The Go alpha clone encoded a sequence of 310 amino acid residues that lacked the NH2 terminus. The homology of the alpha subunits of Gs, Gi, Go, transducin, and ras-encoded protein is discussed. PMID:3086867

  8. Identification and Sequencing of Candida krusei Aconitate Hydratase Gene Using Rapid Amplification of cDNA Ends Method and Phylogenetic Analysis

    PubMed Central

    Fateh, Roohollah; Zaini, Farideh; Kordbacheh, Parivash; Falahati, Mehraban; Rezaie, Sasan; Daie Ghazvini, Roshanak; Borhani, Nahid; Safara, Mahin; Fattahi, Azam; Kanani, Ali; Farahyar, Shirin; Bolhassani, Manzar; Heidari, Mansour

    2015-01-01

    Background: The production and development of an effective fungicidal drug requires the identification of an essential fungal protein as a drug target. Aconitase (ACO) is a mitochondrial protein that plays a vital role in tricarboxylic acid (TCA) cycle and thus production of energy within the cell. Objectives: The current study aimed to sequence Candida krusei ACO gene and determine any amino acid residue differences between human and fungal aconitases to obtain selective inhibition. Materials and Methods: Candida krusei (ATCC: 6258) aconitase gene was determined by 5’Rapid Amplification of cDNA Ends (RACE) method and degenerate Polymerase Chain Reaction (PCR) and analyzed using bioinformatics softwares. Results: One thousand-four hundred-nineteen nucleotide of C. krusei aconitase gene were clarified and submitted in Genbank as a partial sequence and then taxonomic location of C. krusei was determined by nucleotide and amino acid sequences of this gene. The comparison of nucleotide and amino acid sequences of Candida species ACO genes showed that C. krusei possessed characteristic sequences. No significant differences were observed between C. krusei and human aconitases within the active site amino acid residues. Conclusions: Results of the current study indicated that aconitase was not a suitable target to design new anti-fungal drugs that selectively block this enzyme. PMID:26855741

  9. DNA sequencing using differential extension with nucleotide subsets (DENS).

    PubMed Central

    Raja, M C; Zevin-Sonkin, D; Shwartzburd, J; Rozovskaya, T A; Sobolev, I A; Chertkov, O; Ramanathan, V; Lvovsky, L; Ulanovsky, L E

    1997-01-01

    Here we describe template directed enzymatic synthesis of unique primers, avoiding the chemical synthesis step in primer walking. We have termed this conceptually new technique DENS (differential extension with nucleotide subsets). DENS works by selectively extending a short primer, making it a long one at the intended site only. The procedure starts with a limited initial extension of the primer (at 20-30 degrees C) in the presence of only two out of the four possible dNTPs. The primer is extended by 6-9 bases or longer at the intended priming site, which is deliberately selected, (as is the two-dNTP set), to maximize the extension length. The subsequent termination reaction at 60-65 degrees C then accepts the extended primer at the intended site, but not at alternative sites, where the initial extension (if any) is generally much shorter. DENS allows the use of primers as long as 8mers (degenerate in two positions) which prime much more strongly than modular primers involving 5-7mers and which (unlike the latter) can be used with thermostable polymerases, thus allowing cycle-sequencing with dye-terminators compatible with Taq DNA polymerase, as well as making double-stranded DNA sequencing more robust. PMID:9016632

  10. Nucleotide sequence determines the accelerated rate of point mutations.

    PubMed

    Kini, R Manjunatha; Chinnasamy, Arunkumar

    2010-09-01

    Although the theory of evolution was put forth about 150 years ago our understanding of how molecules drive evolution remains poor. It is well-established that proteins evolve at different rates, essentially based on their functional role and three-dimensional structure. However, the highly variable rates of evolution of different proteins - especially the rapidly evolving ones - within a single organism are poorly understood. Using examples of genes for fast-evolving toxins and human hereditary diseases, we show for the first time that specific nucleotide sequences appear to determine point mutation rates. Based on mutation rates, we have classified triplets (not just codons) into stable, unstable and intermediate groups. Toxin genes contain a relatively higher percentage of unstable triplets in their exons compared to introns, whereas non-toxin genes contain a higher percentage of unstable triplets in their introns. Thus the distribution of stable and unstable triplets is correlated with and may explain the accelerated evolution of point mutations in toxins. Similarly, at the genomic level, lower organisms with genes that evolve faster contain a higher percentage of unstable triplets compared to higher organisms. These findings show that mutation rates of proteins, and hence of the organisms, are DNA sequence-dependent and thus provide a proximate mechanism of evolution at the molecular level. PMID:20362603

  11. Single nucleotide polymorphisms associated with rat expressed sequences.

    PubMed

    Guryev, Victor; Berezikov, Eugene; Malik, Rainer; Plasterk, Ronald H A; Cuppen, Edwin

    2004-07-01

    Single nucleotide polymorphisms (SNPs) are the most common source of genetic variation in populations and are thus most likely to account for the majority of phenotypic and behavioral differences between individuals or strains. Although the rat is extensively studied for the latter, data on naturally occurring polymorphisms are mostly lacking. We have used publicly available sequences consisting of whole-genome shotgun (WGS), expressed sequence tag (EST), and mRNA data as a source for the in silico identification of SNPs in gene-coding regions and have identified a large collection of 33,305 high-quality candidate SNPs. Experimental verification of 471 candidate SNPs using a limited set of rat isolates revealed a confirmation rate of approximately 50%. Although the majority of SNPs were identified between Sprague-Dawley (EST data) and Brown Norway (WGS data) strains, we found that 66% of the verified variations are common among different rat strains. All SNPs were extensively annotated, including chromosomal and genetic map information, and nonsynonymous SNPs were analyzed by SIFT and PolyPhen prediction programs for their potential deleterious effect on protein function. Interestingly, we retrieved three SNPs from the database that result in the introduction of a premature stop codon and that could be confirmed experimentally. Two of these "in silico-identified knockouts" reside in interesting QTL regions. Data are publicly available via a Web interface (http://cascad.niob.knaw.nl), allowing simple and advanced search queries.

  12. Buffalo (Bubalus bubalis) interleukin-2: sequence analysis reveals high nucleotide and amino acid identity with interleukin-2 of cattle and other ruminants.

    PubMed

    Sreekumar, E; Premraj, A; Saravanakumar, M; Rasool, T J

    2002-08-01

    A 4400-bp genomic sequence and a 332-bp truncated cDNA sequence of the interleukin-2 (IL-2) gene of Indian water buffalo (Bubalus bubalis) were amplified by polymerase chain reaction and cloned. The coding sequence of the buffalo IL-2 gene was assembled from the 5' end of the genomic clone and the truncated cDNA clone. This sequence had 98.5% nucleotide identity and 98% amino acid identity with cattle IL-2. Three amino acid substitutions were observed at positions 63, 124 and 135. Comparison of the predicted protein structure of buffalo IL-2 with that of human and cattle IL-2 did not reveal significant differences. The putative amino acids responsible for IL-2 receptor binding were conserved in buffalo, cattle and human IL-2. The amino acid sequence of buffalo IL-2 also showed very high identity with that of other ruminants, indicating functional cross-reactivity.

  13. Sequence analysis and expression of a cDNA clone encoding tropomysin in Sinonovacula constricta.

    PubMed

    Song, Juanjuan; Li, Li; Liu, Zhigang; Li, Qiyuan; Ran, Pixin

    2009-02-01

    Shellfish can cause severe anaphylactic reactions. Tropomyosin has been assumed partly responsible for the cross-reactivity among shellfish and other invertebrates. In this study, cDNA of Sinonovacula constricta was amplified by RT-PCR and 3'-RACE from total RNA. The obtained tropomyosin cDNA included an open reading frame coding for 284 amino acids. The deduced amino acid sequence of the corresponding protein shared high identity with other allergenic tropomyosins. Expression of the recombinant tropomyosin was carried out in Escherichia coli BL21(DE3) using vector PET28a and the purification of the recombinant protein was performed via affinity chromatography. IgE reactivity of recombinant tropomyosin was investigated by immunoblot and the sensized precentage was 36% which indicated that tropomyosin was the minor allergens in S. constricta. Moreover, the character of the purified protein was analyzed by MALDI-TOF-MS.

  14. The nucleotide sequence of the uvrD gene of E. coli.

    PubMed Central

    Finch, P W; Emmerson, P T

    1984-01-01

    The nucleotide sequence of a cloned section of the E. coli chromosome containing the uvrD gene has been determined. The coding region for the UvrD protein consists of 2,160 nucleotides which would direct the synthesis of a polypeptide 720 amino acids long with a calculated molecular weight of 82 kd. The predicted amino acid sequence of the UvrD protein has been compared with the amino acid sequences of other known adenine nucleotide binding proteins and a common sequence has been identified, thought to contribute towards adenine nucleotide binding. PMID:6379604

  15. Time scale for cyclostome evolution inferred with a phylogenetic diagnosis of hagfish and lamprey cDNA sequences.

    PubMed

    Kuraku, Shigehiro; Kuratani, Shigeru

    2006-12-01

    The Cyclostomata consists of the two orders Myxiniformes (hagfishes) and Petromyzoniformes (lampreys), and its monophyly has been unequivocally supported by recent molecular phylogenetic studies. Under this updated vertebrate phylogeny, we performed in silico evolutionary analyses using currently available cDNA sequences of cyclostomes. We first calculated the GC-content at four-fold degenerate sites (GC(4)), which revealed that an extremely high GC-content is shared by all the lamprey species we surveyed, whereas no striking pattern in GC-content was observed in any of the hagfish species surveyed. We then estimated the timing of diversification in cyclostome evolution using nucleotide and amino acid sequences. We obtained divergence times of 470-390 million years ago (Mya) in the Ordovician-Silurian-Devonian Periods for the interordinal split between Myxiniformes and Petromyzoniformes; 90-60 Mya in the Cretaceous-Tertiary Periods for the split between the two hagfish subfamilies, Myxininae and Eptatretinae; 280-220 Mya in the Permian-Triassic Periods for the split between the two lamprey subfamilies, Geotriinae and Petromyzoninae; and 30-10 Mya in the Tertiary Period for the split between the two lamprey genera, Petromyzon and Lethenteron. This evolutionary configuration indicates that Myxiniformes and Petromyzoniformes diverged shortly after the common ancestor of cyclostomes split from the future gnathostome lineage. Our results also suggest that intra-subfamilial diversification in hagfish and lamprey lineages (especially those distributed in the northern hemisphere) occurred in the Cretaceous or Tertiary Periods.

  16. Time scale for cyclostome evolution inferred with a phylogenetic diagnosis of hagfish and lamprey cDNA sequences.

    PubMed

    Kuraku, Shigehiro; Kuratani, Shigeru

    2006-12-01

    The Cyclostomata consists of the two orders Myxiniformes (hagfishes) and Petromyzoniformes (lampreys), and its monophyly has been unequivocally supported by recent molecular phylogenetic studies. Under this updated vertebrate phylogeny, we performed in silico evolutionary analyses using currently available cDNA sequences of cyclostomes. We first calculated the GC-content at four-fold degenerate sites (GC(4)), which revealed that an extremely high GC-content is shared by all the lamprey species we surveyed, whereas no striking pattern in GC-content was observed in any of the hagfish species surveyed. We then estimated the timing of diversification in cyclostome evolution using nucleotide and amino acid sequences. We obtained divergence times of 470-390 million years ago (Mya) in the Ordovician-Silurian-Devonian Periods for the interordinal split between Myxiniformes and Petromyzoniformes; 90-60 Mya in the Cretaceous-Tertiary Periods for the split between the two hagfish subfamilies, Myxininae and Eptatretinae; 280-220 Mya in the Permian-Triassic Periods for the split between the two lamprey subfamilies, Geotriinae and Petromyzoninae; and 30-10 Mya in the Tertiary Period for the split between the two lamprey genera, Petromyzon and Lethenteron. This evolutionary configuration indicates that Myxiniformes and Petromyzoniformes diverged shortly after the common ancestor of cyclostomes split from the future gnathostome lineage. Our results also suggest that intra-subfamilial diversification in hagfish and lamprey lineages (especially those distributed in the northern hemisphere) occurred in the Cretaceous or Tertiary Periods. PMID:17261918

  17. Spatially localized generation of nucleotide sequence-specific DNA damage

    PubMed Central

    Oh, Dennis H.; King, Brett A.; Boxer, Steven G.; Hanawalt, Philip C.

    2001-01-01

    Psoralens linked to triplex-forming oligonucleotides (psoTFOs) have been used in conjunction with laser-induced two-photon excitation (TPE) to damage a specific DNA target sequence. To demonstrate that TPE can initiate photochemistry resulting in psoralen–DNA photoadducts, target DNA sequences were incubated with psoTFOs to form triple-helical complexes and then irradiated in liquid solution with pulsed 765-nm laser light, which is half the quantum energy required for conventional one-photon excitation, as used in psoralen + UV A radiation (320–400 nm) therapy. Target DNA acquired strand-specific psoralen monoadducts in a light dose-dependent fashion. To localize DNA damage in a model tissue-like medium, a DNA–psoTFO mixture was prepared in a polyacrylamide gel and then irradiated with a converging laser beam targeting the rear of the gel. The highest number of photoadducts formed at the rear while relatively sparing DNA at the front of the gel, demonstrating spatial localization of sequence-specific DNA damage by TPE. To assess whether TPE treatment could be extended to cells without significant toxicity, cultured monolayers of normal human dermal fibroblasts were incubated with tritium-labeled psoralen without TFO to maximize detectable damage and irradiated by TPE. DNA from irradiated cells treated with psoralen exhibited a 4- to 7-fold increase in tritium activity relative to untreated controls. Functional survival assays indicated that the psoralen–TPE treatment was not toxic to cells. These results demonstrate that DNA damage can be simultaneously manipulated at the nucleotide level and in three dimensions. This approach for targeting photochemical DNA damage may have photochemotherapeutic applications in skin and other optically accessible tissues. PMID:11572980

  18. Spatially localized generation of nucleotide sequence-specific DNA damage.

    PubMed

    Oh, D H; King, B A; Boxer, S G; Hanawalt, P C

    2001-09-25

    Psoralens linked to triplex-forming oligonucleotides (psoTFOs) have been used in conjunction with laser-induced two-photon excitation (TPE) to damage a specific DNA target sequence. To demonstrate that TPE can initiate photochemistry resulting in psoralen-DNA photoadducts, target DNA sequences were incubated with psoTFOs to form triple-helical complexes and then irradiated in liquid solution with pulsed 765-nm laser light, which is half the quantum energy required for conventional one-photon excitation, as used in psoralen + UV A radiation (320-400 nm) therapy. Target DNA acquired strand-specific psoralen monoadducts in a light dose-dependent fashion. To localize DNA damage in a model tissue-like medium, a DNA-psoTFO mixture was prepared in a polyacrylamide gel and then irradiated with a converging laser beam targeting the rear of the gel. The highest number of photoadducts formed at the rear while relatively sparing DNA at the front of the gel, demonstrating spatial localization of sequence-specific DNA damage by TPE. To assess whether TPE treatment could be extended to cells without significant toxicity, cultured monolayers of normal human dermal fibroblasts were incubated with tritium-labeled psoralen without TFO to maximize detectable damage and irradiated by TPE. DNA from irradiated cells treated with psoralen exhibited a 4- to 7-fold increase in tritium activity relative to untreated controls. Functional survival assays indicated that the psoralen-TPE treatment was not toxic to cells. These results demonstrate that DNA damage can be simultaneously manipulated at the nucleotide level and in three dimensions. This approach for targeting photochemical DNA damage may have photochemotherapeutic applications in skin and other optically accessible tissues. PMID:11572980

  19. cDNA cloning of the Octopus dofleini hemocyanin: sequence of the carboxyl-terminal domain.

    PubMed

    Lang, W H

    1988-09-20

    A cDNA library was constructed in pUC 19, using poly(A+) RNA purified from Octopus dofleini branchial gland, which is the site of hemocyanin biosynthesis in cephalopods. The library was screened with an oligonucleotide probe derived from a portion of the partially known sequence of the C-terminal domain of Paroctopus dofleini dofleini. The clone with the longest insert--called pHC1--was sequenced and used as a probe for Northern blotting. It hybridized to a 9.5-kb RNA species, which was also visible as a band after ethidium bromide staining. The cDNA insert (approximately 1200 bp) of pHC1 contained an open reading frame of 1071 bp coding for 357 amino acids. In this insert, a region coding for 42 amino acids from the N-terminal end of the C-terminal domain is missing. These were obtained by sequencing a cloned primer extension product. By comparing our sequence with Helix pomatia beta c-hemocyanin unit D, we found 42.9% identical and 11.5% similar residues. One putative copper binding site (site B) was identified by homology to Helix hemocyanin and arthropodan hemocyanin. The location of a second possible site was identified. PMID:3207675

  20. Identification and characterization of the cDNA sequence encoding amelogenin in rabbit (Oryctolagus cuniculus).

    PubMed

    Bai, Chunyan; Li, Yumei; Yan, Shouqing; Fang, Hengtong; Sun, Boxing; Zhang, Jiabao; Zhao, Zhihui

    2016-02-01

    Amelogenins, the most abundant proteins in tooth enamel extracellular matrix (ECM), are essential for tooth amelogenesis. The nucleotide sequence of amelogenin gene (AMEL) for rabbit, as an important member of mammals and good continuously growing incisor model, is important for comparative and evolutional study. Previous studies about rabbit amelogenin proteins got no consensus yet even as to their existence or size. In this study, with combined usage of in silico and molecular cloning technologies, we identified sequences of two transcripts of rabbit amelogenin, resulting from the alternative splicing of the 45-bp exon 4. The coding regions of the two transcripts are of 567- and 522-bp, encoding 188 and 173 amino acids including a 17-residue signal peptide, respectively. Sequence analysis revealed that rabbit amelogenin features in extremely high GC-content in nucleotide sequence and Alanine content in protein sequence. Detailed comparison of amino acid sequence with other mammals showed that the rabbit amelogenin protein is conserved in the sites and regions important for protein functions. Overall, our results uncovered the mysteries about rabbit amelogenin and revealed its sequence peculiarities. PMID:26551300

  1. Pyruvate decarboxylase from Pisum sativum. Properties, nucleotide and amino acid sequences.

    PubMed

    Mücke, U; Wohlfarth, T; Fiedler, U; Bäumlein, H; Rücknagel, K P; König, S

    1996-04-15

    To study the molecular structure and function of pyruvate decarboxylase (PDC) from plants the protein was isolated from pea seeds and partially characterised. The active enzyme which occurs in the form of higher oligomers consists of two different subunits appearing in SDS/PAGE and mass spectroscopy experiments. For further experiments, like X-ray crystallography, it was necessary to elucidate the protein sequence. Partial cDNA clones encoding pyruvate decarboxylase from seeds of Pisum sativum cv. Miko have been obtained by means of polymerase chain reaction techniques. The first sequences were found using degenerate oligonucleotide primers designated according to conserved amino acid sequences of known pyruvate decarboxylases. The missing parts of one cDNA were amplified applying the 3'- and 5'-rapid amplification of cDNA ends systems. The amino acid sequence deduced from the entire cDNA sequence displays strong similarity to pyruvate decarboxylases from other organisms, especially from plants. A molecular mass of 64 kDa was calculated for this protein correlating with estimations for the smaller subunit of the oligomeric enzyme. The PCR experiments led to at least three different clones representing the middle part of the PDC cDNA indicating the existence of three isozymes. Two of these isoforms could be confirmed on the protein level by sequencing tryptic peptides. Only anaerobically treated roots showed a positive signal for PDC mRNA in Northern analysis although the cDNA from imbibed seeds was successfully used for PCR.

  2. Isolation and sequencing of a cDNA coding for the human DF3 breast carcinoma-associated antigen

    SciTech Connect

    Siddiqui, J.; Abe, M.; Hayes, D.; Shani, E.; Yunis, E.; Kufe, D. )

    1988-04-01

    The murine monoclonal antibody (mAb) DF3 reacts with a high molecular weight glycoprotein detectable in human breast carcinomas. DF3 antigen expression correlates with human breast tumor differentiation, and the detection of a cross-reactive species in human milk has suggested that this antigen might be useful as a marker of differentiated mammary epithelium. To further characterize DF3 antigen expression, the authors have isolated a cDNA clone from a {lambda}gt11 library by screening with mAb DF3. The results demonstrate that this 309-base-pair cDNA, designated pDF9.3, codes for the DF3 epitope. Southern blot analyses of EcoRI-digested DNAs from six human tumor cell lines with {sup 32}P-labeled pDF9.3 have revealed a restriction fragment length polymorphism. Variations in size of the alleles detected by pDF9.3 were also identified in Pst I, but not in HindIII, DNA digests. Furthermore, hybridization of {sup 32}P-labeled pDF9.3 with total cellular RNA from each of these cell lines demonstrated either one or two transcripts that varied from 4.1 to 7.1 kilobases in size. The presence of differently sized transcripts detected by pDF9.3 was also found to correspond with the polymorphic expression of DF3 glycoproteins. Nucleotide sequence analysis of pDF9.3 has revealed a highly conserved (G + C)-rich 60-base-pair tandem repeat. These findings suggest that the variation in size of alleles coding for the polymorphic DF3 glycoprotein may represent different numbers of repeats.

  3. Nucleotide sequence and temporal expression of a baculovirus regulatory gene.

    PubMed

    Guarino, L A; Summers, M D

    1987-07-01

    The nucleotide sequence of a trans-activating regulatory gene (IE-1) of the baculovirus Autographa californica nuclear polyhedrosis virus has been determined. This gene encodes a protein of 581 amino acids with a predicted molecular weight of 66,856. A DNA fragment containing the entire coding sequence of IE-1 was inserted downstream of an RNA promoter. Subsequent cell-free transcription and translation directed the synthesis of a single peptide with an apparent molecular weight of 70,000. Quantitative S1 nuclease analysis indicated that IE-1 was maximally synthesized during a 1-h virus adsorption period and that steady-state levels of IE-1 message were maintained during the first 24 h of infection. Northern blot hybridization indicated that several late transcripts which overlap the IE-1 gene were transcribed from both strands. The precise locations of the 5' and 3' ends of these overlapping transcripts were mapped using S1 nuclease. The overlapping transcripts were grouped in two transcriptional units. One unit was composed of IE-1 and overlapping gamma transcripts which initiated upstream of IE-1 and terminated downstream of IE-1. The other unit, transcribed from the opposite strand, consisted of gamma transcripts with coterminal 5' ends and extended 3' ends. The shorter, more abundant transcripts in this unit overlapped 30 to 40 bases of IE-1 at the 3' end, while the longer transcripts overlapped the entire IE-1 gene. Transcription of several early A. californica nuclear polyhedrosis virus genes, in addition to 39K, was shown to be trans-activated by IE-1, indicating that IE-1 may have a central role in the regulation of beta-gene expression. PMID:16789264

  4. Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

    PubMed

    Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

    2013-06-01

    Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

  5. Murine muscle-specific enolase: cDNA cloning, sequence, and developmental expression.

    PubMed Central

    Lamandé, N; Mazo, A M; Lucas, M; Montarras, D; Pinset, C; Gros, F; Legault-Demare, L; Lazar, M

    1989-01-01

    In vertebrates, the glycolytic enzyme enolase (EC 4.2.1.11) is present as homodimers and heterodimers formed from three distinct subunits of identical molecular weight, alpha, beta, and gamma. We report the cloning and sequencing of a cDNA encoding the beta subunit of murine muscle-specific enolase. The corresponding amino acid sequence shows greater than 80% homology with the beta subunit from chicken obtained by protein sequencing and with alpha and gamma subunits from rat and mouse deduced from cloned cDNAs. In contrast, there is no homology between the 3' untranslated regions of mouse alpha, beta, and gamma enolase mRNAs, which also differ greatly in length. The short 3' untranslated region of beta enolase mRNA accounts for its distinct length, 1600 bases. It is known that a progressive transition from alpha alpha to beta beta enolase occurs in developing skeletal muscle. We show that this transition mainly results from a differential regulation of alpha and beta mRNA levels. Analysis of myogenic cell lines shows that beta enolase gene is expressed at the myoblast stage. Moreover, transfection of premyogenic C3H10T1/2 cells with MyoD1 cDNA shows that the initial expression of beta transcripts occurs during the very first steps of the myogenic pathway, suggesting that it could be a marker event of myogenic lineage determination. Images PMID:2734297

  6. Barcoded cDNA library preparation for small RNA profiling by next-generation sequencing.

    PubMed

    Hafner, Markus; Renwick, Neil; Farazi, Thalia A; Mihailović, Aleksandra; Pena, John T G; Tuschl, Thomas

    2012-10-01

    The characterization of post-transcriptional gene regulation by small regulatory (20-30 nt) RNAs, particularly miRNAs and piRNAs, has become a major focus of research in recent years. A prerequisite for characterizing small RNAs is their identification and quantification across different developmental stages, and in normal and disease tissues, as well as model cell lines. Here we present a step-by-step protocol for generating barcoded small RNA cDNA libraries compatible with Illumina HiSeq sequencing, thereby facilitating miRNA and other small RNA profiling of large sample collections.

  7. Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations

    PubMed Central

    Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

    2016-01-01

    To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules. PMID:27554526

  8. Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

    PubMed

    Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

    2016-01-01

    To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules. PMID:27554526

  9. Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

    PubMed

    Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

    2016-08-24

    To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

  10. Cloning and sequence analysis of cDNA coding for a lectin from Helianthus tuberosus callus and its jasmonate-induced expression.

    PubMed

    Nakagawa, R; Yasokawa, D; Okumura, Y; Nagashima, K

    2000-06-01

    Two lectins (designated as HTA I and HTA II) that seemed to be isolectins were found in Helianthus tuberosus callus. cDNA encoding HTA I was isolated from a ZAP Express expression library by immunoselection by using the anti-HTA antiserum. The sequence of this cDNA consisted of 432 bp nucleotides coding for a polypeptide of 143 amino acid residues (Mr, 15,314). When introduced into E. coli, the cDNA directed the synthesis of active HTA I as indicated by the hemagglutination activity. The deduced amino acid sequence showed homology with some lectins and jasmonate-induced proteins. When callus was cultured in the presence of methyl jasmonate (MeJA), the hemagglutination activity increased in a dose-dependent manner. The levels of expression of the HTA protein and of the corresponding mRNA also increased in the treated callus. In view of these results, HTA I is considered to be a jasmonate-induced protein. PMID:10923797

  11. Isolation and sequence of a cDNA clone for human tyrosinase that maps at the mouse c-albino locus

    SciTech Connect

    Kwon, B.S.; Haq, A.K.; Pomerantz, S.H.; Halaban, R.

    1987-11-01

    Screening of a lambdagt11 human melanocyte cDNA library with antibodies against hamster tyrosinase resulted in the isolation of 16 clones. The cDNA inserts from 13 of the 16 clones cross-hybridized with each other, indicating that they were form related mRNA species. One of the cDNA clones, Pmel34, detected one mRNA species with an approximate length of 2.4 kilobases that was expressed preferentially in normal and malignant melanocytes but not in other cell types. The amino acid sequence deduced from the nucleotide sequence showed that the putative human tyrosinase is composed of 548 amino acids with a molecular weight of 62,610. The deduced protein contains glycosylation sites and histidine-rich sites that could be used for copper binding. Southern blot analysis of DNA derived from newborn mice carrying lethal albino deletion mutations revealed that Pmel34 maps near or at the c-albino locus, the position of the structural gene for tyrosinase.

  12. Serine protease variants encoded by Echis ocellatus venom gland cDNA: cloning and sequencing analysis.

    PubMed

    Hasson, S S; Mothana, R A; Sallam, T A; Al-balushi, M S; Rahman, M T; Al-Jabri, A A

    2010-01-01

    Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs) from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization) the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent. PMID:20936075

  13. The nucleotide sequence of the amiE gene of Pseudomonas aeruginosa.

    PubMed

    Brammar, W J; Charles, I G; Matfield, M; Liu, C P; Drew, R E; Clarke, P H

    1987-05-11

    The nucleotide sequence of the amiE gene, encoding the aliphatic amidase of Pseudomonas aeruginosa, has been determined. The sequence of 1038 nucleotides shows a strong bias in favour of codons with G or C in the third position, and only 44 different codons are utilised.

  14. Cloning and sequencing of Octopus dofleini hemocyanin cDNA: derived sequences of functional units Ode and Odf.

    PubMed

    Lang, W H; van Holde, K E

    1991-01-01

    A number of additional cDNA clones coding for portions of the very large polypeptide chain of Octopus dofleini hemocyanin were isolated and sequenced. These data reveal two very similar coding sequences, which we have denoted "A-type" and "G-type." We have obtained complete A-type sequences coding for functional units Ode and Odf; consequently a total of three such unit sequences are now known from a single subunit of one molluscan hemocyanin. This presents the opportunity to make sequence comparisons within one hemocyanin subunit. Domains within one subunit show on the average 42% identity in amino acid residues; corresponding functional units from hemocyanins of different species show degrees of identity of 53-75%. Therefore, molluscan hemocyanins already existed before the individual molluscan classes diverged in the early Cambrian. Sequence comparisons of molluscan hemocyanins with arthropodan hemocyanins and tyrosinases allow us to identify the ligands of the "Copper B" site with high probability. Possible ligands for the "Copper A" site are proposed, based on sequence comparisons between molluscan hemocyanins and tyrosinases. Besides two histidine side chains, a methionine side chain might be involved in binding of Copper A, a result not in conflict with spectroscopic studies. PMID:1898774

  15. Cloning and sequencing of Octopus dofleini hemocyanin cDNA: derived sequences of functional units Ode and Odf.

    PubMed Central

    Lang, W H; van Holde, K E

    1991-01-01

    A number of additional cDNA clones coding for portions of the very large polypeptide chain of Octopus dofleini hemocyanin were isolated and sequenced. These data reveal two very similar coding sequences, which we have denoted "A-type" and "G-type." We have obtained complete A-type sequences coding for functional units Ode and Odf; consequently a total of three such unit sequences are now known from a single subunit of one molluscan hemocyanin. This presents the opportunity to make sequence comparisons within one hemocyanin subunit. Domains within one subunit show on the average 42% identity in amino acid residues; corresponding functional units from hemocyanins of different species show degrees of identity of 53-75%. Therefore, molluscan hemocyanins already existed before the individual molluscan classes diverged in the early Cambrian. Sequence comparisons of molluscan hemocyanins with arthropodan hemocyanins and tyrosinases allow us to identify the ligands of the "Copper B" site with high probability. Possible ligands for the "Copper A" site are proposed, based on sequence comparisons between molluscan hemocyanins and tyrosinases. Besides two histidine side chains, a methionine side chain might be involved in binding of Copper A, a result not in conflict with spectroscopic studies. Images PMID:1898774

  16. Complete nucleotide sequence of the temperate bacteriophage LBR48, a new member of the family Myoviridae.

    PubMed

    Jang, Se Hwan; Yoon, Bo Hyun; Chang, Hyo Ihl

    2011-02-01

    The complete genomic sequence of LBR48, a temperate bacteriophage induced from a lysogenic strain of Lactobacillus brevis, was found to be 48,211 nucleotides long and to contain 90 putative open reading frames. Based on structural characteristics obtained from microscopic analysis and nucleic acid sequence determination, phage LBR48 can be classified as a member of the family Myoviridae. Analysis of the genome showed the conserved gene order of previously reported phages of the family Siphoviridae from lactic acid bacteria, despite low nucleotide sequence similarity. Analysis of the attachment sites revealed 15-nucleotide-long core sequences. PMID:20976608

  17. Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

    NASA Astrophysics Data System (ADS)

    Qi, Fei; Guo, Huarong; Wang, Jian

    2008-02-01

    Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

  18. Nuclear-encoded chloroplast ribosomal protein L12 of Nicotiana tabacum: characterization of mature protein and isolation and sequence analysis of cDNA clones encoding its cytoplasmic precursor.

    PubMed Central

    Elhag, G A; Thomas, F J; McCreery, T P; Bourque, D P

    1992-01-01

    Poly(A)+ mRNA isolated from Nicotiana tabacum (cv. Petite Havana) leaves was used to prepare a cDNA library in the expression vector lambda gt11. Recombinant phage containing cDNAs coding for chloroplast ribosomal protein L12 were identified and sequenced. Mature tobacco L12 protein has 44% amino acid identity with ribosomal protein L7/L12 of Escherichia coli. The longest L12 cDNA (733 nucleotides) codes for a 13,823 molecular weight polypeptide with a transit peptide of 53 amino acids and a mature protein of 133 amino acids. The transit peptide and mature protein share 43% and 79% amino acid identity, respectively, with corresponding regions of spinach chloroplast ribosomal protein L12. The predicted amino terminus of the mature protein was confirmed by partial sequence analysis of HPLC-purified tobacco chloroplast ribosomal protein L12. A single L12 mRNA of about 0.8 kb was detected by hybridization of L12 cDNA to poly(A)+ and total leaf RNA. Hybridization patterns of restriction fragments of tobacco genomic DNA probed with the L12 cDNA suggested the existence of more than one gene for ribosomal protein L12. Characterization of a second cDNA with an identical L12 coding sequence but a different 3'-noncoding sequence provided evidence that at least two L12 genes are expressed in tobacco. Images PMID:1542565

  19. A cDNA clone containing the entire coding sequence of a mouse H-2Kd histocompatibility antigen

    PubMed Central

    Lalanne, Jean-Louis; Delarbre, Christiane; Gachelin, Gabriel; Kourilsky, Philippe

    1983-01-01

    We have isolated a cDNA clone carrying a 1560 bp long insert which contains the entire coding and 3′ untranslated regions of an H-2Kd mouse histocompatibility antigen. Its sequence and overal features are described. They point to the existence of unique properties of DNA sequences associated with the H-2Kd antigen. PMID:6298749

  20. Bovine dopamine beta-hydroxylase cDNA. Complete coding sequence and expression in mammalian cells with vaccinia virus vector.

    PubMed

    Lewis, E J; Allison, S; Fader, D; Claflin, V; Baizer, L

    1990-01-15

    We have isolated cDNA clones for bovine dopamine beta-hydroxylase from an adrenal medulla cDNA library and have determined the complete coding sequence. The largest cDNA clone isolated from the library is 2.4 kilobase pairs (kb) and contains an open reading frame of 1788 bases, coding for a protein of 597 amino acids and Mr = 66,803. The predicted amino acid sequence of the bovine cDNA contains 85% identity with human dopamine beta-hydroxylase (Lamouroux, A., Vingny, A., Faucon Biquet, N., Darmon, M. C., Franck, R., Henry, J.P., and Mallet, J. (1987) EMBO J. 6, 3931-3937; Kobayashi, K., Kurosawa, Y., Fujita, K., and Nagatsu, T. (1989) Nucleic Acids Res. 17, 1089-1102). Northern blot analysis reveals that the cDNA hybridizes to an mRNA of 2.4 kb present in bovine adrenal medulla, but not in kidney, heart, or liver. In addition, the cDNA hybridizes to a second RNA species of 5.5 kb, which is 4-fold less abundant than the 2.4-kb RNA. In vitro translation of a synthetic RNA transcribed from the 2.4-kb cDNA produces a 68-kDa protein, which is specifically immunoprecipitated by antiserum to bovine dopamine beta-hydroxylase. The 2.4-kb cDNA was cloned into a vaccinia virus vector, and the recombinant virus was used to infect the rat pheochromocytoma PC12 and monkey BSC-40 fibroblast cell lines. In both cell lines, infection with recombinant virus produces a protein of Mr = 75,000, which reacts with antiserum to bovine dopamine beta-hydroxylase. These results indicate that the 2.4-kb cDNA contains the genetic information necessary to code for the bovine dopamine beta-hydroxylase subunit.

  1. Cloning and sequence analysis of cDNA encoding urotensin I precursor.

    PubMed Central

    Ishida, I; Ichikawa, T; Deguchi, T

    1986-01-01

    The primary structure of the precursor of urotensin I, a neuropeptide hormone from the caudal neurosecretory system of the carp Cyprinus carpio, has been determined by analyzing the nucleotide sequence of cloned DNA complementary to the mRNA encoding it. The precursor consists of 145 amino acid residues and the carboxyl terminus represents the 41-amino acid sequence of urotensin I, preceded by Lys-Arg and followed by Gly-Lys. Sequence homology as well as similar organization of the precursors of urotensin I and mammalian corticotropin-releasing factors suggest that they are evolutionarily related. RNA transfer blot analysis indicates that mRNA encoding the precursor of urotensin I is present only in the spinal cord and not in the brain, intestine, liver, or kidney of the carp. Images PMID:3484550

  2. Nucleotide sequence of HS-beta satellite DNA from kangaroo rat Dipodomys ordii.

    PubMed

    Fry, K; Poon, R; Whitcome, P; Idriss, J; Salser, W; Mazrimas, J; Hatch, F

    1973-09-01

    The sequence of the highly repetitive satellite HS-beta DNA fraction from kangaroo rat Dipodomys ordii was determined independently by RNA and DNA sequencing techniques. A basic iterated sequence of 10 nucleotides with several mutational variations was found. Base-composition data are consistent with the proposed sequence and revealed a high content of 5-methylcytosine. DNA and RNA sequencing techniques used gave identical results, showing that the fidelity of synthesis of riboguanidine-substituted DNA under our conditions is adequate for nucleotide sequence studies.

  3. Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli.

    PubMed Central

    Brosius, J; Palmer, M L; Kennedy, P J; Noller, H F

    1978-01-01

    The complete nucleotide sequence of the 16S RNA gene from the rrnB cistron of Escherichia coli has been determined by using three rapid DNA sequencing methods. Nearly all of the structure has been confirmed by two to six independent sequence determinations on both DNA strands. The length of the 16S rRNA chain inferred from the DNA sequence is 1541 nucleotides, in close agreement with previous estimates. We note discrepancies between this sequence and the most recent version of it reported from direct RNA sequencing [Ehresmann, C., Stiegler, P., Carbon, P. & Ebel, J.P. (1977) FEBS Lett. 84, 337-341]. A few of these may be explained by heterogeneity among 16S rRNA sequences from different cistrons. No nucleotide sequences were found in the 16S rRNA gene that cannot be reconciled with RNase digestion products of mature 16S rRNA. Images PMID:368799

  4. High nucleotide and amino acid sequence similarities in tumour necrosis factor-alpha amongst Indian buffalo (Bubalus bubalis), Indian cattle (Bos indicus) and other ruminants.

    PubMed

    Gupta, P K; Bind, R B; Walunj, S S; Saini, M

    2004-08-01

    Tumour necrosis factor-alpha (TNF-alpha) mRNA from Indian water buffalo (Bubalus bubalis) and Indian cattle (Bos indicus) was reverse transcribed and amplified using reverse transcriptase-polymerase chain reaction (RT-PCR). The nucleotide sequences of cDNAs were determined after cloning into pGEM-T-Easy vector (Promega, Madison, WI) and compared with reported nucleotide sequences of TNF-alpha cDNA from other species. The nucleotide sequences of TNF-alpha from Indian cattle revealed significantly high similarities at nucleotide (99.2%) and amino acid (100%) levels with those of cattle (Bos taurus; Zebu). The sequences from buffalo had 98.4% nucleotide and 99.1% amino acid similarities with Indian cattle, indicating functional cross-reactivity. One amino acid deletion at position 63 and one substitution (A-->P) at position 64 were observed in buffalo compared with Indian cattle. The amino acid deletion at position 63 was predicted due to differences in pre-mRNA splicing.

  5. Characterization of a fragment containing a putative TLP cDNA sequence.

    PubMed

    Tarro, G

    2002-01-01

    With the aim of isolating the Tumor Liberated Protein (TLP) gene, reverse transcription-polymerase chain reaction (RT-PCR) was used to isolate a approximately equal to 500 bp fragment containing a putative TLP cDNA sequence. Total RNAs were extracted from several cell lines with RNAzol B reagent (Tel-Test, Inc) and reverse transcribed using the Reverse Transcription System (Promega). PCR was carried out for 35 cycles (1 minute at 95 degrees C, 2 minutes at 40 degrees C and 1 minute at 72 degrees C) using an upstream degenerate oligonucleotide, ACN AAY AAR GAR GCN TCN ATG TG, which corresponds to the amino acid sequence T N K E A S I, and random hexamers as the downstream primer. PCR products were electrophoresed on a 1% agarose gel containing ethidium bromide. The PCR products were cloned in the pGEM-T easy vector (PROMEGA) and the resulting plasmid clones were sequenced with the chain termination method using the Applied Biosystems model 373A DNA sequencer. A putative open reading frame was deducted. The results obtained can be considered as preliminary data that will require more investigation in order to confirm them. We propose to continue the studies to verify that TLP could be a diagnostic marker in human cancer.

  6. Cloning and sequence analysis of the coding sequence of β-actin cDNA from the Chinese alligator and suitable internal reference primers from the β-actin gene.

    PubMed

    Zhu, H N; Zhang, S Z; Zhou, Y K; Wang, C L; Wu, X B

    2015-01-01

    β-Actin is an essential component of the cytoskeleton and is stably expressed in various tissues of animals, thus, it is commonly used as an internal reference for gene expression studies. In this study, a 1731-bp fragment of β-actin cDNA from Alligator sinensis was obtained using the homology cloning technique. Sequence analysis showed that this fragment contained the complete coding sequence of the β-actin gene (1128 bp), encoding 375 amino acids. The amino acid sequence of β-actin is highly conserved and its nucleotide sequence is slightly variable. Multiple alignment analyses showed that the nucleotide sequence of the β-actin gene from A. sinensis is very similar to sequences from birds, with 94-95% identity. Ten pairs of primers with different product sizes and different annealing temperatures were screened by PCR amplification, agarose gel electrophoresis, and DNA sequencing, and could be used as internal reference primers in gene expression studies. This study expands our knowledge of β-actin gene phylogenetic evolution and provides a basis for quantitative gene expression studies in A. sinensis. PMID:26505364

  7. Sequence of a novel cytochrome CYP2B cDNA coding for a protein which is expressed in a sebaceous gland, but not in the liver.

    PubMed Central

    Friedberg, T; Grassow, M A; Bartlomowicz-Oesch, B; Siegert, P; Arand, M; Adesnik, M; Oesch, F

    1992-01-01

    The major phenobarbital-inducible rat hepatic cytochromes P-450, CYP2B1 and CYP2B2, are the paradigmatic members of a cytochrome P-450 gene subfamily that contains at least seven additional members. Specific oligonucleotide probes for these genomic members of the CYP2B subfamily were used to assess their tissue-specific expression. In Northern-blot analysis a probe specific to gene 4 (which is designated now as CYP2B12) hybridized to a single mRNA present in the preputial gland, an organ which is used as a model for sebaceous glands, but did not hybridize to mRNA isolated from the liver or from five other tissues of untreated or Aroclor 1254-treated rats. The cDNA sequence for the CYP2B12 RNA was determined from overlapping cDNA clones and contained a long open reading frame of 1476 bp. The nucleotide sequence of the CYP2B12 cDNA was 85% similar to the sequence of the CYP2B1 cDNA in its coding region and was different from any CYP2B cDNA characterized until now. The cDNA-derived primary structure of the CYP2B12 protein contains a signal sequence for its insertion into the endoplasmic reticulum and the putative haem-binding site characteristic of cytochromes P-450. A part of the potential haem pocket of CYP2B12 was identical with a similar structure in a bacterial protocatechuate dioxygenase. In immunoblot analysis of preputial-gland microsomes, antibodies against CYP2B1 recognized a single abundant protein with a lower apparent molecular mass than that of CYP2B1. Our results demonstrate that the CYP2B12 protein has the potential to be enzymically active and are the first demonstration that a member of the CYP2B subfamily is expressed exclusively and at high levels in an extrahepatic organ. Images Fig. 1. Fig. 5. Fig. 6. PMID:1445240

  8. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA.

    PubMed Central

    Weller, R; Weller, J W; Ward, D M

    1991-01-01

    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences from three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type. Images PMID:1711832

  9. 16S rRNA sequences of uncultivated hot spring cyanobacterial mat inhabitants retrieved as randomly primed cDNA

    SciTech Connect

    Weller, R.; Ward, D.M. ); Weller, J.W. )

    1991-04-01

    Cloning and analysis of cDNAs synthesized from rRNAs is one approach to assess the species composition of natural microbial communities. In some earlier attempts to synthesize cDNA from 16S rRNA (16S rcDNA) from the Octopus Spring cyanobacterial mat, a dominance of short 16S rcDNAs was observed, which appear to have originated only from certain organisms. Priming of cDNA synthesis from small ribosomal subunit RNA with random deoxyhexanucleotides can retrieve longer sequences, more suitable for phylogenetic analysis. Here we report the retrieval of 16S rRNA sequences form three formerly uncultured community members. One sequence type, which was retrieved three times from a total of five sequences analyzed, can be placed in the cyanobacterial phylum. A second sequence type is related to 16S rRNAs from green nonsulfur bacteria. The third sequence type may represent a novel phylogenetic type.

  10. Diversity of preferred nucleotide sequences around the translation initiation codon in eukaryote genomes.

    PubMed

    Nakagawa, So; Niimura, Yoshihito; Gojobori, Takashi; Tanaka, Hiroshi; Miura, Kin-ichiro

    2008-02-01

    Understanding regulatory mechanisms of protein synthesis in eukaryotes is essential for the accurate annotation of genome sequences. Kozak reported that the nucleotide sequence GCCGCC(A/G)CCAUGG (AUG is the initiation codon) was frequently observed in vertebrate genes and that this 'consensus' sequence enhanced translation initiation. However, later studies using invertebrate, fungal and plant genes reported different 'consensus' sequences. In this study, we conducted extensive comparative analyses of nucleotide sequences around the initiation codon by using genomic data from 47 eukaryote species including animals, fungi, plants and protists. The analyses revealed that preferred nucleotide sequences are quite diverse among different species, but differences between patterns of nucleotide bias roughly reflect the evolutionary relationships of the species. We also found strong biases of A/G at position -3, A/C at position -2 and C at position +5 that were commonly observed in all species examined. Genes with higher expression levels showed stronger signals, suggesting that these nucleotides are responsible for the regulation of translation initiation. The diversity of preferred nucleotide sequences around the initiation codon might be explained by differences in relative contributions from two distinct patterns, GCCGCCAUG and AAAAAAAUG, which implies the presence of multiple molecular mechanisms for controlling translation initiation.

  11. Characterization, nucleotide sequence and genome organization of leek white stripe virus, a putative new species of the genus Necrovirus.

    PubMed

    Lot, H; Rubino, L; Delecolle, B; Jacquemond, M; Turturo, C; Russo, M

    1996-01-01

    White stripe is a disease affecting leek in France with which an isometric virus c. 30 nm in diameter is associated. The most evident symptom is the presence of white stripes on the leaves extending to the stem. Attempts to demonstrate transmission through the soil by sowing or transplanting leek in contaminated soil were unsuccessful. The virus was transmitted by sap inoculation to a narrow range of herbaceous hosts, all of which were infected only locally. Virus purification was from infected leek tissues, where it accumulated in large amounts, as demonstrated by ultrastructural observations. RNA was extracted from purified virus preparations and cDNA clones were prepared. The complete nucleotide sequence of the viral RNA was determined: The genome is 3,662 nucleotides long and contains five open reading frames (ORFs). The first (ORF 1) encodes a putative translation product of M(r) 23,803 (p24) and read through of its amber stop codon results in a protein of M(r) 82,625 (p83) (ORF 2). ORF 3 and ORF 4 encode two small polypeptides of M(r) 11,280 (p11) and M(r) 6,261 (p6), respectively. ORF 5 encodes the capsid protein of M(r) 27,460 (p27). The genome organization and sequence alignments with the corresponding products of necroviruses suggest that the virus isolated from leek is a new species in the genus Necrovirus, for which the name of leek white stripe virus (LWSV) is proposed.

  12. A new antifungal peptide from the seeds of Phytolacca americana: characterization, amino acid sequence and cDNA cloning.

    PubMed

    Shao, F; Hu, Z; Xiong, Y M; Huang, Q Z; WangCG; Zhu, R H; Wang, D C

    1999-03-19

    An antifungal peptide from seeds of Phytolacca americana, designated PAFP-s, has been isolated. The peptide is highly basic and consists of 38 residues with three disulfide bridges. Its molecular mass of 3929.0 was determined by mass spectrometry. The complete amino acid sequence was obtained from automated Edman degradation, and cDNA cloning was successfully performed by 3'-RACE. The deduced amino acid sequence of a partial cDNA corresponded to the amino acid sequence from chemical sequencing. PAFP-s exhibited a broad spectrum of antifungal activity, and its activities differed among various fungi. PAFP-s displayed no inhibitory activity towards Escherichia coli. PAFP-s shows significant sequence similarities and the same cysteine motif with Mj-AMPs, antimicrobial peptides from seeds of Mirabilis jalapa belonging to the knottin-type antimicrobial peptide.

  13. Cloning and sequencing of cDNA encoding the human ribosomal protein L11 mRNA

    SciTech Connect

    Mishin, V.P.; Filipenko, M.L.; Muravlev, A.I.

    1995-02-01

    To clone the RPL11 cDNA, we used a polymerase chain reaction (PCR) with the single-stranded cDNA synthesized on the total placentary poly(A){sup +}mRNA with the use of primer M245 containing a 3{prime}-terminal oligo(dT)-tract, the 5{prime}terminal hexadecanucleotide sequence of the M13 universal primer, and a NotiI restriction site between them. On the basis of the known sequence of the 5{prime}-end of the human ribosomal protein L11 mRNA, we chose two partially overlapping deoxyribooligonucleotides as 5{prime}-terminal primers in the amplification of the RPL11 cDNA. A pair of partially overlapping oligonucleotides complementary to the oligo(dT)-containing primer were used as 3{prime}-terminal primers.

  14. Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

    PubMed Central

    Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

    1993-01-01

    A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

  15. Human liver apolipoprotein B-100 cDNA: complete nucleic acid and derived amino acid sequence.

    PubMed Central

    Law, S W; Grant, S M; Higuchi, K; Hospattankar, A; Lackner, K; Lee, N; Brewer, H B

    1986-01-01

    Human apolipoprotein B-100 (apoB-100), the ligand on low density lipoproteins that interacts with the low density lipoprotein receptor and initiates receptor-mediated endocytosis and low density lipoprotein catabolism, has been cloned, and the complete nucleic acid and derived amino acid sequences have been determined. ApoB-100 cDNAs were isolated from normal human liver cDNA libraries utilizing immunoscreening as well as filter hybridization with radiolabeled apoB-100 oligodeoxynucleotides. The apoB-100 mRNA is 14.1 kilobases long encoding a mature apoB-100 protein of 4536 amino acids with a calculated amino acid molecular weight of 512,723. ApoB-100 contains 20 potential glycosylation sites, and 12 of a total of 25 cysteine residues are located in the amino-terminal region of the apolipoprotein providing a potential globular structure of the amino terminus of the protein. ApoB-100 contains relatively few regions of amphipathic helices, but compared to other human apolipoproteins it is enriched in beta-structure. The delineation of the entire human apoB-100 sequence will now permit a detailed analysis of the conformation of the protein, the low density lipoprotein receptor binding domain(s), and the structural relationship between apoB-100 and apoB-48 and will provide the basis for the study of genetic defects in apoB-100 in patients with dyslipoproteinemias. PMID:3464946

  16. Mouse annexin V chromosomal localization, cDNA sequence conservation, and molecular evolution

    SciTech Connect

    Rodriguez-Garcia, M.I.; Morgan, R.O.; Kozak, C.A.

    1996-01-15

    A full-length cDNA encoding mouse annexin V (ANX5) was cloned, sequenced, and utilized for chromosomal mapping. The gene lies on mouse chromosome 3 in close linkage with the fibroblast growth factor 2 (basic) gene and is syntenic with other genes known to have orthologous counterparts on human chromosome 4q. The open reading frame encoded a protein of 319 amino acids (aa), with 92-96% identity to ANX5 in other species. Internal repeat 3 of mouse ANX5 exhibited the highest level of nonconservative aa replacements with respect to other annexin subfamilies, but the greatest sequence conservation among ANX5 species members. This region may thus contain features that distinguish ANX5 from other annexins in properties or function. Phylogenetic analysis and homology testing of ANX5 members indicated that the 34-kDa annexin from Torpedo marmorata may also belong to this subfamily. Comparison of nine species of ANX5 led to an estimation of the unit evolutionary mutation rate at 1% aa replacements every 8 million years, comparable to other annexins. 46 refs., 4 figs.

  17. Cloning and nucleotide sequence of the aroA gene of Bordetella pertussis.

    PubMed Central

    Maskell, D J; Morrissey, P; Dougan, G

    1988-01-01

    The aroA locus of Bordetella pertussis, encoding 5-enolpyruvylshikimate 3-phosphate synthase, has been cloned into Escherichia coli by using a cosmid vector. The gene is expressed in E. coli and complemented an E. coli aroA mutant. The nucleotide sequence of the B. pertussis aroA gene was determined and contains an open reading frame encoding 442 amino acids, with a calculated molecular weight for 5-enolpyruvylshikimate 3-phosphate synthase of 46,688. The amino acid sequence derived from the nucleotide sequence shows homology with the published amino acid sequences of aroA gene products of other microorganisms. PMID:2897356

  18. Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and pairwise sequence comparison

    PubMed Central

    2003-01-01

    Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species. We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences. Calculation of nucleotide frequency and pairwise sequence comparison enabled us to characterize the divergence among member sequences in this satellite DNA family. The results suggest that the evolutionary rate of satellite DNA in D. bellottii is about two-fold greater than the average of the other three fishes, and that the sequence homogenization event occurred in D. puntazzo more recently than in the others. The procedures described here are effective to characterize mode of evolution of satellite DNA. PMID:12734555

  19. Evaluation of intra- and interspecific divergence of satellite DNA sequences by nucleotide frequency calculation and pairwise sequence comparison.

    PubMed

    Kato, Mikio

    2003-01-01

    Satellite DNA sequences are known to be highly variable and to have been subjected to concerted evolution that homogenizes member sequences within species. We have analyzed the mode of evolution of satellite DNA sequences in four fishes from the genus Diplodus by calculating the nucleotide frequency of the sequence array and the phylogenetic distances between member sequences. Calculation of nucleotide frequency and pairwise sequence comparison enabled us to characterize the divergence among member sequences in this satellite DNA family. The results suggest that the evolutionary rate of satellite DNA in D. bellottii is about two-fold greater than the average of the other three fishes, and that the sequence homogenization event occurred in D. puntazzo more recently than in the others. The procedures described here are effective to characterize mode of evolution of satellite DNA. PMID:12734555

  20. Automated Workflow for Preparation of cDNA for Cap Analysis of Gene Expression on a Single Molecule Sequencer

    PubMed Central

    Nagao-Sato, Sayaka; Saijo, Eri; Lassmann, Timo; Kanamori-Katayama, Mutsumi; Kaiho, Ai; Lizio, Marina; Kawaji, Hideya; Carninci, Piero; Forrest, Alistair R. R.; Hayashizaki, Yoshihide

    2012-01-01

    Background Cap analysis of gene expression (CAGE) is a 5′ sequence tag technology to globally determine transcriptional starting sites in the genome and their expression levels and has most recently been adapted to the HeliScope single molecule sequencer. Despite significant simplifications in the CAGE protocol, it has until now been a labour intensive protocol. Methodology In this study we set out to adapt the protocol to a robotic workflow, which would increase throughput and reduce handling. The automated CAGE cDNA preparation system we present here can prepare 96 ‘HeliScope ready’ CAGE cDNA libraries in 8 days, as opposed to 6 weeks by a manual operator.We compare the results obtained using the same RNA in manual libraries and across multiple automation batches to assess reproducibility. Conclusions We show that the sequencing was highly reproducible and comparable to manual libraries with an 8 fold increase in productivity. The automated CAGE cDNA preparation system can prepare 96 CAGE sequencing samples simultaneously. Finally we discuss how the system could be used for CAGE on Illumina/SOLiD platforms, RNA-seq and full-length cDNA generation. PMID:22303458

  1. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

  2. Sequence analysis of functional Apisimin-2 cDNA from royal jelly of Chinese honeybee and its expression in Escherichia coli.

    PubMed

    Shen, Lirong; Xing, Liping; Yang, Yuxiao; Gao, Qikang

    2007-01-01

    Apisimin is one of the functional peptides from royal jelly. The aim of this study was to analyze and in vitro express a new gene encoding Acc-apisimin-2 from Chinese honeybee (Apis cerana cerana) in Escherichia coli. Ninety-six clones containing apisimin expressed sequence tag (EST) were identified from 8568 effective ESTs of the cDNA library of Chinese honeybee worker heads. The coding region of the matured peptide from one clone containing Acc-apisimin-2 gene was sub-cloned into the prokaryotic expression vector pGEX-4T-2. The recombinant vector then was transformed into E. coli BL21 (DE3) for expression. The expression product was analyzed with SDS-PAGE and Western blot. The total length of the Acc-apisimin-2 cDNA was 379 bp, containing an open-reading frame (ORF) of 237 nucleotides encoding a 78 amino acid residue precursor. The Acc-apisimin-2 gene shared 100% homologies with Am-apisimin from A. mellifera, but 93% and 91% homologies with Aciapisimin from A. cerana indica and the previously reported Acc-apisimin-1 sequence (AY278991) on a nucleotide level, respectively. The GST-Acc-apisimin-2 fusion protein expressed in the recombinant vector was about 31 kDa in size and accumulated up to about 22.1% of the total bacterial proteins. About 50% of the recombinant protein was soluble. The fusion protein purified through affinity chromatography was cross reactive with GST antibody, which confirmed the successful expression of GST-Acc-apisimin-2.

  3. Isolation and sequencing of cDNA clones encoding ethylene-induced putative peroxidases from cucumber cotyledons.

    PubMed

    Morgens, P H; Callahan, A M; Dunn, L J; Abeles, F B

    1990-05-01

    A cDNA library from ethephon-treated cucumber cotyledons (Cucumis sativus L. cv. Poinsett 76) was constructed. Two cDNA clones encoding putative peroxidases were isolated by means of a synthetic probe based on a partial amino acid sequence of a 33 kDa cationic peroxidase that had been previously shown to be induced by ethylene. DNA sequencing indicates that the two clones were derived from two closely related RNA species that are related to published plant peroxidase sequences. Southern analysis indicates that there are 1-5 copies in a haploid genome of a gene homologous to the cDNA clones. The deduced amino acid sequences are homologous with a tobacco (55% sequence identity), a horseradish (53%), a turnip (45%), and a potato (41%) peroxidase. The cloned sequences do not encode the 33 kDa peroxidase from which the original synthetic probe was been derived, but rather other putative peroxidases. An increase in the level of mRNA is evident by 3 hours after ethephon or ethylene treatment and plateaus by 15 hours. PMID:2102850

  4. Identification and isolation of full-length cDNA sequences by sequencing and analysis of expressed sequence tags from guarana (Paullinia cupana).

    PubMed

    Figueirêdo, L C; Faria-Campos, A C; Astolfi-Filho, S; Azevedo, J L

    2011-01-01

    The current intense production of biological data, generated by sequencing techniques, has created an ever-growing volume of unanalyzed data. We reevaluated data produced by the guarana (Paullinia cupana) transcriptome sequencing project to identify cDNA clones with complete coding sequences (full-length clones) and complete sequences of genes of biotechnological interest, contributing to the knowledge of biological characteristics of this organism. We analyzed 15,490 ESTs of guarana in search of clones with complete coding regions. A total of 12,402 sequences were analyzed using BLAST, and 4697 full-length clones were identified, responsible for the production of 2297 different proteins. Eighty-four clones were identified as full-length for N-methyltransferase and 18 were sequenced in both directions to obtain the complete genome sequence, and confirm the search made in silico for full-length clones. Phylogenetic analyses were made with the complete genome sequences of three clones, which showed only 0.017% dissimilarity; these are phylogenetically close to the caffeine synthase of Theobroma cacao. The search for full-length clones allowed the identification of numerous clones that had the complete coding region, demonstrating this to be an efficient and useful tool in the process of biological data mining. The sequencing of the complete coding region of identified full-length clones corroborated the data from the in silico search, strengthening its efficiency and utility. PMID:21732283

  5. Identification and isolation of full-length cDNA sequences by sequencing and analysis of expressed sequence tags from guarana (Paullinia cupana).

    PubMed

    Figueirêdo, L C; Faria-Campos, A C; Astolfi-Filho, S; Azevedo, J L

    2011-06-21

    The current intense production of biological data, generated by sequencing techniques, has created an ever-growing volume of unanalyzed data. We reevaluated data produced by the guarana (Paullinia cupana) transcriptome sequencing project to identify cDNA clones with complete coding sequences (full-length clones) and complete sequences of genes of biotechnological interest, contributing to the knowledge of biological characteristics of this organism. We analyzed 15,490 ESTs of guarana in search of clones with complete coding regions. A total of 12,402 sequences were analyzed using BLAST, and 4697 full-length clones were identified, responsible for the production of 2297 different proteins. Eighty-four clones were identified as full-length for N-methyltransferase and 18 were sequenced in both directions to obtain the complete genome sequence, and confirm the search made in silico for full-length clones. Phylogenetic analyses were made with the complete genome sequences of three clones, which showed only 0.017% dissimilarity; these are phylogenetically close to the caffeine synthase of Theobroma cacao. The search for full-length clones allowed the identification of numerous clones that had the complete coding region, demonstrating this to be an efficient and useful tool in the process of biological data mining. The sequencing of the complete coding region of identified full-length clones corroborated the data from the in silico search, strengthening its efficiency and utility.

  6. Cloning and sequence analysis of an Ophiophagus hannah cDNA encoding a precursor of two natriuretic peptide domains.

    PubMed

    Lei, Weiwei; Zhang, Yong; Yu, Guoyu; Jiang, Ping; He, Yingying; Lee, Wenhui; Zhang, Yun

    2011-04-01

    The king cobra (Ophiophagus hannah) is the largest venomous snake. Despite the components are mainly neurotoxins, the venom contains several proteins affecting blood system. Natriuretic peptide (NP), one of the important components of snake venoms, could cause local vasodilatation and a promoted capillary permeability facilitating a rapid diffusion of other toxins into the prey tissues. Due to the low abundance, it is hard to purify the snake venom NPs. The cDNA cloning of the NPs become a useful approach. In this study, a 957 bp natriuretic peptide-encoding cDNA clone was isolated from an O. hannah venom gland cDNA library. The open-reading frame of the cDNA encodes a 210-amino acid residues precursor protein named Oh-NP. Oh-NP has a typical signal peptide sequence of 26 amino acid residues. Surprisingly, Oh-NP has two typical NP domains which consist of the typical sequence of 17-residue loop of CFGXXDRIGC, so it is an unusual NP precursor. These two NP domains share high amino acid sequence identity. In addition, there are two homologous peptides of unknown function within the Oh-NP precursor. To our knowledge, Oh-NP is the first protein precursor containing two NP domains. It might belong to another subclass of snake venom NPs. PMID:21334357

  7. Cloning and sequence analysis of an Ophiophagus hannah cDNA encoding a precursor of two natriuretic peptide domains.

    PubMed

    Lei, Weiwei; Zhang, Yong; Yu, Guoyu; Jiang, Ping; He, Yingying; Lee, Wenhui; Zhang, Yun

    2011-04-01

    The king cobra (Ophiophagus hannah) is the largest venomous snake. Despite the components are mainly neurotoxins, the venom contains several proteins affecting blood system. Natriuretic peptide (NP), one of the important components of snake venoms, could cause local vasodilatation and a promoted capillary permeability facilitating a rapid diffusion of other toxins into the prey tissues. Due to the low abundance, it is hard to purify the snake venom NPs. The cDNA cloning of the NPs become a useful approach. In this study, a 957 bp natriuretic peptide-encoding cDNA clone was isolated from an O. hannah venom gland cDNA library. The open-reading frame of the cDNA encodes a 210-amino acid residues precursor protein named Oh-NP. Oh-NP has a typical signal peptide sequence of 26 amino acid residues. Surprisingly, Oh-NP has two typical NP domains which consist of the typical sequence of 17-residue loop of CFGXXDRIGC, so it is an unusual NP precursor. These two NP domains share high amino acid sequence identity. In addition, there are two homologous peptides of unknown function within the Oh-NP precursor. To our knowledge, Oh-NP is the first protein precursor containing two NP domains. It might belong to another subclass of snake venom NPs.

  8. The nucleotide sequences of 5S rRNAs from three ciliated protozoa.

    PubMed Central

    Kumazaki, T; Hori, H; Osawa, S; Mita, T; Higashinakagawa, T

    1982-01-01

    The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Paramecium/Blepharisma) and 79% (Tetrahymena/Blepharisma), suggesting a close relationship of these three ciliates. PMID:7122243

  9. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  10. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica.

  11. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  12. Diverse nucleotide compositions and sequence fluctuation in Rubisco protein genes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Dehipawala, S.; Cheung, E.; Bienaime, R.; Ye, J.; Tremberger, G., Jr.; Schneider, P.; Lieberman, D.; Cheung, T.

    2011-10-01

    The Rubisco protein-enzyme is arguably the most abundance protein on Earth. The biology dogma of transcription and translation necessitates the study of the Rubisco genes and Rubisco-like genes in various species. Stronger correlation of fractal dimension of the atomic number fluctuation along a DNA sequence with Shannon entropy has been observed in the studied Rubisco-like gene sequences, suggesting a more diverse evolutionary pressure and constraints in the Rubisco sequences. The strategy of using metal for structural stabilization appears to be an ancient mechanism, with data from the porphobilinogen deaminase gene in Capsaspora owczarzaki and Monosiga brevicollis. Using the chi-square distance probability, our analysis supports the conjecture that the more ancient Rubisco-like sequence in Microcystis aeruginosa would have experienced very different evolutionary pressure and bio-chemical constraint as compared to Bordetella bronchiseptica, the two microbes occupying either end of the correlation graph. Our exploratory study would indicate that high fractal dimension Rubisco sequence would support high carbon dioxide rate via the Michaelis- Menten coefficient; with implication for the control of the whooping cough pathogen Bordetella bronchiseptica, a microbe containing a high fractal dimension Rubisco-like sequence (2.07). Using the internal comparison of chi-square distance probability for 16S rRNA (~ E-22) versus radiation repair Rec-A gene (~ E-05) in high GC content Deinococcus radiodurans, our analysis supports the conjecture that high GC content microbes containing Rubisco-like sequence are likely to include an extra-terrestrial origin, relative to Deinococcus radiodurans. Similar photosynthesis process that could utilize host star radiation would not compete with radiation resistant process from the biology dogma perspective in environments such as Mars and exoplanets.

  13. An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library

    PubMed Central

    Lu, Chaofu; Wallis, James G; Browse, John

    2007-01-01

    Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12) gene that is responsible for ricinoleate biosynthesis. The role(s) of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2) gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at the Institute for Genome

  14. cDNA sequences and mRNA levels of two hexamerin storage proteins PinSP1 and PinSP2 from the Indianmeal moth, Plodia interpunctella.

    PubMed

    Zhu, Yu Cheng; Muthukrishnan, Subbaratnam; Kramer, Karl J

    2002-05-01

    In insects, storage proteins or hexamerins accumulate apparently to serve as sources of amino acids during metamorphosis and reproduction. Two storage protein-like cDNAs obtained from a cDNA library prepared from fourth instar larvae of the Indianmeal moth (Plodia interpunctella) were cloned and sequenced. The first clone, PinSP1, contained 2431 nucleotides with a 2295 nucleotide open reading frame (ORF) encoding a protein with 765 amino acid residues. The second cDNA, PinSP2, consisted of 2336 nucleotides with a 2250-nucleotide ORF encoding a protein with 750 amino acid residues. PinSP1 and PinSP2 shared 59% nucleotide sequence identity and 44% deduced amino acid sequence identity. A 17-amino acid signal peptide and a molecular mass of 90.4 kDa were predicted for the PinSP1 protein, whereas a 15-amino acid signal peptide and a mass of 88 kDa were predicted for PinSP2. Both proteins contained conserved insect larval storage protein signature sequence patterns and were 60-70% identical to other lepidopteran larval storage proteins. Expression of mRNA for both larval storage proteins was determined using the quantitative reverse transcription polymerase chain reaction method. Only very low levels were present in the second instar, but both mRNAs dramatically increased during the third instar, peaked in the fourth instar, decreased dramatically late in the same instar and pupal stages, and were undetectable during the adult stage. Males and females exhibited similar mRNA expression levels for both storage proteins during the pupal and adult stages. The results support the hypothesis that P. interpunctella, a species that does not feed after the larval stage, accumulates these two storage proteins as reserves during larval development for subsequent use in the pupal and adult stages.

  15. TranslatorX: multiple alignment of nucleotide sequences guided by amino acid translations.

    PubMed

    Abascal, Federico; Zardoya, Rafael; Telford, Maximilian J

    2010-07-01

    We present TranslatorX, a web server designed to align protein-coding nucleotide sequences based on their corresponding amino acid translations. Many comparisons between biological sequences (nucleic acids and proteins) involve the construction of multiple alignments. Alignments represent a statement regarding the homology between individual nucleotides or amino acids within homologous genes. As protein-coding DNA sequences evolve as triplets of nucleotides (codons) and it is known that sequence similarity degrades more rapidly at the DNA than at the amino acid level, alignments are generally more accurate when based on amino acids than on their corresponding nucleotides. TranslatorX novelties include: (i) use of all documented genetic codes and the possibility of assigning different genetic codes for each sequence; (ii) a battery of different multiple alignment programs; (iii) translation of ambiguous codons when possible; (iv) an innovative criterion to clean nucleotide alignments with GBlocks based on protein information; and (v) a rich output, including Jalview-powered graphical visualization of the alignments, codon-based alignments coloured according to the corresponding amino acids, measures of compositional bias and first, second and third codon position specific alignments. The TranslatorX server is freely available at http://translatorx.co.uk.

  16. Isolation, characterization and cDNA sequencing of a Kazal family proteinase inhibitor from seminal plasma of turkey (Meleagris gallopavo).

    PubMed

    Słowińska, Mariola; Olczak, Mariusz; Wojtczak, Mariola; Glogowski, Jan; Jankowski, Jan; Watorek, Wiesław; Amarowicz, Ryszard; Ciereszko, Andrzej

    2008-06-01

    The turkey reproductive tract and seminal plasma contain a serine proteinase inhibitor that seems to be unique for the reproductive tract. Our experimental objective was to isolate, characterize and cDNA sequence the Kazal family proteinase inhibitor from turkey seminal plasma and testis. Seminal plasma contains two forms of a Kazal family inhibitor: virgin (Ia) represented by an inhibitor of moderate electrophoretic migration rate (present also in the testis) and modified (Ib, a split peptide bond) represented by an inhibitor with a fast migration rate. The inhibitor from the seminal plasma was purified by affinity, ion-exchange and reverse phase chromatography. The testis inhibitor was purified by affinity and ion-exchange chromatography. N-terminal Edman sequencing of the two seminal plasma inhibitors and testis inhibitor were identical. This sequence was used to construct primers and obtain a cDNA sequence from the testis. Analysis of a cDNA sequence indicated that turkey proteinase inhibitor belongs to Kazal family inhibitors (pancreatic secretory trypsin inhibitors, mammalian acrosin inhibitors) and caltrin. The turkey seminal plasma Kazal inhibitor belongs to low molecular mass inhibitors and is characterized by a high value of the equilibrium association constant for inhibitor/trypsin complexes.

  17. Methods for making nucleotide probes for sequencing and synthesis

    SciTech Connect

    Church, George M; Zhang, Kun; Chou, Joseph

    2014-07-08

    Compositions and methods for making a plurality of probes for analyzing a plurality of nucleic acid samples are provided. Compositions and methods for analyzing a plurality of nucleic acid samples to obtain sequence information in each nucleic acid sample are also provided.

  18. The nucleotide sequence of Saccharomyces cerevisiae chromosome XII.

    PubMed

    Johnston, M; Hillier, L; Riles, L; Albermann, K; André, B; Ansorge, W; Benes, V; Brückner, M; Delius, H; Dubois, E; Düsterhöft, A; Entian, K D; Floeth, M; Goffeau, A; Hebling, U; Heumann, K; Heuss-Neitzel, D; Hilbert, H; Hilger, F; Kleine, K; Kötter, P; Louis, E J; Messenguy, F; Mewes, H W; Hoheisel, J D

    1997-05-29

    The yeast Saccharomyces cerevisiae is the pre-eminent organism for the study of basic functions of eukaryotic cells. All of the genes of this simple eukaryotic cell have recently been revealed by an international collaborative effort to determine the complete DNA sequence of its nuclear genome. Here we describe some of the features of chromosome XII.

  19. Finding similar nucleotide sequences using network BLAST searches.

    PubMed

    Ladunga, Istvan

    2009-06-01

    The Basic Local Alignment Search Tool (BLAST) is a keystone of bioinformatics due to its performance and user-friendliness. Beginner and intermediate users will learn how to design and submit blastn and Megablast searches on the Web pages at the National Center for Biotechnology Information. We map nucleic acid sequences to genomes, find identical or similar mRNA, expressed sequence tag, and noncoding RNA sequences, and run Megablast searches, which are much faster than blastn. Understanding results is assisted by taxonomy reports, genomic views, and multiple alignments. We interpret expected frequency thresholds, biological significance, and statistical significance. Weak hits provide no evidence, but hints for further analyses. We find genes that may code for homologous proteins by translated BLAST. We reduce false positives by filtering out low-complexity regions. Parsed BLAST results can be integrated into analysis pipelines. Links in the output connect to Entrez, PUBMED, structural, sequence, interaction, and expression databases. This facilitates integration with a wide spectrum of biological knowledge. PMID:19496060

  20. Nucleotide sequence of a human tRNA gene heterocluster

    SciTech Connect

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-05-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both (3'-/sup 32/P)-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these ..gamma..-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues.

  1. Nucleotide sequence conservation in paramyxoviruses; the concept of codon constellation.

    PubMed

    Rima, Bert K

    2015-05-01

    The stability and conservation of the sequences of RNA viruses in the field and the high error rates measured in vitro are paradoxical. The field stability indicates that there are very strong selective constraints on sequence diversity. The nature of these constraints is discussed. Apart from constraints on variation in cis-acting RNA and the amino acid sequences of viral proteins, there are other ones relating to the presence of specific dinucleotides such CpG and UpA as well as the importance of RNA secondary structures and RNA degradation rates. Recent other constraints identified in other RNA viruses, such as effects of secondary RNA structure on protein folding or modification of cellular tRNA complements, are also discussed. Using the family Paramyxoviridae, I show that the codon usage pattern (CUP) is (i) specific for each virus species and (ii) that it is markedly different from the host - it does not vary even in vaccine viruses that have been derived by passage in a number of inappropriate host cells. The CUP might thus be an additional constraint on variation, and I propose the concept of codon constellation to indicate the informational content of the sequences of RNA molecules relating not only to stability and structure but also to the efficiency of translation of a viral mRNA resulting from the CUP and the numbers and position of rare codons.

  2. Water buffalo (Bubalus bubalis): complete nucleotide mitochondrial genome sequence.

    PubMed

    Parma, Pietro; Erra-Pujada, Marta; Feligini, Maria; Greppi, Gianfranco; Enne, Giuseppe

    2004-01-01

    In this work, we report the whole sequence of the water buffalo (Bubalus bubalis) mitochondrial genome. The water buffalo mt molecule is 16.355 base pair length and shows a genome organization similar to those reported for other mitochondrial genome. These new data provide an useful tool for many research area, i.e. evolutionary study and identification of food origin.

  3. Complete sequence of HLA-B27 cDNA identified through the characterization of structural markers unique to the HLA-A, -B, and -C allelic series

    SciTech Connect

    Szoets, H.; Reithmueller, G.; Weiss, E.; Meo, T.

    1986-03-01

    Antigen HLA-B27 is a high-risk genetic factor with respect to a group of rheumatoid disorders, especially ankylosing spondylitis. A cDNA library was constructed from an autozygous B-cell line expressing HLA-B27, HLA-Cw1, and the previously cloned HLA-A2 antigen. Clones detected with an HLA probe were isolated and sorted into homology groups by differential hybridization and restriction maps. Nucleotide sequencing allowed the unambiguous assignment of cDNAs to HLA-A, -B, and -C loci. The HLA-B27 mRNA has the structure features and the codon variability typical of an HLA class I transcript but it specifies two uncommon amino acid replacements: a cysteine in position 67 and a serine in position 131. The latter substitution may have functional consequences, because it occurs in a conserved region and at a position invariably occupied by a species-specific arginine in humans and lysine in mice. The availability of the complete sequence of HLA-B27 and of the partial sequence of HLA-Cw1 allows the recognition of locus-specific sequence markers, particularly, but not exclusively, in the transmembrane and cytoplasmic domains.

  4. Characterization of rainbow trout gonad, brain and gill deep cDNA repertoires using a Roche 454-Titanium sequencing approach.

    PubMed

    Le Cam, Aurélie; Bobe, Julien; Bouchez, Olivier; Cabau, Cédric; Kah, Olivier; Klopp, Christophe; Lareyre, Jean-Jacques; Le Guen, Isabelle; Lluch, Jérôme; Montfort, Jérôme; Moreews, Francois; Nicol, Barbara; Prunet, Patrick; Rescan, Pierre-Yves; Servili, Arianna; Guiguen, Yann

    2012-05-25

    Rainbow trout, Oncorhynchus mykiss, is an important aquaculture species worldwide and, in addition to being of commercial interest, it is also a research model organism of considerable scientific importance. Because of the lack of a whole genome sequence in that species, transcriptomic analyses of this species have often been hindered. Using next-generation sequencing (NGS) technologies, we sought to fill these informational gaps. Here, using Roche 454-Titanium technology, we provide new tissue-specific cDNA repertoires from several rainbow trout tissues. Non-normalized cDNA libraries were constructed from testis, ovary, brain and gill rainbow trout tissue samples, and these different libraries were sequenced in 10 separate half-runs of 454-Titanium. Overall, we produced a total of 3million quality sequences with an average size of 328bp, representing more than 1Gb of expressed sequence information. These sequences have been combined with all publicly available rainbow trout sequences, resulting in a total of 242,187 clusters of putative transcript groups and 22,373 singletons. To identify the predominantly expressed genes in different tissues of interest, we developed a Digital Differential Display (DDD) approach. This approach allowed us to characterize the genes that are predominantly expressed within each tissue of interest. Of these genes, some were already known to be tissue-specific, thereby validating our approach. Many others, however, were novel candidates, demonstrating the usefulness of our strategy and of such tissue-specific resources. This new sequence information, acquired using NGS 454-Titanium technology, deeply enriched our current knowledge of the expressed genes in rainbow trout through the identification of an increased number of tissue-specific sequences. This identification allowed a precise cDNA tissue repertoire to be characterized in several important rainbow trout tissues. The rainbow trout contig browser can be accessed at the following

  5. Characterization of rainbow trout gonad, brain and gill deep cDNA repertoires using a Roche 454-Titanium sequencing approach.

    PubMed

    Le Cam, Aurélie; Bobe, Julien; Bouchez, Olivier; Cabau, Cédric; Kah, Olivier; Klopp, Christophe; Lareyre, Jean-Jacques; Le Guen, Isabelle; Lluch, Jérôme; Montfort, Jérôme; Moreews, Francois; Nicol, Barbara; Prunet, Patrick; Rescan, Pierre-Yves; Servili, Arianna; Guiguen, Yann

    2012-05-25

    Rainbow trout, Oncorhynchus mykiss, is an important aquaculture species worldwide and, in addition to being of commercial interest, it is also a research model organism of considerable scientific importance. Because of the lack of a whole genome sequence in that species, transcriptomic analyses of this species have often been hindered. Using next-generation sequencing (NGS) technologies, we sought to fill these informational gaps. Here, using Roche 454-Titanium technology, we provide new tissue-specific cDNA repertoires from several rainbow trout tissues. Non-normalized cDNA libraries were constructed from testis, ovary, brain and gill rainbow trout tissue samples, and these different libraries were sequenced in 10 separate half-runs of 454-Titanium. Overall, we produced a total of 3million quality sequences with an average size of 328bp, representing more than 1Gb of expressed sequence information. These sequences have been combined with all publicly available rainbow trout sequences, resulting in a total of 242,187 clusters of putative transcript groups and 22,373 singletons. To identify the predominantly expressed genes in different tissues of interest, we developed a Digital Differential Display (DDD) approach. This approach allowed us to characterize the genes that are predominantly expressed within each tissue of interest. Of these genes, some were already known to be tissue-specific, thereby validating our approach. Many others, however, were novel candidates, demonstrating the usefulness of our strategy and of such tissue-specific resources. This new sequence information, acquired using NGS 454-Titanium technology, deeply enriched our current knowledge of the expressed genes in rainbow trout through the identification of an increased number of tissue-specific sequences. This identification allowed a precise cDNA tissue repertoire to be characterized in several important rainbow trout tissues. The rainbow trout contig browser can be accessed at the following

  6. Statistical analysis of nucleotide runs in coding and noncoding DNA sequences.

    PubMed

    Sprizhitsky YuA; Nechipurenko YuD; Alexandrov, A A; Volkenstein, M V

    1988-10-01

    A statistical analysis of the occurrence of particular nucleotide runs in DNA sequences of different species has been carried out. There are considerable differences of run distributions in DNA sequences of procaryotes, invertebrates and vertebrates. There is an abundance of short runs (1-2 nucleotides long) in the coding sequences and there is a deficiency of such runs in the noncoding regions. However, some interesting exceptions from this rule exist for the run distribution of adenine in procaryotes and for the arrangement of purine-pyrimidine runs in eucaryotes. The similarity in the distributions of such runs in the coding and noncoding regions may be due to some structural features of the DNA molecule as a whole. Runs of guanine (or cytosine) of three to six nucleotides occur predominantly in noncoding DNA regions in eucaryotes, especially in vertebrates.

  7. The nucleotide sequence of spinach chloroplast tryptophan transfer RNA.

    PubMed Central

    Canaday, J; Guillemaut, P; Gloeckler, R; Weil, J H

    1981-01-01

    Spinach chloroplast tRNATrp, purified by column chromatography and two-dimensional gel electrophoresis, has been sequenced using in vitro labeling techniques. The sequence is : pG-C-G-C-U-C-U-U-A-G-U-U-C-A-G-U-U-C-Gm-G-D-A-G-A-A-C-m2G-psi-G-G-G-psi-C-U-C-A-A*-A-A-C-C-C-G-A-U-G-N-C-G-U-A-G-G-T-psi-C-A-A-G-U-C-C-U-A-C-A-G-A-G-C-G-U-G -C-C-AOH. Like the E. coli suppressor tRNA psu+UGA which translates both the opal terminator codon U-G-A and the tryptophan codon U-G-G, spinach chloroplast tRNATrp has C-C-A as an anticodon and contains an A-U pair in the D-stem. Images PMID:6907845

  8. Complete nucleotide sequence and transcriptional analysis of snakehead fish retrovirus.

    PubMed Central

    Hart, D; Frerichs, G N; Rambaut, A; Onions, D E

    1996-01-01

    The complete genome of the snakehead fish retrovirus has been cloned and sequenced, and its transcriptional profile in cell culture has been determined. The 11.2-kb provirus displays a complex expression pattern capable of encoding accessory proteins and is unique in the predicted location of the env initiation codon and signal peptide upstream of gag and the common splice donor site. The virus is distinguishable from all known retrovirus groups by the presence of an arginine tRNA primer binding site. The coding regions are highly divergent and show a number of unusual characteristics, including a large Gag coiled-coil region, a Pol domain of unknown function, and a long, lentiviral-like, Env cytoplasmic domain. Phylogenetic analysis of the Pol sequence emphasizes the divergent nature of the virus from the avian and mammalian retroviruses. The snakehead virus is also distinct from a previously characterized complex fish retrovirus, suggesting that discrete groups of these viruses have yet to be identified in the lower vertebrates. PMID:8648695

  9. Complete nucleotide sequence and transcriptional analysis of snakehead fish retrovirus.

    PubMed

    Hart, D; Frerichs, G N; Rambaut, A; Onions, D E

    1996-06-01

    The complete genome of the snakehead fish retrovirus has been cloned and sequenced, and its transcriptional profile in cell culture has been determined. The 11.2-kb provirus displays a complex expression pattern capable of encoding accessory proteins and is unique in the predicted location of the env initiation codon and signal peptide upstream of gag and the common splice donor site. The virus is distinguishable from all known retrovirus groups by the presence of an arginine tRNA primer binding site. The coding regions are highly divergent and show a number of unusual characteristics, including a large Gag coiled-coil region, a Pol domain of unknown function, and a long, lentiviral-like, Env cytoplasmic domain. Phylogenetic analysis of the Pol sequence emphasizes the divergent nature of the virus from the avian and mammalian retroviruses. The snakehead virus is also distinct from a previously characterized complex fish retrovirus, suggesting that discrete groups of these viruses have yet to be identified in the lower vertebrates.

  10. Nucleotide sequences of five IncF plasmid finP alleles.

    PubMed Central

    Finlay, B B; Frost, L S; Paranchych, W; Willetts, N S

    1986-01-01

    The nucleotide sequences of five finP alleles from various IncF plasmids (finP types I to V) as well as of three finP mutations were determined and compared. The finP gene specificity could be attributed to a variable, six-to-seven-nucleotide loop located between inverted repeats, and the sequence data were consistent with the product of finP being an RNA molecule rather than a protein. The finP mutations interrupted a proposed finP promoter or destabilized a predicted stem-and-loop structure in the finP RNA molecule. PMID:2426248

  11. Nucleotide sequence of a small cryptic plasmid from Acidithiobacillus ferrooxidans strain A-6

    SciTech Connect

    F. Roberto

    2003-10-01

    A 2.1 kb cryptic plasmid from Acidithiobacillus ferrooxidans strain A-6 was isolated and cloned into the E. coli vector plasmid, pUC128. The cloned plasmid was mapped by restriction enzyme fragment analysis and subsequently sequenced. At this time over half the plasmid sequence has been determined and compared to sequences in the GenBank nucleotide and protein sequence databases. Much of the plasmid remains cryptic, but substantial nucleotide and protein sequence similarities have been observed to the putative replication protein, RepA, of the small cryptic plasmids pAYS and pAYL found in the ammonia-oxidizing Nitrosomonas sp. Strain ENI-11. These results suggest an entirely new class of plasmid is maintained in at least one strain of Acidithiobacillus ferrooxidans and other acidophilic bacteria, and raises interesting questions about the origin of this plasmid in acidic environments.

  12. The complete nucleotide sequence and genomic characterization of tropical soda apple mosaic virus.

    PubMed

    Fillmer, Kornelia; Adkins, Scott; Pongam, Patchara; D'Elia, Tom

    2016-08-01

    We report the first complete genome sequence of tropical soda apple mosaic virus (TSAMV), a tobamovirus originally isolated from tropical soda apple (Solanum viarum) collected in Okeechobee, Florida. The complete genome of TSAMV is 6,350 nucleotides long and contains four open reading frames encoding the following proteins: i) 126-kDa methyltransferase/helicase (3354 nt), ii) 183-kDa polymerase (4839 nt), iii) movement protein (771 nt) and iv) coat protein (483 nt). The complete genome sequence of TSAMV shares 80.4 % nucleotide sequence identity with pepper mild mottle virus (PMMoV) and 71.2-74.2 % identity with other tobamoviruses naturally infecting members of the Solanaceae plant family. Phylogenetic analysis of the deduced amino acid sequences of the 126-kDa and 183-kDa proteins and the complete genome sequence place TSAMV in a subcluster with PMMoV within the Solanaceae-infecting subgroup of tobamoviruses.

  13. Relationships amongst bluetongue viruses revealed by comparisons of capsid and outer coat protein nucleotide sequences.

    PubMed

    Gould, A R; Pritchard, L I

    1990-08-01

    Sequence data from the gene segments coding for the capsid protein. VP3, of all eight Australian bluetongue virus serotypes were compared. The high degree of nucleotide sequence homology for VP3 genes amongst BTV isolates from the same geographic region supported previous studies (Gould, 1987; 1988b, c; Gould et al., 1988b) and was proposed as a basis for "topotyping" a bluetongue virus isolate (Gould et al., 1989). The complete nucleotide sequences which coded for the VP2 outer coat proteins of South African BTV serotypes 1 and 3 (vaccine strains) were determined and compared to cognate gene sequences from North American and Australian BTVs. These VP2 comparisons demonstrated that BTVs of the same serotype, but from different geographical regions, were closely related at the nucleotide and amino acid levels. However, close inter-relationships were also demonstrated amongst other BTVs irrespective of serotype or geographic origin. These data enabled phylogenic relationships of the BTV serotypes to be analysed using VP2 nucleotide sequences as a determinant.

  14. Nucleotide composition of CO1 sequences in Chelicerata (Arthropoda): detecting new mitogenomic rearrangements.

    PubMed

    Arabi, Juliette; Judson, Mark L I; Deharveng, Louis; Lourenço, Wilson R; Cruaud, Corinne; Hassanin, Alexandre

    2012-02-01

    Here we study the evolution of nucleotide composition in third codon-positions of CO1 sequences of Chelicerata, using a phylogenetic framework, based on 180 taxa and three markers (CO1, 18S, and 28S rRNA; 5,218 nt). The analyses of nucleotide composition were also extended to all CO1 sequences of Chelicerata found in GenBank (1,701 taxa). The results show that most species of Chelicerata have a positive strand bias in CO1, i.e., in favor of C nucleotides, including all Amblypygi, Palpigradi, Ricinulei, Solifugae, Uropygi, and Xiphosura. However, several taxa show a negative strand bias, i.e., in favor of G nucleotides: all Scorpiones, Opisthothelae spiders and several taxa within Acari, Opiliones, Pseudoscorpiones, and Pycnogonida. Several reversals of strand-specific bias can be attributed to either a rearrangement of the control region or an inversion of a fragment containing the CO1 gene. Key taxa for which sequencing of complete mitochondrial genomes will be necessary to determine the origin and nature of mtDNA rearrangements involved in the reversals are identified. Acari, Opiliones, Pseudoscorpiones, and Pycnogonida were found to show a strong variability in nucleotide composition. In addition, both mitochondrial and nuclear genomes have been affected by higher substitution rates in Acari and Pseudoscorpiones. The results therefore indicate that these two orders are more liable to fix mutations of all types, including base substitutions, indels, and genomic rearrangements.

  15. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail

    PubMed Central

    Niraj, Diwesh Kumar; Kumar, Pushpendra; Mishra, Chinmoy; Narayan, Raj; Bhattacharya, Tarun Kumar; Shrivastava, Kush; Bhushan, Bharat; Tiwari, Ashok Kumar; Saxena, Vishesh; Sahoo, Nihar Ranjan; Sharma, Deepak

    2015-01-01

    Aim: An attempt has been made to study the Myxovirus resistant (Mx1) gene polymorphism in Japanese quail. Materials and Methods: In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region), Fragment II of 148 bp (Exon 5 region), Fragment III of 161 bp (Exon 7 region), and Fragment IV of 176 bp (Exon 13 region) of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Results: Out of the four fragments, one fragment (Fragment II) was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV) were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. Conclusion: The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail. PMID:27047057

  16. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

    PubMed

    Hargreaves, Adam D; Mulley, John F

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species. PMID:26623194

  17. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

    PubMed Central

    Hargreaves, Adam D.

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species. PMID:26623194

  18. Complete nucleotide sequence of the chlorarachniophyte nucleomorph: nature's smallest nucleus.

    PubMed

    Gilson, Paul R; Su, Vanessa; Slamovits, Claudio H; Reith, Michael E; Keeling, Patrick J; McFadden, Geoffrey I

    2006-06-20

    The introduction of plastids into different heterotrophic protists created lineages of algae that diversified explosively, proliferated in marine and freshwater environments, and radically altered the biosphere. The origins of these secondary plastids are usually inferred from the presence of additional plastid membranes. However, two examples provide unique snapshots of secondary-endosymbiosis-in-action, because they retain a vestige of the endosymbiont nucleus known as the nucleomorph. These are chlorarachniophytes and cryptomonads, which acquired their plastids from a green and red alga respectively. To allow comparisons between them, we have sequenced the nucleomorph genome from the chlorarachniophyte Bigelowiella natans: at a mere 373,000 bp and with only 331 genes, the smallest nuclear genome known and a model for extreme reduction. The genome is eukaryotic in nature, with three linear chromosomes containing densely packed genes with numerous overlaps. The genome is replete with 852 introns, but these are the smallest introns known, being only 18, 19, 20, or 21 nt in length. These pygmy introns are shown to be miniaturized versions of normal-sized introns present in the endosymbiont at the time of capture. Seventeen nucleomorph genes encode proteins that function in the plastid. The other nucleomorph genes are housekeeping entities, presumably underpinning maintenance and expression of these plastid proteins. Chlorarachniophyte plastids are thus serviced by three different genomes (plastid, nucleomorph, and host nucleus) requiring remarkable coordination and targeting. Although originating by two independent endosymbioses, chlorarachniophyte and cryptomonad nucleomorph genomes have converged upon remarkably similar architectures but differ in many molecular details that reflect two distinct trajectories to hypercompaction and reduction.

  19. On the feasibility of using the intrinsic fluorescence of nucleotides for DNA sequencing.

    SciTech Connect

    Chowdhury, M. H.; Ray, K.; Johnson, R. L.; Gray, S. K.; Pond, J.; Lakowicz, J. R.; Univ. of Maryland; Univ. of Virginia; Lumerical Solutions, Inc.

    2010-04-29

    There is presently a worldwide effort to increase the speed and decrease the cost of DNA sequencing as exemplified by the goal of the National Human Genome Research Institute (NHGRI) to sequence a human genome for under $1000. Several high throughput technologies are under development. Among these, single strand sequencing using exonuclease appear very promising. However, this approach requires complete labeling of at least two bases at a time, with extrinsic high quantum yield probes. This is necessary because nucleotides absorb in the deep ultraviolet (UV) and emit with extremely low quantum yields. Hence intrinsic emission from DNA and nucleotides is not being exploited for DNA sequencing. In the present paper we consider the possibility of identifying single nucleotides using their intrinsic emission. We used the finite-difference time-domain (FDTD) method to calculate the effects of aluminum nanoparticles on nearby fluorophores that emit in the UV. We find that the radiated power of UV fluorophores is significantly increased when they are in close proximity to aluminum nanostructures. We show that there will be increased localized excitation near aluminum particles at wavelengths used to excite intrinsic nucleotide emission. Using FDTD simulation we show that a typical DNA base when coupled to appropriate aluminum nanostructures leads to highly directional emission. Additionally we present experimental results showing that a thin film of nucleotides show enhanced emission when in close proximity to aluminum nanostructures. Finally we provide Monte Carlo simulations that predict high levels of base calling accuracy for an assumed number of photons that is derived from the emission spectra of the intrinsic fluorescence of the bases. Our results suggest that single nucleotides can be detected and identified using aluminum nanostructures that enhance their intrinsic emission. This capability would be valuable for the ongoing efforts toward the $1000 genome.

  20. Characterization of gamma-crystallin from a catfish: structural characterization of one major isoform with high methionine by cDNA sequencing.

    PubMed

    Pan, F M; Chang, W C; Lin, C H; Hsu, A L; Chiou, S H

    1995-04-01

    gamma-Crystallin is the major and most abundant lens protein present in the eye lens of most teleostean fishes. To facilitate structural characterization of gamma-crystallins isolated from the lens of the catfishes (Clarias fuscus), a cDNA mixture was synthesized from the poly(A)+mRNA isolated from fresh eye lenses, and amplification by polymerase chain reaction (PCR) was adopted to obtain cDNAs encoding various gamma-crystallins. Plasmids of transformed E. coli strain JM109 containing amplified gamma-crystallin cDNAs were purified and prepared for nucleotide sequencing by the dideoxynucleotide chain-termination method. Sequencing more than five clones containing DNA inserts of 0.52 kb revealed the presence of one major isoform with a complete reading frame of 534 base pairs, covering a gamma-crystallin (gamma M1) with a deduced protein sequence of 177 amino acids excluding the initiating methionine. It was of interest to find that this crystallin of pI 9.1 contains a high-methionine content of 15.3% in contrast to those gamma-crystallins of low-methionine content from most mammalian lenses. Sequence comparisons of catfish gamma M1-crystallin with those published sequences of gamma-crystallins from carp, bovine and mouse lenses indicate that there is approx. an 82% sequence homology between the catfish and the carp species of piscine class whereas only 51-58% homology is found between mammals and the catfish. Moreover the differences in the hydropathy profiles for these two groups of gamma-crystallins, i.e. one with a high-methionine content from teleostean fishes and the other with a low-methionine content from mammalian species, reflect a distinct variance in the polarity distributions of surface amino acids in these crystallins.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Nucleotide sequence of the alpha-amylase-pullulanase gene from Clostridium thermohydrosulfuricum.

    PubMed

    Melasniemi, H; Paloheimo, M; Hemiö, L

    1990-03-01

    The nucleotide sequence of the gene (apu) encoding the thermostable alpha-amylase-pullulanase of Clostridium thermohydrosulfuricum was determined. An open reading frame of 4425 bp was present. The deduced polypeptide (Mr 165,600), including a 31 amino acid putative signal sequence, comprised 1475 amino acids, with no cysteine residues. The structural gene was preceded by the consensus promoter sequence TTGACA TATAAT, a putative regulatory sequence and a putative ribosome-binding sequence AAAGGGGG. The codon usage resembled that of Bacillus genes. The deduced sequence of the mature apu product showed similarities to various amylolytic enzymes, especially the neopullulanase of Bacillus stearothermophilus, whereas the signal sequence showed similarity to those of the alpha-amylases of B. stearothermophilus and B. subtilis. Three regions thought to be highly conserved in the primary structure of alpha-amylases could also be distinguished in the apu product, two being partly 'duplicated' in this alpha-1,4/alpha-1,6-active enzyme.

  2. Nucleotide and amino acid sequences of human intestinal alkaline phosphatase: close homology to placental alkaline phosphatase

    SciTech Connect

    Henthorn, P.S.; Raducha, M.; Edwards, Y.H.; Weiss, M.J.; Slaughter, C.; Lafferty, M.A.; Harris, H.

    1987-03-01

    A cDNA clone for human adult intestinal alkaline phosphatase (ALP) (orthophosphoric-monoester phosphohydrolase (alkaline optimum); EC 3.1.3.1) was isolated from a lambdagt11 expression library. The cDNA insert of this clone is 2513 base pairs in length and contains an open reading frame that encodes a 528-amino acid polypeptide. This deduced polypeptide contains the first 40 amino acids of human intestinal ALP, as determined by direct protein sequencing. Intestinal ALP shows 86.5% amino acid identity to placental (type 1) ALP and 56.6% amino acid identity to liver/bone/kidney ALP. In the 3'-untranslated regions, intestinal and placental ALP cDNAs are 73.5% identical (excluding gaps). The evolution of this multigene enzyme family is discussed.

  3. The vicilin gene family of pea (Pisum sativum L.): a complete cDNA coding sequence for preprovicilin.

    PubMed Central

    Lycett, G W; Delauney, A J; Gatehouse, J A; Gilroy, J; Croy, R R; Boulter, D

    1983-01-01

    A cDNA plasmid bank has been constructed using mRNA from developing pea seeds and three cDNAs coding for vicilin polypeptides have been selected. These cDNAs have been sequenced and between them cover the whole of the coding sequence plus part of the 5' and 3' untranslated regions. Comparison with amino acid sequence data from the protein indicates that vicilin is synthesised as preprovicilin with subsequent removal of a signal peptide and a C-terminal peptide as well as post translational endo-proteolytic cleavage. The cDNAs represent two different classes of vicilin genes whilst amino acid data show that there are at least three major classes of vicilin polypeptide. The vicilin sequences show extensive homology with conglycinin and phaseolin except in the regions of the internal proteolytic cleavages. The evolutionary significance of this relationship is discussed. Images PMID:6687941

  4. Identification, characterization, and analysis of cDNA and genomic sequences encoding two different small heat shock proteins in Hordeum vulgare.

    PubMed

    Marmiroli, N; Pavesi, A; Di Cola, G; Hartings, H; Raho, G; Conte, M R; Perrotta, C

    1993-12-01

    In vitro translation of mRNAs prepared from barley (Hordeum vulgare) seedlings (cv. Onice) exposed at 40 degrees C directed the synthesis of major heat shock proteins (HSPs) with molecular masses of 80-90, 70, 42 and 16-22 kDa. A cDNA library prepared from the 40 degrees C mRNAs and screened by differential hybridization led to the isolation of heat shock specific sequences. One of these (Hv hsp18) was confirmed by hybrid-arrested and hybrid-released translation as encoding for an 18-kDa HSP. The barley hsp18 sequence has an open reading frame encoding a 160 amino acid residue 18-kDa protein that is 63% identical to wheat 16.9-kDa HSP (clone C5-8), 54% identical to soybean (Glycine max) 17.5-kDa HSP, and 49% identical to Arabidopsis thaliana 17.6-kDa HSP. Lower similarities were found with class II plant small HSPs such as soybean 17.9-kDa HSP (27%), Pisum sativum 17.7-kDa HSP (30%), wheat (Triticum aestivum) 17.3-kDa HSP (clone Ta hsp 17.3) (30%), and with animal small HSPs and alpha-crystallins. The Hv hsp18 sequence was used to pick up Hv hsp17 genomic sequence encoding for another class I 17-kDa HSP. By computer analysis of the nucleotide sequence the TATA box, two heat shock promoter elements, a metal-ion response element, and the polyadenylation signals were identified. Barley HSP18 has an additional cysteine-rich region when compared with HSP17 mapping at the carboxy terminal end. PMID:8112573

  5. Nucleotide sequence of a cloned woodchuck hepatitis virus genome: evolutional relationship between hepadnaviruses.

    PubMed Central

    Kodama, K; Ogasawara, N; Yoshikawa, H; Murakami, S

    1985-01-01

    We have determined the complete nucleotide sequence of a cloned DNA of woodchuck hepatitis virus (WHV), the most oncogenic virus among hepadnaviruses. The genome, designated WHV2, is 3,320 base pairs long and contains four major open reading frames (ORFs) coded on the same strand of nucleotide sequence as in the human hepatitis B virus (HBV) genome. Comparison of the nucleotide sequence and amino acid sequences deduced from it among the genomes of various hepadnaviruses demonstrates that each protein shows an intrinsic property in conserving its amino acid sequence. A parameter, the ratio of the number of triplets with one-letter change but no amino acid substitution to the total number of triplets in which one-letter change occurred, was introduced to measure the intrinsic properties quantitatively. For each ORF, the parameter gave characteristic values in all combinations. Therefore, the relative evolutional distance between these hepadnaviruses can be measured by the amino acid substitution rate of any ORF. These comparisons suggest that (i) the difference between two WHV clones, WHV1 and WHV2, corresponds to that among clones of a HBV subtype, HBVadr, and (ii) WHV and ground squirrel hepatitis virus can be categorized in a way similar to the subgroups of HBV. PMID:3855246

  6. Drosophila melanogaster mitochondrial DNA: completion of the nucleotide sequence and evolutionary comparisons.

    PubMed

    Lewis, D L; Farr, C L; Kaguni, L S

    1995-11-01

    The nucleotide sequence of the regions flanking the A+T region of Drosophila melanogaster mitochondrial DNA (mtDNA) has been determined. Included are the genes encoding the transfer RNAs for valine, isoleucine, glutamine and methionine, the small ribosomal RNA and the 5'-coding sequences of the large ribosomal RNA and NADH dehydrogenase subunit II. This completes the nucleotide sequence of the D. melanogaster mitochondrial genome. The circular mtDNA of D. melanogaster varies in size among different populations largely due to length differences in the control region (Fauron & Wolstenholme, 1976; Fauron & Wolstenholme, 1980a, b); the mtDNA region we have sequenced, combined with those sequenced by others, yields a composite genome that is 19,517 bp in length as compared to 16,019 bp for the mtDNA of D. yakuba. D. melanogaster mtDNA exhibits an extreme bias in base composition; it comprises 82.2% deoxyadenylate and thymidylate residues as compared to 78.6% in D. yakuba mtDNA. All genes encoded in the mtDNA of both species are in identical locations and orientations. Nucleotide substitution analysis reveals that tRNA and rRNA genes evolve at less than half the rate of protein coding genes.

  7. The human myelin oligodendrocyte glycoprotein (MOG) gene: Complete nucleotide sequence and structural characterization

    SciTech Connect

    Paule Roth, M.; Malfroy, L.; Offer, C.; Sevin, J.; Enault, G.; Borot, N.; Pontarotti, P.; Coppin, H.

    1995-07-20

    Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequences within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.

  8. Nucleotide sequence and genome organization of atractylodes mottle virus, a new member of the genus Carlavirus.

    PubMed

    Zhao, Fumei; Igori, Davaajargal; Lim, Seungmo; Yoo, Ran Hee; Lee, Su-Heon; Moon, Jae Sun

    2015-11-01

    The complete genome sequence of a member of a distinct species of the genus Carlavirus in the family Betaflexiviridae, tentatively named atractylodes mottle virus (AtrMoV), has been determined. Analysis of its genomic organization indicates that it has a single-stranded, positive-sense genomic RNA of 8866 nucleotides, excluding the poly(A) tail, and consists of six open reading frames typical of members of the genus Carlavirus. The individual open reading frames of AtrMoV show moderately low sequence similarity to those of other carlaviruses at the nucleotide and amino acid sequence levels. Pairwise comparison and phylogenetic analysis suggest that AtrMoV is most closely related to chrysanthemum virus B. PMID:26264403

  9. Analysis of the complete nucleotide sequence of the Agrobacterium tumefaciens virB operon.

    PubMed

    Thompson, D V; Melchers, L S; Idler, K B; Schilperoort, R A; Hooykaas, P J

    1988-05-25

    The complete nucleotide sequence of the virB locus, from the octopine Ti plasmid of Agrobacterium tumefaciens strain 15955, has been determined. In the large virB-operon (9600 nucleotides) we have identified eleven open reading frames, designated virB1 to virB11. From DNA sequence analysis it is proposed that nearly all VirB products, i.e. VirB1 to VirB9, are secreted or membrane associated proteins. Interestingly, both a membrane protein (VirB4) and a potential cytoplasmic protein (VirB11) contain the consensus amino acid sequence of ATP-binding proteins. In view of the conjugative T-DNA transfer model, the VirB proteins are suggested to act at the bacterial surface and there play an important role in directing T-DNA transfer to plant cells. PMID:2837739

  10. A sequence of seventy-three nucleotides from the coliphage R17 genome

    PubMed Central

    Rensing, Ulrich F. E.

    1973-01-01

    1. A sequence of 73 nucleotides of the RNA genome from coliphage R17 was determined. It can be read through in only one translational frame. The fragment is not part of the coatprotein cistron (Min Jou et al., 1972), nor does it come from the untranslated sequences described previously (Steitz, 1969; Nichols, 1970; Cory et al., 1970; de Wachter et al., 1971; Contreras et al., 1971; Cory et al., 1972). It contains two sequences of 23 and 24 nucleotides, 22 of which are identical. This kind of reiteration is the first one found in bacteriophage nucleic acid. 2. Improved conditions were found and tested for blocking oligonucleotides with carbodi-imide and cleaving by ribonuclease A at cytidylate residues. 3. A synthetic medium is described which allows labelling in vivo with 32P to give specific radioactivities higher than those obtained in the procedures used previously. ImagesPLATE 1PLATE 2PLATE 3 PMID:4352721

  11. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

    PubMed

    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

    2016-04-01

    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. PMID

  12. Chicken genomics resource: sequencing and annotation of 35,407 ESTs from single and multiple tissue cDNA libraries and CAP3 assembly of a chicken gene index.

    PubMed

    Carre, Wilfrid; Wang, Xiaofei; Porter, Tom E; Nys, Yves; Tang, Jianshan; Bernberg, Erin; Morgan, Robin; Burnside, Joan; Aggrey, Samuel E; Simon, Jean; Cogburn, Larry A

    2006-05-16

    Its accessibility, unique evolutionary position, and recently assembled genome sequence have advanced the chicken to the forefront of comparative genomics and developmental biology research as a model organism. Several chicken expressed sequence tag (EST) projects have placed the chicken in 10th place for accrued ESTs among all organisms in GenBank. We have completed the single-pass 5'-end sequencing of 37,557 chicken cDNA clones from several single and multiple tissue cDNA libraries and have entered 35,407 EST sequences into GenBank. Our chicken EST sequences and those found in public databases (on July 1, 2004) provided a total of 517,727 public chicken ESTs and mRNAs. These sequences were used in the CAP3 assembly of a chicken gene index composed of 40,850 contigs and 79,192 unassembled singlets. The CAP3 contigs show a 96.7% match to the chicken genome sequence. The University of Delaware (UD) EST collection (43,928 clones) was assembled into 19,237 nonredundant sequences (13,495 contigs and 5,742 unassembled singlets). The UD collection contains 6,223 unique sequences that are not found in other public EST collections but show a 76% match to the chicken genome sequence. Our chicken contig and singlet sequences were annotated according to the highest BlastX and/or BlastN hits. The UD CAP3 contig assemblies and singlets are searchable by nucleotide sequence or key word (http://cogburn.dbi.udel.edu), and the cDNA clones are readily available for distribution from the chick EST website and clone repository (http://www.chickest.udel.edu). The present paper describes the construction and normalization of single and multiple tissue chicken cDNA libraries, high-throughput EST sequencing from these libraries, the CAP3 assembly of a chicken gene index from all public ESTs, and the identification of several nonredundant chicken gene sets for production of custom DNA microarrays.

  13. Complete nucleotide sequence of a subviral DNA molecule of porcine circovirus type 2.

    PubMed

    Wen, Han

    2016-07-01

    Porcine circovirus type 2 (PCV2) is a member of the genus Circovirus in the family Circoviridae. Most subgenomic molecules of PCV2 have been mapped. Here, the first full-length sequence of a subviral molecule of PCV2 (CH-IVT12) containing a reverse complement sequence of the PCV2 genome was determined by sequencing DNA extracted from PK15 cells infected with PCV2. The circular CH-IVT12 DNA consists of 1136 nucleotides and contains one major open reading frame. PMID:27084550

  14. Sequence selective naked-eye detection of DNA harnessing extension of oligonucleotide-modified nucleotides.

    PubMed

    Verga, Daniela; Welter, Moritz; Marx, Andreas

    2016-02-01

    DNA polymerases can efficiently and sequence selectively incorporate oligonucleotide (ODN)-modified nucleotides and the incorporated oligonucleotide strand can be employed as primer in rolling circle amplification (RCA). The effective amplification of the DNA primer by Φ29 DNA polymerase allows the sequence-selective hybridisation of the amplified strand with a G-quadruplex DNA sequence that has horse radish peroxidase-like activity. Based on these findings we develop a system that allows DNA detection with single-base resolution by naked eye.

  15. Sequence selective naked-eye detection of DNA harnessing extension of oligonucleotide-modified nucleotides.

    PubMed

    Verga, Daniela; Welter, Moritz; Marx, Andreas

    2016-02-01

    DNA polymerases can efficiently and sequence selectively incorporate oligonucleotide (ODN)-modified nucleotides and the incorporated oligonucleotide strand can be employed as primer in rolling circle amplification (RCA). The effective amplification of the DNA primer by Φ29 DNA polymerase allows the sequence-selective hybridisation of the amplified strand with a G-quadruplex DNA sequence that has horse radish peroxidase-like activity. Based on these findings we develop a system that allows DNA detection with single-base resolution by naked eye. PMID:26774580

  16. The nucleotide sequence at the termini of adenovirus type 5 DNA.

    PubMed Central

    Steenbergh, P H; Maat, J; van Ormondt, H; Sussenbach, J S

    1977-01-01

    The sequences of the first 194 base pairs at both termini of adenovirus type 5 (Ad5) DNA have been determined, using the chemical degradation technique developed by Maxam and Gilbert (Proc. Nat. Acad. Sci. USA 74 (1977), pp. 560-564). The nucleotide sequences 1-75 were confirmed by analysis of labeled RNA transcribed from the terminal HhaI fragments in vitro. The sequence data show that Ad5 DNA has a perfect inverted terminal repetition of 103 base pairs long. Images PMID:600799

  17. Complete nucleotide sequence analysis of a Dengue-1 virus isolated on Easter Island, Chile.

    PubMed

    Cáceres, C; Yung, V; Araya, P; Tognarelli, J; Villagra, E; Vera, L; Fernández, J

    2008-01-01

    Dengue-1 viruses responsible for the dengue fever outbreak in Easter Island in 2002 were isolated from acute-phase sera of dengue fever patients. In order to analyze the complete genome sequence, we designed primers to amplify contiguous segments across the entire sequence of the viral genome. RT-PCR products obtained were cloned, and complete nucleotide and deduced amino acid sequences were determined. This report constitutes the first complete genetic characterization of a DENV-1 isolate from Chile. Phylogenetic analysis shows that an Easter Island isolate is most closely related to Pacific DENV-1 genotype IV viruses.

  18. Sequence of cDNA for rat cystathionine gamma-lyase and comparison of deduced amino acid sequence with related Escherichia coli enzymes.

    PubMed Central

    Erickson, P F; Maxwell, I H; Su, L J; Baumann, M; Glode, L M

    1990-01-01

    A cDNA clone for cystathionine gamma-lyase was isolated from a rat cDNA library in lambda gt11 by screening with a monospecific antiserum. The identity of this clone, containing 600 bp proximal to the 3'-end of the gene, was confirmed by positive hybridization selection. Northern-blot hybridization showed the expected higher abundance of the corresponding mRNA in liver than in brain. Two further cDNA clones from a plasmid pcD library were isolated by colony hybridization with the first clone and were found to contain inserts of 1600 and 1850 bp. One of these was confirmed as encoding cystathionine gamma-lyase by hybridization with two independent pools of oligodeoxynucleotides corresponding to partial amino acid sequence information for cystathionine gamma-lyase. The other clone (estimated to represent all but 8% of the 5'-end of the mRNA) was sequenced and its deduced amino acid sequence showed similarity to those of the Escherichia coli enzymes cystathionine beta-lyase and cystathionine gamma-synthase throughout its length, especially to that of the latter. Images Fig. 1. Fig. 2. Fig. 3. Fig. 5. PMID:2201285

  19. Complete nucleotide sequence of wound tumor virus genomic segments encoding nonstructural polypeptides.

    PubMed

    Anzola, J V; Dall, D J; Xu, Z K; Nuss, D L

    1989-07-01

    Sequence analysis of the genomic segments which encode the five wound tumor virus nonstructural polypeptides has been completed. The complete nucleotide sequence of segments S4 (2565 bp), S6 (1700 bp), S9 (1182 bp), and S10 (1172 bp) are presented in this report while the sequence of segment S12 (851 bp) has been described previously (T. Asamizu, D. Summers, M. B. Motika, J. V. Anzola, and D. L. Nuss, 1985, Virology 144, 398-409). Comparison of the only published sequence for another member of the genus Phytoreovirus, that of rice dwarf virus segment S10, with the combined available wound tumor virus sequence data revealed similarity with WTV segment S10: 54.9 and 30.6% at the nucleotide and amino acid level, respectively. Although wound tumor virus and rice dwarf virus differ in plant host range, tissue specificity, vector range, and disease symptom expression, the level of sequence similarity shared by the two segments suggests a common origin for these viruses. The potential use of a phytoreovirus sequence database for predicting functions of viral encoded gene products is considered.

  20. Nucleotide binding database NBDB – a collection of sequence motifs with specific protein-ligand interactions

    PubMed Central

    Zheng, Zejun; Goncearenco, Alexander; Berezovsky, Igor N.

    2016-01-01

    NBDB database describes protein motifs, elementary functional loops (EFLs) that are involved in binding of nucleotide-containing ligands and other biologically relevant cofactors/coenzymes, including ATP, AMP, ATP, GMP, GDP, GTP, CTP, PAP, PPS, FMN, FAD(H), NAD(H), NADP, cAMP, cGMP, c-di-AMP and c-di-GMP, ThPP, THD, F-420, ACO, CoA, PLP and SAM. The database is freely available online at http://nbdb.bii.a-star.edu.sg. In total, NBDB contains data on 249 motifs that work in interactions with 24 ligands. Sequence profiles of EFL motifs were derived de novo from nonredundant Uniprot proteome sequences. Conserved amino acid residues in the profiles interact specifically with distinct chemical parts of nucleotide-containing ligands, such as nitrogenous bases, phosphate groups, ribose, nicotinamide, and flavin moieties. Each EFL profile in the database is characterized by a pattern of corresponding ligand–protein interactions found in crystallized ligand–protein complexes. NBDB database helps to explore the determinants of nucleotide and cofactor binding in different protein folds and families. NBDB can also detect fragments that match to profiles of particular EFLs in the protein sequence provided by user. Comprehensive information on sequence, structures, and interactions of EFLs with ligands provides a foundation for experimental and computational efforts on design of required protein functions. PMID:26507856

  1. Nucleotide binding database NBDB--a collection of sequence motifs with specific protein-ligand interactions.

    PubMed

    Zheng, Zejun; Goncearenco, Alexander; Berezovsky, Igor N

    2016-01-01

    NBDB database describes protein motifs, elementary functional loops (EFLs) that are involved in binding of nucleotide-containing ligands and other biologically relevant cofactors/coenzymes, including ATP, AMP, ATP, GMP, GDP, GTP, CTP, PAP, PPS, FMN, FAD(H), NAD(H), NADP, cAMP, cGMP, c-di-AMP and c-di-GMP, ThPP, THD, F-420, ACO, CoA, PLP and SAM. The database is freely available online at http://nbdb.bii.a-star.edu.sg. In total, NBDB contains data on 249 motifs that work in interactions with 24 ligands. Sequence profiles of EFL motifs were derived de novo from nonredundant Uniprot proteome sequences. Conserved amino acid residues in the profiles interact specifically with distinct chemical parts of nucleotide-containing ligands, such as nitrogenous bases, phosphate groups, ribose, nicotinamide, and flavin moieties. Each EFL profile in the database is characterized by a pattern of corresponding ligand-protein interactions found in crystallized ligand-protein complexes. NBDB database helps to explore the determinants of nucleotide and cofactor binding in different protein folds and families. NBDB can also detect fragments that match to profiles of particular EFLs in the protein sequence provided by user. Comprehensive information on sequence, structures, and interactions of EFLs with ligands provides a foundation for experimental and computational efforts on design of required protein functions.

  2. Nucleotide binding database NBDB--a collection of sequence motifs with specific protein-ligand interactions.

    PubMed

    Zheng, Zejun; Goncearenco, Alexander; Berezovsky, Igor N

    2016-01-01

    NBDB database describes protein motifs, elementary functional loops (EFLs) that are involved in binding of nucleotide-containing ligands and other biologically relevant cofactors/coenzymes, including ATP, AMP, ATP, GMP, GDP, GTP, CTP, PAP, PPS, FMN, FAD(H), NAD(H), NADP, cAMP, cGMP, c-di-AMP and c-di-GMP, ThPP, THD, F-420, ACO, CoA, PLP and SAM. The database is freely available online at http://nbdb.bii.a-star.edu.sg. In total, NBDB contains data on 249 motifs that work in interactions with 24 ligands. Sequence profiles of EFL motifs were derived de novo from nonredundant Uniprot proteome sequences. Conserved amino acid residues in the profiles interact specifically with distinct chemical parts of nucleotide-containing ligands, such as nitrogenous bases, phosphate groups, ribose, nicotinamide, and flavin moieties. Each EFL profile in the database is characterized by a pattern of corresponding ligand-protein interactions found in crystallized ligand-protein complexes. NBDB database helps to explore the determinants of nucleotide and cofactor binding in different protein folds and families. NBDB can also detect fragments that match to profiles of particular EFLs in the protein sequence provided by user. Comprehensive information on sequence, structures, and interactions of EFLs with ligands provides a foundation for experimental and computational efforts on design of required protein functions. PMID:26507856

  3. Linking the human cytogenetic map with nucleotide sequence: the CCAP clone set.

    PubMed

    Jang, Wonhee; Yonescu, Raluca; Knutsen, Turid; Brown, Theresa; Reppert, Tricia; Sirotkin, Karl; Schuler, Gregory D; Ried, Thomas; Kirsch, Ilan R

    2006-07-15

    We present the completed dataset and clone repository of the Cancer Chromosome Aberration Project (CCAP), an initiative developed and funded through the intramural program of the U.S. National Cancer Institute, to provide seamless linkage of human cytogenetic markers with the primary nucleotide sequence of the human genome. Spaced at 1-2 Mb intervals across the human genome, 1,339 bacterial artificial chromosome (BAC) clones have been localized to chromosomal bands through high-resolution fluorescence in situ hybridization (FISH) mapping. Of these clones, 99.8% can be positioned on the primary human genome sequence and 95% are placed at or close to their precise nucleotide starts and stops. This dataset can be studied and manipulated within generally available public Web sites. The clones are available from a commercial repository. The CCAP BAC clone set provides anchors for the interrogation of gene and sequence involvement in oncogenic and developmental disorders when the starting point is the recognition of a structural, numerical, or interstitial chromosomal aberration. This dataset also provides a current view of the quality and coherence of the available genome sequence and insight into the nucleotide and three-dimensional structures that manifest as Giemsa light and dark chromosomal banding patterns.

  4. Linking the human cytogenetic map with nucleotide sequence: the CCAP clone set.

    PubMed

    Jang, Wonhee; Yonescu, Raluca; Knutsen, Turid; Brown, Theresa; Reppert, Tricia; Sirotkin, Karl; Schuler, Gregory D; Ried, Thomas; Kirsch, Ilan R

    2006-07-15

    We present the completed dataset and clone repository of the Cancer Chromosome Aberration Project (CCAP), an initiative developed and funded through the intramural program of the U.S. National Cancer Institute, to provide seamless linkage of human cytogenetic markers with the primary nucleotide sequence of the human genome. Spaced at 1-2 Mb intervals across the human genome, 1,339 bacterial artificial chromosome (BAC) clones have been localized to chromosomal bands through high-resolution fluorescence in situ hybridization (FISH) mapping. Of these clones, 99.8% can be positioned on the primary human genome sequence and 95% are placed at or close to their precise nucleotide starts and stops. This dataset can be studied and manipulated within generally available public Web sites. The clones are available from a commercial repository. The CCAP BAC clone set provides anchors for the interrogation of gene and sequence involvement in oncogenic and developmental disorders when the starting point is the recognition of a structural, numerical, or interstitial chromosomal aberration. This dataset also provides a current view of the quality and coherence of the available genome sequence and insight into the nucleotide and three-dimensional structures that manifest as Giemsa light and dark chromosomal banding patterns. PMID:16843097

  5. Canine amino acid transport system Xc(-): cDNA sequence, distribution and cystine transport activity in lens epithelial cells.

    PubMed

    Maruo, Takuya; Kanemaki, Nobuyuki; Onda, Ken; Sato, Reiichiro; Ichihara, Nobuteru; Ochiai, Hideharu

    2014-04-01

    The cystine transport activity of a lens epithelial cell line originated from a canine mature cataract was investigated. The distinct cystine transport activity was observed, which was inhibited to 28% by extracellular 1 mM glutamate. The cDNA sequences of canine cysteine/glutamate exchanger (xCT) and 4F2hc were determined. The predicted amino acid sequences were 527 and 533 amino acid polypeptides, respectively. The amino acid sequences of canine xCT and 4F2hc showed high similarities (>80%) to those of humans. The expression of xCT in lens epithelial cell line was confirmed by western blot analysis. RT-PCR analysis revealed high level expression only in the brain, and it was below the detectable level in other tissues.

  6. Nucleotide sequences of an important functional gene hnRNPA2/B1 from Ailuropoda melanoleuca and Ursus thibetanus mupinensis and its potential value in phylogenetic study.

    PubMed

    Du, Yu-jie; Hou, Yi-ling; Hou, Wan-ru

    2014-01-01

    The cDNA fragments of hnRNPA2/B1 were cloned from the giant panda and black bear using RT-PCR method, which were, respectively, 1029bp and 1026bp in length encoding 343 and 341 amino acids. Analysis indicated the cDNA cloned from the giant panda encoded variant B1 while the cDNA cloned from black bear encoded variant A2. Analyzing the hnRNPA2B1 peptide of the giant panda and black bear, 76 glycine residues and 86 glycine residues were, respectively, found, and moreover, most glycine are concentrated in the latter halves of the hnRNPA2B1 peptides. Functional sites prediction also showed many N-myristoylation sites existed in the glycine-rich domain, which is probably related to the role of telomere maintenance. From base bias and substitution analysis, we can conclude that the ORF of hnRNPA2/B1 biased G while hated C, and transition of the third site did not achieve the level of saturation. Orthology analysis indicated that both the nucleotide sequence and the deduced amino acid sequence showed high identity to other 26 hnRNPA2/B1 sequences from mammals and nonmammals reported. These sequences were used to construct phylogenetic trees employing the NJ method with 1000 bootstrap, and the obtained tree demonstrated similar topology with the classical systematics, which suggested the potential value of hnRNPA2/B1 in phylogenetic analysis. This report will be the first step to the study function of hnRNPA2/B1 in the giant panda and black bear, and will provide a scientific basis to disease surveillance, captive breeding, and conservation of the endangered species. PMID:24588753

  7. Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

    PubMed

    Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

    2014-01-01

    High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

  8. Cloning, sequencing and expression of cDNA of bovine neutrophil beta-defensin from water buffalo (Bubalus bubalis).

    PubMed

    Bera, B C; Chaudhury, P; Bhattacharya, D; Bera, A K; Das, S K

    2007-06-01

    Neutrophil beta-defensins have been identified as naturally occurring potent antibacterial cationic peptides serving as effector molecules of innate immunity that provide a first line of defence against pathogens. Considering the broad-spectrum antimicrobial activity against microorganisms and role in innate immunity of the neutrophil beta-defensins, it has been characterized in many livestock species including cattle, sheep, caprine and porcines. Here we report the isolation, cloning, sequencing and expression of precursor bovine neutrophil beta-defensin isolated from Indian water buffalo. Full-length cDNA was amplified using reverse transcription polymerase chain reaction (RT-PCR). The cDNA contained an open reading frame of 192 bp encoding a putative polypeptide of 63 amino acids. Deduced amino acid sequence of buffalo BNBD4 showed varying amino acid identity with the published sequences of related beta-defensins of other domestic ruminant species ranging from 67.18 to 79.68%. Recombinant buffalo defensin was produced in Escherichia coli as fusion protein.

  9. Selective Recovery of 16S rRNA Sequences from Natural Microbial Communities in the Form of cDNA.

    PubMed

    Weller, R; Ward, D M

    1989-07-01

    Cloning of cDNA obtained from 16S rRNA (16S rcDNA) selectively retrieves species-specific sequence information useful for analyzing the composition and structure of natural microbial communities. With this technique we obtained recombinant 16S rcDNA libraries from Escherichia coli and from a model hot-spring cyanobacterial-mat community. The recombinant plasmids contained exclusively 16S rRNA-derived inserts. This selective approach is independent of biasing culture techniques and eliminates the laborious screening required to locate 16S rRNA gene-bearing recombinants in genomic DNA libraries obtained from natural communities. PMID:16347975

  10. Cloning and nucleotide sequence of the anaerobically regulated pepT gene of Salmonella typhimurium.

    PubMed Central

    Miller, C G; Miller, J L; Bagga, D A

    1991-01-01

    The anaerobically regulated pepT gene of Salmonella typhimurium has been cloned in pBR328. Strains carrying the pepT plasmid, pJG17, overproduce peptidase T by approximately 70-fold. The nucleotide sequence of a 2.5-kb region including pepT has been determined. The sequence codes for a protein of 44,855 Da, consistent with a molecular weight of approximately 46,000 for peptidase T (as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and gel filtration). The N-terminal amino acid sequence of peptidase T purified from a pJG17-containing strain matches that predicted by the nucleotide sequence. A plasmid carrying an anaerobically regulated pepT::lacZ transcriptional fusion contains only 165 bp 5' to the start of translation. This region contains a sequence highly homologous to that identified in Escherichia coli as the site of action of the FNR protein, a positive regulator of anaerobic gene expression. A region of the deduced amino acid sequence of peptidase T is similar to segments of Pseudomonas carboxypeptidase G2, the E. coli peptidase encoded by the iap gene, and E. coli peptidase D. PMID:1904438

  11. Nucleotide sequence of the hypervariable region of the human C2 gene

    SciTech Connect

    Zhu, Z.B.; Volanakis, J.V. )

    1991-03-15

    It has been previously suggested that the multiallelic Bam H1/Sst I RFLPs of the human C2 gene arose through deletion/insertion of a tandemly-repeated minisatellite region. In this study the authors subcloned and sequenced the Sst I polymorphic fragment of the b haplotype of the C2 gene. This restriction fragment is 2,450 bp long and maps 1,550 bp 3{prime} of exon 3. Its nucleotide sequence is characterized by the presence of at least 4 different repeated regions varying in size from 18 to 58 bp. One of these regions starting at position 1,413 is 48 bp long and is repeated five times. The first 3 repeats are in tandem and are separated by 72 bp from two additional tandem repeats. Sequence homology among the 5 repeats ranges between 93 and 98%. Eighty three percent of the nucleotides of the repeated-region are G or C. It seems likely that this nucleotide repeat resulted in the multiallelic RFLPs through a mechanism of unequal recombination or replication slippage.

  12. Complete Nucleotide Sequence of a French Isolate of Maize rough dwarf virus, a Fijivirus Member in the Family Reoviridae

    PubMed Central

    Svanella-Dumas, L.; Marais, A.; Faure, C.; Theil, S.; Thibord, J. B.

    2016-01-01

    The complete nucleotide sequence of a French isolate of Maize rough dwarf virus (MRDV) was determined by next-generation sequencing and compared with the single available complete sequence and with the partial sequences of two additional isolates available in online databases. PMID:27445367

  13. Nucleotide sequence of a hop stunt viroid variant isolated from citrus growing in Taiwan.

    PubMed

    Hsu, Y H; Chen, W; Owens, R A

    1995-01-01

    The 303 nucleotide sequence of HSVd-citrus(T), a hop stunt viroid (HSVd) variant present in Etrog citron growing in Taiwan, was determined from cDNAs amplified by the polymerase chain reaction. HSVd-citrus(T) is very similar to several HSVd isolates previously recovered from citrus or cucumber, and exhibits microsequence heterogeneity at positions 154 and 181. Phylogenetic analysis using maximum parsimony grouped HSVd-citrus(T) with seven other isolates from citrus and cucumber in a large cluster of "citrus-type" isolates. A similar analysis revealed marked differences in both the extent and distribution of sequence variation among naturally occurring isolates of potato spindle tuber viroid.

  14. Nucleotide sequencing and characterization of the genes encoding benzene oxidation enzymes of Pseudomonas putida

    SciTech Connect

    Irie, S.; Doi, S.; Yorifuji, T.; Takagi, M.; Yano, K.

    1987-11-01

    The nucleotide sequence of the genes from Pseudomonas putida encoding oxidation of benzene to catechol was determined. Five open reading frames were found in the sequence. Four corresponding protein molecules were detected by a DNA-directed in vitro translation system. Escherichia coli cells containing the fragment with the four open reading frames transformed benzene to cis-benzene glycol, which is an intermediate of the oxidation of benzene to catechol. The relation between the product of each cistron and the components of the benzene oxidation enzyme system is discussed.

  15. Sequence analysis, characterization and mRNA distribution of channel catfish (Ictalurus punctatus Rafinesque, 1818) chemokine (C-X-C motif) receptor 4 (CXCR4) cDNA.

    PubMed

    Yeh, Hung-Yueh; Klesius, Phillip H

    2010-04-15

    Chemokine receptor CXCR4, a member of the G protein-coupled receptor superfamily, binds selectively CXCL12. This protein plays many important roles in immunological as well as pathophysiological functions. In this study, we identified and characterized the channel catfish CXCR4 transcript. The full-length nucleic acid sequence of channel catfish CXCR4 cDNA comprised of 1994 nucleotides, including an open reading frame, which appears to encode a putative peptide of 357 amino acid residues with a calculated molecular mass of 40.1kDa. By comparison with the human counterpart, the channel catfish CXCR4 peptide can be divided into domains, including seven transmembrane domains, four cytoplasmic domains, and four extracellular domains. The CXCR4 transcript was detected in spleen, anterior kidney, liver, intestine, skin and gill of all catfish examined in this study. Because four CXCL of channel catfish have been identified, the result provides valuable information for further exploring the channel catfish chemokine signalling pathways and their roles in immune responses to infection. PMID:19853928

  16. Phylogeny of immunoglobulin heavy chain isotypes: structure of the constant region of Ambystoma mexicanum upsilon chain deduced from cDNA sequence.

    PubMed

    Fellah, J S; Kerfourn, F; Wiles, M V; Schwager, J; Charlemagne, J

    1993-01-01

    An RNA polymerase chain reaction strategy was used to amplify and clone a cDNA segment encoding for the complete constant part of the axolotl IgY heavy (C upsilon) chain. C upsilon is 433 amino acids long and organized into four domains (C upsilon 1-C upsilon 4); each has the typical internal disulfide bond and invariant tryptophane residues. Axolotl C upsilon is most closely related to Xenopus C upsilon (40% identical amino acid residues) and C upsilon 1 shares 46.4% amino acid residues among these species. The presence of additional cysteines in C upsilon 1 and C upsilon 2 domains is consistent with an additional intradomain S-S bond similar to that suggested for Xenopus C upsilon and C chi, and for the avian C upsilon and the human C epsilon. C upsilon 4 ends with the Gly-Lys dipeptide characteristic of secreted mammalian C gamma 3, human C epsilon 4, and avian and anuran C upsilon 4, and contains the consensus [G/GT(AA)] nucleotide splice signal sequence for joining C upsilon 4 to the transmembrane region. These results are consistent with the hypothesis of an ancestral structural relationship between amphibian, avian upsilon chains, and mammalian epsilon chains. However, these molecules have different biological properties: axolotl IgY is secretory Ig, anuran and avian IgY behave like mammalian IgG, and mammalian IgE is implicated in anaphylactic reactions. PMID:8344718

  17. Remote access to ACNUC nucleotide and protein sequence databases at PBIL.

    PubMed

    Gouy, Manolo; Delmotte, Stéphane

    2008-04-01

    The ACNUC biological sequence database system provides powerful and fast query and extraction capabilities to a variety of nucleotide and protein sequence databases. The collection of ACNUC databases served by the Pôle Bio-Informatique Lyonnais includes the EMBL, GenBank, RefSeq and UniProt nucleotide and protein sequence databases and a series of other sequence databases that support comparative genomics analyses: HOVERGEN and HOGENOM containing families of homologous protein-coding genes from vertebrate and prokaryotic genomes, respectively; Ensembl and Genome Reviews for analyses of prokaryotic and of selected eukaryotic genomes. This report describes the main features of the ACNUC system and the access to ACNUC databases from any internet-connected computer. Such access was made possible by the definition of a remote ACNUC access protocol and the implementation of Application Programming Interfaces between the C, Python and R languages and this communication protocol. Two retrieval programs for ACNUC databases, Query_win, with a graphical user interface and raa_query, with a command line interface, are also described. Altogether, these bioinformatics tools provide users with either ready-to-use means of querying remote sequence databases through a variety of selection criteria, or a simple way to endow application programs with an extensive access to these databases. Remote access to ACNUC databases is open to all and fully documented (http://pbil.univ-lyon1.fr/databases/acnuc/acnuc.html).

  18. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    SciTech Connect

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  19. The complete cDNA sequence of laminin alpha 4 and its relationship to the other human laminin alpha chains.

    PubMed

    Richards, A; Al-Imara, L; Pope, F M

    1996-06-15

    We previously localised the gene (LAMA4) encoding a novel laminin alpha 4 chain to chromosome 6q21. In this study, we describe the complete coding sequence and compare the protein with the other three known human laminin alpha chains. Although closely linked to LAMA2, the LAMA4 product most closely resembles laminin alpha 3, a constituent of laminin 5. Like laminin alpha 3A, the alpha 4 chain is a truncated version of the alpha 1 and alpha 2 chains, with a much reduced short arm. While the alpha 4 molecule is most similar to alpha 3, it shares some features of the C-terminal domains G4 and G5 in common with alpha 2. Unlike the LAMA3 gene, LAMA4 appears to encode only a single transcript, as determined by 5' rapid amplification of cDNA ends. The cDNA sequence encodes 1816 amino acids, which include a 24-residue signal peptide. The gene is expressed in skin, placenta, heart, lung, skeletal muscle, and pancreas. We have also shown that the mRNA can be readily reverse transcribed and amplified from cultured dermal fibroblasts. PMID:8706685

  20. Characterization of Mapuera virus: structure, proteins and nucleotide sequence of the gene encoding the nucleocapsid protein.

    PubMed

    Henderson, G W; Laird, C; Dermott, E; Rima, B K

    1995-10-01

    The molecular biology of Mapuera virus was studied at both the protein and nucleic acid levels. Seven virus-encoded proteins were detected in infected Vero cells. The sizes and characteristics of each of the proteins determined from various radiolabelling experiments allowed preliminary identification of the proteins as the large (L; 190 kDa), haemagglutinin neuraminidase (HN; 74 kDa), nucleocapsid (N; 66 kDa), fusion (F0; 63 kDa), phosphoprotein (P; 49 kDa), matrix (M; 43 kDa) and non-structural (V; 35 kDa) proteins. Western blot analysis showed that the HN, N and P proteins were major antigens recognized in the mouse. A cDNA library of total virus-infected cellular mRNA was created and screening of the library resulted in the detection of cDNA sequences representing the N mRNA transcript of Mapuera virus. The N mRNA sequence determined from the clones was 1731 nt in length and contained an ORF that encoded 537 amino acids, the complete 3' untranslated region and part of the 5' non-coding region. The calculated M(r) of the N protein was 59 kDa, which is close to the 66 kDa protein observed by SDS-PAGE. PMID:7595354

  1. Comparison of Sequencing Platforms for Single Nucleotide Variant Calls in a Human Sample

    PubMed Central

    Miller, Webb; Guillory, Joseph; Stinson, Jeremy; Seshagiri, Somasekar

    2013-01-01

    Next-generation sequencings platforms coupled with advanced bioinformatic tools enable re-sequencing of the human genome at high-speed and large cost savings. We compare sequencing platforms from Roche/454(GS FLX), Illumina/HiSeq (HiSeq 2000), and Life Technologies/SOLiD (SOLiD 3 ECC) for their ability to identify single nucleotide substitutions in whole genome sequences from the same human sample. We report on significant GC-related bias observed in the data sequenced on Illumina and SOLiD platforms. The differences in the variant calls were investigated with regards to coverage, and sequencing error. Some of the variants called by only one or two of the platforms were experimentally tested using mass spectrometry; a method that is independent of DNA sequencing. We establish several causes why variants remained unreported, specific to each platform. We report the indel called using the three sequencing technologies and from the obtained results we conclude that sequencing human genomes with more than a single platform and multiple libraries is beneficial when high level of accuracy is required. PMID:23405114

  2. Comparison of sequencing platforms for single nucleotide variant calls in a human sample.

    PubMed

    Ratan, Aakrosh; Miller, Webb; Guillory, Joseph; Stinson, Jeremy; Seshagiri, Somasekar; Schuster, Stephan C

    2013-01-01

    Next-generation sequencings platforms coupled with advanced bioinformatic tools enable re-sequencing of the human genome at high-speed and large cost savings. We compare sequencing platforms from Roche/454(GS FLX), Illumina/HiSeq (HiSeq 2000), and Life Technologies/SOLiD (SOLiD 3 ECC) for their ability to identify single nucleotide substitutions in whole genome sequences from the same human sample. We report on significant GC-related bias observed in the data sequenced on Illumina and SOLiD platforms. The differences in the variant calls were investigated with regards to coverage, and sequencing error. Some of the variants called by only one or two of the platforms were experimentally tested using mass spectrometry; a method that is independent of DNA sequencing. We establish several causes why variants remained unreported, specific to each platform. We report the indel called using the three sequencing technologies and from the obtained results we conclude that sequencing human genomes with more than a single platform and multiple libraries is beneficial when high level of accuracy is required.

  3. Large-scale detection and application of expressed sequence tag single nucleotide polymorphisms in Nicotiana.

    PubMed

    Wang, Y; Zhou, D; Wang, S; Yang, L

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are widespread in the Nicotiana genome. Using an alignment and variation detection method, we developed 20,607,973 SNPs, based on the expressed sequence tag sequences of 10 Nicotiana species. The replacement rate was much higher than the transversion rate in the SNPs, and SNPs widely exist in the Nicotiana. In vitro verification indicated that all of the SNPs were high quality and accurate. Evolutionary relationships between 15 varieties were investigated by polymerase chain reaction with a special primer; the specific 302 locus of these sequence results clearly indicated the origin of Zhongyan 100. A database of Nicotiana SNPs (NSNP) was developed to store and search for SNPs in Nicotiana. NSNP is a tool for researchers to develop SNP markers of sequence data. PMID:26214460

  4. Large-scale detection and application of expressed sequence tag single nucleotide polymorphisms in Nicotiana.

    PubMed

    Wang, Y; Zhou, D; Wang, S; Yang, L

    2015-07-14

    Single nucleotide polymorphisms (SNPs) are widespread in the Nicotiana genome. Using an alignment and variation detection method, we developed 20,607,973 SNPs, based on the expressed sequence tag sequences of 10 Nicotiana species. The replacement rate was much higher than the transversion rate in the SNPs, and SNPs widely exist in the Nicotiana. In vitro verification indicated that all of the SNPs were high quality and accurate. Evolutionary relationships between 15 varieties were investigated by polymerase chain reaction with a special primer; the specific 302 locus of these sequence results clearly indicated the origin of Zhongyan 100. A database of Nicotiana SNPs (NSNP) was developed to store and search for SNPs in Nicotiana. NSNP is a tool for researchers to develop SNP markers of sequence data.

  5. Nucleotide sequence of the SrRNA gene and phylogenetic analysis of Trichomonas tenax.

    PubMed

    Fukura, K; Yamamoto, A; Hashimoto, T; Goto, N

    1996-01-01

    The small subunit ribosomal RNA (SrRNA) gene of Trichomonas tenax ATCC30207 was amplified by PCR and the 1.55-kb product was cloned into plasmid vector pUC18. Four clones were isolated and sequenced. The insert DNAs were 1,552 bp long and their G+C contents were 48.1%; three of them had exactly the same DNA sequences and one had only one nucleotide change. A representative SrRNA sequence was analyzed and a phylogenetic tree was estimated by the neighbor-joining (NJ) method. Among the protists examined, T. tenax was placed as the closest relative of Tritrichomonas foetus, as expected from the traditional taxonomy. The total homology between the two SrRNA sequences was 89.2%.

  6. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  7. Isolation and sequencing of a cDNA for an unusual hemoglobin from the parasitic nematode Pseudoterranova decipiens.

    PubMed Central

    Dixon, B; Walker, B; Kimmins, W; Pohajdak, B

    1991-01-01

    A cDNA clone encoding a 333-amino acid hemoglobin was isolated from the nematode Pseudoterranova decipiens. The protein contains an 18-amino acid hydrophobic signal sequence and has a calculated mass of 37.6 kDa in the mature form. The predicted protein reveals an internal duplication of a 154-amino acid domain (51% identity). Both domains have significant sequence homology to other primitive hemoglobins, in agreement with a duplication event. Hydrophobicity plots reveal identical strongly hydrophobic regions in each domain, which are potential heme binding sites. This confirms previous suggestions that nematode hemoglobins can have two heme groups per molecule. In addition, each domain contains several conserved histidine motifs that may serve as potential copper binding sites. This result provides further evidence that hemoglobins may have evolved from a primitive cytochrome-like molecule. Images PMID:2062843

  8. Construction and evaluation of cDNA libraries for large-scale expressed sequence tag sequencing in wheat (Triticum aestivum L.).

    PubMed

    Zhang, D; Choi, D W; Wanamaker, S; Fenton, R D; Chin, A; Malatrasi, M; Turuspekov, Y; Walia, H; Akhunov, E D; Kianian, P; Otto, C; Simons, K; Deal, K R; Echenique, V; Stamova, B; Ross, K; Butler, G E; Strader, L; Verhey, S D; Johnson, R; Altenbach, S; Kothari, K; Tanaka, C; Shah, M M; Laudencia-Chingcuanco, D; Han, P; Miller, R E; Crossman, C C; Chao, S; Lazo, G R; Klueva, N; Gustafson, J P; Kianian, S F; Dubcovsky, J; Walker-Simmons, M K; Gill, K S; Dvorák, J; Anderson, O D; Sorrells, M E; McGuire, P E; Qualset, C O; Nguyen, H T; Close, T J

    2004-10-01

    A total of 37 original cDNA libraries and 9 derivative libraries enriched for rare sequences were produced from Chinese Spring wheat (Triticum aestivum L.), five other hexaploid wheat genotypes (Cheyenne, Brevor, TAM W101, BH1146, Butte 86), tetraploid durum wheat (T. turgidum L.), diploid wheat (T. monococcum L.), and two other diploid members of the grass tribe Triticeae (Aegilops speltoides Tausch and Secale cereale L.). The emphasis in the choice of plant materials for library construction was reproductive development subjected to environmental factors that ultimately affect grain quality and yield, but roots and other tissues were also included. Partial cDNA expressed sequence tags (ESTs) were examined by various measures to assess the quality of these libraries. All ESTs were processed to remove cloning system sequences and contaminants and then assembled using CAP3. Following these processing steps, this assembly yielded 101,107 sequences derived from 89,043 clones, which defined 16,740 contigs and 33,213 singletons, a total of 49,953 "unigenes." Analysis of the distribution of these unigenes among the libraries led to the conclusion that the enrichment methods were effective in reducing the most abundant unigenes and to the observation that the most diverse libraries were from tissues exposed to environmental stresses including heat, drought, salinity, or low temperature. PMID:15514038

  9. Construction and Evaluation of cDNA Libraries for Large-Scale Expressed Sequence Tag Sequencing in Wheat (Triticum aestivum L.)

    PubMed Central

    Zhang, D.; Choi, D. W.; Wanamaker, S.; Fenton, R. D.; Chin, A.; Malatrasi, M.; Turuspekov, Y.; Walia, H.; Akhunov, E. D.; Kianian, P.; Otto, C.; Simons, K.; Deal, K. R.; Echenique, V.; Stamova, B.; Ross, K.; Butler, G. E.; Strader, L.; Verhey, S. D.; Johnson, R.; Altenbach, S.; Kothari, K.; Tanaka, C.; Shah, M. M.; Laudencia-Chingcuanco, D.; Han, P.; Miller, R. E.; Crossman, C. C.; Chao, S.; Lazo, G. R.; Klueva, N.; Gustafson, J. P.; Kianian, S. F.; Dubcovsky, J.; Walker-Simmons, M. K.; Gill, K. S.; Dvořák, J.; Anderson, O. D.; Sorrells, M. E.; McGuire, P. E.; Qualset, C. O.; Nguyen, H. T.; Close, T. J.

    2004-01-01

    A total of 37 original cDNA libraries and 9 derivative libraries enriched for rare sequences were produced from Chinese Spring wheat (Triticum aestivum L.), five other hexaploid wheat genotypes (Cheyenne, Brevor, TAM W101, BH1146, Butte 86), tetraploid durum wheat (T. turgidum L.), diploid wheat (T. monococcum L.), and two other diploid members of the grass tribe Triticeae (Aegilops speltoides Tausch and Secale cereale L.). The emphasis in the choice of plant materials for library construction was reproductive development subjected to environmental factors that ultimately affect grain quality and yield, but roots and other tissues were also included. Partial cDNA expressed sequence tags (ESTs) were examined by various measures to assess the quality of these libraries. All ESTs were processed to remove cloning system sequences and contaminants and then assembled using CAP3. Following these processing steps, this assembly yielded 101,107 sequences derived from 89,043 clones, which defined 16,740 contigs and 33,213 singletons, a total of 49,953 “unigenes.” Analysis of the distribution of these unigenes among the libraries led to the conclusion that the enrichment methods were effective in reducing the most abundant unigenes and to the observation that the most diverse libraries were from tissues exposed to environmental stresses including heat, drought, salinity, or low temperature. PMID:15514038

  10. Nucleotide sequence variation of chitin synthase genes among ectomycorrhizal fungi and its potential use in taxonomy.

    PubMed Central

    Mehmann, B; Brunner, I; Braus, G H

    1994-01-01

    DNA sequences of single-copy genes coding for chitin synthases (UDP-N-acetyl-D-glucosamine:chitin 4-beta-N-acetylglucosaminyltransferase; EC 2.4.1.16) were used to characterize ectomycorrhizal fungi. Degenerate primers deduced from short, completely conserved amino acid stretches flanking a region of about 200 amino acids of zymogenic chitin synthases allowed the amplification of DNA fragments of several members of this gene family. Different DNA band patterns were obtained from basidiomycetes because of variation in the number and length of amplified fragments. Cloning and sequencing of the most prominent DNA fragments revealed that these differences were due to various introns at conserved positions. The presence of introns in basidiomycetous fungi therefore has a potential use in identification of genera by analyzing PCR-generated DNA fragment patterns. Analyses of the nucleotide sequences of cloned fragments revealed variations in nucleotide sequences from 4 to 45%. By comparison of the deduced amino acid sequences, the majority of the DNA fragments were identified as members of genes for chitin synthase class II. The deduced amino acid sequences from species of the same genus differed only in one amino acid residue, whereas identity between the amino acid sequences of ascomycetous and basidiomycetous fungi within the same taxonomic class was found to be approximately 43 to 66%. Phylogenetic analysis of the amino acid sequence of class II chitin synthase-encoding gene fragments by using parsimony confirmed the current taxonomic groupings. In addition, our data revealed a fourth class of putative zymogenic chitin synthesis. Images PMID:7944356

  11. The mouse collagen X gene: complete nucleotide sequence, exon structure and expression pattern.

    PubMed Central

    Elima, K; Eerola, I; Rosati, R; Metsäranta, M; Garofalo, S; Perälä, M; De Crombrugghe, B; Vuorio, E

    1993-01-01

    Overlapping genomic clones covering the 7.2 kb mouse alpha 1(X) collagen gene, 0.86 kb of promoter and 1.25 kb of 3'-flanking sequences were isolated from two genomic libraries and characterized by nucleotide sequencing. Typical features of the gene include a unique three-exon structure, similar to that in the chick gene, with the entire triple-helical domain of 463 amino acids coded by a single large exon. The highest degree of amino acid and nucleotide sequence conservation was seen in the coding region for the collagenous and C-terminal non-collagenous domains between the mouse and known chick, bovine and human collagen type X sequences. More divergence between the sequences occurred in the N-terminal non-collagenous domain. Similarity between the mammalian collagen X sequences extended into the 3'-untranslated sequence, particularly near the polyadenylation site. The promoter of the mouse collagen X gene was found to contain two TATAA boxes 159 bp apart; primer extension analyses of the transcription start site revealed that both were functional. The promoter has an unusual structure with a very low G + C content of 28% between positions -220 and -1 of the upstream transcription start site. Northern and in situ hybridization analyses confirmed that the expression of the alpha 1(X) collagen gene is restricted to hypertrophic chondrocytes in tissues undergoing endochondral calcification. The detailed sequence information of the gene is useful for studies on the promoter activity of the gene and for generation of transgenic mice. Images Figure 3 Figure 5 Figure 6 PMID:8424763

  12. Nucleotide sequence analysis of a candidate gene for ataxia-telangiectasia group D (ATDC)

    SciTech Connect

    Leonhardt, E.A.; Kapp, L.N.; Young, B.R.; Murnane, J.P. )

    1994-01-01

    A radioresistant cell clone (1B3) was previously isolated after transfection of an ataxia-telangiectasia (AT) group D cell line with a human cosmid library. A cosmid rescued from the integration site in 1B3 contained human DNA from chromosome position 11q23, the same region shown by both genetic linkage and chromosome transfer to contain the genes for AT complementation groups A/B, C, and D. A gene within the cosmid (ATDC) was found to produce mRNAs of different sizes. A cDNA for one of the most abundant mRNAs (3.0 kb) was isolated from a HeLa cell library. In the present study, the authors sequenced the 3.0-kb cDNA and the surrounding intron DNA in the cosmids. They used polymerase chain reaction, with primers in the introns, to confirm the number of exons and to analyze DNA from AT group D cells for mutations within this gene. Although no mutations were found, they do not rule out the possibility that mutations may be present within the regulatory sequences or coding sequences found in other mRNAs specific for this gene. From the sequence analysis, they found that the ATDC gene product is one of a group of proteins that share multiple zinc finger motifs and an adjacent leucine zipper motif. These proteins have been proposed to form homo- or hetero-dimers involved in nucleic acid binding, consistent with the fact that many of these proteins appear to be transcriptional regulatory factors involved in carcinogenesis and/or differentiation. The likelihood that the ATDC gene product is involved in transcriptional regulation could explain the pleiomorphic characteristics of AT, including abnormal cell cycle regulation. 36 refs., 5 figs., 2 tabs.

  13. PEG-Labeled Nucleotides and Nanopore Detection for Single Molecule DNA Sequencing by Synthesis

    PubMed Central

    Kumar, Shiv; Tao, Chuanjuan; Chien, Minchen; Hellner, Brittney; Balijepalli, Arvind; Robertson, Joseph W. F.; Li, Zengmin; Russo, James J.; Reiner, Joseph E.; Kasianowicz, John J.; Ju, Jingyue

    2012-01-01

    We describe a novel single molecule nanopore-based sequencing by synthesis (Nano-SBS) strategy that can accurately distinguish four bases by detecting 4 different sized tags released from 5′-phosphate-modified nucleotides. The basic principle is as follows. As each nucleotide is incorporated into the growing DNA strand during the polymerase reaction, its tag is released and enters a nanopore in release order. This produces a unique ionic current blockade signature due to the tag's distinct chemical structure, thereby determining DNA sequence electronically at single molecule level with single base resolution. As proof of principle, we attached four different length PEG-coumarin tags to the terminal phosphate of 2′-deoxyguanosine-5′-tetraphosphate. We demonstrate efficient, accurate incorporation of the nucleotide analogs during the polymerase reaction, and excellent discrimination among the four tags based on nanopore ionic currents. This approach coupled with polymerase attached to the nanopores in an array format should yield a single-molecule electronic Nano-SBS platform. PMID:23002425

  14. Analysis of xylem formation in pine by cDNA sequencing

    NASA Technical Reports Server (NTRS)

    Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.; Whetten, R. W.; Davies, E. (Principal Investigator)

    1998-01-01

    Secondary xylem (wood) formation is likely to involve some genes expressed rarely or not at all in herbaceous plants. Moreover, environmental and developmental stimuli influence secondary xylem differentiation, producing morphological and chemical changes in wood. To increase our understanding of xylem formation, and to provide material for comparative analysis of gymnosperm and angiosperm sequences, ESTs were obtained from immature xylem of loblolly pine (Pinus taeda L.). A total of 1,097 single-pass sequences were obtained from 5' ends of cDNAs made from gravistimulated tissue from bent trees. Cluster analysis detected 107 groups of similar sequences, ranging in size from 2 to 20 sequences. A total of 361 sequences fell into these groups, whereas 736 sequences were unique. About 55% of the pine EST sequences show similarity to previously described sequences in public databases. About 10% of the recognized genes encode factors involved in cell wall formation. Sequences similar to cell wall proteins, most known lignin biosynthetic enzymes, and several enzymes of carbohydrate metabolism were found. A number of putative regulatory proteins also are represented. Expression patterns of several of these genes were studied in various tissues and organs of pine. Sequencing novel genes expressed during xylem formation will provide a powerful means of identifying mechanisms controlling this important differentiation pathway.

  15. Mouse Mammary Tumor Virus-Like Nucleotide Sequences in Canine and Feline Mammary Tumors▿

    PubMed Central

    Hsu, Wei-Li; Lin, Hsing-Yi; Chiou, Shyan-Song; Chang, Chao-Chin; Wang, Szu-Pong; Lin, Kuan-Hsun; Chulakasian, Songkhla; Wong, Min-Liang; Chang, Shih-Chieh

    2010-01-01

    Mouse mammary tumor virus (MMTV) has been speculated to be involved in human breast cancer. Companion animals, dogs, and cats with intimate human contacts may contribute to the transmission of MMTV between mouse and human. The aim of this study was to detect MMTV-like nucleotide sequences in canine and feline mammary tumors by nested PCR. Results showed that the presence of MMTV-like env and LTR sequences in canine malignant mammary tumors was 3.49% (3/86) and 18.60% (16/86), respectively. For feline malignant mammary tumors, the presence of both env and LTR sequences was found to be 22.22% (2/9). Nevertheless, the MMTV-like LTR and env sequences also were detected in normal mammary glands of dogs and cats. In comparisons of the MMTV-like DNA sequences of our findings to those of NIH 3T3 (MMTV-positive murine cell line) and human breast cancer cells, the sequence similarities ranged from 94 to 98%. Phylogenetic analysis revealed that intermixing among sequences identified from tissues of different hosts, i.e., mouse, dog, cat, and human, indicated the MMTV-like DNA existing in these hosts. Moreover, the env transcript was detected in 1 of the 19 MMTV-positive samples by reverse transcription-PCR. Taken together, our study provides evidence for the existence and expression of MMTV-like sequences in neoplastic and normal mammary glands of dogs and cats. PMID:20881168

  16. Cloning, nucleotide sequence, and expression of the Pasteurella haemolytica A1 glycoprotease gene.

    PubMed Central

    Abdullah, K M; Lo, R Y; Mellors, A

    1991-01-01

    Pasteurella haemolytica serotype A1 secretes a glycoprotease which is specific for O-sialoglycoproteins such as glycophorin A. The gene encoding the glycoprotease enzyme has been cloned in the recombinant plasmid pH1, and its nucleotide sequence has been determined. The gene (designated gcp) codes for a protein of 35.2 kDa, and an active enzyme protein of this molecular mass can be observed in Escherichia coli clones carrying pPH1. In vivo labeling of plasmid-encoded proteins in E. coli maxicells demonstrated the expression of a 35-kDa protein from pPH1. The amino-terminal sequence of the heterologously expressed protein corresponds to that predicted from the nucleotide sequence. The glycoprotease is a neutral metalloprotease, and the predicted amino acid sequence of the glycoprotease contains a putative zinc-binding site. The gene shows no significant homology with the genes for other proteases of procaryotic or eucaryotic origin. However, there is substantial homology between gcp and an E. coli gene, orfX, whose product is believed to function in the regulation of macromolecule biosynthesis. Images PMID:1885539

  17. Cloning and nucleotide sequence of the Salmonella typhimurium LT2 metF gene and its homology with the corresponding sequence of Escherichia coli.

    PubMed

    Stauffer, G V; Stauffer, L T

    1988-05-01

    The Salmonella typhimurium LT2 metF gene, encoding 5,10-methylenetetrahydrofolate reductase, has been cloned. Strains with multicopy plasmids carrying the metF gene overproduce the enzyme 44-fold. The nucleotide sequence of the metF gene was determined, and an open reading frame of 888 nucleotides was identified. The polypeptide deduced from the DNA sequence contains 296 amino acids and has a molecular weight of 33,135 daltons. Mung bean nuclease mapping experiments located the transcription start point and possible transcription termination region for the gene. There is a 25 bp nucleotide sequence between the translation termination site and the possible transcription termination region. This region possesses a GC-rich sequence that could form a stable stem and loop structure once transcribed (delta G = -9 kcal/mol), followed by an AT-rich sequence, both of which are characteristic of rho-independent transcription terminators. The nucleotide and deduced amino acid sequences of the S. typhimurium metF gene are compared with the corresponding sequences of the Escherichia coli metF gene. The nucleotide sequences show 85% homology. Most of the nucleotide differences found do not alter the amino acid sequences, which show 95% homology. The results also show that a change has occurred in the metF region of the S. typhimurium chromosome as compared to the E. coli chromosome.

  18. Nucleotide sequence and revised map location of the arn gene from bacteriophage T4.

    PubMed

    Kim, B C; Kim, K; Park, E H; Lim, C J

    1997-10-31

    Non-glucosylated (Glu-) T-even phage DNAs are restricted by Escherichia coli RgIA and RgIB endonucleases with different specificities. RgIB endonuclease activity is strongly inhibited by anti-restriction endonuclease (Arn) encoded by the bacteriophage T4 genome. The nucleotide sequence of the arn gene encoding Arn was determined. The product of the cloned arn gene was overexpressed by the T7 RNA polymerase/promoter system, and its molecular size is consistent with that predicted from the open reading frame of the arn gene. The arn gene is located between the asiA gene and motA gene in the region of 161,300-161,578 nucleotides.

  19. Nucleotide sequence analysis of the bovine respiratory syncytial virus fusion protein mRNA and expression from a recombinant vaccinia virus.

    PubMed

    Lerch, R A; Anderson, K; Amann, V L; Wertz, G W

    1991-03-01

    Bovine respiratory syncytial (BRS) virus is an important cause of serious respiratory illness in calves. The disease caused in calves is similar to that caused by human respiratory syncytial (HRS) virus in children. The two viruses, however, have distinct host ranges and the attachment glycoproteins, G, have no antigenic cross-reactivity. The fusion glycoproteins, F, of the HRS and BRS viruses, however, have some antigenic cross-reactivity. To further compare the BRS virus and HRS virus fusion proteins, we determined the nucleotide sequence of cDNA clones to the BRS virus F protein mRNA, deduced the amino acid sequence, and compared these sequences with the HRS virus F protein sequences. The BRS virus F mRNA was 1899 nucleotides in length and had a single major open reading frame which could code for a polypeptide of 574 amino acids with an estimated molecular weight of 63.8 kDa. Structural features predicted from the amino acid sequence included an NH2-terminal signal sequence (residues 1-26), a site for proteolytic cleavage (residues 131-136) to generate the disulfide-linked F1 and F2 subunits, and a hydrophobic transmembrane anchor sequence (residues 522-549). The nucleic acid identity between the BRS virus and the HRS virus F mRNA sequences was 71.5%. The predicted BRS virus F protein shared 80.5% overall amino acid identity with the HRS virus F protein with 89% identity in the F1 polypeptide but only 68% identity in the F2 polypeptide. The position and number of the cysteine residues in the F1 and F2 polypeptides were conserved among all F proteins. However, BRS virus F protein had only three potential N-linked carbohydrate acceptor sites in comparison to four or five for the HRS viruses. A difference in the extent of glycosylation between the BRS and HRS virus F2 polypeptides was shown to be responsible for differences observed in the electrophoretic mobility of these proteins. A cDNA containing the complete open reading frame of the BRS virus F mRNA was

  20. Nucleotide sequence of a cloned duck hepatitis B virus genome: comparison with woodchuck and human hepatitis B virus sequences.

    PubMed Central

    Mandart, E; Kay, A; Galibert, F

    1984-01-01

    The nucleotide sequence of an EcoRI duck hepatitis B virus (DHBV) clone was elucidated by using the Maxam and Gilbert method. This sequence, which is 3,021 nucleotides long, was compared with the two previously analyzed hepatitis B-like viruses (human and woodchuck). From this comparison, it was shown that DHBV is derived from an ancestor common to the two others but has a slightly different genomic organization. There was no intergenic region between genes 5 and 8, which were fused into a single open reading frame in DHBV. Genes for the surface and core proteins were assigned to open reading frames 7 and 5/8. Amino acid comparisons showed some structural relationship between gene 6 product and avian reverse transcriptase, suggesting either evolution from a common ancestor or convergence to some particular structure to fulfill a specific function. This should be correlated with the synthesis of an RNA intermediate during DNA replication. This is also taken as an argument in favor of the hypothesis that gene 6 codes for the DNA polymerase that is found within the virion. DNA sequence comparison also showed that the two mammalian hepatitis B viruses are more homologous to each other than they are to DHBV, indicating that DHBV starts to evolve on its own earlier than the two other viruses, as do birds compared with mammals. From this it is proposed that the viruses evolved in a fashion parallel to the species they infect. PMID:6699938

  1. cDNA sequence and heterologous expression of monomeric spinach pullulanase: multiple isomeric forms arise from the same polypeptide.

    PubMed Central

    Renz, A; Schikora, S; Schmid, R; Kossmann, J; Beck, E

    1998-01-01

    The spinach pullulanase gene was cloned and sequenced using peptide sequences of the purified enzyme as a starting point and employing PCR techniques and cDNA library screening. Its open reading frame codes for a protein of 964 amino acids which represents a precursor of the pullulanase. The N-terminal transit peptide consists of 65 amino acids, and the mature protein, comprising 899 amino acids, has a calculated molecular mass of 99kDa. Pullulanase is a member of the alpha-amylase family. In addition to a characteristic catalytic (beta/alpha)8-barrel domain, it contains a domain, F, that is specific for branching and debranching enzymes. Pullulanase cDNA was expressed in Escherichia coli, and the purified protein was compared with the enzyme from spinach leaves. Identity of the two proteins was confirmed in terms of catalytic properties, N-terminal amino acid sequences and molecular masses. The pullulanase produced by E. coli showed the same microheterogeneity as the spinach leaf enzyme: it could be resolved into two substrate-induced forms by electrophoresis in amylopectin-containing polyacrylamide gels, and, in the absence of substrate, into several free forms (charge isomers) by isoelectric focusing or chromatofocusing. Rechromatofocusing of single free forms resulted in the originally observed pattern of molecular forms. However, heterogeneity of the protein disappeared on isoelectric focusing under completely denaturing conditions when only one protein band was observed. Post-translational modifications such as glycosylation and phosphorylation could be excluded as potential explanations for the protein heterogeneity. Therefore the microheterogeneity of spinach leaf pullulanase results from neither genetic variation nor post-translational modifications, but is a property of the single unmodified gene product. The different interconvertible forms of the pullulanase represent protein populations of different tertiary structure of the same polypeptide. PMID

  2. Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

    PubMed

    Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

    2009-07-14

    In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

  3. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015.

    PubMed

    Furuse, Yuki; Okamoto, Michiko; Oshitani, Hitoshi

    2015-11-01

    Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV) is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  4. Nucleotide-sequence of a canine oral papillomavirus containing a long noncoding region.

    PubMed

    Isegawa, N; Ohta, M; Shirasawa, H; Tokita, H; Yamaura, A; Simizu, B

    1995-07-01

    The DNA genome of a canine oral papillomavirus (COPV) was completely sequenced and found to consist of 8607 base pairs, which were the longest of all known papillomaviruses (PVs). Its organization was similar to that of other PVs except that it lacked early gene 5 (E5) and possessed a unique long noncoding region (L-NCR) between the end of the early genes and the beginning of the late genes. COPV also possessed a short noncoding region (S-NCR) which contained a putative upper regulatory region (URR), which is commonly found in PVs. The L-NCR did not show any similarity to known PV DNAs nor other DNA sequences in the GenBank database. Nucleotide sequence analysis of COPV showed that it was closely related to human papillomavirus type 1 (HPV 1) and animal PVs associated with cutaneous lesions in rabbit, European elk, deer and cow as we reported previously. PMID:21552821

  5. Comparisons of the Distribution of Nucleotides and Common Sequences in Deoxyribonucleic Acid from Selected Bacteriophages

    PubMed Central

    Skalka, A.; Hanson, P.

    1972-01-01

    Results from comparisons of deoxyribonucleic acid (DNA) from several classes of bacteriophages suggest that most phage chromosomes contain either a homogeneous distribution of nucleotides or are made up of a few, rather large segments of different quanine plus cytosine (G + C) contents which are internally homogeneous. Among those temperate phages tested, most contained segmented DNA. Comparisons of sequence similarities among segments from lambdoid phage DNA species revealed the following order in relatedness to λ: 82 (and 434) > 21 > 424 > φ80. Most common sequences are found in the highest G + C segments, which in λ contain head and tail genes. Hybridization tests with λ and 186 or P2 DNA species verified that the lambdoids and 186 and P2 belong to two distinct groups. There are fewer homologous sequences between the DNA species of coliphages λ and P2 or 186 than there are between the DNA species of coliphage λ and salmonella phage P22. PMID:4553679

  6. Nucleotide sequence of a satellite RNA associated with carrot motley dwarf in parsley and carrot.

    PubMed

    Menzel, Wulf; Maiss, Edgar; Vetten, H Josef

    2009-02-01

    Carrot motley dwarf (CMD) is known to result from a mixed infection by two viruses, the polerovirus Carrot red leaf virus and one of the umbraviruses Carrot mottle mimic virus or Carrot mottle virus. Some umbraviruses have been shown to be associated with small satellite (sat) RNAs, but none have been reported for the latter two. A CMD-affected parsley plant was used for sap transmission to test plants, that were used for dsRNA isolation. The presence of a 0.8-kbp dsRNA indicated the occurrence of a hitherto unrecognized satRNA associated with CMD. The satRNAs of the CMD isolate from parsley and an isolate from carrot have been sequenced and showed 94% sequence identity. Nucleotide sequences and putative translation products had no significant similarities to GenBank entries. To our knowledge, this is the first report of satRNAs associated with CMD.

  7. Characterization and partial nucleotide sequence of endogenous type C retrovirus segments in human chromosomal DNA.

    PubMed Central

    Repaske, R; O'Neill, R R; Steele, P E; Martin, M A

    1983-01-01

    Twenty-six different murine leukemia virus (MuLV)-related clones have been isolated from a human DNA library and characterized by restriction enzyme mapping and reciprocal nucleic acid hybridization reactions. The sequence of approximately 2,600 nucleotides, spanning more than 4.0 kilobases, of one of the MuLV-related cloned human DNAs was also determined. The deduced amino acid sequence permitted the alignment of this prototype cloned human DNA segment with the p12 gag, p30 gag, p10 gag, and pol regions of Moloney MuLV. A majority of the endogenous type C retrovirus-related segments present in human DNA are approximately 6.0 kilobases in size and appear to contain a deletion of env sequences. Images PMID:6298769

  8. Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

    PubMed Central

    Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

    1987-01-01

    The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

  9. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  10. Nucleotide sequences of the 3' terminal region of onion yellow dwarf virus isolates from Allium plants in Japan.

    PubMed

    Tsuneyoshi, T; Ikeda, Y; Sumi, S

    1997-01-01

    The 2032 nucleotide sequence of the 3' terminal region of onion yellow dwarf virus (OYDV) isolated from Allium wakegi, bearing the genes for viral coat protein (CP) and a truncated RNA-dependent RNA polymerase, has been determined. Respective homologies of the nucleotide sequence in the corresponding region and the deduced amino acid sequence of CP with the equivalents of leek yellow stripe virus (LYSV) from garlic were 68.0 and 59.3%. Variation in the nucleotide sequence is concentrated in the boundary region between the putative RNA-dependent RNA polymerase gene and the CP gene as well as in the 3' noncoding region. These sequence divergencies, including the deletion of 79 nucleotides, resulted both in alterations to the amino acid sequence and the absence of 28 amino acid residues in the amino terminal region of OYDV CP in comparison with LYSV CP. In addition, the length of the 3' noncoding sequence of OYDV was one-third that of LYSV. Comparison of the 3' terminal 1197 nucleotides sequence of OYDV with sequences of the respective cDNAs cloned by RT-PCR directly from the total RNA of infected Allium plants that included two varieties of A. fistulosum, "Wakenegi" and "Shimonita-negi", and A. chinense, showed 90.7% overall identities, even though they have long been cultivated in locally restricted area in Japan. These findings appear to suggest that a single strain of OYDV invaded Japanese Allium plants long ago and spread throughout them. PMID:9354273

  11. cDNA sequence coding for the alpha'-chain of the third complement component in the African lungfish.

    PubMed

    Sato, A; Sültmann, H; Mayer, W E; Figueroa, F; Tichy, H; Klein, J

    1999-04-01

    cDNA clones coding for almost the entire C3 alpha-chain of the African lungfish (Protopterus aethiopicus), a representative of the Sarcopterygii (lobe-finned fishes), were sequenced and characterized. From the sequence it is deduced that the lungfish C3 molecule is probably a disulphide-bonded alpha:beta dimer similar to that of the C3 components of other jawed vertebrates. The deduced sequence contains conserved sites presumably recognized by proteolytic enzymes (e.g. factor I) involved in the activation and inactivation of the component. It also contains the conserved thioester region and the putative site for binding properdin. However, the site for the interaction with complement receptor 2 and factor H are poorly conserved. Either complement receptor 2 and factor H are not present in the lungfish or they bind to different residues at the same or a different site than mammalian complement receptor 2 and factor H. The C3 alpha-chain sequences faithfully reflect the phylogenetic relationships among vertebrate classes and can therefore be used to help to resolve the long-standing controversy concerning the origin of the tetrapods. PMID:10219761

  12. Evolution of tissue-specific keratins as deduced from novel cDNA sequences of the lungfish Protopterus aethiopicus.

    PubMed

    Schaffeld, Michael; Bremer, Miriam; Hunzinger, Christian; Markl, Jürgen

    2005-03-01

    Lungfishes are possibly the closest extant relatives of the land vertebrates (tetrapods). We report here the cDNA and predicted amino acid sequences of 13 different keratins (ten type I and three type II) of the lungfish Protopterus aethiopicus. These keratins include the orthologs of human K8 and K18. The lungfish keratins were also identified in tissue extracts using two-dimensional polyacrylamide gel electrophoresis, keratin blot binding assays and immunoblotting. The identified keratin spots were analyzed by peptide mass fingerprinting which assigned seven sequences (inclusively Protopterus K8 and K18) to their respective protein spot. The peptide mass fingerprints also revealed the fact that the major epidermal type I and type II keratins of this lungfish have not yet been sequenced. Nevertheless, phylogenetic trees constructed from multiple sequence alignments of keratins from lungfish and distantly related vertebrates such as lamprey, shark, trout, frog, and human reveal new insights into the evolution of K8 and K18, and unravel a variety of independent keratin radiation events. PMID:15819414

  13. Molecular cloning and sequence analysis of the cDNA encoding rat liver cysteine sulfinate decarboxylase (CSD).

    PubMed

    Reymond, I; Sergeant, A; Tappaz, M

    1996-06-01

    The taurine biosynthesis enzyme, cysteine sulfinate decarboxylase (CSD), was purified to homogeneity from rat liver. Three CSD peptides generated by tryptic cleavage were isolated and partially sequenced. Two of them showed a marked homology with glutamate decarboxylase and their respective position on the CSD amino acid sequence was postulated accordingly. Using appropriate degenerated primers derived from these two peptides, a PCR amplified DNA fragment was generated from liver poly(A)+ mRNA, cloned and used as a probe to screen a rat liver cDNA library. Three cDNAs, length around 1800 bp, were isolated which all contained an open reading frame (ORF) encoding a 493 amino acid protein with a calculated molecular mass of 55.2 kDa close to the experimental values for CSD. The encoded protein contained the sequence of the three peptides isolated from homogenous liver CSD. Our data confirm and significantly extend those recently published (Kaisaki et al. (1995) Biochim. Biophys. Acta 1262, 79-82). Indeed, an additional base pair found 1371 bp downstream from the initiation codon led to a shift in the open reading frame which extended the carboxy-terminal end by 15 amino acid residues and altogether modified 36 amino acids. The validity of this correction is supported by the finding that the corrected reading frame encoded a peptide issued from CSD tryptic cleavage that was not encoded anywhere in the CSD sequence previously reported. PMID:8679699

  14. Nucleotide sequences derived from pheasant DNA in the genome of recombinant avian leukosis viruses with subgroup F specificity.

    PubMed

    Keshet, E; Temin, H M

    1977-11-01

    Recombination between viral and cellular genes can give rise to new strains of retroviruses. For example, Rous-associated virus 61 (RAV-61) is a recombinant between the Bryan high-titer strain of Rous sarcoma virus (RSV) and normal pheasant DNA. Nucleic acid hybridization techniques were used to study the genome of RAV-61 and another RAV with subgroup F specificity (RAV-F) obtained by passage of RSV-RAV-0 in cells from a ring-necked pheasant embryo. The nucleotide sequences acquired by these two independent isolates of RAV-F that were not shared with the parental virus comprised 20 to 25% of the RAV-F genomes and were indistinguishable by nucleic acid hybridization. (In addition, RAV-F genomes had another set of nucleotide sequences that were homologous to some pheasant nucleotide sequences and also were present in the parental viruses.) A specific complementary DNA, containing only nucleotide sequences complementary to those acquired by RAV-61 through recombination, was prepared. These nucleotide sequences were pheasant derived and were not present in the genomes of reticuloendotheliosis viruses, pheasant viruses, and avian leukosis-sarcoma viruses of subgroups A, B, C, D, and E. They were partially endogenous, however, to avian DNA other than pheasant. The fraction of these nucleotide sequences present in other avian DNAs generally paralleled the genetic relatedness of these avian species to pheasants. However, there was a high degree of homology between these pheasant nucleotide sequences and related nucleotide sequences in the DNA of normal chickens as indicated by the identical melting profiles of the respective hybrids.

  15. Primary structure of the T3 gamma subunit of the T3/T cell antigen receptor complex deduced from cDNA sequences: evolution of the T3 gamma and delta subunits.

    PubMed Central

    Krissansen, G W; Owen, M J; Verbi, W; Crumpton, M J

    1986-01-01

    cDNA clones, whose fusion proteins were recognised by an anti-(T3 gamma chain) serum, were isolated from a lambda gt11 expression library prepared from the human T leukaemia cell line J6. The clones encoded a unique sequence related to that of the T3 delta chain, and hybridised to two mRNA transcripts of 0.8 and 3.5 kb in size, whose expression was restricted to T lymphocytes. The 182 amino acid sequence deduced from the cDNA revealed a typical signal peptide, a predominantly hydrophilic 89 amino residue domain with two N-glycosylation sites, a hydrophobic domain with a centrally located glutamic acid residue and a 44-residue domain with at least one potential serine phosphorylation site for protein kinase C. Given this arrangement the T3 gamma polypeptide most probably has a transmembrane orientation with the N-terminal domain exposed on the cell surface. The amino acid and nucleotide sequences showed marked homology with those of the T3 delta chain, suggesting that the respective genes arose by duplication about 200 million years ago. The intracellular and membrane-proximal half of the extracellular domains were especially well conserved. Images Fig. 1. Fig. 5. PMID:2944745

  16. Nucleotide sequence of the Shiga-like toxin genes of Escherichia coli.

    PubMed Central

    Calderwood, S B; Auclair, F; Donohue-Rolfe, A; Keusch, G T; Mekalanos, J J

    1987-01-01

    We have determined the nucleotide sequence of the sltA and sltB genes that encode the Shiga-like toxin (SLT) produced by Escherichia coli phage H19B. The amino acid composition of the A and B subunits of SLT is very similar to that previously established for Shiga toxin from Shigella dysenteriae 1, and the deduced amino acid sequence of the B subunit of SLT is identical with that reported for the B subunit of Shiga toxin. The genes for the A and B subunits of SLT apparently constitute an operon, with only 12 nucleotides separating the coding regions. There is a 21-base-pair region of dyad symmetry overlapping the proposed promoter of the slt operon that may be involved in regulation of SLT production by iron. The peptide sequence of the A subunit of SLT is homologous to the A subunit of the plant toxin ricin, providing evidence for the hypothesis that certain prokaryotic toxins may be evolutionarily related to eukaryotic enzymes. Images PMID:3299365

  17. Genomic DNA enrichment using sequence capture microarrays: a novel approach to discover sequence nucleotide polymorphisms (SNP) in Brassica napus L.

    PubMed

    Clarke, Wayne E; Parkin, Isobel A; Gajardo, Humberto A; Gerhardt, Daniel J; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G; Snowdon, Rod J; Federico, Maria L; Iniguez-Luy, Federico L

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci -QTL- analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species.

  18. Porcine dentin matrix protein 1: gene structure, cDNA sequence, and expression in teeth.

    PubMed

    Kim, Jung-Wook; Yamakoshi, Yasuo; Iwata, Takanori; Hu, Yuan Yuan; Zhang, Hengmin; Hu, Jan C-C; Simmer, James P

    2006-02-01

    Dentin matrix protein 1 (DMP1) is an acidic non-collagenous protein that is necessary for the proper biomineralization of bone, cartilage, cementum, dentin, and enamel. Dentin matrix protein 1 is highly phosphorylated and potentially glycosylated, but there is no experimental data identifying which specific amino acids are modified. For the purpose of facilitating the characterization of DMP1 from pig, which has the advantage of large developing teeth for obtaining protein in quantity and extensive structural information concerning other tooth matrix proteins, we characterized the porcine DMP1 cDNA and gene structure, raised anti-peptide immunoglobulins that are specific for porcine DMP1, and detected DMP1 protein in porcine tooth extracts and histological sections. Porcine DMP1 has 510 amino acids, including a 16-amino acid signal peptide. The deduced molecular weight of the secreted, unmodified protein is 53.5 kDa. The protein has 93 serines and 12 threonines in the appropriate context for phosphorylation, and four asparagines in a context suitable for glycosylation. Dentin matrix protein 1 protein bands with apparent molecular weights between 30 and 45 kDa were observed in partially purified dentin extracts. In developing teeth, immunohistochemistry localized DMP1 in odontoblasts and the dentinal tubules of mineralized dentin and in ameloblasts, but not in the enamel matrix.

  19. Nucleotide Sequences and Modifications That Determine RIG-I/RNA Binding and Signaling Activities ▿

    PubMed Central

    Uzri, Dina; Gehrke, Lee

    2009-01-01

    Cytoplasmic viral RNAs with 5′ triphosphates (5′ppp) are detected by the RNA helicase RIG-I, initiating downstream signaling and alpha/beta interferon (IFN-α/β) expression that establish an antiviral state. We demonstrate here that the hepatitis C virus (HCV) 3′ untranslated region (UTR) RNA has greater activity as an immune stimulator than several flavivirus UTR RNAs. We confirmed that the HCV 3′-UTR poly(U/UC) region is the determinant for robust activation of RIG-I-mediated innate immune signaling and that its antisense sequence, poly(AG/A), is an equivalent RIG-I activator. The poly(U/UC) region of the fulminant HCV JFH-1 strain was a relatively weak activator, while the antisense JFH-1 strain poly(AG/A) RNA was very potent. Poly(U/UC) activity does not require primary nucleotide sequence adjacency to the 5′ppp, suggesting that RIG-I recognizes two independent RNA domains. Whereas poly(U) 50-nt or poly(A) 50-nt sequences were minimally active, inserting a single C or G nucleotide, respectively, into these RNAs increased IFN-β expression. Poly(U/UC) RNAs transcribed in vitro using modified uridine 2′ fluoro or pseudouridine ribonucleotides lacked signaling activity while functioning as competitive inhibitors of RIG-I binding and IFN-β expression. Nucleotide base and ribose modifications that convert activator RNAs into competitive inhibitors of RIG-I signaling may be useful as modulators of RIG-I-mediated innate immune responses and as tools to dissect the RNA binding and conformational events associated with signaling. PMID:19224987

  20. The nucleotide sequences of some large ribonuclease T1 products from bacteriophage R17 ribonucleic acid

    PubMed Central

    Jeppesen, Peter G. N.

    1971-01-01

    A method of `fingerprinting' high-molecular-weight 32P-labelled RNA species, using a two-dimensional thin-layer-chromatographic separation of ribonuclease T1 digestion products, has been applied to RNA from the Escherichia coli bacteriophage R17. The `fingerprinting' technique, besides giving a unique pattern that can be used as a characterization of the RNA, has made it possible to isolate a number of the larger oligonucleotides and to determine their nucleotide sequences. ImagesPLATE 1 PMID:5158505

  1. The Complete Nucleotide Sequence of the Mitochondrial Genome of Bactrocera minax (Diptera: Tephritidae)

    PubMed Central

    Zhang, Bin; Nardi, Francesco; Hull-Sanders, Helen; Wan, Xuanwu; Liu, Yinghong

    2014-01-01

    The complete 16,043 bp mitochondrial genome (mitogenome) of Bactrocera minax (Diptera: Tephritidae) has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%). Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs). Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD), the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites) and amino acid sequence distance (ASD) were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD) and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T) stretch at the 5′ end of the CR followed by a [TA(A)]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front of the

  2. The nucleotide sequence of glutamate tRNA4 of Drosophila melanogaster.

    PubMed Central

    Altwegg, M; Kubli, E

    1980-01-01

    The nucleotide sequence of Drosophila melanogaster glutamate tRNA4 was determined to be: pU-C-C-C-A-U-A-U-G-G-U-C-psi-A-G-D-G-G-C-D-A-G-G-A-U-A-U-C-U-G-G-C (m) -U-U-U-C-A-C-C-A-G-A-A-G-G-C-C-C-G-G-G-T-psi-U-C-G-A-U-U-C-C-C-G-G-U-A-U-G-G-G-A-A-C-C-AOH. A partial modified C is found at position 32 in the anticodon loop. Images PMID:6775307

  3. Nucleotide sequence and organization of copper resistance genes from Pseudomonas syringae pv. tomato

    SciTech Connect

    Mellano, M.A.; Cooksey, D.A.

    1988-06-01

    The nucleotide sequence of a 4.5-kilobase copper resistance determinant from Pseudomonas syringae pv. tomato revealed four open reading frames (ORFs) in the same orientation. Deletion and site-specific mutational analyses indicated that the first two ORFs were essential for copper resistance; the last two ORFs were required for full resistance, but low-level resistance could be conferred in their absence. Five highly conserved, direct 24-base repeats were found near the beginning of the second ORF, and a similar, but less conserved, repeated region was found in the middle of the first ORF.

  4. Molecular cloning and nucleotide sequence of the 1,2-alpha-D-mannosidase gene, msdS, from Aspergillus saitoi and expression of the gene in yeast cells.

    PubMed

    Inoue, T; Yoshida, T; Ichishima, E

    1995-12-01

    A full-length cDNA encoding 1,2-alpha-D-mannosidase (EC 3.2.1.113) from Aspergillus saitoi was cloned. Analysis of the 1718 bp nucleotide sequence of the cDNA revealed a single open reading frame with 1539 nucleotides of 1,2-alpha-D-mannosidase gene, msdS. The predicted amino-acid sequence of 1,2-alpha-D-mannosidase consists of 513 residues with a molecular mass of 55,767 and is 70%, 26% and 35% identity with those of Penicillium citrinum 1,2-alpha-D-mannosidase, yeast alpha-mannosidase, and mouse alpha-mannosidase. The cDNA of the msdS gene has been cloned and expressed in yeast cells. To identify the activity of expression product methyl-2-O-alpha-mannopyranosyl-alpha-mannopyranoside (Man alpha 1-->2Man-OMe) was used as a substrate at pH 5.0. PMID:8519794

  5. Cloning and characterization of a cDNA sequence encoding the precursor of a chlorotoxin-like peptide from the Chinese scorpion Buthus martensii Karsch.

    PubMed

    Zeng, X C; Li, W X; Zhu, S Y; Peng, F; Zhu, Z H; Wu, K L; Yiang, F H

    2000-08-01

    A full-length cDNA sequence encoding the precursor of a venom peptide with homology to chlorotoxin (named BmKCT) was isolated from a cDNA library made from the venom glands of the Chinese Scorpion Buthus martensii Karsch. The encoded precursor of BmKCT was 59 amino acid residues long including a signal peptide of 24 residues and a mature toxin of 35 residues with four disulfide bridges. The sequence of BmKCT is similar (68% identities) to that of chlorotoxin isolated from Leiurus quinguestriatus quinquestriatus. BmKCT is the first report of the cDNA sequences encoding four-disulfide-bridged short-chain toxins from Buthus martensuii Karsch so far.

  6. Controlled ribonucleotide tailing of cDNA ends (CRTC) by terminal deoxynucleotidyl transferase: a new approach in PCR-mediated analysis of mRNA sequences.

    PubMed

    Schmidt, W M; Mueller, M W

    1996-05-01

    Controlled ribonucleotide tailing of cDNA ends (CRTC) by terminal deoxynucleotidyl transferase is a polymerase chain reaction (PCR)-mediated technique that was developed to facilitate cloning and direct sequence analysis of complete 5'-terminal unknown coding regions of rare RNA molecules. In contrast with standard tailing protocols using dNTPs as the substrate, ribo-tailing of cDNA ends is easily controllable, self-limited (from two to four rNMP incorporations) and highly efficient (>98%). By virtue of the homopolymeric ribo-tail, the modified cDNA is anchored to the 3' overhang of a double-stranded DNA-adaptor in a T4 DNA ligase-dependent ligation. PCR amplification, mediated by two sequence-specific primers, yields the desired unique product suitable for cloning and dideoxy-sequencing.

  7. cDNA sequence of the horse (Equus caballus) LAMA3 gene and characterization of two intronic SNP markers.

    PubMed

    Milenkovic, Dragan; Mata, Xavier; Chadi, Sead; Guérin, Gérard

    2005-12-01

    Laminins are large heterotrimeric basement membrane glycoproteins composed of alpha, beta and gamma chains. The Laminin 5 isoform has an alpha3beta3gamma2 composition and is essential for the adhesion of basal keratinocytes to the underlying epithelial basement membrane where it is mainly located. Mutations in the genes coding for the 3 chains have been associated with a severe skin blistering disease, Herlitz's junctional epidermolysis bullosa (JEB), observed in different species as man, dog, cat and horse. In this study, we report the sequence of the 5.2 kb horse laminin alpha 3 cDNA (LAMA3) as well as the detection of two intronic SNPs. These data will be useful to further identify causal mutations for the disease in this gene. PMID:16287627

  8. Nucleotide deletion and P addition in V(D)J recombination: a determinant role of the coding-end sequence.

    PubMed Central

    Nadel, B; Feeney, A J

    1997-01-01

    During V(D)J recombination, the coding ends to be joined are extensively modified. Those modifications, termed coding-end processing, consist of removal and addition of various numbers of nucleotides. We previously showed in vivo that coding-end processing is specific for each coding end, suggesting that specific motifs in a coding-end sequence influence nucleotide deletion and P-region formation. In this study, we created a panel of recombination substrates containing actual immunoglobulin and T-cell receptor coding-end sequences and dissected the role of each motif by comparing its processing pattern with those of variants containing minimal nucleotide changes from the original sequence. Our results demonstrate the determinant role of specific sequence motifs on coding-end processing and also the importance of the context in which they are found. We show that minimal nucleotide changes in key positions of a coding-end sequence can result in dramatic changes in the processing pattern. We propose that each coding-end sequence dictates a unique hairpin structure, the result of a particular energy conformation between nucleotides organizing the loop and the stem, and that the interplay between this structure and specific sequence motifs influences the frequency and location of nicks which open the coding-end hairpin. These findings indicate that the sequences of the coding ends determine their own processing and have a profound impact on the development of the primary B- and T-cell repertoires. PMID:9199310

  9. A cDNA from pea petals with sequence similarity to pollen allergen, cytokinin-induced and genetic tumour-specific genes: identification of a new family of related sequences.

    PubMed

    Michael, A J

    1996-01-01

    A cDNA isolated from pea petals exhibits extensive similarity to pollen allergen genes, a cytokinin-regulated cDNA from soybean suspension cultures, a partial cDNA preferentially expressed in tobacco genetic tumours, four Arabidopsis expressed sequence tags (ESTs) and fifteen rice ESTs. This diverse family of pollen-allergen-likes genes may have a common ancestor or at least share common functional domains. Possession of a putative signal peptide and a presumed extracellular location is a common aspect of this family of sequences. PMID:8616241

  10. Sequence analysis of the cDNA for the human casein kinase I {delta} (CSNK1D) gene and its chromosomal localization

    SciTech Connect

    Kusuda, Jun; Hidari, Nobuko; Hirai, Momoki; Hashimoto, Katsuyuki

    1996-02-15

    This article reports on the genetic mapping of a cDNA clone encoding human casein kinase I (CK1) using fluorescence in situ hybridization and polymerase chain reaction analysis of human-rodent hybrid cell panels. When compared to the amino acid sequence in the kinase domain of the rat, this cDNA seems to be a human homologue of the CK1 {delta} isoform. Sequence similarity to the kinase domains and function in DNA repair in Saccharomyces cerevisiae and Saccharomyces pombe are discussed. 14 refs., 2 figs.

  11. Expressed Sequence Tags Analysis and Design of Simple Sequence Repeats Markers from a Full-Length cDNA Library in Perilla frutescens (L.).

    PubMed

    Seong, Eun Soo; Yoo, Ji Hye; Choi, Jae Hoo; Kim, Chang Heum; Jeon, Mi Ran; Kang, Byeong Ju; Lee, Jae Geun; Choi, Seon Kang; Ghimire, Bimal Kumar; Yu, Chang Yeon

    2015-01-01

    Perilla frutescens is valuable as a medicinal plant as well as a natural medicine and functional food. However, comparative genomics analyses of P. frutescens are limited due to a lack of gene annotations and characterization. A full-length cDNA library from P. frutescens leaves was constructed to identify functional gene clusters and probable EST-SSR markers via analysis of 1,056 expressed sequence tags. Unigene assembly was performed using basic local alignment search tool (BLAST) homology searches and annotated Gene Ontology (GO). A total of 18 simple sequence repeats (SSRs) were designed as primer pairs. This study is the first to report comparative genomics and EST-SSR markers from P. frutescens will help gene discovery and provide an important source for functional genomics and molecular genetic research in this interesting medicinal plant.

  12. Expressed Sequence Tags Analysis and Design of Simple Sequence Repeats Markers from a Full-Length cDNA Library in Perilla frutescens (L.)

    PubMed Central

    Seong, Eun Soo; Yoo, Ji Hye; Choi, Jae Hoo; Kim, Chang Heum; Jeon, Mi Ran; Kang, Byeong Ju; Lee, Jae Geun; Choi, Seon Kang; Ghimire, Bimal Kumar; Yu, Chang Yeon

    2015-01-01

    Perilla frutescens is valuable as a medicinal plant as well as a natural medicine and functional food. However, comparative genomics analyses of P. frutescens are limited due to a lack of gene annotations and characterization. A full-length cDNA library from P. frutescens leaves was constructed to identify functional gene clusters and probable EST-SSR markers via analysis of 1,056 expressed sequence tags. Unigene assembly was performed using basic local alignment search tool (BLAST) homology searches and annotated Gene Ontology (GO). A total of 18 simple sequence repeats (SSRs) were designed as primer pairs. This study is the first to report comparative genomics and EST-SSR markers from P. frutescens will help gene discovery and provide an important source for functional genomics and molecular genetic research in this interesting medicinal plant. PMID:26664999

  13. Molecular cloning and sequence of cDNA encoding polyoma medium tumor antigen-associated 61-kDa protein.

    PubMed Central

    Walter, G; Ferre, F; Espiritu, O; Carbone-Wiley, A

    1989-01-01

    Polyoma virus medium tumor antigen forms specific complexes with several cellular proteins; among these is a protein of approximately 61 kDa. With antibodies directed against medium tumor antigen, the 61-kDa protein was purified from human 293 cells that were infected with a hybrid adenovirus and overexpressed medium tumor antigen. The purified 61-kDa protein was partially digested with protease V8, and one of the protease V8 fragments was isolated and partially sequenced. The amino acid sequence information was used to design mixed oligonucleotide probes for screening a cDNA library from human placenta. A clone was isolated that hybridized with two separate probes; the clone contained an insert with an open reading frame for 589 amino acids. By in vitro translation of the transcript from this insert, a protein was generated that had the same size and yielded the same pattern of protease V8 fragments as the original 61-kDa protein. Its amino acid sequence reveals 15 repeats, the majority of which are 39 amino acids long. This protein bears no resemblance to proteins in the data bank that was searched. Images PMID:2554323

  14. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)1

    PubMed Central

    Thammina, Chandra S.; Olsen, Richard T.; Malapi-Wight, Martha; Crouch, Jo Anne; Pooler, Margaret R.

    2014-01-01

    • Premise of the study: Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. • Methods and Results: cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and sequenced using the Illumina MiSeq system. Approximately 11.9 million base pairs of sequence data were examined and 845 genic-SSRs were identified, including 469 dinucleotide, 360 trinucleotide, seven tetranucleotide, one pentanucleotide, and eight hexanucleotide repeats. Primer pairs were designed for 71 selectively chosen genic-SSRs containing trinucleotide repeat motifs and were used to amplify the corresponding loci in 18 diverse boxwood accessions. Twenty-three primer pairs amplified polymorphic loci, with two to 10 alleles per locus. • Conclusions: These novel polymorphic genic-SSR markers will aid in evaluating genetic diversity of boxwood germplasm and allow verification of hybrids and cultivars for breeding programs. PMID:25506525

  15. Tilapia growth hormone: molecular cloning of cDNA and expression in Escherichia coli.

    PubMed

    Rentier-Delrue, F; Swennen, D; Philippart, J C; L'Hoir, C; Lion, M; Benrubi, O; Martial, J A

    1989-05-01

    A cDNA library was prepared from poly(A)+RNA extracted from tilapia Oreochromis niloticus anterior pituitaries. The recombinant clones carrying the cDNA sequence of tilapia growth hormone (tiGH) were selected using a fragment of the trout growth hormone (tGH) cDNA as hybridization probe. The nucleotide sequence of the full-length tiGH cDNA was determined. This cDNA encodes a protein of 204 amino acids, including the putative signal peptide of 17 amino acids. Mature tiGH cDNA was inserted in an Escherichia coli expression vector which led to the production of tiGH protein with a yield estimated to be 20% of the total bacterial proteins. PMID:2670496

  16. Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

    PubMed Central

    2013-01-01

    Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different

  17. Infectious hepatitis B virus from cloned DNA of known nucleotide sequence.

    PubMed Central

    Will, H; Cattaneo, R; Darai, G; Deinhardt, F; Schellekens, H; Schaller, H

    1985-01-01

    The infectivity of cloned hepatitis B viral DNA (HBV) has been tested in chimpanzees to identify a fully functional HBV genome and to assess the risk associated with its handling. Only one of two HBV DNA sequence variants tested was shown to be infectious. "Clone purified" virus of predicted nucleotide sequence was produced from the infectious HBV DNA, and the cloned viral genome was identical in structure with naturally occurring HBV. Infection could be initiated independent of whether circular monomeric or plasmid integrated dimeric forms of the viral genome were inoculated, but the infectivity of the DNA depended on liver cell transfection or intrahepatic injection. Intravenous injection of high doses of infectious HBV DNA did not induce hepatitis, suggesting that there is virtually no risk associated with routine laboratory handling of cloned HBV DNA. Images PMID:2983320

  18. The uteroglobin gene region: hormonal regulation, repetitive elements and complete nucleotide sequence of the gene.

    PubMed Central

    Suske, G; Wenz, M; Cato, A C; Beato, M

    1983-01-01

    Differential uteroglobin induction represents an appropriate model for the molecular analysis of the mechanism by which steroid hormones control gene expression in mammals. We have analyzed the structure and hormonal regulation of a 35 Kb region of genomic DNA in which the uteroglobin gene is located. The complete sequence of 3,700 nucleotides including the uteroglobin gene and its flanking regions has been determined, and the limits of the gene established by S1 nuclease mapping. Several regions containing repeated sequences were mapped by blot hybridization, one of which is located within the large intron in the uteroglobin gene. Analysis of the RNAs extracted from endometrium, lung and liver, after treatment with estrogen and/or progesterone shows that within the 35 Kb region, the uteroglobin gene is the only DNA segment whose transcription into stable RNA is induced by progesterone. Images PMID:6304644

  19. Using mitochondrial nucleotide sequences to investigate diversity and genealogical relationships within common carp (Cyprinus carpio L.).

    PubMed

    Thai, B T; Burridge, C P; Pham, T A; Austin, C M

    2005-02-01

    Direct sequencing of mitochondrial DNA (mtDNA) D-loop (745 bp) and MTATPase6/MTATPase8 (857 bp) regions was used to investigate genetic variation within common carp and develop a global genealogy of common carp strains. The D-loop region was more variable than the MTATPase6/MTATPase8 region, but given the wide distribution of carp the overall levels of sequence divergence were low. Levels of haplotype diversity varied widely among countries with Chinese, Indonesian and Vietnamese carp showing the greatest diversity whereas Japanese Koi and European carp had undetectable nucleotide variation. A genealogical analysis supports a close relationship between Vietnamese, Koi and Chinese Color carp strains and to a lesser extent, European carp. Chinese and Indonesian carp strains were the most divergent, and their relationships do not support the evolution of independent Asian and European lineages and current taxonomic treatments.

  20. Nucleotide sequence of nifD from Frankia alni strain ArI3: phylogenetic inferences.

    PubMed

    Normand, P; Gouy, M; Cournoyer, B; Simonet, P

    1992-05-01

    The complete nucleotide sequence of the nifD gene encoding the alpha subunit of component I of nitrogenase from Frankia alni strain ArI3 was determined. The coding region is 1,458 bp in length and encodes a polypeptide of 486 residues with a predicted molecular weight of 53,500. Phylogenetic inferences with 12 complete published nifD sequences were drawn using a variety of approaches. Frankia nifD clusters with proteobacteria rather than with Clostridium pasteurianum, the other Gram-positive bacterium studied. Extant eubacterial nif genes seem to have at least three distinct evolutionary origins as a result of ancient gene duplications. Within the Gram-positive bacterial phylum, functional nif genes descend from different duplicates. PMID:1584016

  1. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    PubMed

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  2. Nucleotide sequence alignment of hdcA from Gram-positive bacteria

    PubMed Central

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A.

    2016-01-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4]. PMID:26958625

  3. Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications

    SciTech Connect

    Torella, JP; Lienert, F; Boehm, CR; Chen, JH; Way, JC; Silver, PA

    2014-08-07

    Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts, and they hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies-for example, repeated terminator and insulator sequences-that complicate recombination-based assembly. We and others have recently developed DNA assembly methods, which we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked with UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly assembled constructs, or into high-quality combinatorial libraries in only 2-3 d. If the DNA parts must be generated from scratch, an additional 2-5 d are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques.

  4. Unique nucleotide sequence (UNS)-guided assembly of repetitive DNA parts for synthetic biology applications

    PubMed Central

    Torella, Joseph P.; Lienert, Florian; Boehm, Christian R.; Chen, Jan-Hung; Way, Jeffrey C.; Silver, Pamela A.

    2016-01-01

    Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts and hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies — for example repeated terminator and insulator sequences — that complicate recombination-based assembly. We and others have recently developed DNA assembly methods that we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked with UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly-assembled constructs, or into high-quality combinatorial libraries in only 2–3 days. If the DNA parts must be generated from scratch, an additional 2–5 days are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques. PMID:25101822

  5. Nucleotide sequence of the DNA packaging and capsid synthesis genes of bacteriophage P2.

    PubMed Central

    Linderoth, N A; Ziermann, R; Haggård-Ljungquist, E; Christie, G E; Calendar, R

    1991-01-01

    Overlapping DNA fragments containing the DNA packaging and capsid synthesis gene region of bacteriophage P2 were cloned and sequenced. In this report we present the complete nucleotide sequence of this 6550 bp region. Each of six open reading frames found in the interval was assigned to one of the essential genes (Q, P, O, N, M and L) by correlating genetic, physical and mutational data with DNA and protein sequence information. Polypeptides predicted were: a capsid completion protein, gpL; the major capsid precursor, gpN; the presumed capsid scaffolding protein; gpO; the ATPase and proposed endonuclease subunits of terminase, gpP and gpM, respectively; and a candidate for the portal protein, gpQ. These gene and protein sequences exhibited no homology to analogous genes or proteins of other bacteriophages. Expression of gene Q in E. coli from a plasmid caused production of a Mr 39,000 Da protein that restored Qam34 growth. This sequence analysis found only genes previously known from analysis of conditional-lethal mutations. No new capsid genes were found. Images PMID:1837355

  6. Complete nucleotide sequence and genome organization of Pelargonium flower break virus.

    PubMed

    Rico, P; Hernández, C

    2004-03-01

    The complete nucleotide sequence of Pelargonium flower break virus (PFBV) has been determined. The genomic RNA is 3923 nucleotides (nt) long and contains five open reading frames (ORFs). The 5'-proximal ORF encodes a 27 kDa protein (p27) and terminates with an amber codon which may be read-through into an in-frame p56 ORF to generate a 86 kDa protein (p86) containing the viral RNA dependent-RNA polymerase motifs. Two small ORFs, located in the central part of the viral genome, encode polypeptides of 7 (p7) and 12 kDa (p12), respectively, which are very likely involved in virus movement. Interestingly, p12 presents a leucine zipper motif that has not been previously reported in related proteins. The 3'-proximal ORF encodes a 37 kDa capsid protein (CP). The p12 ORF is in-frame with the p86 ORF and a double read-through protein of 99 kDa (p99) may be produced. Amino acid sequence comparisons revealed that the proteins encoded by ORFs 2, 3 and 4 are more similar to the corresponding gene products of Carnation mottle virus than to those of other carmoviruses, whereas the p27 and the CP show higher identity with the equivalent proteins of Saguaro cactus virus. Phylogenetic analysis conducted with the different viral products confirmed the assignment of PFBV to the genus Carmovirus. PMID:14991450

  7. Genome-wide association study reveals five nucleotide sequence variants for carcass traits in beef cattle.

    PubMed

    Kim, Y; Ryu, J; Woo, J; Kim, J B; Kim, C Y; Lee, C

    2011-08-01

    Genetic associations of nucleotide sequence variants with carcass traits in beef cattle were investigated using a genome-wide single nucleotide polymorphism (SNP) assay. Three hundred and thirteen Korean cattle were genotyped with the Illumina BovineSNP50 BeadChip, and 39,129 SNPs from 311 animals were analysed for each carcass phenotype after filtering by quality assurance. Five sequence markers were associated with one of the meat quantity or quality traits; rs109593638 on chromosome 3 with marbling score, rs109821175 on chromosome 11 and rs110862496 on chromosome 13 with backfat thickness (BFT), and rs110228023 on chromosome 6 and rs110201414 on chromosome 16 with eye muscle area (EMA) (P < 1.27 × 10(-6) , Bonferonni P < 0.05). The ss96319521 SNP, located within a gene with functions of muscle development, dishevelled homolog 1 (DVL1), would be a desirable candidate marker. Individuals with genotype CC at this gene appeared to have increased both EMA and carcass weight. Fine-mapping would be required to refine each of the five association signals shown in the current study for future application in marker-assisted selection for genetic improvement of beef quality and quantity.

  8. Essential nucleotide sequences and secondary structure elements of the hairpin ribozyme.

    PubMed Central

    Berzal-Herranz, A; Joseph, S; Chowrira, B M; Butcher, S E; Burke, J M

    1993-01-01

    In vitro selection experiments have been used to isolate active variants of the 50 nt hairpin catalytic RNA motif following randomization of individual ribozyme domains and intensive mutagenesis of the ribozyme-substrate complex. Active and inactive variants were characterized by sequencing, analysis of RNA cleavage activity in cis and in trans, and by substrate binding studies. Results precisely define base-pairing requirements for ribozyme helices 3 and 4, and identify eight essential nucleotides (G8, A9, A10, G21, A22, A23, A24 and C25) within the catalytic core of the ribozyme. Activity and substrate binding assays show that point mutations at these eight sites eliminate cleavage activity but do not significantly decrease substrate binding, demonstrating that these bases contribute to catalytic function. The mutation U39C has been isolated from different selection experiments as a second-site suppressor of the down mutants G21U and A43G. Assays of the U39C mutation in the wild-type ribozyme and in a variety of mutant backgrounds show that this variant is a general up mutation. Results from selection experiments involving populations totaling more than 10(10) variants are summarized, and consensus sequences including 16 essential nucleotides and a secondary structure model of four short helices, encompassing 18 bp for the ribozyme-substrate complex are derived. Images PMID:8508779

  9. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    NASA Astrophysics Data System (ADS)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  10. Evidence for Balancing Selection from Nucleotide Sequence Analyses of Human G6PD

    PubMed Central

    Verrelli, Brian C.; McDonald, John H.; Argyropoulos, George; Destro-Bisol, Giovanni; Froment, Alain; Drousiotou, Anthi; Lefranc, Gerard; Helal, Ahmed N.; Loiselet, Jacques; Tishkoff, Sarah A.

    2002-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) mutations that result in reduced enzyme activity have been implicated in malarial resistance and constitute one of the best examples of selection in the human genome. In the present study, we characterize the nucleotide diversity across a 5.2-kb region of G6PD in a sample of 160 Africans and 56 non-Africans, to determine how selection has shaped patterns of DNA variation at this gene. Our global sample of enzymatically normal B alleles and A, A−, and Med alleles with reduced enzyme activities reveals many previously uncharacterized silent-site polymorphisms. In comparison with the absence of amino acid divergence between human and chimpanzee G6PD sequences, we find that the number of G6PD amino acid polymorphisms in human populations is significantly high. Unlike many other G6PD-activity alleles with reduced activity, we find that the age of the A variant, which is common in Africa, may not be consistent with the recent emergence of severe malaria and therefore may have originally had a historically different adaptive function. Overall, our observations strongly support previous genotype-phenotype association studies that proposed that balancing selection maintains G6PD deficiencies within human populations. The present study demonstrates that nucleotide sequence analyses can reveal signatures of both historical and recent selection in the genome and may elucidate the impact that infectious disease has had during human evolution. PMID:12378426

  11. Haplotype structure and population genetic inferences from nucleotide-sequence variation in human lipoprotein lipase.

    PubMed Central

    Clark, A G; Weiss, K M; Nickerson, D A; Taylor, S L; Buchanan, A; Stengård, J; Salomaa, V; Vartiainen, E; Perola, M; Boerwinkle, E; Sing, C F

    1998-01-01

    Allelic variation in 9.7 kb of genomic DNA sequence from the human lipoprotein lipase gene (LPL) was scored in 71 healthy individuals (142 chromosomes) from three populations: African Americans (24) from Jackson, MS; Finns (24) from North Karelia, Finland; and non-Hispanic Whites (23) from Rochester, MN. The sequences had a total of 88 variable sites, with a nucleotide diversity (site-specific heterozygosity) of .002+/-.001 across this 9.7-kb region. The frequency spectrum of nucleotide variation exhibited a slight excess of heterozygosity, but, in general, the data fit expectations of the infinite-sites model of mutation and genetic drift. Allele-specific PCR helped resolve linkage phases, and a total of 88 distinct haplotypes were identified. For 1,410 (64%) of the 2,211 site pairs, all four possible gametes were present in these haplotypes, reflecting a rich history of past recombination. Despite the strong evidence for recombination, extensive linkage disequilibrium was observed. The number of haplotypes generally is much greater than the number expected under the infinite-sites model, but there was sufficient multisite linkage disequilibrium to reveal two major clades, which appear to be very old. Variation in this region of LPL may depart from the variation expected under a simple, neutral model, owing to complex historical patterns of population founding, drift, selection, and recombination. These data suggest that the design and interpretation of disease-association studies may not be as straightforward as often is assumed. PMID:9683608

  12. Nucleotide sequence and newly formed phosphodiester bond of spontaneously ligated satellite tobacco ringspot virus RNA.

    PubMed Central

    Buzayan, J M; Hampel, A; Bruening, G

    1986-01-01

    The satellite RNA of tobacco ringspot virus (STobRV RNA) replicates and becomes encapsidated in association with tobacco ringspot virus. Previous results show that the infected tissue produces multimeric STobRV RNAs of both polarities. RNA that is complementary to encapsidated STobRV RNA, designated as having the (-) polarity, cleaves autolytically at a specific ApG bond. Purified autolysis products spontaneously join in a non-enzymic reaction. We report characteristics of this RNA ligation reaction: the terminal groups that react, the type of bond in the newly formed junction and the nucleotide sequence of the joined RNA. The nucleotide sequence of the ligated RNA shows that joining of the reacting RNAs restored an ApG bond. The junction ApG has a 3'-to-5' phosphodiester bond. Thus the net ligation reaction of STobRV (-)RNA is the precise reversal of autolysis. We discuss this new type of RNA ligation reaction and its implications for the formation of multimeric STobRV RNAs during replication. Images PMID:2433680

  13. Complete nucleotide sequence of the Nilaparvata lugens reovirus: a putative member of the genus Fijivirus.

    PubMed

    Nakashima, N; Koizumi, M; Watanabe, H; Noda, H

    1996-01-01

    The nucleotide sequences of all genome segments of the Nilaparvata lugens reovirus (NLRV), which is found in the brown planthopper Nilaparvata lugens, have been determined and some genes have been assigned to structural and functional proteins. The genome of NLRV consists of 28 699 nucleotides and contains at least 11 large open reading frames (ORFs). The genome of NLRV is the largest among viruses of the family Reoviridae reported to date. The deduced amino acid sequence of genome segment S1 contained the major motifs of RNA polymerase and that of S7 had the purine NTP-binding motif. Based on the molecular masses of the deduced proteins and the particle structure of NLRV, segments S1, S3 and S7 were assigned to the 160, 140 and 75 kDa proteins, respectively, that are located in the inner core. It was deduced that S2 codes for the 135 kDa protein (B spike), which is located on the surface of the inner core. Most reported ORFs of rice black streaked dwarf virus (RBSDV), which shares many properties with NLRV, had similarities with the corresponding ORFs of NLRV. An exception was S7 ORF2, which is found in RBSDV but not NLRV and may therefore be involved in multiplication of RBSDV in rice plants. These results and our previous observations indicate that NLRV should be classified in the genus Fijivirus.

  14. The cDNA sequences encoding two components of the polymeric fraction of the intracellular hemoglobin of Glycera dibranchiata.

    PubMed

    Zafar, R S; Chow, L H; Stern, M S; Scully, J S; Sharma, P R; Vinogradov, S N; Walz, D A

    1990-12-15

    The intracellular hemoglobin of the polychaete Glycera dibranchiata consists of several components, some of which self-associate into a "polymeric" fraction. The cDNA library constructed from the poly(A+) mRNA of Glycera erythrocytes (Simons, P. C., and Satterlee, J. D. (1989) Biochemistry 28, 8525-8530) was screened with two oligodeoxynucleotide probes corresponding to the amino acid sequences MEEKVP and AMNSKV. Each of the two probes identified a full-length positive insert; these were sequenced using the dideoxynucleotide chain termination method. One clone was 630 bases long and contained 36 bases of 5'-untranslated RNA, a reading frame of 441 bases coding for the 147 amino acids of globin P2 including the residues MEEKVP, and a 3'-untranslated region of 153 bases. The other clone was 540 bases long and contained 24 bases of 5'-untranslated RNA, an open reading frame of 441 bases coding for globin P3 including the residues AMNSKV, and a 3'-untranslated region of 75 bases. The inferred amino acid sequences of the two globins were in agreement with the partial amino acid sequences obtained by chemical methods. The P2 and P3 globin sequences, together with the previously determined P1 sequence of a complete insert and partial sequences P4, P5, and P6 obtained from partial inserts (Zafar, R. S., Chow, L. H., Stern, M. S., Vinogradov, S. N., and Walz, D. A. (1990) Biochim. Biophys. Acta, in press) suggest that there are at least six components in the polymeric fraction of Glycera hemoglobin, which is in agreement with the results of polyacrylamide gel electrophoresis in Tris/glycine buffer, pH 8.3, 6 M urea. Nothern and dot blot analyses of Glycera erythrocyte poly(A+) mRNA using the foregoing two cDNA probes clearly demonstrated the presence of mature messages encoding both types of globins. Comparison of the polymeric sequences P1, P2, and P3 with the "monomeric" globins M-II and M-IV using the alignment and templates of Bashford et al. (Bashford, D., Chothia, C

  15. Characterization, nucleotide sequence, and conserved genomic locations of insertion sequence ISRm5 in Rhizobium meliloti.

    PubMed Central

    Laberge, S; Middleton, A T; Wheatcroft, R

    1995-01-01

    A target for ISRm3 transposition in Rhizobium meliloti IZ450 is another insertion sequence element, named ISRm5. ISRm5 is 1,340 bp in length and possesses terminal inverted repeats of unequal lengths (27 and 28 bp) and contain five mismatches. An open reading frame that spans 89% of the length of one DNA strand encodes a putative transposase with significant similarity to the putative transposases of 11 insertion sequence elements from diverse bacterial species, including ISRm3 from R. meliloti. Multiple copies and variants of ISRm5 occur in the R. meliloti genome, often in close association with ISRm3. Five ISRm5 copies in two strains were studied, and each was found to be located between 8-bp direct repeats. At two of these loci, which were shown to be highly conserved in R. meliloti, the copies of ISRm5 were found to be associated with pairs of short inverted repeats resembling transcription terminators. This structural arrangement not only may provide a conserved niche for ISRm5 but also may be a preferred target for transposition. PMID:7768811

  16. Identification and nucleotide sequence of the glycoprotein gB gene of equine herpesvirus 4.

    PubMed

    Riggio, M P; Cullinane, A A; Onions, D E

    1989-03-01

    The nucleotide sequence of the glycoprotein gB gene of equine herpesvirus 4 (EHV-4) was determined. The gene was located within a BamHI genomic library by a combination of Southern and dot-blot hybridization with probes derived from the herpes simplex virus type 1 (HSV-1) gB DNA sequence. The predominant portion of the coding sequences was mapped to a 2.95-kilobase BamHI-EcoRI subfragment at the left-hand end of BamHI-C. Potential TATA box, CAT box, and mRNA start site sequences and the translational initiation codon were located in the BamHI M fragment of the virus, which is located immediately to the left of BamHI-C. A polyadenylation signal, AATAAA, occurs nine nucleotides past the chain termination codon. Translation of these sequences would give a 110-kilodalton protein possessing a 5' hydrophobic signal sequence, a hydrophilic surface domain containing 11 potential N-linked glycosylation sites, a hydrophobic transmembrane domain, and a 3' highly charged cytoplasmic domain. A potential internal proteolytic cleavage site, Arg-Arg/Ser, was identified at residues 459 to 461. Analysis of this protein revealed amino acid sequence homologies of 47% with HSV-1 gB, 54% with pseudorabies virus gpII, 51% with varicella-zoster virus gpII, 29% with human cytomegalovirus gB, and 30% with Epstein-Barr virus gB. Alignment of EHV-4 gB with HSV-1 (KOS) gB further revealed that four potential N-linked glycosylation sites and all 10 cysteine residues on the external surface of the molecules are perfectly conserved, suggesting that the proteins possess similar secondary and tertiary structures. Thus, we showed that EHV-4 gB is highly conserved with the gB and gpII glycoproteins of other herpesviruses, suggesting that this glycoprotein has a similar overall function in each virus. PMID:2915378

  17. Remarkable similarity in genome nucleotide sequences between the Schwarz FF-8 and AIK-C measles virus vaccine strains and apparent nucleotide differences in the phosphoprotein gene.

    PubMed

    Ito, Chie; Ohgimoto, Shinji; Kato, Seiichi; Sharma, Luna Bhatta; Ayata, Minoru; Komase, Katsuhiro; Takeuchi, Kaoru; Ihara, Toshiaki; Ogura, Hisashi

    2011-07-01

    The Schwarz FF-8 (FF-8) and AIK-C measles virus vaccine strains are currently used for vaccination in Japan. Here, the complete genome nucleotide sequence of the FF-8 strain has been determined and its genome sequence found to be remarkably similar to that of the AIK-C strain. These two strains are differentiated only by two nucleotide differences in the phosphoprotein gene. Since the FF-8 strain does not possess the amino acid substitutions in the phospho- and fusion proteins which are responsible for the temperature-sensitivity and small syncytium formation phenotypes of the AIK-C strain, respectively, other unidentified common mechanisms likely attenuate both the FF-8 and AIK-C strains.

  18. The bioinformatics of nucleotide sequence coding for proteins requiring metal coenzymes and proteins embedded with metals

    NASA Astrophysics Data System (ADS)

    Tremberger, G.; Dehipawala, Sunil; Cheung, E.; Holden, T.; Sullivan, R.; Nguyen, A.; Lieberman, D.; Cheung, T.

    2015-09-01

    All metallo-proteins need post-translation metal incorporation. In fact, the isotope ratio of Fe, Cu, and Zn in physiology and oncology have emerged as an important tool. The nickel containing F430 is the prosthetic group of the enzyme methyl coenzyme M reductase which catalyzes the release of methane in the final step of methano-genesis, a prime energy metabolism candidate for life exploration space mission in the solar system. The 3.5 Gyr early life sulfite reductase as a life switch energy metabolism had Fe-Mo clusters. The nitrogenase for nitrogen fixation 3 billion years ago had Mo. The early life arsenite oxidase needed for anoxygenic photosynthesis energy metabolism 2.8 billion years ago had Mo and Fe. The selection pressure in metal incorporation inside a protein would be quantifiable in terms of the related nucleotide sequence complexity with fractal dimension and entropy values. Simulation model showed that the studied metal-required energy metabolism sequences had at least ten times more selection pressure relatively in comparison to the horizontal transferred sequences in Mealybug, guided by the outcome histogram of the correlation R-sq values. The metal energy metabolism sequence group was compared to the circadian clock KaiC sequence group using magnesium atomic level bond shifting mechanism in the protein, and the simulation model would suggest a much higher selection pressure for the energy life switch sequence group. The possibility of using Kepler 444 as an example of ancient life in Galaxy with the associated exoplanets has been proposed and is further discussed in this report. Examples of arsenic metal bonding shift probed by Synchrotron-based X-ray spectroscopy data and Zn controlled FOXP2 regulated pathways in human and chimp brain studied tissue samples are studied in relationship to the sequence bioinformatics. The analysis results suggest that relatively large metal bonding shift amount is associated with low probability correlation R

  19. cDNA and deduced amino acid sequence of human pulmonary surfactant-associated proteolipid SPL(Phe)

    SciTech Connect

    Glasser, S.W.; Korfhagen, T.R.; Weaver, T.; Pilot-Matias, T.; Fox, J.L.; Whitsett, J.A.

    1987-06-01

    Hydrophobic surfactant-associated protein of M/sub r/ 6000-14,000 was isolated from either/ethanol or chloroform/methanol extracts of mammalian pulmonary surfactant. Automated Edman degradation in a gas-phase sequencer showed the major N-terminus of the human low molecular weight protein to be Phe-Pro-Ile-Pro-Leu-Pro-Try-Cys-Trp-Leu-Cys-Arg-Ala-Leu-. Because of the N-terminal phenylalanine, the surfactant protein was designated SPL(Phe). Antiserum generated against hydrophobic surfactant protein(s) from bovine pulmonary surfactant recognized protein of M/sub r/ 6000-14,000 in immunoblot analysis and was used to screen a lambdagt11 expression library constructed from adult human lung poly(A)/sup +/ RNA. This resulted in identification of a 1.4-kilobase cDNA clone that was shown to encode the N-terminus of the surfactant polypeptide SPL(Phe) (Phe-Pro-Ile-Pro-Leu-Pro-) within an open reading frame for a larger protein. Expression of a fused ..beta..-galactosidase-SPL (Phe) gene in Escherichia coli yielded an immunoreactive M/sub r/ 34,000 fusion peptide. Hybrid-arrested translation with the cDNA and immunoprecipitation of (/sup 35/S)methionine-labeled in vitro translation products of human poly(A)/sup +/ RNA with a surfactant polyclonal antibody resulted in identification of a M/sub r/ 40,000 precursor protein. Blot hybridization analysis of electrophoretically fractionated RNA from human lung detected a 2.0-kilobase RNA that was more abundant in adult lung than in fetal lung. These proteins, and specifically SPL(Phe), may therefore be useful for synthesis of replacement surfactants for treatment of hyaline membrane disease in newborn infants or of other surfactant-deficient states.

  20. The Venom Gland Transcriptome of Latrodectus tredecimguttatus Revealed by Deep Sequencing and cDNA Library Analysis

    PubMed Central

    He, Quanze; Duan, Zhigui; Yu, Ying; Liu, Zhen; Liu, Zhonghua; Liang, Songping

    2013-01-01

    Latrodectus tredecimguttatus, commonly known as black widow spider, is well known for its dangerous bite. Although its venom has been characterized extensively, some fundamental questions about its molecular composition remain unanswered. The limited transcriptome and genome data available prevent further understanding of spider venom at the molecular level. In the present study, we combined next-generation sequencing and conventional DNA sequencing to construct a venom gland transcriptome of the spider L. tredecimguttatus, which resulted in the identification of 9,666 and 480 high-confidence proteins among 34,334 de novo sequences and 1,024 cDNA sequences, respectively, by assembly, translation, filtering, quantification and annotation. Extensive functional analyses of these proteins indicated that mRNAs involved in RNA transport and spliceosome, protein translation, processing and transport were highly enriched in the venom gland, which is consistent with the specific function of venom glands, namely the production of toxins. Furthermore, we identified 146 toxin-like proteins forming 12 families, including 6 new families in this spider in which α-LTX-Lt1a family2 is firstly identified as a subfamily of α-LTX-Lt1a family. The toxins were classified according to their bioactivities into five categories that functioned in a coordinate way. Few ion channels were expressed in venom gland cells, suggesting a possible mechanism of protection from the attack of their own toxins. The present study provides a gland transcriptome profile and extends our understanding of the toxinome of spiders and coordination mechanism for toxin production in protein expression quantity. PMID:24312294

  1. The venom gland transcriptome of Latrodectus tredecimguttatus revealed by deep sequencing and cDNA library analysis.

    PubMed

    He, Quanze; Duan, Zhigui; Yu, Ying; Liu, Zhen; Liu, Zhonghua; Liang, Songping

    2013-01-01

    Latrodectus tredecimguttatus, commonly known as black widow spider, is well known for its dangerous bite. Although its venom has been characterized extensively, some fundamental questions about its molecular composition remain unanswered. The limited transcriptome and genome data available prevent further understanding of spider venom at the molecular level. In the present study, we combined next-generation sequencing and conventional DNA sequencing to construct a venom gland transcriptome of the spider L. tredecimguttatus, which resulted in the identification of 9,666 and 480 high-confidence proteins among 34,334 de novo sequences and 1,024 cDNA sequences, respectively, by assembly, translation, filtering, quantification and annotation. Extensive functional analyses of these proteins indicated that mRNAs involved in RNA transport and spliceosome, protein translation, processing and transport were highly enriched in the venom gland, which is consistent with the specific function of venom glands, namely the production of toxins. Furthermore, we identified 146 toxin-like proteins forming 12 families, including 6 new families in this spider in which α-LTX-Lt1a family2 is firstly identified as a subfamily of α-LTX-Lt1a family. The toxins were classified according to their bioactivities into five categories that functioned in a coordinate way. Few ion channels were expressed in venom gland cells, suggesting a possible mechanism of protection from the attack of their own toxins. The present study provides a gland transcriptome profile and extends our understanding of the toxinome of spiders and coordination mechanism for toxin production in protein expression quantity.

  2. araB Gene and nucleotide sequence of the araC gene of Erwinia carotovora.

    PubMed Central

    Lei, S P; Lin, H C; Heffernan, L; Wilcox, G

    1985-01-01

    The araB and araC genes of Erwinia carotovora were expressed in Escherichia coli and Salmonella typhimurium. The araB and araC genes in E. coli, E. carotovora, and S. typhimurium were transcribed in divergent directions. In E. carotovora, the araB and araC genes were separated by 3.5 kilobase pairs, whereas in E. coli and S. typhimurium they were separated by 147 base pairs. The nucleotide sequence of the E. carotovora araC gene was determined. The predicted sequence of AraC protein of E. carotovora was 18 and 29 amino acids longer than that of AraC protein of E. coli and S. typhimurium, respectively. The DNA sequence of the araC gene of E. carotovora was 58% homologous to that of E. coli and 59% homologous to that of S. typhimurium, with respect to the common region they share. The predicted amino acid sequence of AraC protein was 57% homologous to that of E. coli and 58% homologous to that of S. typhimurium. The 5' noncoding regions of the araB and araC genes of E. carotovora had little homology to either of the other two species. Images PMID:3902795

  3. Cloning and nucleotide sequence of the gene coding for citrate synthase from a thermotolerant Bacillus sp.

    PubMed Central

    Schendel, F J; August, P R; Anderson, C R; Hanson, R S; Flickinger, M C

    1992-01-01

    The structural gene coding for citrate synthase from the gram-positive soil isolate Bacillus sp. strain C4 (ATCC 55182) capable of secreting acetic acid at pH 5.0 to 7.0 in the presence of dolime has been cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking citrate synthase. The nucleotide sequence of the entire 3.1-kb HindIII fragment has been determined, and one major open reading frame was found coding for citrate synthase (ctsA). Citrate synthase from Bacillus sp. strain C4 was found to be a dimer (Mr, 84,500) with a subunit with an Mr of 42,000. The N-terminal sequence was found to be identical with that predicted from the gene sequence. The kinetics were best fit to a bisubstrate enzyme with an ordered mechanism. Bacillus sp. strain C4 citrate synthase was not activated by potassium chloride and was not inhibited by NADH, ATP, ADP, or AMP at levels up to 1 mM. The predicted amino acid sequence was compared with that of the E. coli, Acinetobacter anitratum, Pseudomonas aeruginosa, Rickettsia prowazekii, porcine heart, and Saccharomyces cerevisiae cytoplasmic and mitochondrial enzymes. PMID:1311544

  4. UMD-Predictor: A High-Throughput Sequencing Compliant System for Pathogenicity Prediction of any Human cDNA Substitution.

    PubMed

    Salgado, David; Desvignes, Jean-Pierre; Rai, Ghadi; Blanchard, Arnaud; Miltgen, Morgane; Pinard, Amélie; Lévy, Nicolas; Collod-Béroud, Gwenaëlle; Béroud, Christophe

    2016-05-01

    Whole-exome sequencing (WES) is increasingly applied to research and clinical diagnosis of human diseases. It typically results in large amounts of genetic variations. Depending on the mode of inheritance, only one or two correspond to pathogenic mutations responsible for the disease and present in affected individuals. Therefore, it is crucial to filter out nonpathogenic variants and limit downstream analysis to a handful of candidate mutations. We have developed a new computational combinatorial system UMD-Predictor (http://umd-predictor.eu) to efficiently annotate cDNA substitutions of all human transcripts for their potential pathogenicity. It combines biochemical properties, impact on splicing signals, localization in protein domains, variation frequency in the global population, and conservation through the BLOSUM62 global substitution matrix and a protein-specific conservation among 100 species. We compared its accuracy with the seven most used and reliable prediction tools, using the largest reference variation datasets including more than 140,000 annotated variations. This system consistently demonstrated a better accuracy, specificity, Matthews correlation coefficient, diagnostic odds ratio, speed, and provided the shortest list of candidate mutations for WES. Webservices allow its implementation in any bioinformatics pipeline for next-generation sequencing analysis. It could benefit to a wide range of users and applications varying from gene discovery to clinical diagnosis. PMID:26842889

  5. UMD‐Predictor: A High‐Throughput Sequencing Compliant System for Pathogenicity Prediction of any Human cDNA Substitution

    PubMed Central

    Salgado, David; Desvignes, Jean‐Pierre; Rai, Ghadi; Blanchard, Arnaud; Miltgen, Morgane; Pinard, Amélie; Lévy, Nicolas; Collod‐Béroud, Gwenaëlle

    2016-01-01

    ABSTRACT Whole‐exome sequencing (WES) is increasingly applied to research and clinical diagnosis of human diseases. It typically results in large amounts of genetic variations. Depending on the mode of inheritance, only one or two correspond to pathogenic mutations responsible for the disease and present in affected individuals. Therefore, it is crucial to filter out nonpathogenic variants and limit downstream analysis to a handful of candidate mutations. We have developed a new computational combinatorial system UMD‐Predictor (http://umd‐predictor.eu) to efficiently annotate cDNA substitutions of all human transcripts for their potential pathogenicity. It combines biochemical properties, impact on splicing signals, localization in protein domains, variation frequency in the global population, and conservation through the BLOSUM62 global substitution matrix and a protein‐specific conservation among 100 species. We compared its accuracy with the seven most used and reliable prediction tools, using the largest reference variation datasets including more than 140,000 annotated variations. This system consistently demonstrated a better accuracy, specificity, Matthews correlation coefficient, diagnostic odds ratio, speed, and provided the shortest list of candidate mutations for WES. Webservices allow its implementation in any bioinformatics pipeline for next‐generation sequencing analysis. It could benefit to a wide range of users and applications varying from gene discovery to clinical diagnosis. PMID:26842889

  6. cDNA sequence and mapping of the mouse Copb gene encoding the beta subunit of the COPI coatomer complex.

    PubMed

    LI, W; Elliott, R W; Novak, E K; Swank, R T

    1999-05-01

    COPI-coated vesicles are involved in retrograde-directed selective transport of proteins from the Golgi complex to the endoplasmic reticulum (ER) as well as mediate anterograde transport of cargo proteins within the Golgi or in endosomal trafficking. The COPI protein complex contains an ADP-ribosylation factor (ARF1) and seven coatamer subunits (alpha, beta, beta', gamma, delta, epsilon, zeta-COP). The localization and function of human beta subunit of coatamer (COPB) suggests it is likely a candidate gene of ruby-eye-2 (ru2), which is a mouse model of human Hermansky-Pudlak syndrome characterized by the dysfunction of several subcellular organelles. In this study, we determined the entire coding sequence of mouse (Copb) cDNA by combining an overlapping mouse EST contig with EST walking. beta-COP was found highly conserved in mouse, rat, and human, and it is ubiquitously expressed in mouse. The Copb gene was mapped to mouse Chr 7 at a position of 53.3 cM by radiation hybrid mapping. Our RH mapping data, sequencing of RT-PCR products, and Western blotting exclude the Copb gene as a candidate for ru2.

  7. WAViS server for handling, visualization and presentation of multiple alignments of nucleotide or amino acids sequences.

    PubMed

    Zika, Radek; Paces, Jan; Pavlícek, Adam; Paces, Václav

    2004-07-01

    Web Alignment Visualization Server contains a set of web-tools designed for quick generation of publication-quality color figures of multiple alignments of nucleotide or amino acids sequences. It can be used for identification of conserved regions and gaps within many sequences using only common web browsers. The server is accessible at http://wavis.img.cas.cz.

  8. Complete nucleotide sequences of two isolates of cherry green ring mottle virus from peach (Prunus persica) in China.

    PubMed

    Wang, Lihui; Jiang, Dongmei; Niu, Feiqing; Lu, Meiguang; Wang, Hongqing; Li, Shifang

    2013-03-01

    Two complete nucleotide sequences of cherry green ring mottle virus (CGRMV) isolated from peach in Hebei (Hs10) and Fujian (F9) Provinces, China, were determined. Five open reading frames (ORFs) were found in the genomes of both isolates. The F9 and Hs10 isolates shared 82.2 % and 83.4-94.4 % nucleotide sequence identity, respectively, with two CGRMV isolates from cherry. Analysis of the nucleotide and amino acid sequences from the five ORFs of both isolates showed that Hs10 shares the greatest sequence identity with P1A (GenBank AJ291761) from cherry. Phylogenetic analysis indicated that CGRMV isolates from peach and cherry are closely related to members of the genus Foveavirus.

  9. Amino acid sequence of Coprinus macrorhizus peroxidase and cDNA sequence encoding Coprinus cinereus peroxidase. A new family of fungal peroxidases.

    PubMed

    Baunsgaard, L; Dalbøge, H; Houen, G; Rasmussen, E M; Welinder, K G

    1993-04-01

    Sequence analysis and cDNA cloning of Coprinus peroxidase (CIP) were undertaken to expand the understanding of the relationships of structure, function and molecular genetics of the secretory heme peroxidases from fungi and plants. Amino acid sequencing of Coprinus macrorhizus peroxidase, and cDNA sequencing of Coprinus cinereus peroxidase showed that the mature proteins are identical in amino acid sequence, 343 residues in size and preceded by a 20-residue signal peptide. Their likely identity to peroxidase from Arthromyces ramosus is discussed. CIP has an 8-residue, glycine-rich N-terminal extension blocked with a pyroglutamate residue which is absent in other fungal peroxidases. The presence of pyroglutamate, formed by cyclization of glutamine, and the finding of a minor fraction of a variant form lacking the N-terminal residue, indicate that signal peptidase cleavage is followed by further enzymic processing. CIP is 40-45% identical in amino-acid sequence to 11 lignin peroxidases from four fungal species, and 42-43% identical to the two known Mn-peroxidases. Like these white-rot fungal peroxidases, CIP has an additional segment of approximately 40 residues at the C-terminus which is absent in plant peroxidases. Although CIP is much more similar to horseradish peroxidase (HRP C) in substrate specificity, specific activity and pH optimum than to white-rot fungal peroxidases, the sequences of CIP and HRP C showed only 18% identity. Hence, CIP qualifies as the first member of a new family of fungal peroxidases. The nine invariant residues present in all plant, fungal and bacterial heme peroxidases are also found in CIP. The present data support the hypothesis that only one chromosomal CIP gene exists. In contrast, a large number of secretory plant and fungal peroxidases are expressed from several peroxidase gene clusters. Analyses of three batches of CIP protein and of 49 CIP clones revealed the existence of only two highly similar alleles indicating less

  10. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    PubMed

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  11. Plastid sequence evolution: a new pattern of nucleotide substitutions in the Cucurbitaceae.

    PubMed

    Decker-Walters, Deena S; Chung, Sang-Min; Staub, Jack E

    2004-05-01

    Nucleotide substitutions (i.e., point mutations) are the primary driving force in generating DNA variation upon which selection can act. Substitutions called transitions, which entail exchanges between purines (A = adenine, G = guanine) or pyrimidines (C = cytosine, T = thymine), typically outnumber transversions (e.g., exchanges between a purine and a pyrimidine) in a DNA strand. With an increasing number of plant studies revealing a transversion rather than transition bias, we chose to perform a detailed substitution analysis for the plant family Cucurbitaceae using data from several short plastid DNA sequences. We generated a phylogenetic tree for 19 taxa of the tribe Benincaseae and related genera and then scored conservative substitution changes (e.g., those not exhibiting homoplasy or reversals) from the unambiguous branches of the tree. Neither the transition nor (A+T)/(G+C) biases found in previous studies were supported by our overall data. More importantly, we found a novel and symmetrical substitution bias in which Gs had been preferentially replaced by A, As by C, Cs by T, and Ts by G, resulting in the G-->A-->C-->T-->G substitution series. Understanding this pattern will lead to new hypotheses concerning plastid evolution, which in turn will affect the choices of substitution models and other tree-building algorithms for phylogenetic analyses based on nucleotide data.

  12. Isolating Viral and Host RNA Sequences from Archival Material and Production of cDNA Libraries for High-Throughput DNA Sequencing.

    PubMed

    Xiao, Yongli; Sheng, Zong-Mei; Taubenberger, Jeffery K

    2015-05-01

    The vast majority of surgical biopsy and post-mortem tissue samples are formalin-fixed and paraffin-embedded (FFPE), but this process leads to RNA degradation that limits gene expression analysis. As an example, the viral RNA genome of the 1918 pandemic influenza A virus was previously determined in a 9-year effort by overlapping RT-PCR from post-mortem samples. Using the protocols described here, the full genome of the 1918 virus was determined at high coverage in one high-throughput sequencing run of a cDNA library derived from total RNA of a 1918 FFPE sample after duplex-specific nuclease treatments. This basic methodological approach should assist in the analysis of FFPE tissue samples isolated over the past century from a variety of infectious diseases.

  13. Isolating Viral and Host RNA Sequences from Archival Material and Production of cDNA Libraries for High-Throughput DNA Sequencing

    PubMed Central

    Xiao, Yongli; Sheng, Zong-Mei; Taubenberger, Jeffery K.

    2015-01-01

    The vast majority of surgical biopsy and post-mortem tissue samples are formalin-fixed and paraffin-embedded (FFPE), but this process leads to RNA degradation that limits gene expression analysis. As an example, the viral RNA genome of the 1918 pandemic influenza A virus was previously determined in a 9-year effort by overlapping RT-PCR from post-mortem samples. Using the protocols described here, the full genome of the 1918 virus at high coverage was determined in one high-throughput sequencing run of a cDNA library derived from total RNA of a 1918 FFPE sample after duplex-specific nuclease treatments. This basic methodological approach should assist in the analysis of FFPE tissue samples isolated over the past century from a variety of infectious diseases. PMID:26344216

  14. Selective amplification of cDNA sequence from total RNA by cassette-ligation mediated polymerase chain reaction (PCR): application to sequencing 6.5 kb genome segment of hantavirus strain B-1.

    PubMed

    Isegawa, Y; Sheng, J; Sokawa, Y; Yamanishi, K; Nakagomi, O; Ueda, S

    1992-12-01

    A method, referred to as cassette-ligation mediated polymerase chain reaction (PCR), has been developed to permit selective and specific amplification of cDNA sequence from total cellular RNA. This technique comprises (i) digestion of cDNA with multiple restriction enzymes, (ii) ligation of cleavage products to double-stranded DNA cassettes possessing a corresponding restriction site and (iii) amplification of cassette-ligated restriction fragments containing a short, known sequence (but not all the other ligation products) by PCR using the specific and cassette primers; the specific primer is designed to prime synthesis from the known sequence of the cDNA whereas the cassette primer anneals to one strand of the cassette. Sequencing from the cassette primer provides information to design a new primer for the next walking step. The amplified cDNA fragments are often larger than the maximum DNA fragments (500-600 bp) that can be sequenced without the need of synthesizing internal sequencing primer. Each of such large cDNA fragments is dissected into smaller DNA fragments by repeating cassette-ligation mediated PCR exploiting different restriction sites and different sets of cassette primers. This dissection process reduces the number of specific primers to a minimum, thereby increasing the speed of sequencing and minimizing the overall cost. We have successfully applied this cDNA walking and sequencing by the cassette-ligation mediated PCR to the sequencing of an entire 6.5 kb genome segment of hantavirus strain B-1.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Nucleotide Sequence Analyses and Predicted Coding of Bunyavirus Genome RNA Species

    PubMed Central

    Clerx-van Haaster, Corrie M.; Akashi, Hiroomi; Auperin, David D.; Bishop, David H. L.

    1982-01-01

    We performed 3′ RNA sequence analyses of [32P]pCp-end-labeled La Crosse (LAC) virus, alternate LAC virus isolate L74, and snowshoe hare bunyavirus large (L), medium (M), and small (S) negative-stranded viral RNA species to determine the coding capabilities of these species. These analyses were confirmed by dideoxy primer extension studies in which we used a synthetic oligodeoxynucleotide primer complementary to the conserved 3′-terminal decanucleotide of the three viral RNA species (Clerx-van Haaster and Bishop, Virology 105:564-574, 1980). The deduced sequences predicted translation of two S-RNA gene products that were read in overlapping reading frames. So far, only single contiguous open reading frames have been identified for the viral M- and L-RNA species. For the negative-stranded M-RNA species of all three viruses, the single reading frame developed from the first 3′-proximal UAC triplet. Likewise, for the L-RNA of the alternate LAC isolate, a single open reading frame developed from the first 3′-proximal UAC triplet. The corresponding L-RNA sequences of prototype LAC and snowshoe hare viruses initiated open reading frames; however, for both viral L-RNA species there was a preceding 3′-proximal UAC triplet in another reading frame that was followed shortly afterward by a termination codon. A comparison of the sequence data obtained for snowshoe hare virus, LAC virus, and the alternate LAC virus isolate showed that the identified nucleotide substitutions were sufficient to account for some of the fingerprint differences in the L-, M-, and S-RNA species of the three viruses. Unlike the distribution of the L- and M-RNA substitutions, significantly fewer nucleotide substitutions occurred after the initial UAC triplet of the S-RNA species than before this triplet, implying that the overlapping genes of the S RNA provided a constraint against evolution by point mutation. The comparative sequence analyses predicted amino acid differences among the

  16. The complete nucleotide sequence of a new bipartite begomovirus from Brazil infecting Abutilon.

    PubMed

    Paprotka, T; Metzler, V; Jeske, H

    2010-05-01

    The complete nucleotide sequence of Abutilon mosaic Brazil virus (AbMBV), a new bipartite begomovirus from Bahia, Brazil, is described and analyzed phylogenetically. Its DNA A is most closely related to those of Sida-infecting begomoviruses from Brazil and forms a phylogenetic cluster with pepper- and Euphorbia-infecting begomoviruses from Central America. The DNA B component forms a cluster with different Sida- and okra-infecting begomoviruses from Brazil. Both components are distinct from those of the classical Abutilon mosaic virus originating from the West Indies. AbMBV is transmissible to Nicotiana benthamiana and Malva parviflora by biolistics of rolling-circle amplification products and induces characteristic mosaic and vein-clearing symptoms in M. parviflora.

  17. High-Throughput Sequencing Reveals Single Nucleotide Variants in Longer-Kernel Bread Wheat

    PubMed Central

    Chen, Feng; Zhu, Zibo; Zhou, Xiaobian; Yan, Yan; Dong, Zhongdong; Cui, Dangqun

    2016-01-01

    The transcriptomes of bread wheat Yunong 201 and its ethyl methanesulfonate derivative Yunong 3114 were obtained by next-sequencing technology. Single nucleotide variants (SNVs) in the wheat strains were explored and compared. A total of 5907 and 6287 non-synonymous SNVs were acquired for Yunong 201 and 3114, respectively. A total of 4021 genes with SNVs were obtained. The genes that underwent non-synonymous SNVs were significantly involved in ATP binding, protein phosphorylation, and cellular protein metabolic process. The heat map analysis also indicated that most of these mutant genes were significantly differentially expressed at different developmental stages. The SNVs in these genes possibly contribute to the longer kernel length of Yunong 3114. Our data provide useful information on wheat transcriptome for future studies on wheat functional genomics. This study could also help in illustrating the gene functions of the non-synonymous SNVs of Yunong 201 and 3114. PMID:27551288

  18. Developing single nucleotide polymorphism (SNP) markers from transcriptome sequences for identification of longan (Dimocarpus longan) germplasm

    PubMed Central

    Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng

    2015-01-01

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559

  19. High-Throughput Sequencing Reveals Single Nucleotide Variants in Longer-Kernel Bread Wheat.

    PubMed

    Chen, Feng; Zhu, Zibo; Zhou, Xiaobian; Yan, Yan; Dong, Zhongdong; Cui, Dangqun

    2016-01-01

    The transcriptomes of bread wheat Yunong 201 and its ethyl methanesulfonate derivative Yunong 3114 were obtained by next-sequencing technology. Single nucleotide variants (SNVs) in the wheat strains were explored and compared. A total of 5907 and 6287 non-synonymous SNVs were acquired for Yunong 201 and 3114, respectively. A total of 4021 genes with SNVs were obtained. The genes that underwent non-synonymous SNVs were significantly involved in ATP binding, protein phosphorylation, and cellular protein metabolic process. The heat map analysis also indicated that most of these mutant genes were significantly differentially expressed at different developmental stages. The SNVs in these genes possibly contribute to the longer kernel length of Yunong 3114. Our data provide useful information on wheat transcriptome for future studies on wheat functional genomics. This study could also help in illustrating the gene functions of the non-synonymous SNVs of Yunong 201 and 3114. PMID:27551288

  20. Sequencing of cDNA from 50 unrelated patients reveals that mutations in the triple-helical domain of type III procollagen are an infrequent cause of aortic aneurysms.

    PubMed Central

    Tromp, G; Wu, Y; Prockop, D J; Madhatheri, S L; Kleinert, C; Earley, J J; Zhuang, J; Norrgård, O; Darling, R C; Abbott, W M

    1993-01-01

    Detailed DNA sequencing of the triple-helical domain of type III procollagen was carried out on cDNA prepared from 54 patients with aortic aneurysms. The 43 male and 11 female patients originated from 50 different families and five different nationalities. 43 patients had at least one additional blood relative who had aneurysms. Five overlapping asymmetric PCR products, covering all the coding sequences of the triple-helical domain of type III procollagen, were sequenced with 28 specific sequencing primers. Analysis of the sequencing gels revealed only two nucleotide changes that altered the structure of the protein. One was a substitution of threonine for proline at amino acid position 501 and its functional importance was not clearly established. The other was a substitution of arginine for an obligatory glycine at amino acid position 136. In 40 of the 54 patients, detection of a polymorphism in the mRNA established that both alleles were expressed. The results indicate that mutations in type III procollagen are the cause of only about 2% of aortic aneurysms. Images PMID:8514866

  1. Complete nucleotide sequence of the mitochondrial genome of a salamander, Mertensiella luschani.

    PubMed

    Zardoya, Rafael; Malaga-Trillo, Edward; Veith, Michael; Meyer, Axel

    2003-10-23

    The complete nucleotide sequence (16,650 bp) of the mitochondrial genome of the salamander Mertensiella luschani (Caudata, Amphibia) was determined. This molecule conforms to the consensus vertebrate mitochondrial gene order. However, it is characterized by a long non-coding intervening sequence with two 124-bp repeats between the tRNA(Thr) and tRNA(Pro) genes. The new sequence data were used to reconstruct a phylogeny of jawed vertebrates. Phylogenetic analyses of all mitochondrial protein-coding genes at the amino acid level recovered a robust vertebrate tree in which lungfishes are the closest living relatives of tetrapods, salamanders and frogs are grouped together to the exclusion of caecilians (the Batrachia hypothesis) in a monophyletic amphibian clade, turtles show diapsid affinities and are placed as sister group of crocodiles+birds, and the marsupials are grouped together with monotremes and basal to placental mammals. The deduced phylogeny was used to characterize the molecular evolution of vertebrate mitochondrial proteins. Amino acid frequencies were analyzed across the main lineages of jawed vertebrates, and leucine and cysteine were found to be the most and least abundant amino acids in mitochondrial proteins, respectively. Patterns of amino acid replacements were conserved among vertebrates. Overall, cartilaginous fishes showed the least variation in amino acid frequencies and replacements. Constancy of rates of evolution among the main lineages of jawed vertebrates was rejected.

  2. Regulatory regions of two transport operons under nitrogen control: nucleotide sequences.

    PubMed Central

    Higgins, C F; Ames, G F

    1982-01-01

    We have determined the nucleotide sequences of the regulatory regions from two amino acid transport operons from Salmonella typhimurium: dhuA, which regulates the histidine transport operon, and argTr, which regulates argT, the gene encoding the lysine-arginine-ornithine-binding protein, LAO. The promoter for the histidine transport operon has been identified from the sequence change in the promoter-up mutation dhuA1. Neither regulatory region has any of the features typical of the regulatory regions of the amino acid biosynthetic operons, indicating that regulation of at least these transport genes does not involve a transcription attenuation mechanism. We have identified three interesting features, present in both of these sequences, which may be of importance in the regulation of these and other operons: a "stem-loop-foot" structure, a region of specific homology, and a mirror symmetry. The region of mirror symmetry may be a protein recognition site important is regulating expression of these and other operons in response to nitrogen availability. Mirror symmetry as a structure for DNA-protein interaction sites has not been proposed previously. PMID:7041112

  3. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    PubMed Central

    Yang, Seung Hak; Lim, Joung Soo; Khan, Modabber Ahmed; Kim, Bong Soo; Choi, Dong Yoon; Lee, Eun Young; Ahn, Hee Kwon

    2015-01-01

    The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site. PMID:26500442

  4. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

    PubMed

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

    2012-07-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  5. Complete nucleotide sequence of the mitochondrial genome of a salamander, Mertensiella luschani.

    PubMed

    Zardoya, Rafael; Malaga-Trillo, Edward; Veith, Michael; Meyer, Axel

    2003-10-23

    The complete nucleotide sequence (16,650 bp) of the mitochondrial genome of the salamander Mertensiella luschani (Caudata, Amphibia) was determined. This molecule conforms to the consensus vertebrate mitochondrial gene order. However, it is characterized by a long non-coding intervening sequence with two 124-bp repeats between the tRNA(Thr) and tRNA(Pro) genes. The new sequence data were used to reconstruct a phylogeny of jawed vertebrates. Phylogenetic analyses of all mitochondrial protein-coding genes at the amino acid level recovered a robust vertebrate tree in which lungfishes are the closest living relatives of tetrapods, salamanders and frogs are grouped together to the exclusion of caecilians (the Batrachia hypothesis) in a monophyletic amphibian clade, turtles show diapsid affinities and are placed as sister group of crocodiles+birds, and the marsupials are grouped together with monotremes and basal to placental mammals. The deduced phylogeny was used to characterize the molecular evolution of vertebrate mitochondrial proteins. Amino acid frequencies were analyzed across the main lineages of jawed vertebrates, and leucine and cysteine were found to be the most and least abundant amino acids in mitochondrial proteins, respectively. Patterns of amino acid replacements were conserved among vertebrates. Overall, cartilaginous fishes showed the least variation in amino acid frequencies and replacements. Constancy of rates of evolution among the main lineages of jawed vertebrates was rejected. PMID:14604788

  6. Whole genome sequencing of a single Bos taurus animal for single nucleotide polymorphism discovery

    PubMed Central

    Eck, Sebastian H; Benet-Pagès, Anna; Flisikowski, Krzysztof; Meitinger, Thomas; Fries, Ruedi; Strom, Tim M

    2009-01-01

    Background The majority of the 2 million bovine single nucleotide polymorphisms (SNPs) currently available in dbSNP have been identified in a single breed, Hereford cattle, during the bovine genome project. In an attempt to evaluate the variance of a second breed, we have produced a whole genome sequence at low coverage of a single Fleckvieh bull. Results We generated 24 gigabases of sequence, mainly using 36-bp paired-end reads, resulting in an average 7.4-fold sequence depth. This coverage was sufficient to identify 2.44 million SNPs, 82% of which were previously unknown, and 115,000 small indels. A comparison with the genotypes of the same animal, generated on a 50 k oligonucleotide chip, revealed a detection rate of 74% and 30% for homozygous and heterozygous SNPs, respectively. The false positive rate, as determined by comparison with genotypes determined for 196 randomly selected SNPs, was approximately 1.1%. We further determined the allele frequencies of the 196 SNPs in 48 Fleckvieh and 48 Braunvieh bulls. 95% of the SNPs were polymorphic with an average minor allele frequency of 24.5% and with 83% of the SNPs having a minor allele frequency larger than 5%. Conclusions This work provides the first single cattle genome by next-generation sequencing. The chosen approach - low to medium coverage re-sequencing - added more than 2 million novel SNPs to the currently publicly available SNP resource, providing a valuable resource for the construction of high density oligonucleotide arrays in the context of genome-wide association studies. PMID:19660108

  7. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  8. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    SciTech Connect

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

    1988-09-01

    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is /approx/9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged.

  9. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.

    PubMed

    Fuller, Carl W; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J; Kasianowicz, John J; Davis, Randy; Roever, Stefan; Church, George M; Ju, Jingyue

    2016-05-10

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5'-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  10. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  11. Sequencing and analysis of 10967 full-length cDNA clones from Xenopus laevis and Xenopus tropicalis

    SciTech Connect

    Morin, R D; Chang, E; Petrescu, A; Liao, N; Kirkpatrick, R; Griffith, M; Butterfield, Y; Stott, J; Barber, S; Babakaiff, R; Matsuo, C; Wong, D; Yang, G; Smailus, D; Brown-John, M; Mayo, M; Beland, J; Gibson, S; Olson, T; Tsai, M; Featherstone, R; Chand, S; Siddiqui, A; Jang, W; Lee, E; Klein, S; Prange, C; Myers, R M; Green, E D; Wagner, L; Gerhard, D; Marra, M; Jones, S M; Holt, R

    2005-10-31

    Sequencing of full-insert clones from full-length cDNA libraries from both Xenopus laevis and Xenopus tropicalis has been ongoing as part of the Xenopus Gene Collection initiative. Here we present an analysis of 10967 clones (8049 from X. laevis and 2918 from X. tropicalis). The clone set contains 2013 orthologs between X. laevis and X. tropicalis as well as 1795 paralog pairs within X. laevis. 1199 are in-paralogs, believed to have resulted from an allotetraploidization event approximately 30 million years ago, and the remaining 546 are likely out-paralogs that have resulted from more ancient gene duplications, prior to the divergence between the two species. We do not detect any evidence for positive selection by the Yang and Nielsen maximum likelihood method of approximating d{sub N}/d{sub S}. However, d{sub N}/d{sub S} for X. laevis in-paralogs is elevated relative to X. tropicalis orthologs. This difference is highly significant, and indicates an overall relaxation of selective pressures on duplicated gene pairs. Within both groups of paralogs, we found evidence of subfunctionalization, manifested as differential expression of paralogous genes among tissues, as measured by EST information from public resources. We have observed, as expected, a higher instance of subfunctionalization in out-paralogs relative to in-paralogs.

  12. Construction of a cDNA library and preliminary analysis of expressed sequence tags in Piper hainanense.

    PubMed

    Fan, R; Ling, P; Hao, C Y; Li, F P; Huang, L F; Wu, B D; Wu, H S

    2015-01-01

    Black pepper is a perennial climbing vine. It is widely cultivated because its berries can be utilized not only as a spice in food but also for medicinal use. This study aimed to construct a standardized, high-quality cDNA library to facilitated identification of new Piper hainanense transcripts. For this, 262 unigenes were used to generate raw reads. The average length of these 262 unigenes was 774.8 bp. Of these, 94 genes (35.9%) were newly identified, according to the NCBI protein database. Thus, identification of new genes may broaden the molecular knowledge of P. hainanense on the basis of Clusters of Orthologous Groups and Gene Ontology categories. In addition, certain basic genes linked to physiological processes, which can contribute to disease resistance and thereby to the breeding of black pepper. A total of 26 unigenes were found to be SSR markers. Dinucleotide SSR was the main repeat motif, accounting for 61.54%, followed by trinucleotide SSR (23.07%). Eight primer pairs successfully amplified DNA fragments and detected significant amounts of polymorphism among twenty-one piper germplasm. These results present a novel sequence information of P. hainanense, which can serve as the foundation for further genetic research on this species. PMID:26505424

  13. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution

    PubMed Central

    Modahl, Cassandra M.; Mackessy, Stephen P.

    2016-01-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides

  14. Assessment of the nucleotide sequence variability in the bovine T-cell receptor alpha delta joining gene region.

    PubMed

    Fries, R; Ewald, D; Thaller, G; Buitkamp, J

    2001-05-01

    The sequence of 2,193 nucleotides from the bovine T-cell receptor alpha/delta joining gene region (TCRADJ) was determined and compared with the corresponding human and murine sequences. The identity was 75.3% for the comparison of the Bos taurus vs. the Homo sapiens sequence and 63.8% for the Bos taurus vs. the Mus musculus sequence. This comparison permitted the identification of the putatively functional elements within the bovine sequence. Direct sequencing of 2,110 nucleotides in nine animals revealed 12 variable sites. Estimates, based on direct sequencing in three Holstein Friesian animals, for the two measures of sequence variability, nucleotide polymorphism (u) and nucleotide diversity (p), were 0.00050 (60.00036) and 0.00077 (60.00056), respectively. The test statistic, Tajima's D, for the comparison of the two measures indicates that the difference between u and p is close to significance (P < 0.05), suggesting the possibility of selective forces acting on the studied genomic region. Allelic variation at 5 of the 12 variable sites was analysed in 359 animals (48 Anatolian Black, 56 Braunvieh, 115 Fleckvieh, 47 Holstein Friesian, 50 Simmental and 43 Pinzgauer) using the oligonucleotide ligation assay (OLA) in combination with the enzyme linked immunoabsorbant assay (ELISA). Nine unambiguous haplotypes could be derived based on animals with a maximum of one heterozygous site. Four to seven haplotypes were present in the different breeds. When taking into account the frequencies of the haplotypes in the different breeds, especially in Anatolian Black, an ancestral cattle population, we could establish the likely phylogenetic relationships of the haplotypes. Such haplotype trees are the basis for cladistic candidate gene analysis. Our study demonstrates that the systematic search of single nucleotide polymorphisms (SNPs) is useful for analysing all aspects of variability of a given genomic region.

  15. Human biotin-containing subunit of 3-methylcrotonyl-CoA carboxylase gene (MCCA): cDNA sequence, genomic organization, localization to chromosomal band 3q27, and expression.

    PubMed

    Obata, K; Fukuda, T; Morishita, R; Abe, S; Asakawa, S; Yamaguchi, S; Yoshino, M; Ihara, K; Murayama, K; Shigemoto, K; Shimizu, N; Kondo, I

    2001-03-01

    3-Methylcrotonyl-CoA carboxylase (MCCase; EC 6.4.1.4) is a mitochondrial biotin enzyme and plays an essential role in the catabolism of leucine and isovalerate in animals, bacterial species, and plants. MCCase consists of two subunits, those that are biotin-containing and non-biotin-containing. The genes responsible for these subunits have been isolated in soybean, Arabidopsis thaliana, and tomatoes, but not in mammals. In humans, MCCase deficiency has been thought to be a rare metabolic disease, but the number of patients with MCCase deficiency appears to be increasing with a wide range of clinical presentations, some that result in a lethal condition and others that are asymptomatic. In this report, we have isolated and carried out chromosomal mapping of the gene for the biotin-containing subunit (A subunit) of the human MCCase gene, MCCA. The cDNA predicts an open reading frame coding for a 725-amino-acid protein with mitochondrial signal peptide, biotin carboxylase, and biotin-carrier domains. The gene is composed of at least 19 exons and covers more than 70 kb of sequence on band q27 of chromosome 3. MCCA was abundantly expressed in mitochondria-rich organs, such as the heart, skeletal muscles, kidney, and liver. In exon 13, we observed a His/Pro polymorphism at codon 464 (an A to C transition at nucleotide position 1391 in the cDNA sequence). Then, we determined the DNA sequences of the 5' untranslated region and entire coding regions in two patients with MCCase deficiency, but no sequence substitution was detected, suggesting that the gene mutations might be in the non-biotin-containing subunit (B subunit) gene, MCCB, in these patients.

  16. CONSTRUCTION OF SILKWORM MIDGUT cDNA LIBRARY FOR SCREEN AND SEQUENCE ANALYSIS OF PERITROPHIC MEMBRANE PROTEIN GENES.

    PubMed

    Zhou, Yi-Jun; Xue, Bin; Li, Yang-Yang; Li, Fan-Chi; Ni, Min; Shen, Wei-De; Gu, Zhi-Ya; Li, Bing; Shen, Wei-De; Gu, Zhi-Ya; Li, Bing

    2016-01-01

    Silkworm is an important economic insect and the model species for Lepidoptera. The midgut of silkworm is an important physiological barrier, as its peritrophic membrane (PM) can resist pathogen invasion. In this study, a silkworm midgut cDNA library was constructed in order to identify silkworm PM genes. The capacity of the initial library was 6.92 × 10(6) pfu/ml, along with a recombination rate of 92.14% and a postamplification titer of 4.10 × 10(9) pfu/ml. Three silkworm PM protein genes were obtained by immunoscreening, two of which were chitin-binding protein (CBP) genes and one of which was a chitin deacetylase (CDA) gene as revealed by sequence analysis. Three genes were named BmCBP02, BmCBP13, and BmCDA17, and their ORF sizes are 678, 1,029, and 645 bp, respectively; all of them contain sequences of chitin-binding domains. Phylogenetic analysis indicated that BmCBP02 has the highest consensus with Mamestra configurata CBP at 61.0%; BmCBP13 has the highest consensus with Loxostege sticticalis PM CBP at 53.35%; BmCDA17 has the highest consensus with Helicoverpa armigera CDA5a at 70.83%. Tissue transcriptional analysis revealed that all three genes were specifically expressed in the midgut, and during the developmental process of fifth-instar silkworms, the transcription of all the genes showed an upward trend. This study laid a foundation for further studies on the functions of silkworm PM genes.

  17. Ferritin from the Pacific abalone Haliotis discus hannai: Analysis of cDNA sequence, expression, and activity.

    PubMed

    Qiu, Reng; Kan, Yunchao; Li, Dandan

    2016-02-01

    Ferritin plays an important role in iron homeostasis due to its ability to bind and sequester large amounts of iron. In this study, the gene encoding a ferritin (HdhFer2) was cloned from Pacific abalone (Haliotis discus hannai). The full-length cDNA of HdhFer2 contains a 5'-UTR of 121 bp, an ORF of 516 bp, and a 3'-UTR of 252 bp with a polyadenylation signal sequence of AATAAA and a poly(A) tail. It also contains a 31 bp iron-responsive element (IRE) in the 5'-UTR position, which is conserved in many ferritins. HdhFer2 consists of 171 amino acid residues with a predicted molecular weight (MW) ∼19.8 kDa and a theoretical isoelectric point (PI) of 4.84. The deduced amino acid sequence of HdhFer2 contains two ferritin iron-binding region signatures (IBRSs). HdhFer2 mRNA was detected in a wide range of tissues and was dominantly expressed in the gill. Infection with the bacterial pathogen Vibrio anguillarum significantly upregulated HdhFer2 expression in a time-dependent manner. Recombinant HdhFer2 (rHdhFer2) purified from Escherichia coli was able to bind ferrous iron in a concentration-dependent manner. In summary, these results suggest that HdhFer2 is a crucial protein in the iron-withholding defense system, and plays an important role in the innate immune response of abalone. PMID:26766182

  18. Ferritin from the Pacific abalone Haliotis discus hannai: Analysis of cDNA sequence, expression, and activity.

    PubMed

    Qiu, Reng; Kan, Yunchao; Li, Dandan

    2016-02-01

    Ferritin plays an important role in iron homeostasis due to its ability to bind and sequester large amounts of iron. In this study, the gene encoding a ferritin (HdhFer2) was cloned from Pacific abalone (Haliotis discus hannai). The full-length cDNA of HdhFer2 contains a 5'-UTR of 121 bp, an ORF of 516 bp, and a 3'-UTR of 252 bp with a polyadenylation signal sequence of AATAAA and a poly(A) tail. It also contains a 31 bp iron-responsive element (IRE) in the 5'-UTR position, which is conserved in many ferritins. HdhFer2 consists of 171 amino acid residues with a predicted molecular weight (MW) ∼19.8 kDa and a theoretical isoelectric point (PI) of 4.84. The deduced amino acid sequence of HdhFer2 contains two ferritin iron-binding region signatures (IBRSs). HdhFer2 mRNA was detected in a wide range of tissues and was dominantly expressed in the gill. Infection with the bacterial pathogen Vibrio anguillarum significantly upregulated HdhFer2 expression in a time-dependent manner. Recombinant HdhFer2 (rHdhFer2) purified from Escherichia coli was able to bind ferrous iron in a concentration-dependent manner. In summary, these results suggest that HdhFer2 is a crucial protein in the iron-withholding defense system, and plays an important role in the innate immune response of abalone.

  19. Identification, Characterization, and Mapping of Expressed Sequence Tags from an Embryonic Zebrafish Heart cDNA Library

    PubMed Central

    Ton, Christopher; Hwang, David M.; Dempsey, Adam A.; Tang, Hong-Chang; Yoon, Jennifer; Lim, Mindy; Mably, John D.; Fishman, Mark C.; Liew, Choong-Chin

    2000-01-01

    The generation of expressed sequence tags (ESTs) has proven to be a rapid and economical approach by which to identify and characterize expressed genes. We generated 5102 ESTs from a 3-d-old embryonic zebrafish heart cDNA library. Of these, 57.6% matched to known genes, 14.2% matched only to other ESTs, and 27.8% showed no match to any ESTs or known genes. Clustering of all ESTs identified 359 unique clusters comprising 1771 ESTs, whereas the remaining 3331 ESTs did not cluster. This estimates the number of unique genes identified in the data set to be approximately 3690. A total of 1242 unique known genes were used to analyze the gene expression patterns in the zebrafish embryonic heart. These were categorized into seven categories on the basis of gene function. The largest class of genes represented those involved in gene/protein expression (25.9% of known transcripts). This class was followed by genes involved in metabolism (18.7%), cell structure/motility (16.4%), cell signaling and communication (9.6%), cell/organism defense (7.1%), and cell division (4.4%). Unclassified genes constituted the remaining 17.91%. Radiation hybrid mapping was performed for 102 ESTs and comparison of map positions between zebrafish and human identified new synteny groups. Continued comparative analysis will be useful in defining the boundaries of conserved chromosome segments between zebrafish and humans, which will facilitate the transfer of genetic information between the two organisms and improve our understanding of vertebrate evolution. [The sequence data described in this paper have been submitted to the GenBank data library under accession nos. BE693120–BE693210 and BE704450.] PMID:11116087

  20. Cloning and nucleotide sequence of the gene coding for citrate synthase from a thermotolerant Bacillus sp

    SciTech Connect

    Schendel, F.J.; August, P.R.; Anderson, C.R.; Flickinger, M.C. ); Hanson, R.S. )

    1992-01-01

    Acetate salts are emerging as potentially attractive bulk chemicals for a variety of environmental applications, for example, as catalysts to facilitate combustion of high-sulfur coal by electrical utilities and as the biodegradable noncorrosive highway deicing salt calcium magnesium acetate. The structural gene coding for citrate synthase from the gram-positive soil isolate Bacillus sp. strain C4 (ATCC 55182) capable of secreting acetic acid at pH 5.0 to 7.0 in the presence of dolime has been cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking citrate synthase. The nucleotide sequence of the entire 3.1-kb HindIII fragment has been determined, and one major open reading frame was found coding for citrate synthase (ctsA). Citrate synthase from Bacillus sp. strain C4 was found to be a dimer (M{sub r}, 84,500) with a sub unit with an M{sub r} of 42,000. The N-terminal sequence was found to be identical with that predicted from the gene sequence. The kinetics were best fit to a bisubstrate enzyme with an ordered mechanism. Bacillus sp. strain C4 citrate synthase was not activated by potassium chloride and was not inhibited by NADH, ATP, ADP, or AMP at levels up to 1 mM. The predicted amino acid sequence was compared with that of the E. coli, Acinetobacter anitratum, Pseudomonas aeruginosa, Rickettsia prowazekii, porcine heart, and Saccharomyces cerevisiae cytoplasmic and mitochondrial enzymes.

  1. The qa repressor gene of Neurospora crassa: wild-type and mutant nucleotide sequences.

    PubMed Central

    Huiet, L; Giles, N H

    1986-01-01

    The qa-1S gene, one of two regulatory genes in the qa gene cluster of Neurospora crassa, encodes the qa repressor. The qa-1S gene together with the qa-1F gene, which encodes the qa activator protein, control the expression of all seven qa genes, including those encoding the inducible enzymes responsible for the utilization of quinic acid as a carbon source. The nucleotide sequence of the qa-1S gene and its flanking regions has been determined. The deduced coding sequence for the qa-1S protein encodes 918 amino acids with a calculated molecular weight of 100,650 and is interrupted by a single 66-base-pair intervening sequence. Both constitutive and noninducible mutants occur in the qa-1S gene and two different mutations of each type have been cloned and sequenced. All four mutations occur within the predicted coding region of the qa-1S gene. This result strongly supports the hypothesis that the qa-1S gene encodes a repressor. All four mutations are located within codons for the last 300 amino acids of the qa-1S protein. The mutations in three of the mutants involve amino acid substitutions, while the fourth mutant, which has a constitutive phenotype, contains a frameshift mutation. The two constitutive mutations occur in the most distal region of the gene, possibly implicating the COOH-terminal region of the qa repressor in binding to its target. The two noninducible mutations occur in a region proximal to the constitutive mutations, possibly implicating this region of the qa repressor in binding the inducer. Images PMID:3010294

  2. Nucleotide sequence of an immediate-early frog virus 3 gene.

    PubMed

    Willis, D; Foglesong, D; Granoff, A

    1984-12-01

    We have used "gene walking" with synthetic oligonucleotides and M13 dideoxynucleotide sequencing techniques to obtain the complete coding and flanking sequences of the gene encoding a major immediate-early RNA (molecular weight, 169,000) of frog virus 3. R-loop mapping of the cloned XbaI K fragment of frog virus 3 DNA with immediate-early RNA from infected cells showed that an RNA of approximately 500 to 600 nucleotides (the right size to code for the immediate-early viral 18-kilodalton protein of unknown function) hybridized to a region within 100 base pairs of one end of the XbaI K fragment; no evidence for splicing was observed in the electron microscope or by single-strand nuclease analysis. Further restriction mapping narrowed the location of the gene to the XbaI end of a 2-kilobase-pair XbaI-Bg/II fragment, which was bidirectionally subcloned into the bacteriophage pair mp10 and mp11 for sequencing. Mung bean nuclease mapping was used to identify both the 5' and the 3' ends of the mRNA. The 5' end mapped within an AT-rich region 19 base pairs upstream from two in-phase AUG start codons that were immediately followed by an open reading frame of 157 amino acids. Another AT-rich sequence was found at -29 base pairs from the 5' end of the mRNA start site; this sequence may function as a TATA box. The 3' end of the message displayed considerable microheterogeneity, but clearly terminated within a third AT-rich region 50 to 60 base pairs from the translation stop codon. The eucaryotic polyadenylic acid addition signal (AATAAA) was not present, a finding to be expected since frog virus 3 mRNA is not polyadenylated. Both the single-stranded mp10 clone of the XbaI-Bg/II fragment and a 15-base oligonucleotide complementary to the region flanking the two AUG translation start codons inhibited translation of the immediate-early 18-kilodalton protein in vitro, confirming the identity of the sequenced gene. As the regulatory sequences of this gene did not resemble those of

  3. Complete nucleotide sequence of a plant tumor-inducing Ti plasmid.

    PubMed

    Suzuki, K; Hattori, Y; Uraji, M; Ohta, N; Iwata, K; Murata, K; Kato, A; Yoshida, K

    2000-01-25

    Crown gall tumor disease in dicot plants is caused by Agrobacterium tumefaciens harboring a giant tumor-inducing (Ti) plasmid. Here, for the first time among agrobacterial plasmids, the nucleotide sequence of a typical nopaline-type Ti plasmid (pTi-SAKURA) was determined completely. In total, 195 open reading frames (ORFs) were estimated in the 206479 bp long sequence. 20 genes for conjugation, three for replication, 22 for pathogenesis and 37 for genetic colonization of host plants were found within two-thirds of the plasmid. These genes formed seven functional gene clusters with narrow inter-cluster spaces. In the remaining one-third of the plasmid, novel genes including homologs of mutT, Rhizobium nodQ and Sphingomonas ligE genes were found, which are likely to be responsible for the broad host range. Restriction fragment length variation indicates extreme plasticity of the part required for conjugational gene transfer and the above-mentioned one-third of the plasmid, even among closely related Ti plasmids. PMID:10721727

  4. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    PubMed Central

    Park, Ji-Sun; Lee, Sung-Geun; Cho, Han-Gil; Jheong, Weon-Hwa; Paik, Soon-Young

    2015-01-01

    Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4) was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF) composites throughout the whole genome: ORF1 (5,100 bp), ORF2 (1,623 bp), and ORF3 (807 bp). Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines. PMID:25688356

  5. Predicting Mendelian Disease-Causing Non-Synonymous Single Nucleotide Variants in Exome Sequencing Studies

    PubMed Central

    Bao, Su-Ying; Yang, Wanling; Ho, Shu-Leong; Song, Yong-Qiang; Sham, Pak C.

    2013-01-01

    Exome sequencing is becoming a standard tool for mapping Mendelian disease-causing (or pathogenic) non-synonymous single nucleotide variants (nsSNVs). Minor allele frequency (MAF) filtering approach and functional prediction methods are commonly used to identify candidate pathogenic mutations in these studies. Combining multiple functional prediction methods may increase accuracy in prediction. Here, we propose to use a logit model to combine multiple prediction methods and compute an unbiased probability of a rare variant being pathogenic. Also, for the first time we assess the predictive power of seven prediction methods (including SIFT, PolyPhen2, CONDEL, and logit) in predicting pathogenic nsSNVs from other rare variants, which reflects the situation after MAF filtering is done in exome-sequencing studies. We found that a logit model combining all or some original prediction methods outperforms other methods examined, but is unable to discriminate between autosomal dominant and autosomal recessive disease mutations. Finally, based on the predictions of the logit model, we estimate that an individual has around 5% of rare nsSNVs that are pathogenic and carries ∼22 pathogenic derived alleles at least, which if made homozygous by consanguineous marriages may lead to recessive diseases. PMID:23341771

  6. A single-nucleotide substitution mutator phenotype revealed by exome sequencing of human colon adenomas.

    PubMed

    Nikolaev, Sergey I; Sotiriou, Sotirios K; Pateras, Ioannis S; Santoni, Federico; Sougioultzis, Stavros; Edgren, Henrik; Almusa, Henrikki; Robyr, Daniel; Guipponi, Michel; Saarela, Janna; Gorgoulis, Vassilis G; Antonarakis, Stylianos E; Halazonetis, Thanos D

    2012-12-01

    Oncogene-induced DNA replication stress is thought to drive genomic instability in cancer. In particular, replication stress can explain the high prevalence of focal genomic deletions mapping within very large genes in human tumors. However, the origin of single-nucleotide substitutions (SNS) in nonfamilial cancers is strongly debated. Some argue that cancers have a mutator phenotype, whereas others argue that the normal DNA replication error rates are sufficient to explain the number of observed SNSs. Here, we sequenced the exomes of 24, mostly precancerous, colon polyps. Analysis of the sequences revealed mutations in the APC, CTNNB1, and BRAF genes as the presumptive cancer-initiating events and many passenger SNSs. We used the number of SNSs in the various lesions to calculate mutation rates for normal colon and adenomas and found that colon adenomas exhibit a mutator phenotype. Interestingly, the SNSs in the adenomas mapped more often than expected within very large genes, where focal deletions in response to DNA replication stress also map. We propose that single-stranded DNA generated in response to oncogene-induced replication stress compromises the repair of deaminated cytosines and other damaged bases, leading to the observed SNS mutator phenotype.

  7. Nucleotide sequences and mutational analysis of the structural genes for nitrogenase 2 of Azotobacter vinelandii.

    PubMed Central

    Joerger, R D; Loveless, T M; Pau, R N; Mitchenall, L A; Simon, B H; Bishop, P E

    1990-01-01

    The nucleotide sequence (6,559 base pairs) of the genomic region containing the structural genes for nitrogenase 2 (V nitrogenase) from Azotobacter vinelandii was determined. The open reading frames present in this region are organized into two transcriptional units. One contains vnfH (encoding dinitrogenase reductase 2) and a ferredoxinlike open reading frame (Fd). The second one includes vnfD (encoding the alpha subunit of dinitrogenase 2), vnfG (encoding a product similar to the delta subunit of dinitrogenase 2 from A. chroococcum), and vnfK (encoding the beta subunit of dinitrogenase 2). The 5'-flanking regions of vnfH and vnfD contain sequences similar to ntrA-dependent promoters. This gene arrangement allows independent expression of vnfH-Fd and vnfDGK. Mutant strains (CA80 and CA11.80) carrying an insertion in vnfH are still able to synthesize the alpha and beta subunits of dinitrogenase 2 when grown in N-free, Mo-deficient, V-containing medium. A strain (RP1.11) carrying a deletion-plus-insertion mutation in the vnfDGK region produced only dinitrogenase reductase 2. Images PMID:2345152

  8. Nucleotide sequences and mutational analysis of the structural genes for nitrogenase 2 of Azotobacter vinelandii.

    PubMed

    Joerger, R D; Loveless, T M; Pau, R N; Mitchenall, L A; Simon, B H; Bishop, P E

    1990-06-01

    The nucleotide sequence (6,559 base pairs) of the genomic region containing the structural genes for nitrogenase 2 (V nitrogenase) from Azotobacter vinelandii was determined. The open reading frames present in this region are organized into two transcriptional units. One contains vnfH (encoding dinitrogenase reductase 2) and a ferredoxinlike open reading frame (Fd). The second one includes vnfD (encoding the alpha subunit of dinitrogenase 2), vnfG (encoding a product similar to the delta subunit of dinitrogenase 2 from A. chroococcum), and vnfK (encoding the beta subunit of dinitrogenase 2). The 5'-flanking regions of vnfH and vnfD contain sequences similar to ntrA-dependent promoters. This gene arrangement allows independent expression of vnfH-Fd and vnfDGK. Mutant strains (CA80 and CA11.80) carrying an insertion in vnfH are still able to synthesize the alpha and beta subunits of dinitrogenase 2 when grown in N-free, Mo-deficient, V-containing medium. A strain (RP1.11) carrying a deletion-plus-insertion mutation in the vnfDGK region produced only dinitrogenase reductase 2.

  9. Nucleotide sequence and phylogenetic analysis of a new potexvirus: Malva mosaic virus.

    PubMed

    Côté, Fabien; Paré, Christine; Majeau, Nathalie; Bolduc, Marilène; Leblanc, Eric; Bergeron, Michel G; Bernardy, Michael G; Leclerc, Denis

    2008-01-01

    A filamentous virus isolated from Malva neglecta Wallr. (common mallow) and propagated in Chenopodium quinoa was grown, cloned and the complete nucleotide sequence was determined (GenBank accession # DQ660333). The genomic RNA is 6858 nt in length and contains five major open reading frames (ORFs). The genomic organization is similar to members and the viral encoded proteins shared homology with the group of the Potexvirus genus in the Flexiviridae family. Phylogenetic analysis revealed a close relationship with narcissus mosaic virus (NMV), scallion virus X (ScaVX) and, to a lesser extent, to Alstroemeria virus X (AlsVX) and pepino mosaic virus (PepMV). A novel putative pseudoknot structure is predicted in the 3'-UTR of a subgroup of potexviruses, including this newly described virus. The consensus GAAAA sequence is detected at the 5'-end of the genomic RNA and experimental data strongly suggest that this motif could be a distinctive hallmark of this genus. The name Malva mosaic virus is proposed. PMID:18054524

  10. Complete nucleotide sequence of rose yellow leaf virus, a new member of the family Tombusviridae.

    PubMed

    Mollov, Dimitre; Lockhart, Ben; Zlesak, David C

    2014-10-01

    The genome of the rose yellow leaf virus (RYLV) has been determined to be 3918 nucleotides long and to contain seven open reading frames (ORFs). ORF1 encodes a 27-kDa peptide (p27). ORF2 shares a common start codon with ORF1 and continues through the amber stop codon of p27 to encode an 87-kDa (p87) protein that has amino acid similarity to the RNA-dependent RNA polymerase (RdRp) of members of the family Tombusviridae. ORFs 3 and 4 have no significant amino acid similarity to known functional viral ORFs. ORF5 encodes a 6-kDa (p6) protein that has similarity to movement proteins of members of the Tombusviridae. ORF5A has no conventional start codon and overlaps with p6. A putative +1 frameshift mechanism allows p6 translation to continue through the stop codon and results in a 12-kDa protein that has high homology to the carmovirus p13 movement protein. The 37-kDa protein encoded by ORF6 has amino acid sequence similarity to coat proteins (CP) of members of the Tombusviridae. ORF7 has no significant amino acid similarity to known viral ORFs. Phylogenetic analysis of the RdRp amino acid sequences grouped RYLV together with the unclassified Rosa rugosa leaf distortion virus (RrLDV), pelargonium line pattern virus (PLPV), and pelargonium chlorotic ring pattern virus (PCRPV) in a distinct subgroup of the family Tombusviridae. PMID:24838852

  11. Predicting mendelian disease-causing non-synonymous single nucleotide variants in exome sequencing studies.

    PubMed

    Li, Miao-Xin; Kwan, Johnny S H; Bao, Su-Ying; Yang, Wanling; Ho, Shu-Leong; Song, Yong-Qiang; Sham, Pak C

    2013-01-01

    Exome sequencing is becoming a standard tool for mapping Mendelian disease-causing (or pathogenic) non-synonymous single nucleotide variants (nsSNVs). Minor allele frequency (MAF) filtering approach and functional prediction methods are commonly used to identify candidate pathogenic mutations in these studies. Combining multiple functional prediction methods may increase accuracy in prediction. Here, we propose to use a logit model to combine multiple prediction methods and compute an unbiased probability of a rare variant being pathogenic. Also, for the first time we assess the predictive power of seven prediction methods (including SIFT, PolyPhen2, CONDEL, and logit) in predicting pathogenic nsSNVs from other rare variants, which reflects the situation after MAF filtering is done in exome-sequencing studies. We found that a logit model combining all or some original prediction methods outperforms other methods examined, but is unable to discriminate between autosomal dominant and autosomal recessive disease mutations. Finally, based on the predictions of the logit model, we estimate that an individual has around 5% of rare nsSNVs that are pathogenic and carries ~22 pathogenic derived alleles at least, which if made homozygous by consanguineous marriages may lead to recessive diseases. PMID:23341771

  12. Mutations in core nucleotide sequence of hepatitis B virus correlate with fulminant and severe hepatitis.

    PubMed Central

    Ehata, T; Omata, M; Chuang, W L; Yokosuka, O; Ito, Y; Hosoda, K; Ohto, M

    1993-01-01

    Infection with hepatitis B virus leads to a wide spectrum of liver injury, including self-limited acute hepatitis, fulminant hepatitis, and chronic hepatitis with progression to cirrhosis or acute exacerbation to liver failure, as well as an asymptomatic chronic carrier state. Several studies have suggested that the hepatitis B core antigen could be an immunological target of cytotoxic T lymphocytes. To investigate the reason why the extreme immunological attack occurred in fulminant hepatitis and severe exacerbation patients, the entire precore and core region of hepatitis B virus DNA was sequenced in 24 subjects (5 fulminant, 10 severe fatal exacerbation, and 9 self-limited acute hepatitis patients). No significant change in the nucleotide sequence and deduced amino acid residue was noted in the nine self-limited acute hepatitis patients. In contrast, clustering changes in a small segment of 16 amino acids (codon 84-99 from the start of the core gene) in all seven adr subtype infected fulminant and severe exacerbation patients was found. A different segment with clustering substitutions (codon 48-60) was also found in seven of eight adw subtype infected fulminant and severe exacerbation patients. Of the 15 patients, 2 lacked precore stop mutation which was previously reported to be associated with fulminant hepatitis. These data suggest that these core regions with mutations may play an important role in the pathogenesis of hepatitis B viral disease, and such mutations are related to severe liver damage. Images PMID:8450049

  13. Complete nucleotide sequence analysis of the norovirus GII.4 Sydney variant in South Korea.

    PubMed

    Park, Ji-Sun; Lee, Sung-Geun; Jin, Ji-Young; Cho, Han-Gil; Jheong, Weon-Hwa; Paik, Soon-Young

    2015-01-01

    Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4) was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF) composites throughout the whole genome: ORF1 (5,100 bp), ORF2 (1,623 bp), and ORF3 (807 bp). Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  14. Cloning and nucleotide sequence of the hemA gene of Agrobacterium radiobacter.

    PubMed

    Drolet, M; Sasarman, A

    1991-04-01

    The hemA gene of Agrobacterium radiobacter ATCC4718 was identified by hybridization with a hemA probe from Rhizobium meliloti and cloned by complementation of a hemA mutant of Escherichia coli K12. E. coli hemA transformants carrying the hemA gene of Agrobacterium showed delta-aminolevulinic acid synthetase (delta-ALAS) activity in vitro. The hemA gene was carried on a 4.4 kb EcoRI fragment which could be reduced to a 2.6 kb EcoRI-SstI fragment without affecting its complementing or delta-ALAS activity. The sequence of the hemA gene showed an open reading frame of 1215 nucleotides, which could code for a protein of 44,361 Da. This is very close to the molecular weight of the HemA protein obtained using an in vitro coupled transcription-translation system (45,000 Da). Comparison of amino acid sequences of the delta-ALAS of A. radiobacter and Bradyrhizobium japonicum showed strong homology between the two enzymes; less, but still significant, homology was observed when A. radiobacter and human delta-ALAS were compared. Primer extension experiments enabled us to identify two promoters for the hemA gene of A. radiobacter. One of these promoters shows some similarity to the first promoter of the hemA gene of R. meliloti.

  15. Characterization of Sri Lanka rabies virus isolates using nucleotide sequence analysis of nucleoprotein gene.

    PubMed

    Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L

    2001-01-01

    Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.

  16. Escherichia coli gene purR encoding a repressor protein for purine nucleotide synthesis. Cloning, nucleotide sequence, and interaction with the purF operator.

    PubMed

    Rolfes, R J; Zalkin, H

    1988-12-25

    The Escherichia coli gene purR, encoding a repressor protein, was cloned by complementation of a purR mutation. Gene purR on a multicopy plasmid repressed expression of purF and purF-lacZ and reduced the growth rate of host cells by limiting the rate of de novo purine nucleotide synthesis. The level of a 1.3-kilobase purR mRNA was higher in cells grown with excess adenine, suggesting that synthesis of the repressor may be regulated. The chromosomal locus of purR was mapped to coordinate 1755-kb on the E. coli restriction map (Kohara, Y., Akiyama, K., and Isono, K. (1987) Cell 50, 495-508). Pur repressor bound specifically to purF operator DNA as determined by gel retardation and DNase I footprinting assays. The amino acid sequence of Pur repressor was derived from the nucleotide sequence. Pur repressor subunit contains 341 amino acids and has a calculated Mr of 38,179. Pur repressor is 31-35% identical with the galR and cytR repressors and 26% identical with the lacI repressor. These four repressors are likely homologous. Amino acid sequence similarity is greatest in an amino-terminal region presumed to contain a DNA-binding domain. A similarity is also noted in the operator sites for these repressors.

  17. Nucleotide sequences of genome segments S6, S7 and S10 of Dendrolimus punctatus cypovirus 1.

    PubMed

    Hong, J J; Duan, J L; Zhao, S L; Xu, H G; Peng, H Y

    2004-01-01

    The nucleotide sequences of genome segments S6, S7 and S10 of Dendrolimus punctatus cypovirus 1 Hunan I (DpCPV-HN(I)) and DpCPV-HN(I)-Se(3) (DpCPV-HN(I) passed three times in Spodoptera exigua) were determined. Segment S10 was 944 nucleotides in length and encoded a polyhedrin of 248 amino acids (28,439 Da). Only two nucleotide mutations were found between DpCPV-HN(I) S10 and DpCPV-HN(I)-Se3 S10, and the deduced amino acid sequences of the polyhedrin proteins were identical. Segment S7, 1 501 nucleotides, encoded a protein of 448 amino acids ( approximately 50 kDa; p50). Thirty-one nucleotide mutations were found between DpCPV-HN(I) S7 and DpCPV-HN(I)-Se3 S7, but these resulted in only four amino acid changes. DpCPV-HN(I) S6 encoded a protein of 561 amino acids (63,688 Da; p64). The amino acid sequence of p64, had a high leucine content (10%), and contained a leucine zipper motif and one ATP/GTP-binding site motif.

  18. Cloning, mutagenesis, and nucleotide sequence of a siderophore biosynthetic gene (amoA) from Aeromonas hydrophila.

    PubMed Central

    Barghouthi, S; Payne, S M; Arceneaux, J E; Byers, B R

    1991-01-01

    Many isolates of the Aeromonas species produce amonabactin, a phenolate siderophore containing 2,3-dihydroxybenzoic acid (2,3-DHB). An amonabactin biosynthetic gene (amoA) was identified (in a Sau3A1 gene library of Aeromonas hydrophila 495A2 chromosomal DNA) by its complementation of the requirement of Escherichia coli SAB11 for exogenous 2,3-DHB to support siderophore (enterobactin) synthesis. The gene amoA was subcloned as a SalI-HindIII 3.4-kb DNA fragment into pSUP202, and the complete nucleotide sequence of amoA was determined. A putative iron-regulatory sequence resembling the Fur repressor protein-binding site overlapped a possible promoter region. A translational reading frame, beginning with valine and encoding 396 amino acids, was open for 1,188 bp. The C-terminal portion of the deduced amino acid sequence showed 58% identity and 79% similarity with the E. coli EntC protein (isochorismate synthetase), the first enzyme in the E. coli 2,3-DHB biosynthetic pathway, suggesting that amoA probably encodes a step in 2,3-DHB biosynthesis and is the A. hydrophila equivalent of the E. coli entC gene. An isogenic amonabactin-negative mutant, A. hydrophila SB22, was isolated after marker exchange mutagenesis with Tn5-inactivated amoA (amoA::Tn5). The mutant excreted neither 2,3-DHB nor amonabactin, was more sensitive than the wild-type to growth inhibition by iron restriction, and used amonabactin to overcome iron starvation. Images PMID:1830579

  19. Construction of a normalized directionally cloned cDNA library from adult heart and analysis of 3040 clones by partial sequencing.

    PubMed

    Tanaka, T; Ogiwara, A; Uchiyama, I; Takagi, T; Yazaki, Y; Nakamura, Y

    1996-07-01

    Large-scale sequencing of clones from cDNA libraries derived from specific tissues is a rapid and efficient way of discovering novel genes expressed in those tissues. However, because the heart is continually contracting and relaxing, it strongly expresses muscle-contractile genes and/or mitochondrial genes, a bias that reduces the efficiency of this method. To improve the efficiency of identifying novel genes expressed in the heart, we constructed a normalized directionally cloned cDNA library from adult heart and partially sequenced 3040 clones. Comparisons of these sequence data with known DNA sequences in the database revealed that 57.1% of the clones matched human genes already known, 23.4% were identical or almost identical to human expressed sequence tags (ESTs), 14.2% bore no significant homology to any sequences in the database, and 1.2% represented repetitive sequences. The remaining 4.1% showed some homology with known genes, and Northern blot analysis of several clones in this category revealed that most of them were expressed mainly in the heart and skeletal muscle. After redundancy was excluded, the 3040 clones accounted for 1395 distinctive ESTs, 446 of which exhibited no match to any known sequence. Our results suggest that our normalized library is less redundant than standard libraries and is a useful resource for cataloging genes expressed in the heart. PMID:8661126

  20. ANTICALIgN: visualizing, editing and analyzing combined nucleotide and amino acid sequence alignments for combinatorial protein engineering.

    PubMed

    Jarasch, Alexander; Kopp, Melanie; Eggenstein, Evelyn; Richter, Antonia; Gebauer, Michaela; Skerra, Arne

    2016-07-01

    ANTIC ALIGN: is an interactive software developed to simultaneously visualize, analyze and modify alignments of DNA and/or protein sequences that arise during combinatorial protein engineering, design and selection. ANTIC ALIGN: combines powerful functions known from currently available sequence analysis tools with unique features for protein engineering, in particular the possibility to display and manipulate nucleotide sequences and their translated amino acid sequences at the same time. ANTIC ALIGN: offers both template-based multiple sequence alignment (MSA), using the unmutated protein as reference, and conventional global alignment, to compare sequences that share an evolutionary relationship. The application of similarity-based clustering algorithms facilitates the identification of duplicates or of conserved sequence features among a set of selected clones. Imported nucleotide sequences from DNA sequence analysis are automatically translated into the corresponding amino acid sequences and displayed, offering numerous options for selecting reading frames, highlighting of sequence features and graphical layout of the MSA. The MSA complexity can be reduced by hiding the conserved nucleotide and/or amino acid residues, thus putting emphasis on the relevant mutated positions. ANTIC ALIGN: is also able to handle suppressed stop codons or even to incorporate non-natural amino acids into a coding sequence. We demonstrate crucial functions of ANTIC ALIGN: in an example of Anticalins selected from a lipocalin random library against the fibronectin extradomain B (ED-B), an established marker of tumor vasculature. Apart from engineered protein scaffolds, ANTIC ALIGN: provides a powerful tool in the area of antibody engineering and for directed enzyme evolution.

  1. Construction of cDNA library and preliminary analysis of expressed sequence tags from tea plant [Camellia sinensis (L) O. Kuntze].

    PubMed

    Phukon, Munmi; Namdev, Richa; Deka, Diganta; Modi, Mahendra K; Sen, Priyabrata

    2012-09-10

    Tea is the most popular non-alcoholic and healthy beverage across the world. The understanding of the genetic organization and molecular biology of tea plant, which is very poorly understood at present, is required for quantum increase in productivity and efficient use of germplasm for either cultivation or breeding program. Single-pass sequencing of randomly selected cDNA clones is the most widely accepted technique for gene identification and cloning. In the present study, a good quality cDNA library was constructed and preliminary analysis of ESTs was carried out. The titers of unamplified and amplified libraries were 1.4 × 10(6)pfu/ml and 5.27 × 10(8)pfu/ml respectively. A total of 210 cDNA clones from the constructed cDNA library were sequenced and analyzed. A total of 84 high quality Expressed Sequence Tags (ESTs) were generated, among which 71 ESTs had significant homology with sequences in NCBI non-redundant protein database by BLAST X analysis. About 80% ESTs had poly (A) tail at 3' end indicating that the cDNAs were full length. The database-matched ESTs were classified into putative cellular roles, viz. energy-related category (corresponding to 20% of total BLAST X matched ESTs), Transcription (14.2%), protein synthesis (14.2%) cell growth and division (8.6%), cell structure (5.7%), signal transduction (5.7%), transporters (2.9%), disease and defenses (2.9%), secondary metabolism (2.9%) and gene regulation (2.9%). This study provides an overview of the mRNA expression profile and first hand information of gene sequence expressed in tender leaves and apical buds of tea plant.

  2. Complete Nucleotide Sequences and Genome Organization of Two Pepper Mild Mottle Virus Isolates from Capsicum annuum in South Korea.

    PubMed

    Choi, Seung-Kook; Choi, Gug-Seoun; Kwon, Sun-Jung; Yoon, Ju-Yeon

    2016-05-19

    The complete genome sequences of pepper mild mottle virus (PMMoV)-P2 and -P3 were determined by the Sanger sequencing method. Although PMMoV-P2 and PMMoV-P3 have different pathogenicity in some pepper cultivars, the complete genome sequences of PMMoV-P2 and -P3 are composed of 6,356 nucleotides (nt). In this study, we report the complete genome sequences and genome organization of PMMoV-P2 and -P3 isolates from pepper species in South Korea.

  3. Complete Nucleotide Sequences and Genome Organization of Two Pepper Mild Mottle Virus Isolates from Capsicum annuum in South Korea

    PubMed Central

    Choi, Seung-Kook; Choi, Gug-Seoun; Kwon, Sun-Jung

    2016-01-01

    The complete genome sequences of pepper mild mottle virus (PMMoV)-P2 and -P3 were determined by the Sanger sequencing method. Although PMMoV-P2 and PMMoV-P3 have different pathogenicity in some pepper cultivars, the complete genome sequences of PMMoV-P2 and -P3 are composed of 6,356 nucleotides (nt). In this study, we report the complete genome sequences and genome organization of PMMoV-P2 and -P3 isolates from pepper species in South Korea. PMID:27198033

  4. [Polymorphism of DNA nucleotide sequence as a source of enhancement of the discrimination potential of the STR-markers].

    PubMed

    Zemskova, E Yu; Timoshenko, T V; Leonov, S N; Ivanov, P L

    2016-01-01

    The objective of the present pilot investigation was to reveal and to study polymorphism of nucleotide sequence in the alleles of STR loci of human autosomal DNA with special reference to the role of this phenomenon as a source of the differences between homonymous allelic variants. The secondary objection was to evaluate the possibility of using the data thus obtained for the enhancement of the informative value of the forensic medical genotyping of STR loci by means of identification of single nucleotide polymorphisms (SNP) for the purpose of extending their allelic spectrum. The methodological basis of the study was constituted by the comprehensive amplified fragment length polymorphism (AFLP) analysis and amplified fragment sequence polymorphisms (AFSP) analysis of DNA with the use of the PLEX-ID^TM analytical mass-spectrometry platform (Abbot Molecular, USA). The study has demonstrated that polymorphism of DNA nucleotide sequence can be regarded as the possible source of enhancement of the discriminating potential of STR markers. It means that the analysis of polymorphism of DNA nucleotide sequence for genotyping AFLP-type markers of chromosomal DNA can considerably increase the effectiveness of their application as individualizing markers for the purpose of molecular genetic expertises.

  5. A high-density simple sequence repeat and single nucleotide polymorphism genetic map of the tetraploid cotton genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton genome complexity was investigated with a saturated molecular genetic map that combined several sets of microsatellites or simple sequence repeats (SSR) and the first major public set of single nucleotide polymorphism (SNP) markers in cotton genomes (Gossypium spp.), and that was constructed ...

  6. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type shall be “DNA.” In addition, the combined DNA/RNA molecule shall be further described in the to feature... combined DNA/RNA” Name/Key Provide appropriate identifier for feature, preferably from WIPO Standard...

  7. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type shall be “DNA.” In addition, the combined DNA/RNA molecule shall be further described in the to feature... combined DNA/RNA” Name/Key Provide appropriate identifier for feature, preferably from WIPO Standard...

  8. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type shall be “DNA.” In addition, the combined DNA/RNA molecule shall be further described in the to feature... combined DNA/RNA” Name/Key Provide appropriate identifier for feature, preferably from WIPO Standard...

  9. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type shall be “DNA.” In addition, the combined DNA/RNA molecule shall be further described in the to feature... combined DNA/RNA” Name/Key Provide appropriate identifier for feature, preferably from WIPO Standard...

  10. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type shall be “DNA.” In addition, the combined DNA/RNA molecule shall be further described in the to feature... combined DNA/RNA” Name/Key Provide appropriate identifier for feature, preferably from WIPO Standard...

  11. [Polymorphism of DNA nucleotide sequence as a source of enhancement of the discrimination potential of the STR-markers].

    PubMed

    Zemskova, E Yu; Timoshenko, T V; Leonov, S N; Ivanov, P L

    2016-01-01

    The objective of the present pilot investigation was to reveal and to study polymorphism of nucleotide sequence in the alleles of STR loci of human autosomal DNA with special reference to the role of this phenomenon as a source of the differences between homonymous allelic variants. The secondary objection was to evaluate the possibility of using the data thus obtained for the enhancement of the informative value of the forensic medical genotyping of STR loci by means of identification of single nucleotide polymorphisms (SNP) for the purpose of extending their allelic spectrum. The methodological basis of the study was constituted by the comprehensive amplified fragment length polymorphism (AFLP) analysis and amplified fragment sequence polymorphisms (AFSP) analysis of DNA with the use of the PLEX-ID^TM analytical mass-spectrometry platform (Abbot Molecular, USA). The study has demonstrated that polymorphism of DNA nucleotide sequence can be regarded as the possible source of enhancement of the discriminating potential of STR markers. It means that the analysis of polymorphism of DNA nucleotide sequence for genotyping AFLP-type markers of chromosomal DNA can considerably increase the effectiveness of their application as individualizing markers for the purpose of molecular genetic expertises. PMID:27500481

  12. Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

    NASA Astrophysics Data System (ADS)

    Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

    1983-03-01

    A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

  13. Single nucleotide polymorphisms in the IS900 sequence of Mycobacterium avium subsp. paratuberculosis are strain type specific.

    PubMed

    Castellanos, Elena; Aranaz, Alicia; de Juan, Lucia; Alvarez, Julio; Rodríguez, Sabrina; Romero, Beatriz; Bezos, Javier; Stevenson, Karen; Mateos, Ana; Domínguez, Lucas

    2009-07-01

    Insertion sequence IS900 is used as a target for the identification of Mycobacterium avium subsp. paratuberculosis. Previous reports have revealed single nucleotide polymorphisms within IS900. This study, which analyzed the IS900 sequences of a panel of isolates representing M. avium subsp. paratuberculosis strain types I, II, and III, revealed conserved type-specific polymorphisms that could be utilized as a tool for diagnostic and epidemiological purposes.

  14. Sequence analysis and molecular characterization of larval midgut cDNA transcripts encoding peptidases from the yellow mealworm, Tenebrio molitor L.

    PubMed

    Prabhakar, S; Chen, M-S; Elpidina, E N; Vinokurov, K S; Smith, C M; Marshall, J; Oppert, B

    2007-08-01

    Peptidase sequences were analysed in randomly picked clones from cDNA libraries of the anterior or posterior midgut or whole larvae of the yellow mealworm, Tenebrio molitor Linnaeus. Of a total of 1528 sequences, 92 encoded potential peptidases, from which 50 full-length cDNA sequences were obtained, including serine and cysteine proteinases and metallopeptidases. Serine proteinase transcripts were predominant in the posterior midgut, whereas transcripts encoding cysteine and metallopeptidases were mainly found in the anterior midgut. Alignments with other proteinases indicated that 40% of the serine proteinase sequences were serine proteinase homologues, and the remaining ones were identified as either trypsin, chymotrypsin or other serine proteinases. Cysteine proteinase sequences included cathepsin B- and L-like proteinases, and metallopeptidase transcripts were similar to carboxypeptidase A. Northern blot analysis of representative sequences demonstrated the differential expression profile of selected transcripts across five developmental stages of Te. molitor. These sequences provide insights into peptidases in coleopteran insects as a basis to study the response of coleopteran larvae to external stimuli and to evaluate regulatory features of the response.

  15. A single nucleotide polymorphism and sequence analysis of CSN1S1 gene promoter region in Chinese Bos grunniens (yak).

    PubMed

    Bai, W L; Yin, R H; Dou, Q L; Yang, J C; Zhao, S J; Ma, Z J; Yin, R L; Luo, G B; Zhao, Z H

    2010-01-01

    The aim of this study was to investigate the polymorphism of the CSN1S1 gene promoter region in 4 Chinese yak breeds, and compare the yak CSN1S1 gene promoter region sequences with other ruminants. A Polymerase Chain Reaction-Single Strand Conformation Polymorphism protocol was developed for rapid genotyping of the yak CSN1S1 gene. One hundred fifty-eight animals from 4 Chinese yak breeds were genotyped at the CSN1S1 locus using the protocol developed. A single nucleotide polymorphism of the CSN1S1 gene promoter region has been identified in all yak breeds investigated. The polymorphism consists of a single nucleotide substitution G-->A at position 386 of the CSN1S1 gene promoter region, resulting in two alleles named, respectively, G(386) and A(386), based on the nucleotide at position 386. The allele G(386) was found to be more common in the animals investigated. The corresponding nucleotide sequences in GenBank of yak (having the same nucleotides as allele G(386) in this study), bovine, water buffalo, sheep, and goat had similarity of 99.68%, 99.35%, 97.42%, 95.14%, and 94.19%, respectively, with the yak allele A(386.).

  16. Primary structure of a genomic zein sequence of maize.

    PubMed Central

    Hu, N T; Peifer, M A; Heidecker, G; Messing, J; Rubenstein, I

    1982-01-01

    The nucleotide sequence of a genomic clone (termed Z4 ) of the zein multigene family was compared to the nucleotide sequence of related cDNA clones of zein mRNAs. A tandem duplication of a 96-bp sequence is found in the genomic clone that is not present in the related cDNA clones. When the duplication is disregarded, the nucleotide sequence homology between Z4 and its related cDNAs was approximately 97%. The nucleotide sequence is also compared to other isolated cDNAs. No introns in the coding region of the zein gene are detected. The first nucleotide of a putative TATA box, TATAAATA , was located 88 nucleotides upstream of the first nucleotide of the first ATG codon which initiated the open reading frame. The first nucleotide of a putative CCAAT box, CAAAAT , appeared 45 nucleotides upstream of the first nucleotide of the zein cDNA clones in the 3' non-coding region also appeared in the genomic sequence at the same locations. The amino acid composition of the polypeptide specified by the Z4 nucleotide sequence is similar to the known composition of zein proteins. PMID:6233138

  17. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    NASA Astrophysics Data System (ADS)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  18. Isolation of a family of resistance gene analogue sequences of the nucleotide binding site (NBS) type from Lens species.

    PubMed

    Yaish, M W F; Sáenz de Miera, L E; Pérez de la Vega, M

    2004-08-01

    Most known plant disease-resistance genes (R genes) include in their encoded products domains such as a nucleotide-binding site (NBS) or leucine-rich repeats (LRRs). Sequences with unknown function, but encoding these conserved domains, have been defined as resistance gene analogues (RGAs). The conserved motifs within plant NBS domains make it possible to use degenerate primers and PCR to isolate RGAs. We used degenerate primers deduced from conserved motifs in the NBS domain of NBS-LRR resistance proteins to amplify genomic sequences from Lens species. Fragments from approximately 500-850 bp were obtained. The nucleotide sequence analysis of these fragments revealed 32 different RGA sequences in Lens species with a high similarity (up to 91%) to RGAs from other plants. The predicted amino acid sequences showed that lentil sequences contain all the conserved motifs (P-loop, kinase-2, kinase-3a, GLPL, and MHD) present in the majority of other known plant NBS-LRR resistance genes. Phylogenetic analyses grouped the Lens NBS sequences with the Toll and interleukin-1 receptor (TIR) subclass of NBS-LRR genes, as well as with RGA sequences isolated from other legume species. Using inverse PCR on one putative RGA of lentil, we were able to amplify the flanking regions of this sequence, which contained features found in R proteins.

  19. Structural organization, nucleotide sequence, and regulation of the Haemophilus influenzae rec-1+ gene.

    PubMed Central

    Zulty, J J; Barcak, G J

    1993-01-01

    The Haemophilus influenzae rec-1+ protein plays a central role in DNA metabolism, participating in general homologous recombination, recombinational (postreplication) DNA repair, and prophage induction. Although many H. influenzae rec-1 mutants have been phenotypically characterized, little is known about the rec-1+ gene at the molecular level. In this study, we present the genetic organization of the rec-1+ locus, the DNA sequence of rec-1+, and studies of the transcriptional regulation of rec-1+ during cellular assault by DNA-damaging agents and during the induction of competence for genetic transformation. Although little is known about promoter structure in H. influenzae, we identified a potential rec-1+ promoter that is identical in 11 of 12 positions to the bacterial sigma 70-dependent promoter consensus sequence. Results from a primer extension analysis revealed that the start site of rec-1+ transcription is centered 6 nucleotides downstream of this promoter. We identified potential DNA binding sites in the rec-1+ gene for LexA, integration host factor, and cyclic AMP receptor protein. We obtained evidence that at least one of the proposed cyclic AMP receptor protein binding sites is active in modulating rec-1+ transcription. This finding makes rec-1+ control circuitry novel among recA+ homologs. Two H. influenzae DNA uptake sequences that may function as a transcription termination signal were identified in inverted orientations at the end of the rec-1+ coding sequence. In addition, we report the first use of the Escherichia coli lacZ operon fusion technique in H. influenzae to study the transcriptional control of rec-1+. Our results indicate that rec-1+ is transcriptionally induced about threefold during DNA-damaging events. Furthermore, we show that rec-1+ can substitute for recA+ in E. coli to modulate SOS induction of dinB1 expression. Surprisingly, although 5% of the H. influenzae genome is in the form of single-stranded DNA during competence for

  20. Proteus mirabilis MR/P fimbrial operon: genetic organization, nucleotide sequence, and conditions for expression.

    PubMed Central

    Bahrani, F K; Mobley, H L

    1994-01-01

    Proteus mirabilis, an agent of urinary tract infection, expresses at least four fimbrial types. Among these are the MR/P (mannose-resistant/Proteus-like) fimbriae. MrpA, the structural subunit, is optimally expressed at 37 degrees C in Luria broth cultured statically for 48 h by each of seven strains examined. Genes encoding this fimbria were isolated, and the complete nucleotide sequence was determined. The mrp gene cluster encoded by 7,293 bp predicts eight polypeptides: MrpI (22,133 Da), MrpA (17,909 Da), MrpB (19,632 Da), MrpC (96,823 Da), MrpD (27,886 Da), MrpE (19,470 Da), MrpF (17,363 Da), and MrpG (13,169 Da). mrpI is upstream of the gene encoding the major structural subunit gene mrpA and is transcribed in the direction opposite to that of the rest of the operon. All predicted polypeptides share > or = 25% amino acid identity with at least one other enteric fimbrial gene product encoded by the pap, fim, smf, fan, or mrk gene clusters. Images PMID:7910820

  1. Nucleotide sequence and mutational analysis of the vnfENX region of Azotobacter vinelandii.

    PubMed

    Wolfinger, E D; Bishop, P E

    1991-12-01

    The nucleotide sequence (3,600 bp) of a second copy of nifENX-like genes in Azotobacter vinelandii has been determined. These genes are located immediately downstream from vnfA and have been designated vnfENX. The vnfENX genes appear to be organized as a single transcriptional unit that is preceded by a potential RpoN-dependent promoter. While the nifEN genes are thought to be evolutionarily related to nifDK, the vnfEN genes appear to be more closely related to nifEN than to either nifDK, vnfDK, or anfDK. Mutant strains (CA47 and CA48) carrying insertions in vnfE and vnfN, respectively, are able to grow diazotrophically in molybdenum (Mo)-deficient medium containing vanadium (V) (Vnf+) and in medium lacking both Mo and V (Anf+). However, a double mutant (strain DJ42.48) which contains a nifEN deletion and an insertion in vnfE is unable to grow diazotrophically in Mo-sufficient medium or in Mo-deficient medium with or without V. This suggests that NifE and NifN substitute for VnfE and VnfN when the vnfEN genes are mutationally inactivated. AnfA is not required for the expression of a vnfN-lacZ transcriptional fusion, even though this fusion is expressed under Mo- and V-deficient diazotrophic growth conditions.

  2. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    PubMed Central

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  3. Isolation and nucleotide sequencing of lactose carrier mutants that transport maltose.

    PubMed Central

    Brooker, R J; Wilson, T H

    1985-01-01

    The wild-type lactose carrier of Escherichia coli has a poor ability to transport the disaccharide maltose. However, it is possible to select lactose carrier mutants that have an enhanced ability to transport maltose by growing E. coli cells on maltose minimal plates in the presence of isopropyl thiogalactoside (an inducer of the lac operon). We have utilized this approach to isolate 18 independent lactose permease mutants that transport maltose. The relevant DNA sequences have been determined, and all of the mutations were found to be single base pair changes either at triplet 177 or at triplet 236. The nucleotide changes replace alanine-177 with valine or threonine, or tyrosine-236 with phenylalanine, asparagine, serine, or histidine. Transport experiments indicate that all of the mutants have faster maltose transport compared with the wild-type strain. Position 177 mutants retain the ability to transport galactosides, such as lactose and melibiose, at rates similar to the rate of the wild-type strain. In contrast, the position 236 mutants are markedly defective in the ability to transport galactosides. With regard to secondary structure, alanine-177 and tyrosine-236 are located on adjacent hydrophobic segments of the lactose carrier that are predicted to span the membrane. Thus, the results of this study indicate that the substrate recognition site of the lactose carrier is located within the plane of the lipid bilayer. In addition, a tertiary structure model is proposed that suggests how certain transmembrane segments might be localized relative to one another. Images PMID:3889919

  4. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer.

    PubMed

    Morrison, Carl D; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C; Johnson, Candace S; Trump, Donald L

    2014-02-11

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as "stitchers," to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication-licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer.

  5. Associations of single nucleotide polymorphisms in the Pygo2 coding sequence with idiopathic oligospermia and azoospermia.

    PubMed

    Ge, S-Q; Grifin, J; Liu, L-H; Aston, K I; Simon, L; Jenkins, T G; Emery, B R; Carrell, D T

    2015-08-07

    Male infertility is often associated with a decreased sperm count. The Pygo2 gene is expressed in the elongating spermatid during chromatin remodeling; thus impairment in PYGO2 function might lead to spermatogenic arrest, sperm count reduction, and subsequent infertility. The aim of this study was to identify mutations in Pygo2 that might lead to idiopathic oligospermia and azoospermia. DNA was isolated from venous blood from 77 men with normal fertility and 195 men with idiopathic oligospermia or azoospermia. Polymerase chain reaction-sequencing analysis was performed for the three Pygo2 coding regions. Non-synonymous single nucleotide polymorphisms (SNPs) were detected and analyzed using SIFT, Polyphen-2, and Mutation Taster softwares to identify possible changes in protein structure that could affect phenotype. Pygo2 sequencing was successful for 178 patients (30 with mild or moderate oligospermia, 57 with severe oligospermia, and 91 with azoospermia). Three previously reported non-synonymous SNPs were identified in patients with azoospermia or severe oligospermic but not in those with mild or moderate oligozoopermia or normozoospermia. SNPs rs61758740 (M141I) and rs141722381 (N240I) cause the replacement of one hydrophobic or hydrophilic amino acid, respectively, with another, and SNP rs61758741 (K261E) causes the replacement of a basic amino acid with an acidic one. The software predictions demonstrated that SNP rsl41722381 would likely result in disrupted tertiary protein structure and thus could be involved in disease pathogenesis. Overall, this study demonstrated that SNPs in the coding region of Pygo2 might be one of the causative factors in idiopathic oligospermia and azoospermia, resulting in male infertility.

  6. Postzygotic single-nucleotide mosaicisms in whole-genome sequences of clinically unremarkable individuals

    PubMed Central

    Huang, August Y; Xu, Xiaojing; Ye, Adam Y; Wu, Qixi; Yan, Linlin; Zhao, Boxun; Yang, Xiaoxu; He, Yao; Wang, Sheng; Zhang, Zheng; Gu, Bowen; Zhao, Han-Qing; Wang, Meng; Gao, Hua; Gao, Ge; Zhang, Zhichao; Yang, Xiaoling; Wu, Xiru; Zhang, Yuehua; Wei, Liping

    2014-01-01

    Postzygotic single-nucleotide mutations (pSNMs) have been studied in cancer and a few other overgrowth human disorders at whole-genome scale and found to play critical roles. However, in clinically unremarkable individuals, pSNMs have never been identified at whole-genome scale largely due to technical difficulties and lack of matched control tissue samples, and thus the genome-wide characteristics of pSNMs remain unknown. We developed a new Bayesian-based mosaic genotyper and a series of effective error filters, using which we were able to identify 17 SNM sites from ∼80× whole-genome sequencing of peripheral blood DNAs from three clinically unremarkable adults. The pSNMs were thoroughly validated using pyrosequencing, Sanger sequencing of individual cloned fragments, and multiplex ligation-dependent probe amplification. The mutant allele fraction ranged from 5%-31%. We found that C→T and C→A were the predominant types of postzygotic mutations, similar to the somatic mutation profile in tumor tissues. Simulation data showed that the overall mutation rate was an order of magnitude lower than that in cancer. We detected varied allele fractions of the pSNMs among multiple samples obtained from the same individuals, including blood, saliva, hair follicle, buccal mucosa, urine, and semen samples, indicating that pSNMs could affect multiple sources of somatic cells as well as germ cells. Two of the adults have children who were diagnosed with Dravet syndrome. We identified two non-synonymous pSNMs in SCN1A, a causal gene for Dravet syndrome, from these two unrelated adults and found that the mutant alleles were transmitted to their children, highlighting the clinical importance of detecting pSNMs in genetic counseling. PMID:25312340

  7. Quantitative theory of entropic forces acting on constrained nucleotide sequences applied to viruses.

    PubMed

    Greenbaum, Benjamin D; Cocco, Simona; Levine, Arnold J; Monasson, Rémi

    2014-04-01

    We outline a theory to quantify the interplay of entropic and selective forces on nucleotide organization and apply it to the genomes of single-stranded RNA viruses. We quantify these forces as intensive variables that can easily be compared between sequences, outline a computationally efficient transfer-matrix method for their calculation, and apply this method to influenza and HIV viruses. We find viruses altering their dinucleotide motif use under selective forces, with these forces on CpG dinucleotides growing stronger in influenza the longer it replicates in humans. For a subset of genes in the human genome, many involved in antiviral innate immunity, the forces acting on CpG dinucleotides are even greater than the forces observed in viruses, suggesting that both effects are in response to similar selective forces involving the innate immune system. We further find that the dynamics of entropic forces balancing selective forces can be used to predict how long it will take a virus to adapt to a new host, and that it would take H1N1 several centuries to adapt to humans from birds, typically contributing many of its synonymous substitutions to the forcible removal of CpG dinucleotides. By examining the probability landscape of dinucleotide motifs, we predict where motifs are likely to appear using only a single-force parameter and uncover the localization of UpU motifs in HIV. Essentially, we extend the natural language and concepts of statistical physics, such as entropy and conjugated forces, to understanding viral sequences and, more generally, constrained genome evolution.

  8. Phylogenetic analysis of beta-papillomaviruses as inferred from nucleotide and amino acid sequence data.

    PubMed

    Gottschling, Marc; Köhler, Anja; Stockfleth, Eggert; Nindl, Ingo

    2007-01-01

    Human papillomaviruses (HPV) of the beta-group seem to be involved in the pathogenesis of non-melanoma skin cancer. Papillomaviruses are host specific and are considered closely co-evolving with their hosts. Evolutionary incongruence between early genes and late genes has been reported among oncogenic genital alpha-papillomaviruses and considerably challenge phylogenetic reconstructions. We investigated the relationships of 29 beta-HPV (25 types plus four putative new types, subtypes, or variants) as inferred from codon aligned and amino acid sequence data of the genes E1, E2, E6, E7, L1, and L2 using likelihood, distance, and parsimony approaches. An analysis of a L1 fragment included additional nucleotide and amino acid sequences from seven non-human beta-papillomaviruses. Early genes and late genes evolution did not conflict significantly in beta-papillomaviruses based on partition homogeneity tests (p > or = 0.001). As inferred from the complete genome analyses, beta-papillomaviruses were monophyletic and segregated into four highly supported monophyletic assemblages corresponding to the species 1, 2, 3, and fused 4/5. They basically split into the species 1 and the remainder of beta-papillomaviruses, whose species 3, 4, and 5 constituted the sistergroup of species 2. beta-Papillomaviruses have been isolated from humans, apes, and monkeys, and phylogenetic analyses of the L1 fragment showed non-human papillomaviruses highly polyphyletic nesting within the HPV species. Thus, host and virus phylogenies were not congruent in beta-papillomaviruses, and multiple invasions across species borders may contribute (additionally to host-linked evolution) to their diversification.

  9. Nucleotide sequences and genetic analysis of hydrogen oxidation (hox) genes in Azotobacter vinelandii.

    PubMed Central

    Menon, A L; Mortenson, L E; Robson, R L

    1992-01-01

    Azotobacter vinelandii contains a heterodimeric, membrane-bound [NiFe]hydrogenase capable of catalyzing the reversible oxidation of H2. The beta and alpha subunits of the enzyme are encoded by the structural genes hoxK and hoxG, respectively, which appear to form part of an operon that contains at least one further potential gene (open reading frame 3 [ORF3]). In this study, determination of the nucleotide sequence of a region of 2,344 bp downstream of ORF3 revealed four additional closely spaced or overlapping ORFs. These ORFs, ORF4 through ORF7, potentially encode polypeptides with predicted masses of 22.8, 11.4, 16.3, and 31 kDa, respectively. Mutagenesis of the chromosome of A. vinelandii in the area sequenced was carried out by introduction of antibiotic resistance gene cassettes. Disruption of hoxK and hoxG by a kanamycin resistance gene abolished whole-cell hydrogenase activity coupled to O2 and led to loss of the hydrogenase alpha subunit. Insertional mutagenesis of ORF3 through ORF7 with a promoterless lacZ-Kmr cassette established that the region is transcriptionally active and involved in H2 oxidation. We propose to call ORF3 through ORF7 hoxZ, hoxM, hoxL, hoxO, and hoxQ, respectively. The predicted hox gene products resemble those encoded by genes from hydrogenase-related operons in other bacteria, including Escherichia coli and Alcaligenes eutrophus. Images PMID:1624446

  10. T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

    PubMed Central

    Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

    2008-01-01

    Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

  11. Rescue of mumps virus from cDNA.

    PubMed

    Clarke, D K; Sidhu, M S; Johnson, J E; Udem, S A

    2000-05-01

    A complete DNA copy of the genome of a Jeryl Lynn strain of mumps virus (15,384 nucleotides) was assembled from cDNA fragments such that an exact antigenome RNA could be generated following transcription by T7 RNA polymerase and cleavage by hepatitis delta virus ribozyme. The plasmid containing the genome sequence, together with support plasmids which express mumps virus NP, P, and L proteins under control of the T7 RNA polymerase promoter, were transfected into A549 cells previously infected with recombinant vaccinia virus (MVA-T7) that expressed T7 RNA polymerase. Rescue of infectious virus from the genome cDNA was demonstrated by amplification of mumps virus from transfected-cell cultures and by subsequent consensus sequencing of reverse transcription-PCR products generated from infected-cell RNA to verify the presence of specific nucleotide tags introduced into the genome cDNA clone. The only coding change (position 8502, A to G) in the cDNA clone relative to the consensus sequence of the Jeryl Lynn plaque isolate from which it was derived, resulting in a lysine-to-arginine substitution at amino acid 22 of the L protein, did not prevent rescue of mumps virus, even though an amino acid alignment for the L proteins of paramyxoviruses indicates that lysine is highly conserved at that position. This system may provide the basis of a safe and effective virus vector for the in vivo expression of immunologically and biologically active proteins, peptides, and RNAs.

  12. Structural dynamics of cereal mitochondrial genomes as revealed by complete nucleotide sequencing of the wheat mitochondrial genome.

    PubMed

    Ogihara, Yasunari; Yamazaki, Yukiko; Murai, Koji; Kanno, Akira; Terachi, Toru; Shiina, Takashi; Miyashita, Naohiko; Nasuda, Shuhei; Nakamura, Chiharu; Mori, Naoki; Takumi, Shigeo; Murata, Minoru; Futo, Satoshi; Tsunewaki, Koichiro

    2005-01-01

    The application of a new gene-based strategy for sequencing the wheat mitochondrial genome shows its structure to be a 452 528 bp circular molecule, and provides nucleotide-level evidence of intra-molecular recombination. Single, reciprocal and double recombinant products, and the nucleotide sequences of the repeats that mediate their formation have been identified. The genome has 55 genes with exons, including 35 protein-coding, 3 rRNA and 17 tRNA genes. Nucleotide sequences of seven wheat genes have been determined here for the first time. Nine genes have an exon-intron structure. Gene amplification responsible for the production of multicopy mitochondrial genes, in general, is species-specific, suggesting the recent origin of these genes. About 16, 17, 15, 3.0 and 0.2% of wheat mitochondrial DNA (mtDNA) may be of genic (including introns), open reading frame, repetitive sequence, chloroplast and retro-element origin, respectively. The gene order of the wheat mitochondrial gene map shows little synteny to the rice and maize maps, indicative that thorough gene shuffling occurred during speciation. Almost all unique mtDNA sequences of wheat, as compared with rice and maize mtDNAs, are redundant DNA. Features of the gene-based strategy are discussed, and a mechanistic model of mitochondrial gene amplification is proposed. PMID:16260473

  13. Structural dynamics of cereal mitochondrial genomes as revealed by complete nucleotide sequencing of the wheat mitochondrial genome

    PubMed Central

    Ogihara, Yasunari; Yamazaki, Yukiko; Murai, Koji; Kanno, Akira; Terachi, Toru; Shiina, Takashi; Miyashita, Naohiko; Nasuda, Shuhei; Nakamura, Chiharu; Mori, Naoki; Takumi, Shigeo; Murata, Minoru; Futo, Satoshi; Tsunewaki, Koichiro

    2005-01-01

    The application of a new gene-based strategy for sequencing the wheat mitochondrial genome shows its structure to be a 452 528 bp circular molecule, and provides nucleotide-level evidence of intra-molecular recombination. Single, reciprocal and double recombinant products, and the nucleotide sequences of the repeats that mediate their formation have been identified. The genome has 55 genes with exons, including 35 protein-coding, 3 rRNA and 17 tRNA genes. Nucleotide sequences of seven wheat genes have been determined here for the first time. Nine genes have an exon–intron structure. Gene amplification responsible for the production of multicopy mitochondrial genes, in general, is species-specific, suggesting the recent origin of these genes. About 16, 17, 15, 3.0 and 0.2% of wheat mitochondrial DNA (mtDNA) may be of genic (including introns), open reading frame, repetitive sequence, chloroplast and retro-element origin, respectively. The gene order of the wheat mitochondrial gene map shows little synteny to the rice and maize maps, indicative that thorough gene shuffling occurred during speciation. Almost all unique mtDNA sequences of wheat, as compared with rice and maize mtDNAs, are redundant DNA. Features of the gene-based strategy are discussed, and a mechanistic model of mitochondrial gene amplification is proposed. PMID:16260473

  14. Identification of a new P450 expressed in human lung: complete cDNA sequence, cDNA-directed expression, and chromosome mapping.

    PubMed

    Nhamburo, P T; Gonzalez, F J; McBride, O W; Gelboin, H V; Kimura, S

    1989-10-01

    A cDNA coding for a P450 expressed in human lung was isolated from a lambda gt11 library constructed from human lung mRNA using a cDNA probe to rat P450 IVA1. The cDNA-deduced amino acid sequence of this P450, designated IVB1, consisted of 511 amino acids and had a calculated molecular weight of 59,558. The IVB1 amino acid sequence bore 51%, 53%, and 52% similarities to rat IVA1, IVA2, and rabbit P450p-2, respectively. Comparison of the primary amino acid sequence of human IVB1 with rat IVA and rabbit p-2 P450 sequences revealed a region of absolute sequence identity of 17 amino acids between residues 304 and 320. However, the functional significance of this conserved sequence is unknown. Human IVB1 also appears to be related to P450 isozyme 5 that has been extensively characterized in rabbits. The IVB1 cDNA was inserted into a vaccinia virus expression vector and the enzyme expressed in human cell lines. The expressed enzyme had an absorption spectrum with a lambda max at 450 nm when reduced and complexed with carbon monoxide, typical of other cytochrome P450s. Unlike rabbit P450 isozyme 5, however, human IVB1 was unable to activate the promutagen 2-aminofluorene. Human lung microsomal P450s were also unable to metabolize this compound despite the presence of IVB1 mRNA in three out of four human lungs analyzed. In contrast to its expression in lung, IVB1 mRNA was undetectable in livers from 14 individuals, including those from which the lungs were derived. IVB1-related mRNA was also expressed in rat lung and was undetectable in untreated rat liver.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Construction of full-length cDNA library and development of EST-derived simple sequence repeat (EST-SSR) markers in Senecio scandens.

    PubMed

    Qian, Gang; Ping, Junjiao; Lu, Jian; Zhang, Zhen; Wang, Lei; Xu, Delin

    2014-12-01

    Senecio scandens Buch.-Ham. ex D. Don (Compositae) is a crucial source of Chinese traditional medicine with antibacterial properties. We constructed a cDNA library and obtained expressed sequence tags (ESTs) to show the distribution of gene ontology annotations for mRNAs, using an individual plant with superior antibacterial characteristics. Analysis of comparative genomics indicates that the putative uncharacterized proteins (21.07%) might be derived from "molecular function unknown" clones or rare transcripts. Furthermore, the Compositae had high cross-species transferability of EST-derived simple sequence repeats (EST-SSR), based on valid amplifications of 206 primer pairs developed from the newly assembled expressed sequence tag sequences in Artemisia annua L. Among those EST-SSR markers, 52 primers showed polymorphic amplifications between individuals with contrasting diverse antibacterial traits. Our sequence data and molecular markers will be cost-effective tools for further studies such as genome annotation, molecular breeding, and novel transcript profiles within Compositae species.

  16. Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

    SciTech Connect

    Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi ); Nawa, Hiroyuki; Nakanishi, Shigetada )

    1988-05-01

    HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5{prime} portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6{sup *}), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3{prime} end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription.

  17. Sequence-Specific Incorporation of Enzyme-Nucleotide Chimera by DNA Polymerases.

    PubMed

    Welter, Moritz; Verga, Daniela; Marx, Andreas

    2016-08-16

    DNA polymerases select the right nucleotide for the growing polynucleotide chain based on the shape and geometry of the nascent nucleotide pairs and thereby ensure high DNA replication selectivity. High-fidelity DNA polymerases are believed to possess tight active sites that allow little deviation from the canonical structures. However, DNA polymerases are known to use nucleotides with small modifications as substrates, which is key for numerous core biotechnology applications. We show that even high-fidelity DNA polymerases are capable of efficiently using nucleotide chimera modified with a large protein like horseradish peroxidase as substrates for template-dependent DNA synthesis, despite this "cargo" being more than 100-fold larger than the natural substrates. We exploited this capability for the development of systems that enable naked-eye detection of DNA and RNA at single nucleotide resolution. PMID:27392211

  18. Transcription profiling of guanine nucleotide binding proteins during developmental regulation, and pesticide response in Solenopsis invicta (Hymenoptera: Formicidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Guanine nucleotide binding proteins (GNBP or G-protein) are glycoproteins anchored on the cytoplasmic cell membrane, and are mediators for many cellular processes. Complete cDNA of guanine nucleotide-binding protein gene ß-subunit (SiGNBP) was cloned and sequenced from S. invicta workers. To detect ...

  19. Complete Nucleotide Sequence and Genome Organization of Hibiscus Chlorotic Ringspot Virus, a New Member of the Genus Carmovirus: Evidence for the Presence and Expression of Two Novel Open Reading Frames

    PubMed Central

    Huang, Mei; Koh, Dora Chin-Yen; Weng, Li-Juan; Chang, Min-Li; Yap, Yun-Kiam; Zhang, Lee; Wong, Sek-Man

    2000-01-01

    The complete nucleotide sequence of hibiscus chlorotic ringspot virus (HCRSV) was determined. The genomic RNA (gRNA) is 3,911 nucleotides long and has the potential to encode seven viral proteins in the order of 28 (p28), 23 (p23), 81 (p81), 8 (p8), 9 (p9), 38 (p38), and 25 (p25) kDa. Excluding two unique open reading frames (ORFs) encoding p23 and p25, the ORFs encode proteins with high amino acid similarity to those of carmoviruses. In addition to gRNA, two 3′-coterminated subgenomic RNA (sgRNA) species were identified. Full-length cDNA clones derived from gRNA and sgRNA were constructed under the control of a T7 promoter. Both capped and uncapped transcripts derived from the full-length genomic cDNA clone were infectious. In vitro translation and mutagenesis assays confirmed that all the predicted ORFs except the ORF encoding p8 are translatable, and the two novel ORFs (those encoding p23 and p25) may be functionally indispensable for the viral infection cycle. Based on virion morphology and genome organization, we propose that HCRSV be classified as a new member of the genus Carmovirus in family Tombusviridae. PMID:10708431

  20. Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response

    PubMed Central

    Sakurai, Tetsuya; Plata, Germán; Rodríguez-Zapata, Fausto; Seki, Motoaki; Salcedo, Andrés; Toyoda, Atsushi; Ishiwata, Atsushi; Tohme, Joe; Sakaki, Yoshiyuki; Shinozaki, Kazuo; Ishitani, Manabu

    2007-01-01

    Background Cassava, an allotetraploid known for its remarkable tolerance to abiotic stresses is an important source of energy for humans and animals and a raw material for many industrial processes. A full-length cDNA library of cassava plants under normal, heat, drought, aluminum and post harvest physiological deterioration conditions was built; 19968 clones were sequence-characterized using expressed sequence tags (ESTs). Results The ESTs were assembled into 6355 contigs and 9026 singletons that were further grouped into 10577 scaffolds; we found 4621 new cassava sequences and 1521 sequences with no significant similarity to plant protein databases. Transcripts of 7796 distinct genes were captured and we were able to assign a functional classification to 78% of them while finding more than half of the enzymes annotated in metabolic pathways in Arabidopsis. The annotation of sequences that were not paired to transcripts of other species included many stress-related functional categories showing that our library is enriched with stress-induced genes. Finally, we detected 230 putative gene duplications that include key enzymes in reactive oxygen species signaling pathways and could play a role in cassava stress response features. Conclusion The cassava full-length cDNA library here presented contains transcripts of genes involved in stress response as well as genes important for different areas of cassava research. This library will be an important resource for gene discovery, characterization and cloning; in the near future it will aid the annotation of the cassava genome. PMID:18096061

  1. Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

    PubMed Central

    Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

    2002-01-01

    Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

  2. Sequence determination of cDNA clones of transcripts from the tumor-associated region of the Marek's disease virus genome.

    PubMed

    Iwata, A; Ueda, S; Ishihama, A; Hirai, K

    1992-04-01

    The number of 132-bp tandem direct repeats within the long inverted repeat region of the Marek's disease virus type 1 (MDV1) genome increases concomitantly with the loss of oncogenicity during serial passages in cultured cells. Twelve clones carrying the 132-bp sequence were isolated from a cDNA library constructed from chicken embryo fibroblasts infected with the MDV1 Md5 strain. Through sequence analysis of a cDNA clone and primer extension analysis, the corresponding mRNA was found to be a linear transcript which included the two 132-bp tandem direct repeats. Two open reading frames were found in this transcript. One had a week homology with v-fms. The other should increase its size concomitantly with expansion of the 132-bp tandem direct repeat. PCR analysis of both cDNA clones and RNA gave amplified products which were as large as that produced from the genomic clone, indicating that a majority of mRNA from this region is composed of unspliced transcripts.

  3. Nucleotide sequence and mutational analysis of the vnfENX region of Azotobacter vinelandii.

    PubMed Central

    Wolfinger, E D; Bishop, P E

    1991-01-01

    The nucleotide sequence (3,600 bp) of a second copy of nifENX-like genes in Azotobacter vinelandii has been determined. These genes are located immediately downstream from vnfA and have been designated vnfENX. The vnfENX genes appear to be organized as a single transcriptional unit that is preceded by a potential RpoN-dependent promoter. While the nifEN genes are thought to be evolutionarily related to nifDK, the vnfEN genes appear to be more closely related to nifEN than to either nifDK, vnfDK, or anfDK. Mutant strains (CA47 and CA48) carrying insertions in vnfE and vnfN, respectively, are able to grow diazotrophically in molybdenum (Mo)-deficient medium containing vanadium (V) (Vnf+) and in medium lacking both Mo and V (Anf+). However, a double mutant (strain DJ42.48) which contains a nifEN deletion and an insertion in vnfE is unable to grow diazotrophically in Mo-sufficient medium or in Mo-deficient medium with or without V. This suggests that NifE and NifN substitute for VnfE and VnfN when the vnfEN genes are mutationally inactivated. AnfA is not required for the expression of a vnfN-lacZ transcriptional fusion, even though this fusion is expressed under Mo- and V-deficient diazotrophic growth conditions. PMID:1938952

  4. Construction of a muscle cDNA library of Chinese shrimp Fenneropenaeus chinensis and sequence analysis of the troponin I gene

    NASA Astrophysics Data System (ADS)

    Li, Jitao; Chen, Ping; Li, Jian; Liu, Ping; He, Yuying; Wang, Qingyin

    2010-03-01

    A muscle cDNA library of Chinese shrimp ( Fenneropenaeus chinensis) was constructed with the SMART™ cDNA Library Construction Kit. The titer of optimal primary library was 7.7×105 pfu mL-1 and that of the amplified library was 3.0×109 pfu mL-1. The percentages of the recombinant clones of primary and amplified libraries were over 98%. The insert sizes were longer than 400 bp with an average of 1000 bp. A positive clone containing a 794 bp insert was sequenced and identified encoding fast skeletal troponin I gene. This library provided a useful resource for the functional genomic research of F. chinensis.

  5. Immunological responses of turbot (Psetta maxima) to nodavirus infection or polyriboinosinic polyribocytidylic acid (pIC) stimulation, using expressed sequence tags (ESTs) analysis and cDNA microarrays.

    PubMed

    Park, Kyoung C; Osborne, Jane A; Montes, Ariana; Dios, Sonia; Nerland, Audun H; Novoa, Beatriz; Figueras, Antonio; Brown, Laura L; Johnson, Stewart C

    2009-01-01

    To investigate the immunological responses of turbot to nodavirus infection or pIC stimulation, we constructed cDNA libraries from liver, kidney and gill tissues of nodavirus-infected fish and examined the differential gene expression within turbot kidney in response to nodavirus infection or pIC stimulation using a turbot cDNA microarray. Turbot were experimentally infected with nodavirus and samples of each tissue were collected at selected time points post-infection. Using equal amount of total RNA at each sampling time, we made three tissue-specific cDNA libraries. After sequencing 3230 clones we obtained 3173 (98.2%) high quality sequences from our liver, kidney and gill libraries. Of these 2568 (80.9%) were identified as known genes and 605 (19.1%) as unknown genes. A total of 768 unique genes were identified. The two largest groups resulting from the classification of ESTs according to function were the cell/organism defense genes (71 uni-genes) and apoptosis-related process (23 uni-genes). Using these clones, a 1920 element cDNA microarray was constructed and used to investigate the differential gene expression within turbot in response to experimental nodavirus infection or pIC stimulation. Kidney tissue was collected at selected times post-infection (HPI) or stimulation (HPS), and total RNA was isolated for microarray analysis. Of the 1920 genes studied on the microarray, we identified a total of 121 differentially expressed genes in the kidney: 94 genes from nodavirus-infected animals and 79 genes from those stimulated with pIC. Within the nodavirus-infected fish we observed the highest number of differentially expressed genes at 24 HPI. Our results indicate that certain genes in turbot have important roles in immune responses to nodavirus infection and dsRNA stimulation.

  6. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Director of the Federal Register in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. Copies of WIPO... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid...

  7. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Director of the Federal Register in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. Copies of WIPO... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid...

  8. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Director of the Federal Register in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. Copies of WIPO... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid...

  9. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Director of the Federal Register in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. Copies of WIPO... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid...

  10. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Director of the Federal Register in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. Copies of WIPO... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid...

  11. A comparison of nucleotide sequences of measles virus L genes derived from wild-type viruses and SSPE brain tissues.

    PubMed

    Komase, K; Rima, B K; Pardowitz, I; Kunz, C; Billeter, M A; ter Meulen, V; Baczko, K

    1995-04-20

    The nucleotide sequences of the large protein (L) gene derived from two wild-type measles viruses (MV) and two SSPE brain-derived viruses have been determined. All sequences have single large open reading frames encoding 2183 amino acid residues. The deduced L proteins are well conserved and the proposed functional domains which have been identified for rhabdo- and paramyxoviruses are completely conserved in all strains. The degree of variability of L proteins is the lowest of all structural proteins of MV, reflecting its role in virus reproduction and persistence. Biased hypermutation was not observed in the L genes derived from SSPE brain tissue. None of the nucleotide changes can be associated with the attenuated phenotype of the Edmonston vaccine viruses. PMID:7747453

  12. Genetic divergence between subpopulations of the eastern Pacific goose barnacle Pollicipes elegans: mitochondrial cytochrome c subunit 1 nucleotide sequences.

    PubMed

    Van Syoc, R J

    1994-12-01

    Nucleotide sequence data derived from polymerase chain reaction products from the cytochrome oxidase subunit 1 gene of mitochondrial DNA provide evidence for interrupted gene flow and subsequent genetic divergence between geographically separate subpopulations of the edible goose barnacle, Pollicipes elegans, with a 4400-km latitudinal distribution in the eastern Pacific Ocean. The amphitropical subpopulations of Pollicipes elegans have a net nucleotide sequence divergence of about 1.2%. A range of mutation rates are applied to calculate estimates for the timing of this divergence. The earliest estimated time of divergence agrees with a Pliocene time of general warming in the eastern Pacific. The latest estimated times coincide with the Pleistocene epoch and periods of cooling and warming that could have allowed for a series of expansions and contractions of P. elegans populations in the eastern tropical Pacific. These expansions and contractions may, therefore, represent alternating periods of genetic exchange and isolation of the two populations.

  13. Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

    PubMed Central

    Ham, Chan Seon; Kim, Seong Yoon; Ko, Kwang Soo; Jo, Tae-Ho; Son, Gi Hoon

    2014-01-01

    Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI) gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola. PMID:24982938

  14. Characterization of Newcastle disease virus isolates by reverse transcription PCR coupled to direct nucleotide sequencing and development of sequence database for pathotype prediction and molecular epidemiological analysis.

    PubMed Central

    Seal, B S; King, D J; Bennett, J D

    1995-01-01

    Degenerate oligonucleotide primers were synthesized to amplify nucleotide sequences from portions of the fusion protein and matrix protein genes of Newcastle disease virus (NDV) genomic RNA that could be used diagnostically. These primers were used in a single-tube reverse transcription PCR of NDV genomic RNA coupled to direct nucleotide sequencing of the amplified product to characterize more than 30 NDV isolates. In agreement with previous reports, differences in the fusion protein cleavage sequence that correlated genotypically with virulence among various NDV pathotypes were detected. By using sequences generated from the matrix protein gene coding for the nuclear localization signal, lentogenic viruses were again grouped phylogenetically separate from other pathotypes. These techniques were applied to compare neurotropic velogenic viruses isolated from an outbreak of Newcastle disease in cormorants and turkeys. Cormorant NDV isolates and an NDV isolate from an infected turkey flock in North Dakota had the fusion protein cleavage sequence 109SRGRRQKRFVG119. The R-for-G substitution at position 110 may be unique for the cormorant-type isolates. Although the amino acid sequences from the fusion protein cleavage site were identical, nucleotide sequence data correlate the outbreak in turkeys to a cormorant virus isolate from Minnesota and not to a cormorant virus isolate from Michigan. On the basis of sequence information, the cormorant isolates are virulent viruses related to isolates of psittacine origin, possibly genotypically distinct from other velogenic NDV isolates. These techniques can be used reliably for Newcastle disease epidemiology and for prediction of pathotypes of NDV isolates without traditional live-bird inoculations. PMID:8567895

  15. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    PubMed

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  16. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    PubMed

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  17. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    PubMed Central

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  18. A cDNA clone encoding an IgE-binding protein from Brassica anther has significant sequence similarity to Ca(2+)-binding proteins.

    PubMed

    Toriyama, K; Okada, T; Watanabe, M; Ide, T; Ashida, T; Xu, H; Singh, M B

    1995-12-01

    Thirteen cDNA clones encoding IgE-binding proteins were isolated from expression libraries of anthers of Brassica rapa L. and B. napus L. using serum IgE from a patient who was specifically allergic to Brassica pollen. These clones were divided into two groups, I and II, based on the sequence similarity. All the group I cDNAs predicted the same protein of 79 amino acids, while the group II predicted a protein of 83 amino acids with microheterogeneity. Both of the deduced amino acid sequences contained two regions with sequence similarity to Ca(2+)-binding sites of Ca(2+)-binding proteins such as calmodulin. However flanking sequences were distinct from that of calmodulin or other Ca(2+)-binding proteins. RNA-gel blot analysis showed the genes of group I and II were preferentially expressed in anthers at the later developmental stage and in mature pollen. The recombinant proteins produced in Escherichia coli was recognized in immunoblot analysis by the IgE of a Brassica pollen allergic patient, but not by the Ige of a non-allergic patient. The cDNA clones reported here, therefore, represent pollen allergens of Brassica species.

  19. Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.

    PubMed

    Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D

    2001-11-01

    Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus. PMID:11551648

  20. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of the bell-ring frog, Buergeria buergeri (family Rhacophoridae).

    PubMed

    Sano, Naomi; Kurabayashi, Atsushi; Fujii, Tamotsu; Yonekawa, Hiromichi; Sumida, Masayuki

    2004-06-01

    In this study we determined the complete nucleotide sequence (19,959 bp) of the mitochondrial DNA of the rhacophorid frog Buergeria buergeri. The gene content, nucleotide composition, and codon usage of B. buergeri conformed to those of typical vertebrate patterns. However, due to an accumulation of lengthy repetitive sequences in the D-loop region, this species possesses the largest mitochondrial genome among all the vertebrates examined so far. Comparison of the gene organizations among amphibian species (Rana, Xenopus, salamanders and caecilians) revealed that the positioning of four tRNA genes and the ND5 gene in the mtDNA of B. buergeri diverged from the common vertebrate gene arrangement shared by Xenopus, salamanders and caecilians. The unique positions of the tRNA genes in B. buergeri are shared by ranid frogs, indicating that the rearrangements of the tRNA genes occurred in a common ancestral lineage of ranids and rhacophorids. On the other hand, the novel position of the ND5 gene seems to have arisen in a lineage leading to rhacophorids (and other closely related taxa) after ranid divergence. Phylogenetic analysis based on nucleotide sequence data of all mitochondrial genes also supported the gene rearrangement pathway.

  1. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of the bell-ring frog, Buergeria buergeri (family Rhacophoridae).

    PubMed

    Sano, Naomi; Kurabayashi, Atsushi; Fujii, Tamotsu; Yonekawa, Hiromichi; Sumida, Masayuki

    2004-06-01

    In this study we determined the complete nucleotide sequence (19,959 bp) of the mitochondrial DNA of the rhacophorid frog Buergeria buergeri. The gene content, nucleotide composition, and codon usage of B. buergeri conformed to those of typical vertebrate patterns. However, due to an accumulation of lengthy repetitive sequences in the D-loop region, this species possesses the largest mitochondrial genome among all the vertebrates examined so far. Comparison of the gene organizations among amphibian species (Rana, Xenopus, salamanders and caecilians) revealed that the positioning of four tRNA genes and the ND5 gene in the mtDNA of B. buergeri diverged from the common vertebrate gene arrangement shared by Xenopus, salamanders and caecilians. The unique positions of the tRNA genes in B. buergeri are shared by ranid frogs, indicating that the rearrangements of the tRNA genes occurred in a common ancestral lineage of ranids and rhacophorids. On the other hand, the novel position of the ND5 gene seems to have arisen in a lineage leading to rhacophorids (and other closely related taxa) after ranid divergence. Phylogenetic analysis based on nucleotide sequence data of all mitochondrial genes also supported the gene rearrangement pathway. PMID:15329496

  2. The nucleotide sequences of 5S rRNAs from a sea-cucumber, a starfish and a sea-urchin.

    PubMed Central

    Ohama, T; Hori, H; Osawa, S

    1983-01-01

    The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to those of vertebrates (82% identity on average). PMID:6878041

  3. Molecular characterization of the body site-specific human epidermal cytokeratin 9: cDNA cloning, amino acid sequence, and tissue specificity of gene expression.

    PubMed

    Langbein, L; Heid, H W; Moll, I; Franke, W W

    1993-12-01

    Differentiation of human plantar and palmar epidermis is characterized by the suprabasal synthesis of a major special intermediate-sized filament (IF) protein, the type I (acidic) cytokeratin 9 (CK 9). Using partial amino acid (aa) sequence information obtained by direct Edman sequencing of peptides resulting from proteolytic digestion of purified CK 9, we synthesized several redundant primers by 'back-translation'. Amplification by polymerase chain reaction (PCR) of cDNAs obtained by reverse transcription of mRNAs from human foot sole epidermis, including 5'-primer extension, resulted in multiple overlapping cDNA clones, from which the complete cDNA (2353 bp) could be constructed. This cDNA encoded the CK 9 polypeptide with a calculated molecular weight of 61,987 and an isoelectric point at about pH 5.0. The aa sequence deduced from cDNA was verified in several parts by comparison with the peptide sequences and showed the typical structure of type I CKs, with a head (153 aa), and alpha-helical coiled-coil-forming rod (306 aa), and a tail (163 aa) domain. The protein displayed the highest homology to human CK 10, not only in the highly conserved rod domain but also in large parts of the head and the tail domains. On the other hand, the aa sequence revealed some remarkable differences from CK 10 and other CKs, even in the most conserved segments of the rod domain. The nuclease digestion pattern seen on Southern blot analysis of human genomic DNA indicated the existence of a unique CK 9 gene. Using CK 9-specific riboprobes for hybridization on Northern blots of RNAs from various epithelia, a mRNA of about 2.4 kb in length could be identified only in foot sole epidermis, and a weaker cross-hybridization signal was seen in RNA from bovine heel pad epidermis at about 2.0 kb. A large number of tissues and cell cultures were examined by PCR of mRNA-derived cDNAs, using CK 9-specific primers. But even with this very sensitive signal amplification, only palmar

  4. Human {gamma}-aminobutyraldehyde dehydrogenase (ALDH9): cDNA sequence, genomic organization, polymorphism, chromosomal localization, and tissue expression

    SciTech Connect

    Lin, S.W.; Chen, J.C.; Hsu, L.C.

    1996-06-15

    The cDNA and the gene (ALDH9) for a human aldehyde dehydrogenase isozyme, which has a high activity for oxidation of {gamma}-aminobutyraldehyde and other amino aldehydes, were cloned and characterized. The cDNA has an open reading frame of 1479 bp encoding 493 amino acid residues. The gene is about 45 kb and consists of 10 coding exons interrupted by nine introns. The gene was assigned to chromosome 1q22-q23, using fluorescence in situ hybridization. Northern blot hybridization indicated that the size of the mRNA is about 2.4 kb and that the gene is expressed at high levels in adult liver, skeletal muscle, and kidney and low levels in heart, pancreas, lung, and brain. The gene is polymorphic, i.e., C or T at nt 327 and C or G at nt 344. 17 refs., 4 figs., 1 tab.

  5. Palindrome analyser - A new web-based server for predicting and evaluating inverted repeats in nucleotide sequences.

    PubMed

    Brázda, Václav; Kolomazník, Jan; Lýsek, Jiří; Hároníková, Lucia; Coufal, Jan; Št'astný, Jiří

    2016-09-30

    DNA cruciform structures play an important role in the regulation of natural processes including gene replication and expression, as well as nucleosome structure and recombination. They have also been implicated in the evolution and development of diseases such as cancer and neurodegenerative disorders. Cruciform structures are formed by inverted repeats, and their stability is enhanced by DNA supercoiling and protein binding. They have received broad attention because of their important roles in biology. Computational approaches to study inverted repeats have allowed detailed analysis of genomes. However, currently there are no easily accessible and user-friendly tools that can analyse inverted repeats, especially among long nucleotide sequences. We have developed a web-based server, Palindrome analyser, which is a user-friendly application for analysing inverted repeats in various DNA (or RNA) sequences including genome sequences and oligonucleotides. It allows users to search and retrieve desired gene/nucleotide sequence entries from the NCBI databases, and provides data on length, sequence, locations and energy required for cruciform formation. Palindrome analyser also features an interactive graphical data representation of the distribution of the inverted repeats, with options for sorting according to the length of inverted repeat, length of loop, and number of mismatches. Palindrome analyser can be accessed at http://bioinformatics.ibp.cz.

  6. Testing evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences.

    PubMed

    Garcia-Mazcorro, Jose F

    2013-09-01

    The 16S rRNA gene has been widely used as a marker of gut bacterial diversity and phylogeny, yet we do not know the model of evolution that best explains the differences in its nucleotide composition within and among taxa. Over 46 000 good-quality near-full-length 16S rRNA gene sequences from five bacterial phyla were obtained from the ribosomal database project (RDP) by study and, when possible, by within-study characteristics (e.g. anatomical region). Using alignments (RDPX and MUSCLE) of unique sequences, the FINDMODEL tool available at http://www.hiv.lanl.gov/ was utilized to find the model of character evolution (28 models were available) that best describes the input sequence data, based on the Akaike information criterion. The results showed variable levels of agreement (from 33% to 100%) in the chosen models between the RDP-based and the MUSCLE-based alignments among the taxa. Moreover, subgroups of sequences (using either alignment method) from the same study were often explained by different models. Nonetheless, the different representatives of the gut microbiota were explained by different proportions of the available models. This is the first report using evolutionary models to explain the process of nucleotide substitution in gut bacterial 16S rRNA gene sequences. PMID:23808388

  7. MoD Tools: regulatory motif discovery in nucleotide sequences from co-regulated or homologous genes.

    PubMed

    Pavesi, Giulio; Mereghetti, Paolo; Zambelli, Federico; Stefani, Marco; Mauri, Giancarlo; Pesole, Graziano

    2006-07-01

    Understanding the complex mechanisms regulating gene expression at the transcriptional and post-transcriptional levels is one of the greatest challenges of the post-genomic era. The MoD (MOtif Discovery) Tools web server comprises a set of tools for the discovery of novel conserved sequence and structure motifs in nucleotide sequences, motifs that in turn are good candidates for regulatory activity. The server includes the following programs: Weeder, for the discovery of conserved transcription factor binding sites (TFBSs) in nucleotide sequences from co-regulated genes; WeederH, for the discovery of conserved TFBSs and distal regulatory modules in sequences from homologous genes; RNAProfile, for the discovery of conserved secondary structure motifs in unaligned RNA sequences whose secondary structure is not known. In this way, a given gene can be compared with other co-regulated genes or with its homologs, or its mRNA can be analyzed for conserved motifs regulating its post-transcriptional fate. The web server thus provides researchers with different strategies and methods to investigate the regulation of gene expression, at both the transcriptional and post-transcriptional levels. Available at http://www.pesolelab.it/modtools/ and http://www.beacon.unimi.it/modtools/.

  8. Palindrome analyser - A new web-based server for predicting and evaluating inverted repeats in nucleotide sequences.

    PubMed

    Brázda, Václav; Kolomazník, Jan; Lýsek, Jiří; Hároníková, Lucia; Coufal, Jan; Št'astný, Jiří

    2016-09-30

    DNA cruciform structures play an important role in the regulation of natural processes including gene replication and expression, as well as nucleosome structure and recombination. They have also been implicated in the evolution and development of diseases such as cancer and neurodegenerative disorders. Cruciform structures are formed by inverted repeats, and their stability is enhanced by DNA supercoiling and protein binding. They have received broad attention because of their important roles in biology. Computational approaches to study inverted repeats have allowed detailed analysis of genomes. However, currently there are no easily accessible and user-friendly tools that can analyse inverted repeats, especially among long nucleotide sequences. We have developed a web-based server, Palindrome analyser, which is a user-friendly application for analysing inverted repeats in various DNA (or RNA) sequences including genome sequences and oligonucleotides. It allows users to search and retrieve desired gene/nucleotide sequence entries from the NCBI databases, and provides data on length, sequence, locations and energy required for cruciform formation. Palindrome analyser also features an interactive graphical data representation of the distribution of the inverted repeats, with options for sorting according to the length of inverted repeat, length of loop, and number of mismatches. Palindrome analyser can be accessed at http://bioinformatics.ibp.cz. PMID:27603574

  9. The human beta-subunit of rod photoreceptor cGMP phosphodiesterase: complete retinal cDNA sequence and evidence for expression in brain.

    PubMed

    Collins, C; Hutchinson, G; Kowbel, D; Riess, O; Weber, B; Hayden, M R

    1992-07-01

    We have identified and sequenced cDNA clones that encode for the human beta-subunit of rod cGMP phosphodiesterase (PDEB). A single 2565-bp open reading frame that codes for an 854-amino-acid protein was identified. The human beta-subunit protein is 90% identical to the bovine beta-subunit and 91% identical to the mouse protein. Northern blot analysis indicates that the gene is expressed as an abundant 3.5-kb transcript in retina and as a rare 2.9-kb transcript in brain. The isolation of cDNAs from human brain cDNA libraries confirms the brain as a site of expression for this gene. The molecular defect underlying retinal degeneration in the rd mouse has been found to be a nonsense mutation in the beta-subunit of the mouse cGMP PDE, resulting in a truncated protein (Pittler et al., 1991b, Proc. Natl. Acad. Sci. USA. 88: 8322-8326). The molecular cloning of the cDNA encoding for the PDEB represents the first step in establishing whether this gene plays a causative role in any one of the several human hereditary retinopathies or, based on its localization to chromosome 4p 16.3, in the pathogenesis of Huntington disease.

  10. Identification of two suites of cyclotide precursor genes from metallophyte Viola baoshanensis: cDNA sequence variation, alternative RNA splicing and potential cyclotide diversity.

    PubMed

    Zhang, Jun; Liao, Bin; Craik, David J; Li, Jin-Tian; Hu, Min; Shu, Wen-Sheng

    2009-02-15

    Cyclotides are a novel family of plant-derived defense peptides that are biosynthetically produced via the processing of cyclotide precursor (CP) proteins containing one, two or three cyclotide domains. By screening a cDNA library of Viola baoshanensis roots and using RACE and RT-PCR methods, 23 cDNA clones were identified and then used to deduce full CP proteins containing one (VbCP1S-5), two (VbCP6S), or three (VbCP7S) cyclotide domains. RT-PCR and sequence analyses suggested that VbCP6S were resulted from the alternative splicing of VbCP7S RNA. The significance of VbCP7S RNA splicing is that it provides a mechanism for increasing the diversity of cyclotide expression via the recombination of N-terminal repeat (NTR) regions and cyclotide domains. After analyzing the full endoplasmic reticulum (ER) signals of known and novel CPs associated with RT-PCR tests, three primers encoding the conserved sequence ALVLIATFA, AAFALPA-LA and AAFALPA-AFA were proposed to be more efficient in cloning CP genes than the well-applied primer encoding AAFALPA. Cyclotide sequence analyses indicated that the cDNA clones encoded a variety of Möbius and bracelet cyclotides, which were likely involved in the known bioactivities of cyclotides, and also might play a previously unreported role in mediating the metal tolerance of V. baoshanensis. Overall, this study shows that CP genes are varied in V. baoshanensis and cyclotide expression is subject to transcriptional and post-transcriptional regulation in this plant.

  11. Identification and characterization of a novel legume-like lectin cDNA sequence from the red marine algae Gracilaria fisheri.

    PubMed

    Suttisrisung, Sukanya; Senapin, Saengchan; Withyachumnarnkul, Boonsirm; Wongprasert, Kanokpan

    2011-12-01

    A legume-type lectin (L-Lectin) gene of the red algae Gracilaria fisheri (GFL) was cloned by rapid amplification of cDNA ends (RACE). The full-length cDNA of GFL was 1714 bp and contained a 1542 bp open reading frame encoding 513 amino acids with a predicted molecular mass of 56.5 kDa. Analysis of the putative amino acid sequence with NCBI-BLAST revealed a high homology (30-68%) with legume-type lectins (L-lectin) from Griffithsia japonica, Clavispora lusitaniae, Acyrthosiphon pisum, Tetraodon nigroviridis and Xenopus tropicalis. Phylogenetic relationship analysis showed the highest sequence identity to a glycoprotein of the red algae Griffithsia japonica (68%) (GenBank number AAM93989). Conserved Domain Database analysis detected an N-terminal carbohydrate recognition domain (CRD), the characteristic of L-lectins, which contained two sugar binding sites and a metal binding site. The secondary structure prediction of GFL showed a beta-sheet structure, connected with turn and coil. The most abundant structural element of GFL was the random coil, while the alpha-helixes were distributed at the N- and C-termini, and 21 beta-sheets were distributed in the CRD. Computer analysis of three-dimensional structure showed a common feature of L-lectins of GFL, which included an overall globular shape that was composed of a beta-sandwich of two anti-parallel beta-sheets, monosaccharide binding sites, were on the top of the structure and in proximity with a metal binding site. Northern blot analysis using a DIG-labelled probe derived from a partial GFL sequence revealed a hybridization signal of (approx.) 1.7 kb consistent with the length of the full-length GFL cDNA identified by RACE. No detectable band was observed from control total RNA extracted from filamentous green algae.

  12. SMRT Sequencing of Long Tandem Nucleotide Repeats in SCA10 Reveals Unique Insight of Repeat Expansion Structure

    PubMed Central

    Landrian, Ivette; Godiska, Ronald; Shanker, Savita; Yu, Fahong; Farmerie, William G.; Ashizawa, Tetsuo

    2015-01-01

    A large, non-coding ATTCT repeat expansion causes the neurodegenerative disorder, spinocerebellar ataxia type 10 (SCA10). In a subset of SCA10 patients, interruption motifs are present at the 5’ end of the expansion and strongly correlate with epileptic seizures. Thus, interruption motifs are a predictor of the epileptic phenotype and are hypothesized to act as a phenotypic modifier in SCA10. Yet, the exact internal sequence structure of SCA10 expansions remains unknown due to limitations in current technologies for sequencing across long extended tracts of tandem nucleotide repeats. We used the third generation sequencing technology, Single Molecule Real Time (SMRT) sequencing, to obtain full-length contiguous expansion sequences, ranging from 2.5 to 4.4 kb in length, from three SCA10 patients with different clinical presentations. We obtained sequence spanning the entire length of the expansion and identified the structure of known and novel interruption motifs within the SCA10 expansion. The exact interruption patterns in expanded SCA10 alleles will allow us to further investigate the potential contributions of these interrupting sequences to the pathogenic modification leading to the epilepsy phenotype in SCA10. Our results also demonstrate that SMRT sequencing is useful for deciphering long tandem repeats that pose as “gaps” in the human genome sequence. PMID:26295943

  13. Nucleotide sequence variation of the VP7 gene of two G3-type rotaviruses isolated from dogs.

    PubMed

    Martella, V; Pratelli, A; Greco, G; Gentile, M; Fiorente, P; Tempesta, M; Buonavoglia, C

    2001-04-01

    The sequence of the VP7 gene of two rotaviruses isolated from dogs in southern Italy was determined and the inferred amino acid sequence was compared with that of other rotavirus strains. There was very high nucleotide and amino acid identity between canine strain RV198/95 and other canine strains, and to the human strain HCR3A. Strain RV52/96, however, was found to have about 95% identity to the G3 serotype canine strains K9, A79-10 and CU-1 and 96% identity to strain RV198/95 and to the simian strain RRV. Therefore both of the canine strains belong to the G3 serotype. Nevertheless, detailed analysis of the VP7 variable regions revealed that RV52/96 possesses amino acid substitutions uncommon to the other canine isolates. In addition, strain RV52/96 exhibited a nucleotide divergence greater than 16% from all the other canine strains studied; however, it revealed the closest identity (90.4%) to the simian strain RRV. With only a few exceptions, phylogenetic analysis allowed clear differentiation of the G3 rotaviruses on the basis of the species of origin. The nucleotide and amino acid variations observed in strain RV52/96 could account for the existence of a canine rotavirus G3 sub-type. PMID:11226570

  14. Nucleotide sequences and mutations of the 5'-nontranslated region (5'NTR) of natural isolates of an epidemic echovirus 11' (prime).

    PubMed

    Szendrõi, A; El-Sageyer, M; Takács, M; Mezey, I; Berencsi, G

    2000-01-01

    An echovirus 11' (prime) virus caused an epidemic in Hungary in 1989. The leading clinical form of the diseases was myocarditis. Hemorrhagic hepatitis syndroms were also caused, however, with lethal outcome in 13 newborn babies. Altogether 386 children suffered from registered clinical disease. No accumulation of serous meningitis cases and intrauterine death were observed during the epidemic, and the monovalent oral poliovirus vaccination campaign has prevented the further circulation of the virus. The 5'-nontranslated region (5'-NTR) of 12 natural isolates were sequenced (nucleotides: 260-577). The 5'-NTR was found to be different from that of the prototype Gregory strain (X80059) of EV11 (less than 90% identity), but related to the swine vesicular disease virus (D16364) SVDV and EV9 (X92886) as indicated by the best fitting dendogram. The examination of the variable nucleotides in the internal ribosomal entry site (IRES) revealed, that the nucleotide sequence of a region of the epidemic 5'-NTR was identical to that of coxsackievirus B2. Five of the epidemic isolates were found to carry mutations. Seven EV11' IRES elements possessed identical sequences indicating, that the virus has evolved before its arrival to Hungary. The comparative examination of the suboptimal secondary structures revealed, that no one of the mutations affected the secondary structure of stem-loop structures IV and V in the IRES elements. Although it has been shown previously, that the echovirus group is genetically coherent and related to coxsackie B viruses the sequence differences in the epidemic isolates resulted in profound modification of the central stem (residues 477-529) of stem-loop structure No.V known to be affecting neurovirulence of polioviruses. Two alternate cloverleaf (stem-loop) structures were also recognised (nucleotides 376 to 460 and 540 to 565) which seem to mask both regions of the IRES element complementary to the 3'-end of the 18 S rRNA (460 to 466 and 561 to 570

  15. A combined de novo protein sequencing and cDNA library approach to the venomic analysis of Chinese spider Araneus ventricosus.

    PubMed

    Duan, Zhigui; Cao, Rui; Jiang, Liping; Liang, Songping

    2013-01-14

    In past years, spider venoms have attracted increasing attention due to their extraordinary chemical and pharmacological diversity. The recently popularized proteomic method highly improved our ability to analyze the proteins in the venom. However, the lack of information about isolated venom proteins sequences dramatically limits the ability to confidently identify venom proteins. In the present paper, the venom from Araneus ventricosus was analyzed using two complementary approaches: 2-DE/Shotgun-LC-MS/MS coupled to MASCOT search and 2-DE/Shotgun-LC-MS/MS coupled to manual de novo sequencing followed by local venom protein database (LVPD) search. The LVPD was constructed with toxin-like protein sequences obtained from the analysis of cDNA library from A. ventricosus venom glands. Our results indicate that a total of 130 toxin-like protein sequences were unambiguously identified by manual de novo sequencing coupled to LVPD search, accounting for 86.67% of all toxin-like proteins in LVPD. Thus manual de novo sequencing coupled to LVPD search was proved an extremely effective approach for the analysis of venom proteins. In addition, the approach displays impeccable advantage in validating mutant positions of isoforms from the same toxin-like family. Intriguingly, methyl esterifcation of glutamic acid was discovered for the first time in animal venom proteins by manual de novo sequencing.

  16. cDNA cloning and immunological characterization of the rye grass allergen Lol p I.

    PubMed

    Perez, M; Ishioka, G Y; Walker, L E; Chesnut, R W

    1990-09-25

    The complete amino acid sequence of two "isoallergenic" forms of Lol p I, the major rye grass (Lolium perenne) pollen allergen, was deduced from cDNA sequence analysis. cDNA clones isolated from a Lolium perenne pollen library contained an open reading frame coding for a 240-amino acid protein. Comparison of the nucleotide and deduced amino acid sequence of two of these clones revealed four changes at the amino acid level and numerous nucleotide differences. Both clones contained one possible asparagine-linked glycosylation site. Northern blot analysis shows one RNA species of 1.2 kilobases. Based on the complete amino acid sequence of Lol p I, overlapping peptides covering the entire molecule were synthesized. Utilizing these peptides we have identified a determinant within the Lol p I molecule that is recognized by human leukocyte antigen class II-restricted T cells obtained from persons allergic to rye grass pollen.

  17. An Interpretation of the Ancestral Codon from Miller’s Amino Acids and Nucleotide Correlations in Modern Coding Sequences

    PubMed Central

    Carels, Nicolas; de Leon, Miguel Ponce

    2015-01-01

    Purine bias, which is usually referred to as an “ancestral codon”, is known to result in short-range correlations between nucleotides in coding sequences, and it is common in all species. We demonstrate that RWY is a more appropriate pattern than the classical RNY, and purine bias (Rrr) is the product of a network of nucleotide compensations induced by functional constraints on the physicochemical properties of proteins. Through deductions from universal correlation properties, we also demonstrate that amino acids from Miller’s spark discharge experiment are compatible with functional primeval proteins at the dawn of living cell radiation on earth. These amino acids match the hydropathy and secondary structures of modern proteins. PMID:25922573

  18. Construction of a full-length enriched cDNA library and preliminary analysis of expressed sequence tags from Bengal Tiger Panthera tigris tigris.

    PubMed

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-01-01

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105

  19. Construction of a full-length enriched cDNA library and preliminary analysis of expressed sequence tags from Bengal Tiger Panthera tigris tigris.

    PubMed

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-05-24

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.

  20. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    PubMed Central

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-01-01

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105