Sample records for cdna sequences obtained

  1. [Cloning and sequence analysis of full-length cDNA of secoisolariciresinol dehydrogenase of Dysosma versipellis].

    PubMed

    Xu, Li; Ding, Zhi-Shan; Zhou, Yun-Kai; Tao, Xue-Fen

    2009-06-01

    To obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis by RACE PCR,then investigate the character of Secoisolariciresinol Dehydrogenase gene. The full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene was obtained by 3'-RACE and 5'-RACE from Dysosma versipellis. We first reported the full cDNA sequences of Secoisolariciresinol Dehydrogenase in Dysosma versipellis. The acquired gene was 991bp in full length, including 5' untranslated region of 42bp, 3' untranslated region of 112bp with Poly (A). The open reading frame (ORF) encoding 278 amino acid with molecular weight 29253.3 Daltons and isolectric point 6.328. The gene accession nucleotide sequence number in GeneBank was EU573789. Semi-quantitative RT-PCR analysis revealed that the Secoisolariciresinol Dehydrogenase gene was highly expressed in stem. Alignment of the amino acid sequence of Secoisolariciresinol Dehydrogenase indicated there may be some significant amino acid sequence difference among different species. Obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis.

  2. [cDNA library construction from panicle meristem of finger millet].

    PubMed

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  3. Integrating De Novo Transcriptome Assembly and Cloning to Obtain Chicken Ovocleidin-17 Full-Length cDNA

    PubMed Central

    Ning, ZhongHua; Hincke, Maxwell T.; Yang, Ning; Hou, ZhuoCheng

    2014-01-01

    Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not ‘finished’. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences. PMID:24676480

  4. Integrating de novo transcriptome assembly and cloning to obtain chicken Ovocleidin-17 full-length cDNA.

    PubMed

    Zhang, Quan; Liu, Long; Zhu, Feng; Ning, ZhongHua; Hincke, Maxwell T; Yang, Ning; Hou, ZhuoCheng

    2014-01-01

    Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not 'finished'. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences.

  5. Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

    PubMed

    Saito, T; Ochiai, H

    1999-10-01

    cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

  6. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  7. cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

    PubMed

    Huang, Shengbing; Song, Wei; Lin, Qishui

    2005-08-01

    A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

  8. HUNT: launch of a full-length cDNA database from the Helix Research Institute.

    PubMed

    Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

    2001-01-01

    The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

  9. Cloning and expression of cDNA coding for bouganin.

    PubMed

    den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

    2002-03-01

    Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

  10. The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

    PubMed

    Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

    1990-01-05

    We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

  11. Purification, characterization and molecular cloning of chymotrypsin inhibitor peptides from the venom of Burmese Daboia russelii siamensis.

    PubMed

    Guo, Chun-Teng; McClean, Stephen; Shaw, Chris; Rao, Ping-Fan; Ye, Ming-Yu; Bjourson, Anthony J

    2013-05-01

    One novel Kunitz BPTI-like peptide designated as BBPTI-1, with chymotrypsin inhibitory activity was identified from the venom of Burmese Daboia russelii siamensis. It was purified by three steps of chromatography including gel filtration, cation exchange and reversed phase. A partial N-terminal sequence of BBPTI-1, HDRPKFCYLPADPGECLAHMRSF was obtained by automated Edman degradation and a Ki value of 4.77nM determined. Cloning of BBPTI-1 including the open reading frame and 3' untranslated region was achieved from cDNA libraries derived from lyophilized venom using a 3' RACE strategy. In addition a cDNA sequence, designated as BBPTI-5, was also obtained. Alignment of cDNA sequences showed that BBPTI-5 exhibited an identical sequence to BBPTI-1 cDNA except for an eight nucleotide deletion in the open reading frame. Gene variations that represented deletions in the BBPTI-5 cDNA resulted in a novel protease inhibitor analog. Amino acid sequence alignment revealed that deduced peptides derived from cloning of their respective precursor cDNAs from libraries showed high similarity and homology with other Kunitz BPTI proteinase inhibitors. BBPTI-1 and BBPTI-5 consist of 60 and 66 amino acid residues respectively, including six conserved cysteine residues. As these peptides have been reported to have influence on the processes of coagulation, fibrinolysis and inflammation, their potential application in biomedical contexts warrants further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Gene discovery in Eimeria tenella by immunoscreening cDNA expression libraries of sporozoites and schizonts with chicken intestinal antibodies.

    PubMed

    Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie

    2003-04-02

    Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.

  13. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution

    PubMed Central

    Modahl, Cassandra M.; Mackessy, Stephen P.

    2016-01-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides access to cDNA sequences in the absence of living specimens, even from commercial venom sources, to evaluate important regional differences in venom composition and to study snake venom protein evolution. PMID:27280639

  14. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  15. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed Central

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

  16. Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomkinson, B.; Jonsson, A-K

    1991-01-01

    Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

  17. Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

    PubMed

    Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

    2004-01-01

    The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

  18. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    PubMed

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  19. Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

    PubMed

    He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

    2004-09-01

    Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.

  20. Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

    PubMed Central

    Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

    2011-01-01

    Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

  1. Molecular characterization and phylogenetic analysis of a yak (Bos grunniens) κ-casein cDNA from lactating mammary gland.

    PubMed

    Bai, W L; Yin, R H; Dou, Q L; Jiang, W Q; Zhao, S J; Ma, Z J; Luo, G B; Zhao, Z H

    2011-04-01

    κ-Casein is one of the major proteins in the milk of mammals. It plays an important role in determining the size and specific function of milk micelles. We have previously identified and characterized a genetic variant of yak κ-casein by evaluating genomic DNA. Here, we isolate and characterize a yak κ-casein cDNA harboring the full-length open reading frame (ORF) from lactating mammary gland. Total RNA was extracted from mammary tissue of lactating female yak, and the κ-casein cDNA were synthesized by RT-PCR technique, then cloned and sequenced. The obtained cDNA of 660-bp contained an ORF sufficient to encode the entire amino acid sequence of κ-casein precursor protein consisting of 190 amino acids with a signal peptide of 21 amino acids. Yak κ-casein has a predicted molecular mass of 19,006.588 Da with a calculated isoelectric point of 7.245. Compared with the corresponding sequences in GenBank of cattle, buffalo, sheep, goat, Arabian camel, horse, and rabbit, yak κ-casein sequence had identity of 64.76-98.78% in cDNA, and identity of 44.79-98.42% and similarity of 53.65-98.42% in deduced amino acids, revealing a high homology with the other livestock species. Based on κ-casein cDNA sequences, the phylogenetic analysis indicated that yak κ-casein had a close relationship with that of cattle. This work might be useful in the genetic engineering researches for yak κ-casein.

  2. The cDNA-derived amino acid sequence of hemoglobin II from Lucina pectinata.

    PubMed

    Torres-Mercado, Elineth; Renta, Jessicca Y; Rodríguez, Yolanda; López-Garriga, Juan; Cadilla, Carmen L

    2003-11-01

    Hemoglobin II from the clam Lucina pectinata is an oxygen-reactive protein with a unique structural organization in the heme pocket involving residues Gln65 (E7), Tyr30 (B10), Phe44 (CD1), and Phe69 (E11). We employed the reverse transcriptase-polymerase chain reaction (RT-PCR) and methods to synthesize various cDNA(HbII). An initial 300-bp cDNA clone was amplified from total RNA by RT-PCR using degenerate oligonucleotides. Gene-specific primers derived from the HbII-partial cDNA sequence were used to obtain the 5' and 3' ends of the cDNA by RACE. The length of the HbII cDNA, estimated from overlapping clones, was approximately 2114 bases. Northern blot analysis revealed that the mRNA size of HbII agrees with the estimated size using cDNA data. The coding region of the full-length HbII cDNA codes for 151 amino acids. The calculated molecular weight of HbII, including the heme group and acetylated N-terminal residue, is 17,654.07 Da.

  3. Rapid in silico cloning of genes using expressed sequence tags (ESTs).

    PubMed

    Gill, R W; Sanseau, P

    2000-01-01

    Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.

  4. An insight into the sialome of the blood-sucking bug Triatoma infestans, a vector of Chagas' disease

    PubMed Central

    Assumpção, Teresa C. F.; Francischetti, Ivo M. B.; Andersen, John F.; Schwarz, Alexandra; Santana, Jaime M.; Ribeiro, José M. C.

    2008-01-01

    Triatoma infestans is a hemiptera, vector of Chagas’ disease, that feeds exclusively on vertebrate blood in all life stages. Hematophagous insects’ salivary glands (SG) produce potent pharmacological compounds that counteract host hemostasis, including anti-clotting, anti-platelet, and vasodilatory molecules. To obtain a further insight into the salivary biochemical and pharmacological complexity of this insect, a cDNA library from its salivary glands was randomly sequenced. Also, salivary proteins were submitted to two dimentional gel (2D-gel) electrophoresis followed by MS analysis. We present the analysis of a set of 1,534 (SG) cDNA sequences, 645 of which coded for proteins of a putative secretory nature. Most salivary proteins described as lipocalins matched peptide sequences obtained from proteomic results. PMID:18207082

  5. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    PubMed

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  6. High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hadano, S.; Ishida, Y.; Tomiyasu, H.

    1994-09-01

    To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

  7. Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

    A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

  8. Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

    PubMed Central

    Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

    1992-01-01

    cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

  9. Structure, organization and expression of common carp (Cyprinus carpio L.) SLP-76 gene.

    PubMed

    Huang, Rong; Sun, Xiao-Feng; Hu, Wei; Wang, Ya-Ping; Guo, Qiong-Lin

    2008-05-01

    SLP-76 is an important member of the SLP-76 family of adapters, and it plays a key role in TCR signaling and T cell function. Partial cDNA sequence of SLP-76 of common carp (Cyprinus carpio L.) was isolated from thymus cDNA library by the method of suppression subtractive hybridization (SSH). Subsequently, the full length cDNA of carp SLP-76 was obtained by means of 3' RACE and 5' RACE, respectively. The full length cDNA of carp SLP-76 was 2007 bp, consisting of a 5'-terminal untranslated region (UTR) of 285 bp, a 3'-terminal UTR of 240 bp, and an open reading frame of 1482 bp. Sequence comparison showed that the deduced amino acid sequence of carp SLP-76 had an overall similarity of 34-73% to that of other species homologues, and it was composed of an NH2-terminal domain, a central proline-rich domain, and a C-terminal SH2 domain. Amino acid sequence analysis indicated the existence of a Gads binding site R-X-X-K, a 10-aa-long sequence which binds to the SH3 domain of LCK in vitro, and three conserved tyrosine-containing sequence in the NH2-terminal domain. Then we used PCR to obtain a genomic DNA which covers the entire coding region of carp SLP-76. In the 9.2k-long genomic sequence, twenty one exons and twenty introns were identified. RT-PCR results showed that carp SLP-76 was expressed predominantly in hematopoietic tissues, and was upregulated in thymus tissue of four-month carp compared to one-year old carp. RT-PCR and virtual northern hybridization results showed that carp SLP-76 was also upregulated in thymus tissue of GH transgenic carp at the age of four-months. These results suggest that the expression level of SLP-76 gene may be related to thymocyte development in teleosts.

  10. Escaping introns in COI through cDNA barcoding of mushrooms: Pleurotus as a test case.

    PubMed

    Avin, Farhat A; Subha, Bhassu; Tan, Yee-Shin; Braukmann, Thomas W A; Vikineswary, Sabaratnam; Hebert, Paul D N

    2017-09-01

    DNA barcoding involves the use of one or more short, standardized DNA fragments for the rapid identification of species. A 648-bp segment near the 5' terminus of the mitochondrial cytochrome c oxidase subunit I (COI) gene has been adopted as the universal DNA barcode for members of the animal kingdom, but its utility in mushrooms is complicated by the frequent occurrence of large introns. As a consequence, ITS has been adopted as the standard DNA barcode marker for mushrooms despite several shortcomings. This study employed newly designed primers coupled with cDNA analysis to examine COI sequence diversity in six species of Pleurotus and compared these results with those for ITS. The ability of the COI gene to discriminate six species of Pleurotus , the commonly cultivated oyster mushroom, was examined by analysis of cDNA. The amplification success, sequence variation within and among species, and the ability to design effective primers was tested. We compared ITS sequences to their COI cDNA counterparts for all isolates. ITS discriminated between all six species, but some sequence results were uninterpretable, because of length variation among ITS copies. By comparison, a complete COI sequences were recovered from all but three individuals of Pleurotus giganteus where only the 5' region was obtained. The COI sequences permitted the resolution of all species when partial data was excluded for P. giganteus . Our results suggest that COI can be a useful barcode marker for mushrooms when cDNA analysis is adopted, permitting identifications in cases where ITS cannot be recovered or where it offers higher resolution when fresh tissue is. The suitability of this approach remains to be confirmed for other mushrooms.

  11. Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).

    PubMed

    Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng

    2013-11-01

    Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

  12. Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

    PubMed

    Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

    1998-08-01

    An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

  13. Cloning of a coconut endosperm cDNA encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase that accepts medium-chain-length substrates.

    PubMed Central

    Knutzon, D S; Lardizabal, K D; Nelsen, J S; Bleibaum, J L; Davies, H M; Metz, J G

    1995-01-01

    Immature coconut (Cocos nucifera) endosperm contains a 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) activity that shows a preference for medium-chain-length fatty acyl-coenzyme A substrates (H.M. Davies, D.J. Hawkins, J.S. Nelsen [1995] Phytochemistry 39:989-996). Beginning with solubilized membrane preparations, we have used chromatographic separations to identify a polypeptide with an apparent molecular mass of 29 kD, whose presence in various column fractions correlates with the acyltransferase activity detected in those same fractions. Amino acid sequence data obtained from several peptides generated from this protein were used to isolate a full-length clone from a coconut endosperm cDNA library. Clone pCGN5503 contains a 1325-bp cDNA insert with an open reading frame encoding a 308-amino acid protein with a calculated molecular mass of 34.8 kD. Comparison of the deduced amino acid sequence of pCGN5503 to sequences in the data banks revealed significant homology to other putative LPAAT sequences. Expression of the coconut cDNA in Escherichia coli conferred upon those cells a novel LPAAT activity whose substrate activity profile matched that of the coconut enzyme. PMID:8552723

  14. Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

    PubMed

    Navarro, B; Daròs, J A; Flores, R

    1998-07-01

    A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

  15. Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

    PubMed

    Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

    1996-08-01

    The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

  16. Isolation and Expression Profile of the Ca2+-Activated Chloride Channel-like Membrane Protein 6 Gene in Xenopus laevis

    PubMed Central

    Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh

    2011-01-01

    To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170

  17. Studies of a biochemical factory: tomato trichome deep expressed sequence tag sequencing and proteomics.

    PubMed

    Schilmiller, Anthony L; Miner, Dennis P; Larson, Matthew; McDowell, Eric; Gang, David R; Wilkerson, Curtis; Last, Robert L

    2010-07-01

    Shotgun proteomics analysis allows hundreds of proteins to be identified and quantified from a single sample at relatively low cost. Extensive DNA sequence information is a prerequisite for shotgun proteomics, and it is ideal to have sequence for the organism being studied rather than from related species or accessions. While this requirement has limited the set of organisms that are candidates for this approach, next generation sequencing technologies make it feasible to obtain deep DNA sequence coverage from any organism. As part of our studies of specialized (secondary) metabolism in tomato (Solanum lycopersicum) trichomes, 454 sequencing of cDNA was combined with shotgun proteomics analyses to obtain in-depth profiles of genes and proteins expressed in leaf and stem glandular trichomes of 3-week-old plants. The expressed sequence tag and proteomics data sets combined with metabolite analysis led to the discovery and characterization of a sesquiterpene synthase that produces beta-caryophyllene and alpha-humulene from E,E-farnesyl diphosphate in trichomes of leaf but not of stem. This analysis demonstrates the utility of combining high-throughput cDNA sequencing with proteomics experiments in a target tissue. These data can be used for dissection of other biochemical processes in these specialized epidermal cells.

  18. Studies of a Biochemical Factory: Tomato Trichome Deep Expressed Sequence Tag Sequencing and Proteomics1[W][OA

    PubMed Central

    Schilmiller, Anthony L.; Miner, Dennis P.; Larson, Matthew; McDowell, Eric; Gang, David R.; Wilkerson, Curtis; Last, Robert L.

    2010-01-01

    Shotgun proteomics analysis allows hundreds of proteins to be identified and quantified from a single sample at relatively low cost. Extensive DNA sequence information is a prerequisite for shotgun proteomics, and it is ideal to have sequence for the organism being studied rather than from related species or accessions. While this requirement has limited the set of organisms that are candidates for this approach, next generation sequencing technologies make it feasible to obtain deep DNA sequence coverage from any organism. As part of our studies of specialized (secondary) metabolism in tomato (Solanum lycopersicum) trichomes, 454 sequencing of cDNA was combined with shotgun proteomics analyses to obtain in-depth profiles of genes and proteins expressed in leaf and stem glandular trichomes of 3-week-old plants. The expressed sequence tag and proteomics data sets combined with metabolite analysis led to the discovery and characterization of a sesquiterpene synthase that produces β-caryophyllene and α-humulene from E,E-farnesyl diphosphate in trichomes of leaf but not of stem. This analysis demonstrates the utility of combining high-throughput cDNA sequencing with proteomics experiments in a target tissue. These data can be used for dissection of other biochemical processes in these specialized epidermal cells. PMID:20431087

  19. The TGA codons are present in the open reading frame of selenoprotein P cDNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hill, K.E.; Lloyd, R.S.; Read, R.

    1991-03-11

    The TGA codon in DNA has been shown to direct incorporation of selenocysteine into protein. Several proteins from bacteria and animals contain selenocysteine in their primary structures. Each of the cDNA clones of these selenoproteins contains one TGA codon in the open reading frame which corresponds to the selenocysteine in the protein. A cDNA clone for selenoprotein P (SeP), obtained from a {gamma}ZAP rat liver library, was sequenced by the dideoxy termination method. The correct reading frame was determined by comparison of the deduced amino acid sequence with the amino acid sequence of several peptides from SeP. Using SeP labelledmore » with {sup 75}Se in vivo, the selenocysteine content of the peptides was verified by the collection of carboxymethylated {sup 77}Se-selenocysteine as it eluted from the amino acid analyzer and determination of the radioactivity contained in the collected samples. Ten TGA codons are present in the open reading frame of the cDNA. Peptide fragmentation studies and the deduced sequence indicate that selenium-rich regions are located close to the carboxy terminus. Nine of the 10 selenocysteines are located in the terminal 26% of the sequence with four in the terminal 15 amino acids. The deduced sequence codes for a protein of 385 amino acids. Cleavage of the signal peptide gives the mature protein with 366 amino acids and a calculated mol wt of 41,052 Da. Searches of PIR and SWISSPROT protein databases revealed no similarity with glutathione peroxidase or other selenoproteins.« less

  20. Horse cDNA clones encoding two MHC class I genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barbis, D.P.; Maher, J.K.; Stanek, J.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  1. JPRS Report, Science and Technology USSR: Life Sciences.

    DTIC Science & Technology

    1990-07-16

    4 1 VETERINARY MEDICINE Primary Structure of RNA Polymerase Gene of Foot-and-Mouth Disease Virus ( FMDV ...neering were used to obtain cDNA corresponding to the Primary Structure of RNA Polymerase Gene of RNA polymerase gene to FMDV A 2 2 , with a map of the...Foot-and-Mouth Disease Virus ( FMDV ) A22 primary nucleotide sequence of the cDNA provided. 18400538F Moscow BIOORGANICHESKA YA Analysis of the data

  2. [Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

    PubMed

    Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

    2016-10-01

    To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

  3. cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

    PubMed

    Simon, J W; Slabas, A R

    1998-09-18

    The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

  4. Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

    PubMed Central

    Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

    1994-01-01

    Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

  5. A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

    PubMed

    Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

    2011-09-01

    Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

  6. Differentially expressed genes of Coptotermes formosanus (Isoptera: Rhinotermitidae) challenged by chemical insecticides.

    PubMed

    Zhang, Yi; Zhao, Yuanyuan; Qiu, Xuehong; Han, Richou

    2013-08-01

    Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae) termites are harmful social insects to wood constructions. The current control methods heavily depend on the chemical insecticides with increasing resistance. Analysis of the differentially expressed genes mediated by chemical insecticides will contribute to the understanding of the termite resistance to chemicals and to the establishment of alternative control measures. In the present article, a full-length cDNA library was constructed from the termites induced by a mixture of commonly used insecticides (0.01% sulfluramid and 0.01% triflumuron) for 24 h, by using the RNA ligase-mediated Rapid Amplification cDNA End method. Fifty-eight differentially expressed clones were obtained by polymerase chain reaction and confirmed by dot-blot hybridization. Forty-six known sequences were obtained, which clustered into 33 unique sequences grouped in 6 contigs and 27 singlets. Sixty-seven percent (22) of the sequences had counterpart genes from other organisms, whereas 33% (11) were undescribed. A Gene Ontology analysis classified 33 unique sequences into different functional categories. In general, most of the differential expression genes were involved in binding and catalytic activity.

  7. A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

    PubMed

    Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

    2000-06-30

    For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

  8. Large-Scale Concatenation cDNA Sequencing

    PubMed Central

    Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

    1997-01-01

    A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

  9. Digital transcriptome profiling using selective hexamer priming for cDNA synthesis.

    PubMed

    Armour, Christopher D; Castle, John C; Chen, Ronghua; Babak, Tomas; Loerch, Patrick; Jackson, Stuart; Shah, Jyoti K; Dey, John; Rohl, Carol A; Johnson, Jason M; Raymond, Christopher K

    2009-09-01

    We developed a procedure for the preparation of whole transcriptome cDNA libraries depleted of ribosomal RNA from only 1 microg of total RNA. The method relies on a collection of short, computationally selected oligonucleotides, called 'not-so-random' (NSR) primers, to obtain full-length, strand-specific representation of nonribosomal RNA transcripts. In this study we validated the technique by profiling human whole brain and universal human reference RNA using ultra-high-throughput sequencing.

  10. Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

    PubMed

    Hu, B; Li, J; Yu, W; Fang, J

    1993-01-01

    Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

  11. Construction and characterization of a normalized cDNA library of Nannochloropsis oculata (Eustigmatophyceae)

    NASA Astrophysics Data System (ADS)

    Yu, Jianzhong; Ma, Xiaolei; Pan, Kehou; Yang, Guanpin; Yu, Wengong

    2010-07-01

    We constructed and characterized a normalized cDNA library of Nannochloropsis oculata CS-179, and obtained 905 nonredundant sequences (NRSs) ranging from 431-1 756 bp in length. Among them, 496 were very similar to nonredundant ones in the GenBank ( E ≤1.0e-05), and 349 ESTs had significant hits with the clusters of eukaryotic orthologous groups (KOG). Bases G and/or C at the third position of codons of 14 amino acid residues suggested a strong bias in the conserved domain of 362 NRSs (>60%). We also identified the unigenes encoding phosphorus and nitrogen transporters, suggesting that N. oculata could efficiently transport and metabolize phosphorus and nitrogen, and recognized the unigenes that involved in biosynthesis and storage of both fatty acids and polyunsaturated fatty acids (PUFAs), which will facilitate the demonstration of eicosapentaenoic acid (EPA) biosynthesis pathway of N. oculata. In comparison with the original cDNA library, the normalized library significantly increased the efficiencies of random sequencing and rarely expressed genes discovering, and decreased the frequency of abundant gene sequences.

  12. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    PubMed

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  13. Identifying active foraminifera in the Sea of Japan using metatranscriptomic approach

    NASA Astrophysics Data System (ADS)

    Lejzerowicz, Franck; Voltsky, Ivan; Pawlowski, Jan

    2013-02-01

    Metagenetics represents an efficient and rapid tool to describe environmental diversity patterns of microbial eukaryotes based on ribosomal DNA sequences. However, the results of metagenetic studies are often biased by the presence of extracellular DNA molecules that are persistent in the environment, especially in deep-sea sediment. As an alternative, short-lived RNA molecules constitute a good proxy for the detection of active species. Here, we used a metatranscriptomic approach based on RNA-derived (cDNA) sequences to study the diversity of the deep-sea benthic foraminifera and compared it to the metagenetic approach. We analyzed 257 ribosomal DNA and cDNA sequences obtained from seven sediments samples collected in the Sea of Japan at depths ranging from 486 to 3665 m. The DNA and RNA-based approaches gave a similar view of the taxonomic composition of foraminiferal assemblage, but differed in some important points. First, the cDNA dataset was dominated by sequences of rotaliids and robertiniids, suggesting that these calcareous species, some of which have been observed in Rose Bengal stained samples, are the most active component of foraminiferal community. Second, the richness of monothalamous (single-chambered) foraminifera was particularly high in DNA extracts from the deepest samples, confirming that this group of foraminifera is abundant but not necessarily very active in the deep-sea sediments. Finally, the high divergence of undetermined sequences in cDNA dataset indicate the limits of our database and lack of knowledge about some active but possibly rare species. Our study demonstrates the capability of the metatranscriptomic approach to detect active foraminiferal species and prompt its use in future high-throughput sequencing-based environmental surveys.

  14. Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

    PubMed

    Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

    1991-08-01

    1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

  15. Characterization of the cDNA coding for rat brain cysteine sulfinate decarboxylase: brain and liver enzymes are identical proteins encoded by two distinct mRNAs.

    PubMed

    Tappaz, M; Bitoun, M; Reymond, I; Sergeant, A

    1999-09-01

    Cysteine sulfinate decarboxylase (CSD) is considered as the rate-limiting enzyme in the biosynthesis of taurine, a possible osmoregulator in brain. Through cloning and sequencing of RT-PCR and RACE-PCR products of rat brain mRNAs, a 2,396-bp cDNA sequence was obtained encoding a protein of 493 amino acids (calculated molecular mass, 55.2 kDa). The corresponding fusion protein showed a substrate specificity similar to that of the endogenous enzyme. The sequence of the encoded protein is identical to that encoded by liver CSD cDNA. Among other characterized amino acid decarboxylases, CSD shows the highest homology (54%) with either isoform of glutamic acid decarboxylase (GAD65 and GAD67). A single mRNA band, approximately 2.5 kb, was detected by northern blot in RNA extracts of brain, liver, and kidney. However, brain and liver CSD cDNA sequences differed in the 5' untranslated region. This indicates two forms of CSD mRNA. Analysis of PCR-amplified products of genomic DNA suggests that the brain form results from the use of a 3' alternative internal splicing site within an exon specifically found in liver CSD mRNA. Through selective RT-PCR the brain form was detected in brain only, whereas the liver form was found in liver and kidney. These results indicate a tissue-specific regulation of CSD genomic expression.

  16. Sequence and structural implications of a bovine corneal keratan sulfate proteoglycan core protein. Protein 37B represents bovine lumican and proteins 37A and 25 are unique

    NASA Technical Reports Server (NTRS)

    Funderburgh, J. L.; Funderburgh, M. L.; Brown, S. J.; Vergnes, J. P.; Hassell, J. R.; Mann, M. M.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    Amino acid sequence from tryptic peptides of three different bovine corneal keratan sulfate proteoglycan (KSPG) core proteins (designated 37A, 37B, and 25) showed similarities to the sequence of a chicken KSPG core protein lumican. Bovine lumican cDNA was isolated from a bovine corneal expression library by screening with chicken lumican cDNA. The bovine cDNA codes for a 342-amino acid protein, M(r) 38,712, containing amino acid sequences identified in the 37B KSPG core protein. The bovine lumican is 68% identical to chicken lumican, with an 83% identity excluding the N-terminal 40 amino acids. Location of 6 cysteine and 4 consensus N-glycosylation sites in the bovine sequence were identical to those in chicken lumican. Bovine lumican had about 50% identity to bovine fibromodulin and 20% identity to bovine decorin and biglycan. About two-thirds of the lumican protein consists of a series of 10 amino acid leucine-rich repeats that occur in regions of calculated high beta-hydrophobic moment, suggesting that the leucine-rich repeats contribute to beta-sheet formation in these proteins. Sequences obtained from 37A and 25 core proteins were absent in bovine lumican, thus predicting a unique primary structure and separate mRNA for each of the three bovine KSPG core proteins.

  17. Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oshima, A.; Kyle, J.W.; Miller, R.D.

    1987-02-01

    The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

  18. Deep sampling of the Palomero maize transcriptome by a high throughput strategy of pyrosequencing.

    PubMed

    Vega-Arreguín, Julio C; Ibarra-Laclette, Enrique; Jiménez-Moraila, Beatriz; Martínez, Octavio; Vielle-Calzada, Jean Philippe; Herrera-Estrella, Luis; Herrera-Estrella, Alfredo

    2009-07-06

    In-depth sequencing analysis has not been able to determine the overall complexity of transcriptional activity of a plant organ or tissue sample. In some cases, deep parallel sequencing of Expressed Sequence Tags (ESTs), although not yet optimized for the sequencing of cDNAs, has represented an efficient procedure for validating gene prediction and estimating overall gene coverage. This approach could be very valuable for complex plant genomes. In addition, little emphasis has been given to efforts aiming at an estimation of the overall transcriptional universe found in a multicellular organism at a specific developmental stage. To explore, in depth, the transcriptional diversity in an ancient maize landrace, we developed a protocol to optimize the sequencing of cDNAs and performed 4 consecutive GS20-454 pyrosequencing runs of a cDNA library obtained from 2 week-old Palomero Toluqueño maize plants. The protocol reported here allowed obtaining over 90% of informative sequences. These GS20-454 runs generated over 1.5 Million reads, representing the largest amount of sequences reported from a single plant cDNA library. A collection of 367,391 quality-filtered reads (30.09 Mb) from a single run was sufficient to identify transcripts corresponding to 34% of public maize ESTs databases; total sequences generated after 4 filtered runs increased this coverage to 50%. Comparisons of all 1.5 Million reads to the Maize Assembled Genomic Islands (MAGIs) provided evidence for the transcriptional activity of 11% of MAGIs. We estimate that 5.67% (86,069 sequences) do not align with public ESTs or annotated genes, potentially representing new maize transcripts. Following the assembly of 74.4% of the reads in 65,493 contigs, real-time PCR of selected genes confirmed a predicted correlation between the abundance of GS20-454 sequences and corresponding levels of gene expression. A protocol was developed that significantly increases the number, length and quality of cDNA reads using massive 454 parallel sequencing. We show that recurrent 454 pyrosequencing of a single cDNA sample is necessary to attain a thorough representation of the transcriptional universe present in maize, that can also be used to estimate transcript abundance of specific genes. This data suggests that the molecular and functional diversity contained in the vast native landraces remains to be explored, and that large-scale transcriptional sequencing of a presumed ancestor of the modern maize varieties represents a valuable approach to characterize the functional diversity of maize for future agricultural and evolutionary studies.

  19. Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

    PubMed

    Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

    2016-08-24

    To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

  20. Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

    PubMed

    Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

    2005-12-02

    cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

  1. Multihormonal induction of hepatic α2u-globulin mRNA as measured by hybridization to complementary DNA

    PubMed Central

    Kurtz, David T.; Feigelson, Philip

    1977-01-01

    A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184

  2. Cloning and sequence analysis of Hemonchus contortus HC58cDNA.

    PubMed

    Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li

    2007-06-01

    The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.

  3. Characterization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish.

    PubMed

    Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B

    2004-03-01

    The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.

  4. Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

    PubMed Central

    Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

    2010-01-01

    Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

  5. Construction and Evaluation of Normalized cDNA Libraries Enriched with Full-Length Sequences for Rapid Discovery of New Genes from Sisal (Agave sisalana Perr.) Different Developmental Stages

    PubMed Central

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-01-01

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing. PMID:23202944

  6. A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

    PubMed

    Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

    2011-11-25

    Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

  7. Germacrene C synthase from Lycopersicon esculentum cv. VFNT Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase

    PubMed Central

    Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney

    1998-01-01

    Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865

  8. Sequence evaluation of four specific cDNA libraries for developmental genomics of sunflower.

    PubMed

    Tamborindeguy, C; Ben, C; Liboz, T; Gentzbittel, L

    2004-04-01

    Four different cDNA libraries were constructed from sunflower protoplasts growing under embryogenic and non-embryogenic conditions: one standard library from each condition and two subtractive libraries in opposite sense. A total of 22,876 cDNA clones were obtained and 4800 ESTs were sequenced, giving rise to 2479 high quality ESTs representing an unigene set of 1502 sequences. This set was compared with ESTs represented in public databases using the programs BLASTN and BLASTX, and its members were classified according to putative function using the catalog in the Kyoto Encyclopedia of Genes and Genomes (KEGG). Some 33% of sequences failed to align with existing plant ESTs and therefore represent putative novel genes. The libraries show a low level of redundancy and, on average, 50% of the present ESTs have not been previously reported for sunflower. Several potentially interesting genes were identified, based on their homology with genes involved in animal zygotic division or plant embryogenesis. We also identified two ESTs that show significantly different levels of expression under embryogenic and non-embryogenic conditions. The libraries described here represent an original and valuable resource for the discovery of yet unknown genes putatively involved in dicot embryogenesis and improving our knowledge of the mechanisms involved in polarity acquisition by plant embryos.

  9. Using single nuclei for RNA-seq to capture the transcriptome of postmortem neurons

    PubMed Central

    Krishnaswami, Suguna Rani; Grindberg, Rashel V; Novotny, Mark; Venepally, Pratap; Lacar, Benjamin; Bhutani, Kunal; Linker, Sara B; Pham, Son; Erwin, Jennifer A; Miller, Jeremy A; Hodge, Rebecca; McCarthy, James K; Kelder, Martin; McCorrison, Jamison; Aevermann, Brian D; Fuertes, Francisco Diez; Scheuermann, Richard H; Lee, Jun; Lein, Ed S; Schork, Nicholas; McConnell, Michael J; Gage, Fred H; Lasken, Roger S

    2016-01-01

    A protocol is described for sequencing the transcriptome of a cell nucleus. Nuclei are isolated from specimens and sorted by FACS, cDNA libraries are constructed and RNA-seq is performed, followed by data analysis. Some steps follow published methods (Smart-seq2 for cDNA synthesis and Nextera XT barcoded library preparation) and are not described in detail here. Previous single-cell approaches for RNA-seq from tissues include cell dissociation using protease treatment at 30 °C, which is known to alter the transcriptome. We isolate nuclei at 4 °C from tissue homogenates, which cause minimal damage. Nuclear transcriptomes can be obtained from postmortem human brain tissue stored at −80 °C, making brain archives accessible for RNA-seq from individual neurons. The method also allows investigation of biological features unique to nuclei, such as enrichment of certain transcripts and precursors of some noncoding RNAs. By following this procedure, it takes about 4 d to construct cDNA libraries that are ready for sequencing. PMID:26890679

  10. Construction of a cDNA library from female adult of Toxocara canis, and analysis of EST and immune-related genes expressions.

    PubMed

    Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin

    2011-10-01

    Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.

  11. Sequence of interleukin-2 isolated from human placental poly A+ RNA: possible role in maintenance of fetal allograft.

    PubMed

    Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J

    1996-02-01

    There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.

  12. Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

    PubMed Central

    LaPolla, R J; Mayne, K M; Davidson, N

    1984-01-01

    A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

  13. [Cloning, sequencing and prokaryotic expression of cDNAs for the antifreeze protein family from the beetle Tenebrio molitor].

    PubMed

    Liu, Zhong-Yuan; Wang, Yun; Lü, Guo-Dong; Wang, Xian-Lei; Zhang, Fu-Chun; Ma, Ji

    2006-12-01

    The partial cDNA sequence coding for the antifreeze proteins in the Tenebrio molitor was obtained by RT-PCR. Sequence analysis revealed nine putative cDNAs with a high degree of homology to Tenebrio molitor antifreeze proteins. The recombinant pGEX-4T-1-tmafp-XJ430 was introduced into E. coli BL21 to induce a GST fusion protein by IPTG. SDS-PAGE of the fusion protein demonstrated that the antifreeze protein migrated at a size of 38 kDa. The immunization was performed by intra-muscular injection of pCDNA3-tmafp-XJ430, and then antiserum was detected by ELISA. The titer of the antibody was 1:2,000. Western blotting analysis showed the antiserum was specific against the antifreeze protein. This finding could lead to further investigation of the properties and function of antifreeze proteins.

  14. Sequence verification as quality-control step for production of cDNA microarrays.

    PubMed

    Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

    2001-07-01

    To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

  15. Amino acid sequence of a trypsin inhibitor from a Spirometra (Spirometra erinaceieuropaei).

    PubMed

    Sanda, A; Uchida, A; Itagaki, T; Kobayashi, H; Inokuchi, N; Koyama, T; Iwama, M; Ohgi, K; Irie, M

    2001-12-01

    A trypsin inhibitor that is highly homologous with bovine pancreatic trypsin inhibitor (BPTI) was co-purified along with RNase from Spirometra (Spirometra erinaceieuropaei). The amino acid sequence of this inhibitor (SETI) and the nucleotide sequence of the cDNA encoding this protein were determined by protein chemistry and gene technology. SETI contains 68 amino acid residues and has a molecular mass of 7,798 Da. SETI has 31 amino acid residues that are identical with BPTI's sequence, including 6 half-cystine and 5 aromatic amino acid residues. The active site Lys residue in BPTI is replaced by an Arg residue in SETI. SETI is an effective inhibitor of trypsin and moderately inhibits a-chymotrypsin, but less inhibits elastase or subtilisin. SETI was expressed by E. coli containing a PelB vector carrying the SETI encoding cDNA; an expression yield of 0.68 mg/l was obtained. The phylogenetic relationship of SETI and the other BPTI-like trypsin inhibitors was analyzed using most likelihood inference methods.

  16. The transcriptome of Spodoptera exigua larvae exposed to different types of microbes.

    PubMed

    Pascual, Laura; Jakubowska, Agata K; Blanca, Jose M; Cañizares, Joaquin; Ferré, Juan; Gloeckner, Gernot; Vogel, Heiko; Herrero, Salvador

    2012-08-01

    We have obtained and characterized the transcriptome of Spodoptera exigua larvae with special emphasis on pathogen-induced genes. In order to obtain a highly representative transcriptome, we have pooled RNA from diverse insect colonies, conditions and tissues. Sequenced cDNA included samples from 3 geographically different colonies. Enrichment of RNA from pathogen-related genes was accomplished by exposing larvae to different pathogenic and non-pathogenic microbial agents such as the bacteria Bacillus thuringiensis, Micrococcus luteus, and Escherichia coli, the yeast Saccharomyces cerevisiae, and the S. exigua nucleopolyhedrovirus (SeMNPV). In addition, to avoid the loss of tissue-specific genes we included cDNA from the midgut, fat body, hemocytes and integument derived from pathogen exposed insects. RNA obtained from the different types of samples was pooled, normalized and sequenced. Analysis of the sequences obtained using the Roche 454 FLX and Sanger methods has allowed the generation of the largest public set of ESTs from S. exigua, including a large group of immune genes, and the identification of an important number of SSR (simple sequence repeats) and SNVs (single nucleotide variants: SNPs and INDELs) with potential use as genetic markers. Moreover, data mining has allowed the discovery of novel RNA viruses with potential influence in the insect population dynamics and the larval interactions with the microbial pesticides that are currently in use for the biological control of this pest. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Isolation of candidate genes of Friedreich`s ataxia on chromosome 9q13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Montermini, L.; Zara, F.; Pandolfo, M.

    1994-09-01

    Friedreich`s ataxia (FRDA) is an autosomal recessive degenerative disease involving the central and peripheral nervous system and the heart. The mutated gene in FRDA has recently been localized within a 450 Kb interval on chromosome 9q13 between the markers D9S202/FR1/FR8. We have been able to confirm such localization for the disease gene by analysis of extended haplotype in consanguineous families. Cases of loss of marker homozygosity, which are likely to be due to ancient recombinations, have been found to involve D9S110, D9S15, and D9S111 on the telomeric side, and FR5 on the centromeric side, while homozygosity was always found formore » a core haplotype including D9S5, FD1, and D9S202. We constructed a YAC contig spanning the region between the telomeric markers and FR5, and cosmids have been obtained from the YACs. In order to isolate transcribed sequences from the FRDA candidate region we are utilizing a combination of approaches, including hybridization of YACs and cosmids to an arrayed human heart cDNA library, cDNA direct selection, and exon amplification. A transcribed sequence near the telomeric end of the region has been isolated by cDNA direct selection using pooled cosmids as genomic template and primary human heart, muscle, brain, liver and placenta cDNAs as cDNA source. We have shown this sequence to be the human equivalent of ZO-2, a tight junction protein previously described in the dog. No mutations of this gene have been found in FRDA subjects. Additional cDNA have recently been isolated and they are currently being evaluated.« less

  18. Evaluation and Adaptation of a Laboratory-Based cDNA Library Preparation Protocol for Retrospective Sequencing of Archived MicroRNAs from up to 35-Year-Old Clinical FFPE Specimens

    PubMed Central

    Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J.; Rohan, Thomas; Ben-Dov, Iddo Z.

    2017-01-01

    Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens. PMID:28335433

  19. Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

    NASA Astrophysics Data System (ADS)

    Qi, Fei; Guo, Huarong; Wang, Jian

    2008-02-01

    Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

  20. The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

    PubMed Central

    2004-01-01

    The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

  1. Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

    PubMed Central

    DeWitt, D L; Smith, W L

    1988-01-01

    Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

  2. Large-Scale Collection and Analysis of Full-Length cDNAs from Brachypodium distachyon and Integration with Pooideae Sequence Resources

    PubMed Central

    Mochida, Keiichi; Uehara-Yamaguchi, Yukiko; Takahashi, Fuminori; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo

    2013-01-01

    A comprehensive collection of full-length cDNAs is essential for correct structural gene annotation and functional analyses of genes. We constructed a mixed full-length cDNA library from 21 different tissues of Brachypodium distachyon Bd21, and obtained 78,163 high quality expressed sequence tags (ESTs) from both ends of ca. 40,000 clones (including 16,079 contigs). We updated gene structure annotations of Brachypodium genes based on full-length cDNA sequences in comparison with the latest publicly available annotations. About 10,000 non-redundant gene models were supported by full-length cDNAs; ca. 6,000 showed some transcription unit modifications. We also found ca. 580 novel gene models, including 362 newly identified in Bd21. Using the updated transcription start sites, we searched a total of 580 plant cis-motifs in the −3 kb promoter regions and determined a genome-wide Brachypodium promoter architecture. Furthermore, we integrated the Brachypodium full-length cDNAs and updated gene structures with available sequence resources in wheat and barley in a web-accessible database, the RIKEN Brachypodium FL cDNA database. The database represents a “one-stop” information resource for all genomic information in the Pooideae, facilitating functional analysis of genes in this model grass plant and seamless knowledge transfer to the Triticeae crops. PMID:24130698

  3. Brain cDNA clone for human cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McTiernan, C.; Adkins, S.; Chatonnet, A.

    1987-10-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

  4. Molecular Cloning and Characterization of Novel Morus alba Germin-Like Protein Gene Which Encodes for a Silkworm Gut Digestion-Resistant Antimicrobial Protein

    PubMed Central

    Patnaik, Bharat Bhusan; Kim, Dong Hyun; Oh, Seung Han; Song, Yong-Su; Chanh, Nguyen Dang Minh; Kim, Jong Sun; Jung, Woo-jin; Saha, Atul Kumar; Bindroo, Bharat Bhushan; Han, Yeon Soo

    2012-01-01

    Background Silkworm fecal matter is considered one of the richest sources of antimicrobial and antiviral protein (substances) and such economically feasible and eco-friendly proteins acting as secondary metabolites from the insect system can be explored for their practical utility in conferring broad spectrum disease resistance against pathogenic microbial specimens. Methodology/Principal Findings Silkworm fecal matter extracts prepared in 0.02 M phosphate buffer saline (pH 7.4), at a temperature of 60°C was subjected to 40% saturated ammonium sulphate precipitation and purified by gel-filtration chromatography (GFC). SDS-PAGE under denaturing conditions showed a single band at about 21.5 kDa. The peak fraction, thus obtained by GFC wastested for homogeneityusing C18reverse-phase high performance liquid chromatography (HPLC). The activity of the purified protein was tested against selected Gram +/− bacteria and phytopathogenic Fusarium species with concentration-dependent inhibitionrelationship. The purified bioactive protein was subjected to matrix-assisted laser desorption and ionization-time of flight mass spectrometry (MALDI-TOF-MS) and N-terminal sequencing by Edman degradation towards its identification. The N-terminal first 18 amino acid sequence following the predicted signal peptide showed homology to plant germin-like proteins (Glp). In order to characterize the full-length gene sequence in detail, the partial cDNA was cloned and sequenced using degenerate primers, followed by 5′- and 3′-rapid amplification of cDNA ends (RACE-PCR). The full-length cDNA sequence composed of 630 bp encoding 209 amino acids and corresponded to germin-like proteins (Glps) involved in plant development and defense. Conclusions/Significance The study reports, characterization of novel Glpbelonging to subfamily 3 from M. alba by the purification of mature active protein from silkworm fecal matter. The N-terminal amino acid sequence of the purified protein was found similar to the deduced amino acid sequence (without the transit peptide sequence) of the full length cDNA from M. alba. PMID:23284650

  5. Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

    PubMed

    Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

    2001-10-31

    Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

  6. Atomic force microscope observation of branching in single transcript molecules derived from human cardiac muscle

    NASA Astrophysics Data System (ADS)

    Reed, Jason; Hsueh, Carlin; Mishra, Bud; Gimzewski, James K.

    2008-09-01

    We have used an atomic force microscope to examine a clinically derived sample of single-molecule gene transcripts, in the form of double-stranded cDNA, (c: complementary) obtained from human cardiac muscle without the use of polymerase chain reaction (PCR) amplification. We observed a log-normal distribution of transcript sizes, with most molecules being in the range of 0.4-7.0 kilobase pairs (kb) or 130-2300 nm in contour length, in accordance with the expected distribution of mRNA (m: messenger) sizes in mammalian cells. We observed novel branching structures not previously known to exist in cDNA, and which could have profound negative effects on traditional analysis of cDNA samples through cloning, PCR and DNA sequencing.

  7. Cloning, in Vitro expression, and novel phylogenetic classification of a channel catfish estrogen receptor

    USGS Publications Warehouse

    Xia, Z.; Patino, R.; Gale, W.L.; Maule, A.G.; Densmore, L.D.

    1999-01-01

    We obtained two channel catfish estrogen receptor (ccER) cDNA from liver of female fish using RT–PCR. The two fragments were identical in sequence except that the smaller one had an out-of-frame deletion in the E domain, suggesting the existence of ccER splice variants. The larger fragment was used to screen a cDNA library from liver of a prepubescent female. A cDNA was obtained that encoded a 581-amino-acid ER with a deduced molecular weight of 63.8 kDa. Extracts of COS-7 cells transfected with ccER cDNA bound estrogen with high affinity (Kd = 4.7 nM) and specificity. Maximum parsimony and Neighbor Joining analyses were used to generate a phylogenetic classification of ccER on the basis of 18 full-length ER sequences. The tree suggested the existence of two major ER branches. One branch contained two clearly divergent clades which included all piscine ER (except Japanese eel ER) and all tetrapod ERα, respectively. The second major branch contained the eel ER and the mammalian ERβ. The high degree of divergence between the eel ER and mammalian ERβ suggested that they also represent distinct piscine and tetrapod ER. These data suggest that ERα and ERβ are present throughout vertebrates and that these two major ER types evolved by duplication of an ancestral ER gene. Sequence alignments with other members of the nuclear hormone receptor superfamily indicated the presence of 8 amino acids in the E domain that align exclusively among ER. Four of these amino acids have not received prior research attention and their function is unknown. The novel finding of putative ER splice variants in a nonmammalian vertebrate and the novel phylogenetic classification of ER offer new perspectives in understanding the diversification and function of ER.

  8. Extending Immunological Profiling in the Gilthead Sea Bream, Sparus aurata, by Enriched cDNA Library Analysis, Microarray Design and Initial Studies upon the Inflammatory Response to PAMPs.

    PubMed

    Boltaña, Sebastian; Castellana, Barbara; Goetz, Giles; Tort, Lluis; Teles, Mariana; Mulero, Victor; Novoa, Beatriz; Figueras, Antonio; Goetz, Frederick W; Gallardo-Escarate, Cristian; Planas, Josep V; Mackenzie, Simon

    2017-02-03

    This study describes the development and validation of an enriched oligonucleotide-microarray platform for Sparus aurata (SAQ) to provide a platform for transcriptomic studies in this species. A transcriptome database was constructed by assembly of gilthead sea bream sequences derived from public repositories of mRNA together with reads from a large collection of expressed sequence tags (EST) from two extensive targeted cDNA libraries characterizing mRNA transcripts regulated by both bacterial and viral challenge. The developed microarray was further validated by analysing monocyte/macrophage activation profiles after challenge with two Gram-negative bacterial pathogen-associated molecular patterns (PAMPs; lipopolysaccharide (LPS) and peptidoglycan (PGN)). Of the approximately 10,000 EST sequenced, we obtained a total of 6837 EST longer than 100 nt, with 3778 and 3059 EST obtained from the bacterial-primed and from the viral-primed cDNA libraries, respectively. Functional classification of contigs from the bacterial- and viral-primed cDNA libraries by Gene Ontology (GO) showed that the top five represented categories were equally represented in the two libraries: metabolism (approximately 24% of the total number of contigs), carrier proteins/membrane transport (approximately 15%), effectors/modulators and cell communication (approximately 11%), nucleoside, nucleotide and nucleic acid metabolism (approximately 7.5%) and intracellular transducers/signal transduction (approximately 5%). Transcriptome analyses using this enriched oligonucleotide platform identified differential shifts in the response to PGN and LPS in macrophage-like cells, highlighting responsive gene-cassettes tightly related to PAMP host recognition. As observed in other fish species, PGN is a powerful activator of the inflammatory response in S. aurata macrophage-like cells. We have developed and validated an oligonucleotide microarray (SAQ) that provides a platform enriched for the study of gene expression in S. aurata with an emphasis upon immunity and the immune response.

  9. Illumina sequencing of green stink bug nymph and adult cdna to identify potential rnai gene targets

    USDA-ARS?s Scientific Manuscript database

    Whole-body transcriptomes for nymphs and adults of the green stink bug, Acrosternum hilare (Say), were sequenced on an Illumina® Genome Analyzer IIx sequencer. The insects were collected from sites in North Carolina and Virginia, USA. The cDNA library for each sample was sequenced on one lane of an...

  10. Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

    PubMed

    Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

    1991-03-01

    We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

  11. A simple and novel method for RNA-seq library preparation of single cell cDNA analysis by hyperactive Tn5 transposase.

    PubMed

    Brouilette, Scott; Kuersten, Scott; Mein, Charles; Bozek, Monika; Terry, Anna; Dias, Kerith-Rae; Bhaw-Rosun, Leena; Shintani, Yasunori; Coppen, Steven; Ikebe, Chiho; Sawhney, Vinit; Campbell, Niall; Kaneko, Masahiro; Tano, Nobuko; Ishida, Hidekazu; Suzuki, Ken; Yashiro, Kenta

    2012-10-01

    Deep sequencing of single cell-derived cDNAs offers novel insights into oncogenesis and embryogenesis. However, traditional library preparation for RNA-seq analysis requires multiple steps with consequent sample loss and stochastic variation at each step significantly affecting output. Thus, a simpler and better protocol is desirable. The recently developed hyperactive Tn5-mediated library preparation, which brings high quality libraries, is likely one of the solutions. Here, we tested the applicability of hyperactive Tn5-mediated library preparation to deep sequencing of single cell cDNA, optimized the protocol, and compared it with the conventional method based on sonication. This new technique does not require any expensive or special equipment, which secures wider availability. A library was constructed from only 100 ng of cDNA, which enables the saving of precious specimens. Only a few steps of robust enzymatic reaction resulted in saved time, enabling more specimens to be prepared at once, and with a more reproducible size distribution among the different specimens. The obtained RNA-seq results were comparable to the conventional method. Thus, this Tn5-mediated preparation is applicable for anyone who aims to carry out deep sequencing for single cell cDNAs. Copyright © 2012 Wiley Periodicals, Inc.

  12. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    PubMed

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  13. Distinct profiles of expressed sequence tags during intestinal regeneration in the sea cucumber Holothuria glaberrima

    PubMed Central

    Rojas-Cartagena, Carmencita; Ortíz-Pineda, Pablo; Ramírez-Gómez, Francisco; Suárez-Castillo, Edna C.; Matos-Cruz, Vanessa; Rodríguez, Carlos; Ortíz-Zuazaga, Humberto; García-Arrarás, José E.

    2010-01-01

    Repair and regeneration are key processes for tissue maintenance, and their disruption may lead to disease states. Little is known about the molecular mechanisms that underline the repair and regeneration of the digestive tract. The sea cucumber Holothuria glaberrima represents an excellent model to dissect and characterize the molecular events during intestinal regeneration. To study the gene expression profile, cDNA libraries were constructed from normal, 3-day, and 7-day regenerating intestines of H. glaberrima. Clones were randomly sequenced and queried against the nonredundant protein database at the National Center for Biotechnology Information. RT-PCR analyses were made of several genes to determine their expression profile during intestinal regeneration. A total of 5,173 sequences from three cDNA libraries were obtained. About 46.2, 35.6, and 26.2% of the sequences for the normal, 3-days, and 7-days cDNA libraries, respectively, shared significant similarity with known sequences in the protein database of GenBank but only present 10% of similarity among them. Analysis of the libraries in terms of functional processes, protein domains, and most common sequences suggests that a differential expression profile is taking place during the regeneration process. Further examination of the expressed sequence tag dataset revealed that 12 putative genes are differentially expressed at significant level (R > 6). Experimental validation by RT-PCR analysis reveals that at least three genes (unknown C-4677-1, melanotransferrin, and centaurin) present a differential expression during regeneration. These findings strongly suggest that the gene expression profile varies among regeneration stages and provide evidence for the existence of differential gene expression. PMID:17579180

  14. Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

    PubMed Central

    2011-01-01

    Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot plants. Codon usages of melon full-length transcripts were largely similar to those of Arabidopsis coding sequences. Conclusion The collection of melon ESTs generated from full-length enriched and standard cDNA libraries is expected to play significant roles in annotating the melon genome. The ESTs and associated analysis results will be useful resources for gene discovery, functional analysis, marker-assisted breeding of melon and closely related species, comparative genomic studies and for gaining insights into gene expression patterns. PMID:21599934

  15. Biosynthesis of Lipoic Acid in Arabidopsis: Cloning and Characterization of the cDNA for Lipoic Acid Synthase1

    PubMed Central

    Yasuno, Rie; Wada, Hajime

    1998-01-01

    Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738

  16. Production of hydroxylated fatty acids in genetically modified plants

    DOEpatents

    Somerville, Chris; Broun, Pierre; van de Loo, Frank

    2001-01-01

    This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants.

  17. Expressed sequence tag analysis of adult human lens for the NEIBank Project: over 2000 non-redundant transcripts, novel genes and splice variants.

    PubMed

    Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

    2002-06-15

    To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.

  18. The Drosophila gene collection: Identification of putative full-length cDNAs for 70 percent of D. melanogaster genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stapleton, Mark; Liao, Guochun; Brokstein, Peter

    2002-08-12

    Collections of full-length nonredundant cDNA clones are critical reagents for functional genomics. The first step toward these resources is the generation and single-pass sequencing of cDNA libraries that contain a high proportion of full-length clones. The first release of the Drosophila Gene Collection Release 1 (DGCr1) was produced from six libraries representing various tissues, developmental stages, and the cultured S2 cell line. Nearly 80,000 random 5prime expressed sequence tags (EST) from these libraries were collapsed into a nonredundant set of 5849 cDNAs, corresponding to {approx}40 percent of the 13,474 predicted genes in Drosophila. To obtain cDNA clones representing the remainingmore » genes, we have generated an additional 157,835 5prime ESTs from two previously existing and three new libraries. One new library is derived from adult testis, a tissue we previously did not exploit for gene discovery; two new cap-trapped normalized libraries are derived from 0-22hr embryos and adult heads. Taking advantage of the annotated D. melanogaster genome sequence, we clustered the ESTs by aligning them to the genome. Clusters that overlap genes not already represented by cDNA clones in the DGCr1 were analyzed further, and putative full-length clones were selected for inclusion in the new DGC. This second release of the DGC (DGCr2) contains 5061 additional clones, extending the collection to 10,910 cDNAs representing >70 percent of the predicted genes in Drosophila.« less

  19. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  20. Comparative 454 pyrosequencing of transcripts from two olive genotypes during fruit development

    PubMed Central

    Alagna, Fiammetta; D'Agostino, Nunzio; Torchia, Laura; Servili, Maurizio; Rao, Rosa; Pietrella, Marco; Giuliano, Giovanni; Chiusano, Maria Luisa; Baldoni, Luciana; Perrotta, Gaetano

    2009-01-01

    Background Despite its primary economic importance, genomic information on olive tree is still lacking. 454 pyrosequencing was used to enrich the very few sequence data currently available for the Olea europaea species and to identify genes involved in expression of fruit quality traits. Results Fruits of Coratina, a widely cultivated variety characterized by a very high phenolic content, and Tendellone, an oleuropein-lacking natural variant, were used as starting material for monitoring the transcriptome. Four different cDNA libraries were sequenced, respectively at the beginning and at the end of drupe development. A total of 261,485 reads were obtained, for an output of about 58 Mb. Raw sequence data were processed using a four step pipeline procedure and data were stored in a relational database with a web interface. Conclusion Massively parallel sequencing of different fruit cDNA collections has provided large scale information about the structure and putative function of gene transcripts accumulated during fruit development. Comparative transcript profiling allowed the identification of differentially expressed genes with potential relevance in regulating the fruit metabolism and phenolic content during ripening. PMID:19709400

  1. Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1

    PubMed Central

    Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.

    2000-01-01

    Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440

  2. Partial characterization of normal and Haemophilus influenzae-infected mucosal complementary DNA libraries in chinchilla middle ear mucosa.

    PubMed

    Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D

    2010-04-01

    We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.

  3. Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

    PubMed Central

    Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

    2010-01-01

    Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

  4. Sequencing, bioinformatic characterization and expression pattern of a putative amino acid transporter from the parasitic cestode Echinococcus granulosus.

    PubMed

    Camicia, Federico; Paredes, Rodolfo; Chalar, Cora; Galanti, Norbel; Kamenetzky, Laura; Gutierrez, Ariana; Rosenzvit, Mara C

    2008-03-31

    We have sequenced and partially characterized an Echinococcus granulosus cDNA, termed egat1, from a protoscolex signal sequence trap (SST) cDNA library. The isolated 1627 bp long cDNA contains an ORF of 489 amino acids and shows an amino acid identity of 30% with neutral and excitatory amino acid transporters members of the Dicarboxylate/Amino Acid Na+ and/or H+ Cation Symporter family (DAACS) (TC 2.A.23). Additional bioinformatics analysis of EgAT1, confirmed the results obtained by similarity searches and showed the presence of 9 to 10 transmembrane domains, consensus sequences for N-glycosylation between the third and fourth transmembrane domain, a highly similar hydropathy profile with ASCT1 (a known member of DAACS family), high score with SDF (Sodium Dicarboxilate Family) and similar motifs with EDTRANSPORT, a fingerprint of excitatory amino acid transporters. The localization of the putative amino acid transporter was analyzed by in situ hybridization and immunofluorescence in protoscoleces and associated germinal layer. The in situ hybridization labelling indicates the distribution of egat1 mRNA throughout the tegument. EgAT1 protein, which showed in Western blots a molecular mass of approximately 60 kD, is localized in the subtegumental region of the metacestode, particularly around suckers and rostellum of protoscoleces and layers from brood capsules. The sequence and expression analyses of EgAT1 pave the way for functional analysis of amino acids transporters of E. granulosus and its evaluation as new drug targets against cystic echinococcosis.

  5. Analysis of beta-carotene hydroxylase gene cDNA isolated from the American oil-palm (Elaeis oleifera) mesocarp tissue cDNA library

    PubMed Central

    Bhore, Subhash J; Kassim, Amelia; Loh, Chye Ying; Shah, Farida H

    2010-01-01

    It is well known that the nutritional quality of the American oil-palm (Elaeis oleifera) mesocarp oil is superior to that of African oil-palm (Elaeis guineensis Jacq. Tenera) mesocarp oil. Therefore, it is of important to identify the genetic features for its superior value. This could be achieved through the genome sequencing of the oil-palm. However, the genome sequence is not available in the public domain due to commercial secrecy. Hence, we constructed a cDNA library and generated expressed sequence tags (3,205) from the mesocarp tissue of the American oil-palm. We continued to annotate each of these cDNAs after submitting to GenBank/DDBJ/EMBL. A rough analysis turned our attention to the beta-carotene hydroxylase (Chyb) enzyme encoding cDNA. Then, we completed the full sequencing of cDNA clone for its both strands using M13 forward and reverse primers. The full nucleotide and protein sequence was further analyzed and annotated using various Bioinformatics tools. The analysis results showed the presence of fatty acid hydroxylase superfamily domain in the protein sequence. The multiple sequence alignment of selected Chyb amino acid sequences from other plant species and algal members with E. oleifera Chyb using ClustalW and its phylogenetic analysis suggest that Chyb from monocotyledonous plant species, Lilium hubrid, Crocus sativus and Zea mays are the most evolutionary related with E. oleifera Chyb. This study reports the annotation of E. oleifera Chyb. Abbreviations ESTs - expressed sequence tags, EoChyb - Elaeis oleifera beta-carotene hydroxylase, MC - main cluster PMID:21364789

  6. Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)

    NASA Technical Reports Server (NTRS)

    Shibata, K.; Abe, S.; Davies, E.

    2001-01-01

    Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.

  7. Expressed sequence tags (ESTs) and phylogenetic analysis of floral genes from a paleoherb species, Asarum caudigerum.

    PubMed

    Zhao, Yinhe; Wang, Guoying; Zhang, Jinpeng; Yang, Junbo; Peng, Shang; Gao, Lianming; Li, Chengyun; Hu, Jinyong; Li, Dezhu; Gao, Lizhi

    2006-07-01

    Asarum caudigerum (Aristolochiaceae) is an important species of paleoherb in relation to understanding the origin and evolution of angiosperm flowers, due to its basal position in the angiosperms. The aim of this study was to isolate floral-related genes from A. caudigerum, and to infer evolutionary relationships among florally expression-related genes, to further illustrate the origin and diversification of flowers in angiosperms. A subtracted floral cDNA library was constructed from floral buds using suppression subtractive hybridization (SSH). The cDNA of floral buds and leaves at the seedling stage were used as a tester and a driver, respectively. To further identify the function of putative MADS-box transcription factors, phylogenetic trees were reconstructed in order to infer evolutionary relationships within the MADS-box gene family. In the forward-subtracted floral cDNA library, 1920 clones were randomly sequenced, from which 567 unique expressed sequence tags (ESTs) were obtained. Among them, 127 genes failed to show significant similarity to any published sequences in GenBank and thus are putatively novel genes. Phylogenetic analysis indicated that a total of 29 MADS-box transcription factors were members of the APETALA3(AP3) subfamily, while nine others were putative MADS-box transcription factors that formed a cluster with MADS-box genes isolated from Amborella, the basal-most angiosperm, and those from the gymnosperms. This suggests that the origin of A. caudigerum is intermediate between the angiosperms and gymnosperms.

  8. Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

    PubMed Central

    Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

    1998-01-01

    Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

  9. Molecular cloning and expression of rat liver bile acid CoA ligase.

    PubMed

    Falany, Charles N; Xie, Xiaowei; Wheeler, James B; Wang, Jin; Smith, Michelle; He, Dongning; Barnes, Stephen

    2002-12-01

    Bile acid CoA ligase (BAL) is responsible for catalyzing the first step in the conjugation of bile acids with amino acids. Sequencing of putative rat liver BAL cDNAs identified a cDNA (rBAL-1) possessing a 51 nucleotide 5'-untranslated region, an open reading frame of 2,070 bases encoding a 690 aa protein with a molecular mass of 75,960 Da, and a 138 nucleotide 3'-nontranslated region followed by a poly(A) tail. Identity of the cDNA was established by: 1) the rBAL-1 open reading frame encoded peptides obtained by chemical sequencing of the purified rBAL protein; 2) expressed rBAL-1 protein comigrated with purified rBAL during SDS-polyacrylamide gel electrophoresis; and 3) rBAL-1 expressed in insect Sf9 cells had enzymatic properties that were comparable to the enzyme isolated from rat liver. Evidence for a relationship between fatty acid and bile acid metabolism is suggested by specific inhibition of rBAL-1 by cis-unsaturated fatty acids and its high homology to a human very long chain fatty acid CoA ligase. In summary, these results indicate that the cDNA for rat liver BAL has been isolated and expression of the rBAL cDNA in insect Sf9 cells results in a catalytically active enzyme capable of utilizing several different bile acids as substrates.

  10. Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

    PubMed

    Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

    2016-10-01

    A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone.

  11. Combined proteomic and molecular approaches for cloning and characterization of copper-zinc superoxide dismutase (Cu, Zn-SOD2) from garlic (Allium sativum).

    PubMed

    Hadji Sfaxi, Imen; Ezzine, Aymen; Coquet, Laurent; Cosette, Pascal; Jouenne, Thierry; Marzouki, M Nejib

    2012-09-01

    Superoxide dismutases (SODs; EC 1.15.1.1) are key enzymes in the cells protection against oxidant agents. Thus, SODs play a major role in the protection of aerobic organisms against oxygen-mediated damages. Three SOD isoforms were previously identified by zymogram staining from Allium sativum bulbs. The purified Cu, Zn-SOD2 shows an antagonist effect to an anticancer drug and alleviate cytotoxicity inside tumor cells lines B16F0 (mouse melanoma cells) and PAE (porcine aortic endothelial cells). To extend the characterization of Allium SODs and their corresponding genes, a proteomic approach was applied involving two-dimensional gel electrophoresis and LC-MS/MS analyses. From peptide sequence data obtained by mass spectrometry and sequences homologies, primers were defined and a cDNA fragment of 456 bp was amplified by RT-PCR. The cDNA nucleotide sequence analysis revealed an open reading frame coding for 152 residues. The deduced amino acid sequence showed high identity (82-87%) with sequences of Cu, Zn-SODs from other plant species. Molecular analysis was achieved by a protein 3D structural model.

  12. 3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

    PubMed

    Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

    2004-01-01

    The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

  13. Chicken immunoglobulin gamma-heavy chains: limited VH gene repertoire, combinatorial diversification by D gene segments and evolution of the heavy chain locus.

    PubMed

    Parvari, R; Avivi, A; Lentner, F; Ziv, E; Tel-Or, S; Burstein, Y; Schechter, I

    1988-03-01

    cDNA clones encoding the variable and constant regions of chicken immunoglobulin (Ig) gamma-chains were obtained from spleen cDNA libraries. Southern blots of kidney DNA show that the variable region sequences of eight cDNA clones reveal the same set of bands corresponding to approximately 30 cross-hybridizing VH genes of one subgroup. Since the VH clones were randomly selected, it is likely that the bulk of chicken H-chains are encoded by a single VH subgroup. Nucleotide sequence determinations of two cDNA clones reveal VH, D, JH and the constant region. The VH segments are closely related to each other (83% homology) as expected for VH or the same subgroup. The JHs are 15 residues long and differ by one amino acid. The Ds differ markedly in sequence (20% homology) and size (10 and 20 residues). These findings strongly indicate multiple (at least two) D genes which by a combinatorial joining mechanism diversify the H-chains, a mechanism which is not operative in the chicken L-chain locus. The most notable among the chicken Igs is the so-called 7S IgG because its H-chain differs in many important aspects from any mammalian IgG. The sequence of the C gamma cDNA reported here resolves this issue. The chicken C gamma is 426 residues long with four CH domains (unlike mammalian C gamma which has three CH domains) and it shows 25% homology to the chicken C mu. The chicken C gamma is most related to the mammalian C epsilon in length, the presence of four CH domains and the distribution of cysteines in the CH1 and CH2 domains. We propose that the unique chicken C gamma is the ancestor of the mammalian C epsilon and C gamma subclasses, and discuss the evolution of the H-chain locus from that of chicken with presumably three genes (mu, gamma, alpha) to the mammalian loci with 8-10 H-chain genes.

  14. Molecular cloning and sequencing of the cDNA and gene for a novel elastinolytic metalloproteinase from Aspergillus fumigatus and its expression in Escherichia coli.

    PubMed Central

    Sirakova, T D; Markaryan, A; Kolattukudy, P E

    1994-01-01

    An extracellular elastinolytic metalloproteinase, purified from Aspergillus fumigatus isolated from an aspergillosis and patient/and an internal peptide derived from it were subjected to N-terminal sequencing. Oligonucleotide primers based on these sequences were used to PCR amplify a segment of the metalloproteinase cDNA, which was used as a probe to isolate the cDNA and gene for this enzyme. The gene sequence matched exactly with the cDNA sequence except for the four introns that interrupted the open reading frame. According to the deduced amino acid sequence, the metalloproteinase has a signal sequence and 227 additional amino acids preceding the sequence for the mature protein of 389 amino acids with a calculated molecular mass of 42 kDa, which is close to the size of the purified mature fungal proteinase. This sequence contains segments that matched both the N terminus of the mature protein and the internal peptide. A. fumigatus metalloproteinase contains some of the conserved zinc-binding and active-site motifs characteristic of metalloproteinases but shows no overall homology with known metalloproteinases. The cDNA of the mature protein when introduced into Escherichia coli directed the expression of a protein with a size, N-terminal sequence, and immunological cross-reactivity identical to those of the native fungal enzyme. Although the enzyme in the inclusion bodies could not be renatured, expression at 30 degrees C yielded soluble enzyme that showed chromatographic behavior identical to that of the native fungal enzyme and catalyzed hydrolysis of elastin. The metalloproteinase gene described here was not found in Aspergillus flavus. Images PMID:7927676

  15. Acetylcholinesterase of the Sand Fly, Phlebotomus papatasi (Scopoli): cDNA Sequence, Baculovirus Expression, and Biochemical Properties

    DTIC Science & Technology

    2013-01-01

    identity to acetylcholinesterase mRNA sequences of Culex tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a...tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a 710-amino acid protein [GenBank: AFP20868] exhibiting 85...improve effectiveness of pesticide application for control of the new world sand fly Lutzomyia longipalpis in chicken sheds [13]. Attempts to control

  16. [Molecular cloning and characterization of a novel Clonorchis sinensis antigenic protein containing tandem repeat sequences].

    PubMed

    Liu, Qian; Xu, Xue-Nian; Zhou, Yan; Cheng, Na; Dong, Yu-Ting; Zheng, Hua-Jun; Zhu, Yong-Qiang; Zhu, Yong-Qiang

    2013-08-01

    To find and clone new antigen genes from the lambda-ZAP cDNA expression library of adult Clonorchis sinensis, and determine the immunological characteristics of the recombinant proteins. The cDNA expression library of adult C. sinensis was screened by pooled sera of clonorchiasis patients. The sequences of the positive phage clones were compared with the sequences in EST database, and the full-length sequence of the gene (Cs22 gene) was obtained by RT-PCR. cDNA fragments containing 2 and 3 times tandem repeat sequences were generated by jumping PCR. The sequence encoding the mature peptide or the tandem repeat sequence was respectively cloned into the prokaryotic expression vector pET28a (+), and then transformed into E. coli Rosetta DE3 cells for expression. The recombinant proteins (rCs22-2r, rCs22-3r, rCs22M-2r, and rCs22M-3r) were purified by His-bind-resin (Ni-NTA) affinity chromatography. The immunogenicity of rCs22-2r and rCs22-3r was identified by ELISA. To evaluate the immunological diagnostic value of rCs22-2r and rCs22-3r, serum samples from 35 clonorchiasis patients, 31 healthy individuals, 15 schistosomiasis patients, 15 paragonimiasis westermani patients and 13 cysticercosis patients were examined by ELISA. To locate antigenic determinants, the pooled sera of clonorchiasis patients and healthy persons were analyzed for specific antibodies by ELISA with recombinant protein rCs22M-2r and rCs22M-3r containing the tandem repeat sequences. The full-length sequence of Cs22 antigen gene of C. sinensis was obtained. It contained 13 times tandem repeat sequences of EQQDGDEEGMGGDGGRGKEKGKVEGEDGAGEQKEQA. Bioinformatics analysis indicated that the protein (Cs22) belonged to GPI-anchored proteins family. The recombinant proteins rCs22-2r and rCs22-3r showed a certain level of immunogenicity. The positive rate by ELISA coated with the purified PrCs22-2r and PrCs22-3r for sera of clonorchiasis patients both were 45.7% (16/35), and 3.2% (1/31) for those of healthy persons. There was no cross reaction with sera of schistosomiasis and cysticercosis patients. The cross reaction with sera of paragonimiasis westermani patients was 1/15. The recombinant proteins rCs22M-2r and rCs22M-3r which only contained tandem repeats were specifically recognized by pooled sera of clonorchiasis patients. The Cs22 antigen gene of Clonorchis sinensis is obtained, and the recombinant proteins have certain diagnostic value. The antigenic determinant is located in tandem repeat sequences.

  17. Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

    PubMed Central

    Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

    1986-01-01

    Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

  18. Is plant mitochondrial RNA editing a source of phylogenetic incongruence? An answer from in silico and in vivo data sets.

    PubMed

    Picardi, Ernesto; Quagliariello, Carla

    2008-03-26

    In plant mitochondria, the post-transcriptional RNA editing process converts C to U at a number of specific sites of the mRNA sequence and usually restores phylogenetically conserved codons and the encoded amino acid residues. Sites undergoing RNA editing evolve at a higher rate than sites not modified by the process. As a result, editing sites strongly affect the evolution of plant mitochondrial genomes, representing an important source of sequence variability and potentially informative characters. To date no clear and convincing evidence has established whether or not editing sites really affect the topology of reconstructed phylogenetic trees. For this reason, we investigated here the effect of RNA editing on the tree building process of twenty different plant mitochondrial gene sequences and by means of computer simulations. Based on our simulation study we suggest that the editing 'noise' in tree topology inference is mainly manifested at the cDNA level. In particular, editing sites tend to confuse tree topologies when artificial genomic and cDNA sequences are generated shorter than 500 bp and with an editing percentage higher than 5.0%. Similar results have been also obtained with genuine plant mitochondrial genes. In this latter instance, indeed, the topology incongruence increases when the editing percentage goes up from about 3.0 to 14.0%. However, when the average gene length is higher than 1,000 bp (rps3, matR and atp1) no differences in the comparison between inferred genomic and cDNA topologies could be detected. Our findings by the here reported in silico and in vivo computer simulation system seem to strongly suggest that editing sites contribute in the generation of misleading phylogenetic trees if the analyzed mitochondrial gene sequence is highly edited (higher than 3.0%) and reduced in length (shorter than 500 bp). In the current lack of direct experimental evidence the results presented here encourage, thus, the use of genomic mitochondrial rather than cDNA sequences for reconstructing phylogenetic events in land plants.

  19. Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

    PubMed Central

    Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

    1987-01-01

    The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

  20. Kinetic Induction of Oat Shoot Pulvinus Invertase mRNA by Gravistimulation and Partial cDNA Cloning by the Polymerase Chain Reaction

    NASA Technical Reports Server (NTRS)

    Wu, Liu-Lai; Song, Il; Karuppiah, Nadarajah; Kaufman, Peter B.

    1993-01-01

    An asymmetric (top vs. bottom halves of pulvini) induction of invertase mRNA by gravistimulation was analyzed in oat shoot pulvini. Total RNA and poly(A)(+) RNA, isolated from oat pulvini, and two oli-gonucleotide primers, corresponding to two conserved amino acid sequences (NDPNG and WECPD) found in invertase from other species, were used for the polymerase chain reaction (PCR). A partial length cDNA (550 bp) was obtained and characterized. A 62% nucleotide sequence homology and 58% deduced amino acid sequence homology, as compared to beta-fructosidase of carrot cell wall, was found. Northern blot analysis showed that there was an obviously transient induction of invertase mRNA by gravistimulation in the oat pulvinus system. The mRNA was rapidly induced to a maximum level at 1 hour after gravistimulation treatment and gradually decreased afterwards. The mRNA level in the bottom half of the oat pulvinus was significantly higher than that in the top half of the pulvinus tissue. The kinetic induction of invertase mRNA was consistent with the transient accumulation of invertase activity during the graviresponse of the pulvinus. This indicates that the expression of the invertase gene(s) could be regulated by gravistimulation at the transcriptional level. Southern blot analysis showed that there were two to three genomic DNA fragments which hybridized with the partial-length invertase cDNA.

  1. Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

    PubMed

    Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

    1987-12-01

    Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene.

  2. Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

    PubMed

    Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

    2000-05-01

    A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

  3. Single Cell Transcriptomics of Hypothalamic Warm Sensitive Neurons that Control Core Body Temperature and Fever Response

    PubMed Central

    Eberwine, James; Bartfai, Tamas

    2011-01-01

    We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451

  4. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    PubMed

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  5. Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes

    PubMed Central

    Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney

    2012-01-01

    RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676

  6. ILG1 : a new integrase-like gene that is a marker of bacterial contamination by the laboratory Escherichia coli strain TOP10F'.

    PubMed Central

    Tian, Wenzhi; Chua, Kevin; Strober, Warren; Chu, Charles C.

    2002-01-01

    BACKGROUND: Identification of differentially expressed genes between normal and diseased states is an area of intense current medical research that can lead to the discovery of new therapeutic targets. However, isolation of differentially expressed genes by subtraction often suffers from unreported contamination of the resulting subtraction library with clones containing DNA sequences not from the original RNA samples. MATERIALS AND METHODS: Subtraction using cDNA representational difference analysis (RDA) was performed on human B cells from normal or common variable immunodeficiency patients. The material remaining after the subtraction was cloned and individual clones were sequenced. The sequence of one clone with similarity to integrases (ILG1, integrase-like gene-1) was used to obtain the full length cDNA sequence and as a probe for the presence of this sequence in RNA or genomic DNA samples. RESULTS: After five rounds of cDNA RDA, 23.3% of the clones from the resulting subtraction library contained Escherichia coli DNA. In addition, three clones contained the sequence of a new integrase, ILG1. The full length cDNA sequence of ILG1 exhibits prokaryotic, but not eukaryotic, features. At the DNA level, ILG1 is not similar to any known gene. At the protein level, ILG1 has 58% similarity to integrases from the cryptic P4 bacteriophage family (S clade). The catalytic domain of ILG1 contains the conserved features found in site-specific recombinases. The critical residues that form the catalytic active site pocket are conserved, including the highly conserved R-H-R-Y hallmark of these recombinases. Interestingly, ILG1 was not present in the original B cell populations. By probing genomic DNA, ILG1 could only be detected in the E. coli TOP10F' strain used in our laboratory for molecular cloning, but not in any of its precursor strains, including TOP10. Furthermore, bacteria cultured from the mouth of the laboratory worker who performed cDNA RDA were also positive for ILG1. CONCLUSIONS: In the course of our studies using cDNA RDA, we have isolated and identified ILG1, a likely active site-specific recombinase and new member of the bacteriophage P4 family of integrases. This family of integrases is implicated in the horizontal DNA transfer of pathogenic genes between bacterial species, such as those found in pathogenic strains of E. coli, Shigella, Yersinia, and Vibrio cholera. Using ILG1 as a marker of our laboratory E. coli strain TOP10F', our evidence suggests that contaminating bacterial DNA in our subtraction experiment is due to this laboratory bacterial strain, which colonized exposed surfaces of the laboratory worker. Thus, identification of differentially expressed genes between normal and diseased states could be dramatically improved by using extra precaution to prevent bacterial contamination of samples. PMID:12393938

  7. Expression of ayu (Plecoglossus altivelis) Pit-1 in Escherichia coli: its purification and immunohistochemical detection using monoclonal antibody.

    PubMed

    Chiu, Chi-Chien; John, Joseph Abraham Christopher; Hseu, Tzong-Hsiung; Chang, Chi-Yao

    2002-03-01

    The pituitary-specific transcription factor Pit-1 belongs to the family of POU-domain proteins and is known to play an important role in the differentiation of pituitary cells. Here we report the complete nucleotide sequence of cDNA encoding Pit-1 from the brackish water fish, ayu (Plecoglossus altivelis). Nucleotide sequence analysis of 1910 bp of ayu Pit-1 cDNA revealed an open reading frame of 1074 bp that encodes a protein of 358 amino acids containing a POU-specific domain, POU homeodomain, and an STA (Ser/Thr-rich activation) transactivation domain. We inserted the coding region of Pit-1 cDNA, obtained by PCR, into a pET-20b(+) plasmid to produce recombinant Pit-1 in Escherichia coli BL21 (DE3) pLysS cells. Upon induction with isopropyl beta-D-thiogalactopyranoside, Pit-1 was expressed and accumulated as inclusion bodies in E. coli. The protein was then purified in one step by affinity chromatography on a nickel-nitrilotriacetic acid agarose column under denaturing conditions. This method yielded 0.7 mg of highly pure and stable protein per 200 ml of bacterial culture. A band of 40 kDa, resolved as recombinant ayu Pit-1 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, agrees well with the molecular mass calculated from the translated cDNA sequence. The purified recombinant Pit-1 was confirmed in vitro through Western blot analysis, using its monoclonal antibody. This monoclonal antibody detected Pit-1 in the nuclei of ayu developing pituitary by immunohistochemical reaction. It serves as a good reagent for the detection of ayu Pit-1 in situ. Copyright 2002 Elsevier Science (USA).

  8. Molecular cloning and characterization of SoxB2 gene from Zhikong scallop Chlamys farreri

    NASA Astrophysics Data System (ADS)

    He, Yan; Bao, Zhenmin; Guo, Huihui; Zhang, Yueyue; Zhang, Lingling; Wang, Shi; Hu, Jingjie; Hu, Xiaoli

    2013-11-01

    The Sox proteins play critical roles during the development of animals, including sex determination and central nervous system development. In this study, the SoxB2 gene was cloned from a mollusk, the Zhikong scallop ( Chlamys farreri), and characterized with respect to phylogeny and tissue distribution. The full-length cDNA and genomic DNA sequences of C. farreri SoxB2 ( Cf SoxB2) were obtained by rapid amplification of cDNA ends and genome walking, respectively, using a partial cDNA fragment from the highly conserved DNA-binding domain, i.e., the High Mobility Group (HMG) box. The full-length cDNA sequence of Cf SoxB2 was 2 048 bp and encoded 268 amino acids protein. The genomic sequence was 5 551 bp in length with only one exon. Several conserved elements, such as the TATA-box, GC-box, CAAT-box, GATA-box, and Sox/sry-sex/testis-determining and related HMG box factors, were found in the promoter region. Furthermore, real-time quantitative reverse transcription PCR assays were carried out to assess the mRNA expression of Cf SoxB 2 in different tissues. SoxB2 was highly expressed in the mantle, moderately in the digestive gland and gill, and weakly expressed in the gonad, kidney and adductor muscle. In male and female gonads at different developmental stages of reproduction, the expression levels of Cf SoxB2 were similar. Considering the specific expression and roles of SoxB 2 in other animals, in particular vertebrates, and the fact that there are many pallial nerves in the mantle, cerebral ganglia in the digestive gland and gill nerves in gill, we propose a possible essential role in nervous tissue function for Sox B 2 in C. farreri.

  9. Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum

    PubMed Central

    Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki

    1998-01-01

    The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312

  10. Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

    PubMed Central

    Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

    1993-01-01

    A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

  11. Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

    PubMed Central

    Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

    1995-01-01

    The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

  12. Housekeeping while brain's storming Validation of normalizing factors for gene expression studies in a murine model of traumatic brain injury

    PubMed Central

    Rhinn, Hervé; Marchand-Leroux, Catherine; Croci, Nicole; Plotkine, Michel; Scherman, Daniel; Escriou, Virginie

    2008-01-01

    Background Traumatic brain injury models are widely studied, especially through gene expression, either to further understand implied biological mechanisms or to assess the efficiency of potential therapies. A large number of biological pathways are affected in brain trauma models, whose elucidation might greatly benefit from transcriptomic studies. However the suitability of reference genes needed for quantitative RT-PCR experiments is missing for these models. Results We have compared five potential reference genes as well as total cDNA level monitored using Oligreen reagent in order to determine the best normalizing factors for quantitative RT-PCR expression studies in the early phase (0–48 h post-trauma (PT)) of a murine model of diffuse brain injury. The levels of 18S rRNA, and of transcripts of β-actin, glyceraldehyde-3P-dehydrogenase (GAPDH), β-microtubulin and S100β were determined in the injured brain region of traumatized mice sacrificed at 30 min, 3 h, 6 h, 12 h, 24 h and 48 h post-trauma. The stability of the reference genes candidates and of total cDNA was evaluated by three different methods, leading to the following rankings as normalization factors, from the most suitable to the less: by using geNorm VBA applet, we obtained the following sequence: cDNA(Oligreen); GAPDH > 18S rRNA > S100β > β-microtubulin > β-actin; by using NormFinder Excel Spreadsheet, we obtained the following sequence: GAPDH > cDNA(Oligreen) > S100β > 18S rRNA > β-actin > β-microtubulin; by using a Confidence-Interval calculation, we obtained the following sequence: cDNA(Oligreen) > 18S rRNA; GAPDH > S100β > β-microtubulin > β-actin. Conclusion This work suggests that Oligreen cDNA measurements, 18S rRNA and GAPDH or a combination of them may be used to efficiently normalize qRT-PCR gene expression in mouse brain trauma injury, and that β-actin and β-microtubulin should be avoided. The potential of total cDNA as measured by Oligreen as a first-intention normalizing factor with a broad field of applications is highlighted. Pros and cons of the three methods of normalization factors selection are discussed. A generic time- and cost-effective procedure for normalization factor validation is proposed. PMID:18611280

  13. Expression cloning of a gibberellin 20-oxidase, a multifunctional enzyme involved in gibberellin biosynthesis.

    PubMed Central

    Lange, T; Hedden, P; Graebe, J E

    1994-01-01

    In the biosynthetic pathway to the gibberellins (GAs), carbon-20 is removed by oxidation to give the C19-GAs, which include the biologically active plant hormones. We report the isolation of a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing) EC 1.14.11.-] by screening a cDNA library from developing cotyledons of pumpkin (Cucurbita maxima L.) for expression of this enzyme. When mRNA from either the cotyledons or the endosperm was translated in vitro using rabbit reticulocyte lysates, the products contained GA12 20-oxidase activity. A polyclonal antiserum was raised against the amino acid sequence of a peptide released by tryptic digestion of purified GA 20-oxidase from the endosperm. A cDNA expression library in lambda gt11 was prepared from cotyledon mRNA and screened with the antiserum. The identity of positive clones was confirmed by the demonstration of GA12 20-oxidase activity in single bacteriophage plaques. Recombinant protein from a selected clone catalyzed the three-step conversions of GA12 to GA25 and of GA53 to GA17, as well as the formation of the C19-GAs, GA1, GA9, and GA20, from their respective aldehyde precursors, GA23, GA24, and GA19. The nucleotide sequence of the cDNA insert contains an open reading frame of 1158 nt encoding a protein of 386 amino acid residues. The predicted M(r) (43,321) and pI (5.3) are similar to those determined experimentally for the native GA 20-oxidase. Furthermore, the derived amino acid sequence includes sequences obtained from the N terminus and two tryptic peptides from the native enzyme. It also contains regions that are highly conserved in a group of non-heme Fe-containing dioxygenases. Images PMID:8078921

  14. Molecular Cloning and Ethylene Induction of mRNA Encoding a Phytoalexin Elicitor-Releasing Factor, beta-1,3-Endoglucanase, in Soybean.

    PubMed

    Takeuchi, Y; Yoshikawa, M; Takeba, G; Tanaka, K; Shibata, D; Horino, O

    1990-06-01

    Soybean (Glycine max) beta-1,3-endoglucanase (EC 3.2. 1.39) is involved in one of the earliest plant-pathogen interactions that may lead to active disease resistance by releasing elicitor-active carbohydrates from the cell walls of fungal pathogens. Ethylene induced beta-1,3-endoglucanase activity to 2- to 3-fold higher levels in cotyledons of soybean seedlings. A specific polyclonal antiserum raised against purified soybean beta-1,3-endoglucanase was used to immunoprecipitate in vitro translation products, demonstrating that ethylene induction increased translatable beta-1,3-endoglucanase mRNA. Several cDNA clones for the endoglucanase gene were obtained by antibody screening of a lambda-gt11 expression library prepared from soybean cotyledons. Hybrid-select translation experiments indicated that the cloned cDNA encoded a 36-kilodalton precursor protein product that was specifically immunoprecipitated with beta-1,3-endoglucanase antiserum. Escherichia coli cells expressing the cloned cDNA also synthesized an immunologically positive protein. Nucleotide sequence of three independent clones revealed a single uninterrupted open reading frame of 1041 nucleotides, corresponding to a polypeptide of 347 residue long. The primary amino acid sequence of beta-1,3-endoglucanase as deduced from the nucleotide sequence was confirmed by direct amino acid sequencing of trypsin digests of the glucanase. The soybean beta-1,3-endoglucanase exhibited 53% amino acid homology to a beta-1,3-glucanase cloned from cultured tobacco cells and 48% homology to a beta-(1,3-1,4)-glucanase from barley. Utilizing the largest cloned cDNA (pEG488) as a hybridization probe, it was found that the increase in translatable beta-1,3-endoglucanase mRNA seen upon ethylene treatment of soybean seedlings was due to 50- to 100-fold increase in steady state mRNA levels, indicating that ethylene regulates gene expression of this enzyme important in disease resistance at the level of gene transcription.

  15. Genomic clones for human cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kott, M.; Venta, P.J.; Larsen, J.

    1987-05-01

    A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less

  16. Molecular characterization of an ependymin precursor from goldfish brain.

    PubMed

    Königstorfer, A; Sterrer, S; Eckerskorn, C; Lottspeich, F; Schmidt, R; Hoffmann, W

    1989-01-01

    Ependymins are thought to be implicated in fundamental processes involved in plasticity of the goldfish CNS. Gas-phase sequencing of purified ependymins beta and gamma revealed that they share the same N-terminal sequence. Each sequence displays microheterogeneities at several positions. Based on the protein sequences obtained, we constructed synthetic oligonucleotides and used them as hybridization probes for screening cDNA libraries of goldfish brain. In this article we describe the full-length sequence of a mRNA encoding a precursor of ependymins. A cleavable signal sequence characteristic of secretory proteins is located at the N-terminal end, followed directly by the ependymin sequence. Also, two potential N-glycosylation sites were detected. A computer search revealed that ependymins form a novel family of unique proteins.

  17. Molecular characterization and expression analysis of ubiquitin-activating enzyme E1 gene in Citrus reticulata.

    PubMed

    Miao, Hong-Xia; Qin, Yong-Hua; Ye, Zi-Xing; Hu, Gui-Bing

    2013-01-25

    Ubiquitin-activating enzyme E1 (UBE1) catalyzes the first step in the ubiquitination reaction, which targets a protein for degradation via a proteasome pathway. UBE1 plays an important role in metabolic processes. In this study, full-length cDNA and DNA sequences of UBE1 gene, designated CrUBE1, were obtained from 'Wuzishatangju' (self-incompatible, SI) and 'Shatangju' (self-compatible, SC) mandarins. 5 amino acids and 8 bases were different in cDNA and DNA sequences of CrUBE1 between 'Wuzishatangju' and 'Shatangju', respectively. Southern blot analysis showed that there existed only one copy of the CrUBE1 gene in genome of 'Wuzishatangju' and 'Shatangju'. The temporal and spatial expression characteristics of the CrUBE1 gene were investigated using semi-quantitative RT-PCR (SqPCR) and quantitative real-time PCR (qPCR). The expression level of the CrUBE1 gene in anthers of 'Shatangju' was approximately 10-fold higher than in anthers of 'Wuzishatangju'. The highest expression level of CrUBE1 was detected in pistils at 7days after self-pollination of 'Wuzishatangju', which was approximately 5-fold higher than at 0 h. To obtain CrUBE1 protein, the full-length cDNA of CrUBE1 genes from 'Wuzishatangju' and 'Shatangju' were successfully expressed in Pichia pastoris. Pollen germination frequency of 'Wuzishatangju' was significantly inhibited with increasing of CrUBE1 protein concentrations from 'Wuzishatangju'. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mencinger, M.; Panagopoulos, I.; Andreasson, P.

    1997-05-01

    Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

  19. Immune-Related Transcriptome of Coptotermes formosanus Shiraki Workers: The Defense Mechanism

    PubMed Central

    Hussain, Abid; Li, Yi-Feng; Cheng, Yu; Liu, Yang; Chen, Chuan-Cheng; Wen, Shuo-Yang

    2013-01-01

    Formosan subterranean termites, Coptotermes formosanus Shiraki, live socially in microbial-rich habitats. To understand the molecular mechanism by which termites combat pathogenic microbes, a full-length normalized cDNA library and four Suppression Subtractive Hybridization (SSH) libraries were constructed from termite workers infected with entomopathogenic fungi (Metarhizium anisopliae and Beauveria bassiana), Gram-positive Bacillus thuringiensis and Gram-negative Escherichia coli, and the libraries were analyzed. From the high quality normalized cDNA library, 439 immune-related sequences were identified. These sequences were categorized as pattern recognition receptors (47 sequences), signal modulators (52 sequences), signal transducers (137 sequences), effectors (39 sequences) and others (164 sequences). From the SSH libraries, 27, 17, 22 and 15 immune-related genes were identified from each SSH library treated with M. anisopliae, B. bassiana, B. thuringiensis and E. coli, respectively. When the normalized cDNA library was compared with the SSH libraries, 37 immune-related clusters were found in common; 56 clusters were identified in the SSH libraries, and 259 were identified in the normalized cDNA library. The immune-related gene expression pattern was further investigated using quantitative real time PCR (qPCR). Important immune-related genes were characterized, and their potential functions were discussed based on the integrated analysis of the results. We suggest that normalized cDNA and SSH libraries enable us to discover functional genes transcriptome. The results remarkably expand our knowledge about immune-inducible genes in C. formosanus Shiraki and enable the future development of novel control strategies for the management of Formosan subterranean termites. PMID:23874972

  20. Physiological and Molecular Biological Characterization of Intracellular Carbonic Anhydrase from the Marine Diatom Phaeodactylum tricornutum1

    PubMed Central

    Satoh, Dan; Hiraoka, Yasutaka; Colman, Brian; Matsuda, Yusuke

    2001-01-01

    A single intracellular carbonic anhydrase (CA) was detected in air-grown and, at reduced levels, in high CO2-grown cells of the marine diatom Phaeodactylum tricornutum (UTEX 642). No external CA activity was detected irrespective of growth CO2 conditions. Ethoxyzolamide (0.4 mm), a CA-specific inhibitor, severely inhibited high-affinity photosynthesis at low concentrations of dissolved inorganic carbon, whereas 2 mm acetazolamide had little effect on the affinity for dissolved inorganic carbon, suggesting that internal CA is crucial for the operation of a carbon concentrating mechanism in P. tricornutum. Internal CA was purified 36.7-fold of that of cell homogenates by ammonium sulfate precipitation, and two-step column chromatography on diethylaminoethyl-sephacel and p-aminomethylbenzene sulfone amide agarose. The purified CA was shown, by SDS-PAGE, to comprise an electrophoretically single polypeptide of 28 kD under both reduced and nonreduced conditions. The entire sequence of the cDNA of this CA was obtained by the rapid amplification of cDNA ends method and indicated that the cDNA encodes 282 amino acids. Comparison of this putative precursor sequence with the N-terminal amino acid sequence of the purified CA indicated that it included a possible signal sequence of up to 46 amino acids at the N terminus. The mature CA was found to consist of 236 amino acids and the sequence was homologous to β-type CAs. Even though the zinc-ligand amino acid residues were shown to be completely conserved, the amino acid residues that may constitute a CO2-binding site appeared to be unique among the β-CAs so far reported. PMID:11500545

  1. Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)

    PubMed Central

    Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing

    1998-01-01

    The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330

  2. cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoefler, G.; Forstner, M.; Hulla, W.

    1994-01-01

    Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

  3. The cDNA sequence of a neutral horseradish peroxidase.

    PubMed

    Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

    1991-02-16

    A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

  4. Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

    PubMed Central

    Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

    2000-01-01

    We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

  5. The gene for stinging nettle lectin (Urtica dioica agglutinin) encodes both a lectin and a chitinase.

    PubMed

    Lerner, D R; Raikhel, N V

    1992-06-05

    Chitin-binding proteins are present in a wide range of plant species, including both monocots and dicots, even though these plants contain no chitin. To investigate the relationship between in vitro antifungal and insecticidal activities of chitin-binding proteins and their unknown endogenous functions, the stinging nettle lectin (Urtica dioica agglutinin, UDA) cDNA was cloned using a synthetic gene as the probe. The nettle lectin cDNA clone contained an open reading frame encoding 374 amino acids. Analysis of the deduced amino acid sequence revealed a 21-amino acid putative signal sequence and the 86 amino acids encoding the two chitin-binding domains of nettle lectin. These domains were fused to a 19-amino acid "spacer" domain and a 244-amino acid carboxyl extension with partial identity to a chitinase catalytic domain. The authenticity of the cDNA clone was confirmed by deduced amino acid sequence identity with sequence data obtained from tryptic digests, RNA gel blot, and polymerase chain reaction analyses. RNA gel blot analysis also showed the nettle lectin message was present primarily in rhizomes and inflorescence (with immature seeds) but not in leaves or stems. Chitinase enzymatic activity was found when the chitinase-like domain alone or the chitinase-like domain with the chitin-binding domains were expressed in Escherichia coli. This is the first example of a chitin-binding protein with both a duplication of the 43-amino acid chitin-binding domain and a fusion of the chitin-binding domains to a structurally unrelated domain, the chitinase domain.

  6. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

    PubMed

    Hargreaves, Adam D; Mulley, John F

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  7. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

    PubMed Central

    Hargreaves, Adam D.

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species. PMID:26623194

  8. Cloning of a human hepatocyte growth factor/scatter factor transcription variant from a gastric cancer cell line HSC-39.

    PubMed

    Yokozaki, H; Tahara, H; Oue, N; Tahara, E

    2000-01-01

    A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.

  9. Cloning, sequence, and expression of a blood group B active recombinant alpha-D-galactosidase from pinto bean (Phaseolus vulgaris).

    PubMed

    Davis, M O; Hata, D J; Johnson, S A; Jones, D E; Harmata, M A; Evans, M L; Walker, J C; Smith, D S

    1997-07-01

    A cDNA encoding pinto bean alpha-D-galactosidase [E.C. 3.2.1.22] was obtained by amplification of cDNA using highly conserved sequences found in eucaryotic alpha-D-galactosidases. Subsequently a full length Phaseolus cDNA clone was obtained that is 1537 nt long and contains untranslated 5' and 3' sequences. The nucleotide sequence of the cDNA has a high degree of homology with other eucaryotic alpha-D-galactosidase genes. The recombinant alpha-D-galactosidase (rGal) was expressed in Escherichia coli and purified by ion exchange and affinity chromatography. Purified rGal was homogeneous by SDS-PAGE and had relative masses of 40.1 and 45.4 kDa under nonreducing and reducing conditions, respectively. The N-terminal sequence of the expressed protein contained the sequence GNGLGQTPPMG corresponding to that deduced from the cDNA sequence. The native molecular weight for rGal was determined to be 32.18 kDa by Sephacryl S-200 chromatography. The specific activity of the rGal was 349 mu moles of PNP-alpha-D-galactopyranoside hydrolyzed per mg of pure rGal per min. rGal was highly specific for alpha-D-galactosyl residues and degraded B oligosaccharide. No detectable hemagglutinin or protease activity was present in the preparations. Furthermore, rGal was active against the blood group B antigen on native human erythrocytes in cell suspension assays. The only detectable RBC phenotypic change was loss of the B and P1 epitopes. Recombinant Phaseolus vulgaris alpha-D-galactosidase may have useful biotechnical applications in the potential mass production of enzymatically converted, universally transfusable type O RBCs. alpha-D-galactosidase [E.C. 3.2.1.22] has been purified from a variety of procaryotic and eucaryotic species. Most alpha-D-galactosidases have similar low molecular weight substrate specificities, but activity against high molecular weight substrates is variable. Terminal alpha-D-galactoside residues are present in glycoproteins and glycolipids. Some alpha-D-galactosidases have activity against alpha-D-galactosyl residues on cell membrane glycoconjugates. Glycosidases with this property are useful for carbohydrate structural studies and biotechnical applications. Enzymes free of other glycosidase activities with activity near neutral pH are particularly useful for membrane modification studies on native cells. Complex sugar chains in glycolipids and glycoproteins have often been implicated in the growth and development of eucaryotes. In particular, complex sugar chains play an important role in the recognition of self in the immune system. Some alpha-D-galactosidases can modify certain carbohydrate membrane epitopes, thereby modulating the immune response. For example, the blood group B epitope expressed on erythrocytes contains a terminal alpha-D-galactosyl residue. Individuals lacking this antigen produce naturally occurring complement fixing antibodies to the B epitope. Hydrolysis of this terminal saccharide destroys the antigenic activity of the B determinant producing H antigen (blood type O) on erythrocytes. Only rare individuals produce clinically significant antibodies to the H antigen, and therefore, type O red blood cells are "universally" compatible and in great demand. Dhar purified alpha-D-galactosidase isozymes from Phaseolus vulgaris and characterized their activity. To our knowledge, our laboratory, in a brief report, is the first to describe the cloning of the gene and the use of recombinant enzyme for seroconverting blood type B to O cells. This paper describes the cloning, sequence, expression, purification, and characterization of recombinant alpha-D-galactosidase. Activity of the recombinant enzyme on the native human erythrocyte blood group B epitope is shown.

  10. Single cell transcriptomics of hypothalamic warm sensitive neurons that control core body temperature and fever response Signaling asymmetry and an extension of chemical neuroanatomy.

    PubMed

    Eberwine, James; Bartfai, Tamas

    2011-03-01

    We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.

  11. Constructing and detecting a cDNA library for mites.

    PubMed

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  12. Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

    PubMed Central

    Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

    2014-01-01

    Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

  13. Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

    PubMed

    Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

    2004-12-15

    cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

  14. Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

    PubMed Central

    Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

    1987-01-01

    Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

  15. Characterization of papain-like isoenzymes from latex of Asclepias curassavica by molecular biology validated by proteomic approach.

    PubMed

    Obregón, Walter D; Liggieri, Constanza S; Trejo, Sebastian A; Avilés, Francesc X; Vairo-Cavalli, Sandra E; Priolo, Nora S

    2009-01-01

    Latices from Asclepias spp are used in wound healing and the treatment of some digestive disorders. These pharmacological actions have been attributed to the presence of cysteine proteases in these milky latices. Asclepias curassavica (Asclepiadaceae), "scarlet milkweed" is a perennial subshrub native to South America. In the current paper we report a new approach directed at the selective biochemical and molecular characterization of asclepain cI (acI) and asclepain cII (acII), the enzymes responsible for the proteolytic activity of the scarlet milkweed latex. SDS-PAGE spots of both purified peptidases were digested with trypsin and Peptide Mass Fingerprints (PMFs) obtained showed no equivalent peptides. No identification was possible by MASCOT search due to the paucity of information concerning Asclepiadaceae latex cysteine proteinases available in databases. From total RNA extracted from latex samples, cDNA of both peptidases was obtained by RT-PCR using degenerate primers encoding Asclepiadaceae cysteine peptidase conserved domains. Theoretical PMFs of partial polypeptide sequences obtained by cloning (186 and 185 amino acids) were compared with empirical PMFs, confirming that the sequences of 186 and 185 amino acids correspond to acI and acII, respectively. N-terminal sequences of acI and acII, characterized by Edman sequencing, were overlapped with those coming from the cDNA to obtain the full-length sequence of both mature peptidases (212 and 211 residues respectively). Alignment and phylogenetic analysis confirmed that acI and acII belong to the subfamily C1A forming a new group of papain-like cysteine peptidases together with asclepain f from Asclepias fruticosa. We conclude that PMF could be adopted as an excellent tool to differentiate, in a fast and unequivocal way, peptidases with very similar physicochemical and functional properties, with advantages over other conventional methods (for instance enzyme kinetics) that are time consuming and afford less reliable results.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lagrimini, L.M.

    Since this manuscript was submitted we have conducted a more thorough physiological analysis of water relations in wild-type and peroxidase overproducing plants. These experiments include pressure bomb, plasmolysis, and membrane integrity analysis. We are also in the process of analyzing other phenotypes in peroxidase overproducer plants such as excessive browning of tissue, the rapid death of tissue in culture, and poor germination of seed. Transformed plants of Nicotiana tabacum and Nicotiana sylvestris were obtained which have peroxidase activity 3--7 fold lower than wild-type plants. This was done by introducing a chimeric gene composed of the CaMV 35S promoter and themore » 5' half of the tobacco anionic peroxidase cDNA in the antisense RNA configuration. A manuscript which describes this work is being written, and will be submitted for publication in January 1990. The anionic peroxidase gene has been cloned by hybridization to the cloned cDNA. The entire gene is contained on an 8.7kb fragment within a lambda phage clone. Several smaller DNA fragments have been subcloned, and some have been sequenced. One exon within the coding sequence has been sequenced, along with the partial sequence of two introns. Further sequencing is being carried-out to identify the promoter, which will be later joined to a reporter gene. 6 figs.« less

  17. Heterologous Array Analysis in Pinaceae: Hybridization of Pinus Taeda cDNA Arrays With cDNA From Needles and Embryogenic Cultures of P. Taeda, P. Sylvestris or Picea Abies

    PubMed Central

    van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov

    2002-01-01

    Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264

  18. Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

    PubMed

    Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

    2011-12-01

    Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

  19. Sequence and pattern of expression of a bovine homologue of a human mitochondrial transport protein associated with Grave's disease.

    PubMed

    Fiermonte, G; Runswick, M J; Walker, J E; Palmieri, F

    1992-01-01

    A human cDNA has been isolated previously from a thyroid library with the aid of serum from a patient with Grave's disease. It encodes a protein belonging to the mitochondrial metabolite carrier family, referred to as the Grave's disease carrier protein (GDC). Using primers based on this sequence, overlapping cDNAs encoding the bovine homologue of the GDC have been isolated from total bovine heart poly(A)+ cDNA. The bovine protein is 18 amino acids shorter than the published human sequence, but if a frame shift requiring the removal of one nucleotide is introduced into the human cDNA sequence, the human and bovine proteins become identical in their C-terminal regions, and 308 out of 330 amino acids are conserved over their entire sequences. The bovine cDNA has been used to investigate the expression of the GDC in various bovine tissues. In the tissues that were examined, the GDC is most strongly expressed in the thyroid, but substantial amounts of its mRNA were also detected in liver, lung and kidney, and lesser amounts in heart and skeletal muscle.

  20. cDNA cloning and immunological characterization of a newly identified enolase allergen from Penicillium citrinum and Aspergillus fumigatus.

    PubMed

    Lai, Hsiu-Yu; Tam, Ming F; Tang, Ren-Bin; Chou, Hong; Chang, Ching-Yun; Tsai, Jaw-Ji; Shen, Horng-Der

    2002-03-01

    Penicillium citrinum and Aspergillus fumigatus are prevalent indoor airborne fungal species that have been implicated in human respiratory allergic disorders. It is important to understand the allergenic profile of these fungal species. The purpose of the present study is to characterize a newly identified enolase allergen from P. citrinum and A. fumigatus. Fungal proteins were separated by two-dimensional (2D) gel electrophoresis and blotted onto polyvinylidene difluoride membranes. Protein spots that reacted with IgE antibodies in serum samples from asthmatic patients were identified and the N-terminal amino acid sequences were determined by Edman degradation. The peptide sequences obtained were utilized in cloning the cDNA of the allergen genes by reverse transcriptase-polymerase chain reaction and the 5'- and 3'-rapid amplification cDNA end reactions. Our results from 2D immunoblotting identified a 47-kD IgE-reactive component in the extracts of P. citrinum and A. fumigatus. The N-terminal amino acid sequences of the 47-kD proteins are homologous to those of fungal enolases. The corresponding enolase cDNA from P. citrinum contains 1,552 bp and encodes a protein of 438 residues. In A. fumigatus, the isolated enolase cDNA has 1,649 bp and contains a 438-amino acid open reading frame. The deduced amino acid sequences of these two enolases have 94% identity. These enolases from P. citrinum and A. fumigatus were expressed in Escherichia coli as a His-tagged protein and designated as rPen c 22 and rAsp f 22, respectively. Sera from 7 (30%) of the 23 Penicillium-sensitized asthmatic patients showed IgE binding to the 47-kD P. citrinum component (Pen c 22) and rPen c 22. In addition, six of seven Pen c 22-positive serum samples have IgE immunoblot reactivity to the 47-kD A. fumigatus component (Asp f 22) and rAsp f 22. A polyclonal rabbit antiserum generated against the N-terminal peptide of Pen c 22 can react with Pen c 22, rPen c 22, Asp f 22 and rAsp f 22. In addition, the presence of IgE cross-reactivity between rPen c 22 and rAsp f 22 and between enolases from A. fumigatus and Alternaria alternata was also detected by immunoblot inhibition. These results demonstrated that a novel enolase allergen from P. citrinum (Pen c 22) and A. fumigatus (Asp f 22) was identified. In addition, IgE cross-reactivity between enolase allergens from A. fumigatus and P. citrinum and between enolases from A. fumigatus and A. alternata was also detected. Results obtained provide more information on fungal enolase allergens. Copyright 2002 S. Karger AG, Basel

  1. Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

    PubMed

    Ozsolak, Fatih

    2016-01-01

    With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

  2. Comprehensive red blood cell and platelet antigen prediction from whole genome sequencing: proof of principle

    PubMed Central

    Westhoff, Connie M.; Uy, Jon Michael; Aguad, Maria; Smeland‐Wagman, Robin; Kaufman, Richard M.; Rehm, Heidi L.; Green, Robert C.; Silberstein, Leslie E.

    2015-01-01

    BACKGROUND There are 346 serologically defined red blood cell (RBC) antigens and 33 serologically defined platelet (PLT) antigens, most of which have known genetic changes in 45 RBC or six PLT genes that correlate with antigen expression. Polymorphic sites associated with antigen expression in the primary literature and reference databases are annotated according to nucleotide positions in cDNA. This makes antigen prediction from next‐generation sequencing data challenging, since it uses genomic coordinates. STUDY DESIGN AND METHODS The conventional cDNA reference sequences for all known RBC and PLT genes that correlate with antigen expression were aligned to the human reference genome. The alignments allowed conversion of conventional cDNA nucleotide positions to the corresponding genomic coordinates. RBC and PLT antigen prediction was then performed using the human reference genome and whole genome sequencing (WGS) data with serologic confirmation. RESULTS Some major differences and alignment issues were found when attempting to convert the conventional cDNA to human reference genome sequences for the following genes: ABO, A4GALT, RHD, RHCE, FUT3, ACKR1 (previously DARC), ACHE, FUT2, CR1, GCNT2, and RHAG. However, it was possible to create usable alignments, which facilitated the prediction of all RBC and PLT antigens with a known molecular basis from WGS data. Traditional serologic typing for 18 RBC antigens were in agreement with the WGS‐based antigen predictions, providing proof of principle for this approach. CONCLUSION Detailed mapping of conventional cDNA annotated RBC and PLT alleles can enable accurate prediction of RBC and PLT antigens from whole genomic sequencing data. PMID:26634332

  3. Molecular Cloning and Sequencing of Channel Catfish, Ictalurus punctatus, Cathepsin H and L cDNA

    USDA-ARS?s Scientific Manuscript database

    Cathepsin H and L, a lysosomal cysteine endopeptidase of the papain family, are ubiquitously expressed and involve in antigen processing. In this communication, the channel catfish cathepsin H and L transcripts were sequenced and analyzed. Total RNA from tissues was extracted and cDNA libraries we...

  4. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

    USDA-ARS?s Scientific Manuscript database

    Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

  5. Cloning of novel cellulases from cellulolytic fungi: heterologous expression of a family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris.

    PubMed

    Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana

    2011-12-10

    Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Analysis and Functional Annotation of an Expressed Sequence Tag Collection for Tropical Crop Sugarcane

    PubMed Central

    Vettore, André L.; da Silva, Felipe R.; Kemper, Edson L.; Souza, Glaucia M.; da Silva, Aline M.; Ferro, Maria Inês T.; Henrique-Silva, Flavio; Giglioti, Éder A.; Lemos, Manoel V.F.; Coutinho, Luiz L.; Nobrega, Marina P.; Carrer, Helaine; França, Suzelei C.; Bacci, Maurício; Goldman, Maria Helena S.; Gomes, Suely L.; Nunes, Luiz R.; Camargo, Luis E.A.; Siqueira, Walter J.; Van Sluys, Marie-Anne; Thiemann, Otavio H.; Kuramae, Eiko E.; Santelli, Roberto V.; Marino, Celso L.; Targon, Maria L.P.N.; Ferro, Jesus A.; Silveira, Henrique C.S.; Marini, Danyelle C.; Lemos, Eliana G.M.; Monteiro-Vitorello, Claudia B.; Tambor, José H.M.; Carraro, Dirce M.; Roberto, Patrícia G.; Martins, Vanderlei G.; Goldman, Gustavo H.; de Oliveira, Regina C.; Truffi, Daniela; Colombo, Carlos A.; Rossi, Magdalena; de Araujo, Paula G.; Sculaccio, Susana A.; Angella, Aline; Lima, Marleide M.A.; de Rosa, Vicente E.; Siviero, Fábio; Coscrato, Virginia E.; Machado, Marcos A.; Grivet, Laurent; Di Mauro, Sonia M.Z.; Nobrega, Francisco G.; Menck, Carlos F.M.; Braga, Marilia D.V.; Telles, Guilherme P.; Cara, Frank A.A.; Pedrosa, Guilherme; Meidanis, João; Arruda, Paulo

    2003-01-01

    To contribute to our understanding of the genome complexity of sugarcane, we undertook a large-scale expressed sequence tag (EST) program. More than 260,000 cDNA clones were partially sequenced from 26 standard cDNA libraries generated from different sugarcane tissues. After the processing of the sequences, 237,954 high-quality ESTs were identified. These ESTs were assembled into 43,141 putative transcripts. Of the assembled sequences, 35.6% presented no matches with existing sequences in public databases. A global analysis of the whole SUCEST data set indicated that 14,409 assembled sequences (33% of the total) contained at least one cDNA clone with a full-length insert. Annotation of the 43,141 assembled sequences associated almost 50% of the putative identified sugarcane genes with protein metabolism, cellular communication/signal transduction, bioenergetics, and stress responses. Inspection of the translated assembled sequences for conserved protein domains revealed 40,821 amino acid sequences with 1415 Pfam domains. Reassembling the consensus sequences of the 43,141 transcripts revealed a 22% redundancy in the first assembling. This indicated that possibly 33,620 unique genes had been identified and indicated that >90% of the sugarcane expressed genes were tagged. PMID:14613979

  7. A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

    PubMed Central

    Walker, M D; Park, C W; Rosen, A; Aronheim, A

    1990-01-01

    Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

  8. Sequencing and comparative genomic analysis of 1227 Felis catus cDNA sequences enriched for developmental, clinical and nutritional phenotypes

    PubMed Central

    2012-01-01

    Background The feline genome is valuable to the veterinary and model organism genomics communities because the cat is an obligate carnivore and a model for endangered felids. The initial public release of the Felis catus genome assembly provided a framework for investigating the genomic basis of feline biology. However, the entire set of protein coding genes has not been elucidated. Results We identified and characterized 1227 protein coding feline sequences, of which 913 map to public sequences and 314 are novel. These sequences have been deposited into NCBI's genbank database and complement public genomic resources by providing additional protein coding sequences that fill in some of the gaps in the feline genome assembly. Through functional and comparative genomic analyses, we gained an understanding of the role of these sequences in feline development, nutrition and health. Specifically, we identified 104 orthologs of human genes associated with Mendelian disorders. We detected negative selection within sequences with gene ontology annotations associated with intracellular trafficking, cytoskeleton and muscle functions. We detected relatively less negative selection on protein sequences encoding extracellular networks, apoptotic pathways and mitochondrial gene ontology annotations. Additionally, we characterized feline cDNA sequences that have mouse orthologs associated with clinical, nutritional and developmental phenotypes. Together, this analysis provides an overview of the value of our cDNA sequences and enhances our understanding of how the feline genome is similar to, and different from other mammalian genomes. Conclusions The cDNA sequences reported here expand existing feline genomic resources by providing high-quality sequences annotated with comparative genomic information providing functional, clinical, nutritional and orthologous gene information. PMID:22257742

  9. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  10. Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

    PubMed Central

    Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

    1987-01-01

    Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene. Images PMID:2825184

  11. In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

    PubMed Central

    Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

    2005-01-01

    The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642

  12. Genomic resources for songbird research and their use in characterizing gene expression during brain development

    PubMed Central

    Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry

    2007-01-01

    Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146

  13. A diverse family of serine proteinase genes expressed in cotton boll weevil (Anthonomus grandis): implications for the design of pest-resistant transgenic cotton plants.

    PubMed

    Oliveira-Neto, Osmundo B; Batista, João A N; Rigden, Daniel J; Fragoso, Rodrigo R; Silva, Rodrigo O; Gomes, Eliane A; Franco, Octávio L; Dias, Simoni C; Cordeiro, Célia M T; Monnerat, Rose G; Grossi-De-Sá, Maria F

    2004-09-01

    Fourteen different cDNA fragments encoding serine proteinases were isolated by reverse transcription-PCR from cotton boll weevil (Anthonomus grandis) larvae. A large diversity between the sequences was observed, with a mean pairwise identity of 22% in the amino acid sequence. The cDNAs encompassed 11 trypsin-like sequences classifiable into three families and three chymotrypsin-like sequences belonging to a single family. Using a combination of 5' and 3' RACE, the full-length sequence was obtained for five of the cDNAs, named Agser2, Agser5, Agser6, Agser10 and Agser21. The encoded proteins included amino acid sequence motifs of serine proteinase active sites, conserved cysteine residues, and both zymogen activation and signal peptides. Southern blotting analysis suggested that one or two copies of these serine proteinase genes exist in the A. grandis genome. Northern blotting analysis of Agser2 and Agser5 showed that for both genes, expression is induced upon feeding and is concentrated in the gut of larvae and adult insects. Reverse northern analysis of the 14 cDNA fragments showed that only two trypsin-like and two chymotrypsin-like were expressed at detectable levels. Under the effect of the serine proteinase inhibitors soybean Kunitz trypsin inhibitor and black-eyed pea trypsin/chymotrypsin inhibitor, expression of one of the trypsin-like sequences was upregulated while expression of the two chymotrypsin-like sequences was downregulated. Copyright 2004 Elsevier Ltd.

  14. A combined de novo protein sequencing and cDNA library approach to the venomic analysis of Chinese spider Araneus ventricosus.

    PubMed

    Duan, Zhigui; Cao, Rui; Jiang, Liping; Liang, Songping

    2013-01-14

    In past years, spider venoms have attracted increasing attention due to their extraordinary chemical and pharmacological diversity. The recently popularized proteomic method highly improved our ability to analyze the proteins in the venom. However, the lack of information about isolated venom proteins sequences dramatically limits the ability to confidently identify venom proteins. In the present paper, the venom from Araneus ventricosus was analyzed using two complementary approaches: 2-DE/Shotgun-LC-MS/MS coupled to MASCOT search and 2-DE/Shotgun-LC-MS/MS coupled to manual de novo sequencing followed by local venom protein database (LVPD) search. The LVPD was constructed with toxin-like protein sequences obtained from the analysis of cDNA library from A. ventricosus venom glands. Our results indicate that a total of 130 toxin-like protein sequences were unambiguously identified by manual de novo sequencing coupled to LVPD search, accounting for 86.67% of all toxin-like proteins in LVPD. Thus manual de novo sequencing coupled to LVPD search was proved an extremely effective approach for the analysis of venom proteins. In addition, the approach displays impeccable advantage in validating mutant positions of isoforms from the same toxin-like family. Intriguingly, methyl esterifcation of glutamic acid was discovered for the first time in animal venom proteins by manual de novo sequencing. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  15. Molecular identification and partial sequence analysis of an aryl hydrocarbon receptor from beluga (Delphinapterus leucas)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jensen, B.A.; Hahn, M.E.

    1995-12-31

    The aryl hydrocarbon receptor (AhR) mediates the effects of many common and potentially toxic organic hydrocarbons, including some polychlorinated biphenyls and dioxins. Since small cetaceans often inhabit industrially polluted coastal waters, comparison of the molecular structure and function of this protein in cetaeans with other marine and mammalian species is important for evaluating the sensitivity of cetaceans to these pollutants. An AhR protein has been identified in beluga liver by photoaffinity labeling. In the present study, the authors sought to clone and sequence an AhR cDNA from beluga as a prelude to studying its structure and function, using reverse-transcription polymerasemore » chain reaction (RT-PCR) and degenerate primers, a 515 base pair fragment was amplified, cloned and sequenced, revealing homology to the PAS domain (ligand binding and dimerization region) of AhRs from terrestrial mammals. This portion of the putative beluga AhR has 82% amino acid and 81% nucleotide sequence identity to the mouse AhR, and 63% amino acid and 64% nucleotide sequence identity to an AhR from the marine fish Fundulus heteroclitus. A beluga cDNA library was synthesized and is currently being screened with the PCR-generated fragment to obtain the complete coding sequence. This is the first molecular evidence of AhR presence in cetaceans.« less

  16. Lipoxygenase in Caragana jubata responds to low temperature, abscisic acid, methyl jasmonate and salicylic acid.

    PubMed

    Bhardwaj, Pardeep Kumar; Kaur, Jagdeep; Sobti, Ranbir Chander; Ahuja, Paramvir Singh; Kumar, Sanjay

    2011-09-01

    Lipoxygenase (LOX) catalyses oxygenation of free polyunsaturated fatty acids into oxylipins, and is a critical enzyme of the jasmonate signaling pathway. LOX has been shown to be associated with biotic and abiotic stress responses in diverse plant species, though limited data is available with respect to low temperature and the associated cues. Using rapid amplification of cDNA ends, a full-length cDNA (CjLOX) encoding lipoxygenase was cloned from apical buds of Caragana jubata, a temperate plant species that grows under extreme cold. The cDNA obtained was 2952bp long consisting of an open reading frame of 2610bp encoding 869 amino acids protein. Multiple alignment of the deduced amino acid sequence with those of other plants demonstrated putative LH2/ PLAT domain, lipoxygenase iron binding catalytic domain and lipoxygenase_2 signature sequences. CjLOX exhibited up- and down-regulation of gene expression pattern in response to low temperature (LT), abscisic acid (ABA), methyl jasmonate (MJ) and salicylic acid (SA). Among all the treatments, a strong up-regulation was observed in response to MJ. Data suggests an important role of jasmonate signaling pathway in response to LT in C. jubata. Copyright © 2011 Elsevier B.V. All rights reserved.

  17. Cloning and characterisation of cDNA sequences encoding for anti-lipopolysaccharide factors (ALFs) in Brazilian palaemonid and penaeid shrimps.

    PubMed

    Rosa, Rafael Diego; Stoco, Patricia Hermes; Barracco, Margherita Anna

    2008-11-01

    Anti-lipopolysaccharide factors (ALFs) are antimicrobial peptides found in limulids and crustaceans that have a potent and broad range of antimicrobial activity. We report here the identification and molecular characterisation of new sequences encoding for ALFs in the haemocytes of the freshwater prawn Macrobrachium olfersi and also in two Brazilian penaeid species, Farfantepenaeus paulensis and Litopenaeus schmitti. All obtained sequences encoded for highly cationic peptides containing two conserved cysteine residues flanking a putative LPS-binding domain. They exhibited a significant amino acid similarity with crustacean and limulid ALF sequences, especially with those of penaeid shrimps. This is the first identification of ALF in a freshwater prawn.

  18. A general strategy for cloning viroids and other small circular RNAs that uses minimal amounts of template and does not require prior knowledge of its sequence.

    PubMed

    Navarro, B; Daròs, J A; Flores, R

    1996-01-01

    Two PCR-based methods are described for obtaining clones of small circular RNAs of unknown sequence and for which only minute amounts are available. To avoid introducing any assumption about the RNA sequence, synthesis of the cDNAs is initiated with random primers. The cDNA population is then PCR-amplified using a primer whose sequence is present at both sides of the cDNAs, since they have been obtained with random hexamers and then a linker with the sequence of the PCR primer has been ligated to their termini, or because the cDNAs have been synthesized with an oligonucleotide that contains the sequence of the PCR primer at its 5' end and six randomized positions at its 3' end. The procedures need only approximately 50 ng of purified RNA template. The reasons for the emergence of cloning artifacts and precautions to avoid them are discussed.

  19. Construction of a robust microarray from a non-model species (largemouth bass) using pyrosequencing technology

    PubMed Central

    Garcia-Reyero, Natàlia; Griffitt, Robert J.; Liu, Li; Kroll, Kevin J.; Farmerie, William G.; Barber, David S.; Denslow, Nancy D.

    2009-01-01

    A novel custom microarray for largemouth bass (Micropterus salmoides) was designed with sequences obtained from a normalized cDNA library using the 454 Life Sciences GS-20 pyrosequencer. This approach yielded in excess of 58 million bases of high-quality sequence. The sequence information was combined with 2,616 reads obtained by traditional suppressive subtractive hybridizations to derive a total of 31,391 unique sequences. Annotation and coding sequences were predicted for these transcripts where possible. 16,350 annotated transcripts were selected as target sequences for the design of the custom largemouth bass oligonucleotide microarray. The microarray was validated by examining the transcriptomic response in male largemouth bass exposed to 17β-œstradiol. Transcriptomic responses were assessed in liver and gonad, and indicated gene expression profiles typical of exposure to œstradiol. The results demonstrate the potential to rapidly create the tools necessary to assess large scale transcriptional responses in non-model species, paving the way for expanded impact of toxicogenomics in ecotoxicology. PMID:19936325

  20. RICD: a rice indica cDNA database resource for rice functional genomics.

    PubMed

    Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin

    2008-11-26

    The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  1. Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

    PubMed

    de Bellocq, J Goüy; Leirs, H

    2009-09-01

    Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

  2. Molecular cloning of crustins from the hemocytes of Brazilian penaeid shrimps.

    PubMed

    Rosa, Rafael Diego; Bandeira, Paula Terra; Barracco, Margherita Anna

    2007-09-01

    Crustins are antimicrobial peptides initially identified in the hemocytes of the crab Carcinus maenas (11.5-kDa peptide or carcinin) and recently also recognized in penaeid shrimps and other crustacean species. The aim of this study was to identify sequences encoding for crustins from the hemocytes of four Brazilian penaeid species: Farfantepenaeus paulensis, Farfantepenaeus subtilis, Farfantepenaeus brasiliensis and Litopenaeus schmitti. Using primers based on consensus nucleotide alignment of crustins from different crustaceans, cDNA sequences coding for crustins in all indigenous penaeid species were amplified. The obtained four crustin sequences encoded for peptides containing a hydrophobic N-terminal region rich in glycine repeats and a C-terminal part with 12 cysteine residues and a conserved whey acidic protein domain. All obtained crustin sequences showed high amino acidic similarity among each other and with crustins from litopenaeid shrimps (76-98%). This is the first report of crustins in native Brazilian penaeid shrimps.

  3. Complementary DNA libraries: an overview.

    PubMed

    Ying, Shao-Yao

    2004-07-01

    The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

  4. Transcriptome analysis by strand-specific sequencing of complementary DNA

    PubMed Central

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-01-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

  5. Transcriptome analysis by strand-specific sequencing of complementary DNA.

    PubMed

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-10-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

  6. Characterization of the venom from the Australian scorpion Urodacus yaschenkoi: Molecular mass analysis of components, cDNA sequences and peptides with antimicrobial activity.

    PubMed

    Luna-Ramírez, Karen; Quintero-Hernández, Veronica; Vargas-Jaimes, Leonel; Batista, Cesar V F; Winkel, Kenneth D; Possani, Lourival D

    2013-03-01

    The Urodacidae scorpions are the most widely distributed of the four families in Australia and represent half of the species in the continent, yet their venoms remain largely unstudied. This communication reports the first results of a proteome analysis of the venom of the scorpion Urodacus yaschenkoi performed by mass fingerprinting, after high performance liquid chromatography (HPLC) separation. A total of 74 fractions were obtained by HPLC separation allowing the identification of approximately 274 different molecular masses with molecular weights varying from 287 to 43,437 Da. The most abundant peptides were those from 1 K Da and 4-5 K Da representing antimicrobial peptides and putative potassium channel toxins, respectively. Three such peptides were chemically synthesized and tested against Gram-positive and Gram-negative bacteria showing minimum inhibitory concentration in the low micromolar range, but with moderate hemolytic activity. It also reports a transcriptome analysis of the venom glands of the same scorpion species, undertaken by constructing a cDNA library and conducting random sequencing screening of the transcripts. From the resultant cDNA library 172 expressed sequence tags (ESTs) were analyzed. These transcripts were further clustered into 120 unique sequences (23 contigs and 97 singlets). The identified putative proteins can be assorted in several groups, such as those implicated in common cellular processes, putative neurotoxins and antimicrobial peptides. The scorpion U. yaschenkoi is not known to be dangerous to humans and its venom contains peptides similar to those of Opisthacanthus cayaporum (antibacterial), Scorpio maurus palmatus (maurocalcin), Opistophthalmus carinatus (opistoporines) and Hadrurus gerstchi (scorpine-like molecules), amongst others. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Cloning, expression and activation of a truncated 92-kDa gelatinase minienzyme.

    PubMed

    Kröger, M; Tschesche, H

    1997-09-01

    The matrix metalloproteinases (MMPs) are a family of highly homologous zinc-endopeptidases that degrade extracellular matrix components. Human 92-kDa gelatinase (MMP-9) represents one of the MMPs that cleaves native collagen type IV. As a basis for structural investigations, the short form (catalytic domain, amino acid residues 113-450) of the 92-kDa gelatinase cDNA was cloned and expressed in E. coli as a minienzyme. By combination of reverse transcription (RT) and polymerase chain reaction (PCR), the truncated 92-kDa gelatinase-cDNA was amplified from the corresponding mRNA derived from ovarian carcinoma cells. The cDNA fragment obtained was cloned in E. coli and sequenced. With the exception of one nucleotide inversion at position 745 (gt-->tg) the cDNA sequence was identical to the nucleotide sequence of the 92-kDa gelatinase as has been previously reported. The protein was expressed in E. coli using the vector pET-12b. The recombinant protein was stored in inclusion bodies and extracted as a 38 kDa species from the inclusion bodies by solubilization in 8 M urea. The product was purified by affinity chromatography and gel filtration. Amino-terminal sequence analysis confirmed the identity with the catalytic domain of 92-kDa gelatinase. The recombinant protein was refolded in the presence of Ca2+ and Zn2+ and yielded an active minienzyme with gelatinolytic activity. It degrades the native substrate collagen type IV and the synthetic substrate Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 x AcOH like the full-length 92-kDa gelatinase. The catalytic activity could be inhibited by the specific MMP inhibitors TIMP-1 and TIMP-2.

  8. Characterization of the gene encoding the polymorphic immunodominant molecule, a neutralizing antigen of Theileria parva

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Toye, P.G.; Metzelaar, M.J.; Wijngaard, P.L.J.

    1995-08-01

    Theileria parva, a tick-transmitted protozoan parasite related to Plasmodium spp., causes the disease East Coast fever, an acute and usually fatal lymphoproliferative disorder of cattle in Africa. Previous studies using sera from cattle that have survived infection identified a polymorphic immunodominant molecule (PIM) that is expressed by both the infective sporozoite stage of the parasite and the intracellular schizont. Here we show that mAb specific for the PIM Ag can inhibit sporozoite invasion of lymphocytes in vitro. A cDNA clone encoding the PIM Ag of the T. parva (Muguga) stock was obtained by using these mAb in a novel eukaryoticmore » expression cloning system that allows isolation of cDNA encoding cytoplasmic or surface Ags. To establish the molecular basis of the polymorphism of PIM, the cDNA of the PIM Ag from a buffalo-derived T. parva stock was isolated and its sequence was compared with that of the cattle-derived Muguga PIM. The two cDNAs showed considerable identity in both the 5{prime} and 3{prime} regions, but there was substantial sequence divergence in the central regions. Several types of repeated sequences were identified in the variant regions. In the Muguga form of the molecule, there were five tandem repeats of the tetrapeptide, QPEP, that were shown, by transfection of a deleted version of the PIM gene, not to react with several anti-PIM mAbs. By isolating and sequencing the genomic version of the gene, we identified two small introns in the 3{prime} region of the gene. Finally, we showed that polyclonal rat Abs against recombinant PIM neutralize sporozoite infectivity in vitro, suggesting that the PIM Ag should be evaluated for its capacity to immunize cattle against East Coast Fever.« less

  9. Beta-keratins of differentiating epidermis of snake comprise glycine-proline-serine-rich proteins with an avian-like gene organization.

    PubMed

    Dalla Valle, Luisa; Nardi, Alessia; Belvedere, Paola; Toni, Mattia; Alibardi, Lorenzo

    2007-07-01

    Beta-keratins of reptilian scales have been recently cloned and characterized in some lizards. Here we report for the first time the sequence of some beta-keratins from the snake Elaphe guttata. Five different cDNAs were obtained using 5'- and 3'-RACE analyses. Four sequences differ by only few nucleotides in the coding region, whereas the last cDNA shows, in this region, only 84% of identity. The gene corresponding to one of the cDNA sequences has a single intron present in the 5'-untranslated region. This genomic organization is similar to that of birds' beta-keratins. Cloning and Southern blotting analysis suggest that snake beta-keratins belong to a family of high-related genes as for geckos. PCR analysis suggests a head-to-tail orientation of genes in the same chromosome. In situ hybridization detected beta-keratin transcripts almost exclusively in differentiating oberhautchen and beta-cells of the snake epidermis in renewal phase. This is confirmed by Northern blotting that showed, in this phase, a high expression of two different transcripts whereas only the longer transcript is expressed at a much lower level in resting skin. The cDNA coding sequences encoded putative glycine-proline-serine rich proteins containing 137-139 amino acids, with apparent isoelectric point at 7.5 and 8.2. A central region, rich in proline, shows over 50% homology with avian scale, claw, and feather keratins. The prediction of secondary structure shows mainly a random coil conformation and few beta-strand regions in the central region, likely involved in the formation of a fibrous framework of beta-keratins. This region was possibly present in basic reptiles that originated reptiles and birds. Copyright 2007 Wiley-Liss, Inc.

  10. Nucleotide sequence and regulatory studies of VGF, a nervous system-specific mRNA that is rapidly and relatively selectively induced by nerve growth factor.

    PubMed

    Salton, S R

    1991-09-01

    A nervous system-specific mRNA that is rapidly induced in PC12 cells to a greater extent by nerve growth factor (NGF) than by epidermal growth factor treatment has been cloned. The polypeptide deduced from the nucleic acid sequence of the NGF33.1 cDNA clone contains regions of amino acid sequence identity with that predicted by the cDNA clone VGF, and further analysis suggests that both NGF33.1 and VGF cDNA clones very likely correspond to the same mRNA (VGF). In this report both the nucleic acid sequence that corresponds to VGF mRNA and the polypeptide predicted by the NGF33.1 cDNA clone are presented. Genomic Southern analysis and database comparison did not detect additional sequences with high homology to the VGF gene. Induction of VGF mRNA by depolarization and phorbol 12-myristate 13-acetate treatment was greater than by serum stimulation or protein kinase A pathway activation. These studies suggest that VGF mRNA is induced to the greatest extent by NGF treatment and that VGF is one of the most rapidly regulated neuronal mRNAs identified in PC12 cells.

  11. Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

    PubMed

    Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

    1997-06-05

    We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

  12. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  13. Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

    PubMed

    Lu, L; Komada, M; Kitamura, N

    1998-06-15

    Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

  14. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

    PubMed Central

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

    2016-01-01

    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leong, JoAnn Ching

    The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

  16. Molecular analysis of ARF1 expression profiles during development of physic nut (Jatropha curcas L.).

    PubMed

    Qin, Xiaobo; Lin, Fanrong; Lii, Yifan; Gou, Chunbao; Chen, Fang

    2011-03-01

    A cDNA clone designated arf1 was isolated from a physic nut (Jatropha curcas L.) endosperm cDNA library which encodes a small GTP-binding protein and has significant homology to ADP-ribosylation factors (ARF) in plants, animals and microbes. The cDNA contains an open reading frame that encodes a polypeptide of 181 amino acids with a calculated molecular mass of 20.7 kDa. The deduced amino acid sequence showed high homology to known ARFs from other organisms. The products of the arf1 obtained by overexpression in E. coli revealed the specific binding activity toward GTP. The expression of arf1 was observed in flowers, roots, stems and leaves as analyzed by RT-PCR, and its transcriptional level was highest in flowers. In particular, the accumulation of arf1 transcripts was different under various environmental stresses in seedlings. The results suggest that arf1 plays distinct physiological roles in Jatropha curcas cells.

  17. The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

    PubMed Central

    Craig, R K; Hall, L; Parker, D; Campbell, P N

    1981-01-01

    A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

  18. Sequence, molecular properties, and chromosomal mapping of mouse lumican

    NASA Technical Reports Server (NTRS)

    Funderburgh, J. L.; Funderburgh, M. L.; Hevelone, N. D.; Stech, M. E.; Justice, M. J.; Liu, C. Y.; Kao, W. W.; Conrad, G. W.; Spooner, B. S. (Principal Investigator)

    1995-01-01

    PURPOSE. Lumican is a major proteoglycan of vertebrate cornea. This study characterizes mouse lumican, its molecular form, cDNA sequence, and chromosomal localization. METHODS. Lumican sequence was determined from cDNA clones selected from a mouse corneal cDNA expression library using a bovine lumican cDNA probe. Tissue expression and size of lumican mRNA were determined using Northern hybridization. Glycosidase digestion followed by Western blot analysis provided characterization of molecular properties of purified mouse corneal lumican. Chromosomal mapping of the lumican gene (Lcn) used Southern hybridization of a panel of genomic DNAs from an interspecific murine backcross. RESULTS. Mouse lumican is a 338-amino acid protein with high-sequence identity to bovine and chicken lumican proteins. The N-terminus of the lumican protein contains consensus sequences for tyrosine sulfation. A 1.9-kb lumican mRNA is present in cornea and several other tissues. Antibody against bovine lumican reacted with recombinant mouse lumican expressed in Escherichia coli and also detected high molecular weight proteoglycans in extracts of mouse cornea. Keratanase digestion of corneal proteoglycans released lumican protein, demonstrating the presence of sulfated keratan sulfate chains on mouse corneal lumican in vivo. The lumican gene (Lcn) was mapped to the distal region of mouse chromosome 10. The Lcn map site is in the region of a previously identified developmental mutant, eye blebs, affecting corneal morphology. CONCLUSIONS. This study demonstrates sulfated keratan sulfate proteoglycan in mouse cornea and describes the tools (antibodies and cDNA) necessary to investigate the functional role of this important corneal molecule using naturally occurring and induced mutants of the murine lumican gene.

  19. Generation of a total of 6483 expressed sequence tags from 60 day-old bovine whole fetus and fetal placenta.

    PubMed

    Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y

    2004-05-01

    Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.

  20. Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)

    PubMed Central

    2011-01-01

    Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559

  1. Purification, characterization, and cDNA cloning of a novel acidic endoglycoceramidase from the jellyfish, Cyanea nozakii.

    PubMed

    Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M

    2000-10-06

    Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.

  2. Isolation and bacterial expression of a sesquiterpene synthase CDNA clone from peppermint(mentha .chi. piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Crock, John E.

    1999-01-01

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-farnesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-farnesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  3. Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    DOEpatents

    Croteau, Rodney Bruce; Crock, John E.

    2005-01-25

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-famesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-famesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  4. Assignment of the human caltractin gene (CALT) to Xq28 by fluorescence in situ hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Tanaka; Okui, Keiko; Nakamura, Yusuke

    1994-12-01

    The centrosome is the major microtubule-organizing center of interphase eukaryotic cells, an its duplication is essential to eukaryotic cell division. Caltractin, a structural component of centrosomes, is highly homologous in amino acid sequence to the product of the CDC31 gene of Saccharomyces cerevisiae. In S. cerevisiae, an important role for CDC31 in duplication of the spindle pole body (SPB), a kind of microtubule-organizing center, has been demonstrated by an experiment in which mutant CDC31 prevented SPB duplication and led to formation of a monopolar spindle. In view of the localization of human caltractin in centrosomes and the sequence homology itmore » bears to yeast CDC31, it is reasonable to assume that caltractin functions in humans as CDC31 does in yeast. As a part of the Human Genome Project, we have been determining nucleotide sequences of DNA clones randomly selected from a directionally cloned cDNA library constructed from fetal brain mRNA obtained from Clontech (La Jolla, CA). By comparing 5{prime} partial DNA sequences of these cDNA clones with known DNA sequences in the database, we found one clone that was highly homologous to the caltractin gene of Chlamydomonas, which turned out to be the same as a human gene identified recently. 4 refs., 1 fig.« less

  5. From biomedicine to natural history research: EST resources for ambystomatid salamanders

    PubMed Central

    Putta, Srikrishna; Smith, Jeramiah J; Walker, John A; Rondet, Mathieu; Weisrock, David W; Monaghan, James; Samuels, Amy K; Kump, Kevin; King, David C; Maness, Nicholas J; Habermann, Bianca; Tanaka, Elly; Bryant, Susan V; Gardiner, David M; Parichy, David M; Voss, S Randal

    2004-01-01

    Background Establishing genomic resources for closely related species will provide comparative insights that are crucial for understanding diversity and variability at multiple levels of biological organization. We developed ESTs for Mexican axolotl (Ambystoma mexicanum) and Eastern tiger salamander (A. tigrinum tigrinum), species with deep and diverse research histories. Results Approximately 40,000 quality cDNA sequences were isolated for these species from various tissues, including regenerating limb and tail. These sequences and an existing set of 16,030 cDNA sequences for A. mexicanum were processed to yield 35,413 and 20,599 high quality ESTs for A. mexicanum and A. t. tigrinum, respectively. Because the A. t. tigrinum ESTs were obtained primarily from a normalized library, an approximately equal number of contigs were obtained for each species, with 21,091 unique contigs identified overall. The 10,592 contigs that showed significant similarity to sequences from the human RefSeq database reflected a diverse array of molecular functions and biological processes, with many corresponding to genes expressed during spinal cord injury in rat and fin regeneration in zebrafish. To demonstrate the utility of these EST resources, we searched databases to identify probes for regeneration research, characterized intra- and interspecific nucleotide polymorphism, saturated a human – Ambystoma synteny group with marker loci, and extended PCR primer sets designed for A. mexicanum / A. t. tigrinum orthologues to a related tiger salamander species. Conclusions Our study highlights the value of developing resources in traditional model systems where the likelihood of information transfer to multiple, closely related taxa is high, thus simultaneously enabling both laboratory and natural history research. PMID:15310388

  6. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    PubMed Central

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

  7. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    DTIC Science & Technology

    1987-10-13

    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  8. An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl desaturase homolog

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van De Loo, F.J.; Broun, P.; Turner, S.

    1995-07-18

    Recent spectroscopic evidence implicating a binuclear iron site at the reaction center of fatty acyl desaturases suggested to us that certain fatty acyl hydroxylases may share significant amino acid sequence similarity with desaturases. To test this theory, we prepared a cDNA library from developing endosperm of the castor-oil plant (Ricinus communis L.) and obtained partial nucleotide sequences for 468 anonymous clones that were not expressed at high levels in leaves, a tissue deficient in 12-hydroxyoleic acid. This resulted in the identification of several cDNA clones encoding a polypeptide of 387 amino acids with a predicted molecular weight of 44,407 andmore » with {approx}67% sequence homology to microsomal oleate desaturase from Arabidopsis. Expression of a full-length clone under control of the cauliflower mosaic virus 35S promoter in transgenic tobacco resulted in the accumulation of low levels of 12-hydroxyoleic acid in seeds, indicating that the clone encodes the castor oleate hydroxylase. These results suggest that fatty acyl desaturases and hydroxylases share similar reaction mechanisms and provide an example of enzyme evolution. 26 refs., 6 figs., 1 tab.« less

  9. A novel gene, RSD-3/HSD-3.1, encodes a meiotic-related protein expressed in rat and human testis.

    PubMed

    Zhang, Xiaodong; Liu, Huixian; Zhang, Yan; Qiao, Yuan; Miao, Shiying; Wang, Linfang; Zhang, Jianchao; Zong, Shudong; Koide, S S

    2003-06-01

    The expression of stage-specific genes during spermatogenesis was determined by isolating two segments of rat seminiferous tubule at different stages of the germinal epithelium cycle delineated by transillumination-delineated microdissection, combined with differential display polymerase chain reaction to identify the differential transcripts formed. A total of 22 cDNAs were identified and accepted by GenBank as new expressed sequence tags. One of the expressed sequence tags was radiolabeled and used as a probe to screen a rat testis cDNA library. A novel full-length cDNA composed of 2228 bp, designated as RSD-3 (rat sperm DNA no.3, GenBank accession no. AF094609) was isolated and characterized. The reading frame encodes a polypeptide consisting of 526 amino acid residues, containing a number of DNA binding motifs and phosphorylation sites for PKC, CK-II, and p34cdc2. Northern blot of mRNA prepared from various tissues of adult rats showed that RSD-3 is expressed only in the testis. The initial expression of the RSD-3 gene was detected in the testis on the 30th postnatal day and attained adult level on the 60th postnatal day. Immunolocalization of RSD-3 in germ cells of rat testis showed that its expression is restricted to primary spermatocytes, undergoing meiosis division I. A human testis homologue of RSD-3 cDNA, designated as HSD-3.1 (GenBank accession no. AF144487) was isolated by screening the Human Testis Rapid-Screen arrayed cDNA library panels by RT-PCR. The exon-intron boundaries of HSD-3.1 gene were determined by aligning the cDNA sequence with the corresponding genome sequence. The cDNA consisted of 12 exons that span approximately 52.8 kb of the genome sequence and was mapped to chromosome 14q31.3.

  10. Molecular cloning and 3D model of first cytochrome P450 from CYP3A subfamily in saltwater crocodile (Crocodylus porosus).

    PubMed

    Tabassum, Rabia

    2017-10-18

    Cytochrome P450s (CYPs) play critical role in oxidative metabolism of numerous xenobiotics and endogenous compounds. The first CYP3A subfamily member in saltwater crocodile has been cloned and modelled for three-dimensional (3D) structure. The full-length cDNA was obtained employing reverse transcription polymerase chain reaction (RT-PCR) strategy and rapid amplification of cDNA ends (RACE). The cDNA sequence of 1659 nucleotides includes 132 nucleotides from 5' untranslated region (UTR), an open reading frame of 1527 nucleotides encoding 509 amino acids designated as CYP3A163. The alignment of CYP3A163 sequence with CYP3A subfamily across the lineages exhibit the loss of 1 residue in birds and 7 residues in mammals in comparison to reptiles suggesting the adaptation processes during evolution. The amino acid identity of CYP3A163 with Alligator mississippiensis CYP3A77 and Homo sapiens CYP3A4 is 91% and 62% respectively. The 3D structure of CYP3A163 modelled using human CYP3A4 structure as a template with Phyre 2 software, represents high similarity with its functionally important motifs and catalytic domain. Both sequence and structure of CYP3A163 display the common and conserved features of CYP3A subfamily. Overall, this study provides primary molecular and structural data of CYP3A163 required to investigate the xenobiotic metabolism in saltwater crocodiles. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Cross-referencing yeast genetics and mammalian genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hieter, P.; Basset, D.; Boguski, M.

    1994-09-01

    We have initiated a project that will systematically transfer information about yeast genes onto the genetic maps of mice and human beings. Rapidly expanding human EST data will serve as a source of candidate human homologs that will be repeatedly searched using yeast protein sequence queries. Search results will be automatically reported to participating labs. Human cDNA sequences from which the ESTs are derived will be mapped at high resolution in the human and mouse genomes. The comparative mapping information cross-references the genomic position of novel human cDNAs with functional information known about the cognate yeast genes. This should facilitatemore » the initial identification of genes responsible for mammalian mutant phenotypes, including human disease. In addition, the identification of mammalian homologs of yeast genes provides reagents for determining evolutionary conservation and for performing direct experiments in multicellular eukaryotes to enhance study of the yeast protein`s function. For example, ESTs homologous to CDC27 and CDC16 were identified, and the corresponding cDNA clones were obtained from ATTC, completely sequenced, and mapped on human and mouse chromosomes. In addition, the CDC17hs cDNA has been used to raise antisera to the CDC27Hs protein and used in subcellular localization experiments and junctional studies in mammalian cells. We have received funding from the National Center for Human Genome Research to provide a community resource which will establish comprehensive cross-referencing among yeast, human, and mouse loci. The project is set up as a service and information on how to communicate with this effort will be provided.« less

  12. Isolation and expression analysis of cDNAs that are associated with alternate bearing in Olea europaea L. cv. Ayvalık

    PubMed Central

    2013-01-01

    Background Olive cDNA libraries to isolate candidate genes that can help enlightening the molecular mechanism of periodicity and / or fruit production were constructed and analyzed. For this purpose, cDNA libraries from the leaves of trees in “on year” and in “off year” in July (when fruits start to appear) and in November (harvest time) were constructed. Randomly selected 100 positive clones from each library were analyzed with respect to sequence and size. A fruit-flesh cDNA library was also constructed and characterized to confirm the reliability of each library’s temporal and spatial properties. Results Quantitative real-time RT-PCR (qRT-PCR) analyses of the cDNA libraries confirmed cDNA molecules that are associated with different developmental stages (e. g. “on year” leaves in July, “off year” leaves in July, leaves in November) and fruits. Hence, a number of candidate cDNAs associated with “on year” and “off year” were isolated. Comparison of the detected cDNAs to the current EST database of GenBank along with other non - redundant databases of NCBI revealed homologs of previously described genes along with several unknown cDNAs. Of around 500 screened cDNAs, 48 cDNA elements were obtained after eliminating ribosomal RNA sequences. These independent transcripts were analyzed using BLAST searches (cutoff E-value of 1.0E-5) against the KEGG and GenBank nucleotide databases and 37 putative transcripts corresponding to known gene functions were annotated with gene names and Gene Ontology (GO) terms. Transcripts in the biological process were found to be related with metabolic process (27%), cellular process (23%), response to stimulus (17%), localization process (8.5%), multicellular organismal process (6.25%), developmental process (6.25%) and reproduction (4.2%). Conclusions A putative P450 monooxigenase expressed fivefold more in the “on year” than that of “off year” leaves in July. Two putative dehydrins expressed significantly more in “on year” leaves than that of “off year” leaves in November. Homologs of UDP – glucose epimerase, acyl - CoA binding protein, triose phosphate isomerase and a putative nuclear core anchor protein were significant in fruits only, while a homolog of an embryo binding protein / small GTPase regulator was detected in “on year” leaves only. One of the two unknown cDNAs was specific to leaves in July while the other was detected in all of the libraries except fruits. KEGG pathway analyses for the obtained sequences correlated with essential metabolisms such as galactose metabolism, amino sugar and nucleotide sugar metabolisms and photosynthesis. Detailed analysis of the results presents candidate cDNAs that can be used to dissect further the genetic basis of fruit production and / or alternate bearing which causes significant economical loss for olive growers. PMID:23552171

  13. A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library.

    PubMed

    Waugh, Caryll; Cromer, Deborah; Grimm, Andrew; Chopra, Abha; Mallal, Simon; Davenport, Miles; Mak, Johnson

    2015-04-09

    Massive, parallel sequencing is a potent tool for dissecting the regulation of biological processes by revealing the dynamics of the cellular RNA profile under different conditions. Similarly, massive, parallel sequencing can be used to reveal the complexity of viral quasispecies that are often found in the RNA virus infected host. However, the production of cDNA libraries for next-generation sequencing (NGS) necessitates the reverse transcription of RNA into cDNA and the amplification of the cDNA template using PCR, which may introduce artefact in the form of phantom nucleic acids species that can bias the composition and interpretation of original RNA profiles. Using HIV as a model we have characterised the major sources of error during the conversion of viral RNA to cDNA, namely excess RNA template and the RNaseH activity of the polymerase enzyme, reverse transcriptase. In addition we have analysed the effect of PCR cycle on detection of recombinants and assessed the contribution of transfection of highly similar plasmid DNA to the formation of recombinant species during the production of our control viruses. We have identified RNA template concentrations, RNaseH activity of reverse transcriptase, and PCR conditions as key parameters that must be carefully optimised to minimise chimeric artefacts. Using our optimised RT-PCR conditions, in combination with our modified PCR amplification procedure, we have developed a reliable technique for accurate determination of RNA species using NGS technology.

  14. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    PubMed

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

    2005-01-01

    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  15. Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.

    PubMed

    Pietrowski, D; Förster, M

    2000-01-01

    The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

  16. Development and Application of a Salmonid EST Database and cDNA Microarray: Data Mining and Interspecific Hybridization Characteristics

    PubMed Central

    Rise, Matthew L.; von Schalburg, Kristian R.; Brown, Gordon D.; Mawer, Melanie A.; Devlin, Robert H.; Kuipers, Nathanael; Busby, Maura; Beetz-Sargent, Marianne; Alberto, Roberto; Gibbs, A. Ross; Hunt, Peter; Shukin, Robert; Zeznik, Jeffrey A.; Nelson, Colleen; Jones, Simon R.M.; Smailus, Duane E.; Jones, Steven J.M.; Schein, Jacqueline E.; Marra, Marco A.; Butterfield, Yaron S.N.; Stott, Jeff M.; Ng, Siemon H.S.; Davidson, William S.; Koop, Ben F.

    2004-01-01

    We report 80,388 ESTs from 23 Atlantic salmon (Salmo salar) cDNA libraries (61,819 ESTs), 6 rainbow trout (Oncorhynchus mykiss) cDNA libraries (14,544 ESTs), 2 chinook salmon (Oncorhynchus tshawytscha) cDNA libraries (1317 ESTs), 2 sockeye salmon (Oncorhynchus nerka) cDNA libraries (1243 ESTs), and 2 lake whitefish (Coregonus clupeaformis) cDNA libraries (1465 ESTs). The majority of these are 3′ sequences, allowing discrimination between paralogs arising from a recent genome duplication in the salmonid lineage. Sequence assembly reveals 28,710 different S. salar, 8981 O. mykiss, 1085 O. tshawytscha, 520 O. nerka, and 1176 C. clupeaformis putative transcripts. We annotate the submitted portion of our EST database by molecular function. Higher- and lower-molecular-weight fractions of libraries are shown to contain distinct gene sets, and higher rates of gene discovery are associated with higher-molecular weight libraries. Pyloric caecum library group annotations indicate this organ may function in redox control and as a barrier against systemic uptake of xenobiotics. A microarray is described, containing 7356 salmonid elements representing 3557 different cDNAs. Analyses of cross-species hybridizations to this cDNA microarray indicate that this resource may be used for studies involving all salmonids. PMID:14962987

  17. Deletions of fetal and adult muscle cDNA in Duchenne and Becker muscular dystrophy patients.

    PubMed Central

    Cross, G S; Speer, A; Rosenthal, A; Forrest, S M; Smith, T J; Edwards, Y; Flint, T; Hill, D; Davies, K E

    1987-01-01

    We have isolated a cDNA molecule from a human adult muscle cDNA library which is deleted in several Duchenne muscular dystrophy patients. Patient deletions have been used to map the exons across the Xp21 region of the short arm of the X chromosome. We demonstrate that a very mildly affected 61 year old patient is deleted for at least nine exons of the adult cDNA. We find no evidence for differential exon usage between adult and fetal muscle in this region of the gene. There must therefore be less essential domains of the protein structure which can be removed without complete loss of function. The sequence of 2.0 kb of the adult cDNA shows no homology to any previously described protein listed in the data banks although sequence comparison at the amino acid level suggests that the protein has a structure not dissimilar to rod structures of cytoskeletal proteins such as lamin and myosin. There are single nucleotide differences in the DNA sequence between the adult and fetal cDNAs which result in amino acid changes but none that would be predicted to change the structure of the protein dramatically. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 7. PMID:3428261

  18. Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

    PubMed

    Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

    1999-09-01

    We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

  19. Metatranscriptomics of Soil Eukaryotic Communities.

    PubMed

    Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2016-01-01

    Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

  20. Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

    PubMed Central

    Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

    1982-01-01

    We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

  1. Ranalexin. A novel antimicrobial peptide from bullfrog (Rana catesbeiana) skin, structurally related to the bacterial antibiotic, polymyxin.

    PubMed

    Clark, D P; Durell, S; Maloy, W L; Zasloff, M

    1994-04-08

    Antimicrobial peptides comprise a diverse class of molecules used in host defense by plants, insects, and animals. In this study we have isolated a novel antimicrobial peptide from the skin of the bullfrog, Rana catesbeiana. This 20 amino acid peptide, which we have termed Ranalexin, has the amino acid sequence: NH2-Phe-Leu-Gly-Gly-Leu-Ile-Lys-Ile-Val-Pro-Ala-Met-Ile-Cys-Ala-Val-Thr- Lys-Lys - Cys-COOH, and it contains a single intramolecular disulfide bond which forms a heptapeptide ring within the molecule. Structurally, Ranalexin resembles the bacterial antibiotic, polymyxin, which contains a similar heptapeptide ring. We have also cloned the cDNA for Ranalexin from a metamorphic R. catesbeiana tadpole cDNA library. Based on the cDNA sequence, it appears that Ranalexin is initially synthesized as a propeptide with a putative signal sequence and an acidic amino acid-rich region at its amino-terminal end. Interestingly, the putative signal sequence of the Ranalexin cDNA is strikingly similar to the signal sequence of opioid peptide precursors isolated from the skin of the South American frogs Phyllomedusa sauvagei and Phyllomedusa bicolor. Northern blot analysis and in situ hybridization experiments demonstrated that Ranalexin mRNA is first expressed in R. catesbeiana skin at metamorphosis and continues to be expressed into adulthood.

  2. Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.

    PubMed

    Judelson, H S; Michelmore, R W

    1990-01-01

    Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.

  3. Normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  4. Normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1997-06-10

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  5. A Bowman-Birk protease inhibitor purified, cloned, sequenced and characterized from the seeds of Maclura pomifera (Raf.) Schneid.

    PubMed

    Indarte, Martín; Lazza, Cristian M; Assis, Diego; Caffini, Néstor O; Juliano, María A; Avilés, Francesc X; Daura, Xavier; López, Laura M I; Trejo, Sebastián A

    2017-02-01

    A new BBI-type protease inhibitor with remarkable structural characteristics was purified, cloned, and sequenced from seeds of Maclura pomifera , a dicotyledonous plant belonging to the Moraceae family. In this work, we report a Bowman-Birk inhibitor (BBI) isolated, purified, cloned, and characterized from Maclura pomifera seeds (MpBBI), the first of this type from a species belonging to Moraceae family. MpBBI was purified to homogeneity by RP-HPLC, total RNA was extracted from seeds of M. pomifera, and the 3'RACE-PCR method was applied to obtain the cDNA, which was cloned and sequenced. Peptide mass fingerprinting (PMF) analysis showed correspondence between the in silico-translated protein and MpBBI, confirming that it corresponds to a new plant protease inhibitor. The obtained cDNA encoded a polypeptide of 65 residues and possesses 10 cysteine residues, with molecular mass of 7379.27, pI 6.10, and extinction molar coefficient of 9105 M -1  cm -1 . MpBBI inhibits strongly trypsin with K i in the 10 -10 M range and was stable in a wide array of pH and extreme temperatures. MpBBI comparative modeling was applied to gain insight into its 3D structure and highlighted some distinguishing features: (1) two non-identical loops, (2) loop 1 (CEEESRC) is completely different from any known BBI, and (3) the amount of disulphide bonds is also different from any reported BBI from dicot plants.

  6. Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

    PubMed

    Ken, C F; Lin, C T; Wu, J L; Shaw, J F

    2000-06-01

    A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

  7. Characterization of a cDNA encoding a protein involved in formation of the skeleton during development of the sea urchin Lytechinus pictus.

    PubMed

    Livingston, B T; Shaw, R; Bailey, A; Wilt, F

    1991-12-01

    In order to investigate the role of proteins in the formation of mineralized tissues during development, we have isolated a cDNA that encodes a protein that is a component of the organic matrix of the skeletal spicule of the sea urchin, Lytechinus pictus. The expression of the RNA encoding this protein is regulated over development and is localized to the descendents of the micromere lineage. Comparison of the sequence of this cDNA to homologous cDNAs from other species of urchin reveal that the protein is basic and contains three conserved structural motifs: a signal peptide, a proline-rich region, and an unusual region composed of a series of direct repeats. Studies on the protein encoded by this cDNA confirm the predicted reading frame deduced from the nucleotide sequence and show that the protein is secreted and not glycosylated. Comparison of the amino acid sequence to databases reveal that the repeat domain is similar to proteins that form a unique beta-spiral supersecondary structure.

  8. Identification of novel and known oocyte-specific genes using complementary DNA subtraction and microarray analysis in three different species.

    PubMed

    Vallée, Maud; Gravel, Catherine; Palin, Marie-France; Reghenas, Hélène; Stothard, Paul; Wishart, David S; Sirard, Marc-André

    2005-07-01

    The main objective of the present study was to identify novel oocyte-specific genes in three different species: bovine, mouse, and Xenopus laevis. To achieve this goal, two powerful technologies were combined: a polymerase chain reaction (PCR)-based cDNA subtraction, and cDNA microarrays. Three subtractive libraries consisting of 3456 clones were established and enriched for oocyte-specific transcripts. Sequencing analysis of the positive insert-containing clones resulted in the following classification: 53% of the clones corresponded to known cDNAs, 26% were classified as uncharacterized cDNAs, and a final 9% were classified as novel sequences. All these clones were used for cDNA microarray preparation. Results from these microarray analyses revealed that in addition to already known oocyte-specific genes, such as GDF9, BMP15, and ZP, known genes with unknown function in the oocyte were identified, such as a MLF1-interacting protein (MLF1IP), B-cell translocation gene 4 (BTG4), and phosphotyrosine-binding protein (xPTB). Furthermore, 15 novel oocyte-specific genes were validated by reverse transcription-PCR to confirm their preferential expression in the oocyte compared to somatic tissues. The results obtained in the present study confirmed that microarray analysis is a robust technique to identify true positives from the suppressive subtractive hybridization experiment. Furthermore, obtaining oocyte-specific genes from three species simultaneously allowed us to look at important genes that are conserved across species. Further characterization of these novel oocyte-specific genes will lead to a better understanding of the molecular mechanisms related to the unique functions found in the oocyte.

  9. Plant fatty acid hydroxylases

    DOEpatents

    Somerville, Chris; Broun, Pierre; van de Loo, Frank

    2001-01-01

    This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

  10. Mass fingerprinting of the venom and transcriptome of venom gland of scorpion Centruroides tecomanus.

    PubMed

    Valdez-Velázquez, Laura L; Quintero-Hernández, Verónica; Romero-Gutiérrez, Maria Teresa; Coronas, Fredy I V; Possani, Lourival D

    2013-01-01

    Centruroides tecomanus is a Mexican scorpion endemic of the State of Colima, that causes human fatalities. This communication describes a proteome analysis obtained from milked venom and a transcriptome analysis from a cDNA library constructed from two pairs of venom glands of this scorpion. High perfomance liquid chromatography separation of soluble venom produced 80 fractions, from which at least 104 individual components were identified by mass spectrometry analysis, showing to contain molecular masses from 259 to 44,392 Da. Most of these components are within the expected molecular masses for Na(+)- and K(+)-channel specific toxic peptides, supporting the clinical findings of intoxication, when humans are stung by this scorpion. From the cDNA library 162 clones were randomly chosen, from which 130 sequences of good quality were identified and were clustered in 28 contigs containing, each, two or more expressed sequence tags (EST) and 49 singlets with only one EST. Deduced amino acid sequence analysis from 53% of the total ESTs showed that 81% (24 sequences) are similar to known toxic peptides that affect Na(+)-channel activity, and 19% (7 unique sequences) are similar to K(+)-channel especific toxins. Out of the 31 sequences, at least 8 peptides were confirmed by direct Edman degradation, using components isolated directly from the venom. The remaining 19%, 4%, 4%, 15% and 5% of the ESTs correspond respectively to proteins involved in cellular processes, antimicrobial peptides, venom components, proteins without defined function and sequences without similarity in databases. Among the cloned genes are those similar to metalloproteinases.

  11. Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.

    PubMed Central

    Newsome, A L; McLean, J W; Lively, M O

    1992-01-01

    Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959

  12. 1,4-Benzoquinone reductase from Phanerochaete chrysosporium: cDNA cloning and regulation of expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akileswaran, L.; Brock, B.J.; Cereghino, J.L.

    1999-02-01

    A cDNA clone encoding a quinone reductase (QR) from the white rot basidiomycete Phanerochaete chrysosporium was isolated and sequenced. The cDNA consisted of 1,007 nucleotides and a poly(A) tail and encoded a deduced protein containing 271 amino acids. The experimentally determined eight-amino-acid N-germinal sequence of the purified QR protein from P. chrysosporium matched amino acids 72 to 79 of the predicted translation product of the cDNA. The M{sub r} of the predicted translation product, beginning with Pro-72, was essentially identical to the experimentally determined M{sub r} of one monomer of the QR dimer, and this finding suggested that QR ismore » synthesized as a proenzyme. The results of in vitro transcription-translation experiments suggested that QR is synthesized as a proenzyme with a 71-amino-acid leader sequence. This leader sequence contains two potential KEX2 cleavage sites and numerous potential cleavage sites for dipeptidyl aminopeptidase. The QR activity in cultures of P. chrysosporium increased following the addition of 2-dimethoxybenzoquinone, vanillic acid, or several other aromatic compounds. An immunoblot analysis indicated that induction resulted in an increase in the amount of QR protein, and a Northern blot analysis indicated that this regulation occurs at the level of the qr mRNA.« less

  13. Complete nucleotide and derived amino acid sequence of cDNA encoding the mitochondrial uncoupling protein of rat brown adipose tissue: lack of a mitochondrial targeting presequence.

    PubMed Central

    Ridley, R G; Patel, H V; Gerber, G E; Morton, R C; Freeman, K B

    1986-01-01

    A cDNA clone spanning the entire amino acid sequence of the nuclear-encoded uncoupling protein of rat brown adipose tissue mitochondria has been isolated and sequenced. With the exception of the N-terminal methionine the deduced N-terminus of the newly synthesized uncoupling protein is identical to the N-terminal 30 amino acids of the native uncoupling protein as determined by protein sequencing. This proves that the protein contains no N-terminal mitochondrial targeting prepiece and that a targeting region must reside within the amino acid sequence of the mature protein. Images PMID:3012461

  14. Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

    PubMed

    Stevens, Mark; Viganó, Felicita

    2007-04-01

    The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

  15. Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis.

    PubMed

    Kong, Hee Jeong; Cho, Hyun Kook; Park, Eun-Mi; Hong, Gyeong-Eun; Kim, Young-Ok; Nam, Bo-Hye; Kim, Woo-Jin; Lee, Sang-Jun; Han, Hyon Sob; Jang, In-Kwon; Lee, Chang Hoon; Cheong, Jaehun; Choi, Tae-Jin

    2009-01-01

    Proteinase inhibitors play important roles in host defence systems involving blood coagulation and pathogen digestion. We isolated and characterized a cDNA clone for a Kazal-type proteinase inhibitor (KPI) from a hemocyte cDNA library of the oriental white shrimp Fenneropenaeus chinensis. The KPI gene consists of three exons and two introns. KPI cDNA contains an open reading frame of 396 bp, a polyadenylation signal sequence AATAAA, and a poly (A) tail. KPI cDNA encodes a polypeptide of 131 amino acids with a putative signal peptide of 21 amino acids. The deduced amino acid sequence of KPI contains two homologous Kazal domains, each with six conserved cysteine residues. The mRNA of KPI is expressed in the hemocytes of healthy shrimp, and the higher expression of KPI transcript is observed in shrimp infected with the white spot syndrome virus (WSSV), suggesting a potential role for KPI in host defence mechanisms.

  16. Sequence characterization of cDNA sequence of encoding of an antimicrobial Peptide with no disulfide bridge from the Iranian mesobuthus eupeus venomous glands.

    PubMed

    Farajzadeh-Sheikh, Ahmad; Jolodar, Abbas; Ghaemmaghami, Shamsedin

    2013-01-01

    Scorpion venom glands produce some antimicrobial peptides (AMP) that can rapidly kill a broad range of microbes and have additional activities that impact on the quality and effectiveness of innate responses and inflammation. In this study, we reported the identification of a cDNA sequence encoding cysteine-free antimicrobial peptides isolated from venomous glands of this species. Total RNA was extracted from the Iranian mesobuthus eupeus venom glands, and cDNA was synthesized by using the modified oligo (dT). The cDNA was used as the template for applying Semi-nested RT- PCR technique. PCR Products were used for direct nucleotide sequencing and the results were compared with Gen Bank database. A 213 BP cDNA fragment encoding the entire coding region of an antimicrobial toxin from the Iranian scorpion M. Eupeus venom glands were isolated. The full-length sequence of the coding region was 210 BP contained an open reading frame of 70 amino with a predicted molecular mass of 7970.48 Da and theoretical Pi of 9.10. The open reading frame consists of 210 BP encoding a precursor of 70 amino acid residues, including a signal peptide of 23 residues a propertied of 7 residues, and a mature peptide of 34 residues with no disulfide bridge. The peptide has detectable sequence identity to the Lesser Asian mesobuthus eupeus MeVAMP-2 (98%), MeVAMP-9 (60%) and several previously described AMPs from other scorpion venoms including mesobuthus martensii (94%) and buthus occitanus Israelis (82%). The secondary structure of the peptide mainly consisted of α-helical structure which was generally conserved by previously reported scorpion counterparts. The phylogenetic analysis showed that the Iranian MeAMP-like toxin was similar but not identical with that of venom antimicrobial peptides from lesser Asian scorpion mesobuthus eupeus.

  17. FragIdent--automatic identification and characterisation of cDNA-fragments.

    PubMed

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  18. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  19. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1998-11-03

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

  20. Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

    NASA Astrophysics Data System (ADS)

    Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.

    2015-09-01

    A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.

  1. Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

    PubMed

    Hussey, Richard S; Huang, Guozhong; Allen, Rex

    2011-01-01

    Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

  2. Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

    PubMed

    Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

    2011-11-04

    A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

    PubMed

    Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

    2008-10-15

    The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

  4. Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

    PubMed

    Li, Chao; Chang, Wei Shan

    2014-01-01

    Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

  5. Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

    PubMed Central

    Chang, Wei Shan

    2014-01-01

    Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

  6. Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

    PubMed Central

    Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

    1991-01-01

    Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

  7. Venom proteomic and venomous glands transcriptomic analysis of the Egyptian scorpion Scorpio maurus palmatus (Arachnida: Scorpionidae).

    PubMed

    Abdel-Rahman, Mohamed A; Quintero-Hernandez, Veronica; Possani, Lourival D

    2013-11-01

    Proteomic analysis of the scorpion venom Scorpio maurus palmatus was performed using reverse-phase HPLC separation followed by mass spectrometry determination. Sixty five components were identified with molecular masses varying from 413 to 14,009 Da. The high percentage of peptides (41.5%) was from 3 to 5 KDa which may represent linear antimicrobial peptides and KScTxs. Also, 155 expressed sequence tags (ESTs) were analyzed through construction the cDNA library prepared from a pair of venomous gland. About 77% of the ESTs correspond to toxin-like peptides and proteins with definite open reading frames. The cDNA sequencing results also show the presence of sequences whose putative products have sequence similarity with antimicrobial peptides (24%), insecticidal toxins, β-NaScTxs, κ-KScTxs, α-KScTxs, calcines and La1-like peptides. Also, we have obtained 23 atypical types of venom molecules not recorded in other scorpion species. Moreover, 9% of the total ESTs revealed significant similarities with proteins involved in the cellular processes of these scorpion venomous glands. This is the first set of molecular masses and transcripts described from this species, in which various venom molecules have been identified. They belong to either known or unassigned types of scorpion venom peptides and proteins, and provide valuable information for evolutionary analysis and venomics. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Molecular cloning and characterization of a new basic peroxidase cDNA from soybean hypocotyls infected with Phytophthora sojae f.sp. glycines.

    PubMed

    Yi, S Y; Hwang, B K

    1998-10-31

    Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.

  9. Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

    PubMed Central

    Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

    1993-01-01

    Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

  10. Characterization of embryo-specific genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sung, Z.R.

    1988-01-01

    The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that are not expressed in mature tissues -- the embryogenic genes. In order to isolate these genes, we immunized a rabbit with total extracts of somatic embryos of carrot, and enriched the anti-embryo antiserum for antibodies reacting with extracts of carrot somatic embryos. Using this enriched antiserum, we screened a lambda gt11 cDNA library constructed from embryo poly A{sup +} RNA, and isolated 10 cDNA clones that detect embryogenic mRNAs. Monospecific antibodies have beenmore » purified for proteins corresponding to each cDNA sequence. Four cDNA clones were further characterized in terms of the expression of their corresponding mRNA and protein in somatic embryos of carrot. In some cases, comparable gene sequences or products have been detected in somatic and zygotic embryos of other plant species. The characteristics of these 4 cDNA clones -- clone Nos. 8, 59, and 66 -- are described in this report. 3 figs.« less

  11. The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika

    2010-01-27

    Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set ofmore » tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in EST library sequencing approaches, and thus represent a rich resource for studies of environmental genomics.« less

  12. Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

    PubMed Central

    Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

    2017-01-01

    Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

  13. Sialome of a Generalist Lepidopteran Herbivore: Identification of Transcripts and Proteins from Helicoverpa armigera Labial Salivary Glands

    PubMed Central

    Celorio-Mancera, Maria de la Paz; Courtiade, Juliette; Muck, Alexander; Heckel, David G.; Musser, Richard O.; Vogel, Heiko

    2011-01-01

    Although the importance of insect saliva in insect-host plant interactions has been acknowledged, there is very limited information on the nature and complexity of the salivary proteome in lepidopteran herbivores. We inspected the labial salivary transcriptome and proteome of Helicoverpa armigera, an important polyphagous pest species. To identify the majority of the salivary proteins we have randomly sequenced 19,389 expressed sequence tags (ESTs) from a normalized cDNA library of salivary glands. In parallel, a non-cytosolic enriched protein fraction was obtained from labial salivary glands and subjected to two-dimensional gel electrophoresis (2-DE) and de novo peptide sequencing. This procedure allowed comparison of peptides and EST sequences and enabled us to identify 65 protein spots from the secreted labial saliva 2DE proteome. The mass spectrometry analysis revealed ecdysone, glucose oxidase, fructosidase, carboxyl/cholinesterase and an uncharacterized protein previously detected in H. armigera midgut proteome. Consistently, their corresponding transcripts are among the most abundant in our cDNA library. We did find redundancy of sequence identification of saliva-secreted proteins suggesting multiple isoforms. As expected, we found several enzymes responsible for digestion and plant offense. In addition, we identified non-digestive proteins such as an arginine kinase and abundant proteins of unknown function. This identification of secreted salivary gland proteins allows a more comprehensive understanding of insect feeding and poses new challenges for the elucidation of protein function. PMID:22046331

  14. cDNA sequence and expression of a cold-responsive gene in Citrus unshiu.

    PubMed

    Hara, M; Wakasugi, Y; Ikoma, Y; Yano, M; Ogawa, K; Kuboi, T

    1999-02-01

    A cDNA clone encoding a protein (CuCOR19), the sequence of which is similar to Poncirus COR19, of the dehydrin family was isolated from the epicarp of Citrus unshiu. The molecular mass of the predicted protein was 18,980 daltons. CuCOR19 was highly hydrophilic and contained three repeating elements including Lys-rich motifs. The gene expression in leaves increased by cold stress.

  15. An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

    PubMed

    Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

    2004-01-21

    We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

  16. Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

    PubMed

    Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

    1996-10-31

    Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

  17. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1996-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  18. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1996-01-09

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  19. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  20. Characterisation and In Silico Analysis of Interleukin-4 cDNA of Nilgai (Boselaphus tragocamelus) and Indian Buffalo (Bubalus bubalis)

    PubMed Central

    Saini, M.; Palai, T. K.; Das, D. K.; Hatle, K. M.; Gupta, P. K.

    2013-01-01

    Interleukin-4 (IL-4) produced from Th2 cells modulates both innate and adaptive immune responses. It is a common belief that wild animals possess better immunity against diseases than domestic and laboratory animals; however, the immune system of wild animals is not fully explored yet. Therefore, a comparative study was designed to explore the wildlife immunity through characterisation of IL-4 cDNA of nilgai, a wild ruminant, and Indian buffalo, a domestic ruminant. Total RNA was extracted from peripheral blood mononuclear cells of nilgai and Indian buffalo and reverse transcribed into cDNA. Respective cDNA was further cloned and sequenced. Sequences were analysed in silico and compared with their homologues available at GenBank. The deduced 135 amino acid protein of nilgai IL-4 is 95.6% similar to that of Indian buffalo. N-linked glycosylation sequence, leader sequence, Cysteine residues in the signal peptide region, and 3′ UTR of IL-4 were found to be conserved across species. Six nonsynonymous nucleotide substitutions were found in Indian buffalo compared to nilgai amino acid sequence. Tertiary structure of this protein in both species was modeled, and it was found that this protein falls under 4-helical cytokines superfamily and short chain cytokine family. Phylogenetic analysis revealed a single cluster of ruminants including both nilgai and Indian buffalo that was placed distinct from other nonruminant mammals. PMID:24348167

  1. Characterization of transformation related genes in oral cancer cells.

    PubMed

    Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M

    1998-04-16

    A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.

  2. Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing.

    PubMed

    Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M

    2013-07-01

    Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility ("retrohoming") by a process that requires reverse transcription of a highly structured, 2-2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3' ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications.

  3. Characterization of Geraniol Synthase from the Peltate Glands of Sweet Basil1

    PubMed Central

    Iijima, Yoko; Gang, David R.; Fridman, Eyal; Lewinsohn, Efraim; Pichersky, Eran

    2004-01-01

    The monoterpene fraction of the lemon-scented sweet basil (Ocimum basilicum) cv Sweet Dani consists mostly of citral (a mixture of geranial and neral), with lower levels of geraniol and nerol. These compounds are stored in the peltate glands found on the leaf epidermis. Younger leaves, which have a higher density of such glands, also have a higher content of monoterpenes than older leaves. Geraniol synthase (GES) activity, generating geraniol from geranyl diphosphate, was shown to be localized exclusively or almost exclusively to glands. GES activity resides in a homodimeric protein that was purified to near homogeneity. Basil GES requires Mn2+ as a divalent metal cofactor for activity and produces only geraniol from geranyl diphosphate. Km values of 21 and 51 μm were obtained for geranyl diphosphate and Mn2+, respectively. In the presence of 18O-labeled water, GES catalyzed the formation of 18O-geraniol from geranyl diphosphate, indicating that the reaction mechanism of GES is similar to that of other monoterpene synthases and is different from the action of phosphatases. A GES cDNA was isolated based on analysis of a glandular trichome expressed sequence tag database, and the sequence of the protein encoded by this cDNA shows some similarity to sequences of other terpene synthases. The expression of the GES cDNA in Escherichia coli resulted in a protein with enzymatic activity essentially identical to that of plant-purified GES. RNA gel-blot analysis indicated that GES is expressed in glands but not in leaves of basil cv Sweet Dani, whose glands contain geraniol and citral, and not in glands or leaves of another basil variety that makes other monoterpenes but not geraniol or citral. PMID:14657409

  4. Evidence of accelerated evolution and ectodermal-specific expression of presumptive BDS toxin cDNAs from Anemonia viridis.

    PubMed

    Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Cuttitta, Angela

    2013-10-30

    Anemonia viridis is a widespread and extensively studied Mediterranean species of sea anemone from which a large number of polypeptide toxins, such as blood depressing substances (BDS) peptides, have been isolated. The first members of this class, BDS-1 and BDS-2, are polypeptides belonging to the β-defensin fold family and were initially described for their antihypertensive and antiviral activities. BDS-1 and BDS-2 are 43 amino acid peptides characterised by three disulfide bonds that act as neurotoxins affecting Kv3.1, Kv3.2 and Kv3.4 channel gating kinetics. In addition, BDS-1 inactivates the Nav1.7 and Nav1.3 channels. The development of a large dataset of A. viridis expressed sequence tags (ESTs) and the identification of 13 putative BDS-like cDNA sequences has attracted interest, especially as scientific and diagnostic tools. A comparison of BDS cDNA sequences showed that the untranslated regions are more conserved than the protein-coding regions. Moreover, the KA/KS ratios calculated for all pairwise comparisons showed values greater than 1, suggesting mechanisms of accelerated evolution. The structures of the BDS homologs were predicted by molecular modelling. All toxins possess similar 3D structures that consist of a triple-stranded antiparallel β-sheet and an additional small antiparallel β-sheet located downstream of the cleavage/maturation site; however, the orientation of the triple-stranded β-sheet appears to differ among the toxins. To characterise the spatial expression profile of the putative BDS cDNA sequences, tissue-specific cDNA libraries, enriched for BDS transcripts, were constructed. In addition, the proper amplification of ectodermal or endodermal markers ensured the tissue specificity of each library. Sequencing randomly selected clones from each library revealed ectodermal-specific expression of ten BDS transcripts, while transcripts of BDS-8, BDS-13, BDS-14 and BDS-15 failed to be retrieved, likely due to under-representation in our cDNA libraries. The calculation of the relative abundance of BDS transcripts in the cDNA libraries revealed that BDS-1, BDS-3, BDS-4, BDS-5 and BDS-6 are the most represented transcripts.

  5. A novel glutamine-rich putative transcriptional adaptor protein (TIG-1), preferentially expressed in placental and bone-marrow tissues.

    PubMed

    Abraham, S; Solomon, W B

    2000-09-19

    We used a subtractive hybridization protocol to identify novel expressed sequence tags (ESTs) corresponding to mRNAs whose expression was induced upon exposure of the human leukemia cell line K562 to the phorbol ester 12-O-tetradecanolyphorbol-13-acetate (TPA). The complete open reading frame of one of the novel ESTs, named TIG-1, was obtained by screening K562 cell and placental cDNA libraries. The deduced open reading frame of the TIG-1 cDNA encodes for a glutamine repeat-rich protein with a predicted molecular weight of 63kDa. The predicted open reading frame also contains a consensus bipartite nuclear localization signal, though no specific DNA-binding domain is found. The corresponding TIG-1 mRNA is ubiquitously expressed. Placental tissue expresses the TIG-1 mRNA 200 times more than the lowest expressing tissues such as kidney and lung. There is also preferential TIG-1 mRNA expression in cells of bone-marrow lineage.In-vitro transcription/translation of the TIG-1 cDNA yielded a polypeptide with an apparent molecular weight of 97kDa. Using polyclonal antibodies obtained from a rabbit immunized with the carboxy-terminal portion of bacterially expressed TIG-1 protein, a polypeptide with molecular weight of 97kDa was identified by Western blot analyses of protein lysates obtained from K562 cells. Cotransfection assays of K562 cells, using a GAL4-TIG-1 fusion gene and GAL4 operator-CAT, indicate that the TIG-1 protein may have transcriptional regulatory activity when tethered to DNA. We hypothesize that this novel glutamine-rich protein participates in a protein complex that regulates gene transcription. It has been demonstrated by Naar et al. (Naar, A.M., Beaurang, P.A., Zhou, S., Abraham, S., Solomon, W.B., Tjian, R., 1999, Composite co-activator ARC mediates chromatin-directed transcriptional activation. Nature 398, 828-830) that the amino acid sequences of peptide fragments obtained from a polypeptide found in a complex of proteins that alters chromatin structure (ARC) are identical to portions of the deduced open reading frame of TIG-1 mRNA.

  6. Analysis of xylem formation in pine by cDNA sequencing

    NASA Technical Reports Server (NTRS)

    Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.; hide

    1998-01-01

    Secondary xylem (wood) formation is likely to involve some genes expressed rarely or not at all in herbaceous plants. Moreover, environmental and developmental stimuli influence secondary xylem differentiation, producing morphological and chemical changes in wood. To increase our understanding of xylem formation, and to provide material for comparative analysis of gymnosperm and angiosperm sequences, ESTs were obtained from immature xylem of loblolly pine (Pinus taeda L.). A total of 1,097 single-pass sequences were obtained from 5' ends of cDNAs made from gravistimulated tissue from bent trees. Cluster analysis detected 107 groups of similar sequences, ranging in size from 2 to 20 sequences. A total of 361 sequences fell into these groups, whereas 736 sequences were unique. About 55% of the pine EST sequences show similarity to previously described sequences in public databases. About 10% of the recognized genes encode factors involved in cell wall formation. Sequences similar to cell wall proteins, most known lignin biosynthetic enzymes, and several enzymes of carbohydrate metabolism were found. A number of putative regulatory proteins also are represented. Expression patterns of several of these genes were studied in various tissues and organs of pine. Sequencing novel genes expressed during xylem formation will provide a powerful means of identifying mechanisms controlling this important differentiation pathway.

  7. Expressed sequence tag analysis of guinea pig (Cavia porcellus) eye tissues for NEIBank

    PubMed Central

    Simpanya, Mukoma F.; Wistow, Graeme; Gao, James; David, Larry L.; Giblin, Frank J.

    2008-01-01

    Purpose To characterize gene expression patterns in guinea pig ocular tissues and identify orthologs of human genes from NEIBank expressed sequence tags. Methods RNA was extracted from dissected eye tissues of 2.5-month-old guinea pigs to make three unamplified and unnormalized cDNA libraries in the pCMVSport-6 vector for the lens, retina, and eye minus lens and retina. Over 4,000 clones were sequenced from each library and were analyzed using GRIST for clustering and gene identification. Lens crystallin EST data were validated using two-dimensional electrophoresis (2-DE), matrix assisted laser desorption (MALDI), and electrospray ionization mass spectrometry (ESIMS). Results Combined data from the three libraries generated a total of 6,694 distinctive gene clusters, with each library having between 1,000 and 3,000 clusters. Approximately 60% of the total gene clusters were novel cDNA sequences and had significant homologies to other mammalian sequences in GenBank. Complete cDNA sequences were obtained for many guinea pig lens proteins, including αA/αAinsert-, γN-, and γS-crystallins, lengsin and GRIFIN. The ratio of αA- to αB-crystallin on 2-DE gels was 8: 1 in the lens nucleus and 6.5: 1 in the cortex. Analysis of ESTs, genome sequence, and proteins (by MALDI), did not reveal any evidence for the presence of γD-, γE-, and γF-crystallin in the guinea pig. Predicted masses of many guinea pig lens crystallins were confirmed by ESIMS analysis. For the retina, orthologs of human phototransduction genes were found, such as Rhodopsin, S-antigen (Sag, Arrestin), and Transducin. The guinea-pig ortholog of NRL, a key rod photoreceptor-specific transcription factor, was also represented in EST data. In the ‘rest-of-eye’ library, the most abundant transcripts included decorin and keratin 12, representative of the cornea. Conclusions Genomic analysis of guinea pig eye tissues provides sequence-verified clones for future studies. Guinea pig orthologs of many human eye specific genes were identified. Guinea pig gene structures were similar to their human and rodent gene counterparts. Surprisingly, no orthologs of γD-, γE-, and γF-crystallin were found in EST, proteomic, or the current guinea pig genome data. PMID:19104676

  8. Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

    PubMed Central

    Kilimann, M W; DeGennaro, L J

    1985-01-01

    To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

  9. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  10. Characterization of infectious Murray Valley encephalitis virus derived from a stably cloned genome-length cDNA.

    PubMed

    Hurrelbrink, R J; Nestorowicz, A; McMinn, P C

    1999-12-01

    An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under the control of a T7 RNA polymerase promoter. The clone was constructed by using existing components of a cDNA library, in addition to cDNA of the 3' terminus derived by RT-PCR of poly(A)-tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined sequence of the 3' UTR was found to contain elements conserved throughout the genus FLAVIVIRUS: RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of CDV-1-51 and MVE-1-51 (LD(50) values and mortality profiles) were found to be identical in vivo in the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a valuable tool for investigating the molecular determinants of virulence in MVE virus.

  11. Cloning and sequence analysis of Bufo arenarum oviductin cDNA and detection of its orthologous gene expression in the mouse female reproductive tract.

    PubMed

    Barrera, Daniel; Valdecantos, Pablo A; García, E Vanesa; Miceli, Dora C

    2012-02-01

    The glycoprotein envelope surrounding the Bufo arenarum egg exists in different functional forms. Conversion between types involves proteolysis of specific envelope glycoproteins. When the egg is released from the ovary, the envelope cannot be penetrated by sperm. Conversion to a penetrable state occurs during passage through the pars recta portion of the oviduct, where oviductin, a serine protease with trypsin-like substrate specificity, hydrolyzes two kinds of envelope glycoproteins: gp84 and gp55. The nucleotide sequence of a 3203 bp B. arenarum oviductin cDNA was obtained. Deduced amino acid sequence showed a complete open reading frame encoding 980 amino acids. B. arenarum oviductin is a multi-domain protein with a protease domain at the N-terminal region followed by two CUB domains and toward the C-terminal region another protease domain, which lacked an active histidine site, and one CUB domain. Expression of ovochymase 2, the mammalian orthologous of amphibian oviductin, was assayed in mouse female reproductive tract. Ovochymase 2 mRNA was unnoticeable in the mouse oviduct but expression was remarkable in the uterus. Phylogenetic relationship between oviductin and ovochymase 2 opens the possibility to understand the role of this enzyme in mammalian reproduction.

  12. Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome.

    PubMed

    Lamm, Ayelet T; Stadler, Michael R; Zhang, Huibin; Gent, Jonathan I; Fire, Andrew Z

    2011-02-01

    We have used a combination of three high-throughput RNA capture and sequencing methods to refine and augment the transcriptome map of a well-studied genetic model, Caenorhabditis elegans. The three methods include a standard (non-directional) library preparation protocol relying on cDNA priming and foldback that has been used in several previous studies for transcriptome characterization in this species, and two directional protocols, one involving direct capture of single-stranded RNA fragments and one involving circular-template PCR (CircLigase). We find that each RNA-seq approach shows specific limitations and biases, with the application of multiple methods providing a more complete map than was obtained from any single method. Of particular note in the analysis were substantial advantages of CircLigase-based and ssRNA-based capture for defining sequences and structures of the precise 5' ends (which were lost using the double-strand cDNA capture method). Of the three methods, ssRNA capture was most effective in defining sequences to the poly(A) junction. Using data sets from a spectrum of C. elegans strains and stages and the UCSC Genome Browser, we provide a series of tools, which facilitate rapid visualization and assignment of gene structures.

  13. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  14. cDNA encoding a polypeptide including a hev ein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  15. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  16. CDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  17. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  18. Isolation, characterization and cloning of a cDNA encoding a new antifungal defensin from Phaseolus vulgaris L. seeds.

    PubMed

    Games, Patrícia D; Dos Santos, Izabela S; Mello, Erica O; Diz, Mariângela S S; Carvalho, André O; de Souza-Filho, Gonçalo A; Da Cunha, Maura; Vasconcelos, Ilka M; Ferreira, Beatriz Dos S; Gomes, Valdirene M

    2008-12-01

    The PvD1 defensin was purified from Phaseolus vulgaris (cv. Pérola) seeds, basically as described by Terras et al. [Terras FRG, Schoofs HME, De Bolle MFC, Van Leuven F, Ress SB, Vanderleyden J, Cammue BPA, Broekaer TWF. Analysis of two novel classes of plant antifungal proteins from radish (Raphanus sativus L.) seeds. J Biol Chem 1992;267(22):15301-9], with some modifications. A DEAE-Sepharose, equilibrated with 20mM Tris-HCl, pH 8.0, was initially utilized for the separation of peptides after ammonium sulfate fractionation. The basic fraction (the non-retained peak) obtained showed the presence of one unique band in SDS-Tricine gel electrophoresis with a molecular mass of approximately 6kDa. The purification of this peptide was confirmed after a reverse-phase chromatography in a C2/C18 column by HPLC, where once again only one peak was observed and denominated H1. H1 was submitted to N-terminal sequencing and the comparative analysis in databanks revealed high similarity with sequences of different defensins isolated from other plants species. The N-terminal sequence of the mature defensin isolated was used to produce a degenerated primer. This primer allowed the amplification of the defensin cDNA by RT-PCR from mRNA of P. vulgaris seeds. The sequence analysis of the cloned cDNA, named PVD1, demonstrated 314bp encoding a polypeptide of 47 amino acids. The deduced peptide presented high similarity with plant defensins of Vigna unguiculata (93%), Cicer arietinum (95%) and Pachyrhizus erosus (87%). PvD1 inhibited the growth of the yeasts, Candida albicans, Candida parapsilosis, Candida tropicalis, Candida guilliermondii, Kluyveromyces marxiannus and Saccharomyces cerevisiae. PvD1 also presented an inhibitory activity against the growth of phytopathogenic fungi including Fusarium oxysporum, Fusarium solani, Fusarium lateritium and Rizoctonia solani.

  19. Analysis of expressed sequence tags from the four main developmental stages of Trypanosoma congolense

    PubMed Central

    Helm, Jared R.; Hertz-Fowler, Christiane; Aslett, Martin; Berriman, Matthew; Sanders, Mandy; Quail, Michael A.; Soares, Marcelo B.; Bonaldo, Maria F.; Sakurai, Tatsuya; Inoue, Noboru; Donelson, John E.

    2009-01-01

    Trypanosoma congolense is one of the most economically important pathogens of livestock in Africa. Culture-derived parasites of each of the three main insect stages of the T. congolense life cycle, i.e., the procyclic, epimastigote and metacyclic stages, and bloodstream stage parasites isolated from infected mice, were used to construct stage-specific cDNA libraries and expressed sequence tags (ESTs or cDNA clones) in each library were sequenced. Thirteen EST clusters encoding different variant surface glycoproteins (VSGs) were detected in the metacyclic library and twenty-six VSG EST clusters were found in the bloodstream library, six of which are shared by the metacyclic library. Rare VSG ESTs are present in the epimastigote library, and none were detected in the procyclic library. ESTs encoding enzymes that catalyze oxidative phosphorylation and amino acid metabolism are about twice as abundant in the procyclic and epimastigote stages as in the metacyclic and bloodstream stages. In contrast, ESTs encoding enzymes involved in glycolysis, the citric acid cycle and nucleotide metabolism are about the same in all four developmental stages. Cysteine proteases, kinases and phosphatases are the most abundant enzyme groups represented by the ESTs. All four libraries contain T. congolense-specific expressed sequences not present in the T. brucei and T. cruzi genomes. Normalized cDNA libraries were constructed from the metacyclic and bloodstream stages, and found to be further enriched for T. congolense-specific ESTs. Given that cultured T. congolense offers an experimental advantage over other African trypanosome species, these ESTs provide a basis for further investigation of the molecular properties of these four developmental stages, especially the epimastigote and metacyclic stages for which it is difficult to obtain large quantities of organisms. The T. congolense EST databases are available at: http://www.sanger.ac.uk/Projects/T_congolense/EST_index.shtml. PMID:19559733

  20. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

    1987-06-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

  1. Efficacy of vaccination with plasmid DNA encoding for HER2/neu or HER2/neu-eGFP fusion protein against prostate cancer in rats.

    PubMed

    Bhattachary, R; Bukkapatnam, R; Prawoko, I; Soto, J; Morgan, M; Salup, R R

    2002-05-01

    Despite early diagnosis and improved therapy, 31,500 men will die from prostate cancer (PC) this year. The HER2/neu oncoprotein is an important effector of cell growth found in the majority of high-grade prostatic tumors and is capable of rendering immunogenicity. The antigenicity of this oncoprotein might prove useful in the development of PC vaccines. Our goal is to prove the principle that a single DNA vaccine can provide reliable immunity against PC in the MatLyLu (MLL) translational tumor model. The parental rat MatLyLu PC cell line expresses low to moderate levels of the rat neu protein. To simulate in vivo human PC, MatLyLu cells were transfected with a truncated sequence of human HER2/neu cDNA cloned into the pCI-neo vector. This HER2/neu cDNA sequence encodes the first 433 amino acids of the extracellular domain (ECD). MatLyLu cells were also transfected with the same HER2/neu cDNA sequence cloned into the N1-terminal sequence of EGFP reporter gene to produce a fusion protein. The partial ECD sequence of HER2/neu includes five rat major histocompatibility (MHC)-II-restricted peptides with complete human-to-rat cross-species homology. The HER2/neu protein overexpression was documented by Western Blot analysis, and the expression of fusion protein was monitored by confocal microscopy and fluorimetry. Vaccination with a single injection of HER2/neu cDNA protected 50% of animals against HER2/neu-MatLyLu tumors (P < 0.01). When the tumor cells were engineered to express HER2/neu-EGFP fusion protein, the antitumor immunity was enhanced, as following vaccination with HER2/neu-EGFP cDNA, 80% of these rats rejected HER2/neu-EGFP-MatLyLu (P<0.001). Both vaccines induced HER2/neu-specific antibody titers. Rats vaccinated with EGFP-cDNA rejected 80% of EGFP-MatLyLu tumors and, interestingly, 40% of HER2/neu-MatLyLu tumors. None of the cDNA vaccines induced immunity against parental MatLyLu cells. Our data clearly demonstrate that a single injection of HER2/neu-EGFP cDNA is a very effective vaccine against PC tumors expressing the cognate tumor-associated antigen (TA). The antitumor immunity is significantly more pronounced if the tumors express xenogeneic HER2/neu-EGFP fusion protein as opposed to only the syngeneic HER2/neu oncoprotein. Our data suggests that the HER2/neu-EGFP-MatLyLu tumor is a potential animal tumor model for investigating therapeutic vaccine strategies against PC in vivo and demonstrates the limitations of a cDNA vaccine only encoding for MHC-II-restricted HER2/neu-ECD sequence peptides.

  2. Crystal structure of a papain-fold protein without the catalytic residue: a novel member in the cysteine proteinase family.

    PubMed

    Zhang, Min; Wei, Zhiyi; Chang, Shaojie; Teng, Maikun; Gong, Weimin

    2006-04-21

    A 31kDa cysteine protease, SPE31, was isolated from the seeds of a legume plant, Pachyrizhus erosus. The protein was purified, crystallized and the 3D structure solved using molecular replacement. The cDNA was obtained by RT PCR followed by amplification using mRNA isolated from the seeds of the legume plant as a template. Analysis of the cDNA sequence and the 3D structure indicated the protein to belong to the papain family. Detailed analysis of the structure revealed an unusual replacement of the conserved catalytic Cys with Gly. Replacement of another conserved residue Ala/Gly by a Phe sterically blocks the access of the substrate to the active site. A polyethyleneglycol molecule and a natural peptide fragment were bound to the surface of the active site. Asn159 was found to be glycosylated. The SPE31 cDNA sequence shares several features with P34, a protein found in soybeans, that is implicated in plant defense mechanisms as an elicitor receptor binding to syringolide. P34 has also been shown to interact with vegetative storage proteins and NADH-dependent hydroxypyruvate reductase. These roles suggest that SPE31 and P34 form a unique subfamily within the papain family. The crystal structure of SPE31 complexed with a natural peptide ligand reveals a unique active site architecture. In addition, the clear evidence of glycosylated Asn159 provides useful information towards understanding the functional mechanism of SPE31/P34.

  3. Equus caballus Major Histocompatibility Complex Class I Is an Entry Receptor for Equine Herpesvirus Type 1▿

    PubMed Central

    Kurtz, Brian M.; Singletary, Lauren B.; Kelly, Sean D.; Frampton, Arthur R.

    2010-01-01

    In this study, Equus caballus major histocompatibility complex class I (MHC-I) was identified as a cellular entry receptor for the alphaherpesvirus equine herpesvirus type 1 (EHV-1). This novel EHV-1 receptor was discovered using a cDNA library from equine macrophages. cDNAs from this EHV-1-susceptible cell type were inserted into EHV-1-resistant B78H1 murine melanoma cells, these cells were infected with an EHV-1 lacZ reporter virus, and cells that supported virus infection were identified by X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) staining. Positive cells were subjected to several rounds of purification to obtain homogeneous cell populations that were shown to be uniformly infected with EHV-1. cDNAs from these cell populations were amplified by PCR and then sequenced. The sequence data revealed that the EHV-1-susceptible cells had acquired an E. caballus MHC-I cDNA. Cell surface expression of this receptor was verified by confocal immunofluorescence microscopy. The MHC-I cDNA was cloned into a mammalian expression vector, and stable B78H1 cell lines were generated that express this receptor. These cell lines were susceptible to EHV-1 infection while the parental B78H1 cells remained resistant to infection. In addition, EHV-1 infection of the B78H1 MHC-I-expressing cell lines was inhibited in a dose-dependent manner by an anti-MHC-I antibody. PMID:20610718

  4. Application of a cDNA microarray for profiling the gene expression of Echinococcus granulosus protoscoleces treated with albendazole and artemisinin.

    PubMed

    Lü, Guodong; Zhang, Wenbao; Wang, Jianhua; Xiao, Yunfeng; Zhao, Jun; Zhao, Jianqin; Sun, Yimin; Zhang, Chuanshan; Wang, Junhua; Lin, Renyong; Liu, Hui; Zhang, Fuchun; Wen, Hao

    2014-12-01

    Cystic echinoccocosis (CE) is a neglected zoonosis that is caused by the dog-tapeworm Echinococcus granulosus. The disease is endemic worldwide. There is an urgent need for searching effective drug for the treatment of the disease. In this study, we sequenced a cDNA library constructed using RNA isolated from oncospheres, protoscoleces, cyst membrane and adult worms of E. granulosus. A total of 9065 non-redundant or unique sequences were obtained and spotted on chips as uniEST probes to profile the gene expression in protoscoleces of E. granulosus treated with the anthelmintic drugs albendazole and artemisinin, respectively. The results showed that 7 genes were up-regulated and 38 genes were down-regulated in the protoscoleces treated with albendazole. Gene analysis showed that these genes are responsible for energy metabolism, cell cycle and assembly of cell structure. We also identified 100 genes up-regulated and 6 genes down-regulated in the protoscoleces treated with artemisinin. These genes play roles in the transduction of environmental signals, and metabolism. Albendazole appeared its drug efficacy in damaging cell structure, while artemisinin was observed to increase the formation of the heterochromatin in protoscolex cells. Our results highlight the utility of using cDNA microarray methods to detect gene expression profiles of E. granulosus and, in particular, to understand the pharmacologic mechanism of anti-echinococcosis drugs. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Cloning, characterization and functional analysis of a 1-FEH cDNA from Vernonia herbacea (Vell.) Rusby.

    PubMed

    Asega, Amanda Francine; do Nascimento, João Roberto O; Schroeven, Lindsey; Van den Ende, Wim; Carvalho, Maria Angela M

    2008-08-01

    Variations in the inulin contents have been detected in rhizophores of Vernonia herbacea during the phenological cycle. These variations indicate the occurrence of active inulin synthesis and depolymerization throughout the cycle and a role for this carbohydrate as a reserve compound. 1-Fructan exohydrolase (1-FEH) is the enzyme responsible for inulin depolymerization, and its activity has been detected in rhizophores of sprouting plants. Defoliation and low temperature are enhancer conditions of this 1-FEH activity. The aim of the present work was the cloning of this enzyme. Rhizophores were collected from plants induced to sprout, followed by storage at 5 degrees C. A full length 1-FEH cDNA sequence was obtained by PCR and inverse PCR techniques, and expressed in Pichia pastoris. Cold storage enhances FEH gene expression. Vh1-FEH was shown to be a functional 1-FEH, hydrolyzing predominantly beta-2,1 linkages, sharing high identity with chicory FEH sequences, and its activity was inhibited by 81% in the presence of 10 mM sucrose. In V. herbacea, low temperature and sucrose play a role in the control of fructan degradation. This is the first study concerning the cloning and functional analysis of a 1-FEH cDNA of a native species from the Brazilian Cerrado. Results will contribute to understanding the role of fructans in the establishment of a very successful fructan flora of the Brazilian Cerrado, subjected to water limitation and low temperature during winter.

  6. Insights from computational analysis of full-length β-ketoacyl-[ACP] synthase-II cDNA isolated from American and African oil palms

    PubMed Central

    Bhore, Subhash J.; Cha, Thye S.; Amelia, Kassim; Shah, Farida H.

    2014-01-01

    Background: Palm oil derived from fruits (mesocarp) of African oil palm (Elaeis guineensis Jacq. Tenera) and American oil palm (E. oleifera) is important for food industry. Due to high yield, Elaeis guineensis (Tenera) is cultivated on commercial scale, though its oil contains high (~54%) level of saturated fatty acids. The rate-limiting activity of beta-ketoacyl-[ACP] synthase-II (KAS-II) is considered mainly responsible for the high (44%) level of palmitic acid (C16:0) in the oil obtained from E. guineensis. Objective: The objective of this study was to annotate KAS-II cDNA isolated from American and African oil palms. Materials and Methods: The full-length E. oleifera KAS-II (EoKAS-II) cDNA clone was isolated using random method of gene isolation. Whereas, the E. guineensis KAS-II (EgTKAS-II) cDNA was isolated using reverse transcriptase polymerase chain reaction (RT-PCR) technique; and missing ends were obtained by employing 5’and 3’ RACE technique. Results: The results show that EoKAS-II and EgTKAS-II open reading frames (ORFs) are of 1689 and 1721 bp in length, respectively. Further analysis of the both EoKAS-II and EgTKAS-II predicted protein illustrates that they contains conserved domains for ‘KAS-I and II’, ‘elongating’ condensing enzymes, ‘condensing enzymes super-family’, and ‘3-oxoacyl-[ACP] synthase II’. The predicted protein sequences shows 95% similarity with each other. Consecutively, the three active sites (Cys, His, and His) were identified in both proteins. However, difference in positions of two active Histidine (His) residues was noticed. Conclusion: These insights may serve as the foundation in understanding the variable activity of KAS-II in American and African oil palms; and cDNA clones could be useful in the genetic engineering of oil palms. PMID:24678202

  7. Purification, cDNA cloning, and regulation of lysophospholipase from rat liver.

    PubMed

    Sugimoto, H; Hayashi, H; Yamashita, S

    1996-03-29

    A lysophospholipase was purified 506-fold from rat liver supernatant. The preparation gave a single 24-kDa protein band on SDS-polyacrylamide gel electrophoresis. The enzyme hydrolyzed lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, lysophosphatidylserine, and 1-oleoyl-2-acetyl-sn-glycero-3-phosphocholine at pH 6-8. The purified enzyme was used for the preparation of antibody and peptide sequencing. A cDNA clone was isolated by screening a rat liver lambda gt11 cDNA library with the antibody, followed by the selection of further extended clones from a lambda gt10 library. The isolated cDNA was 2,362 base pairs in length and contained an open reading frame encoding 230 amino acids with a Mr of 24,708. The peptide sequences determined were found in the reading frame. When the cDNA was expressed in Escherichia coli cells as the beta-galactosidase fusion, lysophosphatidylcholine-hydrolyzing activity was markedly increased. The deduced amino acid sequence showed significant similarity to Pseudomonas fluorescence esterase A and Spirulina platensis esterase. The three sequences contained the GXSXG consensus at similar positions. The transcript was found in various tissues with the following order of abundance: spleen, heart, kidney, brain, lung, stomach, and testis = liver. In contrast, the enzyme protein was abundant in the following order: testis, liver, kidney, heart, stomach, lung, brain, and spleen. Thus the mRNA abundance disagreed with the level of the enzyme protein in liver, testis, and spleen. When HL-60 cells were induced to differentiate into granulocytes with dimethyl sulfoxide, the 24-kDa lysophospholipase protein increased significantly, but the mRNA abundance remained essentially unchanged. Thus a posttranscriptional control mechanism is present for the regulation of 24-kDa lysophospholipase.

  8. Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

    PubMed

    Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

    2003-01-01

    A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

  9. Light regulation of the abundance of mRNA encoding a nucleolin-like protein localized in the nucleoli of pea nuclei.

    PubMed Central

    Tong, C G; Reichler, S; Blumenthal, S; Balk, J; Hsieh, H L; Roux, S J

    1997-01-01

    A cDNA encoding a nucleolar protein was selected from a pea (Pisum sativum) plumule library, cloned, and sequenced. The translated sequence of the cDNA has significant percent identity to Xenopus laevis nucleolin (31%), the alfalfa (Medicago sativa) nucleolin homolog (66%), and the yeast (Saccharomyces cerevisiae) nucleolin homolog (NSR1) (28%). It also has sequence patterns in its primary structure that are characteristic of all nucleolins, including an N-terminal acidic motif, RNA recognition motifs, and a C-terminal Gly- and Arg-rich domain. By immunoblot analysis, the polyclonal antibodies used to select the cDNA bind selectively to a 90-kD protein in purified pea nuclei and nucleoli and to an 88-kD protein in extracts of Escherichia coli expressing the cDNA. In immunolocalization assays of pea plumule cells, the antibodies stained primarily a region surrounding the fibrillar center of nucleoli, where animal nucleolins are typically found. Southern analysis indicated that the pea nucleolin-like protein is encoded by a single gene, and northern analysis showed that the labeled cDNA binds to a single band of RNA, approximately the same size and the cDNA. After irradiation of etiolated pea seedlings by red light, the mRNA level in plumules decreased during the 1st hour and then increased to a peak of six times the 0-h level at 12 h. Far-red light reversed this effect of red light, and the mRNA accumulation from red/far-red light irradiation was equal to that found in the dark control. This indicates that phytochrome may regulate the expression of this gene. PMID:9193096

  10. Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.

    PubMed Central

    Wu, S; Kriz, A L; Widholm, J M

    1994-01-01

    The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that the different chitinase isoforms in maize might have different functions in the plant, since they show differential expression patterns under different conditions. PMID:7972490

  11. Molecular Characterization of the Skate Peripherin/rds Gene: Relationship to Its Orthologues and Paralogues

    PubMed Central

    Li, Chibo; Ding, Xi-Qin; O’Brien, John; Al-Ubaidi, Muayyad R.

    2010-01-01

    PURPOSE A great deal of information about functionally significant domains of a protein may be obtained by comparison of primary sequences of gene homologues over a broad phylogenetic base. This study was designed to identify evolutionarily conserved domains of the photoreceptor disc membrane protein peripherin/rds by analysis of the homologue in a primitive vertebrate, the skate. METHODS A skate retinal cDNA library was screened using a mouse peripherin/rds clone. The 5′ and 3′ untranslated regions of the skate peripherin/rds (srds) cDNA were isolated by the rapid amplification of cDNA ends (RACE) approach. The gene structure was characterized by PCR amplification and sequencing of genomic fragments. Northern and Western blot analyses were used to identify srds transcript and protein, respectively. RESULTS A new homologue of peripherin/rds was identified from the skate retinal cDNA library. SRDS is a glycoprotein with a predicted molecular mass of 40.2 kDa. The srds gene consists of two exons and one small intron and transcribes into a single 6-kb message. Phylogenetic analysis places SRDS at the base of peripherin/rds family and near the division of that group and the branch leading to rds-like and rom-1 genes. SRDS protein is 54.5% identical with peripherin/rds across species. Identity is significantly higher (73%) in the intradiscal domains. Sequence comparison revealed the conservation of all residues that have been shown, on mutation, to associate with retinitis pigmentosa and showed conservation of most residues associated with macular dystrophies. Comparison with ROM-1 and other rds-like proteins revealed the presence of a highly conserved domain in the large intradiscal loop. CONCLUSIONS Srds represents the skate orthologue of mammalian peripherin/rds genes. Conservation of most of the residues associated with human retinal diseases indicates that these residues serve important functional roles. The high degree of conservation of a short stretch within the large intradiscal loop also suggests an important function for this domain. PMID:12766040

  12. Active site characterization and molecular cloning of Tenebrio molitor midgut trehalase and comments on their insect homologs.

    PubMed

    Gomez, Ana; Cardoso, Christiane; Genta, Fernando A; Terra, Walter R; Ferreira, Clélia

    2013-08-01

    The soluble midgut trehalase from Tenebrio molitor (TmTre1) was purified after several chromatographic steps, resulting in an enzyme with 58 kDa and pH optimum 5.3 (ionizing active groups in the free enzyme: pK(e1) = 3.8 ± 0.2 pK(e2) = 7.4 ± 0.2). The purified enzyme corresponds to the deduced amino acid sequence of a cloned cDNA (TmTre1-cDNA), because a single cDNA coding a soluble trehalase was found in the T. molitor midgut transcriptome. Furthermore, the mass of the protein predicted to be coded by TmTre1-cDNA agrees with that of the purified enzyme. TmTre1 has the essential catalytic groups Asp 315 and Glu 513 and the essential Arg residues R164, R217, R282. Carbodiimide inactivation of the purified enzyme at different pH values reveals an essential carboxyl group with pKa = 3.5 ± 0.3. Phenylglyoxal modified a single Arg residue with pKa = 7.5 ± 0.2, as observed in the soluble trehalase from Spodoptera frugiperda (SfTre1). Diethylpyrocarbonate modified a His residue that resulted in a less active enzyme with pK(e1) changed to 4.8 ± 0.2. In TmTre1 the modified His residue (putatively His 336) is more exposed than the His modified in SfTre1 (putatively His 210) and that affects the ionization of an Arg residue. The architecture of the active site of TmTre1 and SfTre1 is different, as shown by multiple inhibition analysis, the meaning of which demands further research. Trehalase sequences obtained from midgut transcriptomes (pyrosequencing and Illumina data) from 8 insects pertaining to 5 different orders were used in a cladogram, together with other representative sequences. The data suggest that the trehalase gene went duplication and divergence prior to the separation of the paraneopteran and holometabolan orders and that the soluble trehalase derived from the membrane-bound one by losing the C-terminal transmembrane loop. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

    PubMed

    Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

    2007-06-01

    As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

  14. Human somatostatin I: sequence of the cDNA.

    PubMed Central

    Shen, L P; Pictet, R L; Rutter, W J

    1982-01-01

    RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

  15. Cloning and sequencing of the cDNA species for mammalian dimeric dihydrodiol dehydrogenases.

    PubMed Central

    Arimitsu, E; Aoki, S; Ishikura, S; Nakanishi, K; Matsuura, K; Hara, A

    1999-01-01

    Cynomolgus and Japanese monkey kidneys, dog and pig livers and rabbit lens contain dimeric dihydrodiol dehydrogenase (EC 1.3.1.20) associated with high carbonyl reductase activity. Here we have isolated cDNA species for the dimeric enzymes by reverse transcriptase-PCR from human intestine in addition to the above five animal tissues. The amino acid sequences deduced from the monkey, pig and dog cDNA species perfectly matched the partial sequences of peptides digested from the respective enzymes of these animal tissues, and active recombinant proteins were expressed in a bacterial system from the monkey and human cDNA species. Northern blot analysis revealed the existence of a single 1.3 kb mRNA species for the enzyme in these animal tissues. The human enzyme shared 94%, 85%, 84% and 82% amino acid identity with the enzymes of the two monkey strains (their sequences were identical), the dog, the pig and the rabbit respectively. The sequences of the primate enzymes consisted of 335 amino acid residues and lacked one amino acid compared with the other animal enzymes. In contrast with previous reports that other types of dihydrodiol dehydrogenase, carbonyl reductases and enzymes with either activity belong to the aldo-keto reductase family or the short-chain dehydrogenase/reductase family, dimeric dihydrodiol dehydrogenase showed no sequence similarity with the members of the two protein families. The dimeric enzyme aligned with low degrees of identity (14-25%) with several prokaryotic proteins, in which 47 residues are strictly or highly conserved. Thus dimeric dihydrodiol dehydrogenase has a primary structure distinct from the previously known mammalian enzymes and is suggested to constitute a novel protein family with the prokaryotic proteins. PMID:10477285

  16. Production of hydroxylated fatty acids in genetically modified plants

    DOEpatents

    Somerville, Chris [Portola Valley, CA; Broun, Pierre [Burlingame, CA; van de Loo, Frank [Weston, AU; Boddupalli, Sekhar S [Manchester, MI

    2011-08-23

    This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

  17. Production of hydroxylated fatty acids in genetically modified plants

    DOEpatents

    Somerville, Chris; Broun, Pierre; van de Loo, Frank; Boddupalli, Sekhar S.

    2005-08-30

    This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

  18. Cloning and tissue distribution of rat hear fatty acid binding protein mRNA: identical forms in heart and skeletal muscle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Claffey, K.P.; Herrera, V.L.; Brecher, P.

    1987-12-01

    A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less

  19. Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

    NASA Astrophysics Data System (ADS)

    Sun, S. M.; Slightom, J. L.; Hall, T. C.

    1981-01-01

    A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

  20. Isolation and characterization of full-length putative alcohol dehydrogenase genes from polygonum minus

    NASA Astrophysics Data System (ADS)

    Hamid, Nur Athirah Abd; Ismail, Ismanizan

    2013-11-01

    Polygonum minus, locally named as Kesum is an aromatic herb which is high in secondary metabolite content. Alcohol dehydrogenase is an important enzyme that catalyzes the reversible oxidation of alcohol and aldehyde with the presence of NAD(P)(H) as co-factor. The main focus of this research is to identify the gene of ADH. The total RNA was extracted from leaves of P. minus which was treated with 150 μM Jasmonic acid. Full-length cDNA sequence of ADH was isolated via rapid amplification cDNA end (RACE). Subsequently, in silico analysis was conducted on the full-length cDNA sequence and PCR was done on genomic DNA to determine the exon and intron organization. Two sequences of ADH, designated as PmADH1 and PmADH2 were successfully isolated. Both sequences have ORF of 801 bp which encode 266 aa residues. Nucleotide sequence comparison of PmADH1 and PmADH2 indicated that both sequences are highly similar at the ORF region but divergent in the 3' untranslated regions (UTR). The amino acid is differ at the 107 residue; PmADH1 contains Gly (G) residue while PmADH2 contains Cys (C) residue. The intron-exon organization pattern of both sequences are also same, with 3 introns and 4 exons. Based on in silico analysis, both sequences contain "classical" short chain alcohol dehydrogenases/reductases ((c) SDRs) conserved domain. The results suggest that both sequences are the members of short chain alcohol dehydrogenase family.

  1. Transcriptomic Analysis of the Salivary Glands of an Invasive Whitefly

    PubMed Central

    Su, Yun-Lin; Li, Jun-Min; Li, Meng; Luan, Jun-Bo; Ye, Xiao-Dong; Wang, Xiao-Wei; Liu, Shu-Sheng

    2012-01-01

    Background Some species of the whitefly Bemisia tabaci complex cause tremendous losses to crops worldwide through feeding directly and virus transmission indirectly. The primary salivary glands of whiteflies are critical for their feeding and virus transmission. However, partly due to their tiny size, research on whitefly salivary glands is limited and our knowledge on these glands is scarce. Methodology/Principal Findings We sequenced the transcriptome of the primary salivary glands of the Mediterranean species of B. tabaci complex using an effective cDNA amplification method in combination with short read sequencing (Illumina). In a single run, we obtained 13,615 unigenes. The quantity of the unigenes obtained from the salivary glands of the whitefly is at least four folds of the salivary gland genes from other plant-sucking insects. To reveal the functions of the primary glands, sequence similarity search and comparisons with the whole transcriptome of the whitefly were performed. The results demonstrated that the genes related to metabolism and transport were significantly enriched in the primary salivary glands. Furthermore, we found that a number of highly expressed genes in the salivary glands might be involved in secretory protein processing, secretion and virus transmission. To identify potential proteins of whitefly saliva, the translated unigenes were put into secretory protein prediction. Finally, 295 genes were predicted to encode secretory proteins and some of them might play important roles in whitefly feeding. Conclusions/Significance: The combined method of cDNA amplification, Illumina sequencing and de novo assembly is suitable for transcriptomic analysis of tiny organs in insects. Through analysis of the transcriptome, genomic features of the primary salivary glands were dissected and biologically important proteins, especially secreted proteins, were predicted. Our findings provide substantial sequence information for the primary salivary glands of whiteflies and will be the basis for future studies on whitefly-plant interactions and virus transmission. PMID:22745728

  2. Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.

    PubMed Central

    Grange, T; de Sa, C M; Oddos, J; Pictet, R

    1987-01-01

    We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805

  3. Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

    PubMed

    Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

    1994-12-01

    Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

  4. Vacuolar H[sup +]-ATPase 69-kilodalton catalytic subunit cDNA from developing cotton (Gossypium hirsutum) ovules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilkins, T.A.

    1993-06-01

    This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.

  5. Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

    PubMed Central

    Matroudi, S.; Zamani, M.R.; Motallebi, M.

    2008-01-01

    In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

  6. Sequencing, Analysis, and Annotation of Expressed Sequence Tags for Camelus dromedarius

    PubMed Central

    Al-Swailem, Abdulaziz M.; Shehata, Maher M.; Abu-Duhier, Faisel M.; Al-Yamani, Essam J.; Al-Busadah, Khalid A.; Al-Arawi, Mohammed S.; Al-Khider, Ali Y.; Al-Muhaimeed, Abdullah N.; Al-Qahtani, Fahad H.; Manee, Manee M.; Al-Shomrani, Badr M.; Al-Qhtani, Saad M.; Al-Harthi, Amer S.; Akdemir, Kadir C.; Otu, Hasan H.

    2010-01-01

    Despite its economical, cultural, and biological importance, there has not been a large scale sequencing project to date for Camelus dromedarius. With the goal of sequencing complete DNA of the organism, we first established and sequenced camel EST libraries, generating 70,272 reads. Following trimming, chimera check, repeat masking, cluster and assembly, we obtained 23,602 putative gene sequences, out of which over 4,500 potentially novel or fast evolving gene sequences do not carry any homology to other available genomes. Functional annotation of sequences with similarities in nucleotide and protein databases has been obtained using Gene Ontology classification. Comparison to available full length cDNA sequences and Open Reading Frame (ORF) analysis of camel sequences that exhibit homology to known genes show more than 80% of the contigs with an ORF>300 bp and ∼40% hits extending to the start codons of full length cDNAs suggesting successful characterization of camel genes. Similarity analyses are done separately for different organisms including human, mouse, bovine, and rat. Accompanying web portal, CAGBASE (http://camel.kacst.edu.sa/), hosts a relational database containing annotated EST sequences and analysis tools with possibility to add sequences from public domain. We anticipate our results to provide a home base for genomic studies of camel and other comparative studies enabling a starting point for whole genome sequencing of the organism. PMID:20502665

  7. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    PubMed

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  8. Genetic Regulation in the Aiptasia pallida Symbiosis - Performance Report, Year 1.

    DTIC Science & Technology

    1997-02-01

    and symbiotic zooxanthellae is one developed for serial analysis of gene expression (SAGE). We initially tested the SAGE protocol with cDNA generated...technically difficult. We are now focusing on constructing representative cDNA libraries from cultured and symbiotic zooxanthellae and will sequence

  9. Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my

    A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less

  10. cDNA cloning, expression, and mutagenesis of a PR-10 protein SPE-16 from the seeds of Pachyrrhizus erosus.

    PubMed

    Wu, Fang; Yan, Ming; Li, Yikun; Chang, Shaojie; Song, Xiaomin; Zhou, Zhaocai; Gong, Weimin

    2003-12-19

    SPE-16 is a new 16kDa protein that has been purified from the seeds of Pachyrrhizus erosus. It's N-terminal amino acid sequence shows significant sequence homology to pathogenesis-related class 10 proteins. cDNA encoding 150 amino acids was cloned by RT-PCR and the gene sequence proved SPE-16 to be a new member of PR-10 family. The cDNA was cloned into pET15b plasmid and expressed in Escherichia coli. The bacterially expressed SPE-16 also demonstrated ribonuclease-like activity in vitro. Site-directed mutation of three conserved amino acids E95A, E147A, Y150A, and a P-loop truncated form were constructed and their different effects on ribonuclease activities were observed. SPE-16 is also able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS) in the native state. The ANS anion is a much-utilized "hydrophobic probe" for proteins. This binding activity indicated another biological function of SPE-16.

  11. Cloning and analysis of DnaJ family members in the silkworm, Bombyx mori.

    PubMed

    Li, Yinü; Bu, Cuiyu; Li, Tiantian; Wang, Shibao; Jiang, Feng; Yi, Yongzhu; Yang, Huipeng; Zhang, Zhifang

    2016-01-15

    Heat shock proteins (Hsps) are involved in a variety of critical biological functions, including protein folding, degradation, and translocation and macromolecule assembly, act as molecular chaperones during periods of stress by binding to other proteins. Using expressed sequence tag (EST) and silkworm (Bombyx mori) transcriptome databases, we identified 27 cDNA sequences encoding the conserved J domain, which is found in DnaJ-type Hsps. Of the 27 J domain-containing sequences, 25 were complete cDNA sequences. We divided them into three types according to the number and presence of conserved domains. By analyzing the gene structures, intron numbers, and conserved domains and constructing a phylogenetic tree, we found that the DnaJ family had undergone convergent evolution, obtaining new domains to expand the diversity of its family members. The acquisition of the new DnaJ domains most likely occurred prior to the evolutionary divergence of prokaryotes and eukaryotes. The expression of DnaJ genes in the silkworm was generally higher in the fat body. The tissue distribution of DnaJ1 proteins was detected by western blotting, demonstrating that in the fifth-instar larvae, the DnaJ1 proteins were expressed at their highest levels in hemocytes, followed by the fat body and head. We also found that the DnaJ1 transcripts were likely differentially translated in different tissues. Using immunofluorescence cytochemistry, we revealed that in the blood cells, DnaJ1 was mainly localized in the cytoplasm. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Chitin synthase in the filarial parasite, Brugia malayi.

    PubMed

    Harris, M T; Lai, K; Arnold, K; Martinez, H F; Specht, C A; Fuhrman, J A

    2000-12-01

    Fragments of putative chitin synthase (chs) genes from two filarial species (Brugia malayi and Dirofilaria immitis) were amplified by PCR using degenerate primers. The full genomic and cDNA sequences were obtained for the B. malayi chs gene (Bm-chs-1); the predicted amino acid sequence is highly similar, over a large region, to two CHS sequences of the nematode Caenorhabditis elegans and also to two insect CHS sequences. Bm-chs-1 is abundantly transcribed in B. malayi adult females, independent of their fertilization status, but is also expressed in males and microfilariae. Oocytes and early embryos contain large amounts of Bm-chs-1 transcript by in situ hybridization, but later stage embryos within the maternal uterus show little or no Bm-chs-1 transcript. No specific hybridization could be demonstrated in maternal somatic tissues. Polyclonal antibodies were raised against a peptide expressed from a recombinant cDNA fragment of Bm-chs-1; immunostaining detected CHS protein in oocytes and early to midstage embryos. These studies characterize a gene that is likely to be essential to oogenesis and embryonic development in a parasitic nematode. Because chitin synthesis and eggshell formation begin after fertilization, the presence of CHS protein in early oocytes suggests that the enzyme must be activated as a result of fertilization. These studies also demonstrate that chitin synthesis may not be restricted to eggshell formation in nematodes, as the Bm-chs-1 gene is transcribed in life cycle stages other than adult females.

  13. Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

    NASA Technical Reports Server (NTRS)

    Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

    1992-01-01

    We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

  14. Stachyose synthesis in seeds of adzuki bean (Vigna angularis): molecular cloning and functional expression of stachyose synthase.

    PubMed

    Peterbauer, T; Mucha, J; Mayer, U; Popp, M; Glössl, J; Richter, A

    1999-12-01

    Stachyose is the major soluble carbohydrate in seeds of a number of important crop species. It is synthesized from raffinose and galactinol by the action of stachyose synthase (EC 2.4.1.67). We report here on the identification of a cDNA encoding stachyose synthase from seeds of adzuki bean (Vigna angularis Ohwi et Ohashi). Based on internal amino acid sequences of the enzyme purified from adzuki bean, oligonucleotides were designed and used to amplify corresponding sequences from adzuki bean cDNA by RT-PCR, followed by rapid amplification of cDNA ends (RACE-PCR). The complete cDNA sequence comprised 3046 nucleotides and included an open reading frame which encoded a polypeptide of 857 amino acid residues. The entire coding region was amplified by PCR, engineered into the baculovirus expression vector pVL1393 and introduced into Spodoptera frugiperda (Sf21) insect cells for heterologous expression. The recombinant protein was immunologically reactive with polyclonal antibodies raised against stachyose synthase purified from adzuki bean and was shown to be a functional stachyose synthase with the same catalytic properties as its native counterpart. High levels of stachyose synthase mRNA were transiently accumulated midway through seed development, and the enzyme was also present in mature seeds and during germination.

  15. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

    PubMed

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-12-01

    A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

  16. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

    PubMed Central

    Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

    1987-01-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

  17. Cloning a Chymotrypsin-Like 1 (CTRL-1) Protease cDNA from the Jellyfish Nemopilema nomurai

    PubMed Central

    Heo, Yunwi; Kwon, Young Chul; Bae, Seong Kyeong; Hwang, Duhyeon; Yang, Hye Ryeon; Choudhary, Indu; Lee, Hyunkyoung; Yum, Seungshic; Shin, Kyoungsoon; Yoon, Won Duk; Kang, Changkeun; Kim, Euikyung

    2016-01-01

    An enzyme in a nematocyst extract of the Nemopilema nomurai jellyfish, caught off the coast of the Republic of Korea, catalyzed the cleavage of chymotrypsin substrate in an amidolytic kinetic assay, and this activity was inhibited by the serine protease inhibitor, phenylmethanesulfonyl fluoride. We isolated the full-length cDNA sequence of this enzyme, which contains 850 nucleotides, with an open reading frame of 801 encoding 266 amino acids. A blast analysis of the deduced amino acid sequence showed 41% identity with human chymotrypsin-like (CTRL) and the CTRL-1 precursor. Therefore, we designated this enzyme N. nomurai CTRL-1. The primary structure of N. nomurai CTRL-1 includes a leader peptide and a highly conserved catalytic triad of His69, Asp117, and Ser216. The disulfide bonds of chymotrypsin and the substrate-binding sites are highly conserved compared with the CTRLs of other species, including mammalian species. Nemopilema nomurai CTRL-1 is evolutionarily more closely related to Actinopterygii than to Scyphozoan (Aurelia aurita) or Hydrozoan (Hydra vulgaris). The N. nomurai CTRL1 was amplified from the genomic DNA with PCR using specific primers designed based on the full-length cDNA, and then sequenced. The N. nomurai CTRL1 gene contains 2434 nucleotides and four distinct exons. The 5′ donor splice (GT) and 3′ acceptor splice sequences (AG) are wholly conserved. This is the first report of the CTRL1 gene and cDNA structures in the jellyfish N. nomurai. PMID:27399771

  18. Cloning a Chymotrypsin-Like 1 (CTRL-1) Protease cDNA from the Jellyfish Nemopilema nomurai.

    PubMed

    Heo, Yunwi; Kwon, Young Chul; Bae, Seong Kyeong; Hwang, Duhyeon; Yang, Hye Ryeon; Choudhary, Indu; Lee, Hyunkyoung; Yum, Seungshic; Shin, Kyoungsoon; Yoon, Won Duk; Kang, Changkeun; Kim, Euikyung

    2016-07-05

    An enzyme in a nematocyst extract of the Nemopilema nomurai jellyfish, caught off the coast of the Republic of Korea, catalyzed the cleavage of chymotrypsin substrate in an amidolytic kinetic assay, and this activity was inhibited by the serine protease inhibitor, phenylmethanesulfonyl fluoride. We isolated the full-length cDNA sequence of this enzyme, which contains 850 nucleotides, with an open reading frame of 801 encoding 266 amino acids. A blast analysis of the deduced amino acid sequence showed 41% identity with human chymotrypsin-like (CTRL) and the CTRL-1 precursor. Therefore, we designated this enzyme N. nomurai CTRL-1. The primary structure of N. nomurai CTRL-1 includes a leader peptide and a highly conserved catalytic triad of His(69), Asp(117), and Ser(216). The disulfide bonds of chymotrypsin and the substrate-binding sites are highly conserved compared with the CTRLs of other species, including mammalian species. Nemopilema nomurai CTRL-1 is evolutionarily more closely related to Actinopterygii than to Scyphozoan (Aurelia aurita) or Hydrozoan (Hydra vulgaris). The N. nomurai CTRL1 was amplified from the genomic DNA with PCR using specific primers designed based on the full-length cDNA, and then sequenced. The N. nomurai CTRL1 gene contains 2434 nucleotides and four distinct exons. The 5' donor splice (GT) and 3' acceptor splice sequences (AG) are wholly conserved. This is the first report of the CTRL1 gene and cDNA structures in the jellyfish N. nomurai.

  19. Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2008-01-01

    Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…

  20. Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

    PubMed

    Bricheux, G; Brugerolle, G

    1997-08-01

    The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

  1. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    PubMed

    Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

    2002-11-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

  2. Transcriptome analysis of eyestalk and hemocytes in the ridgetail white prawn Exopalaemon carinicauda: assembly, annotation and marker discovery.

    PubMed

    Li, Jitao; Li, Jian; Chen, Ping; Liu, Ping; He, Yuying

    2015-01-01

    The ridgetail white prawn Exopalaemon carinicauda is one of major economic mariculture species in eastern China. The deficiency of genomic and transcriptomic data is becoming the bottleneck of further researches on its good traits. In the present study, 454 pyrosequencing was undertaken to investigate the transcriptome profiles of E. carinicauda. A collection of 1,028,710 sequence reads (459.59 Mb) obtained from cDNA prepared from eyestalk and hemocytes was assembled into 162,056 expressed sequence tags (ESTs). Of these, 29.88 % of 48,428 contigs and 70.12 % of 113,628 singlets possessed high similarities to sequences in the GenBank non-redundant database, with most significant (E value <1e(-10)) unigenes matches occurring with crustacean and insect sequences. KEGG analysis of unigenes identified putative members of biological pathways related to growth and immunity. In addition, we obtained a total of putative 125,112 SNPs and 13,467 microsatellites. These results will contribute to the understanding of the genome makeup and provide useful information for future functional genomic research in E. carinicauda.

  3. Phylogenetic and Structural Analysis of the Pluripotency Factor Sex-Determining Region Y box2 Gene of Camelus dromedarius (cSox2).

    PubMed

    Alawad, Abdullah; Alharbi, Sultan; Alhazzaa, Othman; Alagrafi, Faisal; Alkhrayef, Mohammed; Alhamdan, Ziyad; Alenazi, Abdullah; Al-Johi, Hasan; Alanazi, Ibrahim O; Hammad, Mohamed

    2016-01-01

    Although the sequencing information of Sox2 cDNA for many mammalian is available, the Sox2 cDNA of Camelus dromedaries has not yet been characterized. The objective of this study was to sequence and characterize Sox2 cDNA from the brain of C. dromedarius (also known as Arabian camel). A full coding sequence of the Sox2 gene from the brain of C. dromedarius was amplified by reverse transcription PCRjmc and then sequenced using the 3730XL series platform Sequencer (Applied Biosystem) for the first time. The cDNA sequence displayed an open reading frame of 822 nucleotides, encoding a protein of 273 amino acids. The molecular weight and the isoelectric point of the translated protein were calculated as 29.825 kDa and 10.11, respectively, using bioinformatics analysis. The predicted cSox2 protein sequence exhibited high identity: 99% for Homo sapiens, Mus musculus, Bos taurus, and Vicugna pacos; 98% for Sus scrofa and 93% for Camelus ferus. A 3D structure was built based on the available crystal structure of the HMG-box domain of human stem cell transcription factor Sox2 (PDB: 2 LE4) with 81 residues and predicting bioinformatics software for 273 amino acid residues. The comparison confirms the presence of the HMG-box domain in the cSox2 protein. The orthologous phylogenetic analysis showed that the Sox2 isoform from C. dromedarius was grouped with humans, alpacas, cattle, and pigs. We believe that this genetic and structural information will be a helpful source for the annotation. Furthermore, Sox2 is one of the transcription factors that contributes to the generation-induced pluripotent stem cells (iPSCs), which in turn will probably help generate camel induced pluripotent stem cells (CiPSCs).

  4. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    PubMed Central

    Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

    2009-01-01

    Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

  5. [Cloning and functional characterization of phytoene desaturase in Andrographis paniculata].

    PubMed

    Shen, Qin-qin; Li, Li-xia; Zhan, Peng-lin; Wang, Qiang

    2015-10-01

    A full-length cDNA of phytoene desaturase (PDS) gene from Andrographis paniculata was obtained through RACE-PCR. The cDNA sequence consists of 2 224 bp with an intact ORF of 1 752 bp (GeneBank: KP982892), encoding a ploypeptide of 584 amino acids. Homology analysis showed that the deduced protein has extensive sequence similarities to PDS from other plants, and contains a conserved NAD ( H) -binding domain of plant dehydrase cofactor binding-domain in N-terminal. Phylogenetic analysis demonstrated that ApPDS was more related to PDS of Sesamum indicum and Pogostemon cablin. The semi-quantitative RT-PCR analysis revealed that ApPDS expressed in whole aboveground tissues with the highest expression in leaves. Virus induced gene silencing (VIGS) was performed to characterize the functional of ApPDS in planta. Significant photobleaching was not observed in infiltrated leaves, while the PDS gene has been down-regulated significantly at the yellowish area. To the best of our knowledge, this represents the first report of PDS gene cloning and functional characterization from A. paniculata, which lays the foundation for further investigation of new genes, especially that correlative to andrographolide biosynthetic pathway.

  6. Human HST1 (HSTF1) gene maps to chromosome band 11q13 and coamplifies with the INT2 gene in human cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoshida, Michihiro C.; Wada, Makio; Satoh, Hitoshi

    1988-07-01

    The human HST1 gene, previously designated the hst gene, and now assigned the name HSTF1 for heparin-binding secretory transforming factor in human gene nomenclature, was originally identified as a transforming gene in DNAs from human stomach cancers by transfection assay with mouse NIH 3T3 cells. The amino acid sequence of the product deduced from DNA sequences of the HST1 cDNA and genomic clones had approximately 40% homology to human basic and acidic fibroblast growth factors and mouse Int-2-encoded protein. The authors have mapped the human HST1 gene to chromosome 11 at band q13.3 by Southern blot hybridization analysis of amore » panel of human and mouse somatic cell hybrids and in situ hybridization with an HST1 cDNA probe. The HST1 gene was found to be amplified in DNAs obtained from a stomach cancer and a vulvar carcinoma cell line, A431. In all of these samples of DNA, the INT2 gene, previously mapped to human chromosome 11q13, was also amplified to the same degree as the HST1 gene.« less

  7. Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

    PubMed Central

    Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

    1983-01-01

    The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

  8. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  9. Genes expressed during the development and ripening of watermelon fruit.

    PubMed

    Levi, A; Davis, A; Hernandez, A; Wechter, P; Thimmapuram, J; Trebitsh, T; Tadmor, Y; Katzir, N; Portnoy, V; King, S

    2006-11-01

    A normalized cDNA library was constructed using watermelon flesh mRNA from three distinct developmental time-points and was subtracted by hybridization with leaf cDNA. Random cDNA clones of the watermelon flesh subtraction library were sequenced from the 5' end in order to identify potentially informative genes associated with fruit setting, development, and ripening. One-thousand and forty-six 5'-end sequences (expressed sequence tags; ESTs) were assembled into 832 non-redundant sequences, designated as "EST-unigenes". Of these 832 "EST-unigenes", 254 ( approximately 30%) have no significant homology to sequences published so far for other plant species. Additionally, 168 "EST-unigenes" ( approximately 20%) correspond to genes with unknown function, whereas 410 "EST-unigenes" ( approximately 50%) correspond to genes with known function in other plant species. These "EST-unigenes" are mainly associated with metabolism, membrane transport, cytoskeleton synthesis and structure, cell wall formation and cell division, signal transduction, nucleic acid binding and transcription factors, defense and stress response, and secondary metabolism. This study provides the scientific community with novel genetic information for watermelon as well as an expanded pool of genes associated with fruit development in watermelon. These genes will be useful targets in future genetic and functional genomic studies of watermelon and its development.

  10. Generation and Analysis of a Large-Scale Expressed Sequence Tag Database from a Full-Length Enriched cDNA Library of Developing Leaves of Gossypium hirsutum L

    PubMed Central

    Pang, Chaoyou; Fan, Shuli; Song, Meizhen; Yu, Shuxun

    2013-01-01

    Background Cotton (Gossypium hirsutum L.) is one of the world’s most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. Methodology/Principal Findings In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR), which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. Conclusions/Significance These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence assembly and annotation in G. hirsutum and comparative genomics among Gossypium species. PMID:24146870

  11. Community Composition and Transcriptional Activity of Ammonia-Oxidizing Prokaryotes of Seagrass Thalassia hemprichii in Coral Reef Ecosystems.

    PubMed

    Ling, Juan; Lin, Xiancheng; Zhang, Yanying; Zhou, Weiguo; Yang, Qingsong; Lin, Liyun; Zeng, Siquan; Zhang, Ying; Wang, Cong; Ahmad, Manzoor; Long, Lijuan; Dong, Junde

    2018-01-01

    Seagrasses in coral reef ecosystems play important ecological roles by enhancing coral reef resilience under ocean acidification. However, seagrass primary productivity is typically constrained by limited nitrogen availability. Ammonia oxidation is an important process conducted by ammonia-oxidizing archaea (AOA) and bacteria (AOB), yet little information is available concerning the community structure and potential activity of seagrass AOA and AOB. Therefore, this study investigated the variations in the abundance, diversity and transcriptional activity of AOA and AOB at the DNA and transcript level from four sample types: the leaf, root, rhizosphere sediment and bulk sediment of seagrass Thalassia hemprichii in three coral reef ecosystems. DNA and complementary DNA (cDNA) were used to prepare clone libraries and DNA and cDNA quantitative PCR ( q PCR) assays, targeting the ammonia monooxygenase-subunit ( amo A) genes as biomarkers. Our results indicated that the closest relatives of the obtained archaeal and bacterial amo A gene sequences recovered from DNA and cDNA libraries mainly originated from the marine environment. Moreover, all the obtained AOB sequences belong to the Nitrosomonadales cluster. Nearly all the AOA communities exhibited higher diversity than the AOB communities at the DNA level, but the q PCR data demonstrated that the abundances of AOB communities were higher than that of AOA communities based on both DNA and RNA transcripts. Collectively, most of the samples shared greater community composition similarity with samples from the same location rather than sample type. Furthermore, the abundance of archaeal amo A gene in rhizosphere sediments showed significant relationships with the ammonium concentration of sediments and the nitrogen content of plant tissue (leaf and root) at the DNA level ( P < 0.05). Conversely, no such relationships were found for the AOB communities. This work provides new insight into the nitrogen cycle, particularly nitrification of seagrass meadows in coral reef ecosystems.

  12. Characterization of a monoclonal antibody and a cDNA for polyubiquitin of Amoeba proteus.

    PubMed

    Lee, S Y; Kim, H J; Yoo, S Y; Ahn, T I

    1998-01-01

    A monoclonal antibody was obtained that reacts with many different proteins (14-200 kDa) of Amoeba proteus. By indirect immunofluorescence microscopy we found the antigens to be dispersed throughout the cytoplasm but were more concentrated in the nucleus. The antibody cross-reacted with proteins of Tetrahymena, Xenopus embryo, and mouse macrophages. Using the antibody as a probe we cloned a cDNA of 1.2 kb coding for ubiquitin in five repeats. Amino acid sequences of ameba's polyubiquitin showed the most variations among the nineteen polyubiquitins of other organisms compared. The well-conserved 20Ser and 55Thr residues were replaced with Gly and Ser, respectively. The 28Ala residue found in most organisms was replaced with Gln or Glu in the amoeba. Amoebae contained two ubiquitin-mRNAs that could be detected by Northern blot analysis using the cDNA as a probe. In an analysis for specificity, the antibody reacted with polyubiquitin and ubiquitin-fusion proteins larger than 14 kDa but not with monomeric ubiquitin. The antibody is a useful probe in the detection and characterization of proteins ubiquitinated in response to cellular stresses.

  13. Genome-Wide Profiling of RNA–Protein Interactions Using CLIP-Seq

    PubMed Central

    Stork, Cheryl; Zheng, Sika

    2017-01-01

    UV crosslinking immunoprecipitation (CLIP) is an increasingly popular technique to study protein–RNA interactions in tissues and cells. Whole cells or tissues are ultraviolet irradiated to generate a covalent bond between RNA and proteins that are in close contact. After partial RNase digestion, antibodies specific to an RNA binding protein (RBP) or a protein–epitope tag is then used to immunoprecipitate the protein–RNA complexes. After stringent washing and gel separation the RBP–RNA complex is excised. The RBP is protease digested to allow purification of the bound RNA. Reverse transcription of the RNA followed by high-throughput sequencing of the cDNA library is now often used to identify protein bound RNA on a genome-wide scale. UV irradiation can result in cDNA truncations and/or mutations at the crosslink sites, which complicates the alignment of the sequencing library to the reference genome and the identification of the crosslinking sites. Meanwhile, one or more amino acids of a crosslinked RBP can remain attached to its bound RNA due to incomplete digestion of the protein. As a result, reverse transcriptase may not read through the crosslink sites, and produce cDNA ending at the crosslinked nucleotide. This is harnessed by one variant of CLIP methods to identify crosslinking sites at a nucleotide resolution. This method, individual nucleotide resolution CLIP (iCLIP) circularizes cDNA to capture the truncated cDNA and also increases the efficiency of ligating sequencing adapters to the library. Here, we describe the detailed procedure of iCLIP. PMID:26965263

  14. Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum).

    PubMed

    Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining

    2013-08-01

    Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

  15. The arbuscular mycorrhizal fungal protein glomalin is a putative homolog of heat shock protein 60.

    PubMed

    Gadkar, Vijay; Rillig, Matthias C

    2006-10-01

    Work on glomalin-related soil protein produced by arbuscular mycorrhizal (AM) fungi (AMF) has been limited because of the unknown identity of the protein. A protein band cross-reactive with the glomalin-specific antibody MAb32B11 from the AM fungus Glomus intraradices was partially sequenced using tandem liquid chromatography-mass spectrometry. A 17 amino acid sequence showing similarity to heat shock protein 60 (hsp 60) was obtained. Based on degenerate PCR, a full-length cDNA of 1773 bp length encoding the hsp 60 gene was isolated from a G. intraradices cDNA library. The ORF was predicted to encode a protein of 590 amino acids. The protein sequence had three N-terminal glycosylation sites and a string of GGM motifs at the C-terminal end. The GiHsp 60 ORF had three introns of 67, 76 and 131 bp length. The GiHsp 60 was expressed using an in vitro translation system, and the protein was purified using the 6xHis-tag system. A dot-blot assay on the purified protein showed that it was highly cross-reactive with the glomalin-specific antibody MAb32B11. The present work provides the first evidence for the identity of the glomalin protein in the model AMF G. intraradices, thus facilitating further characterization of this protein, which is of great interest in soil ecology.

  16. Molecular cloning and characterization of the light-harvesting chlorophyll a/b gene from the pigeon pea (Cajanus cajan).

    PubMed

    Qiao, Guang; Wen, Xiao-Peng; Zhang, Ting

    2015-12-01

    Light-harvesting chlorophyll a/b-binding proteins (LHCB) have been implicated in the stress response. In this study, a gene encoding LHCB in the pigeon pea was cloned and characterized. Based on the sequence of a previously obtained 327 bp Est, a full-length 793 bp cDNA was cloned using the rapid amplification of cDNA ends (RACE) method. It was designated CcLHCB1 and encoded a 262 amino acid protein. The calculated molecular weight of the CcLHCB1 protein was 27.89 kDa, and the theoretical isoelectric point was 5.29. Homology search and sequence multi-alignment demonstrated that the CcLHCB1 protein sequence shared a high identity with LHCB from other plants. Bioinformatics analysis revealed that CcLHCB1 was a hydrophobic protein with three transmembrane domains. By fluorescent quantitative real-time polymerase chain reaction (PCR), CcLHCB1 mRNA transcripts were detectable in different tissues (leaf, stem, and root), with the highest level found in the leaf. The expression of CcLHCB1 mRNA in the leaves was up-regulated by drought stimulation and AM inoculation. Our results provide the basis for a better understanding of the molecular organization of LCHB and might be useful for understanding the interaction between plants and microbes in the future.

  17. Developing expressed sequence tag libraries and the discovery of simple sequence repeat markers for two species of raspberry (Rubus L.).

    PubMed

    Bushakra, Jill M; Lewers, Kim S; Staton, Margaret E; Zhebentyayeva, Tetyana; Saski, Christopher A

    2015-10-26

    Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed sequence tags (ESTs) are a source of SSRs that can be used to develop markers to facilitate plant breeding and for more basic research across genera and higher plant orders. Leaf and meristem tissue from 'Heritage' red raspberry (Rubus idaeus) and 'Bristol' black raspberry (R. occidentalis) were utilized for RNA extraction. After conversion to cDNA and library construction, ESTs were sequenced, quality verified, assembled and scanned for SSRs.  Primers flanking the SSRs were designed and a subset tested for amplification, polymorphism and transferability across species. ESTs containing SSRs were functionally annotated using the GenBank non-redundant (nr) database and further classified using the gene ontology database. To accelerate development of EST-SSRs in the genus Rubus (Rosaceae), 1149 and 2358 cDNA sequences were generated from red raspberry and black raspberry, respectively. The cDNA sequences were screened using rigorous filtering criteria which resulted in the identification of 121 and 257 SSR loci for red and black raspberry, respectively. Primers were designed from the surrounding sequences resulting in 131 and 288 primer pairs, respectively, as some sequences contained more than one SSR locus. Sequence analysis revealed that the SSR-containing genes span a diversity of functions and share more sequence identity with strawberry genes than with other Rosaceous species. This resource of Rubus-specific, gene-derived markers will facilitate the construction of linkage maps composed of transferable markers for studying and manipulating important traits in this economically important genus.

  18. Overexpression of Nrp/b (nuclear restrict protein in brain) suppresses the malignant phenotype in the C6/ST1 glioma cell line.

    PubMed

    Degaki, Theri Leica; Demasi, Marcos Angelo Almeida; Sogayar, Mari Cleide

    2009-11-01

    Upon searching for glucocorticoid-regulated cDNA sequences associated with the transformed to normal phenotypic reversion of C6/ST1 rat glioma cells, we identified Nrp/b (nuclear restrict protein in brain) as a novel rat gene. Here we report on the identification and functional characterization of the complete sequence encoding the rat NRP/B protein. The cloned cDNA presented a 1767 nucleotides open-reading frame encoding a 589 amino acids residues sequence containing a BTB/POZ (broad complex Tramtrack bric-a-brac/Pox virus and zinc finger) domain in its N-terminal region and kelch motifs in its C-terminal region. Sequence analysis indicates that the rat Nrp/b displays a high level of identity with the equivalent gene orthologs from other organisms. Among rat tissues, Nrp/b expression is more pronounced in brain tissue. We show that overexpression of the Nrp/b cDNA in C6/ST1 cells suppresses anchorage independence in vitro and tumorigenicity in vivo, altering their malignant nature towards a more benign phenotype. Therefore, Nrp/b may be postulated as a novel tumor suppressor gene, with possible relevance for glioblastoma therapy.

  19. Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.

    PubMed

    Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R

    2016-08-30

    The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

  20. SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd

    2015-09-01

    The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

  1. RNA circularization reveals terminal sequence heterogeneity in a double-stranded RNA virus.

    PubMed

    Widmer, G

    1993-03-01

    Double-stranded RNA viruses (dsRNA), termed LRV1, have been found in several strains of the protozoan parasite Leishmania. With the aim of constructing a full-length cDNA copy of the viral genome, including its terminal sequences, a protocol based on PCR amplification across the 3'-5' junction of circularized RNA was developed. This method proved to be applicable to dsRNA. It provided a relatively simple alternative to one-sided PCR, without loss of specificity inherent in the use of generic primers. LRV1 terminal nucleotide sequences obtained by this method showed a considerable variation in length, particularly at the 5' end of the positive strand, as well as the potential for forming 3' overhangs. The opposite genomic end terminates in 0, 1, or 2 TCA trinucleotide repeats. These results are compared with terminal sequences derived from one-sided PCR experiments.

  2. [Characterization and transcriptional analysis of a new CC chemokine associated with innate imimune response in cobia (Rachycentron canadum)].

    PubMed

    Su, Y; Feng, J; Sun, X; Guo, Z; Xu, L; Jiang, J

    2013-01-01

    Chemokines are small, secreted cytokine peptides, known principally for their ability to induce migration and activation of leukocyte populations under both pathological and physiological conditions. On the basis of previously constructed express sequence tags (ESTs) of the head kidney and spleen cDNA library of the perciform marine fish Rachycentron canadum (common name cobia). We used bi-directional rapid amplification of cDNA ends (RACE) and obtained a full-length cDNA of a new CC chemokine gene (designated RcCC3). The RcCC3 putative peptide exhibits sequence similarity to the group of CCL19/21/25 CC chemokines. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used in transcript expression studies of RcCC3. We examined the constitutive expression of the transcripts in 12 tissues of non-stressed cobia; RcCC3 transcripts were detected in all tissues examined, with the highest expression in gill and liver, following by head kidney, kidney, spleen, skin, intestine, muscle, stomach, heart, blood and brain. Transcript expression of RcCC3 was examined in immune-related organs, including head kidney, spleen and liver, following intraperitoneal injection of phosphate-buffered saline control, polyriboinosinic polyribocytidylic acid (poly(I:C)) and formalin-killed Vibrio carchariae (bacterial vaccine). The transcripts in these tissues were quickly up-regulated by the injection of poly(I:C) and bacterial vaccine at early time points, although with different expression profiles. These results indicate RcCC3 represents an important component of innate immunity in cobia.

  3. Molecular cloning and functional expression of bovine spleen ecto-NAD+ glycohydrolase: structural identity with human CD38.

    PubMed Central

    Augustin, A; Muller-Steffner, H; Schuber, F

    2000-01-01

    Bovine spleen ecto-NAD(+) glycohydrolase, an archetypal member of the mammalian membrane-associated NAD(P)(+) glycohydrolase enzyme family (EC 3.2.2.6), displays catalytic features similar to those of CD38, i.e. a protein originally described as a lymphocyte differentiation marker involved in the metabolism of cyclic ADP-ribose and signal transduction. Using amino acid sequence information obtained from NAD(+) glycohydrolase and from a truncated and hydrosoluble form of the enzyme (hNADase) purified to homogeneity, a full-length cDNA clone was obtained. The deduced sequence indicates a protein of 278 residues with a molecular mass of 31.5 kDa. It predicts that bovine ecto-NAD(+) glycohydrolase is a type II transmembrane protein, with a very short intracellular tail. The bulk of the enzyme, which is extracellular and contains two potential N-glycosylation sites, yields the fully catalytically active hNADase which is truncated by 71 residues. Transfection of HeLa cells with the full-length cDNA resulted in the expression of the expected NAD(+) glycohydrolase, ADP-ribosyl cyclase and GDP-ribosyl cyclase activities at the surface of the cells. The bovine enzyme, which is the first 'classical' NAD(P)(+) glycohydrolase whose structure has been established, presents a particularly high sequence identity with CD38, including the presence of 10 strictly conserved cysteine residues in the ectodomain and putative catalytic residues. However, it lacks two otherwise conserved cysteine residues near its C-terminus. Thus hNADase, the truncated protein of 207 amino acids, represents the smallest functional domain endowed with all the catalytic activities of CD38/NAD(+) glycohydrolases so far identified. Altogether, our data strongly suggest that the cloned bovine spleen ecto-NAD(+) glycohydrolase is the bovine equivalent of CD38. PMID:10600637

  4. Identification and suppression of the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase in Zea mays L.

    PubMed Central

    Marita, Jane M; Hatfield, Ronald D; Rancour, David M; Frost, Kenneth E

    2014-01-01

    Grasses, such as Zea mays L. (maize), contain relatively high levels of p-coumarates (pCA) within their cell walls. Incorporation of pCA into cell walls is believed to be due to a hydroxycinnamyl transferase that couples pCA to monolignols. To understand the role of pCA in maize development, the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase (pCAT) was isolated and purified from maize stems. Purified pCAT was subjected to partial trypsin digestion, and peptides were sequenced by tandem mass spectrometry. TBLASTN analysis of the acquired peptide sequences identified a single full-length maize cDNA clone encoding all the peptide sequences obtained from the purified enzyme. The cDNA clone was obtained and used to generate an RNAi construct for suppressing pCAT expression in maize. Here we describe the effects of suppression of pCAT in maize. Primary screening of transgenic maize seedling leaves using a new rapid analytical platform was used to identify plants with decreased amounts of pCA. Using this screening method, mature leaves from fully developed plants were analyzed, confirming reduced pCA levels throughout plant development. Complete analysis of isolated cell walls from mature transgenic stems and leaves revealed that lignin levels did not change, but pCA levels decreased and the lignin composition was altered. Transgenic plants with the lowest levels of pCA had decreased levels of syringyl units in the lignin. Thus, altering the levels of pCAT expression in maize leads to altered lignin composition, but does not appear to alter the total amount of lignin present in the cell walls. PMID:24654730

  5. Identification and suppression of the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase in Zea mays L.

    PubMed

    Marita, Jane M; Hatfield, Ronald D; Rancour, David M; Frost, Kenneth E

    2014-06-01

    Grasses, such as Zea mays L. (maize), contain relatively high levels of p-coumarates (pCA) within their cell walls. Incorporation of pCA into cell walls is believed to be due to a hydroxycinnamyl transferase that couples pCA to monolignols. To understand the role of pCA in maize development, the p-coumaroyl CoA:hydroxycinnamyl alcohol transferase (pCAT) was isolated and purified from maize stems. Purified pCAT was subjected to partial trypsin digestion, and peptides were sequenced by tandem mass spectrometry. TBLASTN analysis of the acquired peptide sequences identified a single full-length maize cDNA clone encoding all the peptide sequences obtained from the purified enzyme. The cDNA clone was obtained and used to generate an RNAi construct for suppressing pCAT expression in maize. Here we describe the effects of suppression of pCAT in maize. Primary screening of transgenic maize seedling leaves using a new rapid analytical platform was used to identify plants with decreased amounts of pCA. Using this screening method, mature leaves from fully developed plants were analyzed, confirming reduced pCA levels throughout plant development. Complete analysis of isolated cell walls from mature transgenic stems and leaves revealed that lignin levels did not change, but pCA levels decreased and the lignin composition was altered. Transgenic plants with the lowest levels of pCA had decreased levels of syringyl units in the lignin. Thus, altering the levels of pCAT expression in maize leads to altered lignin composition, but does not appear to alter the total amount of lignin present in the cell walls. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  6. The intron 1 of HPV 16 has a suboptimal branch point at a guanosine.

    PubMed

    De la Rosa-Rios, Marco Antonio; Martínez-Salazar, Martha; Martínez-Garcia, Martha; González-Bonilla, César; Villegas-Sepúlveda, Nicolás

    2006-06-01

    The branch point sequence (BPS) of intron 1 of the HPV-16 was determined via RT-PCR in a cell free system, using lariat intermediates obtained by in vitro splicing reactions. We used synthetic E6/E7 transcripts and HeLa nuclear protein extracts to obtain the splicing intermediates. Then, a divergent oligonucleotide primer set, pairing on the lariat RNA that encompassed the 2'-5' phosphodiester bond formed between the 5' end of the intron and the BPS, was used for cDNA synthesis and PCR amplification. Subsequent RT-PCR assays revealed four splicing intermediates, made up of a major intermediary corresponding to the BPS and four cryptic branched sequences. Only intermediates bound at the 5' end of the intron are probably the authentic branch point sequence, and all of them branch at guanosine 328 instead of the typical adenosine. Unusually, the BPS of intron 1 of HPV-16 is a suboptimal sequence (AGUGAGU) that differs from the eukaryotic consensus BPS, which correlates with the splicing profile observed for early transcripts of HPV-16 in tumors and tumor derived cell lines. The implications of this unusual branch point sequence for splicing of the HPV-16 pre-mRNA are discussed.

  7. Single-Cell RNA Sequencing of Glioblastoma Cells.

    PubMed

    Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G

    2018-01-01

    Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.

  8. Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

    PubMed Central

    Huebner, K; Druck, T; Croce, C M; Thiesen, H J

    1991-01-01

    cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

  9. An annotated cDNA library of juvenile Euprymna scolopes with and without colonization by the symbiont Vibrio fischeri

    PubMed Central

    Chun, Carlene K; Scheetz, Todd E; Bonaldo, Maria de Fatima; Brown, Bartley; Clemens, Anik; Crookes-Goodson, Wendy J; Crouch, Keith; DeMartini, Tad; Eyestone, Mari; Goodson, Michael S; Janssens, Bernadette; Kimbell, Jennifer L; Koropatnick, Tanya A; Kucaba, Tamara; Smith, Christina; Stewart, Jennifer J; Tong, Deyan; Troll, Joshua V; Webster, Sarahrose; Winhall-Rice, Jane; Yap, Cory; Casavant, Thomas L; McFall-Ngai, Margaret J; Soares, M Bento

    2006-01-01

    Background Biologists are becoming increasingly aware that the interaction of animals, including humans, with their coevolved bacterial partners is essential for health. This growing awareness has been a driving force for the development of models for the study of beneficial animal-bacterial interactions. In the squid-vibrio model, symbiotic Vibrio fischeri induce dramatic developmental changes in the light organ of host Euprymna scolopes over the first hours to days of their partnership. We report here the creation of a juvenile light-organ specific EST database. Results We generated eleven cDNA libraries from the light organ of E. scolopes at developmentally significant time points with and without colonization by V. fischeri. Single pass 3' sequencing efforts generated 42,564 expressed sequence tags (ESTs) of which 35,421 passed our quality criteria and were then clustered via the UIcluster program into 13,962 nonredundant sequences. The cDNA clones representing these nonredundant sequences were sequenced from the 5' end of the vector and 58% of these resulting sequences overlapped significantly with the associated 3' sequence to generate 8,067 contigs with an average sequence length of 1,065 bp. All sequences were annotated with BLASTX (E-value < -03) and Gene Ontology (GO). Conclusion Both the number of ESTs generated from each library and GO categorizations are reflective of the activity state of the light organ during these early stages of symbiosis. Future analyses of the sequences identified in these libraries promise to provide valuable information not only about pathways involved in colonization and early development of the squid light organ, but also about pathways conserved in response to bacterial colonization across the animal kingdom. PMID:16780587

  10. Heat-shock response in a molluscan cell line: characterization of the response and cloning of an inducible HSP70 cDNA.

    PubMed

    Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P

    1997-11-01

    Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.

  11. Construction of a cDNA library for miniature pig mandibular deciduous molars

    PubMed Central

    2014-01-01

    Background The miniature pig provides an excellent experimental model for tooth morphogenesis because its diphyodont and heterodont dentition resembles that of humans. However, little information is available on the process of tooth development or the exact molecular mechanisms controlling tooth development in miniature pigs or humans. Thus, the analysis of gene expression related to each stage of tooth development is very important. Results In our study, after serial sections were made, the development of the crown of the miniature pigs’ mandibular deciduous molar could be divided into five main phases: dental lamina stage (E33-E35), bud stage (E35-E40), cap stage (E40-E50), early bell stage (E50-E60), and late bell stage (E60-E65). Total RNA was isolated from the tooth germ of miniature pig embryos at E35, E45, E50, and E60, and a cDNA library was constructed. Then, we identified cDNA sequences on a large scale screen for cDNA profiles in the developing mandibular deciduous molars (E35, E45, E50, and E60) of miniature pigs using Illumina Solexa deep sequencing. Microarray assay was used to detect the expression of genes. Lastly, through Unigene sequence analysis and cDNA expression pattern analysis at E45 and E60, we found that 12 up-regulated and 15 down-regulated genes during the four periods are highly conserved genes homologous with known Homo sapiens genes. Furthermore, there were 6 down-regulated and 2 up-regulated genes in the miniature pig that were highly homologous to Homo sapiens genes compared with those in the mouse. Conclusion Our results not only identify the specific transcriptome and cDNA profile in developing mandibular deciduous molars of the miniature pig, but also provide useful information for investigating the molecular mechanism of tooth development in the miniature pig. PMID:24750690

  12. Glycoproteins of the vitelline envelope of Amphibian oocyte: biological and molecular characterization of ZPC component (gp41) in Bufo arenarum.

    PubMed

    Barisone, Gustavo A; Krapf, Darío; Correa-Fiz, Florencia; Arranz, Silvia E; Cabada, Marcelo O

    2007-05-01

    The vitelline envelope (VE) participates in sperm-egg interactions during the first steps of fertilization. In Bufo arenarum, this envelope is composed of at least four glycoproteins, with molecular masses of 120, 75, 41, and 38 kDa and molar ratio of 1:1.3:7.4:4.8, respectively. These components were isolated and covalently coupled to silanized glass slides in order to study their sperm-binding capacity. When considering the molar ratio of the glycoproteins in the egg-envelope and assuming that each protein is monovalent for sperm, the assay showed that gp41 and gp38 possess 55 and 25% of total sperm-binding activity. We obtained a full-length cDNA of gp41 (ZPC), comprising a sequence for 486 amino acids, with 43.3% homology with Xenopus laevis ZPC. As in the case of mammalian ZP3 and Xenopus ZPC, Bufo ZPC presented a furin-like (convertase) and a C-terminal transmembrane domain (TMD) reflecting common biosynthetic and secretory pathways. As it was reported for some fishes, we obtained evidence that suggests the presence of more than one zpc gene in Bufo genome, based on different partial cDNA sequences of zpc, Southern blots and two-dimensional SDS-PAGE of deglycosylated egg-envelope components. As far as we are aware, this is the first observation of the presence of different zpc genes in an Amphibian species. Copyright (c) 2006 Wiley-Liss, Inc.

  13. Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.

    PubMed

    Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero

    2003-09-01

    The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.

  14. Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.

    PubMed

    Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr

    2008-10-13

    cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.

  15. Display of a maize cDNA library on baculovirus infected insect cells.

    PubMed

    Meller Harel, Helene Y; Fontaine, Veronique; Chen, Hongying; Jones, Ian M; Millner, Paul A

    2008-08-12

    Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV) have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 x 10(5) independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1), was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

  16. De Novo Generation and Characterization of New Zika Virus Isolate Using Sequence Data from a Microcephaly Case

    PubMed Central

    Setoh, Yin Xiang; Prow, Natalie A.; Peng, Nias; Hugo, Leon E.; Devine, Gregor; Hazlewood, Jessamine E.

    2017-01-01

    ABSTRACT Zika virus (ZIKV) has recently emerged and is the etiological agent of congenital Zika syndrome (CZS), a spectrum of congenital abnormalities arising from neural tissue infections in utero. Herein, we describe the de novo generation of a new ZIKV isolate, ZIKVNatal, using a modified circular polymerase extension reaction protocol and sequence data obtained from a ZIKV-infected fetus with microcephaly. ZIKVNatal thus has no laboratory passage history and is unequivocally associated with CZS. ZIKVNatal could be used to establish a fetal brain infection model in IFNAR−/− mice (including intrauterine growth restriction) without causing symptomatic infections in dams. ZIKVNatal was also able to be transmitted by Aedes aegypti mosquitoes. ZIKVNatal thus retains key aspects of circulating pathogenic ZIKVs and illustrates a novel methodology for obtaining an authentic functional viral isolate by using data from deep sequencing of infected tissues. IMPORTANCE The major complications of an ongoing Zika virus outbreak in the Americas and Asia are congenital defects caused by the virus’s ability to cross the placenta and infect the fetal brain. The ability to generate molecular tools to analyze viral isolates from the current outbreak is essential for furthering our understanding of how these viruses cause congenital defects. The majority of existing viral isolates and infectious cDNA clones generated from them have undergone various numbers of passages in cell culture and/or suckling mice, which is likely to result in the accumulation of adaptive mutations that may affect viral properties. The approach described herein allows rapid generation of new, fully functional Zika virus isolates directly from deep sequencing data from virus-infected tissues without the need for prior virus passaging and for the generation and propagation of full-length cDNA clones. The approach should be applicable to other medically important flaviviruses and perhaps other positive-strand RNA viruses. PMID:28529976

  17. De Novo Generation and Characterization of New Zika Virus Isolate Using Sequence Data from a Microcephaly Case.

    PubMed

    Setoh, Yin Xiang; Prow, Natalie A; Peng, Nias; Hugo, Leon E; Devine, Gregor; Hazlewood, Jessamine E; Suhrbier, Andreas; Khromykh, Alexander A

    2017-01-01

    Zika virus (ZIKV) has recently emerged and is the etiological agent of congenital Zika syndrome (CZS), a spectrum of congenital abnormalities arising from neural tissue infections in utero . Herein, we describe the de novo generation of a new ZIKV isolate, ZIKV Natal , using a modified circular polymerase extension reaction protocol and sequence data obtained from a ZIKV-infected fetus with microcephaly. ZIKV Natal thus has no laboratory passage history and is unequivocally associated with CZS. ZIKV Natal could be used to establish a fetal brain infection model in IFNAR -/- mice (including intrauterine growth restriction) without causing symptomatic infections in dams. ZIKV Natal was also able to be transmitted by Aedes aegypti mosquitoes. ZIKV Natal thus retains key aspects of circulating pathogenic ZIKVs and illustrates a novel methodology for obtaining an authentic functional viral isolate by using data from deep sequencing of infected tissues. IMPORTANCE The major complications of an ongoing Zika virus outbreak in the Americas and Asia are congenital defects caused by the virus's ability to cross the placenta and infect the fetal brain. The ability to generate molecular tools to analyze viral isolates from the current outbreak is essential for furthering our understanding of how these viruses cause congenital defects. The majority of existing viral isolates and infectious cDNA clones generated from them have undergone various numbers of passages in cell culture and/or suckling mice, which is likely to result in the accumulation of adaptive mutations that may affect viral properties. The approach described herein allows rapid generation of new, fully functional Zika virus isolates directly from deep sequencing data from virus-infected tissues without the need for prior virus passaging and for the generation and propagation of full-length cDNA clones. The approach should be applicable to other medically important flaviviruses and perhaps other positive-strand RNA viruses.

  18. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

    PubMed Central

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-01-01

    Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

  19. Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

    PubMed Central

    Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

    2015-01-01

    Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

  20. Bitis gabonica (Gaboon viper) snake venom gland: toward a catalog for the full- length transcripts (cDNA) and proteins

    PubMed Central

    Francischetti, Ivo M. B.; My-Pham, Van; Harrison, Jim; Garfield, Mark K.; Ribeiro, José M. C.

    2010-01-01

    The venom gland of the snake Bitis gabonica (Gaboon viper) was used for the first time to construct a unidirectional cDNA phage library followed by high-throughput sequencing and bioinformatic analysis. Hundreds of cDNAs were obtained and clustered into contigs. We found mostly novel full-length cDNA coding for metalloproteases (P-II and P-III classes), Lys49-phospholipase A2, serine proteases with essential mutations in the active site, Kunitz protease inhibitors, several C-type lectins, bradykinin-potentiating peptide, vascular endothelial growth factor, nucleotidases and nucleases, nerve growth factor, and L-amino acid oxidases. Two new members of the recently described short coding region family of disintegrin, displaying RGD and MLD motifs are reported. In addition, we have identified for the first time a cytokine-like molecule and a multi-Kunitz protease inhibitor in snake venoms. The CLUSTAL alignment and the unrooted cladograms for selected families of B. gabonica venom proteins are also presented. A significant number of sequences were devoid of database matches, suggesting that their biologic function remains to be identified. This paper also reports the N-terminus of the 15 most abundant venom proteins and the sequences matching their corresponding transcripts. The electronic version of this manuscript, available on request, contains spreadsheets with hyperlinks to FASTA-formatted files for each contig and the best match to the GenBank and Conserved Domain Databases, in addition to CLUSTAL alignments of each contig. We have thus generated a comprehensive catalog of the B. gabonica venom gland, containing for each secreted protein: i) the predicted molecular weight, ii) the predicted isoelectric point, iii) the accession number, and iv) the putative function. The role of these molecules is discussed in the context of the envenomation caused by the Gaboon viper. PMID:15276202

  1. Cloning, characterization, and expression of Cytochrome b ( Cytb)—a key mitochondrial gene from Prorocentrum donghaiense

    NASA Astrophysics Data System (ADS)

    Zhao, Liyuan; Mi, Tiezhu; Zhen, Yu; Yu, Zhigang

    2012-05-01

    Mitochondrial cytochrome b (Cytb), one of the few proteins encoded by the mitochondrial DNA, plays an important role in transferring electrons. As a mitochondrial gene, it has been widely used for phylogenetic analysis. Previously, a 949-bp fragment of the coding gene and mRNA editing were characterized from Prorocentrum donghaiense, which might prove useful for resolving P. donghaiense from closely related species. However, the full-length coding region has not been characterized. In this study, we used rapid amplification of cDNA ends (RACE) to obtain full-length, 1 124 bp cDNA. Cytb transcript contained a standard initiation codon ATG, but did not have a recognizable stop codon. Homology comparison showed that the P. donghaiense Cytb had a high sequence identity to Cytb sequences from other dinoflagellate species. Phylogenetic analysis placed Cytb from P. donghaiense in the clade of dinoflagellates and it clustered together strongly with that from P. minimum. Based on the full-length sequence, we inferred 32 editing events at different positions, accounting for 2.93% of the Cytb gene. 34.4% (11) of the changes were A to G, 25% (8) were T to C, and 25% (8) were C to U, with smaller proportions of G to C and G to A edits (9.4% (3) and 6.2% (2), respectively). The expression level of the Cytb transcript was quantified by real-time PCR with a TaqMan probe at different times during the whole growth phase. The average Cytb transcript was present at 39.27±7.46 copies of cDNA per cell during the whole growth cycle, and the expression of Cytb was relatively stable over the different phases. These results deepen our understanding of the structure and characteristics of Cytb in P. donghaiense, and confirmed that Cytb in P. donghaiense is a candidate reference gene for studying the expression of other genes.

  2. Sorghum Expressed Sequence Tags Identify Signature Genes for Drought, Pathogenesis, and Skotomorphogenesis from a Milestone Set of 16,801 Unique Transcripts1[w

    PubMed Central

    Pratt, Lee H.; Liang, Chun; Shah, Manish; Sun, Feng; Wang, Haiming; Reid, St. Patrick; Gingle, Alan R.; Paterson, Andrew H.; Wing, Rod; Dean, Ralph; Klein, Robert; Nguyen, Henry T.; Ma, Hong-mei; Zhao, Xin; Morishige, Daryl T.; Mullet, John E.; Cordonnier-Pratt, Marie-Michèle

    2005-01-01

    Improved knowledge of the sorghum transcriptome will enhance basic understanding of how plants respond to stresses and serve as a source of genes of value to agriculture. Toward this goal, Sorghum bicolor L. Moench cDNA libraries were prepared from light- and dark-grown seedlings, drought-stressed plants, Colletotrichum-infected seedlings and plants, ovaries, embryos, and immature panicles. Other libraries were prepared with meristems from Sorghum propinquum (Kunth) Hitchc. that had been photoperiodically induced to flower, and with rhizomes from S. propinquum and johnsongrass (Sorghum halepense L. Pers.). A total of 117,682 expressed sequence tags (ESTs) were obtained representing both 3′ and 5′ sequences from about half that number of cDNA clones. A total of 16,801 unique transcripts, representing tentative UniScripts (TUs), were identified from 55,783 3′ ESTs. Of these TUs, 9,032 are represented by two or more ESTs. Collectively, these libraries were predicted to contain a total of approximately 31,000 TUs. Individual libraries, however, were predicted to contain no more than about 6,000 to 9,000, with the exception of light-grown seedlings, which yielded an estimate of close to 13,000. In addition, each library exhibits about the same level of complexity with respect to both the number of TUs preferentially expressed in that library and the frequency with which two or more ESTs is found in only that library. These results indicate that the sorghum genome is expressed in highly selective fashion in the individual organs and in response to the environmental conditions surveyed here. Close to 2,000 differentially expressed TUs were identified among the cDNA libraries examined, of which 775 were differentially expressed at a confidence level of 98%. From these 775 TUs, signature genes were identified defining drought, Colletotrichum infection, skotomorphogenesis (etiolation), ovary, immature panicle, and embryo. PMID:16169961

  3. alpha-Mannosidosis in the guinea pig: cloning of the lysosomal alpha-mannosidase cDNA and identification of a missense mutation causing alpha-mannosidosis.

    PubMed

    Berg, Thomas; Hopwood, John J

    2002-03-16

    alpha-Mannosidosis is a lysosomal storage disorder caused by deficient activity of the lysosomal alpha-mannosidase. We report here the sequencing and expression of the lysosomal alpha-mannosidase cDNA from normal and alpha-mannosidosis guinea pigs. The amino acid sequence of the guinea pig enzyme displayed 82-85% identity to the lysosomal alpha-mannosidase in other mammals. The cDNA of the alpha-mannosidosis guinea pig contained a missense mutation, 679C>T, leading to substitution of arginine by tryptophan at amino acid position 227 (R227W). The R227W allele segregated with the alpha-mannosidosis genotype in the guinea pig colony and introduction of R227W into the wild-type sequence eliminated the production of recombinant alpha-mannosidase activity in heterologous expression studies. Furthermore, the guinea pig mutation has been found in human patients. Our results strongly indicate that the 679C>T mutation causes alpha-mannosidosis and suggest that the guinea pig will be an excellent model for investigation of pathogenesis and evaluation of therapeutic strategies for human alpha-mannosidosis.

  4. Molecular cloning of a cDNA encoding the precursor of adenoregulin from frog skin. Relationships with the vertebrate defensive peptides, dermaseptins.

    PubMed

    Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P

    1993-03-31

    Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.

  5. Identification and characterization of a DnaJ gene from red alga Pyropia yezoensis (Bangiales, Rhodophyta)

    NASA Astrophysics Data System (ADS)

    Liu, Jiao; Li, Xianchao; Tang, Xuexi; Zhou, Bin

    2016-03-01

    Members of the DnaJ family are proteins that play a pivotal role in various cellular processes, such as protein folding, protein transport and cellular responses to stress. In the present study, we identified and characterized the full-length DnaJ cDNA sequence from expressed sequence tags of Pyropia yezoensis ( PyDnaJ) via rapid identification of cDNA ends. This cDNA encoded a protein of 429 amino acids, which shared high sequence similarity with other identified DnaJ proteins, such as a heat shock protein 40/DnaJ from Pyropia haitanensis. The relative mRNA expression level of PyDnaJ was investigated using real-time PCR to determine its specific expression during the algal life cycle and during desiccation. The relative mRNA expression level in sporophytes was higher than that in gametophytes and significantly increased during the whole desiccation process. These results indicate that PyDnaJ is an authentic member of the DnaJ family in plants and red algae and might play a pivotal role in mitigating damage to P. yezoensis during desiccation.

  6. The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

    PubMed Central

    Allison, J; Hall, L; MacIntyre, I; Craig, R K

    1981-01-01

    (1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

  7. Saponin Biosynthesis in Saponaria vaccaria. cDNAs Encoding β-Amyrin Synthase and a Triterpene Carboxylic Acid Glucosyltransferase1[OA

    PubMed Central

    Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W.; Covello, Patrick S.

    2007-01-01

    Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a β-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290

  8. Quantitation of normal CFTR mRNA in CF patients with splice-site mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Z.; Olsen, J.C.; Silverman, L.M.

    Previously we identified two mutations in introns of the CFTR gene associated with partially active splice sites and unusual clinical phenotypes. One mutation in intron 19 (3849+10 kb C to T) is common in CF patients with normal sweat chloride values; an 84 bp sequence from intron 19, which contains a stop codon, is inserted between exon 19 and exon 20 in most nasal CFTR transcripts. The other mutation in intron 14B (2789+5 G to A) is associated with elevated sweat chloride levels, but mild pulmonary disease; exon 14B (38 bp) is spliced out of most nasal CFTR transcipts. Themore » remaining CFTR cDNA sequences, other than the 84 bp insertion of exon 14B deletion, are identical to the published sequence. To correlate genotype and phenotype, we used quantitative RT-PCR to determine the levels of normally-spliced CFTR mRNA in nasal epithelia from these patients. CFTR cDNA was amplified (25 cycles) by using primers specific for normally-spliced species, {gamma}-actin cDNA was amplified as a standard.« less

  9. Characterization and expression of the calpastatin gene in Cyprinus carpio.

    PubMed

    Chen, W X; Ma, Y

    2015-07-03

    Calpastatin, an important protein used to regulate meat quality traits in animals, is encoded by the CAST gene. The aim of the present study was to clone the cDNA sequence of the CAST gene and detect the expression of CAST in the tissues of Cyprinus carpio. The cDNA of the C. carpio CAST gene, amplified using rapid amplification of cDNA ends PCR, is 2834 bp in length (accession No. JX275386), contains a 2634-bp open reading frame, and encodes a protein with 877 amino acid residues. The amino acid sequence of the C. carpio CAST gene was 88, 80, and 59% identical to the sequences observed in grass carp, zebrafish, and other fish, respectively. The C. carpio CAST was observed to contain four conserved domains with 54 serine phosphorylation loci, 28 threonine phosphorylation loci, 1 tyrosine phosphorylation loci, and 6 specific protein kinase C phosphorylation loci. The CAST gene showed widespread expression in different tissues of C. carpio. Surprisingly, the relative expression of the CAST transcript in the muscle and heart tissues of C. carpio was significantly higher than in other tissues (P < 0.01).

  10. Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation.

    PubMed

    Bhat, P V; Labrecque, J; Boutin, J M; Lacroix, A; Yoshida, A

    1995-12-12

    Retinoic acid (RA), an important regulator of cell differentiation, is biosynthesized from retinol via retinal by a two-step oxidation process. We previously reported the purification and partial amino acid (aa) sequence of a rat kidney aldehyde dehydrogenase (ALDH) isozyme that catalyzed the oxidation of 9-cis and all-trans retinal to corresponding RA with high efficiency [Labrecque et al. Biochem. J. 305 (1995) 681-684]. A rat kidney cDNA library was screened using a 291-bp PCR product generated from total kidney RNA using a pair of oligodeoxyribonucleotide primers matched with the aa sequence. The full-length rat kidney ALDH cDNA contains a 2315-bp (501 aa) open reading frame (ORF). The aa sequence of rat kidney ALDH is 89, 96 and 87% identical to that of the rat cytosolic ALDH, the mouse cytosolic ALDH and human cytosolic ALDH, respectively. Northern blot and RT-PCR-mediated analysis demonstrated that rat kidney ALDH is strongly expressed in kidney, lung, testis, intestine, stomach and trachea, but weakly in the liver.

  11. Cell and molecular biology of the spiny dogfish Squalus acanthias and little skate Leucoraja erinacea: insights from in vitro cultured cells.

    PubMed

    Barnes, D W

    2012-04-01

    Two of the most commonly used elasmobranch experimental model species are the spiny dogfish Squalus acanthias and the little skate Leucoraja erinacea. Comparative biology and genomics with these species have provided useful information in physiology, pharmacology, toxicology, immunology, evolutionary developmental biology and genetics. A wealth of information has been obtained using in vitro approaches to study isolated cells and tissues from these organisms under circumstances in which the extracellular environment can be controlled. In addition to classical work with primary cell cultures, continuously proliferating cell lines have been derived recently, representing the first cell lines from cartilaginous fishes. These lines have proved to be valuable tools with which to explore functional genomic and biological questions and to test hypotheses at the molecular level. In genomic experiments, complementary (c)DNA libraries have been constructed, and c. 8000 unique transcripts identified, with over 3000 representing previously unknown gene sequences. A sub-set of messenger (m)RNAs has been detected for which the 3' untranslated regions show elements that are remarkably well conserved evolutionarily, representing novel, potentially regulatory gene sequences. The cell culture systems provide physiologically valid tools to study functional roles of these sequences and other aspects of elasmobranch molecular cell biology and physiology. Information derived from the use of in vitro cell cultures is valuable in revealing gene diversity and information for genomic sequence assembly, as well as for identification of new genes and molecular markers, construction of gene-array probes and acquisition of full-length cDNA sequences. © 2012 The Author. Journal of Fish Biology © 2012 The Fisheries Society of the British Isles.

  12. Large-scale transcriptome characterization and mass discovery of SNPs in globe artichoke and its related taxa.

    PubMed

    Scaglione, Davide; Lanteri, Sergio; Acquadro, Alberto; Lai, Zhao; Knapp, Steven J; Rieseberg, Loren; Portis, Ezio

    2012-10-01

    Cynara cardunculus (2n = 2× = 34) is a member of the Asteraceae family that contributes significantly to the agricultural economy of the Mediterranean basin. The species includes two cultivated varieties, globe artichoke and cardoon, which are grown mainly for food. Cynara cardunculus is an orphan crop species whose genome/transcriptome has been relatively unexplored, especially in comparison to other Asteraceae crops. Hence, there is a significant need to improve its genomic resources through the identification of novel genes and sequence-based markers, to design new breeding schemes aimed at increasing quality and crop productivity. We report the outcome of cDNA sequencing and assembly for eleven accessions of C. cardunculus. Sequencing of three mapping parental genotypes using Roche 454-Titanium technology generated 1.7 × 10⁶ reads, which were assembled into 38,726 reference transcripts covering 32 Mbp. Putative enzyme-encoding genes were annotated using the KEGG-database. Transcription factors and candidate resistance genes were surveyed as well. Paired-end sequencing was done for cDNA libraries of eight other representative C. cardunculus accessions on an Illumina Genome Analyzer IIx, generating 46 × 10⁶ reads. Alignment of the IGA and 454 reads to reference transcripts led to the identification of 195,400 SNPs with a Bayesian probability exceeding 95%; a validation rate of 90% was obtained by Sanger-sequencing of a subset of contigs. These results demonstrate that the integration of data from different NGS platforms enables large-scale transcriptome characterization, along with massive SNP discovery. This information will contribute to the dissection of key agricultural traits in C. cardunculus and facilitate the implementation of marker-assisted selection programs. © 2012 The Authors. Plant Biotechnology Journal © 2012 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  13. cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

    PubMed

    Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

    2010-07-01

    Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

  14. Two potato proteins, including a novel RING finger protein (HIP1), interact with the potyviral multifunctional protein HCpro.

    PubMed

    Guo, Deyin; Spetz, Carl; Saarma, Mart; Valkonen, Jari P T

    2003-05-01

    Potyviral helper-component proteinase (HCpro) is a multifunctional protein exerting its cellular functions in interaction with putative host proteins. In this study, cellular protein partners of the HCpro encoded by Potato virus A (PVA) (genus Potyvirus) were screened in a potato leaf cDNA library using a yeast two-hybrid system. Two cellular proteins were obtained that interact specifically with PVA HCpro in yeast and in the two in vitro binding assays used. Both proteins are encoded by single-copy genes in the potato genome. Analysis of the deduced amino acid sequences revealed that one (HIP1) of the two HCpro interactors is a novel RING finger protein. The sequence of the other protein (HIP2) showed no resemblance to the protein sequences available from databanks and has known biological functions.

  15. Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potier, M.C.; Dutriaux, A.; Lambolez, B.

    1993-03-01

    Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

  16. LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

    PubMed

    Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

    2017-09-15

    Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

  17. Molecular characterization, mRNA expression of prolactin receptor (PRLR) gene during pregnancy, nonpregnancy in the yak (Bos grunniens).

    PubMed

    Zi, Xiang-Dong; Chen, Da-Wen; Wang, Hong-Mei

    2012-02-01

    Prolactin (PRL) plays central roles in a wide range of body functions in mammals, and the actions are mediated by the specific cell surface receptor, the prolactin receptor (PRLR). To better understand the role of PRL in the yak (Bos grunniens), in the present study, we first cloned yak PRLR cDNA, and compared its mRNA expression in several tissues with cattle (Bos taurus). By reverse transcriptase-polymerase chain reaction (RT-PCR) strategy, we obtained full-length of yak PRLR cDNA sequence comprised of an open reading frame of 1746bp encoding a 581 amino acid protein, and contained a signal sequence and a transmembrane region. The intracellular domain had two pairs of cysteine residues and a WSXWS motif. The cytoplasmic domain comprised 323 residues and contained box 1 sequence. The yak PRLR shared 66.0-98.5% protein sequence identity with mammalian homologs. Real-time PCR analysis revealed that PRLR mRNA was higher in mammary tissue than in ovary and endometrium (P<0.01). During pregnancy, the ovary and mammary PRLR mRNA expression increased by 33- and 2.9-fold in yak, respectively, and increased by 46- and 3.8-fold in cattle, respectively. PRLR mRNA expression was higher (P<0.05) in mammary tissue and ovary of pregnant cow than that of pregnant yak. It is proposed that the increased ovarian and mammary PRLR mRNA expression during pregnancy may be associated with corpus luteum function for maintenance of pregnancy and mammary development for subsequent lactation. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Molecular characterization of a nuclear topoisomerase II from Nicotiana tabacum that functionally complements a temperature-sensitive topoisomerase II yeast mutant.

    PubMed

    Singh, B N; Mudgil, Yashwanti; Sopory, S K; Reddy, M K

    2003-07-01

    We have successfully expressed enzymatically active plant topoisomerase II in Escherichia coli for the first time, which has enabled its biochemical characterization. Using a PCR-based strategy, we obtained a full-length cDNA and the corresponding genomic clone of tobacco topoisomerase II. The genomic clone has 18 exons interrupted by 17 introns. Most of the 5' and 3' splice junctions follow the typical canonical consensus dinucleotide sequence GU-AG present in other plant introns. The position of introns and phasing with respect to primary amino acid sequence in tobacco TopII and Arabidopsis TopII are highly conserved, suggesting that the two genes are evolved from the common ancestral type II topoisomerase gene. The cDNA encodes a polypeptide of 1482 amino acids. The primary amino acid sequence shows a striking sequence similarity, preserving all the structural domains that are conserved among eukaryotic type II topoisomerases in an identical spatial order. We have expressed the full-length polypeptide in E. coli and purified the recombinant protein to homogeneity. The full-length polypeptide relaxed supercoiled DNA and decatenated the catenated DNA in a Mg(2+)- and ATP-dependent manner, and this activity was inhibited by 4'-(9-acridinylamino)-3'-methoxymethanesulfonanilide (m-AMSA). The immunofluorescence and confocal microscopic studies, with antibodies developed against the N-terminal region of tobacco recombinant topoisomerase II, established the nuclear localization of topoisomerase II in tobacco BY2 cells. The regulated expression of tobacco topoisomerase II gene under the GAL1 promoter functionally complemented a temperature-sensitive TopII(ts) yeast mutant.

  19. Analysis and functional annotation of expressed sequence tags from the fall armyworm Spodoptera frugiperda

    PubMed Central

    Deng, Youping; Dong, Yinghua; Thodima, Venkata; Clem, Rollie J; Passarelli, A Lorena

    2006-01-01

    Background Little is known about the genome sequences of lepidopteran insects, although this group of insects has been studied extensively in the fields of endocrinology, development, immunity, and pathogen-host interactions. In addition, cell lines derived from Spodoptera frugiperda and other lepidopteran insects are routinely used for baculovirus foreign gene expression. This study reports the results of an expressed sequence tag (EST) sequencing project in cells from the lepidopteran insect S. frugiperda, the fall armyworm. Results We have constructed an EST database using two cDNA libraries from the S. frugiperda-derived cell line, SF-21. The database consists of 2,367 ESTs which were assembled into 244 contigs and 951 singlets for a total of 1,195 unique sequences. Conclusion S. frugiperda is an agriculturally important pest insect and genomic information will be instrumental for establishing initial transcriptional profiling and gene function studies, and for obtaining information about genes manipulated during infections by insect pathogens such as baculoviruses. PMID:17052344

  20. Characterization and distribution of a maize cDNA encoding a peptide similar to the catalytic region of second messenger dependent protein kinases

    NASA Technical Reports Server (NTRS)

    Biermann, B.; Johnson, E. M.; Feldman, L. J.

    1990-01-01

    Maize (Zea mays) roots respond to a variety of environmental stimuli which are perceived by a specialized group of cells, the root cap. We are studying the transduction of extracellular signals by roots, particularly the role of protein kinases. Protein phosphorylation by kinases is an important step in many eukaryotic signal transduction pathways. As a first phase of this research we have isolated a cDNA encoding a maize protein similar to fungal and animal protein kinases known to be involved in the transduction of extracellular signals. The deduced sequence of this cDNA encodes a polypeptide containing amino acids corresponding to 33 out of 34 invariant or nearly invariant sequence features characteristic of protein kinase catalytic domains. The maize cDNA gene product is more closely related to the branch of serine/threonine protein kinase catalytic domains composed of the cyclic-nucleotide- and calcium-phospholipid-dependent subfamilies than to other protein kinases. Sequence identity is 35% or more between the deduced maize polypeptide and all members of this branch. The high structural similarity strongly suggests that catalytic activity of the encoded maize protein kinase may be regulated by second messengers, like that of all members of this branch whose regulation has been characterized. Northern hybridization with the maize cDNA clone shows a single 2400 base transcript at roughly similar levels in maize coleoptiles, root meristems, and the zone of root elongation, but the transcript is less abundant in mature leaves. In situ hybridization confirms the presence of the transcript in all regions of primary maize root tissue.

  1. Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

    PubMed

    Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

    2008-06-15

    To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

  2. Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

    PubMed Central

    Takeshita, S; Kikuno, R; Tezuka, K; Amann, E

    1993-01-01

    A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580

  3. Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

    PubMed

    Reid-Bayliss, Kate S; Loeb, Lawrence A

    2017-08-29

    Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

  4. cDNA cloning, functional expression and antifungal activities of a dimeric plant defensin SPE10 from Pachyrrhizus erosus seeds.

    PubMed

    Song, Xiaomin; Wang, Jing; Wu, Fang; Li, Xu; Teng, Maikun; Gong, Weimin

    2005-01-01

    SPE10 is an antifungal protein isolated from the seeds of Pachyrrhizus erosus. cDNA encoding a 47 amino acid peptide was cloned by RT-PCR and the gene sequence proved SPE10 to be a new member of plant defensin family. The synthetic cDNA with codons preferred in yeast was cloned into the pPIC9 plasmid directly in-frame with the secretion signal alpha-mating factor, and highly expressed in methylotrophic Pichia pastoris. Activity assays showed the recombinant SPE10 inhibited specifically the growth of several pathogenic fungi as native SPE10. Circular dichroism and fluorescence spectroscopy analysis indicated that the native and recombinant protein should have same folding, though there are eight cystein residues in the sequence. Several evidence suggested SPE10 should be the first dimeric plant defensin reported so far.

  5. Capsicum annuum dehydrin, an osmotic-stress gene in hot pepper plants.

    PubMed

    Chung, Eunsook; Kim, Soo-Yong; Yi, So Young; Choi, Doil

    2003-06-30

    Osmotic stress-related genes were selected from an EST database constructed from 7 cDNA libraries from different tissues of the hot pepper. A full-length cDNA of Capsicum annuum dehydrin (Cadhn), a late embryogenesis abundant (lea) gene, was selected from the 5' single pass sequenced cDNA clones and sequenced. The deduced polypeptide has 87% identity with potato dehydrin C17, but very little identity with the dehydrin genes of other organisms. It contains a serine-tract (S-segment) and 3 conserved lysine-rich domains (K-segments). Southern blot analysis showed that 2 copies are present in the hot pepper genome. Cadhn was induced by osmotic stress in leaf tissues as well as by the application of abscisic acid. The RNA was most abundant in green fruit. The expression of several osmotic stress-related genes was examined and Cadhn proved to be the most abundantly expressed of these in response to osmotic stress.

  6. Casein expression in cytotoxic T lymphocytes.

    PubMed Central

    Grusby, M J; Mitchell, S C; Nabavi, N; Glimcher, L H

    1990-01-01

    A cDNA that expresses a mRNA restricted to cytotoxic T lymphocytes (CTL) and mammary tissue has been isolated and characterized. The deduced amino acid sequence from this cDNA shows extensive homology with the previously reported amino acid sequence for rat alpha-casein. Indeed, the presence of a six-residue-repeated motif that is specific for rodent alpha-caseins strongly supports the identification of this cDNA as mouse alpha-casein. Northern (RNA) blot analysis of many hematopoietic cell types revealed that this gene is restricted to CTL, being expressed in four of six CTL lines examined. Furthermore, CTL that express this gene were also found to express other members of the casein gene family, such as beta- and kappa-casein. These results suggest that caseins may be important in CTL function, and their potential role in CTL-mediated lysis is discussed. Images PMID:2395885

  7. HLA genotyping by next-generation sequencing of complementary DNA.

    PubMed

    Segawa, Hidenobu; Kukita, Yoji; Kato, Kikuya

    2017-11-28

    Genotyping of the human leucocyte antigen (HLA) is indispensable for various medical treatments. However, unambiguous genotyping is technically challenging due to high polymorphism of the corresponding genomic region. Next-generation sequencing is changing the landscape of genotyping. In addition to high throughput of data, its additional advantage is that DNA templates are derived from single molecules, which is a strong merit for the phasing problem. Although most currently developed technologies use genomic DNA, use of cDNA could enable genotyping with reduced costs in data production and analysis. We thus developed an HLA genotyping system based on next-generation sequencing of cDNA. Each HLA gene was divided into 3 or 4 target regions subjected to PCR amplification and subsequent sequencing with Ion Torrent PGM. The sequence data were then subjected to an automated analysis. The principle of the analysis was to construct candidate sequences generated from all possible combinations of variable bases and arrange them in decreasing order of the number of reads. Upon collecting candidate sequences from all target regions, 2 haplotypes were usually assigned. Cases not assigned 2 haplotypes were forwarded to 4 additional processes: selection of candidate sequences applying more stringent criteria, removal of artificial haplotypes, selection of candidate sequences with a relaxed threshold for sequence matching, and countermeasure for incomplete sequences in the HLA database. The genotyping system was evaluated using 30 samples; the overall accuracy was 97.0% at the field 3 level and 98.3% at the G group level. With one sample, genotyping of DPB1 was not completed due to short read size. We then developed a method for complete sequencing of individual molecules of the DPB1 gene, using the molecular barcode technology. The performance of the automatic genotyping system was comparable to that of systems developed in previous studies. Thus, next-generation sequencing of cDNA is a viable option for HLA genotyping.

  8. Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).

    PubMed Central

    Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K

    1990-01-01

    Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342

  9. Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

    PubMed Central

    Li, Hongshan; Dai, Huaguo; Wei, Hui

    2005-01-01

    A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

  10. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1987-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

  11. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1990-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

  12. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1988-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

  13. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.

    1989-01-01

    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

  14. Sequence analysis of 497 mouse brain ESTs expressed in the substantia nigra

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stewart, G.J.; Savioz, A.; Davies, R.W.

    1997-01-15

    The use of subtracted, region-specific cDNA libraries combined with single-pass cDNA sequencing allows the discovery of novel genes and facilitates molecular description of the tissue or region involved. We report the sequence of 497 mouse expressed sequence tags (ESTs) from two subtracted libraries enriched for cDNAs expressed in the substantia nigra, a brain region with important roles in movement control and Parkinson disease. Of these, 238 ESTs give no database matches and therefore derive from novel genes. A further 115 ESTs show sequence similarity to ESTs from other organisms, which themselves do not yield any significant database matches to genesmore » of known function. Fifty-six ESTs show sequence similarity to previously identified genes whose mouse homologues have not been reported. The total number of ESTs reported that are new for the mouse is 407, which, together with the 90 ESTs corresponding to known mouse genes or cDNAs, contributes to the molecular description of the substantia nigra. 21 refs., 4 tabs.« less

  15. Expression, purification, and evaluation for anticancer activity of ribosomal protein L31 gene (RPL31) from the giant panda (Ailuropoda melanoleuca).

    PubMed

    Su, Xiu-Lan; Hou, Yi-Ling; Yan, Xiang-Hui; Ding, Xiang; Hou, Wan-Ru; Sun, Bing; Zhang, Si-Nan

    2012-09-01

    Ribosomal protein L31 gene is a component of the 60S large ribosomal subunit encoded by RPL31 gene, while ribosomal protein L31 (RPL31) is an important constituent of peptidyltransferase center. In our research, the cDNA and the genomic sequence of RPL31 were cloned successfully from the giant panda (Ailuropoda melanoleuca) using RT-PCR technology respectively, following sequencing and analyzing preliminarily. We constructed a recombinant expression vector contained RPL31 cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product was purified to obtain recombinant protein of RPL31 from the giant panda. Recombinant protein of RPL31 obtained from the experiment acted on human laryngeal carcinoma Hep-2 and human hepatoma HepG-2 cells for study of its anti-cancer activity by MTT [3-(4, 5-dimehyl-2-thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide] method. Then observe these cells growth depressive effect. The result indicated that the cDNA fragment of the RPL31 cloned from the giant panda is 419 bp in size, containing an open reading frame of 378 bp, and deduced protein was composed of 125 amino acids with an estimated molecular weight of 14.46-kDa and PI of 11.21. The length of the genomic sequence is 8,091 bp, which was found to possess four exons and three introns. The RPL31 gene can be readily expressed in E.coli, expecting 18-kDa polypeptide that formed inclusion bodies. Recombinant protein RPL31 from the giant panda consists of 157 amino acids with an estimated molecular weight of 17.86 kDa and PI of 10.77. The outcomes showed that the cell growth inhibition rate in a time- and dose-dependent on recombinant protein RPL31. And also indicated that the effect at low concentrations was better than high concentrations on Hep-2 cells, and the concentration of 0.33 μg/mL had the best rate of growth inhibition, 44 %. Consequently, our study aimed at revealing the recombinant protein RPL31 anti-cancer function from the giant panda, providing scientific basis and resources for the research and development of cancer protein drugs anti-cancer mechanism research. Further studies of the mechanism and the signal transduction pathways are in progress.

  16. Analysis of expressed sequence tags from Prunus mume flower and fruit and development of simple sequence repeat markers

    PubMed Central

    2010-01-01

    Background Expressed Sequence Tag (EST) has been a cost-effective tool in molecular biology and represents an abundant valuable resource for genome annotation, gene expression, and comparative genomics in plants. Results In this study, we constructed a cDNA library of Prunus mume flower and fruit, sequenced 10,123 clones of the library, and obtained 8,656 expressed sequence tag (EST) sequences with high quality. The ESTs were assembled into 4,473 unigenes composed of 1,492 contigs and 2,981 singletons and that have been deposited in NCBI (accession IDs: GW868575 - GW873047), among which 1,294 unique ESTs were with known or putative functions. Furthermore, we found 1,233 putative simple sequence repeats (SSRs) in the P. mume unigene dataset. We randomly tested 42 pairs of PCR primers flanking potential SSRs, and 14 pairs were identified as true-to-type SSR loci and could amplify polymorphic bands from 20 individual plants of P. mume. We further used the 14 EST-SSR primer pairs to test the transferability on peach and plum. The result showed that nearly 89% of the primer pairs produced target PCR bands in the two species. A high level of marker polymorphism was observed in the plum species (65%) and low in the peach (46%), and the clustering analysis of the three species indicated that these SSR markers were useful in the evaluation of genetic relationships and diversity between and within the Prunus species. Conclusions We have constructed the first cDNA library of P. mume flower and fruit, and our data provide sets of molecular biology resources for P. mume and other Prunus species. These resources will be useful for further study such as genome annotation, new gene discovery, gene functional analysis, molecular breeding, evolution and comparative genomics between Prunus species. PMID:20626882

  17. Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

    NASA Astrophysics Data System (ADS)

    Zhao, Chunling; Ju, Jiyu

    2015-06-01

    The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

  18. Complement component 3: characterization and association with mastitis resistance in Egyptian water buffalo and cattle.

    PubMed

    El-Halawany, Nermin; Abd-El-Monsif, Shawky A; Al-Tohamy Ahmed, F M; Hegazy, Lamees; Abdel-Shafy, Hamdy; Abdel-Latif, Magdy A; Ghazi, Yasser A; Neuhoff, Christiane; Salilew-Wondim, Dessie; Schellander, Karl

    2017-03-01

    Mastitis is an infectious disease of the mammary gland that leads to reduced milk production and change in milk composition. Complement component C3 plays a major role as a central molecule of the complement cascade involving in killing of microorganisms, either directly or in cooperation with phagocytic cells. C3 cDNA were isolated, from Egyptian buffalo and cattle, sequenced and characterized. The C3 cDNA sequences of buffalo and cattle consist of 5025 and 5019 bp, respectively. Buffalo and cattle C3 cDNAs share 99% of sequence identity with each other. The 4986 bp open reading frame in buffalo encodes a putative protein of 1661 amino acids-as in cattle-and includes all the functional domains. Further, analysis of the C3 cDNA sequences detected six novel single-nucleotide polymorphisms (SNPs) in buffalo and three novel SNPs in cattle. The association analysis of the detected SNPs with milk somatic cell score as an indicator of mastitis revealed that the most significant association in buffalo was found in the C>A substitution (ss: 1752816097) in exon 27, whereas in cattle it was in the C>T substitution (ss: 1752816085) in exon 12. Our findings provide preliminary information about the contribution of C3 polymorphisms to mastitis resistance in buffalo and cattle.

  19. EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries

    PubMed Central

    Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

    2008-01-01

    Background Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. Results We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. Conclusion EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects. PMID:18402700

  20. EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries.

    PubMed

    Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

    2008-04-10

    Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects.

  1. Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

    PubMed

    Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

    2014-01-01

    High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

  2. Human placental lactogen mRNA and its structural genes during pregnancy: quantitation with a complementary DNA.

    PubMed Central

    McWilliams, D; Callahan, R C; Boime, I

    1977-01-01

    A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681

  3. fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

    PubMed

    Khun, H H; Deved, V; Wong, H; Lee, B C

    2000-12-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

  4. fbpABC Gene Cluster in Neisseria meningitidis Is Transcribed as an Operon

    PubMed Central

    Khun, Heng H.; Deved, Vinay; Wong, Howard; Lee, B. Craig

    2000-01-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR. PMID:11083849

  5. Comparison of the canine and human acid {beta}-galactosidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahern-Rindell, A.J.; Kretz, K.A.; O`Brien, J.S.

    Several canine cDNA libraries were screened with human {beta}-galactosidase cDNA as probe. Seven positive clones were isolated and sequenced yielding a partial (2060 bp) canine {beta}-galactosidase cDNA with 86% identity to the human {beta}-galactosidase cDNA. Preliminary analysis of a canine genomic library indicated conservation of exon number and size. Analysis by Northern blotting disclosed a single mRNA of 2.4 kb in fibroblasts and liver from normal dogs and dogs affected with GM1 gangliosidosis. Although incomplete, these results indicate canine GM1 gangliosidosis is a suitable animal model of the human disease and should further efforts to devise a gene therapy strategymore » for its treatment. 20 refs., 2 figs., 1 tab.« less

  6. [Multiplexing mapping of human cDNAs]. Final report, September 1, 1991--February 28, 1994

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    Using PCR with automated product analysis, 329 human brain cDNA sequences have been assigned to individual human chromosomes. Primers were designed from single-pass cDNA sequences expressed sequence tags (ESTs). Primers were used in PCR reactions with DNA from somatic cell hybrid mapping panels as templates, often with multiplexing. Many ESTs mapped match sequence database records. To evaluate of these matches, the position of the primers relative to the matching region (In), the BLAST scores and the Poisson probability values of the EST/sequence record match were determined. In cases where the gene product was stringently identified by the sequence match hadmore » already been mapped, the gene locus determined by EST was consistent with the previous position which strongly supports the validity of assigning unknown genes to human chromosomes based on the EST sequence matches. In the present cases mapping the ESTs to a chromosome can also be considered to have mapped the known gene product: rolipram-sensitive cAMP phosphodiesterase, chromosome 1; protein phosphatase 2A{beta}, chromosome 4; alpha-catenin, chromosome 5; the ELE1 oncogene, chromosome 10q11.2 or q2.1-q23; MXII protein, chromosome l0q24-qter; ribosomal protein L18a homologue, chromosome 14; ribosomal protein L3, chromosome 17; and moesin, Xp11-cen. There were also ESTs mapped that were closely related to non-human sequence records. These matches therefore can be considered to identify human counterparts of known gene products, or members of known gene families. Examples of these include membrane proteins, translation-associated proteins, structural proteins, and enzymes. These data then demonstrate that single pass sequence information is sufficient to design PCR primers useful for assigning cDNA sequences to human chromosomes. When the EST sequence matches previous sequence database records, the chromosome assignments of the EST can be used to make preliminary assignments of the human gene to a chromosome.« less

  7. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  8. Mechanistic insights into induction of vitellogenin gene expression by estrogens in Sydney rock oysters, Saccostrea glomerata.

    PubMed

    Tran, Thi Kim Anh; MacFarlane, Geoff R; Kong, Richard Yuen Chong; O'Connor, Wayne A; Yu, Richard Man Kit

    2016-05-01

    Marine molluscs, such as oysters, respond to estrogenic compounds with the induction of the egg yolk protein precursor, vitellogenin (Vtg), availing a biomarker for estrogenic pollution. Despite this application, the precise molecular mechanism through which estrogens exert their action to induce molluscan vitellogenesis is unknown. As a first step to address this question, we cloned a gene encoding Vtg from the Sydney rock oyster Saccostrea glomerata (sgVtg). Using primers designed from a partial sgVtg cDNA sequence available in Genbank, a full-length sgVtg cDNA of 8498bp was obtained by 5'- and 3'-RACE. The open reading frame (ORF) of sgVtg was determined to be 7980bp, which is substantially longer than the orthologs of other oyster species. Its deduced protein sequence shares the highest homology at the N- and C-terminal regions with other molluscan Vtgs. The full-length genomic DNA sequence of sgVtg was obtained by genomic PCR and genome walking targeting the gene body and flanking regions, respectively. The genomic sequence spans 20kb and consists of 30 exons and 29 introns. Computer analysis identified three closely spaced half-estrogen responsive elements (EREs) in the promoter region and a 210-bp CpG island 62bp downstream of the transcription start site. Upregulation of sgVtg mRNA expression was observed in the ovaries following in vitro (explants) and in vivo (tank) exposure to 17β-estradiol (E2). Notably, treatment with an estrogen receptor (ER) antagonist in vitro abolished the upregulation, suggesting a requirement for an estrogen-dependent receptor for transcriptional activation. DNA methylation of the 5' CpG island was analysed using bisulfite genomic sequencing of the in vivo exposed ovaries. The CpG island was found to be hypomethylated (with 0-3% methylcytosines) in both control and E2-exposed oysters. However, no significant differential methylation or any correlation between methylation and sgVtg expression levels was observed. Overall, the results support the possible involvement of an ERE-containing promoter and an estrogen-activated receptor in estrogen signalling in marine molluscs. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Expression of human argininosuccinate synthetase after retroviral-mediated gene transfer.

    PubMed

    Wood, P A; Partridge, C A; O'Brien, W E; Beaudet, A L

    1986-09-01

    The cDNA sequence for human argininosuccinate synthetase (AS) was introduced into plasmid expression vectors with an SV40 promoter or Rous sarcoma virus promoter to construct pSV2-AS and pRSV-AS, respectively, and human enzyme was synthesized after gene transfer into Chinese hamster cells. The functional cDNA was inserted into the retroviral vectors pZIP-NeoSV(X) and pZIP-NeoSV(B). Ecotropic AS retrovirus was produced after calcium-phosphate-mediated gene transfer of these constructions into the packaging cell line psi-2, and viral titers up to 10(5) CFU/ml were obtained. Recombinant AS retrovirus was evaluated by detecting G-418-resistant colonies after infection of the rodent cells, XC, NRK, and 3T3. Colonies were also obtained when infected XC cells were selected in citrulline medium for expression of AS activity. Southern blot analysis of infected cells demonstrated that the recombinant retroviral genome was not altered grossly after infecting some rodent cells, while other cells showed evidence of rearrangement. A rapid assay for detecting AS retrovirus was developed based on the incorporation of [14C]citrulline into protein by intact 3T3 cells or XC cells.

  10. Molecular cloning of human protein 4.2: a major component of the erythrocyte membrane.

    PubMed Central

    Sung, L A; Chien, S; Chang, L S; Lambert, K; Bliss, S A; Bouhassira, E E; Nagel, R L; Schwartz, R S; Rybicki, A C

    1990-01-01

    Protein 4.2 (P4.2) comprises approximately 5% of the protein mass of human erythrocyte (RBC) membranes. Anemia occurs in patients with RBCs deficient in P4.2, suggesting a role for this protein in maintaining RBC stability and integrity. We now report the molecular cloning and characterization of human RBC P4.2 cDNAs. By immunoscreening a human reticulocyte cDNA library and by using the polymerase chain reaction, two cDNA sequences of 2.4 and 2.5 kilobases (kb) were obtained. These cDNAs differ only by a 90-base-pair insert in the longer isoform located three codons downstream from the putative initiation site. The 2.4- and 2.5-kb cDNAs predict proteins of approximately 77 and approximately 80 kDa, respectively, and the authenticity was confirmed by sequence identity with 46 amino acids of three cyanogen bromide-cleaved peptides of P4.2. Northern blot analysis detected a major 2.4-kb RNA species in reticulocytes. Isolation of two P4.2 cDNAs implies existence of specific regulation of P4.2 expression in human RBCs. Human RBC P4.2 has significant homology with human factor XIII subunit a and guinea pig liver transglutaminase. Sequence alignment of P4.2 with these two transglutaminases, however, revealed that P4.2 lacks the critical cysteine residue required for the enzymatic crosslinking of substrates. Images PMID:1689063

  11. Clustered array of ochratoxin A biosynthetic genes in Aspergillus steynii and their expression patterns in permissive conditions.

    PubMed

    Gil-Serna, Jessica; Vázquez, Covadonga; González-Jaén, María Teresa; Patiño, Belén

    2015-12-02

    Aspergillus steynii is probably the most relevant species of section Circumdati producing ochratoxin A (OTA). This mycotoxin contaminates a wide number of commodities and it is highly toxic for humans and animals. Little is known on the biosynthetic genes and their regulation in Aspergillus species. In this work, we identified and analysed three contiguous genes in A. steynii using 5'-RACE and genome walking approaches which predicted a cytochrome P450 monooxygenase (p450ste), a non-ribosomal peptide synthetase (nrpsste) and a polyketide synthase (pksste). These three genes were contiguous within a 20742 bp long genomic DNA fragment. Their corresponding cDNA were sequenced and their expression was analysed in three A. steynii strains using real time RT-PCR specific assays in permissive conditions in in vitro cultures. OTA was also analysed in these cultures. Comparative analyses of predicted genomic, cDNA and amino acid sequences were performed with sequences of similar gene functions. All the results obtained in these analyses were consistent and point out the involvement of these three genes in OTA biosynthesis by A. steynii and showed a co-ordinated expression pattern. This is the first time that a clustered organization OTA biosynthetic genes has been reported in Aspergillus genus. The results also suggested that this situation might be common in Aspergillus OTA-producing species and distinct to the one described for Penicillium species. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feyereisen-Koener, J.M.

    Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.

  13. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    PubMed

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  14. Heterologous expression of an aspartic protease gene from biocontrol fungus Trichoderma asperellum in Pichia pastoris.

    PubMed

    Yang, Xiaoxue; Cong, Hua; Song, Jinzhu; Zhang, Junzheng

    2013-11-01

    Trichoderma asperellum parasitizes a large variety of phytopathogenic fungi. The mycoparasitic activity of T. asperellum depends on the secretion of complex mixtures of hydrolytic enzymes able to degrade the host cell wall and proteases which are a group of enzymes capable of degrading proteins from host. In this study, a full-length cDNA clone of aspartic protease gene, TaAsp, from T. asperellum was obtained and sequenced. The 1,185 bp long cDNA sequence was predicted to encode a 395 amino acid polypeptide with molecular mass of 42.3 kDa. The cDNA of TaAsp was inserted into the pPIC9K vector and transformed into yeast Pichia pastoris GS115 for heterologous expression. A clearly visible band with molecular mass about 42 kDa in the SDS-PAGE gel indicated that the transformant harboring the gene TaAsp had been successfully translated in P. pastoris and produced a recombinant protein. Enzyme characterization test showed that the optimum fermentation time for P. pastoris GS115 transformant was 72 h. Enzyme activity of the recombinant aspartic proteinase remained relatively stable at 25-60 °C and pH 3.0-9.0, which indicated its good prospect of application in biocontrol. The optimal pH value and temperature of the enzyme activity were pH 4.0 and 40 °C, and under this condition, with casein as the substrate, the recombinant protease activity was 18.5 U mL(-1). In order to evaluate antagonistic activity of the recombinant protease against pathogenic fungi, five pathogenic fungi, Fusarium oxysporum, Alternaria alternata, Cytospora chrysosperma, Sclerotinia sclerotiorum and Rhizoctonia solani, were applied to the test of in vitro inhibition of their mycelial growth by culture supernatant of P. pastoris GS115 transformant.

  15. Apple beta-galactosidase. Activity against cell wall polysaccharides and characterization of a related cDNA clone.

    PubMed Central

    Ross, G S; Wegrzyn, T; MacRae, E A; Redgwell, R J

    1994-01-01

    A beta-galactosidase was purified from cortical tissue of ripe apples (Malus domestica Borkh. cv Granny Smith) using a procedure involving affinity chromatography on lactosyl-Sepharose. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated that two polypeptides of 44 and 32 kD were present in the fraction that showed activity against the synthetic substrate p-nitrophenol-beta-D-galactopyranoside. The enzyme preparation was incubated with polysaccharide extracts from apple cell walls containing beta-(1-->4)-linked galactans, and products of digestion were analyzed by gas chromatography. Small amounts of monomeric galactose were released during incubation, showing that the enzyme was active against native substrates. Amino acid sequence information was obtained from the purified protein, and this showed high homology with the anticipated polypeptide coded by the ethylene-regulated SR12 gene in carnation (K.G. Raghothama, K.A. Lawton, P.B. Goldborough, W.R. Woodson [1991] Plant Mol Biol 17: 61-71) and a harvest-related pTIP31 cDNA from asparagus (G. King, personal communication). Using the asparagus cDNA clone as a probe, an apple homolog (pABG1) was isolated. This clone contains a 2637-bp insert, including an open reading frame that codes for a polypeptide of 731 amino acids. Cleavage of an N-terminal signal sequence would leave a predicted polypeptide of 78.5 kD. Genomic DNA analysis and the isolation of other homologous apple clones suggest that pABG1 represents one member of an apple beta-galactosidase gene family. Northern analysis during fruit development and ripening showed accumulation of pABG1-homologous RNA during fruit ripening. Enzyme activity as measured in crude extracts increased during fruit development to a level that was maintained during ripening. PMID:7991682

  16. Molecular cloning of hsf1 and hsbp1 cDNAs, and the expression of hsf1, hsbp1 and hsp70 under heat stress in the sea cucumber Apostichopus japonicus.

    PubMed

    Xu, Dongxue; Sun, Lina; Liu, Shilin; Zhang, Libin; Yang, Hongsheng

    2016-08-01

    The heat shock response (HSR) is known for the elevated synthesis of heat shock proteins (HSPs) under heat stress, which is mediated primarily by heat shock factor 1 (HSF1). Heat shock factor binding protein 1 (HSBP1) and feedback control of heat shock protein 70 (HSP70) are major regulators of the activity of HSF1. We obtained full-length cDNA of genes hsf1 and hsbp1 in the sea cucumber Apostichopus japonicus, which are the second available for echinoderm (after Strongylocentrotus purpuratus), and the first available for holothurian. The full-length cDNA of hsf1 was 2208bp, containing a 1326bp open reading frame encoding 441 amino acids. The full-length cDNA of hsbp1 was 2850bp, containing a 225bp open reading frame encoding 74 amino acids. The similarities of A. japonicus HSF1 with other species are low, and much higher similarity identities of A. japonicus HSBP1 were shared. Phylogenetic trees showed that A. japonicus HSF1 and HSBP1 were clustered with sequences from S. purpuratus, and fell into distinct clades with sequences from mollusca, arthropoda and vertebrata. Analysis by real-time PCR showed hsf1 and hsbp1 mRNA was expressed constitutively in all tissues examined. The expression of hsf1, hsbp1 and hsp70 in the intestine at 26°C was time-dependent. The results of this study might provide new insights into the regulation of heat shock response in this species. Copyright © 2016. Published by Elsevier Inc.

  17. Construction of cDNA library from intestine, mesentery and coelomocyte of Apostichopus japonicus Selenka infected with Vibrio sp. and a preliminary analysis of immunity-related genes

    NASA Astrophysics Data System (ADS)

    Liu, Hongzhan; Zheng, Fengrong; Sun, Xiuqin; Cai, Yimei

    2012-06-01

    The aquaculture of sea cucumber Apostichopus japonicus (Echinodermata, Holothuroidea) has grown rapidly during recent years and has become an important sector of the marine industry in Northern China. However, with the rapid growth of the industry and the use of non-standard culture techniques, epidemic diseases of A. japonicus now pose increasing problems to the industry. To screen the genes with stress response to bacterial infection in sea cucumber at a genome wide level, we constructed a cDNA library from A. japonicus Selenka (Aspidochirotida: Stichopodidae) after infecting them with Vibrio sp. for 48 h. Total RNA was extracted from the intestine, mesentery and coelomocyte of infected sea cucumber using Trizol and mRNA was isolated by Oligotex mRNA Kits. The ligated cDNAs were transformed into DH5α, and a library of 3.24×105 clones (3.24×105 cfu mL-1) was obtained with the sizes of inserted fragments ranging from 0.8 to 2.5 kb. Sequencing the cDNA clones resulted in a total of 1106 ESTs that passed the quality control. BlastX and BlastN searches have identified 168 (31.5%) ESTs sharing significant homology with known sequences in NCBI protein or nucleotide databases. Among a panel of 25 putative immunity-related genes, serum lectin isoform, complement component 3, complement component 3-like genes were further studied by real-time PCR and they all increased more than 5 fold in response to Vibrio sp. challenge. Our library provides a valuable molecular tool for future study of invertebrate immunity against bacterial infection and our gene expression data indicates the importance of the immune system in the evolution and development of sea cucumber.

  18. Massive Collection of Full-Length Complementary DNA Clones and Microarray Analyses:. Keys to Rice Transcriptome Analysis

    NASA Astrophysics Data System (ADS)

    Kikuchi, Shoshi

    2009-02-01

    Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.

  19. cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cool, D.E.; Tonks, N.K.; Charbonneau, H.

    1989-07-01

    A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less

  20. Subcellular distribution of serine acetyltransferase from Pisum sativum and characterization of an Arabidopsis thaliana putative cytosolic isoform.

    PubMed

    Ruffet, M L; Lebrun, M; Droux, M; Douce, R

    1995-01-15

    The intracellular compartmentation of serine acetyltransferase, a key enzyme in the L-cysteine biosynthesis pathway, has been investigated in pea (Pisum sativum) leaves, by isolation of organelles and fractionation of protoplasts. Enzyme activity was mainly located in mitochondria (approximately 76% of total cellular activity). Significant activity was also identified in both the cytosol (14% of total activity) and chloroplasts (10% of total activity). Three enzyme forms were separated by anion-exchange chromatography, and each form was found to be specific for a given intracellular compartment. To obtain cDNA encoding the isoforms, functional complementation experiments were performed using an Arabidopsis thaliana expression library and an Escherichia coli mutant devoid of serine acetyltransferase activity. This strategy allowed isolation of three distinct cDNAs encoding serine acetyltransferase isoforms, as confirmed by enzyme activity measurements, genomic hybridizations, and nucleotide sequencing. The cDNA and related gene for one of the three isoforms have been characterized. The predicted amino acid sequence shows that it encodes a polypeptide of M(r) 34,330 exhibiting 41% amino acid identity with the E. coli serine acetyltransferase. Since none of the general features of transit peptides could be observed in the N-terminal region of this isoform, we assume that it is a cytosolic form.

  1. Molecular Cloning and Optimization for High Level Expression of Cold-Adapted Serine Protease from Antarctic Yeast Glaciozyma antarctica PI12

    PubMed Central

    Ahmad Mazian, Mu'adz; Salleh, Abu Bakar; Basri, Mahiran; Rahman, Raja Noor Zaliha Raja Abd.

    2014-01-01

    Psychrophilic basidiomycete yeast, Glaciozyma antarctica strain PI12, was shown to be a protease-producer. Isolation of the PI12 protease gene from genomic and mRNA sequences allowed determination of 19 exons and 18 introns. Full-length cDNA of PI12 protease gene was amplified by rapid amplification of cDNA ends (RACE) strategy with an open reading frame (ORF) of 2892 bp, coded for 963 amino acids. PI12 protease showed low homology with the subtilisin-like protease from fungus Rhodosporidium toruloides (42% identity) and no homology to other psychrophilic proteases. The gene encoding mature PI12 protease was cloned into Pichia pastoris expression vector, pPIC9, and positioned under the induction of methanol-alcohol oxidase (AOX) promoter. The recombinant PI12 protease was efficiently secreted into the culture medium driven by the Saccharomyces cerevisiae α-factor signal sequence. The highest protease production (28.3 U/ml) was obtained from P. pastoris GS115 host (GpPro2) at 20°C after 72 hours of postinduction time with 0.5% (v/v) of methanol inducer. The expressed protein was detected by SDS-PAGE and activity staining with a molecular weight of 99 kDa. PMID:25093119

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Greene, T.W.; Chantler, S.E.; Kahn, M.L.

    ADPglucose pyrophosphorylase (glucose-1-phosphate adenylytransferase; AD P:{alpha}-D-glucose-1-phosphate adenylyltransferase, EC 2.7.7.27) catalyzes a key regulatory step in {alpha}-glucan synthesis in bacteria and higher plants. We have previously shown that the expression of the cDNA sequences of the potato tuber large (LS) and small (SS) subunits yielded a functional heterotetrameric enzyme capable of complementing a mutation in the single AGP (glgC) structural gene of Escherichia coli. This heterologous complementation provides a powerful genetic approach to obtain biochemical information on the specific roles of LS and SS in enzyme function. By mutagenizing the LS cDNA with hydroxylamine and then coexpressing with wild-type SS inmore » an E. coli glgC{sup {minus}} strain, >350 mutant colonies were identified that were impaired in glycogen production. One mutant exhibited enzymatic and antigen levels comparable to the wild-type recombinant enzyme but required 45-fold greater levels of the activator 3-phosphoglycerate for maximum activity. Sequence analysis identified a single nucleotide change that resulted in the change of Pro-52 to Leu. This heterologous genetic system provides and efficient means to identify residues important for catalysis and allosteric functioning and should lead to novel approaches to increase plant productivity. 31 refs., 4 figs., 1 tab.« less

  3. Quantitation of apolipoprotein epsilon gene expression by competitive polymerase chain reaction in a patient with familial apolipoprotein E deficiency.

    PubMed

    Dobmeyer, J M; Rexin, M; Dobmeyer, T S; Klein, S A; Rossol, R; Feussner, G

    1998-06-22

    A simple method of obtaining semiquantitative and reliable data on apolipoprotein (apo) sigma gene expression is described. We detected apo sigma specific sequences by reverse transcription (rT)-PCR. For quantitative measurement, an apo sigma DNA standard was produced allowing the development of a competitive PCR-method. The efficiency of RNA extraction and cDNA synthesis was controlled by quantitation of a housekeeping gene (glyceraldehyde-3-phosphatedehydrogenase, G3PDH) in separate reactions. To imitate a defined induction of apo sigma gene expression, serial twofold dilutions of total RNA were reversely transcribed and the respective cDNAs used to perform a competitive apo sigma and G3PDH PCR. The change in apo sigma cDNA and G3PDH cDNA was 1.7-2.3-fold with an expected value of 2.0-fold. Standard deviations in three independently performed experiments were within a range of < 15% of the mean, indicating low intra-assay variation and high reproducibility. To illustrate this method, apo sigma gene expression was measured in a patient with complete lack of functional active apo E in comparison to healthy controls. The method presented here might be valuable in assessment of apo sigma gene expression in human disease.

  4. Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

    PubMed Central

    Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

    1993-01-01

    A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

  5. Molecular characterization of a gene POLR2H encoded an essential subunit for RNA polymerase II from the Giant Panda (Ailuropoda Melanoleuca).

    PubMed

    Du, Yu-Jie; Hou, Yi-Ling; Hou, Wan-Ru

    2013-02-01

    The Giant Panda is an endangered and valuable gene pool in genetic, its important functional gene POLR2H encodes an essential shared peptide H of RNA polymerases. The genomic DNA and cDNA sequences were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) adopting touchdown-PCR and reverse transcription polymerase chain reaction (RT-PCR), respectively. The length of the genomic sequence of the Giant Panda is 3,285 bp, including five exons and four introns. The cDNA fragment cloned is 509 bp in length, containing an open reading frame of 453 bp encoding 150 amino acids. Alignment analysis indicated that both the cDNA and its deduced amino acid sequence were highly conserved. Protein structure prediction showed that there was one protein kinase C phosphorylation site, four casein kinase II phosphorylation sites and one amidation site in the POLR2H protein, further shaping advanced protein structure. The cDNA cloned was expressed in Escherichia coli, which indicated that POLR2H fusion with the N-terminally His-tagged form brought about the accumulation of an expected 20.5 kDa polypeptide in line with the predicted protein. On the basis of what has already been achieved in this study, further deep-in research will be conducted, which has great value in theory and practical significance.

  6. Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.

    PubMed

    Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P

    2001-08-17

    Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.

  7. Genes from the 20Q13 amplicon and their uses

    DOEpatents

    Gray, Joe; Collins, Colin; Hwang, Soo-in; Godfrey, Tony; Kowbel, David; Rommens, Johanna

    1999-01-01

    The present invention relates to cDNA sequences from a region of amplification on chromosome 20 associated with disease. The sequences can be used in hybridization methods for the identification of chromosomal abnormalities associated with various diseases. The sequences can also be used for treatment of diseases.

  8. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    PubMed

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  9. First complete genome sequence of an emerging cucumber green mottle mosaic virus isolate in North America

    USDA-ARS?s Scientific Manuscript database

    The complete genome sequence (6,423 nt) of an emerging Cucumber green mottle mosaic virus (CGMMV) isolate on cucumber in North America was determined through deep sequencing of sRNA and rapid amplification of cDNA ends. It shares 99% nucleotide sequence identity to the Asian genotype, but only 90% t...

  10. Partial DNA sequencing of Douglas-fir cDNAs used in RFLP mapping

    Treesearch

    K.D. Jermstad; D.L. Bassoni; C.S. Kinlaw; D.B. Neale

    1998-01-01

    DNA sequences from 87 Douglas-fir (Pseudotsuga menziesii [Mirb.] Franco) cDNA RFLP probes were determined. Sequences were submitted to the GenBank dbEST database and searched for similarity against nucleotide and protein databases using the BLASTn and BLASTx programs. Twenty-one sequences (24%) were assigned putative functions; 18 of which...

  11. WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

    PubMed

    Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

    2010-07-01

    High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

  12. WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data

    PubMed Central

    Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

    2010-01-01

    High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users. PMID:20501601

  13. Application of industrial scale genomics to discovery of therapeutic targets in heart failure.

    PubMed

    Mehraban, F; Tomlinson, J E

    2001-12-01

    In recent years intense activity in both academic and industrial sectors has provided a wealth of information on the human genome with an associated impressive increase in the number of novel gene sequences deposited in sequence data repositories and patent applications. This genomic industrial revolution has transformed the way in which drug target discovery is now approached. In this article we discuss how various differential gene expression (DGE) technologies are being utilized for cardiovascular disease (CVD) drug target discovery. Other approaches such as sequencing cDNA from cardiovascular derived tissues and cells coupled with bioinformatic sequence analysis are used with the aim of identifying novel gene sequences that may be exploited towards target discovery. Additional leverage from gene sequence information is obtained through identification of polymorphisms that may confer disease susceptibility and/or affect drug responsiveness. Pharmacogenomic studies are described wherein gene expression-based techniques are used to evaluate drug response and/or efficacy. Industrial-scale genomics supports and addresses not only novel target gene discovery but also the burgeoning issues in pharmaceutical and clinical cardiovascular medicine relative to polymorphic gene responses.

  14. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

    PubMed

    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

    2016-04-01

    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Sequence of a cDNA and expression of the gene encoding a putative epidermal chitin synthase of Manduca sexta.

    PubMed

    Zhu, Yu-Cheng; Specht, Charles A; Dittmer, Neal T; Muthukrishnan, Subbaratnam; Kanost, Michael R; Kramer, Karl J

    2002-11-01

    Glycosyltransferases are enzymes that synthesize oligosaccharides, polysaccharides and glycoconjugates. One type of glycosyltransferase is chitin synthase, a very important enzyme in biology, which is utilized by insects, fungi, and other invertebrates to produce chitin, a polysaccharide of beta-1,4-linked N-acetylglucosamine. Chitin is an important component of the insect's exoskeletal cuticle and gut lining. To identify and characterize a chitin synthase gene of the tobacco hornworm, Manduca sexta, degenerate primers were designed from two highly conserved regions in fungal and nematode chitin synthase protein sequences and then used to amplify a similar region from Manduca cDNA. A full-length cDNA of 5152 nucleotides was assembled for the putative Manduca chitin synthase gene, MsCHS1, and sequencing of genomic DNA verified the contiguity of the sequence. The MsCHS1 cDNA has an ORF of 4692 nucleotides that encodes a transmembrane protein of 1564 amino acid residues with a mass of approximately 179 kDa (GenBank no. AY062175). It is most similar, over its entire length of protein sequence, to putative chitin synthases from other insects and nematodes, with 68% identity to enzymes from both the blow fly, Lucilia cuprina, and the fruit fly, Drosophila melanogaster. The similarity with fungal chitin synthases is restricted to the putative catalytic domain, and the MsCHS1 protein has, at equivalent positions, several amino acids that are essential for activity as revealed by mutagenesis of the fungal enzymes. A 5.3-kb transcript of MsCHS1 was identified by northern blot hybridization of RNA from larval epidermis, suggesting that the enzyme functions to make chitin deposited in the cuticle. Further examination by RT-PCR showed that MsCHS1 expression is regulated in the epidermis, with the amount of transcript increasing during phases of cuticle deposition.

  16. Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, J.; Varner, J.E.

    1985-07-01

    Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

  17. A highly sensitive and accurate gene expression analysis by sequencing ("bead-seq") for a single cell.

    PubMed

    Matsunaga, Hiroko; Goto, Mari; Arikawa, Koji; Shirai, Masataka; Tsunoda, Hiroyuki; Huang, Huan; Kambara, Hideki

    2015-02-15

    Analyses of gene expressions in single cells are important for understanding detailed biological phenomena. Here, a highly sensitive and accurate method by sequencing (called "bead-seq") to obtain a whole gene expression profile for a single cell is proposed. A key feature of the method is to use a complementary DNA (cDNA) library on magnetic beads, which enables adding washing steps to remove residual reagents in a sample preparation process. By adding the washing steps, the next steps can be carried out under the optimal conditions without losing cDNAs. Error sources were carefully evaluated to conclude that the first several steps were the key steps. It is demonstrated that bead-seq is superior to the conventional methods for single-cell gene expression analyses in terms of reproducibility, quantitative accuracy, and biases caused during sample preparation and sequencing processes. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Molecular cloning, expression, purification and osteoblasts proliferation activity of sika deer thymosin beta10.

    PubMed

    Wang, J; Liu, M; Bai, X; Zhang, H; Xu, Z; Zhao, D; Zhao, Y

    2017-12-01

    Thymosin beta 10 (Tβ10) is a member of the β-thymosin family. As an actin-binding peptide, thymosin β10 is involved in many important biological activities. Transcriptome sequencing results suggest that Tβ10 may play important roles in the growth of deer antler. In this study, Tβ10 cDNA was isolated from sika deer, and complete open reading frame consisting of 129 nucleotides was obtained by PCR amplification. The predicted peptide was 42 amino acids in length. The sdTβ10 cDNA was cloned and expressed in Escherichia coli resulting in a 6 kDa recombinant-His tagged protein. The recombinant, non-glycosylated peptide was overexpressed in a soluble form and purified by immobilized metal ion affinity chromatography. Functional studies revealed that recombinant Tβ10 stimulated osteoblasts proliferation. This study provides the first evidence that recombinant sika deer Tβ10 promotes proliferation in an osteoblasts cell model. Copyright© by the Polish Academy of Sciences.

  19. Canine adiponectin: cDNA structure, mRNA expression in adipose tissues and reduced plasma levels in obesity.

    PubMed

    Ishioka, K; Omachi, A; Sagawa, M; Shibata, H; Honjoh, T; Kimura, K; Saito, M

    2006-04-01

    Adiponectin is a protein synthesized and secreted by adipocytes. Decreased adiponectin is responsible for insulin resistance and atherosclerosis associated with human obesity. We obtained a cDNA clone corresponding to canine adiponectin, whose nucleotide and deduced amino acid sequences were highly identical to those of other species. Adiponectin mRNA was detected in adipose tissues, but not in other tissues, of dogs. When 22 adult beagles were given a high-energy diet for 14 weeks, they became obese, showing heavier body weights, higher plasma leptin concentrations, but lower plasma adiponectin concentrations. The adiponectin concentrations of plasma samples collected from 71 dogs visiting veterinary practices were negatively correlated to plasma leptin concentrations, being lower in obese than non-obese dogs. These results are compatible with those reported in other species, and suggest that adiponectin is an index of adiposity and a target molecule for studies on diseases associated with obesity in dogs.

  20. Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species

    PubMed Central

    Bychenko, Oksana S.; Sukhanova, Lyubov V.; Azhikina, Tatyana L.; Skvortsov, Timofey A.; Belomestnykh, Tuyana V.; Sverdlov, Eugene D.

    2014-01-01

    The aim of this work was to get deeper insight into genetic factors involved in the adaptive divergence of closely related species, specifically two representatives of Baikal coregonids—Baikal whitefish (Coregonus baicalensis Dybowski) and Baikal omul (Coregonus migratorius Georgi)—that diverged from a common ancestor as recently as 10–20 thousand years ago. Using the Serial Analysis of Gene Expression method, we obtained libraries of short representative cDNA sequences (tags) from the brains of Baikal whitefish and omul. A comparative analysis of the libraries revealed quantitative differences among ~4% tags of the fishes under study. Based on the similarity of these tags with cDNA of known organisms, we identified candidate genes taking part in adaptive divergence. The most important candidate genes related to the adaptation of Baikal whitefish and Baikal omul, identified in this work, belong to the genes of cell metabolism, nervous and immune systems, protein synthesis, and regulatory genes as well as to DTSsa4 Tc1-like transposons which are widespread among fishes. PMID:24719892

  1. Cloning and Expression of cDNA for Rat Heme Oxygenase

    NASA Astrophysics Data System (ADS)

    Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi

    1985-12-01

    Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.

  2. RNA-Seq analysis to capture the transcriptome landscape of a single cell

    PubMed Central

    Tang, Fuchou; Barbacioru, Catalin; Nordman, Ellen; Xu, Nanlan; Bashkirov, Vladimir I; Lao, Kaiqin; Surani, M. Azim

    2013-01-01

    We describe here a protocol for digital transcriptome analysis in a single mouse blastomere using a deep sequencing approach. An individual blastomere was first isolated and put into lysate buffer by mouth pipette. Reverse transcription was then performed directly on the whole cell lysate. After this, the free primers were removed by Exonuclease I and a poly(A) tail was added to the 3′ end of the first-strand cDNA by Terminal Deoxynucleotidyl Transferase. Then the single cell cDNAs were amplified by 20 plus 9 cycles of PCR. Then 100-200 ng of these amplified cDNAs were used to construct a sequencing library. The sequencing library can be used for deep sequencing using the SOLiD system. Compared with the cDNA microarray technique, our assay can capture up to 75% more genes expressed in early embryos. The protocol can generate deep sequencing libraries within 6 days for 16 single cell samples. PMID:20203668

  3. Biochemical, molecular, and phylogenetic analysis of pyruvate carboxylase in the yellow fever mosquito, Aedes aegypti.

    PubMed

    Tu, Z; Hagedorn, H H

    1997-02-01

    Pyruvate carboxylase (PC, pyruvate: carbon dioxide ligase [ADP-forming], EC 6.4.1.1) was purified from the yellow fever mosquito, Aedes aegypti. The purified PC showed two polypeptides of similar M(r) (133 and 128 k). The N-terminal sequences of both polypeptides were shown to be very similar, if not identical. A polyclonal antiserum against the 133 kDa polypeptide cross-reacted strongly with the 128 kDa polypeptide. PC was found in all tissues examined. Using a semi-quantitative Western blot assay, PC was shown to be concentrated in the indirect flight muscles and fat body preparations. The ratios of the 133 to 128 kDa polypeptides were shown to differ in various tissues and an Aedes albopictus cell line. The indirect flight muscle was the only tissue in which the 128 kDa polypeptide was more abundant, while both the midgut and the cell line showed almost exclusively the 133 kDa polypeptide. Both peptides were present in varying amounts in brain, malpighian tubule, ovary and fat body preparation. The two isoforms of PC could play different roles in the flight muscle and other tissues. Clones covering a complete cDNA of PC of A. aegypti were obtained using a directional approach. The 3952 bp nucleotide sequence, including a 3585 bp coding region, was determined from these cDNA clones. The deduced 1195 amino acid sequence has a calculated M(r) of 132,200. A putative mitochondrial targeting sequence was determined by comparing the deduced amino acid sequence to the N-terminal sequences of the mature protein. The presence of a mitochondrial targeting sequence indicates that the mosquito PC encoded by the cloned cDNA may be localized in the mitochondria. After the targeting sequence, three functional domains were identified in the following order; biotin carboxylase (BC), carboxyltransferase (CT) and biotin carboxyl carrier protein (BCCP). The mosquito PC showed very high similarity to PCs from other sources (55.1-75.2% identity). Genomic Southern analysis indicated that there could be two similar PC genes or a single PC gene with allelic polymorphism in the A. aegypti genome. The evolutionary relationship of PCs among different organisms was consistent with the accepted evolutionary relationship of their host organisms. The evolution of the domain structures of the biotin-dependent carboxylases including PC was also investigated. This analysis indicates that biotin-dependent carboxylases evolved from a common origin. The analysis also provides evidence for early gene duplication events that shaped the family of biotin-dependent carboxylases. Clear evidence for the coevolution of BC and BCCP domains is presented, although they are associated with very different CT domains and the relative position of the three functional domains varies between members of the biotin-dependent carboxylases.

  4. Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response

    PubMed Central

    Sakurai, Tetsuya; Plata, Germán; Rodríguez-Zapata, Fausto; Seki, Motoaki; Salcedo, Andrés; Toyoda, Atsushi; Ishiwata, Atsushi; Tohme, Joe; Sakaki, Yoshiyuki; Shinozaki, Kazuo; Ishitani, Manabu

    2007-01-01

    Background Cassava, an allotetraploid known for its remarkable tolerance to abiotic stresses is an important source of energy for humans and animals and a raw material for many industrial processes. A full-length cDNA library of cassava plants under normal, heat, drought, aluminum and post harvest physiological deterioration conditions was built; 19968 clones were sequence-characterized using expressed sequence tags (ESTs). Results The ESTs were assembled into 6355 contigs and 9026 singletons that were further grouped into 10577 scaffolds; we found 4621 new cassava sequences and 1521 sequences with no significant similarity to plant protein databases. Transcripts of 7796 distinct genes were captured and we were able to assign a functional classification to 78% of them while finding more than half of the enzymes annotated in metabolic pathways in Arabidopsis. The annotation of sequences that were not paired to transcripts of other species included many stress-related functional categories showing that our library is enriched with stress-induced genes. Finally, we detected 230 putative gene duplications that include key enzymes in reactive oxygen species signaling pathways and could play a role in cassava stress response features. Conclusion The cassava full-length cDNA library here presented contains transcripts of genes involved in stress response as well as genes important for different areas of cassava research. This library will be an important resource for gene discovery, characterization and cloning; in the near future it will aid the annotation of the cassava genome. PMID:18096061

  5. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    PubMed

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  6. Minimap2: pairwise alignment for nucleotide sequences.

    PubMed

    Li, Heng

    2018-05-10

    Recent advances in sequencing technologies promise ultra-long reads of ∼100 kilo bases (kb) in average, full-length mRNA or cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in length. Existing alignment programs are unable or inefficient to process such data at scale, which presses for the development of new alignment algorithms. Minimap2 is a general-purpose alignment program to map DNA or long mRNA sequences against a large reference database. It works with accurate short reads of ≥ 100bp in length, ≥1kb genomic reads at error rate ∼15%, full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely related full chromosomes of hundreds of megabases in length. Minimap2 does split-read alignment, employs concave gap cost for long insertions and deletions (INDELs) and introduces new heuristics to reduce spurious alignments. It is 3-4 times as fast as mainstream short-read mappers at comparable accuracy, and is ≥30 times faster than long-read genomic or cDNA mappers at higher accuracy, surpassing most aligners specialized in one type of alignment. https://github.com/lh3/minimap2. hengli@broadinstitute.org.

  7. Isolation and characterisation of a pod dehiscence zone-specific polygalacturonase from Brassica napus.

    PubMed

    Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B

    1996-06-01

    Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.

  8. The delta-subunit of murine guanine nucleotide exchange factor eIF-2B. Characterization of cDNAs predicts isoforms differing at the amino-terminal end.

    PubMed

    Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N

    1994-12-02

    Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.

  9. Comparison of next generation sequencing technologies for transcriptome characterization

    PubMed Central

    2009-01-01

    Background We have developed a simulation approach to help determine the optimal mixture of sequencing methods for most complete and cost effective transcriptome sequencing. We compared simulation results for traditional capillary sequencing with "Next Generation" (NG) ultra high-throughput technologies. The simulation model was parameterized using mappings of 130,000 cDNA sequence reads to the Arabidopsis genome (NCBI Accession SRA008180.19). We also generated 454-GS20 sequences and de novo assemblies for the basal eudicot California poppy (Eschscholzia californica) and the magnoliid avocado (Persea americana) using a variety of methods for cDNA synthesis. Results The Arabidopsis reads tagged more than 15,000 genes, including new splice variants and extended UTR regions. Of the total 134,791 reads (13.8 MB), 119,518 (88.7%) mapped exactly to known exons, while 1,117 (0.8%) mapped to introns, 11,524 (8.6%) spanned annotated intron/exon boundaries, and 3,066 (2.3%) extended beyond the end of annotated UTRs. Sequence-based inference of relative gene expression levels correlated significantly with microarray data. As expected, NG sequencing of normalized libraries tagged more genes than non-normalized libraries, although non-normalized libraries yielded more full-length cDNA sequences. The Arabidopsis data were used to simulate additional rounds of NG and traditional EST sequencing, and various combinations of each. Our simulations suggest a combination of FLX and Solexa sequencing for optimal transcriptome coverage at modest cost. We have also developed ESTcalc http://fgp.huck.psu.edu/NG_Sims/ngsim.pl, an online webtool, which allows users to explore the results of this study by specifying individualized costs and sequencing characteristics. Conclusion NG sequencing technologies are a highly flexible set of platforms that can be scaled to suit different project goals. In terms of sequence coverage alone, the NG sequencing is a dramatic advance over capillary-based sequencing, but NG sequencing also presents significant challenges in assembly and sequence accuracy due to short read lengths, method-specific sequencing errors, and the absence of physical clones. These problems may be overcome by hybrid sequencing strategies using a mixture of sequencing methodologies, by new assemblers, and by sequencing more deeply. Sequencing and microarray outcomes from multiple experiments suggest that our simulator will be useful for guiding NG transcriptome sequencing projects in a wide range of organisms. PMID:19646272

  10. Design and screening of M13 phage display cDNA libraries.

    PubMed

    Georgieva, Yuliya; Konthur, Zoltán

    2011-02-17

    The last decade has seen a steady increase in screening of cDNA expression product libraries displayed on the surface of filamentous bacteriophage. At the same time, the range of applications extended from the identification of novel allergens over disease markers to protein-protein interaction studies. However, the generation and selection of cDNA phage display libraries is subjected to intrinsic biological limitations due to their complex nature and heterogeneity, as well as technical difficulties regarding protein presentation on the phage surface. Here, we review the latest developments in this field, discuss a number of strategies and improvements anticipated to overcome these challenges making cDNA and open reading frame (ORF) libraries more readily accessible for phage display. Furthermore, future trends combining phage display with next generation sequencing (NGS) will be presented.

  11. Inferring Higher Functional Information for RIKEN Mouse Full-Length cDNA Clones With FACTS

    PubMed Central

    Nagashima, Takeshi; Silva, Diego G.; Petrovsky, Nikolai; Socha, Luis A.; Suzuki, Harukazu; Saito, Rintaro; Kasukawa, Takeya; Kurochkin, Igor V.; Konagaya, Akihiko; Schönbach, Christian

    2003-01-01

    FACTS (Functional Association/Annotation of cDNA Clones from Text/Sequence Sources) is a semiautomated knowledge discovery and annotation system that integrates molecular function information derived from sequence analysis results (sequence inferred) with functional information extracted from text. Text-inferred information was extracted from keyword-based retrievals of MEDLINE abstracts and by matching of gene or protein names to OMIM, BIND, and DIP database entries. Using FACTS, we found that 47.5% of the 60,770 RIKEN mouse cDNA FANTOM2 clone annotations were informative for text searches. MEDLINE queries yielded molecular interaction-containing sentences for 23.1% of the clones. When disease MeSH and GO terms were matched with retrieved abstracts, 22.7% of clones were associated with potential diseases, and 32.5% with GO identifiers. A significant number (23.5%) of disease MeSH-associated clones were also found to have a hereditary disease association (OMIM Morbidmap). Inferred neoplastic and nervous system disease represented 49.6% and 36.0% of disease MeSH-associated clones, respectively. A comparison of sequence-based GO assignments with informative text-based GO assignments revealed that for 78.2% of clones, identical GO assignments were provided for that clone by either method, whereas for 21.8% of clones, the assignments differed. In contrast, for OMIM assignments, only 28.5% of clones had identical sequence-based and text-based OMIM assignments. Sequence, sentence, and term-based functional associations are included in the FACTS database (http://facts.gsc.riken.go.jp/), which permits results to be annotated and explored through web-accessible keyword and sequence search interfaces. The FACTS database will be a critical tool for investigating the functional complexity of the mouse transcriptome, cDNA-inferred interactome (molecular interactions), and pathome (pathologies). PMID:12819151

  12. NADH:ubiquinone oxidoreductase from bovine heart mitochondria. cDNA sequences of the import precursors of the nuclear-encoded 39 kDa and 42 kDa subunits.

    PubMed Central

    Fearnley, I M; Finel, M; Skehel, J M; Walker, J E

    1991-01-01

    The 39 kDa and 42 kDa subunits of NADH:ubiquinone oxidoreductase from bovine heart mitochondria are nuclear-coded components of the hydrophobic protein fraction of the enzyme. Their amino acid sequences have been deduced from the sequences of overlapping cDNA clones. These clones were amplified from total bovine heart cDNA by means of the polymerase chain reaction, with the use of complex mixtures of oligonucleotide primers based upon fragments of protein sequence determined at the N-terminals of the proteins and at internal sites. The protein sequences of the 39 kDa and 42 kDa subunits are 345 and 320 amino acid residues long respectively, and their calculated molecular masses are 39,115 Da and 36,693 Da. Both proteins are predominantly hydrophilic, but each contains one or two hydrophobic segments that could possibly be folded into transmembrane alpha-helices. The bovine 39 kDa protein sequence is related to that of a 40 kDa subunit from complex I from Neurospora crassa mitochondria; otherwise, it is not related significantly to any known sequence, including redox proteins and two polypeptides involved in import of proteins into mitochondria, known as the mitochondrial processing peptidase and the processing-enhancing protein. Therefore the functions of the 39 kDa and 42 kDa subunits of complex I are unknown. The mitochondrial gene product, ND4, a hydrophobic component of complex I with an apparent molecular mass of about 39 kDa, has been identified in preparations of the enzyme. This subunit stains faintly with Coomassie Blue dye, and in many gel systems it is not resolved from the nuclearcoded 36 kDa subunit. Images Fig. 1. PMID:1832859

  13. Antimicrobial peptide evolution in the Asiatic honey bee Apis cerana.

    PubMed

    Xu, Peng; Shi, Min; Chen, Xue-Xin

    2009-01-01

    The Asiatic honeybee, Apis cerana Fabricius, is an important honeybee species in Asian countries. It is still found in the wild, but is also one of the few bee species that can be domesticated. It has acquired some genetic advantages and significantly different biological characteristics compared with other Apis species. However, it has been less studied, and over the past two decades, has become a threatened species in China. We designed primers for the sequences of the four antimicrobial peptide cDNA gene families (abaecin, defensin, apidaecin, and hymenoptaecin) of the Western honeybee, Apis mellifera L. and identified all the antimicrobial peptide cDNA genes in the Asiatic honeybee for the first time. All the sequences were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). In all, 29 different defensin cDNA genes coding 7 different defensin peptides, 11 different abaecin cDNA genes coding 2 different abaecin peptides, 13 different apidaecin cDNA genes coding 4 apidaecin peptides and 34 different hymenoptaecin cDNA genes coding 13 different hymenoptaecin peptides were cloned and identified from the Asiatic honeybee adult workers. Detailed comparison of these four antimicrobial peptide gene families with those of the Western honeybee revealed that there are many similarities in the quantity and amino acid components of peptides in the abaecin, defensin and apidaecin families, while many more hymenoptaecin peptides are found in the Asiatic honeybee than those in the Western honeybee (13 versus 1). The results indicated that the Asiatic honeybee adult generated more variable antimicrobial peptides, especially hymenoptaecin peptides than the Western honeybee when stimulated by pathogens or injury. This suggests that, compared to the Western honeybee that has a longer history of domestication, selection on the Asiatic honeybee has favored the generation of more variable antimicrobial peptides as protection against pathogens.

  14. A catalog for the transcripts from the venomous structures of the caterpillar Lonomia obliqua: identification of the proteins potentially involved in the coagulation disorder and hemorrhagic syndrome

    PubMed Central

    Veiga, Ana B. G.; Ribeiro, José M. C.; Guimarães, Jorge A.; Francischetti, Ivo M.B.

    2010-01-01

    Accidents with the caterpillar Lonomia obliqua are often associated with a coagulation disorder and hemorrhagic syndrome in humans. In the present study, we have constructed cDNA libraries from two venomous structures of the caterpillar, namely the tegument and the bristle. High-throughput sequencing and bioinformatics analyses were performed in parallel. Over one thousand cDNAs were obtained and clustered to produce a database of 538 contigs and singletons (clusters) for the tegument library and 368 for the bristle library. We have thus identified dozens of full-length cDNAs coding for proteins with sequence homology to snake venom prothrombin activator, trypsin-like enzymes, blood coagulation factors and prophenoloxidase cascade activators. We also report cDNA coding for cysteine proteases, Group III phospholipase A2, C-type lectins, lipocalins, in addition to protease inhibitors including serpins, Kazal-type inhibitors, cystatins and trypsin inhibitor-like molecules. Antibacterial proteins and housekeeping genes are also described. A significant number of sequences were devoid of database matches, suggesting that their biologic function remains to be defined. We also report the N-terminus of the most abundant proteins present in the bristle, tegument, hemolymph, and "cryosecretion". Thus, we have created a catalog that contains the predicted molecular weight, isoelectric point, accession number, and putative function for each selected molecule from the venomous structures of L. obliqua. The role of these molecules in the coagulation disorder and hemorrhagic syndrome caused by envenomation with this caterpillar is discussed. All sequence information and the Supplemental Data, including Figures and Tables with hyperlinks to FASTA-formatted files for each contig and the best match to the Databases, are available at http://www.ncbi.nih.gov/projects/omes. PMID:16023793

  15. Cloning, sequencing, purification, and crystal structure of Grenache (Vitis vinifera) polyphenol oxidase.

    PubMed

    Virador, Victoria M; Reyes Grajeda, Juan P; Blanco-Labra, Alejandro; Mendiola-Olaya, Elizabeth; Smith, Gary M; Moreno, Abel; Whitaker, John R

    2010-01-27

    The full-length cDNA sequence (P93622_VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C222(1). The structure was obtained at 2.2 A resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1 ) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and alpha, beta, and gamma) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed.

  16. Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

    PubMed

    Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian

    2014-01-01

    Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

  17. Identification of differentially-expressed genes potentially implicated in drought response in pitaya (Hylocereus undatus) by suppression subtractive hybridization and cDNA microarray analysis.

    PubMed

    Fan, Qing-Jie; Yan, Feng-Xia; Qiao, Guang; Zhang, Bing-Xue; Wen, Xiao-Peng

    2014-01-01

    Drought is one of the most severe threats to the growth, development and yield of plant. In order to unravel the molecular basis underlying the high tolerance of pitaya (Hylocereus undatus) to drought stress, suppression subtractive hybridization (SSH) and cDNA microarray approaches were firstly combined to identify the potential important or novel genes involved in the plant responses to drought stress. The forward (drought over drought-free) and reverse (drought-free over drought) suppression subtractive cDNA libraries were constructed using in vitro shoots of cultivar 'Zihonglong' exposed to drought stress and drought-free (control). A total of 2112 clones, among which half were from either forward or reverse SSH library, were randomly picked up to construct a pitaya cDNA microarray. Microarray analysis was carried out to verify the expression fluctuations of this set of clones upon drought treatment compared with the controls. A total of 309 expressed sequence tags (ESTs), 153 from forward library and 156 from reverse library, were obtained, and 138 unique ESTs were identified after sequencing by clustering and blast analyses, which included genes that had been previously reported as responsive to water stress as well as some functionally unknown genes. Thirty six genes were mapped to 47 KEGG pathways, including carbohydrate metabolism, lipid metabolism, energy metabolism, nucleotide metabolism, and amino acid metabolism of pitaya. Expression analysis of the selected ESTs by reverse transcriptase polymerase chain reaction (RT-PCR) corroborated the results of differential screening. Moreover, time-course expression patterns of these selected ESTs further confirmed that they were closely responsive to drought treatment. Among the differentially expressed genes (DEGs), many are related to stress tolerances including drought tolerance. Thereby, the mechanism of drought tolerance of this pitaya genotype is a very complex physiological and biochemical process, in which multiple metabolism pathways and many genes were implicated. The data gained herein provide an insight into the mechanism underlying the drought stress tolerance of pitaya, as well as may facilitate the screening of candidate genes for drought tolerance. © 2013 Elsevier B.V. All rights reserved.

  18. Phylogenetic sequence analysis, recombinant expression, and tissue distribution of a channel catfish estrogen receptor beta

    USGS Publications Warehouse

    Xia, Zhenfang; Gale, William L.; Chang, Xiaotian; Langenau, David; Patino, Reynaldo; Maule, Alec G.; Densmore, Llewellyn D.

    2000-01-01

    An estrogen receptor β (ERβ) cDNA fragment was amplified by RT-PCR of total RNAextracted from liver and ovary of immature channel catfish. This cDNA fragment was used to screen an ovarian cDNA library made from an immature female fish. A clone was obtained that contained an open reading frame encoding a 575-amino-acid protein with a deduced molecular weight of 63.9 kDa. Maximum parsimony and Neighbor Joining analyses were used to generate a phylogenetic classification of channel catfish ERβ on the basis of 25 full-length teleost and tetrapod ER sequences. The consensus tree obtained indicated the existence of two major vertebrate ER subtypes, α and β. Within each subtype, and in accordance with established phylogenetic relationships, teleost and tetrapod ER were monophyletic confirming the results of a previous analysis (Z. Xiaet al., 1999, Gen. Comp. Endocrinol. 113, 360–368). Extracts of COS-7 cells transfectedwith channel catfish ERβ cDNA bound estrogen with high affinity (Kd = 0.21 nM) and specificity. The affinity of channel catfish ERβ for estrogen was higher than previously reported for channel catfish ERα. As determined by qualitative RT-PCR, the tissue distributions of ERα and ERβ were similar but not identical. Both ER subtypes were present in ovary and testis. ERα was found in all other tissues examined from juvenile and mature fish of both sexes. ERβ was also found in most tissues except, in most cases, whole blood and head kidney. Interestingly, the pattern of expression of ER subtypes in head kidney always corresponded to the pattern in whole blood. In conclusion, we isolated a channel catfish ERβ with ligand-binding affinity and tissue expression patterns different from ERα. Also, we confirmed the validity of our previously proposed general classification scheme for vertebrate ER into α and β subtypes and within each subtype, into teleost and tetrapod clades.

  19. Molecular Cloning, Bioinformatics Analysis and Expression of Insulin-Like Growth Factor 2 from Tianzhu White Yak, Bos grunniens

    PubMed Central

    Zhang, Quanwei; Gong, Jishang; Wang, Xueying; Wu, Xiaohu; Li, Yalan; Ma, Youji; Zhang, Yong; Zhao, Xingxu

    2014-01-01

    The IGF family is essential for normal embryonic and postnatal development and plays important roles in the immune system, myogenesis, bone metabolism and other physiological functions, which makes the study of its structure and biological characteristics important. Tianzhu white yak (Bos grunniens) domesticated under alpine hypoxia environments, is well adapted to survive and grow against severe hypoxia and cold temperatures for extended periods. In this study, a full coding sequence of the IGF2 gene of Tianzhu white yak was amplified by reverse transcription PCR and rapid-amplification of cDNA ends (RACE) for the first time. The cDNA sequence revealed an open reading frame of 450 nucleotides, encoding a protein with 179 amino acids. Its expression in different tissues was also studied by Real time PCR. Phylogenetic tree analysis indicated that yak IGF2 was similar to Bos taurus, and 3D structure showed high similarity with the human IGF2. The putative full CDS of yak IGF2 was amplified by PCR in five tissues, and cDNA sequence analysis showed high homology to bovine IGF2. Moreover the super secondary structure prediction showed a similar 3D structure with human IGF2. Its conservation in sequence and structure has facilitated research on IGF2 and its physiological function in yak. PMID:24394317

  20. Analyses of chicken immunoglobulin light chain cDNA clones indicate a few germline V lambda genes and allotypes of the C lambda locus.

    PubMed

    Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I

    1987-01-01

    cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.

  1. cDNA cloning and heterologous expression of a wheat proteinase inhibitor of subtilisin and chymotrypsin (WSCI) that interferes with digestive enzymes of insect pests.

    PubMed

    Di Gennaro, Simone; Ficca, Anna G; Panichi, Daniela; Poerio, Elia

    2005-04-01

    A cDNA encoding the proteinase inhibitor WSCI (wheat subtilisin/chymotrypsin inhibitor) was isolated by RT-PCR. Degenerate oligonucleotide primers were designed based on the amino acid sequence of WSCI and on the nucleotide sequence of the two homologous inhibitors (CI-2A and CI-2B) isolated from barley. For large-scale production, wsci cDNA was cloned into the E. coli vector pGEX-2T. The fusion protein GST-WSCI was efficiently produced in the bacterial expression system and, as the native inhibitor, was capable of inhibiting bacterial subtilisin, mammalian chymotrypsins and chymotrypsin-like activities present in crude extracts of a number of insect larvae ( Helicoverpa armigera , Plodia interpunctella and Tenebrio molitor ). The recombinant protein produced was also able to interfere with chymotrypsin-like activity isolated from immature wheat caryopses. These findings support a physiological role for this inhibitor during grain maturation.

  2. Purification, cDNA cloning, and characterization of LysM-containing plant chitinase from horsetail (Equisetum arvense).

    PubMed

    Inamine, Saki; Onaga, Shoko; Ohnuma, Takayuki; Fukamizo, Tamo; Taira, Toki

    2015-01-01

    Chitinase-A (EaChiA), molecular mass 36 kDa, was purified from the vegetative stems of a horsetail (Equisetum arvense) using a series of column chromatography. The N-terminal amino acid sequence of EaChiA was similar to the lysin motif (LysM). A cDNA encoding EaChiA was cloned by rapid amplification of cDNA ends and polymerase chain reaction. It consisted of 1320 nucleotides and encoded an open reading frame of 361 amino acid residues. The deduced amino acid sequence indicated that EaChiA is composed of a N-terminal LysM domain and a C-terminal plant class IIIb chitinase catalytic domain, belonging to the glycoside hydrolase family 18, linked by proline-rich regions. EaChiA has strong chitin-binding activity, however, no antifungal activity. This is the first report of a chitinase from Equisetopsida, a class of fern plants, and the second report of a LysM-containing chitinase from a plant.

  3. Eimeria tenella enolase and pyruvate kinase: a likely role in glycolysis and in others functions.

    PubMed

    Labbé, Marie; Péroval, Marylène; Bourdieu, Christiane; Girard-Misguich, Fabienne; Péry, Pierre

    2006-12-01

    Two cDNA codings for glycolytic enzymes were cloned from a cDNA library constructed from the schizont stage of the avian parasite Eimeria tenella. Enolase and pyruvate kinase cDNA were fully sequenced and compared with sequences of enzymes from other organisms. Although these enzymes were already detected in the sporozoite stage, their expression was enhanced during the first schizogony in accordance with the anaerobic conditions of this part of the life cycle of the parasite. Under activating conditions, microscopic observations suggest that these glycolytic enzymes were relocalised inside sporozoites and moreover were in part secreted. The enzymes were also localised at the apex of the first generation of merozoites. Enolase was partly observed inside the nucleus of sporozoites and schizonts. Taken together, these results suggest that glycolytic enzymes not only have a function in glycolysis during anaerobic intracellular stages but may also participate in the invasion process and, for enolase, in the control of gene regulation.

  4. Silk Materials Functionalized via Genetic Engineering for Biomedical Applications.

    PubMed

    Deptuch, Tomasz; Dams-Kozlowska, Hanna

    2017-12-12

    The great mechanical properties, biocompatibility and biodegradability of silk-based materials make them applicable to the biomedical field. Genetic engineering enables the construction of synthetic equivalents of natural silks. Knowledge about the relationship between the structure and function of silk proteins enables the design of bioengineered silks that can serve as the foundation of new biomaterials. Furthermore, in order to better address the needs of modern biomedicine, genetic engineering can be used to obtain silk-based materials with new functionalities. Sequences encoding new peptides or domains can be added to the sequences encoding the silk proteins. The expression of one cDNA fragment indicates that each silk molecule is related to a functional fragment. This review summarizes the proposed genetic functionalization of silk-based materials that can be potentially useful for biomedical applications.

  5. Characterization of a marsupial sperm protamine gene and its transcripts from the North American opossum (Didelphis marsupialis).

    PubMed

    Winkfein, R J; Nishikawa, S; Connor, W; Dixon, G H

    1993-07-01

    A synthetic oligonucleotide primer, designed from marsupial protamine protein-sequence data [Balhorn, R., Corzett, M., Matrimas, J. A., Cummins, J. & Faden, B. (1989) Analysis of protamines isolated from two marsupials, the ring-tailed wallaby and gray short-tailed opossum, J. Cell. Biol. 107] was used to amplify, via the polymerase chain reaction, protamine sequences from a North American opossum (Didelphis marsupialis) cDNA. Using the amplified sequences as probes, several protamine cDNA clones were isolated. The protein sequence, predicted from the cDNA sequences, consisted of 57 amino acids, contained a large number of arginine residues and exhibited the sequence ARYR at its amino terminus, which is conserved in avian and most eutherian mammal protamines. Like the true protamines of trout and chicken, the opossum protamine lacked cysteine residues, distinguishing it from placental mammalian protamine 1 (P1 or stable) protamines. Examination of the protamine gene, isolated by polymerase-chain-reaction amplification of genomic DNA, revealed the presence of an intron dividing the protamine-coding region, a common characteristic of all mammalian P1 genes. In addition, extensive sequence identity in the 5' and 3' flanking regions between mouse and opossum sequences classify the marsupial protamine as being closely related to placental mammal P1. Protamine transcripts, in both birds and mammals, are present in two size classes, differing by the length of their poly(A) tails (either short or long). Examination of opossum protamine transcripts by Northern hybridization revealed four distinct mRNA species in the total RNA fraction, two of which were enriched in the poly(A)-rich fraction. Northern-blot analysis, using an intron-specific probe, revealed the presence of intron sequences in two of the four protamine transcripts. If expressed, the corresponding protein from intron-containing transcripts would differ from spliced transcripts by length (49 versus 57 amino acids) and would contain a cysteine residue.

  6. Cloning of precursors for two MIH/VIH-related peptides in the prawn, Macrobrachium rosenbergii.

    PubMed

    Yang, W J; Rao, K R

    2001-11-30

    Two cDNA clones (634 and 1366 bp) encoding MIH/VIH (molt-inhibiting hormone/vitellogenesis-inhibiting hormone)-related peptides were isolated and sequenced from a Macrobrachium rosenbergii eyestalk ganglia cDNA library. The clones contain a 360 and 339 bp open-reading frame, and their conceptually translated peptides consist of a 41 and 34 amino acid signal peptide, respectively, and a 78 amino acid residue mature peptide hormone. The amino acid sequences of the peptides exhibit higher identities with other known MIHs and VIH (44-69%) than with CHHs (28-33%). This is the first report describing the cloning and sequencing of two MIH/VIH-related peptides in a single crustacean species. Transcription of these mRNAs was detected in the eyestalk ganglia, but not in the thoracic ganglia, hepatopancreas, gut, gill, heart, or muscle.

  7. Isolating Viral and Host RNA Sequences from Archival Material and Production of cDNA Libraries for High-Throughput DNA Sequencing

    PubMed Central

    Xiao, Yongli; Sheng, Zong-Mei; Taubenberger, Jeffery K.

    2015-01-01

    The vast majority of surgical biopsy and post-mortem tissue samples are formalin-fixed and paraffin-embedded (FFPE), but this process leads to RNA degradation that limits gene expression analysis. As an example, the viral RNA genome of the 1918 pandemic influenza A virus was previously determined in a 9-year effort by overlapping RT-PCR from post-mortem samples. Using the protocols described here, the full genome of the 1918 virus at high coverage was determined in one high-throughput sequencing run of a cDNA library derived from total RNA of a 1918 FFPE sample after duplex-specific nuclease treatments. This basic methodological approach should assist in the analysis of FFPE tissue samples isolated over the past century from a variety of infectious diseases. PMID:26344216

  8. Cloning and baculovirus expression of a desiccation stress gene from the beetle, Tenebrio molitor.

    PubMed

    Graham, L A; Bendena, W G; Walker, V K

    1996-02-01

    The cDNA sequence encoding a novel desiccation stress protein (dsp28) found in the hemolymph of the common yellow mealworm beetle, Tenebrio molitor, has been determined. The sequence encodes a 225 amino acid protein containing a 20 amino acid signal peptide. Dsp28 shows no significant similarity to any known nucleic acid or protein sequence. Levels of dsp28 mRNA were found to increase approx 5-fold following desiccation. Dsp28 cDNA has been cloned into a baculovirus expression vector and the expressed protein was compared to native dsp28. Both dsp28 expressed by recombinant baculovirus and native dsp28 are glycosylated and N-terminally processed. Although dsp28 is induced by cold in addition to desiccation stress, it does not contribute to the freezing point depression (thermal hysteresis) observed in Tenebrio hemolymph.

  9. The Lipopolysaccharide and β-1,3-Glucan Binding Protein Gene Is Upregulated in White Spot Virus-Infected Shrimp (Penaeus stylirostris)

    PubMed Central

    Roux, Michelle M.; Pain, Arnab; Klimpel, Kurt R.; Dhar, Arun K.

    2002-01-01

    Pattern recognition proteins such as lipopolysaccharide and β-1,3-glucan binding protein (LGBP) play an important role in the innate immune response of crustaceans and insects. Random sequencing of cDNA clones from a hepatopancreas cDNA library of white spot virus (WSV)-infected shrimp provided a partial cDNA (PsEST-289) that showed similarity to the LGBP gene of crayfish and insects. Subsequently full-length cDNA was cloned by the 5′-RACE (rapid amplification of cDNA ends) technique and sequenced. The shrimp LGBP gene is 1,352 bases in length and is capable of encoding a polypeptide of 376 amino acids that showed significant similarity to homologous genes from crayfish, insects, earthworms, and sea urchins. Analysis of the shrimp LGBP deduced amino acid sequence identified conserved features of this gene family including a potential recognition motif for β-(1→3) linkage of polysaccharides and putative RGD cell adhesion sites. It is known that LGBP gene expression is upregulated in bacterial and fungal infection and that the binding of lipopolysaccharide and β-1,3-glucan to LGBP activates the prophenoloxidase (proPO) cascade. The temporal expression of LGBP and proPO genes in healthy and WSV-challenged Penaeus stylirostris shrimp was measured by real-time quantitative reverse transcription-PCR, and we showed that LGBP gene expression in shrimp was upregulated as the WSV infection progressed. Interestingly, the proPO expression was upregulated initially after infection followed by a downregulation as the viral infection progressed. The downward trend in the expression of proPO coincided with the detection of WSV in the infected shrimp. Our data suggest that shrimp LGBP is an inducible acute-phase protein that may play a critical role in shrimp-WSV interaction and that the WSV infection regulates the activation and/or activity of the proPO cascade in a novel way. PMID:12072514

  10. Identification of an additional member of the protein-tyrosine-phosphatase family: evidence for alternative splicing in the tyrosine phosphatase domain.

    PubMed Central

    Matthews, R J; Cahir, E D; Thomas, M L

    1990-01-01

    Protein-tyrosine-phosphatases (protein-tyrosine-phosphate phosphohydrolase, EC 3.13.48) have been implicated in the regulation of cell growth; however, to date few tyrosine phosphatases have been characterized. To identify additional family members, the cDNA for the human tyrosine phosphatase leukocyte common antigen (LCA; CD45) was used to screen, under low stringency, a mouse pre-B-cell cDNA library. Two cDNA clones were isolated and sequence analysis predicts a protein sequence of 793 amino acids. We have named the molecule LRP (LCA-related phosphatase). RNA transfer analysis indicates that the cDNAs were derived from a 3.2-kilobase mRNA. The LRP mRNA is transcribed in a wide variety of tissues. The predicted protein structure can be divided into the following structural features: a short 19-amino acid leader sequence, an exterior domain of 123 amino acids that is predicted to be highly glycosylated, a 24-amino acid membrane-spanning region, and a 627-amino acid cytoplasmic region. The cytoplasmic region contains two approximately 260-amino acid domains, each with homology to the tyrosine phosphatase family. One of the cDNA clones differed in that it had a 108-base-pair insertion that, while preserving the reading frame, would disrupt the first protein-tyrosine-phosphatase domain. Analysis of genomic DNA indicates that the insertion is due to an alternatively spliced exon. LRP appears to be evolutionarily conserved as a putative homologue has been identified in the invertebrate Styela plicata. Images PMID:2162042

  11. ACVP-05: Virus Genetic Analysis from Cell-Free Plasma, Virally Infected Cells or Tissues and Cultured Supernatant Via Single Genome Amplification and Direct Sequencing | Frederick National Laboratory for Cancer Research

    Cancer.gov

    The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested

  12. Occurrence of mitochondrial CO1 pseudogenes in Neocalanus plumchrus (Crustacea: Copepoda): Hybridization indicated by recombined nuclear mitochondrial pseudogenes

    PubMed Central

    Lin, Ya-Ying

    2017-01-01

    A portion of the mitochondrial cytochrome c oxidase I gene was sequenced using both genomic DNA and complement DNA from three planktonic copepod Neocalanus species (N. cristatus, N. plumchrus, and N. flemingeri). Small but critical sequence differences in CO1 were observed between gDNA and cDNA from N. plumchrus. Furthermore, careful observation revealed the presence of recombination between sequences in gDNA from N. plumchrus. Moreover, a chimera of the N. cristatus and N. plumchrus sequences was obtained from N. plumchrus gDNA. The observed phenomena can be best explained by the preferential amplification of the nuclear mitochondrial pseudogenes from gDNA of N. plumchrus. Two conclusions can be drawn from the observations. First, nuclear mitochondrial pseudogenes are pervasive in N. plumchrus. Second, a mating between a female N. cristatus and a male N. plumchrus produced viable offspring, which further backcrossed to a N. plumchrus individual. These observations not only demonstrate intriguing mating behavior in these species, but also emphasize the importance of careful interpretation of species marker sequences amplified from gDNA. PMID:28231343

  13. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed Central

    Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

    1994-01-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

  14. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed

    Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

    1994-05-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

  15. Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases

    PubMed Central

    Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten

    2013-01-01

    Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002

  16. The mining of pearl formation genes in pearl oyster Pinctada fucata by cDNA suppression subtractive hybridization.

    PubMed

    Wang, Ning; Kinoshita, Shigeharu; Nomura, Naoko; Riho, Chihiro; Maeyama, Kaoru; Nagai, Kiyohito; Watabe, Shugo

    2012-04-01

    Recent researches revealed the regional preference of biomineralization gene transcription in the pearl oyster Pinctada fucata: it transcribed mainly the genes responsible for nacre secretion in mantle pallial, whereas the ones regulating calcite shells expressed in mantle edge. This study took use of this character and constructed the forward and reverse suppression subtractive hybridization (SSH) cDNA libraries. A total of 669 cDNA clones were sequenced and 360 expressed sequence tags (ESTs) greater than 100 bp were generated. Functional annotation associated 95 ESTs with specific functions, and 79 among them were identified from P. fucata at the first time. In the forward SSH cDNA library, it recognized mass amount of nacre protein genes, biomineralization genes dominantly expressed in the mantle pallial, calcium-ion-binding genes, and other biomineralization-related genes important for pearl formation. Real-time PCR showed that all the examined genes were distributed in oyster mantle tissues with a consistence to the SSH design. The detection of their RNA transcripts in pearl sac confirmed that the identified genes were certainly involved in pearl formation. Therefore, the data from this work will initiate a new round of pearl formation gene study and shed new insights into molluscan biomineralization.

  17. Characterization and simulation of cDNA microarray spots using a novel mathematical model

    PubMed Central

    Kim, Hye Young; Lee, Seo Eun; Kim, Min Jung; Han, Jin Il; Kim, Bo Kyung; Lee, Yong Sung; Lee, Young Seek; Kim, Jin Hyuk

    2007-01-01

    Background The quality of cDNA microarray data is crucial for expanding its application to other research areas, such as the study of gene regulatory networks. Despite the fact that a number of algorithms have been suggested to increase the accuracy of microarray gene expression data, it is necessary to obtain reliable microarray images by improving wet-lab experiments. As the first step of a cDNA microarray experiment, spotting cDNA probes is critical to determining the quality of spot images. Results We developed a governing equation of cDNA deposition during evaporation of a drop in the microarray spotting process. The governing equation included four parameters: the surface site density on the support, the extrapolated equilibrium constant for the binding of cDNA molecules with surface sites on glass slides, the macromolecular interaction factor, and the volume constant of a drop of cDNA solution. We simulated cDNA deposition from the single model equation by varying the value of the parameters. The morphology of the resulting cDNA deposit can be classified into three types: a doughnut shape, a peak shape, and a volcano shape. The spot morphology can be changed into a flat shape by varying the experimental conditions while considering the parameters of the governing equation of cDNA deposition. The four parameters were estimated by fitting the governing equation to the real microarray images. With the results of the simulation and the parameter estimation, the phenomenon of the formation of cDNA deposits in each type was investigated. Conclusion This study explains how various spot shapes can exist and suggests which parameters are to be adjusted for obtaining a good spot. This system is able to explore the cDNA microarray spotting process in a predictable, manageable and descriptive manner. We hope it can provide a way to predict the incidents that can occur during a real cDNA microarray experiment, and produce useful data for several research applications involving cDNA microarrays. PMID:18096047

  18. Bioinformatics and expressional analysis of cDNA clones from floral buds

    NASA Astrophysics Data System (ADS)

    Pawełkowicz, Magdalena Ewa; Skarzyńska, Agnieszka; Cebula, Justyna; Hincha, Dirck; ZiÄ bska, Karolina; PlÄ der, Wojciech; Przybecki, Zbigniew

    2017-08-01

    The application of genomic approaches may serve as an initial step in understanding the complexity of biochemical network and cellular processes responsible for regulation and execution of many developmental tasks. The molecular mechanism of sex expression in cucumber is still not elucidated. A study of differential expression was conducted to identify genes involved in sex determination and floral organ morphogenesis. Herein, we present generation of expression sequence tags (EST) obtained by differential hybridization (DH) and subtraction technique (cDNA-DSC) and their characteristic features such as molecular function, involvement in biology processes, expression and mapping position on the genome.

  19. Identification of differentially expressed genes associated with the enhancement of X-ray susceptibility by RITA in a hypopharyngeal squamous cell carcinoma cell line (FaDu).

    PubMed

    Luan, Jinwei; Li, Xianglan; Guo, Rutao; Liu, Shanshan; Luo, Hongyu; You, Qingshan

    2016-06-01

    Next generation sequencing and bio-informatic analyses were conducted to investigate the mechanism of reactivation of p53 and induction of tumor cell apoptosis (RITA)-enhancing X-ray susceptibility in FaDu cells. The cDNA was isolated from FaDu cells treated with 0 X-ray, 8 Gy X-ray, or 8 Gy X-ray + RITA. Then, cDNA libraries were created and sequenced using next generation sequencing, and each assay was repeated twice. Subsequently, differentially expressed genes (DEGs) were identified using Cuffdiff in Cufflinks and their functions were predicted by pathway enrichment analyses. Genes that were constantly up- or down-regulated in 8 Gy X-ray-treated FaDu cells and 8 Gy X-ray + RITA-treated FaDu cells were obtained as RITA genes. Afterward, the protein-protein interaction (PPI) relationships were obtained from the STRING database and a PPI network was constructed using Cytoscape. Furthermore, ClueGO was used for pathway enrichment analysis of genes in the PPI network. Total 2,040 and 297 DEGs were identified in FaDu cells treated with 8 Gy X-ray or 8 Gy X-ray + RITA, respectively. PARP3 and NEIL1 were enriched in base excision repair, and CDK1 was enriched in p53 signaling pathway. RFC2 and EZH2 were identified as RITA genes. In the PPI network, many interaction relationships were identified (e.g., RFC2-CDK1, EZH2-CDK1 and PARP3-EZH2). ClueGO analysis showed that RFC2 and EZH2 were related to cell cycle. RFC2, EZH2, CDK1, PARP3 and NEIL1 may be associated, and together enhance the susceptibility of FaDu cells treated with RITA to the deleterious effects of X-ray.

  20. [Cloning, Expression and Immunodiagnostic Evaluation of the Fasciola gigantica Thioredoxin Peroxidase].

    PubMed

    Wang, Yue-qi; Zhou, Yan; Cheng, Na; Chen, Mu-xin; Ai, Lin; Liu, Yu-hua; Zhang, Jian-guo; Luo, Jia-jun; Xu, Xue-nian

    2015-04-01

    To immunoscreen the gene encoding thioredoxin peroxidase (TPx) from a cDNA library made from adult Fasciola gigantica worms, clone and express the gene, and evaluate the immunodiagnostic value of TPx recombinant protein. The A ZAP cDNA library was immunoscreened with pooled serum of fascioliasis gigantica patients. The obtained positive clones were sequenced and analyzed by multiple sequence alignment. The full-length (rFgTPx) and N-termianal truncated (rFgTPx_nt) sequence of FgTPx was subcloned into prokaryotic plasmid pET28a(+) with a non-fusion expression technique, respectively. The recombinant proteins of rFgTPx and rFgTPx_nt were purified by His-bind affinity column (Ni-NTA). rFgTPx and rFgTPx_nt were used in indirect ELISA to test the antibody response of the serum samples. Sera of 27 fascioliasis gigantica patients, 15 patients with schistosomaisis japonica, 15 clonorchiasis sinensis patients, and 32 healthy donors were tested by using the recombinant protein based ELISA. The TPx recombinant proteins were obtained through expression, purification and renaturation, the relative molecular mass of rFgTPx and rFgTPx_nt were Mr 30,000 and Mr 26,000, respectively. The total diagnostic coincidence rate, sensitivity and specificity of rFgTPx_nt-based ELISA was 87.6% (78/89), 66.7% (18/27), and 96.8% (60/62), respectively. The cross reaction with Schistosoma japonicum and Clonorchis sinensis was 0 and 1/15 for rFgTPx_nt, respectively. Before and after treatment, A450 value of the serum samples from fascioliasis patients was 0.233 ± 0.088 and 0.129 ± 0.072, respectively (t = 4.27, P < 0.01). The gene encoding TPx is expressed in the prokaryotic expression system. The recombinant protein shows proper sensitivity and high specificity for the serodiagnosis of Fasciola gigantica infection.

  1. Molecular cloning and immunoglobulin E reactivity of a natural rubber latex lecithinase homologue, the major allergenic component of Hev b 4.

    PubMed

    Sunderasan, E; Bahari, A; Arif, S A M; Zainal, Z; Hamilton, R G; Yeang, H Y

    2005-11-01

    Hev b 4 is an allergenic natural rubber latex (NRL) protein complex that is reactive in skin prick tests and in vitro immunoassays. On SDS-polyacrylamide gel electrophoresis (SDS-PAGE), Hev b 4 is discerned predominantly at 53-55 kDa together with a 57 kDa minor component previously identified as a cyanogenic glucosidase. Of the 13 NRL allergens recognized by the International Union of Immunological Societies, the 53-55 kDa Hev b 4 major protein is the only candidate that lacks complete cDNA and protein sequence information. We sought to clone the transcript encoding the Hev b 4 major protein, and characterize the native protein and its recombinant form in relation to IgE binding. The 5'/3' rapid amplification of cDNA ends method was employed to obtain the complete cDNA of the Hev b 4 major protein. A recombinant form of the protein was over-expressed in Escherichia coli. The native Hev b 4 major protein was deglycosylated by trifluoromethane sulphonic acid. Western immunoblots of the native, deglycosylated and recombinant proteins were performed using both polyclonal antibodies and sera from latex-allergic patients. The cDNA encoding the Hev b 4 major protein was cloned. Its open reading frame matched lecithinases in the conserved domain database and contained 10 predicted glycosylation sites. Detection of glycans on the Hev b 4 lecithinase homologue confirmed it to be a glycoprotein. The deglycosylated lecithinase homologue was discerned at 40 kDa on SDS-PAGE, this being comparable to the 38.53 kDa mass predicted by its cDNA. Deglycosylation of the lecithinase homologue resulted in the loss of IgE recognition, although reactivity to polyclonal rabbit anti-Hev b 4 was retained. IgE from latex-allergic patients also failed to recognize the non-glycosylated E. coli recombinant lecithinase homologue. The IgE epitopes of the Hev b 4 lecithinase homologue reside mainly in its carbohydrate moiety, which also account for the discrepancy between the observed molecular weight of the protein and the value calculated from its cDNA.

  2. PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

    PubMed

    Wimmer, Katharina; Wernstedt, Annekatrin

    2014-01-01

    The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

  3. Characterization and mapping of the human rhodopsin kinase gene and screening of the gene for mutations in patients with retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khani, S.C.; Lin, D.; Magovcevic, I.

    1994-09-01

    Rhodopsin kinase (RK) is a cytosolic enzyme in rod photoreceptors that initiates the deactivation of the phototransductions cascade by phosphorylating photoactivated rhodopsin. Although the cDNA sequence of bovine RK has been determined previously, no human cDNA or genomic sequence has thus far been available for genetic studies. In order to investigate the possible role of this candidate gene in retinitis pigmentosa (RP) and allied diseases, we have isolated and characterized human cDNA and genomic clones derived from the RK locus. The coding sequence of the human gene is 1692 nucleotides in length and is split into seven exons. The humanmore » and the bovine sequence show 84% identity at the nucleotide level and 92% identity at the amino acid level. Thus far, the intronic sequences flanking each exon except for one have been determined. We have also mapped the human RK gene to chromosome 13q34 using fluorescence in situ hybridization. To our knowledge, no RP gene has as yet been linked to this region. However, since the substrate for RK (rhodopsin) and other members of the phototransduction cascade have been implicated in the pathogenesis of RP, it is conceivable that defects in RK can also cause some forms of this disease. We are evaluating this possibility by screening DNA from 173 patients with autosomal recessive RP and 190 patients with autosomal dominant RP. So far, we have found 11 patients with variant bands. In one patient with autosomal dominant RP we discovered the missense change Ser536Leu. Cosegregation studies and further sequencing of the variant bands are currently underway.« less

  4. Complex alternative splicing of acetylcholinesterase transcripts in Torpedo electric organ; primary structure of the precursor of the glycolipid-anchored dimeric form.

    PubMed Central

    Sikorav, J L; Duval, N; Anselmet, A; Bon, S; Krejci, E; Legay, C; Osterlund, M; Reimund, B; Massoulié, J

    1988-01-01

    In this paper, we show the existence of alternative splicing in the 3' region of the coding sequence of Torpedo acetylcholinesterase (AChE). We describe two cDNA structures which both diverge from the previously described coding sequence of the catalytic subunit of asymmetric (A) forms (Schumacher et al., 1986; Sikorav et al., 1987). They both contain a coding sequence followed by a non-coding sequence and a poly(A) stretch. Both of these structures were shown to exist in poly(A)+ RNAs, by S1 mapping experiments. The divergent region encoded by the first sequence corresponds to the precursor of the globular dimeric form (G2a), since it contains the expected C-terminal amino acids, Ala-Cys. These amino acids are followed by a 29 amino acid extension which contains a hydrophobic segment and must be replaced by a glycolipid in the mature protein. Analyses of intact G2a AChE showed that the common domain of the protein contains intersubunit disulphide bonds. The divergent region of the second type of cDNA consists of an adjacent genomic sequence, which is removed as an intron in A and Ga mRNAs, but may encode a distinct, less abundant catalytic subunit. The structures of the cDNA clones indicate that they are derived from minor mRNAs, shorter than the three major transcripts which have been described previously (14.5, 10.5 and 5.5 kb). Oligonucleotide probes specific for the asymmetric and globular terminal regions hybridize with the three major transcripts, indicating that their size is determined by 3'-untranslated regions which are not related to the differential splicing leading to A and Ga forms. Images PMID:3181125

  5. The organisation and interviral homologies of genes at the 3' end of tobacco rattle virus RNA1

    PubMed Central

    Boccara, Martine; Hamilton, William D. O.; Baulcombe, David C.

    1986-01-01

    The RNA1 of tobacco rattle virus (TRV) has been cloned as cDNA and the nucleotide sequence determined of 2 kb from the 3'-terminal region. The sequence contains three long open reading frames. One of these starts 5' of the cDNA and probably corresponds to the carboxy-terminal sequence of a 170-K protein encoded on RNA1. The deduced protein sequence from this reading frame shows homology with the putative replicases of tobacco mosaic virus (TMV) and tricornaviruses. The location of the second open reading frame, which encodes a 29-K polypeptide, was shown by Northern blot analysis to coincide with a 1.6-kb subgenomic RNA. The validity of this reading frame was confirmed by showing that the cDNA extending over this region could be transcribed and translated in vitro to produce a polypeptide of the predicted size which co-migrates in electrophoresis with a translation product of authentic viral RNA. The sequence of this 29-K polypeptide showed homology with two regions in the 30-K protein of TMV. This homology includes positions in the TMV 30-K protein where mutations have been identified which affect the transport of virus between cells. The third open reading frame encodes a potential 16-K protein and was shown by Northern blot hybridisation to be contained within the region of a 0.7-kb subgenomic RNA which is found in cellular RNA of infected cells but not virus particles. The many similarities between TRV and TMV in viral morphology, gene organisation and sequence suggest that these two viral groups may share a common viral ancestor. ImagesFig. 2.Fig. 3. PMID:16453668

  6. Next generation sequencing technology: a powerful tool for the genome characterization of sugarcane mosaic virus from Sorghum almum

    USDA-ARS?s Scientific Manuscript database

    Next generation sequencing (NGS) technology was used to analyze the occurrence of viruses in Sorghum almum plants in Florida exhibiting mosaic symptoms. Total RNA was extracted from symptomatic leaves and used as a template for cDNA library preparation. The resulting library was sequenced on an Illu...

  7. Characterization of the gene encoding component C3 of the complement system from the spider Loxosceles laeta venom glands: Phylogenetic implications.

    PubMed

    Myamoto, D T; Pidde-Queiroz, G; Pedroso, A; Gonçalves-de-Andrade, R M; van den Berg, C W; Tambourgi, D V

    2016-09-01

    A transcriptome analysis of the venom glands of the spider Loxosceles laeta, performed by our group, in a previous study (Fernandes-Pedrosa et al., 2008), revealed a transcript with a sequence similar to the human complement component C3. Here we present the analysis of this transcript. cDNA fragments encoding the C3 homologue (Lox-C3) were amplified from total RNA isolated from the venom glands of L. laeta by RACE-PCR. Lox-C3 is a 5178 bps cDNA sequence encoding a 190kDa protein, with a domain configuration similar to human C3. Multiple alignments of C3-like proteins revealed two processing sites, suggesting that Lox-C3 is composed of three chains. Furthermore, the amino acids consensus sequences for the thioester was found, in addition to putative sequences responsible for FB binding. The phylogenetic analysis showed that Lox-C3 belongs to the same group as two C3 isoforms from the spider Hasarius adansoni (Family Salcitidae), showing 53% homology with these. This is the first characterization of a Loxosceles cDNA sequence encoding a human C3 homologue, and this finding, together with our previous finding of the expression of a FB-like molecule, suggests that this spider species also has a complement system. This work will help to improve our understanding of the innate immune system in these spiders and the ancestral structure of C3. Copyright © 2016 Elsevier GmbH. All rights reserved.

  8. Differences in expression of retinal pigment epithelium mRNA between normal canines

    PubMed Central

    2004-01-01

    Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

  9. Vesicular monoamine transporter-1 (VMAT-1) mRNA and immunoreactive proteins in mouse brain.

    PubMed

    Ashe, Karen M; Chiu, Wan-Ling; Khalifa, Ahmed M; Nicolas, Antoine N; Brown, Bonnie L; De Martino, Randall R; Alexander, Clayton P; Waggener, Christopher T; Fischer-Stenger, Krista; Stewart, Jennifer K

    2011-01-01

    Vesicular monoamine transporter 1 (VMAT-1) mRNA and protein were examined (1) to determine whether adult mouse brain expresses full-length VMAT-1 mRNA that can be translated to functional transporter protein and (2) to compare immunoreactive VMAT-1 proteins in brain and adrenal. VMAT-1 mRNA was detected in mouse brain with RT-PCR. The cDNA was sequenced, cloned into an expression vector, transfected into COS-1 cells, and cell protein was assayed for VMAT-1 activity. Immunoreactive proteins were examined on western blots probed with four different antibodies to VMAT-1. Sequencing confirmed identity of the entire coding sequences of VMAT-1 cDNA from mouse medulla oblongata/pons and adrenal to a Gen-Bank reference sequence. Transfection of the brain cDNA into COS-1 cells resulted in transporter activity that was blocked by the VMAT inhibitor reserpine and a proton ionophore, but not by tetrabenazine, which has a high affinity for VMAT-2. Antibodies to either the C- or N- terminus of VMAT-1 detected two proteins (73 and 55 kD) in transfected COS-1 cells. The C-terminal antibodies detected both proteins in extracts of mouse medulla/pons, cortex, hypothalamus, and cerebellum but only the 73 kD protein and higher molecular weight immunoreactive proteins in mouse adrenal and rat PC12 cells, which are positive controls for rodent VMAT-1. These findings demonstrate that a functional VMAT-1 mRNA coding sequence is expressed in mouse brain and suggest processing of VMAT-1 protein differs in mouse adrenal and brain.

  10. Quantitative high-throughput profiling of snake venom gland transcriptomes and proteomes (Ovophis okinavensis and Protobothrops flavoviridis)

    PubMed Central

    2013-01-01

    Background Advances in DNA sequencing and proteomics have facilitated quantitative comparisons of snake venom composition. Most studies have employed one approach or the other. Here, both Illumina cDNA sequencing and LC/MS were used to compare the transcriptomes and proteomes of two pit vipers, Protobothrops flavoviridis and Ovophis okinavensis, which differ greatly in their biology. Results Sequencing of venom gland cDNA produced 104,830 transcripts. The Protobothrops transcriptome contained transcripts for 103 venom-related proteins, while the Ovophis transcriptome contained 95. In both, transcript abundances spanned six orders of magnitude. Mass spectrometry identified peptides from 100% of transcripts that occurred at higher than contaminant (e.g. human keratin) levels, including a number of proteins never before sequenced from snakes. These transcriptomes reveal fundamentally different envenomation strategies. Adult Protobothrops venom promotes hemorrhage, hypotension, incoagulable blood, and prey digestion, consistent with mammalian predation. Ovophis venom composition is less readily interpreted, owing to insufficient pharmacological data for venom serine and metalloproteases, which comprise more than 97.3% of Ovophis transcripts, but only 38.0% of Protobothrops transcripts. Ovophis venom apparently represents a hybrid strategy optimized for frogs and small mammals. Conclusions This study illustrates the power of cDNA sequencing combined with MS profiling. The former quantifies transcript composition, allowing detection of novel proteins, but cannot indicate which proteins are actually secreted, as does MS. We show, for the first time, that transcript and peptide abundances are correlated. This means that MS can be used for quantitative, non-invasive venom profiling, which will be beneficial for studies of endangered species. PMID:24224955

  11. Cloning of human cDNAs for Apg-1 and Apg-2, members of the Hsp110 family, and chromosomal assignment of their genes.

    PubMed

    Nonoguchi, K; Itoh, K; Xue, J H; Tokuchi, H; Nishiyama, H; Kaneko, Y; Tatsumi, K; Okuno, H; Tomiwa, K; Fujita, J

    1999-09-03

    In mice, the Hsp110/SSE family is composed of the heat shock protein (Hsp)110/105, Apg-1 and Apg-2. In humans, however, only the Hsp110/105 homolog has been identified as a member, and two cDNAs, Hsp70RY and HS24/p52, potentially encoding proteins structurally similar to, but smaller than, mouse Apg-2 have been reported. To clarify the membership of Hsp110 family in humans, we isolated Apg-1 and Apg-2 cDNAs from a human testis cDNA library. The human Apg-1 was 100% and 91.8% identical in length and amino acid (aa) sequence, respectively, to mouse Apg-1. Human Apg-2 was one aa shorter than and 95.5% identical in sequence to mouse Apg-2. In ECV304, human endothelial cells Apg-1 but not Apg-2 transcripts were induced in 2 h by a temperature shift from 32 degrees C to 39 degrees C. As found in mice, the response was stronger than that to a 37-42 degrees C shift. The human Apg-1 and Apg-2 genes were mapped to the chromosomal loci 4q28 and 5q23.3-q31.1, respectively, by fluorescence in-situ hybridization. We isolated cDNA and genomic clones encompassing the region critical for the difference between Apg-2 and HS24/p52. Although the primer sets used were derived from the sequences common to both cDNAs, all cDNA and genomic clones corresponded to Apg-2. Using a similar approach, the relationship between Apg-2 and Hsp70RY was assessed, and no clone corresponding to Hsp70RY was obtained. These results demonstrated that the Hsp110 family consists of at least three members, Apg-1, Apg-2 and Hsp110 in humans as well as in mice. The significance of HS24/p52 and Hsp70RY cDNAs previously reported remains to be determined.

  12. HOXBES2: a novel epididymal HOXB2 homeoprotein and its domain-specific association with spermatozoa.

    PubMed

    Prabagaran, E; Bandivdekar, A H; Dighe, V; Raghavan, V P

    2007-02-01

    The sperm from the testis acquires complete fertilizing ability and forward progressive motility following its transit through the epididymis. Acquisition of these characteristics results from the modification of the sperm proteome following interactions with epididymal secretions. In our attempts to identify epididymis-specific sperm plasma membrane proteins, a partial 2.83-kb clone was identified by immunoscreening a monkey epididymal cDNA library with an agglutinating monoclonal antibody raised against washed human spermatozoa. The sequence of the 2.83-kb clone exhibited homology to the region between 1 and 1097 bp of the homeobox gene, Hoxb2. This sequence was found to be species conserved, as revealed by RT-PCR analysis. To obtain a full-length clone of the sequence, 5' RACE-PCR (rapid amplification of cDNA ends PCR) was carried out using rat epididymal RNA as the template. It resulted in a full-length 1.657-kb cDNA encoding a 32.9-kDa putative protein. The protein designated HOXBES2 exhibited homology to the conserved 61-amino acid homeodomain region of the HOXB2 homeoprotein. However, characteristic differences were noted in its amino and carboxyl termini compared with HOXB2. A putative 30-kDa protein was detected in the tissue extracts from adult rat epididymis and caudal spermatozoa, and a 37-kDa protein was detected in the rat embryo when probed with a polyclonal antibody against HOXB2 protein. Multiple tissue Western blot and immunohistochemical analysis further indicated its expression in the cytoplasm of the principal and basal epithelial cells, with maximal expression in the distal epididymal segments. Northern blot analysis detected a single approximately 2.5-kb transcript from the adult epididymis. Indirect immunofluorescence localized the protein to the acrosome, midpiece, and equatorial segments of rat caudal and ejaculated human and monkey spermatozoa, respectively. In conclusion, we have identified and characterized a novel epididymal homeoprotein different from HOXB2 protein and hereafter referred to as HOXBES2, (HOXB2 homeodomain containing epididymis-specific sperm protein) with a probable role in fertilization.

  13. Cloning and functional characterization of the DA2 receptor gene in Chinese mitten crab (Eriocheir sinensis)

    PubMed Central

    Xu, Min-jie; Zhang, Cong; Yang, Zhigang

    2018-01-01

    Dopamine (DA) plays a modulatory role in numerous physiological processes such as light adaptation and food intake, and exerts these functions through DA receptors (DARs). This study presents, for the first time, isolation and characterization of the dopamine receptor 2(DA2 receptor) cDNA from the intestinal tissue of Eriocheir sinensis, an economically important freshwater aquaculture species in China. The DA2 receptor cDNA sequence, which was obtained by rapid amplification of cDNA ends, is 2369bp long, encode peptide of 589 amino acid, and is highly homologous to related sequences in crustaceans. Analysis of the deduced amino acid sequence and the structure of the DA2 indicated that this receptor is a member of the family of G protein-coupled receptors (GPCRs), as it contains seven transmembrane domains and other common signatures of GPCRs. RT-PCR showed that the expression of the DA2 receptor gene was distributed in various tissues, and high expression levels were observed in the cranial ganglia and the thoracic ganglia. Further study of the effect of photoperiod on DA2 expression showed that constant darkness induced a significant increase in DA2 expression in the cranial ganglia. Finally, analysis of DA2 receptor expression under different feeding statuses showed that there was significantly greater expression in the hepatopancreas and intestines after feeding than before feeding, but there were no differences in expression between the before feeding and during feeding periods in either tissue. Our results indicate that the DA2 receptor structurally belongs to the family of G protein-coupled receptors, and that the cranial ganglia are the main tissues in which the DA2 receptor participates in light adaptation during dark hours. In addition, the DA2 receptor in E. sinensis may be involved in the physiological regulation of the hepatopancreas and digestive tract after the ingestion of food. This study provides a foundation for further exploration of the light adaptation and digestive functions of the DA2 receptor in decapods. PMID:29554147

  14. Sequencing cDNAs: An Introduction to DNA Sequence Analysis in the Undergraduate Molecular Genetics Course.

    ERIC Educational Resources Information Center

    Galewsky, Samuel

    2000-01-01

    Introduces a series of molecular genetics laboratories where students pick a single colony from a Drosophila melanogester embryo cDNA library and purify the plasmid, then analyze the insert through restriction digests and gel electrophoresis. (Author/YDS)

  15. Isolation and Characterization of a Sex-Specific Lectin in a Marine Red Alga, Aglaothamnion oosumiense Itono

    PubMed Central

    Han, Jong Won; Klochkova, Tatyana A.; Shim, Jun Bo; Yoon, Kangsup

    2012-01-01

    In red algae, spermatial binding to female trichogynes is mediated by a lectin-carbohydrate complementary system. Aglaothamnion oosumiense is a microscopic filamentous red alga. The gamete recognition and binding occur at the surface of the hairlike trichogyne on the female carpogonium. Male spermatia are nonmotile. Previous studies suggested the presence of a lectin responsible for gamete recognition on the surface of female trychogynes. A novel N-acetyl-d-galactosamine-specific protein was isolated from female plants of A. oosumiense by affinity chromatography and named AOL1. The lectin was monomeric and did not agglutinate horse blood or human erythrocytes. The N-terminal amino acid sequence of the protein was analyzed, and degenerate primers were designed. A full-length cDNA encoding the lectin was obtained using rapid amplification of cDNA ends-PCR (RACE-PCR). The cDNA was 1,095 bp in length and coded for a protein of 259 amino acids with a deduced molecular mass of 21.4 kDa, which agreed well with the protein data. PCR analysis using genomic DNA showed that both male and female plants have this gene. However, Northern blotting and two-dimensional electrophoresis showed that this protein was expressed 12 to 15 times more in female plants. The lectin inhibited spermatial binding to the trichogynes when preincubated with spermatia, suggesting its involvement in gamete binding. PMID:22865077

  16. Sequence features and phylogenetic analysis of the stress protein Hsp90α in chinook salmon Oncorhynchus tshawytscha, a poikilothermic vertebrate

    USGS Publications Warehouse

    Palmisano, Aldo N.; Winton, James R.; Dickhoff, Walton W.

    1999-01-01

    We cloned and sequenced a chinook salmon Hsp90 cDNA; sequence analysis shows it to be Hsp90??. Phylogenetic analysis supports the hypothesis that ?? and ?? paralogs of Hsp90 arose as a result of a gene duplication event and that they diverged early in the evolution of vertebrates, before tetrapods separated from the teleost lineage. Among several differences distinguishing poikilothermic Hsp90?? sequences from their bird and mammal orthologs, the teleost versions specifically lack a characteristic QTQDQP phosphorylation site near the N-terminus. We used the cDNA to develop an RNA (Northern) blot to quantify cellular Hsp90 mRNA levels. Chinook salmon embryonic (CHSE-214) cells responded to heat shock with a rapid rise in Hsp90 mRNA through 4 h, followed by a gradual decline over the next 20 h. Hsp90 mRNA level may be useful as a stress indicator, especially in a laboratory setting or in response to acute heat stress.

  17. Isolation and cloning of a metalloproteinase from king cobra snake venom.

    PubMed

    Guo, Xiao-Xi; Zeng, Lin; Lee, Wen-Hui; Zhang, Yun; Jin, Yang

    2007-06-01

    A 50 kDa fibrinogenolytic protease, ohagin, from the venom of Ophiophagus hannah was isolated by a combination of gel filtration, ion-exchange and heparin affinity chromatography. Ohagin specifically degraded the alpha-chain of human fibrinogen and the proteolytic activity was completely abolished by EDTA, but not by PMSF, suggesting it is a metalloproteinase. It dose-dependently inhibited platelet aggregation induced by ADP, TMVA and stejnulxin. The full sequence of ohagin was deduced by cDNA cloning and confirmed by protein sequencing and peptide mass fingerprinting. The full-length cDNA sequence of ohagin encodes an open reading frame of 611 amino acids that includes signal peptide, proprotein and mature protein comprising metalloproteinase, disintegrin-like and cysteine-rich domains, suggesting it belongs to P-III class metalloproteinase. In addition, P-III class metalloproteinases from the venom glands of Naja atra, Bungarus multicinctus and Bungarus fasciatus were also cloned in this study. Sequence analysis and phylogenetic analysis indicated that metalloproteinases from elapid snake venoms form a new subgroup of P-III SVMPs.

  18. Proteinaceous toxins from three species of scorpaeniform fish (lionfish Pterois lunulata, devil stinger Inimicus japonicus and waspfish Hypodytes rubripinnis): close similarity in properties and primary structures to stonefish toxins.

    PubMed

    Kiriake, Aya; Suzuki, Yasuko; Nagashima, Yuji; Shiomi, Kazuo

    2013-08-01

    The crude toxins from three species of venomous fish (lionfish Pterois lunulata, devil stinger Inimicus japonicus and waspfish Hypodytes rubripinnis) belonging to the order Scorpaeniformes exhibited mouse-lethal, hemolytic, edema-forming and nociceptive activities. In view of the antigenic cross-reactivity with the stonefish toxins, the primary structures of the stonefish toxin-like toxins from the three scorpaeniform fish were determined by cDNA cloning using primers designed from the highly conserved sequences of the stonefish toxins. Based on the data obtained in gel filtration, immunoblotting and cDNA cloning, each toxin was judged to be a 160 kDa heterodimer composed of 80 kDa α- and β-subunits. The three scorpaeniform fish toxins contain a B30.2/SPRY domain (∼200 amino acid residues) in the C-terminal region of each subunit, as reported for the toxins from two species of lionfish and two species of stonefish. With respect to the amino acid sequence similarity, the scorpaeniform fish toxins are divided into the following two groups: toxins from three species of lionfish and those from devil stinger, two species of stonefish and waspfish. The phylogenetic tree generated also clearly supports the classification of the toxins. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

    PubMed

    Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

    2018-05-27

    Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

  20. Molecular cloning of the heat shock protein 20 gene from Paphia textile and its expression in response to heat shock

    NASA Astrophysics Data System (ADS)

    Li, Jiakai; Wu, Xiangwei; Tan, Jing; Zhao, Ruixiang; Deng, Lingwei; Liu, Xiande

    2015-07-01

    P. textile is an important aquaculture species in China and is mainly distributed in Fujian, Guangdong, and Guangxi Provinces. In this study, an HSP20 cDNA designated PtHSP20 was cloned from P. textile. The full-length cDNA of PtHSP20 is 1 090 bp long and contains a 5' untranslated region (UTR) of 93 bp, a 3' UTR of 475 bp, and an open reading frame (ORF) of 522 bp. The PtHSP20 cDNA encodes 173 amino acid residues and has a molecular mass of 20.22 kDa and an isoelectric point of 6.2. Its predicted amino acid sequence shows that PtHSP20 contains a typical α-crystallin domain (residues 77-171) and three polyadenylation signal-sequences at the C-terminus. According to an amino acid sequence alignment, PtHSP20 shows moderate homology to other mollusk sHSPs. PtHSP20 mRNA was present in all of the test tissues including the heart, digestive gland, adductor muscle, gonad, gill, and mantle, with the highest concentration found in the gonad. Under the stress of high temperature, the expression of PtHSP20 mRNA was down-regulated in all of the tissues except the adductor muscle and gonad.

Top