Characterization of Lactic Acid Bacteria as Poultry Probiotic Candidates with Aflatoxin B1 Binding Activities

NASA Astrophysics Data System (ADS)

Damayanti, E.; Istiqomah, L.; Saragih, J. E.; Purwoko, T.; Sardjono

2017-12-01

Our previous studies have selected lactic acid bacteria (LAB) with antifungal activities from traditional fermented foods made from cassava (G7) and silage feed palm leaf (PDS5 and PDS3). In this study we evaluated their ability to bind aflatoxin B1 (AFB1) and probiotic characteristic. The probiotic characteristic assays of LAB consisted of resistance to acidic conditions (pH 3), gastric juice and bile salts 0.3%. We also carried out an in vitro evaluation of LAB aflatoxin binding ability in viable and non-viable cell for 24 and 48 hours of incubation. The measurement of aflatoxin content was performed by ELISA method using AgraQuant Total Aflatoxin Assay kit. The results showed that all isolates were potential as probiotics and the G7 isolate had the highest viability among other isolates in pH 3 (92.61 %) and the bile salts assay (97.71 %). The percentage of aflatoxin reduction between viable and non-viable cell from each LAB isolate were different. The highest aflatoxin reduction in viable cell assay was performed by G7 isolate (69.11 %) whereas in non-viable cell assay was performed by PDS3 isolate (73.75 %) during incubation time 48 hours. In this study, G7 isolate performed the best probiotic characteristics with the highest viability in acid pH assay, bile salt 0.3% assay and percentage of aflatoxin B1 reduction in viable cell condition. Molecular identification using 16S rRNA sequence analysis showed that G7 isolate had homology with Lactobacillus plantarum (99.9%). It was concluded that Lactobacillus plantarum G7 was potential as probiotic with aflatoxin binding activities.

The Rho ADP-ribosylating C3 exoenzyme binds cells via an Arg-Gly-Asp motif.

PubMed

Rohrbeck, Astrid; Höltje, Markus; Adolf, Andrej; Oms, Elisabeth; Hagemann, Sandra; Ahnert-Hilger, Gudrun; Just, Ingo

2017-10-27

The Rho ADP-ribosylating C3 exoenzyme (C3bot) is a bacterial protein toxin devoid of a cell-binding or -translocation domain. Nevertheless, C3 can efficiently enter intact cells, including neurons, but the mechanism of C3 binding and uptake is not yet understood. Previously, we identified the intermediate filament vimentin as an extracellular membranous interaction partner of C3. However, uptake of C3 into cells still occurs (although reduced) in the absence of vimentin, indicating involvement of an additional host cell receptor. C3 harbors an Arg-Gly-Asp (RGD) motif, which is the major integrin-binding site, present in a variety of integrin ligands. To check whether the RGD motif of C3 is involved in binding to cells, we performed a competition assay with C3 and RGD peptide or with a monoclonal antibody binding to β1-integrin subunit and binding assays in different cell lines, primary neurons, and synaptosomes with C3-RGD mutants. Here, we report that preincubation of cells with the GRGDNP peptide strongly reduced C3 binding to cells. Moreover, mutation of the RGD motif reduced C3 binding to intact cells and also to recombinant vimentin. Anti-integrin antibodies also lowered the C3 binding to cells. Our results indicate that the RGD motif of C3 is at least one essential C3 motif for binding to host cells and that integrin is an additional receptor for C3 besides vimentin. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Special AT-rich sequence binding protein 1 promotes tumor growth and metastasis of esophageal squamous cell carcinoma.

PubMed

Ma, Jun; Wu, Kaiming; Zhao, Zhenxian; Miao, Rong; Xu, Zhe

2017-03-01

Esophageal squamous cell carcinoma is one of the most aggressive malignancies worldwide. Special AT-rich sequence binding protein 1 is a nuclear matrix attachment region binding protein which participates in higher order chromatin organization and tissue-specific gene expression. However, the role of special AT-rich sequence binding protein 1 in esophageal squamous cell carcinoma remains unknown. In this study, western blot and quantitative real-time polymerase chain reaction analysis were performed to identify differentially expressed special AT-rich sequence binding protein 1 in a series of esophageal squamous cell carcinoma tissue samples. The effects of special AT-rich sequence binding protein 1 silencing by two short-hairpin RNAs on cell proliferation, migration, and invasion were assessed by the CCK-8 assay and transwell assays in esophageal squamous cell carcinoma in vitro. Special AT-rich sequence binding protein 1 was significantly upregulated in esophageal squamous cell carcinoma tissue samples and cell lines. Silencing of special AT-rich sequence binding protein 1 inhibited the proliferation of KYSE450 and EC9706 cells which have a relatively high level of special AT-rich sequence binding protein 1, and the ability of migration and invasion of KYSE450 and EC9706 cells was distinctly suppressed. Special AT-rich sequence binding protein 1 could be a potential target for the treatment of esophageal squamous cell carcinoma and inhibition of special AT-rich sequence binding protein 1 may provide a new strategy for the prevention of esophageal squamous cell carcinoma invasion and metastasis.

Development of binding assays in microfabricated picoliter vials: an assay for biotin.

PubMed

Grosvenor, A L; Feltus, A; Conover, R C; Daunert, S; Anderson, K W

2000-06-01

A homogeneous binding assay for the detection of biotin in picoliter vials was developed using the photoprotein aequorin as the label. The binding assay was based on the competition of free biotin with biotinylated aequorin (AEQ-biotin) for avidin. A sequential protocol was used, and modification of the assay to reduce the number of steps was examined. Results showed that detection limits on the order of 10(-14) mol of biotin were possible. Reducing the number of steps provided similar detection limits but only if the amount of avidin used was decreased. These binding assays based on picoliter volumes have potential applications in a variety of fields, including microanalysis and single-cell analysis, where the amount of sample is limited. In addition, these assays are suitable for the high-throughput screening of biopharmaceuticals.

DEVELOPMENT AND CHARACTERIZATION OF A CELL LINE THAT STABLY EXPRESSES AN ESTROGEN-RESPONSIVE LUCIFERASE REPORTER FOR THE DETECTION OF ESTROGEN RECEPTOR AGONIST AND ANTAGONISTS

EPA Science Inventory

Screening for endocrine disrupting chemicals (EDCs) that act as estrogens or antiestrogens relies on the use of in vitro binding and gene expression assays coupled with short-term diagnostic in vivo assays. Although binding assays are useful to identify chemicals that are competi...

Advantages and application of label-free detection assays in drug screening.

PubMed

Cunningham, Brian T; Laing, Lance G

2008-08-01

Adoption is accelerating for a new family of label-free optical biosensors incorporated into standard format microplates owing to their ability to enable highly sensitive detection of small molecules, proteins and cells for high-throughput drug discovery applications. Label-free approaches are displacing other detection technologies owing to their ability to provide simple assay procedures for hit finding/validation, accessing difficult target classes, screening the interaction of cells with drugs and analyzing the affinity of small molecule inhibitors to target proteins. This review describes several new drug discovery applications that are under development for microplate-based photonic crystal optical biosensors and the key issues that will drive adoption of the technology. Microplate-based optical biosensors are enabling a variety of cell-based assays, inhibition assays, protein-protein binding assays and protein-small molecule binding assays to be performed with high-throughput and high sensitivity.

Phosphatidylserine recognition and induction of apoptotic cell clearance by Drosophila engulfment receptor Draper.

PubMed

Tung, Tran Thanh; Nagaosa, Kaz; Fujita, Yu; Kita, Asana; Mori, Hiroki; Okada, Ryo; Nonaka, Saori; Nakanishi, Yoshinobu

2013-05-01

The membrane phospholipid phosphatidylserine is exposed on the cell surface during apoptosis and acts as an eat-me signal in the phagocytosis of apoptotic cells in mammals and nematodes. However, whether this is also true in insects was unclear. When milk fat globule-epidermal growth factor 8, a phosphatidylserine-binding protein of mammals, was ectopically expressed in Drosophila, the level of phagocytosis was reduced, whereas this was not the case for the same protein lacking a domain responsible for the binding to phosphatidylserine. We found that the extracellular region of Draper, an engulfment receptor of Drosophila, binds to phosphatidylserine in an enzyme-linked immunosorbent assay-like solid-phase assay and in an assay for surface plasmon resonance. A portion of Draper containing domains EMI and NIM located close to the N-terminus was required for binding to phosphatidylserine, and a Draper protein lacking this region was not active in Drosophila. Finally, the level of tyrosine-phosphorylated Draper, indicative of the activation of Draper, in a hemocyte-derived cell line was increased after treatment with phosphatidylserine-containing liposome. These results indicated that phosphatidylserine serves as an eat-me signal in the phagocytic removal of apoptotic cells in Drosophila and that Draper is a phosphatidylserine-binding receptor for phagocytosis.

Multi-Laboratory Study of Five Methods for the Determination of Brevetoxins in Shellfish Tissue Extracts.

PubMed

Dickey, Robert W; Plakas, Steven M; Jester, Edward L E; El Said, Kathleen R; Johannessen, Jan N; Flewelling, Leanne J; Scott, Paula; Hammond, Dan G; Van Dolah, Frances M; Leighfield, Tod A; Bottein Dachraoui, Marie-Yasmine; Ramsdell, John S; Pierce, Richard H; Henry, Mike S; Poli, Mark A; Walker, Calvin; Kurtz, Jan; Naar, Jerome; Baden, Daniel G; Musser, Steve M; White, Kevin D; Truman, Penelope; Miller, Aaron; Hawryluk, Timothy P; Wekell, Marleen M; Stirling, David; Quilliam, Michael A; Lee, Jung K

A thirteen-laboratory comparative study tested the performance of four methods as alternatives to mouse bioassay for the determination of brevetoxins in shellfish. The methods were N2a neuroblastoma cell assay, two variations of the sodium channel receptor binding assay, competitive ELISA, and LC/MS. Three to five laboratories independently performed each method using centrally prepared spiked and naturally incurred test samples. Competitive ELISA and receptor binding (96-well format) compared most favorably with mouse bioassay. Between-laboratory relative standard deviations (RSDR) ranged from 10 to 20% for ELISA and 14 to 31% for receptor binding. Within-laboratory (RSDr) ranged from 6 to 15% for ELISA, and 5 to 31% for receptor binding. Cell assay was extremely sensitive but data variation rendered it unsuitable for statistical treatment. LC/MS performed as well as ELISA on spiked test samples but was inordinately affected by lack of toxin-metabolite standards, uniform instrumental parameters, or both, on incurred test samples. The ELISA and receptor binding assay are good alternatives to mouse bioassay for the determination of brevetoxins in shellfish.

The minor house dust mite allergen Der p 13 is a fatty acid-binding protein and an activator of a TLR2-mediated innate immune response.

PubMed

Satitsuksanoa, P; Kennedy, M; Gilis, D; Le Mignon, M; Suratannon, N; Soh, W T; Wongpiyabovorn, J; Chatchatee, P; Vangveravong, M; Rerkpattanapipat, T; Sangasapaviliya, A; Piboonpocanun, S; Nony, E; Ruxrungtham, K; Jacquet, A

2016-10-01

The house dust mite (HDM) allergen Der p 13 could be a lipid-binding protein able to activate key innate signaling pathways in the initiation of the allergic response. We investigated the IgE reactivity of recombinant Der p 13 (rDer p 13), its lipid-binding activities, and its capacity to stimulate airway epithelium cells. Purified rDer p 13 was characterized by mass spectrometry, circular dichroism, fluorescence-based lipid-binding assays, and in silico structural prediction. IgE-binding activity and allergenic potential of Der p 13 were examined by ELISA, basophil degranulation assays, and in vitro airway epithelial cell activation assays. Protein modeling and biophysical analysis indicated that Der p 13 adopts a β-barrel structure with a predominately apolar pocket representing a potential binding site for hydrophobic ligands. Fluorescent lipid-binding assays confirmed that the protein is highly selective for ligands and that it binds a fatty acid with a dissociation constant typical of lipid transporter proteins. The low IgE-binding frequency (7%, n = 224) in Thai HDM-allergic patients as well as the limited propensity to activate basophil degranulation classifies Der p 13 as a minor HDM allergen. Nevertheless, the protein with its presumptively associated lipid(s) triggered the production of IL-8 and GM-CSF in respiratory epithelial cells through a TLR2-, MyD88-, NF-kB-, and MAPK-dependent signaling pathway. Although a minor allergen, Der p 13 may, through its lipid-binding capacity, play a role in the initiation of the HDM-allergic response through TLR2 activation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Geraniin extracted from the rind of Nephelium lappaceum binds to dengue virus type-2 envelope protein and inhibits early stage of virus replication.

PubMed

Abdul Ahmad, Siti Aisyah; Palanisamy, Uma D; Tejo, Bimo A; Chew, Miaw Fang; Tham, Hong Wai; Syed Hassan, Sharifah

2017-11-21

The rapid rise and spread in dengue cases, together with the unavailability of safe vaccines and effective antiviral drugs, warrant the need to discover and develop novel anti-dengue treatments. In this study the antiviral activity of geraniin, extracted from the rind of Nephelium lappaceum, against dengue virus type-2 (DENV-2) was investigated. Geraniin was prepared from Nephelium lappaceum rind by reverse phase C-18 column chromatography. Cytotoxicity of geraniin towards Vero cells was evaluated using MTT assay while IC 50 value was determined by plaque reduction assay. The mode-of-action of geraniin was characterized using the virucidal, attachment, penetration and the time-of-addition assays'. Docking experiments with geraniin molecule and the DENV envelope (E) protein was also performed. Finally, recombinant E Domain III (rE-DIII) protein was produced to physiologically test the binding of geraniin to DENV-2 E-DIII protein, through ELISA competitive binding assay. Cytotoxicity assay confirmed that geraniin was not toxic to Vero cells, even at the highest concentration tested. The compound exhibited DENV-2 plaque formation inhibition, with an IC 50 of 1.75 μM. We further revealed that geraniin reduced viral infectivity and inhibited DENV-2 from attaching to the cells but had little effect on its penetration. Geraniin was observed to be most effective when added at the early stage of DENV-2 infection. Docking experiments showed that geraniin binds to DENV E protein, specifically at the DIII region, while the ELISA competitive binding assay confirmed geraniin's interaction with rE-DIII with high affinity. Geraniin from the rind of Nephelium lappaceum has antiviral activity against DENV-2. It is postulated that the compound inhibits viral attachment by binding to the E-DIII protein and interferes with the initial cell-virus interaction. Our results demonstrate that geraniin has the potential to be developed into an effective antiviral treatment, particularly for early phase dengue viral infection.

FcUni-RLuc: an engineered Renilla luciferase with Fc binding ability and light emission activity.

PubMed

Farzannia, A; Roghanian, R; Zarkesh-Esfahani, S H; Nazari, M; Emamzadeh, R

2015-03-07

A novel and advanced Fc-binding probe – FcUni-RLuc namely – has been produced and functionally assayed for labelling IgGs. The Fc antibody binding sequence – HWRGWV – was fused to Renilla luciferase, and the purified probe was employed for bioluminescence enzyme-linked immunoabsorbance assay of Her2 positive cells.

A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations

PubMed Central

Bentley, Marvin; Decker, Helena; Luisi, Julie

2015-01-01

Identifying the proteins that regulate vesicle trafficking is a fundamental problem in cell biology. In this paper, we introduce a new assay that involves the expression of an FKBP12-rapamycin–binding domain–tagged candidate vesicle-binding protein, which can be inducibly linked to dynein or kinesin. Vesicles can be labeled by any convenient method. If the candidate protein binds the labeled vesicles, addition of the linker drug results in a predictable, highly distinctive change in vesicle localization. This assay generates robust and easily interpretable results that provide direct experimental evidence of binding between a candidate protein and the vesicle population of interest. We used this approach to compare the binding of Kinesin-3 family members with different endosomal populations. We found that KIF13A and KIF13B bind preferentially to early endosomes and that KIF1A and KIF1Bβ bind preferentially to late endosomes and lysosomes. This assay may have broad utility for identifying the trafficking proteins that bind to different vesicle populations. PMID:25624392

Small molecule antagonists of the urokinase (uPA): urokinase receptor (uPAR) interaction with high reported potencies show only weak effects in cell-based competition assays employing the native uPAR ligand.

PubMed

De Souza, Melissa; Matthews, Hayden; Lee, Jodi A; Ranson, Marie; Kelso, Michael J

2011-04-15

Binding of the urokinase-type plasminogen activator (uPA) to its cell-surface-bound receptor uPAR and upregulation of the plasminogen activation system (PAS) correlates with increased metastasis and poor prognosis in several tumour types. Disruptors of the uPA:uPAR interaction represent promising anti-tumour/metastasis agents and several approaches have been explored for this purpose, including the use of small molecule antagonists. Two highly potent non-peptidic antagonists 1 and 2 (IC(50)1=0.8 nM, IC(50)2=33 nM) from the patent literature were reportedly identified using competition assays employing radiolabelled uPAR-binding uPA fragments and appeared as useful pharmacological tools for studying the PAS. Before proceeding to such studies, confirmation was sought that 1 and 2 retained their potencies in physiologically relevant cell-based competition assays employing uPAR's native binding partner high molecular weight uPA (HMW-uPA). This study describes a new solution phase synthesis of 1, a mixed solid/solution phase synthesis of 2 and reports the activities of 1 and 2 in semi-quantitative competition flow cytometry assays and quantitative cell-based uPA activity assays that employed HMW-uPA as the competing ligand. The flow cytometry experiments revealed that high concentrations of 2 (10-100 μM) are required to compete with HMW-uPA for uPAR binding and that 1 shows no antagonist effects at 100 μM. The cell-based enzyme activity assays similarly revealed that 1 and 2 are poor inhibitors of cell surface-bound HMW-uPA activity (IC(50) >100 μM for 1 and 2). The report highlights the dangers of identifying false-positive lead uPAR antagonists from competition assays employing labelled competing ligands other than the native HMW-uPA. Copyright © 2011 Elsevier Ltd. All rights reserved.

Detection of potential (anti)progestagenic endocrine disruptors using a recombinant human progesterone receptor binding and transactivation assay.

PubMed

Viswanath, Gunda; Halder, Sujata; Divya, Gunda; Majumder, Chandrajeet B; Roy, Partha

2008-11-25

The present work describes the identification of (anti)progestin endocrine disrupting chemicals (EDC) using a two step screening system. In the first step a competitive binding assay was developed using recombinant human progesterone receptor (hPR). The tested chemicals were of various classes like insecticides, their metabolites, industrial chemicals and waste water treatment plant (WWTP) effluents. All the tested chemicals demonstrated a high affinity binding for hPR. The average IC50 values of the test chemicals were within the range of 1-25microM. In the second step of screening, a mammalian cell-based hPR transactivation assay was developed where HEK 293 cells were co-transfected with hPR and luciferase reporter gene under the control of progesterone-response element. Stimulation of the cells with progesterone resulted in about 25-fold up regulation of luciferase activity, with EC50 value of 4nM. Potent anti-progesterone, RU486, significantly inhibited progesterone-induced transactivation and non-progestagenic steroids failed to transactivate hPR till 1microM concentrations. The chemicals showing high binding affinities in competitive binding assays were then tested in transactivation assay and all of them were found to be anti-progestative except WWTP effluents. Transactivation assays using extracted water samples from five different WWTP effluents showed that it was rich in progestative compounds. The levels of induction caused by these effluents were in the range of 15-25% of induction by progesterone and they represented about 6ng/l equivalent progesterone activities. In conclusion, we demonstrated that this two step assay provides an efficient screening tool for the detection of (anti)progestative EDC in various samples.

Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Miranda Santos, I.K.; Pereira, M.E.

1984-09-01

Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various /sup 125/I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeusmore » and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.« less

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

Heterotypic binding between neuronal membrane vesicles and glial cells is mediated by a specific cell adhesion molecule

PubMed Central

1984-01-01

By means of a multistage quantitative assay, we have identified a new kind of cell adhesion molecule (CAM) on neuronal cells of the chick embryo that is involved in their adhesion to glial cells. The assay used to identify the binding component (which we name neuron-glia CAM or Ng-CAM) was designed to distinguish between homotypic binding (e.g., neuron to neuron) and heterotypic binding (e.g., neuron to glia). This distinction was essential because a single neuron might simultaneously carry different CAMs separately mediating each of these interactions. The adhesion of neuronal cells to glial cells in vitro was previously found to be inhibited by Fab' fragments prepared from antisera against neuronal membranes but not by Fab' fragments against N-CAM, the neural cell adhesion molecule. This suggested that neuron-glia adhesion is mediated by specific cell surface molecules different from previously isolated CAMs . To verify that this was the case, neuronal membrane vesicles were labeled internally with 6-carboxyfluorescein and externally with 125I-labeled antibodies to N-CAM to block their homotypic binding. Labeled vesicles bound to glial cells but not to fibroblasts during a 30-min incubation period. The specific binding of the neuronal vesicles to glial cells was measured by fluorescence microscopy and gamma spectroscopy of the 125I label. Binding increased with increasing concentrations of both glial cells and neuronal vesicles. Fab' fragments prepared from anti-neuronal membrane sera that inhibited binding between neurons and glial cells were also found to inhibit neuronal vesicle binding to glial cells. The inhibitory activity of the Fab' fragments was depleted by preincubation with neuronal cells but not with glial cells. Trypsin treatment of neuronal membrane vesicles released material that neutralized Fab' fragment inhibition; after chromatography, neutralizing activity was enriched 50- fold. This fraction was injected into mice to produce monoclonal antibodies; an antibody was obtained that interacted with neurons, inhibited binding of neuronal membrane vesicles to glial cells, and recognized an Mr = 135,000 band in immunoblots of embryonic chick brain membranes. These results suggest that this molecule is present on the surfaces of neurons and that it directly or indirectly mediates adhesion between neurons and glial cells. Because the monoclonal antibody as well as the original polyspecific antibodies that were active in the assay did not bind to glial cells, we infer that neuron- glial interaction is heterophilic, i.e., it occurs between Ng-CAM on neurons and an as yet unidentified CAM present on glial cells. PMID:6725397

A High Content Drug Screen Identifies Ursolic Acid as an Inhibitor of Amyloid β Protein Interactions with Its Receptor CD36*

PubMed Central

Wilkinson, Kim; Boyd, Justin D.; Glicksman, Marcie; Moore, Kathryn J.; El Khoury, Joseph

2011-01-01

A pathological hallmark of Alzheimer disease (AD) is deposition of amyloid β (Aβ) in the brain. Aβ binds to microglia via a receptor complex that includes CD36 leading to production of proinflammatory cytokines and neurotoxic reactive oxygen species and subsequent neurodegeneration. Interruption of Aβ binding to CD36 is a potential therapeutic strategy for AD. To identify pharmacologic inhibitors of Aβ binding to CD36, we developed a 384-well plate assay for binding of fluorescently labeled Aβ to Chinese hamster ovary cells stably expressing human CD36 (CHO-CD36) and screened an Food and Drug Administration-approved compound library. The assay was optimized based on the cells' tolerance to dimethyl sulfoxide, Aβ concentration, time required for Aβ binding, reproducibility, and signal-to-background ratio. Using this assay, we identified four compounds as potential inhibitors of Aβ binding to CD36. These compounds were ursolic acid, ellipticine, zoxazolamine, and homomoschatoline. Of these compounds, only ursolic acid, a naturally occurring pentacyclic triterpenoid, successfully inhibited binding of Aβ to CHO-CD36 cells in a dose-dependent manner. The ursolic acid effect reached a plateau at ∼20 μm, with a maximal inhibition of 64%. Ursolic acid also blocked binding of Aβ to microglial cells and subsequent ROS production. Our data indicate that cell-based high-content screening of small molecule libraries for their ability to block binding of Aβ to its receptors is a useful tool to identify novel inhibitors of receptors involved in AD pathogenesis. Our data also suggest that ursolic acid is a potential therapeutic agent for AD via its ability to block Aβ-CD36 interactions. PMID:21835916

Surface Display of the Receptor-Binding Region of the Lactobacillus brevis S-Layer Protein in Lactococcus lactis Provides Nonadhesive Lactococci with the Ability To Adhere to Intestinal Epithelial Cells

PubMed Central

Åvall-Jääskeläinen, Silja; Lindholm, Agneta; Palva, Airi

2003-01-01

Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactococcus lactis NZ9000. Western blot assay of lactococcal cell wall extracts with anti-SlpA antibodies confirmed that the SlpA adhesion domain of the fusion protein was expressed and located within the cell wall layer. Whole-cell enzyme-linked immunosorbent assay and immunofluorescence microscopy verified that the SlpA adhesion-mediating region was accessible on the lactococcal cell surface. In vitro adhesion assays with the human intestinal epithelial cell line Intestine 407 indicated that the recombinant lactococcal cells had gained an ability to adhere to Intestine 407 cells significantly greater than that of wild-type L. lactis NZ9000. Serum inhibition assay further confirmed that adhesion of recombinant lactococci to Intestine 407 cells was indeed mediated by the N terminus-encoding part of the slpA gene. The ability of the receptor-binding region of SlpA to adhere to fibronectin was also confirmed with this lactococcal surface display system. These results show that, with the aid of the receptor-binding region of the L. brevis SlpA protein, the ability to adhere to gut epithelial cells can indeed be transferred to another, nonadhesive, lactic acid bacterium. PMID:12676705

Surface display of the receptor-binding region of the Lactobacillus brevis S-layer protein in Lactococcus lactis provides nonadhesive lactococci with the ability to adhere to intestinal epithelial cells.

PubMed

Avall-Jääskeläinen, Silja; Lindholm, Agneta; Palva, Airi

2003-04-01

Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactococcus lactis NZ9000. Western blot assay of lactococcal cell wall extracts with anti-SlpA antibodies confirmed that the SlpA adhesion domain of the fusion protein was expressed and located within the cell wall layer. Whole-cell enzyme-linked immunosorbent assay and immunofluorescence microscopy verified that the SlpA adhesion-mediating region was accessible on the lactococcal cell surface. In vitro adhesion assays with the human intestinal epithelial cell line Intestine 407 indicated that the recombinant lactococcal cells had gained an ability to adhere to Intestine 407 cells significantly greater than that of wild-type L. lactis NZ9000. Serum inhibition assay further confirmed that adhesion of recombinant lactococci to Intestine 407 cells was indeed mediated by the N terminus-encoding part of the slpA gene. The ability of the receptor-binding region of SlpA to adhere to fibronectin was also confirmed with this lactococcal surface display system. These results show that, with the aid of the receptor-binding region of the L. brevis SlpA protein, the ability to adhere to gut epithelial cells can indeed be transferred to another, nonadhesive, lactic acid bacterium.

Expression of human FcgammaRIIIa as a GPI-linked molecule on CHO cells to enable measurement of human IgG binding.

PubMed

Armour, Kathryn L; Smith, Cheryl S; Clark, Michael R

2010-03-31

The efficacy of a therapeutic IgG molecule may be as dependent on the optimisation of the constant region to suit its intended indication as on the selection of its variable regions. A crucial effector function to be maximised or minimised is antibody-dependent cell-mediated cytotoxicity by natural killer cells. Traditional assays of ADCC activity suffer from considerable inter-donor and intra-donor variability, which makes the measurement of antibody binding to human FcgammaRIIIa, the key receptor for ADCC, an attractive alternative method of assessment. Here, we describe the development of cell lines and assays for this purpose. The transmembrane receptor, FcgammaRIIIa, requires co-expression with signal transducing subunits to prevent its degradation, unlike the homologous receptor FcgammaRIIIb that is expressed as a GPI-anchored molecule. Therefore, to simplify the production of cell lines as reliable assay components, we expressed FcgammaRIIIa as a GPI-anchored molecule. Separate, stable CHO cell lines that express either the 158F or the higher-affinity 158V allotype of FcgammaRIIIa were isolated using fluorescence-activated cell sorting. The identities of the expressed receptors were confirmed using a panel of monoclonal antibodies that distinguish between subclasses and allotypes of FcgammaRIII and the cell lines were shown to have slightly higher levels of receptor than FcgammaRIII-positive peripheral blood mononuclear cells. Because the affinity of FcgammaRIIIa for IgG is intermediate amongst the receptors that bind IgG, we were able to use these cell lines to develop flow cytometric assays to measure the binding of both complexed and monomeric immunoglobulin. Thus, by choosing the appropriate method, weakly- or strongly-binding IgG can be efficiently compared. We have quantified the difference in the binding of wildtype IgG1 and IgG3 molecules to the two functional allotypes of the receptor and report that the FcgammaRIIIa-158V-antibody interaction is 3- to 4-fold stronger that the interaction with FcgammaRIIIa-158F. Overall, these robust assays should be valuable for batch-testing clinical material as well as providing tools for improving the design of therapeutic IgG. 2010 Elsevier B.V. All rights reserved.

SH2-PLA: a sensitive in-solution approach for quantification of modular domain binding by proximity ligation and real-time PCR.

PubMed

Thompson, Christopher M; Bloom, Lee R; Ogiue-Ikeda, Mari; Machida, Kazuya

2015-06-26

There is a great interest in studying phosphotyrosine dependent protein-protein interactions in tyrosine kinase pathways that play a critical role in many aspects of cellular function. We previously established SH2 profiling, a phosphoproteomic approach based on membrane binding assays that utilizes purified Src Homology 2 (SH2) domains as a molecular tool to profile the global tyrosine phosphorylation state of cells. However, in order to use this method to investigate SH2 binding sites on a specific target in cell lysate, additional procedures such as pull-down or immunoprecipitation which consume large amounts of sample are required. We have developed PLA-SH2, an alternative in-solution modular domain binding assay that takes advantage of Proximity Ligation Assay and real-time PCR. The SH2-PLA assay utilizes oligonucleotide-conjugated anti-GST and anti-EGFR antibodies recognizing a GST-SH2 probe and cellular EGFR, respectively. If the GST-SH2 and EGFR are in close proximity as a result of SH2-phosphotyrosine interactions, the two oligonucleotides are brought within a suitable distance for ligation to occur, allowing for efficient complex amplification via real-time PCR. The assay detected signal across at least 3 orders of magnitude of lysate input with a linear range spanning 1-2 orders and a low femtomole limit of detection for EGFR phosphotyrosine. SH2 binding kinetics determined by PLA-SH2 showed good agreement with established far-Western analyses for A431 and Cos1 cells stimulated with EGF at various times and doses. Further, we showed that PLA-SH2 can survey lung cancer tissues using 1 μl lysate without requiring phospho-enrichment. We showed for the first time that interactions between SH2 domain probes and EGFR in cell lysate can be determined in a microliter-scale assay using SH2-PLA. The obvious benefit of this method is that the low sample requirement allows detection of SH2 binding in samples which are difficult to analyze using traditional protein interaction assays. This feature along with short assay runtime makes this method a useful platform for the development of high throughput assays to determine modular domain-ligand interactions which could have wide-ranging applications in both basic and translational cancer research.

Adhesion of MC3T3-E1 cells to bone sialoprotein and bone osteopontin specifically bound to collagen I.

PubMed

Bernards, Matthew T; Qin, Chunlin; Ratner, Buddy D; Jiang, Shaoyi

2008-09-01

Bone sialoprotein (BSP) and bone osteopontin (OPN) are members of the SIBLING (small integrin-binding ligand, N-linked glycoproteins) family of proteins commonly found in mineralized tissues. Previously, OPN was shown to exhibit a preferential orientation for MC3T3-E1 cell adhesion when it was specifically bound to collagen. In this work, the orientation of BSP under similar circumstances is examined and compared with OPN. Radiolabeled adsorption isotherms were obtained for BSP bound to both tissue culture polystyrene (TCPS) and collagen-coated TCPS. The results show that collagen has the capacity to bind almost twice as much OPN under identical conditions. An in vitro MC3T3-E1 cell adhesion assay was then performed to compare the cell binding ability of BSP on either TCPS or collagen-coated TCPS with identical amounts of adsorbed protein. It was found that there is no significant difference in the cell binding ability of BSP on either of the substrates. For cell binding studies on collagen-coated TCPS, it was shown that there are a greater number of cells bound to substrates with adsorbed OPN as compared with BSP. The preferable orientation of OPN for cell binding coupled with the higher binding capability of collagen for OPN indicates that OPN is more important than BSP for osteoblast adhesion to the collagen matrix. In addition, a cell inhibition assay was performed to show that all of the cell binding that occurred throughout these studies was dependent upon integrin interactions with the RGD cell binding moiety.

Adhesion of MC3T3-E1 cells to bone sialoprotein and bone osteopontin specifically bound to collagen I

PubMed Central

Bernards, Matthew T.; Qin, Chunlin; Ratner, Buddy D.; Jiang, Shaoyi

2009-01-01

Bone sialoprotein (BSP) and bone osteopontin (OPN) are members of the SIBLING (small integrin-binding ligand, N-linked glycoproteins) family of proteins commonly found in mineralized tissues. Previously, OPN was shown to exhibit a preferential orientation for MC3T3-E1 cell adhesion when it was specifically bound to collagen. In this work, the orientation of BSP under similar circumstances is examined and compared with OPN. Radiolabeled adsorption isotherms were obtained for BSP bound to both tissue culture polystyrene (TCPS) and collagen-coated TCPS. The results show that collagen has the capacity to bind almost twice as much OPN under identical conditions. An in vitro MC3T3-E1 cell adhesion assay was then performed to compare the cell binding ability of BSP on either TCPS or collagen-coated TCPS with identical amounts of adsorbed protein. It was found that there is no significant difference in the cell binding ability of BSP on either of the substrates. For cell binding studies on collagen-coated TCPS, it was shown that there are a greater number of cells bound to substrates with adsorbed OPN as compared with BSP. The preferable orientation of OPN for cell binding coupled with the higher binding capability of collagen for OPN indicates that OPN is more important than BSP for osteoblast adhesion to the collagen matrix. In addition, a cell inhibition assay was performed to show that all of the cell binding that occurred throughout these studies was dependent upon integrin interactions with the RGD cell binding moiety. PMID:18041732

Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

PubMed

Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

2012-09-01

Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

Detection of receptor-specific murine leukemia virus binding to cells by immunofluorescence analysis.

PubMed Central

Kadan, M J; Sturm, S; Anderson, W F; Eglitis, M A

1992-01-01

Four classes of murine leukemia virus (MuLV) which display distinct cellular tropisms and bind to different retrovirus receptors to initiate virus infection have been described. In the present study, we describe a rapid, sensitive immunofluorescence assay useful for characterizing the initial binding of MuLV to cells. By using the rat monoclonal antibody 83A25 (L. H. Evans, R. P. Morrison, F. G. Malik, J. Portis, and W. J. Britt, J. Virol. 64:6176-6183, 1990), which recognizes an epitope of the envelope gp70 molecule common to the different classes of MuLV, it is possible to analyse the binding of ecotropic, amphotropic, or xenotropic MuLV by using only a single combination of primary and secondary antibodies. The MuLV binding detected by this assay is envelope receptor specific and matches the susceptibility to infection determined for cells from a variety of species. The binding of amphotropic MuLV to NIH 3T3 cells was shown to be rapid, saturable, and temperature dependent. Chinese hamster ovary (CHO-K1) cells normally lack the ability to bind ecotropic virus and are not infectible by ecotropic vectors. Expression of the cloned ecotropic retrovirus receptor gene (Rec) in CHO-K1 cells confers high levels of ecotropic virus-specific binding and confers susceptibility to infection. Characterization of MuLV binding to primary cells may provide insight into the infectibility of cells by retroviruses and aid in the selection of appropriate vectors for gene transfer experiments. PMID:1312632

Lectin binding assays for in-process monitoring of sialylation in protein production.

PubMed

Xu, Weiduan; Chen, Jianmin; Yamasaki, Glenn; Murphy, John E; Mei, Baisong

2010-07-01

Many therapeutic proteins require appropriate glycosylation for their biological activities and plasma half life. Coagulation factor VIII (FVIII) is a glycoprotein which has extensive post-translational modification by N-linked glycosylation. The terminal sialic acid in the N-linked glycans of FVIII is required for maximal circulatory half life. The extent of FVIII sialylation can be determined by high pH anion-exchange chromatography coupled with a pulse electrochemical detector (HPAEC-PED), but this requires a large amount of purified protein. Using FVIII as a model, the objective of the present study was to develop assays that enable detection and prediction of sialylation deficiency at an early stage in the process and thus prevent downstream product quality excursions. Lectin ECA (Erythrina Cristagalli) binds to unsialylated Galbeta1-4 GlcNAc and the ECA-binding level (i.e., terminal Gal(beta1-4) exposure) is inversely proportional to the level of sialylation. By using ECA, a cell-based assay was developed to measure the global sialylation profile in FVIII producing cells. To examine the Galbeta1-4 exposure on the FVIII molecule in bioreactor tissue culture fluid (TCF), an ELISA-based ECA-FVIII binding assay was developed. The ECA-binding specificity in both assays was assessed by ECA-specific sugar inhibitors and neuraminidase digestion. The ECA-binding specificity was also independently confirmed by a ST3GAL4 siRNA knockdown experiment. To establish the correlation between Galbeta1-4 exposure and the HPAEC-PED determined FVIII sialylation value, the FVIII containing bioreactor TCF and the purified FVIII samples were tested with ECA ELISA binding assay. The results indicated an inverse correlation between ECA binding and the corresponding HPAEC-PED sialylation value. The ECA-binding assays are cost effective and can be rapidly performed, thereby making them effective for in-process monitoring of protein sialylation.

Expression, subcellular localization and regulation of sigma receptor in retinal Müller cells

PubMed Central

Jiang, Guoliang; Mysona, Barbara; Dun, Ying; Gnana-Prakasam, Jaya P.; Pabla, Navjotsin; Li, Weiguo; Dong, Zheng; Ganapathy, Vadivel; Smith, Sylvia B.

2013-01-01

Purpose Sigma receptors (σR) are non-opioid, non-phencyclidine binding sites with robust neuroprotective properties. σR1 is expressed in brain oligodendrocytes, but its expression and binding capacity have not been analyzed in retinal glial cells. This study examined the expression, subcellular localization, binding activity and regulation of σR1 in retinal Müller cells. Methods Primary mouse Müller cells (1°MC) were analyzed by RT-PCR, immunoblotting and immunocytochemistry for the expression of σR1 and data were compared to the rat Müller cell line, rMC-1 and rat ganglion cell line, RGC-5. Confocal microscopy was used to determine the subcellular σR1 location in 1°MC. Membranes prepared from these cells were used for binding assays using [3H]-pentazocine (PTZ). The kinetics of binding, the ability of various σR1 ligands to compete with σR1 binding and the effects of nitric oxide (NO) and reactive oxygen species (ROS) donors on binding were examined. Results σR1 is expressed in 1°MC and is localized to the nuclear and endoplasmic reticulum membranes. Binding assays showed that in 1°MCs, rMC-1 and RGC-5 cells, the binding of PTZ was saturable. [3H]-PTZ bound with high affinity in RGC-5 and rMC-1 cells and the binding was similarly robust in 1°MC. Competition studies showed marked inhibition of [3H]-PTZ binding in the presence of σR1-specific ligands. Incubation of cells with NO and ROS donors markedly increased σR1 binding activity. Conclusions Müller cells express σR1 and demonstrate robust σR1 binding activity, which is inhibited by σR1 ligands and is stimulated during oxidative stress. The potential of Müller cells to bind σR1 ligands may prove beneficial in retinal degenerative diseases such as diabetic retinopathy. PMID:17122151

Integrated Model of Chemical Perturbations of a Biological PathwayUsing 18 In Vitro High Throughput Screening Assays for the Estrogen Receptor

EPA Science Inventory

We demonstrate a computational network model that integrates 18 in vitro, high-throughput screening assays measuring estrogen receptor (ER) binding, dimerization, chromatin binding, transcriptional activation and ER-dependent cell proliferation. The network model uses activity pa...

Method for estimating protein binding capacity of polymeric systems.

PubMed

Sharma, Vaibhav; Blackwood, Keith A; Haddow, David; Hook, Lilian; Mason, Chris; Dye, Julian F; García-Gareta, Elena

2015-01-01

Composite biomaterials made from synthetic and protein-based polymers are extensively researched in tissue engineering. To successfully fabricate a protein-polymer composite, it is critical to understand how strongly the protein binds to the synthetic polymer, which occurs through protein adsorption. Currently, there is no cost-effective and simple method for characterizing this interfacial binding. To characterize this interfacial binding, we introduce a simple three-step method that involves: 1) synthetic polymer surface characterisation, 2) a quick, inexpensive and robust novel immuno-based assay that uses protein extraction compounds to characterize protein binding strength followed by 3) an in vitro 2D model of cell culture to confirm the results of the immuno-based assay. Fibrinogen, precursor of fibrin, was adsorbed (test protein) on three different polymeric surfaces: silicone, poly(acrylic acid)-coated silicone and poly(allylamine)-coated silicone. Polystyrene surface was used as a reference. Characterisation of the different surfaces revealed different chemistry and roughness. The novel immuno-based assay showed significantly stronger binding of fibrinogen to both poly(acrylic acid) and poly(allylamine) coated silicone. Finally, cell studies showed that the strength of the interaction between the protein and the polymer had an effect on cell growth. This novel immuno-based assay is a valuable tool in developing composite biomaterials of synthetic and protein-based polymers with the potential to be applied in other fields of research where protein adsorption onto surfaces plays an important role.

Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone

PubMed Central

Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna

2016-01-01

The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023

Binding of environmental carcinogens to asbestos and mineral fibres.

PubMed Central

Harvey, G; Pagé, M; Dumas, L

1984-01-01

A rapid method has been developed for measuring the binding capacity of asbestos and other mineral fibres for environmental carcinogens. Benzo(alpha)pyrene (B(alpha)P), nitrosonornicotine (NNN), and N-acetyl-2-aminofluorene (NAAF) were assayed in the presence of Canadian grade 4T30 chrysotile, chrysotile A, amosite, crocidolite, glass microfibres, glasswool, attapulgite, and titanium dioxide. Chrysotile binds significantly more carcinogens than the other mineral fibres. This binding assay is reproducible with coefficients of variation of less than 8% and 6% respectively for inter and intra assay. The influence of pH was also studied, and there is good correlation between the carcinogen binding and the charge of the tested mineral fibres. The in vitro cytotoxicity on macrophage like cell line P388D1 and the haemolytic activity of various mineral fibres were also measured; a good correlation was found between the binding capacity and the cytotoxicity of tested mineral fibres on P388D1 cells. These results give some explanations for the reported synergism between exposure to asbestos and the smoking habits of workers. PMID:6331497

Development of an enzyme-linked immunosorbent assay and a beta-1 adrenergic receptor-based assay for monitoring the drug atenolol.

PubMed

Sapir, A; Shalev, A Hariton; Skalka, N; Bronshtein, A; Altstein, M

2013-03-01

Two approaches for monitoring atenolol (ATL) were applied: an immunochemical assay and a competitive-binding assay, based on the interaction between ATL and its target receptor, β1 adrenergic receptor (β1AR). Polyclonal antibodies (Abs) for ATL were generated, and a highly specific microplate immunochemical assay, that is, an enzyme-linked immunosorbent assay (ELISA), for its detection was developed. The ATL ELISA exhibited I50 and limit of detection (I20) values of 0.15 ± 0.048 and 0.032 ± 0.016 ng/ml, respectively, and the Abs did not cross-react with any of the tested beta-blocker drugs. Furthermore, a human β1AR (h-β1AR) was stably expressed in Spodoptera frugiperda cells (Sf9). The receptor was employed to develop a competitive-binding assay that monitored binding of ATL in the presence of isoproteranol by quantification of secondary messenger, cyclic adenosine monophosphate (cAMP), levels in the transfected cells. The assay showed that the recombinant h-β1AR was functional, could bind the agonistic ligand isoproterenol as well as the antagonist ATL, as indicated by a dose-dependent elevation of cAMP in the presence of isoproteranol, and decrease after ATL addition. The highly efficient and sensitive ELISA and the receptor assay represent two methods suitable for efficient and cost-effective large-scale, high-throughput monitoring of ATL in environmental, agricultural, and biological samples. Copyright © 2012 SETAC.

Expression, subcellular localization, and regulation of sigma receptor in retinal muller cells.

PubMed

Jiang, Guoliang; Mysona, Barbara; Dun, Ying; Gnana-Prakasam, Jaya P; Pabla, Navjotsin; Li, Weiguo; Dong, Zheng; Ganapathy, Vadivel; Smith, Sylvia B

2006-12-01

Sigma receptors (sigmaRs) are nonopioid, nonphencyclidine binding sites with robust neuroprotective properties. Type 1 sigmaR1 (sigmaR1) is expressed in brain oligodendrocytes, but its expression and binding capacity have not been analyzed in retinal glial cells. This study examined the expression, subcellular localization, binding activity, and regulation of sigmaR1 in retinal Müller cells. Primary mouse Müller cells (MCs) were analyzed by RT-PCR, immunoblotting, and immunocytochemistry for the expression of sigmaR1, and data were compared with those of the rat Müller cell line (rMC-1) and the rat ganglion cell line (RGC-5). Confocal microscopy was used to determine the subcellular sigmaR1 location in primary mouse MCs. Membranes prepared from these cells were used for binding assays with [3H]-pentazocine (PTZ). The kinetics of binding, the ability of various sigmaR1 ligands to compete with sigmaR1 binding, and the effects of donated nitric oxide (NO) and reactive oxygen species (ROS) on binding were examined. sigmaR1 is expressed in primary mouse MCs and is localized to the nuclear and endoplasmic reticulum membranes. Binding assays showed that in primary mouse MCs, rMC-1, and RGC-5, the binding of PTZ was saturable. [3H]-PTZ bound with high affinity in RGC-5 and rMC-1 cells, and the binding was similarly robust in primary mouse MCs. Competition studies showed marked inhibition of [3H]-PTZ binding in the presence of sigmaR1-specific ligands. Incubation of cells with NO and ROS donors markedly increased sigmaR1 binding activity. MCs express sigmaR1 and demonstrate robust sigmaR1 binding activity, which is inhibited by sigmaR1 ligands and is stimulated during oxidative stress. The potential of Müller cells to bind sigmaR1 ligands may prove beneficial in retinal degenerative diseases such as diabetic retinopathy.

Live Cell Imaging Confocal Microscopy Analysis of HBV Myr-PreS1 Peptide Binding and Uptake in NTCP-GFP Expressing HepG2 Cells.

PubMed

König, Alexander; Glebe, Dieter

2017-01-01

To obtain basic knowledge about specific molecular mechanisms involved in the entry of pathogens into cells is the basis for establishing pharmacologic substances blocking initial viral binding, infection, and subsequent viral spread. Lack of information about key cellular factors involved in the initial steps of HBV infection has hampered the characterization of HBV binding and entry for decades. However, recently, the liver-specific sodium-dependent taurocholate cotransporting polypeptide (NTCP) has been discovered as a functional receptor for HBV and HDV, thus opening the field for new concepts of basic binding and entry of HBV and HDV. Here, we describe practical issues of a basic in vitro assay system to examine kinetics and mechanisms of receptor-dependent HBV binding, uptake, and intracellular trafficking by live-cell imaging confocal microscopy. The assay system is comprised of HepG2 cells expressing a NTCP-GFP fusion-protein and chemically synthesized, fluorophore-labeled part of HBV surface protein, spanning the first N-terminal 48 amino acids of preS1 of the large hepatitis B virus surface protein.

Basal cell adhesion molecule/lutheran protein. The receptor critical for sickle cell adhesion to laminin.

PubMed Central

Udani, M; Zen, Q; Cottman, M; Leonard, N; Jefferson, S; Daymont, C; Truskey, G; Telen, M J

1998-01-01

Sickle red cells bind significant amounts of soluble laminin, whereas normal red cells do not. Solid phase assays demonstrate that B-CAM/LU binds laminin on intact sickle red cells and that red cell B-CAM/LU binds immobilized laminin, whereas another putative laminin binding protein, CD44, does not. Ligand blots also identify B-CAM/LU as the only erythrocyte membrane protein(s) that binds laminin. Finally, transfection of murine erythroleukemia cells with human B-CAM cDNA induces binding of both soluble and immobilized laminin. Thus, B-CAM/LU appears to be the major laminin-binding protein of sickle red cells. Previously reported overexpression of B-CAM/LU by epithelial cancer cells suggests that this protein may also serve as a laminin receptor in malignant tumors. PMID:9616226

Analysis of surface properties of fixed and live cells using derivatized agarose beads.

PubMed

Navarro, Vanessa M; Walker, Sherri L; Badali, Oliver; Abundis, Maria I; Ngo, Lylla L; Weerasinghe, Gayani; Barajas, Marcela; Zem, Gregory; Oppenheimer, Steven B

2002-01-01

A novel assay has been developed for the histochemical characterization of surface properties of cells based on their adhesion to agarose beads derivatized with more than 100 types of molecules, including sugars, lectins and other proteins, and amino acids. The assay simply involves mixing small quantities of washed cells and beads in droplets on glass microscope slides and determining to which beads various cell types adhere. Distilled water was found to be the best medium for this assay because added ions or molecules in other media inhibit adhesion in some cases. Many cells, however, cannot tolerate distilled water. Here we show that cells fixed with either of two fixatives (1% formaldehyde or Prefer fixative) displayed similar bead-binding properties as did live cells. Specificity of cell-bead binding was tested by including specific free molecules in the test suspensions in hapten-type inhibition experiments. If a hapten compound inhibited live-cell adhesion to a specific bead, it also inhibited fixed-cell adhesion to a specific bead. The results of these experiments suggest that fixed cells display authentic surface properties, opening the door for the use of this assay with many cell types that cannot tolerate distilled water.

Label-Free, LC-MS-Based Assays to Quantitate Small-Molecule Antagonist Binding to the Mammalian BLT1 Receptor.

PubMed

Chen, Xun; Stout, Steven; Mueller, Uwe; Boykow, George; Visconti, Richard; Siliphaivanh, Phieng; Spencer, Kerrie; Presland, Jeremy; Kavana, Michael; Basso, Andrea D; McLaren, David G; Myers, Robert W

2017-08-01

We have developed and validated label-free, liquid chromatography-mass spectrometry (LC-MS)-based equilibrium direct and competition binding assays to quantitate small-molecule antagonist binding to recombinant human and mouse BLT1 receptors expressed in HEK 293 cell membranes. Procedurally, these binding assays involve (1) equilibration of the BLT1 receptor and probe ligand, with or without a competitor; (2) vacuum filtration through cationic glass fiber filters to separate receptor-bound from free probe ligand; and (3) LC-MS analysis in selected reaction monitoring mode for bound probe ligand quantitation. Two novel, optimized probe ligands, compounds 1 and 2, were identified by screening 20 unlabeled BLT1 antagonists for direct binding. Saturation direct binding studies confirmed the high affinity, and dissociation studies established the rapid binding kinetics of probe ligands 1 and 2. Competition binding assays were established using both probe ligands, and the affinities of structurally diverse BLT1 antagonists were measured. Both binding assay formats can be executed with high specificity and sensitivity and moderate throughput (96-well plate format) using these approaches. This highly versatile, label-free method for studying ligand binding to membrane-associated receptors should find broad application as an alternative to traditional methods using labeled ligands.

In vitro toxicity testing with microplate cell cultures: Impact of cell binding.

PubMed

Gülden, Michael; Schreiner, Jeannine; Seibert, Hasso

2015-06-05

In vitro generated data on toxic potencies are generally based on nominal concentrations. However, cellular and extracellular binding and elimination processes may reduce the available free fraction of a compound. Then, nominal effective concentrations do not represent appropriate measures of toxic exposure in vitro and underestimate toxic potencies. In this study it was investigated whether cell binding can affect the availability of chemicals in microplate based toxicity assays. To this end the cytotoxicity of compounds like mercury chloride, digitonin and alcohol ethoxylates, accumulated by cells via different modes, was investigated in 96-well microplate cultures with varying concentrations of Balb/c 3T3 cells. The median effective nominal concentrations of all but one of the tested compounds depended linearly from the cell concentration. Applying a previously developed equilibrium distribution model cell concentration-independent median effective extracellular concentrations and cell burdens, respectively, could be calculated. The compounds were accumulated by the cells with bioconcentration factors, BCF, between 480 and ≥ 25,000. Cell binding of the alcohol ethoxylates was correlated with their lipophilicity. The results show that significant cell binding can occur even at the small cell volume fractions (∼ 1 × 10(-5) to 3 × 10(-3) L/L) encountered in microplate assays. To what extent cell binding affects the bioavailability depends on the BCF and the cell volume fraction. EC50 measurements in the presence of at least two different cell concentrations allow for excluding or detecting significant cell binding and for determining more appropriate measures of toxic exposure in vitro like median effective extracellular (free) concentrations or cell burdens. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Characterization of the high affinity binding of epsilon toxin from Clostridium perfringens to the renal system.

PubMed

Dorca-Arévalo, Jonatan; Martín-Satué, Mireia; Blasi, Juan

2012-05-25

Epsilon toxin (ε-toxin), produced by Clostridium perfringens types B and D, causes fatal enterotoxaemia in livestock. In the renal system, the toxin binds to target cells before oligomerization, pore formation and cell death. Still, there is little information about the cellular and molecular mechanism involved in the initial steps of the cytotoxic action of ε-toxin, including the specific binding to the target sensitive cells. In the present report, the binding step of ε-toxin to the MDCK cell line is characterized by means of an ELISA-based binding assay with recombinant ε-toxin-green fluorescence protein (ε-toxin-GFP) and ε-prototoxin-GFP. In addition, different treatments with Pronase E, detergents, N-glycosidase F and beta-elimination on MDCK cells and renal cryosections have been performed to further characterize the ε-toxin binding. The ELISA assays revealed a single binding site with a similar dissociation constant (K(d)) for ε-toxin-GFP and ε-prototoxin-GFP, but a three-fold increase in B(max) levels in the case of ε-toxin-GFP. Double staining on kidney cryoslices with lectins and ε-prototoxin-GFP revealed specific binding to distal and collecting tubule cells. In addition, experiments on kidney and bladder cryoslices demonstrated the specific binding to distal tubule of a range of mammalian renal systems. Pronase E and beta-elimination treatments on kidney cryoslices and MDCK cells revealed that the binding of ε-toxin in renal system is mediated by a O-glycoprotein. Detergent treatments revealed that the integrity of the plasma membrane is required for the binding of ε-toxin to its receptor. Copyright © 2011 Elsevier B.V. All rights reserved.

Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

PubMed Central

2015-01-01

The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

A simple method for determining polymeric IgA-containing immune complexes.

PubMed

Sancho, J; Egido, J; González, E

1983-06-10

A simplified assay to measure polymeric IgA-immune complexes in biological fluids is described. The assay is based upon the specific binding of a secretory component for polymeric IgA. In the first step, multimeric IgA (monomeric and polymeric) immune complexes are determined by the standard Raji cell assay. Secondly, labeled secretory component added to the assay is bound to polymeric IgA-immune complexes previously fixed to Raji cells, but not to monomeric IgA immune complexes. To avoid false positives due to possible complement-fixing IgM immune complexes, prior IgM immunoadsorption is performed. Using anti-IgM antiserum coupled to CNBr-activated Sepharose 4B this step is not time-consuming. Polymeric IgA has a low affinity constant and binds weakly to Raji cells, as Scatchard analysis of the data shows. Thus, polymeric IgA immune complexes do not bind to Raji cells directly through Fc receptors, but through complement breakdown products, as with IgG-immune complexes. Using this method, we have been successful in detecting specific polymeric-IgA immune complexes in patients with IgA nephropathy (Berger's disease) and alcoholic liver disease, as well as in normal subjects after meals of high protein content. This new, simple, rapid and reproducible assay might help to study the physiopathological role of polymeric IgA immune complexes in humans and animals.

Synthesis, DNA binding, topoisomerase inhibition and cytotoxic properties of 2-chloroethylnitrosourea derivatives of hoechst 33258.

PubMed

Bielawski, Krzysztof; Bielawska, Anna; Anchim, Tomasz; Wołczyński, Sławomir

2005-06-01

A number of novel 2-chloroethylnitrosourea derivatives of Hoechst 33258 were synthesized and examined for cytotoxicity in breast cancer cell cultures and for inhibition of topoisomerases I and II. Evaluation of the cytotoxicity of these compounds employing a MTT assay and inhibition of [3H]thymidine incorporation into DNA in both MDA-MB-231 and MCF-7 breast cancer cells demonstrated that these compounds were more active than Hoechst 33258. The DNA-binding ability of these compounds was evaluated by an ultrafiltration method using calf thymus DNA, poly(dA-dT)2 and poly(dG-dC)2, indicated that these compounds as well as Hoechst 33258 well interact with AT base pair compared with GC pair. Binding studies indicate that these compounds bind more tightly to double-stranded DNA than the parent compound Hoechst 33258. The degree to which these compounds inhibited cell growth breast cancer cells was generally consistent with their relative DNA binding affinity. Mechanistic studies revealed that these compounds act as topoisomerase I (topo I) or topoisomerase II (topo II) inhibitors in plasmid relaxation assays.

Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

PubMed

Barnert, R H; Zeichhardt, H; Habermehl, K O

1992-02-01

Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

HLA Class I Binding 9mer Peptides from Influenza A Virus Induce CD4+ T Cell Responses

PubMed Central

Wang, Mingjun; Larsen, Mette V.; Nielsen, Morten; Harndahl, Mikkel; Justesen, Sune; Dziegiel, Morten H.; Buus, Søren; Tang, Sheila T.; Lund, Ole; Claesson, Mogens H.

2010-01-01

Background Identification of human leukocyte antigen class I (HLA-I) restricted cytotoxic T cell (CTL) epitopes from influenza virus is of importance for the development of new effective peptide-based vaccines. Methodology/Principal Findings In the present work, bioinformatics was used to predict 9mer peptides derived from available influenza A viral proteins with binding affinity for at least one of the 12 HLA-I supertypes. The predicted peptides were then selected in a way that ensured maximal coverage of the available influenza A strains. One hundred and thirty one peptides were synthesized and their binding affinities for the HLA-I supertypes were measured in a biochemical assay. Influenza-specific T cell responses towards the peptides were quantified using IFNγ ELISPOT assays with peripheral blood mononuclear cells (PBMC) from adult healthy HLA-I typed donors as responder cells. Of the 131 peptides, 21 were found to induce T cell responses in 19 donors. In the ELISPOT assay, five peptides induced responses that could be totally blocked by the pan-specific anti-HLA-I antibody W6/32, whereas 15 peptides induced responses that could be completely blocked in the presence of the pan-specific anti-HLA class II (HLA-II) antibody IVA12. Blocking of HLA-II subtype reactivity revealed that 8 and 6 peptide responses were blocked by anti-HLA-DR and -DP antibodies, respectively. Peptide reactivity of PBMC depleted of CD4+ or CD8+ T cells prior to the ELISPOT culture revealed that effectors are either CD4+ (the majority of reactivities) or CD8+ T cells, never a mixture of these subsets. Three of the peptides, recognized by CD4+ T cells showed binding to recombinant DRA1*0101/DRB1*0401 or DRA1*0101/DRB5*0101 molecules in a recently developed biochemical assay. Conclusions/Significance HLA-I binding 9mer influenza virus-derived peptides induce in many cases CD4+ T cell responses restricted by HLA-II molecules. PMID:20479886

Antiviral and Anticancer Optimization Studies of the DNA-binding Marine Natural Product Aaptamine

PubMed Central

Bowling, John J.; Pennaka, Hari K.; Ivey, Kelly; Wahyuono, Subagus; Kelly, Michelle; Schinazi, Raymond F.; Valeriote, Frederick A.; Graves, David E.; Hamann, Mark T.

2016-01-01

Aaptamine has potent cytotoxicity that may be explained by its ability to intercalate DNA. Aaptamine was evaluated for its ability to bind to DNA to validate DNA binding as the primary mechanism of cytotoxicity. Based on UV–vis absorbance titration data, the Kobs for aaptamine was 4.0 (±0.2) × 103 which was essentially equivalent to the known DNA intercalator N-[2-(diethylamino)ethyl]-9-aminoacridine-4-carboxamide. Semi-synthetic core modifications were performed to improve the general structural diversity of known aaptamine analogs and vary its absorption characteristics. Overall, 26 aaptamine derivatives were synthesized which consisted of a simple homologous range of mono and di-N-alkylations as well as some 9-O-sulfonylation and bis-O-isoaaptamine dimer products. Each product was evaluated for activity in a variety of whole cell and viral assays including a unique solid tumor disk diffusion assay. Details of aaptamine's DNA-binding activity and its derivatives’ whole cell and viral assay results are discussed. PMID:18251774

Binding of /sup 18/F by cell membranes and cell walls of Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yotis, W.W.; Zeb, M.; McNulty, J.

1983-07-01

The binding of /sup 18/F to isolated cell membranes and cell walls of Streptococcus mutans GS-5 or other bacteria was assayed. The attachment of /sup 18/F to these cell envelopes proceeded slowly and reached equilibrium within 60 min. /sup 18/F binding was stimulated by Ca/sup 2 +/ (1 mM). The binding of /sup 18/F to cellular components was dependent upon the pH, as well as the amount of /sup 18/F and dose of the binder employed. The binding of /sup 18/F by cell walls prepared from fluoride-sensitive and fluoride-resistant cells of S. salivarius and S. mutans did not differ significantly.more » The pretreatment of cell walls or cell membranes for 60 min at 30 degrees C with 1 mg of RNase, DNase, or trypsin per ml did not influence the binding of /sup 18/F by the walls and membranes of S. mutans GS-5. However, prior exposure of cell membranes to sodium dodecyl sulfate caused a significant reduction in the number of /sup 18/F atoms bound by the membranes. In saturated assay systems, cell membranes of S. mutans GS-5 bound 10(15) to 10(16) atoms of /sup 18/F per mg (dry weight), whereas cell walls from S. mutans GS-5, FA-1, and HS-6 or Actinomyces viscosus T14V and T14AV bound 10(12) to 10(13) atoms of /sup 18/F per mg (dry weight). /sup 18/F in this quantity (10(12) to 10(13) atoms) cannot be detected with the fluoride electrode. The data provide, for the first time, a demonstration of /sup 18/F binding by cell membranes and walls of oral flora.« less

Influence of differentiation on muscarinic receptors in N1E 115 neuroblastoma cells.

PubMed

Buyse, M A; Lefebvre, R A; Fraeyman, N H

1989-01-01

The effect of inducing morphological differentiation in N1E 115 mouse neuroblastoma cells on the number of muscarinic receptors and the ligand binding affinity was investigated using the lipophylic quinuclidinyl benzylate and the hydrophylic N-methylscopolamine as tritiated ligands. Induction of morphological differentiation was accompanied by a two- to three-fold increase of the number of receptors when assayed in a broken cell preparation; the ligand binding affinity was unaffected by differentiation. Using intact cells, this increase was not paralleled by a similar increase in binding sites accessible for N-methylscopolamine, which binds preferentially to extracellular sites.

RNA Whole-Mount In situ Hybridisation Proximity Ligation Assay (rISH-PLA), an Assay for Detecting RNA-Protein Complexes in Intact Cells.

PubMed

Roussis, Ioannis M; Guille, Matthew; Myers, Fiona A; Scarlett, Garry P

2016-01-01

Techniques for studying RNA-protein interactions have lagged behind those for DNA-protein complexes as a consequence of the complexities associated with working with RNA. Here we present a method for the modification of the existing In Situ Hybridisation-Proximity Ligation Assay (ISH-PLA) protocol to adapt it to the study of RNA regulation (rISH-PLA). As proof of principle we used the well-characterised interaction of the Xenopus laevis Staufen RNA binding protein with Vg1 mRNA, the complex of which co-localises to the vegetal pole of Xenopus oocytes. The applicability of both the Stau1 antibody and the Locked Nucleic Acid probe (LNA) recognising Vg1 mRNA were independently validated by whole-mount Immunohistochemistry and whole-mount in situ hybridisation assays respectively prior to combining them in the rISH-PLA assay. The rISH-PLA assay allows the identification of a given RNA-protein complex at subcellular and single cell resolution, thus avoiding the lack of spatial resolution and sensitivity associated with assaying heterogenous cell populations from which conventional RNA-protein interaction detection techniques suffer. This technique will be particularly usefully for studying the activity of RNA binding proteins (RBPs) in complex mixtures of cells, for example tissue sections or whole embryos.

Hemolytic activity in Flavobacterium psychrophilum is a contact-dependent, two-step mechanism and differently expressed in smooth and rough phenotypes.

PubMed

Högfors-Rönnholm, Eva; Wiklund, Tom

2010-12-01

The hemolytic activity of cells of smooth and rough phenotypic variants of the Gram-negative fish pathogen Flavobacterium psychrophilum was investigated in two different assays, a microplate and an agarose hemolysis assay, using rainbow trout erythrocytes. The smooth cells showed a high and the rough cells a negligible, concentration dependent, hemolytic activity in the microplate assay. Both smooth and rough cells showed a rather weak hemolytic activity, with two distinct hemolytic patterns, in the agarose assay. The hemolytic activity of the cells was not regulated by iron availability and cell-free extracellular products did not show any hemolytic activity. The smooth cells, in contrast to the rough cells, showed a high ability to agglutinate erythrocytes and both hemagglutination and hemolytic activity was impaired by treatment of the cells with sialic acid. The hemolytic activity was furthermore reduced after proteolytic and heat treatment of the cells. The results from the present study suggest that the hemolytic activity in F. psychrophilum is highly expressed in the smooth phenotype, and that it is a contact-dependent and two-step mechanism that is initiated by the binding of the bacterial cells to the erythrocytes through sialic acid-binding lectins and then executed by thermolabile proteinaceous hemolysins. Copyright © 2010 Elsevier Ltd. All rights reserved.

Generation of cell lines for drug discovery through random activation of gene expression: application to the human histamine H3 receptor.

PubMed

Song, J; Doucette, C; Hanniford, D; Hunady, K; Wang, N; Sherf, B; Harrington, J J; Brunden, K R; Stricker-Krongrad, A

2005-06-01

Target-based high-throughput screening (HTS) plays an integral role in drug discovery. The implementation of HTS assays generally requires high expression levels of the target protein, and this is typically accomplished using recombinant cDNA methodologies. However, the isolated gene sequences to many drug targets have intellectual property claims that restrict the ability to implement drug discovery programs. The present study describes the pharmacological characterization of the human histamine H3 receptor that was expressed using random activation of gene expression (RAGE), a technology that over-expresses proteins by up-regulating endogenous genes rather than introducing cDNA expression vectors into the cell. Saturation binding analysis using [125I]iodoproxyfan and RAGE-H3 membranes revealed a single class of binding sites with a K(D) value of 0.77 nM and a B(max) equal to 756 fmol/mg of protein. Competition binding studies showed that the rank order of potency for H3 agonists was N(alpha)-methylhistamine approximately (R)-alpha- methylhistamine > histamine and that the rank order of potency for H3 antagonists was clobenpropit > iodophenpropit > thioperamide. The same rank order of potency for H3 agonists and antagonists was observed in the functional assays as in the binding assays. The Fluorometic Imaging Plate Reader assays in RAGE-H3 cells gave high Z' values for agonist and antagonist screening, respectively. These results reveal that the human H3 receptor expressed with the RAGE technology is pharmacologically comparable to that expressed through recombinant methods. Moreover, the level of expression of the H3 receptor in the RAGE-H3 cells is suitable for HTS and secondary assays.

Optimization of Time-Resolved Fluorescence Assay for Detection of Eu-DOTA-labeled Ligand-Receptor Interactions

PubMed Central

De Silva, Channa R.; Vagner, Josef; Lynch, Ronald; Gillies, Robert J.; Hruby, Victor J.

2010-01-01

Lanthanide-based luminescent ligand binding assays are superior to traditional radiolabel assays due to improved sensitivity and affordability in high throughput screening while eliminating the use of radioactivity. Despite significant progress using lanthanide(III)-coordinated chelators such as DTPA derivatives, dissociation-enhanced lanthanide fluoroimmunoassays (DELFIA) have not yet been successfully used with more stable chelators, e.g. DOTA derivatives, due to the incomplete release of lanthanide(III) ions from the complex. Here, a modified and an optimized DELFIA procedure incorporating an acid treatment protocol is introduced for use with Eu(III)-DOTA labeled peptides. Complete release of Eu(III) ions from DOTA labeled ligands was observed using hydrochloric acid (2.0 M) prior to the luminescent enhancement step. NDP-α-MSH labeled with Eu(III)-DOTA was synthesized and the binding affinity to cells overexpressing the human melanocortin-4 receptors (hMC4R) was evaluated using the modified protocol. Binding data indicate that the Eu(III)-DOTA linked peptide bound to these cells with an affinity similar to its DTPA analogue. The modified DELFIA procedure was further used to monitor the binding of an Eu(III)-DOTA labeled heterobivalent peptide to the cells expressing both hMC4R and CCK-2 (Cholecystokinin) receptors. The modified assay provides superior results and is appropriate for high-throughput screening of ligand libraries. PMID:19852924

A Chrysin Derivative Suppresses Skin Cancer Growth by Inhibiting Cyclin-dependent Kinases*

PubMed Central

Liu, Haidan; Liu, Kangdong; Huang, Zunnan; Park, Chan-Mi; Thimmegowda, N. R.; Jang, Jae-Hyuk; Ryoo, In-Ja; He, Long; Kim, Sun-Ok; Oi, Naomi; Lee, Ki Won; Soung, Nak-Kyun; Bode, Ann M.; Yang, Yifeng; Zhou, Xinmin; Erikson, Raymond L.; Ahn, Jong-Seog; Hwang, Joonsung; Kim, Kyoon Eon; Dong, Zigang; Kim, Bo-Yeon

2013-01-01

Chrysin (5,7-dihydroxyflavone), a natural flavonoid widely distributed in plants, reportedly has chemopreventive properties against various cancers. However, the anticancer activity of chrysin observed in in vivo studies has been disappointing. Here, we report that a chrysin derivative, referred to as compound 69407, more strongly inhibited EGF-induced neoplastic transformation of JB6 P+ cells compared with chrysin. It attenuated cell cycle progression of EGF-stimulated cells at the G1 phase and inhibited the G1/S transition. It caused loss of retinoblastoma phosphorylation at both Ser-795 and Ser-807/811, the preferred sites phosphorylated by Cdk4/6 and Cdk2, respectively. It also suppressed anchorage-dependent and -independent growth of A431 human epidermoid carcinoma cells. Compound 69407 reduced tumor growth in the A431 mouse xenograft model and retinoblastoma phosphorylation at Ser-795 and Ser-807/811. Immunoprecipitation kinase assay results showed that compound 69407 attenuated endogenous Cdk4 and Cdk2 kinase activities in EGF-stimulated JB6 P+ cells. Pulldown and in vitro kinase assay results indicated that compound 69407 directly binds with Cdk2 and Cdk4 in an ATP-independent manner and inhibited their kinase activities. A binding model between compound 69407 and a crystal structure of Cdk2 predicted that compound 69407 was located inside the Cdk2 allosteric binding site. The binding was further verified by a point mutation binding assay. Overall results indicated that compound 69407 is an ATP-noncompetitive cyclin-dependent kinase inhibitor with anti-tumor effects, which acts by binding inside the Cdk2 allosteric pocket. This study provides new insights for creating a general pharmacophore model to design and develop novel ATP-noncompetitive agents with chemopreventive or chemotherapeutic potency. PMID:23888052

Homogeneous bioluminescence competitive binding assay for folate based on a coupled glucose-6-phosphate dehydrogenase--bacterial luciferase enzyme system.

PubMed

Huang, W; Feltus, A; Witkowski, A; Daunert, S

1996-05-01

A homogeneous bioluminescence competitive binding assay for folate was developed by using a coupled enzyme system of glucose-6-phosphate dehydrogenase (G6PDH) and bacterial luciferase. A highly substituted G6PDH-folate conjugate was prepared by employing an N-hydroxysuccinimide/carbodiimide method. Folate binding protein inhibits the activity of the conjugate. In the presence of folate, there is a competition between folate and the G6PDH-folate conjugate for the binding site of the folate binding protein, and the activity of the conjugate is recovered. Thus, the concentration of folate can be related to the activity of the G6PDH-folate conjugate, which is directly related to the bioluminescence produced by the coupled enzyme reaction. Using this assay, dose-response curves with a detection limit of 2.5 x 10(-8) M folate were obtained, which is an improvement of an order of magnitude with respect to an assay that monitors G6PDH activity spectrophotometrically. The assay was validated using vitamin tablets and a cell culture medium.

In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.

PubMed

Machida, Kazuya

2017-01-01

Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.

DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuzuhara, T.; Suganuma, M.; Oka, K.

2007-11-03

Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

Renilla luciferase-labeled Annexin V: a new probe for detection of apoptotic cells.

PubMed

Nazari, Mahboobeh; Emamzadeh, Rahman; Hosseinkhani, Saman; Cevenini, Luca; Michelini, Elisa; Roda, Aldo

2012-11-07

The Ca(2+)-dependent binding of Annexin V to phosphatidylserine on cell surfaces is a reliable marker for apoptosis that is widely used in flow cytometry based apoptosis assays. In this paper, we report a new class of Annexin V-based probes for apoptosis. Luciferase from Renilla reniformis (RLuc) was linked to Annexin V and expressed successfully in a soluble form in Escherichia coli BL21 (DE3). The new probe, Rluc/Annexin V, was purified and functionally assayed for detection of apoptosis in actinomycin D-induced apoptotic Jurkat cells. Moreover, the spontaneous apoptosis in neutrophils was shown using the new probe. The results indicate that Rluc/Annexin V can bind to the apoptotic cells, and the signal of Renilla luciferase can be detected by luminometric measurements. The availability of Rluc/Annexin V may be of potential commercial interest for improving current apoptosis assays.

Homogeneous time-resolved G protein-coupled receptor-ligand binding assay based on fluorescence cross-correlation spectroscopy.

PubMed

Antoine, Thomas; Ott, David; Ebell, Katharina; Hansen, Kerrin; Henry, Luc; Becker, Frank; Hannus, Stefan

2016-06-01

G protein-coupled receptors (GPCRs) mediate many important physiological functions and are considered as one of the most successful therapeutic target classes for a wide spectrum of diseases. Drug discovery projects generally benefit from a broad range of experimental approaches for screening compound libraries and for the characterization of binding modes of drug candidates. Owing to the difficulties in solubilizing and purifying GPCRs, assay formats have been so far mainly limited to cell-based functional assays and radioligand binding assays. In this study, we used fluorescence cross-correlation spectroscopy (FCCS) to analyze the interaction of detergent-solubilized receptors to various types of GPCR ligands: endogenous peptides, small molecules, and a large surrogate antagonist represented by a blocking monoclonal antibody. Our work demonstrates the suitability of the homogeneous and time-resolved FCCS assay format for a robust, high-throughput determination of receptor-ligand binding affinities and kinetic rate constants for various therapeutically relevant GPCRs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Adherence of oral streptococci: evidence for nonspecific adsorption to saliva-coated hydroxylapatite surfaces.

PubMed Central

Staat, R H; Peyton, J C

1984-01-01

It is proposed that binding of oral streptococci to saliva-coated hydroxylapatite (SHA) surfaces is a multifactorial process involving both specific and nonspecific receptors. In this context, specific binding is described as a high-affinity, saturable interaction between the cell and binding surface. Conversely, nonspecific binding is considered to be a nonsaturable, generalized, low-affinity reaction. Experimental differentiation of specific binding from nonspecific binding was achieved with a competition assay which utilized a large excess of nonradiolabeled bacteria to compete with the 3H-labeled cells for attachment to receptors on 1.5 mg of SHA crystals. Competition assays of Streptococcus sanguis and Streptococcus mitis adhesion clearly demonstrated that the total binding isotherm was composed of a saturable specific binding reaction and a minor nonspecific binding component. This was further substantiated by analysis of nonlinear Scatchard plots of the total binding data. The competition data for Streptococcus mutans binding indicated that ca. 50% of the S. mutans binding appeared to be specific, although saturation of the SHA surfaces with bacterial cells could not be demonstrated. Experiments measuring desorption of radiolabeled cells from SHA crystals into buffer showed that ca. 50% of the bound S. mutans cells were removed after 4 h, whereas less than 5% of the S. sanguis cells were eluted from the SHA surfaces. The kinetics of attachment were studied by using an extract of Persea americana as a noncompetitive inhibitor of adherence. The total cell binding data for these experiments suggested a very rapid binding reaction followed by a slower rate of attachment. It was concluded from these three different experimental approaches that adherence of selected oral streptococci to SHA surfaces involves specific, high-affinity and nonspecific, low-affinity binding reactions. The concept is developed that in vitro streptococcal attachment to SHA can be described as a two-reaction process in which the low-affinity interaction of the cell with the SHA surface precedes the establishment of the stronger, specific bonds needed for the maintenance of streptococci in the oral cavity. PMID:6327530

Removal of either N-glycan site from the envelope receptor binding domain of Moloney and Friend but not AKV mouse ecotropic gammaretroviruses alters receptor usage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knoper, Ryan C.; Ferrarone, John; Yan Yuhe

2009-09-01

Three N-linked glycosylation sites were removed from the envelope glycoproteins of Friend, Moloney, and AKV mouse ecotropic gammaretroviruses: gs1 and gs2, in the receptor binding domain; and gs8, in a region implicated in post-binding cell fusion. Mutants were tested for their ability to infect rodent cells expressing 4 CAT-1 receptor variants. Three mutants (Mo-gs1, Mo-gs2, and Fr-gs1) infect NIH 3T3 and rat XC cells, but are severely restricted in Mus dunni cells and Lec8, a Chinese hamster cell line susceptible to ecotropic virus. This restriction is reproduced in ferret cells expressing M. dunni dCAT-1, but not in cells expressing NIHmore » 3T3 mCAT-1. Virus binding assays, pseudotype assays, and the use of glycosylation inhibitors further suggest that restriction is primarily due to receptor polymorphism and, in M. dunni cells, to glycosylation of cellular proteins. Virus envelope glycan size or type does not affect infectivity. Thus, host range variation due to N-glycan deletion is receptor variant-specific, cell-specific, virus type-specific, and glycan site-specific.« less

Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

1988-09-01

To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

The effect of interferon on the receptor sites to rabies virus on mouse neuroblastoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Briggs, D.J.

1989-01-01

The binding of rabies virus to mouse neuroblastoma cells (MNA) primed with alpha interferon (IFN-{alpha}), beta interferon (IFN-{beta}), or alpha bungarotoxin (BTX) was examined. A saturable number of receptor sites to rabies virus was calculated by increasing the amount of {sup 3}H-CVS added to a constant number of untreated MNA cells. MNA cells were then exposed to 20 I.U. of IFN-{alpha}, IFN-{beta}, or 1 {mu}g of BTX and assayed to determine if these treatments had an effect on the number of receptor sites to rabies virus. Total amount of {sup 3}H-CVS bound to MNA cells was determined during a threemore » hour incubation period. Cold competition assays using 1,000 fold excess unlabeled CVS were used to determine non-specific binding for each treatment. Specific binding was then calculated by subtracting non-specific binding from the total amount of CVS bound to MNA cells. A similar amount of total viral protein bound to untreated and IFN-{beta}, and BTX treated cells after 180 minutes of incubation. The bound protein varied by only 0.07 {mu}g. However, the amount of specific and non-specific binding varied a great deal between treatments. BTX caused an increase in non-specific and a decrease in specific binding of rabies virus. IFN-{beta} produced variable results in non-specific and specific binding while IFN-{alpha} caused mainly specific binding to occur. The most significant change brought about by IFN-{alpha} was an increase in the rate of viral attachment. At 30 minutes post-infection, IFN-{alpha} treated cells had bound 90% of the total amount of virus bound to untreated cells after 180 minutes. The increased binding rate did not cause a productive infection of rabies virus. No viral production was evident after an incubation period of 48 hours in either IFN-{alpha} or IFN-{beta} treated cells.« less

HPV binding assay to Laminin-332/integrin α6β4 on human keratinocytes.

PubMed

Brendle, Sarah A; Christensen, Neil D

2015-01-01

Human papillomaviruses (HPVs) have been shown to bind to Laminin-332 (Ln-332) on the extracellular matrix (ECM) secreted by human keratinocytes. The assay described here is an important tool to study HPV receptor binding to the ECM. The assay can also be modified to study the receptors required for HPV infection and for binding to tissues. We previously showed that Ln-332 is essential for the binding of HPV11 to human keratinocytes and that infectious entry of HPV11 requires α6β4 integrin for the transfer of HPV11 from ECM to host cells (Culp et al., J Virol 80:8940-8950, 2006). We also demonstrated that several of the high-risk HPV types (16, 18, 31 and 45) bind to Ln-332 and/or other components of the ECM in vitro (Broutian et al., J Gen Virol 91:531-540, 2010). The exact binding and internalization mechanism(s) for HPV are still under investigation. A better understanding of these mechanisms will aid in the design of therapeutics against HPVs and ultimately help prevent many cancers. In this chapter, we describe the HPV binding assay to Ln-332/integrin α6β4 on human keratinocytes (ECM). We also present data and suggestions for modifying the assay for testing the specificity of HPV for receptors (by blocking receptors) and binding to human tissues (basement membrane, BM) in order to study binding mechanisms.

The production of KIR-Fc fusion proteins and their use in a multiplex HLA class I binding assay.

PubMed

Hilton, Hugo G; Moesta, Achim K; Guethlein, Lisbeth A; Blokhuis, Jeroen; Parham, Peter; Norman, Paul J

2015-10-01

Soluble recombinant proteins that comprise the extracellular part of a surface expressed receptor attached to the Fc region of an IgG antibody have facilitated the determination of ligand specificity for an array of immune system receptors. Among such receptors is the family of killer cell immunoglobulin-like receptors (KIR) that recognize HLA class I ligands. These receptors, expressed on natural killer (NK) cells and T cells, play important roles in both immune defense and placental development in early pregnancy. Here we describe a method for the production of two domain KIR-Fc fusion proteins using baculovirus infected insect cells. This method is more scalable than traditional mammalian cell expression systems and produces efficiently folded proteins that carry posttranslational modifications found in native KIR. We also describe a multiplex binding assay using the Luminex platform that determines the avidity and specificity of two domain KIR-Fc for a panel of microbeads, each coated with one of 97 HLA class I allotypes. This assay is simple to perform, and represents a major improvement over the assays used previously, which were limited in the number of KIR and HLA class I combinations that could be assayed at any one time. The results obtained from this assay can be used to predict the response of NK cell and T cells when their KIR recognize HLA class I. Copyright © 2015 Elsevier B.V. All rights reserved.

The putative Agrobacterium transcriptional activator-like virulence protein VirD5 may target T-complex to prevent the degradation of coat proteins in the plant cell nucleus.

PubMed

Wang, Yafei; Peng, Wei; Zhou, Xu; Huang, Fei; Shao, Lingyun; Luo, Meizhong

2014-09-01

Agrobacterium exports at least five virulence proteins (VirE2, VirE3, VirF, VirD2, VirD5) into host cells and hijacks some host plant factors to facilitate its transformation process. Random DNA binding selection assays (RDSAs), electrophoretic mobility shift assays (EMSAs) and yeast one-hybrid systems were used to identify protein-bound DNA elements. Bimolecular fluorescence complementation, glutathione S-transferase pull-down and yeast two-hybrid assays were used to detect protein interactions. Protoplast transformation, coprecipitation, competitive binding and cell-free degradation assays were used to analyze the relationships among proteins. We found that Agrobacterium VirD5 exhibits transcriptional activation activity in yeast, is located in the plant cell nucleus, and forms homodimers. A specific VirD5-bound DNA element designated D5RE (VirD5 response element) was identified. VirD5 interacted directly with Arabidopsis VirE2 Interacting Protein 1 (AtVIP1). However, the ternary complex of VirD5-AtVIP1-VirE2 could be detected, whereas that of VirD5-AtVIP1-VBF (AtVIP1 Binding F-box protein) could not. We demonstrated that VirD5 competes with VBF for binding to AtVIP1 and stabilizes AtVIP1 and VirE2 in the cell-free degradation system. Our results indicated that VirD5 may act as both a transcriptional activator-like effector to regulate host gene expression and a protector preventing the coat proteins of the T-complex from being quickly degraded by the host's ubiquitin proteasome system (UPS). © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Development and validation of receptor occupancy pharmacodynamic assays used in the clinical development of the monoclonal antibody vedolizumab.

PubMed

Wyant, Tim; Estevam, Jose; Yang, Lili; Rosario, Maria

2016-03-01

Vedolizumab is a monoclonal antibody approved for use in ulcerative colitis and Crohn's disease. By specifically binding to α4 β7 integrin, vedolizumab prevents trafficking of lymphocytes to the gut, thereby interfering with disease pathology. During the clinical development program, the pharmacodynamic effect of vedolizumab was evaluated by 2 flow cytometry receptor occupancy assays: act-1 (ACT-1) and mucosal addressin cell adhesion molecule-1 (MAdCAM-1). Here we describe the development and validation of these assays. The ACT-1 assay is a receptor occupancy free-site assay that uses a monoclonal antibody with the same binding epitope as vedolizumab to detect free (unbound) sites on α4 β7 integrin. The MAdCAM-1 assay used a soluble version of the natural ligand for α4 β7 integrin to detect free sites. The assays were validated using a fit-for-purpose approach throughout the clinical development of vedolizumab. Both the ACT-1 assay and the MAdCAM-1 assay demonstrated acceptable reproducibility and repeatability. The assays were sufficiently stable to allow for clinical use. During clinical testing the assays demonstrated that vedolizumab was able to saturate peripheral cells at all doses tested. Two pharmacodynamic receptor occupancy assays were developed and validated to assess the effect of vedolizumab on peripheral blood cells. The results of these assays demonstrated the practical use of flow cytometry to examine pharmacodynamic response in clinical trials. © 2015 International Clinical Cytometry Society.

Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

PubMed

Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

2014-07-01

Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

Screening Anti-Cancer Drugs against Tubulin using Catch-and-Release Electrospray Ionization Mass Spectrometry

NASA Astrophysics Data System (ADS)

Rezaei Darestani, Reza; Winter, Philip; Kitova, Elena N.; Tuszynski, Jack A.; Klassen, John S.

2016-05-01

Tubulin, which is the building block of microtubules, plays an important role in cell division. This critical role makes tubulin an attractive target for the development of chemotherapeutic drugs to treat cancer. Currently, there is no general binding assay for tubulin-drug interactions. The present work describes the application of the catch-and-release electrospray ionization mass spectrometry (CaR-ESI-MS) assay to investigate the binding of colchicinoid drugs to αβ-tubulin dimers extracted from porcine brain. Proof-of-concept experiments using positive (ligands with known affinities) and negative (non-binders) controls were performed to establish the reliability of the assay. The assay was then used to screen a library of seven colchicinoid analogues to test their binding to tubulin and to rank their affinities.

Transcriptional regulation of human MUC4 gene: identification of a novel inhibitory element and its nuclear binding protein.

PubMed

Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi

2013-08-01

The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.

Rapid assays for lectin toxicity and binding changes that reflect altered glycosylation in mammalian cells.

PubMed

Stanley, Pamela; Sundaram, Subha

2014-06-03

Glycosylation engineering is used to generate glycoproteins, glycolipids, or proteoglycans with a more defined complement of glycans on their glycoconjugates. For example, a mammalian cell glycosylation mutant lacking a specific glycosyltransferase generates glycoproteins, and/or glycolipids, and/or proteoglycans with truncated glycans missing the sugar transferred by that glycosyltransferase, as well as those sugars that would be added subsequently. In some cases, an alternative glycosyltransferase may then use the truncated glycans as acceptors, thereby generating a new or different glycan subset in the mutant cell. Another type of glycosylation mutant arises from gain-of-function mutations that, for example, activate a silent glycosyltransferase gene. In this case, glycoconjugates will have glycans with additional sugar(s) that are more elaborate than the glycans of wild type cells. Mutations in other genes that affect glycosylation, such as nucleotide sugar synthases or transporters, will alter the glycan complement in more general ways that usually affect several types of glycoconjugates. There are now many strategies for generating a precise mutation in a glycosylation gene in a mammalian cell. Large-volume cultures of mammalian cells may also generate spontaneous mutants in glycosylation pathways. This article will focus on how to rapidly characterize mammalian cells with an altered glycosylation activity. The key reagents for the protocols described are plant lectins that bind mammalian glycans with varying avidities, depending on the specific structure of those glycans. Cells with altered glycosylation generally become resistant or hypersensitive to lectin toxicity, and have reduced or increased lectin or antibody binding. Here we describe rapid assays to compare the cytotoxicity of lectins in a lectin resistance test, and the binding of lectins or antibodies by flow cytometry in a glycan-binding assay. Based on these tests, glycosylation changes expressed by a cell can be revealed, and glycosylation mutants classified into phenotypic groups that may reflect a loss-of-function or gain-of-function mutation in a specific gene involved in glycan synthesis. Copyright © 2014 John Wiley & Sons, Inc.

Circulating Immune Complexes in Lyme Arthritis

PubMed Central

Hardin, John A.; Walker, Lesley C.; Steere, Allen C.; Trumble, Thomas C.; Tung, Kenneth S. K.; Williams, Ralph C.; Ruddy, Shaun; Malawista, Stephen E.

1979-01-01

We have found immunoglobulin (Ig) G-containing material consistent with immune complexes in the sera of patients with Lyme arthritis. It was detected in 29 of 55 sera (55%) from 31 patients by at least one of three assays: 125I-C1q binding, C1q solid phase, or Raji cell. The presence of reactive material correlated with clinical aspects of disease activity; it was found early in the illness, was most prominent in sera from the sickest patients, was infrequent during remissions, and often fluctuated in parallel with changes in clinical status. The results in the two C1q assays showed a strong positive correlation (P<0.001). They were each elevated in 45% of the sera and were usually concordant (85%). In contrast, the Raji cell assay was less frequently positive and often discordant with the C1q assays. In sucrose density gradients, putative circulating immune complexes sedimented near 19S; they, too, were detected best by the two assays based on C1q binding. An additional 7S component was found in some sera by the 125I-C1q binding assay. Serum complement was often above the range of normal in patients with mild disease and normal in patients with severe disease but did not correlate significantly with levels of circulating immune complexes. IgM and IgG rheumatoid factors were not detectable. These findings support a role for immune complexes in the pathogenesis of Lyme arthritis. Their measurement, by either the 125I-C1q binding assay or by the C1q solid phase assay, often provides a sensitive index of disease activity. Moreover, the complexes are likely sources of disease-related antigens for further study of this new disorder. PMID:429566

Stimulation of iodine organification in porcine thyroid cells by thyroid stimulators.

PubMed

Ginsberg, J; Shewring, G; Howells, R; Smith, B R; Hall, R

Several Graves' sera were simultaneously assessed in a bioassay based on the ability of porcine thyroid cells to organify 125I and in a radioreceptor assay for TSH receptor binding activity. Both assay systems were sensitive to 1 mcU/ml (final concentration) of unlabelled bovine TSH. Six Graves' sera were studied in detail over a wide (0-1.0 mcl sera) dose response range in repeat determinations. Two sera exhibited parallel binding and stimulating. However, two sera revealed significant inhibition of 125I-TSH binding prior to the demonstration of stimulation and the other two sera showed stimulatory capabilities before significant binding was evident. IgG was prepared from one serum by ammonium sulphate precipitation and chromatography on Sepharose 6B and then subjected to preparative isoelectric focusing. The isoelectric distribution of the two activities were found to be identical with major peaks of activity at pl=9.5 and pl=8.5. In summary: 1) each Graves' sera exhibits different dose-response curves with respect to binding and stimulation, 2) at certain concentrations of sera, only binding or stimulation were evident, 3) neither assay was consistently more sensitive for the presence of Graves' immunoglobulins, 4) for one Graves' sera, binding and stimulation could not be separated by isoelectric focusing. These studies would suggest each Graves' immunoglobulin has inherently different characteristics in its interaction with the TSH receptor.

Synthesis and characterization of time-resolved fluorescence probes for evaluation of competitive binding to melanocortin receptors.

PubMed

Alleti, Ramesh; Vagner, Josef; Dehigaspitiya, Dilani Chathurika; Moberg, Valerie E; Elshan, N G R D; Tafreshi, Narges K; Brabez, Nabila; Weber, Craig S; Lynch, Ronald M; Hruby, Victor J; Gillies, Robert J; Morse, David L; Mash, Eugene A

2013-09-01

Probes for use in time-resolved fluorescence competitive binding assays at melanocortin receptors based on the parental ligands MSH(4), MSH(7), and NDP-α-MSH were prepared by solid phase synthesis methods, purified, and characterized. The saturation binding of these probes was studied using HEK-293 cells engineered to overexpress the human melanocortin 4 receptor (hMC4R) as well as the human cholecystokinin 2 receptor (hCCK2R). The ratios of non-specific binding to total binding approached unity at high concentrations for each probe. At low probe concentrations, receptor-mediated binding and uptake was discernable, and so probe concentrations were kept as low as possible in determining Kd values. The Eu-DTPA-PEGO-MSH(4) probe exhibited low specific binding relative to non-specific binding, even at low nanomolar concentrations, and was deemed unsuitable for use in competition binding assays. The Eu-DTPA-PEGO probes based on MSH(7) and NDP-α-MSH exhibited Kd values of 27±3.9nM and 4.2±0.48nM, respectively, for binding with hMC4R. These probes were employed in competitive binding assays to characterize the interactions of hMC4R with monovalent and divalent MSH(4), MSH(7), and NDP-α-MSH constructs derived from squalene. Results from assays with both probes reflected only statistical enhancements, suggesting improper ligand spacing on the squalene scaffold for the divalent constructs. The Ki values from competitive binding assays that employed the MSH(7)-based probe were generally lower than the Ki values obtained when the probe based on NDP-α-MSH was employed, which is consistent with the greater potency of the latter probe. The probe based on MSH(7) was also competed with monovalent, divalent, and trivalent MSH(4) constructs that previously demonstrated multivalent binding in competitive binding assays against a variant of the probe based on NDP-α-MSH. Results from these assays confirm multivalent binding, but suggest a more modest increase in avidity for these MSH(4) constructs than was previously reported. Copyright © 2013 Elsevier Ltd. All rights reserved.

Shikonin, a natural product from the root of Lithospermum erythrorhizon, is a cytotoxic DNA-binding agent.

PubMed

Chen, Changmin; Shanmugasundaram, Kumaran; Rigby, Alan C; Kung, Andrew L

2013-04-11

To search for compounds that disrupt binding of the EWS-FLI1 fusion protein to its cognate targets, we developed a homogeneous high-throughput proximity assay and screened 5200 small molecule compounds. Many well-known DNA-binding chemotherapeutic agents, such as actinomycin D, cisplatin, doxorubicin, daunorubicin, and epirubicin scored in the assay and not surprising also disrupted the binding of other transcription factors. Unexpectedly, we found that Shikonin, a natural product from the root of Lithospermum erythrorhizon, similarly disrupted protein-DNA interactions. Mechanistic studies demonstrated that Shikonin displaces SYBR green from binding to the minor groove of DNA and is able to inhibit topoisomerase mediated DNA relaxation. In cells, Shikonin blocked the binding of EWS-FLI1 to the NR0B1 promoter, and attenuated gene expression. Shikonin rapidly induced G2/M arrest and apoptosis in Ewing sarcoma cells. These results demonstrate that contrary to other purported mechanisms of action, Shikonin is a DNA-binding cytotoxic agent. Copyright © 2013 Elsevier B.V. All rights reserved.

Monoclonal Antibody Binding to a Surface-Exposed Epitope on Cowdria ruminantium That Is Conserved among Eight Strains

PubMed Central

Shompole, Sankale; Rurangirwa, Fred R.; Wambugu, Anderson; Sitienei, John; Mwangi, Duncan M.; Musoke, Anthony J.; Mahan, Suman; Wells, Clive W.; McGuire, Travis C.

2000-01-01

Monoclonal antibodies (MAb) binding to Cowdria ruminantium elementary bodies (EB) were identified by enzyme-linked immunosorbent assay, and surface binding of one MAb (446.15) to intact EB was determined by immunofluorescence, immunogold labeling, and transmission electron microscopy. MAb 446.15 bound an antigen of approximately 43 kDa in immunoblots of eight geographically distinct strains. The MAb did not react with Ehrlichia canis antigens or uninfected bovine endothelial cell lysate and may be useful in diagnostic assays and vaccine development. PMID:11063511

The slow cell death response when screening chemotherapeutic agents.

PubMed

Blois, Joseph; Smith, Adam; Josephson, Lee

2011-09-01

To examine the correlation between cell death and a common surrogate of death used in screening assays, we compared cell death responses to those obtained with the sulforhodamine B (SRB) cell protein-based "cytotoxicity" assay. With the SRB assay, the Hill equation was used to obtain an IC50 and final cell mass, or cell mass present at infinite agent concentrations, with eight adherent cell lines and four agents (32 agent/cell combinations). Cells were treated with high agent concentrations (well above the SRB IC50) and the death response determined as the time-dependent decrease in cells failing to bind both annexin V and vital fluorochromes by flow cytometry. Death kinetics were categorized as fast (5/32) (similar to the reference nonadherent Jurkat line), slow (17/32), or none (10/32), despite positive responses in the SRB assay in all cases. With slow cell death, a single exposure to a chemotherapeutic agent caused a slow, progressive increase in dead (necrotic) and dying (apoptotic) cells for at least 72 h. Cell death (defined by annexin and/or fluorochrome binding) did not correlate with the standard SRB "cytotoxicity" assay. With the slow cell death response, a single exposure to an agent caused a slow conversion from vital to apoptotic and necrotic cells over at least 72 h (the longest time point examined). Here, increasing the time of exposure to agent concentrations modestly above the SRB IC50 provides a method of maximizing cell kill. If tumors respond similarly, sustained low doses of chemotherapeutic agents, rather than a log-kill, maximum tolerated dose strategy may be an optimal strategy of maximizing tumor cell death.

High Throughput, Real-time, Dual-readout Testing of Intracellular Antimicrobial Activity and Eukaryotic Cell Cytotoxicity

PubMed Central

Chiaraviglio, Lucius; Kang, Yoon-Suk; Kirby, James E.

2016-01-01

Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require several additional experimental steps prior to readout, such as cell lysis, colony forming unit determination, or reagent addition. When performing thousands of assays, for example, during high-throughput screening, the downstream effort required for these types of assays is considerable. Therefore, to facilitate high-throughput antimicrobial discovery, we developed a real-time assay to simultaneously identify inhibitors of intracellular bacterial growth and assess eukaryotic cell cytotoxicity. Specifically, real-time intracellular bacterial growth detection was enabled by marking bacterial screening strains with either a bacterial lux operon (1st generation assay) or fluorescent protein reporters (2nd generation, orthogonal assay). A non-toxic, cell membrane-impermeant, nucleic acid-binding dye was also added during initial infection of macrophages. These dyes are excluded from viable cells. However, non-viable host cells lose membrane integrity permitting entry and fluorescent labeling of nuclear DNA (deoxyribonucleic acid). Notably, DNA binding is associated with a large increase in fluorescent quantum yield that provides a solution-based readout of host cell death. We have used this combined assay to perform a high-throughput screen in microplate format, and to assess intracellular growth and cytotoxicity by microscopy. Notably, antimicrobials may demonstrate synergy in which the combined effect of two or more antimicrobials when applied together is greater than when applied separately. Testing for in vitro synergy against intracellular pathogens is normally a prodigious task as combinatorial permutations of antibiotics at different concentrations must be assessed. However, we found that our real-time assay combined with automated, digital dispensing technology permitted facile synergy testing. Using these approaches, we were able to systematically survey action of a large number of antimicrobials alone and in combination against the intracellular pathogen, Legionella pneumophila. PMID:27911388

Specific repression of β-globin promoter activity by nuclear ferritin

PubMed Central

Broyles, Robert H.; Belegu, Visar; DeWitt, Christina R.; Shah, Sandeep N.; Stewart, Charles A.; Pye, Quentin N.; Floyd, Robert A.

2001-01-01

Developmental hemoglobin switching involves sequential globin gene activations and repressions that are incompletely understood. Earlier observations, described herein, led us to hypothesize that nuclear ferritin is a repressor of the adult β-globin gene in embryonic erythroid cells. Our data show that a ferritin-family protein in K562 cell nuclear extracts binds specifically to a highly conserved CAGTGC motif in the β-globin promoter at −153 to −148 bp from the cap site, and mutation of the CAGTGC motif reduces binding 20-fold in competition gel-shift assays. Purified human ferritin that is enriched in ferritin-H chains also binds the CAGTGC promoter segment. Expression clones of ferritin-H markedly repress β-globin promoter-driven reporter gene expression in cotransfected CV-1 cells in which the β-promoter has been stimulated with the transcription activator erythroid Krüppel-like factor (EKLF). We have constructed chloramphenicol acetyltransferase reporter plasmids containing either a wild-type or mutant β-globin promoter for the −150 CAGTGC motif and have compared the constructs for susceptibility to repression by ferritin-H in cotransfection assays. We find that stimulation by cotransfected EKLF is retained with the mutant promoter, whereas repression by ferritin-H is lost. Thus, mutation of the −150 CAGTGC motif not only markedly reduces in vitro binding of nuclear ferritin but also abrogates the ability of expressed ferritin-H to repress this promoter in our cell transfection assay, providing a strong link between DNA binding and function, and strong support for our proposal that nuclear ferritin-H is a repressor of the human β-globin gene. Such a repressor could be helpful in treating sickle cell and other genetic diseases. PMID:11481480

[Receptor elements for biosensors in two ways of methylotrophic yeast immobilization].

PubMed

Zaĭtsev, M G; Arliapov, V A; Alferov, V A; Reshetilov, A N

2012-01-01

Receptor elements for biosensors based on Hansenula polymorpha NCYC 495 In yeast cells for ethanol assay were developed using two ways of cell immobilization, i.e., physical adsorption on a glass fiber membrane and covalent binding on a modified nitrocellulose membrane. The linear diapason of ethanol assays for a biosensor based on yeast cells adsorbed on glass fiber was 0.05-1.18; for a biosensor based on yeasts immobilized on a nitrocellulose membrane, 0.2-1.53 mM. Receptor elements based on sorbed cells possessed 2.5 times higher long-term stability. The time response was 1.5 times less for cells immobilized using DEAE-dextran and benzochinone. The results of ethyl alcohol assays using biosensors based on cells immobilized via adsorption and covalent binding, as well as using the standard areometric method, had high correlation coefficients (0.998 and 0.997, respectively, for the two ways of immobilization). The results indicate the possibility to consider the described models of receptor elements for biosensors as prototypes for experimental samples for practical use.

Arctigenin Inhibits Liver Cancer Tumorigenesis by Inhibiting Gankyrin Expression via C/EBPα and PPARα

PubMed Central

Sun, Ying; Tan, Yu-jun; Lu, Zhan-zhao; Li, Bing-bing; Sun, Cheng-hong; Li, Tao; Zhao, Li-li; Liu, Zhong; Zhang, Gui-min; Yao, Jing-chun; Li, Jie

2018-01-01

Burdock (Arctium lappa) is a popular vegetable in China and Japan that is consumed for its general health benefits. The principal active component of burdock is arctigenin, which shows a range of bioactivities in vivo and in vitro. Here, we investigated the potential anti-tumor effects of arctigenin using two human hepatocellular carcinoma (HCC) cell lines, HepG2 and Hep3B, and sought to elucidate its potential mechanisms of action. Our results showed that arctigenin treatment inhibited cell growth in both HepG2 and Hep3B cell lines (IC50 of 4.74 nM for HepG2 cells, and of 59.27 nM for Hep3B cells). In addition, migration, invasion, and colony formation by HepG2 cells were significantly inhibited by arctigenin. By contrast, treatment of Hep3B cells with arctigenin did not alter these parameters. Arctigenin also significantly reduced the levels of gankyrin mRNA and protein in HepG2 cells, but not in Hep3B cells. A luciferase assay indicated that arctigenin targeted the -450 to -400 region of the gankyrin promoter. This region is also the potential binding site for both C/EBPα and PPARα, as predicted and confirmed by an online software analysis and ChIP assay. Additionally, a co-immunoprecipitation (Co-IP) assay showed that binding between C/EBPα and PPARα was increased in the presence of arctigenin. However, arctigenin did not increase the expression of C/EBPα or PPARα protein. A binding screening assay and liquid chromatography–mass spectrometry (LC–MS) were performed to identify the mechanisms by which arctigenin regulates gankyrin expression. The results suggested that arctigenin could directly increase C/EBPα binding to the gankyrin promoter (-432 to -422 region), but did not affect PPARα binding. Expression of gankyrin, C/EBPα, and PPARα were analyzed in tumor tissues of patients using real-time PCR. Both C/EBPα and PPARα showed negative correlations with gankyrin. In tumor-bearing mice, arctigenin had a significant inhibitory effect on HCC growth. In conclusion, our results suggested that arctigenin could inhibit liver cancer growth by directly recruiting C/EBPα to the gankyrin promoter. PPARα subsequently bound to C/EBPα, and both had a negative regulatory effect on gankyrin expression. This study has identified a new mechanism of action of arctigenin against liver cancer growth. PMID:29636686

Arctigenin Inhibits Liver Cancer Tumorigenesis by Inhibiting Gankyrin Expression via C/EBPα and PPARα.

PubMed

Sun, Ying; Tan, Yu-Jun; Lu, Zhan-Zhao; Li, Bing-Bing; Sun, Cheng-Hong; Li, Tao; Zhao, Li-Li; Liu, Zhong; Zhang, Gui-Min; Yao, Jing-Chun; Li, Jie

2018-01-01

Burdock ( Arctium lappa ) is a popular vegetable in China and Japan that is consumed for its general health benefits. The principal active component of burdock is arctigenin, which shows a range of bioactivities in vivo and in vitro . Here, we investigated the potential anti-tumor effects of arctigenin using two human hepatocellular carcinoma (HCC) cell lines, HepG2 and Hep3B, and sought to elucidate its potential mechanisms of action. Our results showed that arctigenin treatment inhibited cell growth in both HepG2 and Hep3B cell lines (IC 50 of 4.74 nM for HepG2 cells, and of 59.27 nM for Hep3B cells). In addition, migration, invasion, and colony formation by HepG2 cells were significantly inhibited by arctigenin. By contrast, treatment of Hep3B cells with arctigenin did not alter these parameters. Arctigenin also significantly reduced the levels of gankyrin mRNA and protein in HepG2 cells, but not in Hep3B cells. A luciferase assay indicated that arctigenin targeted the -450 to -400 region of the gankyrin promoter. This region is also the potential binding site for both C/EBPα and PPARα, as predicted and confirmed by an online software analysis and ChIP assay. Additionally, a co-immunoprecipitation (Co-IP) assay showed that binding between C/EBPα and PPARα was increased in the presence of arctigenin. However, arctigenin did not increase the expression of C/EBPα or PPARα protein. A binding screening assay and liquid chromatography-mass spectrometry (LC-MS) were performed to identify the mechanisms by which arctigenin regulates gankyrin expression. The results suggested that arctigenin could directly increase C/EBPα binding to the gankyrin promoter (-432 to -422 region), but did not affect PPARα binding. Expression of gankyrin, C/EBPα , and PPARα were analyzed in tumor tissues of patients using real-time PCR. Both C/EBPα and PPARα showed negative correlations with gankyrin. In tumor-bearing mice, arctigenin had a significant inhibitory effect on HCC growth. In conclusion, our results suggested that arctigenin could inhibit liver cancer growth by directly recruiting C/EBPα to the gankyrin promoter. PPARα subsequently bound to C/EBPα, and both had a negative regulatory effect on gankyrin expression. This study has identified a new mechanism of action of arctigenin against liver cancer growth.

Bicyclic tetrapeptide histone deacetylase inhibitors with methoxymethyl ketone and boronic acid zinc-binding groups.

PubMed

Islam, Md Nurul; Islam, Md Shahidul; Hoque, Md Ashraful; Kato, Tamaki; Nishino, Norikazu; Ito, Akihiro; Yoshida, Minoru

2014-12-01

Histone deacetylase (HDAC) inhibitors are a class of potential therapeutics for the treatment of cancer. Bicyclic tetrapeptides equipped with methoxymethyl ketone and boronic acid as zinc-binding group were designed and synthesized. The inhibitory activities of these compounds were evaluated against HDAC enzymes. The cell-free and cell-based assay data showed that both potency and selectivity changed with the change in zinc-binding group. Boronic acid-based compound showed poor activity whereas methoxymethyl ketone-based compound displayed impressive activity in both cell-free and cell-based conditions. Copyright © 2014 Elsevier Inc. All rights reserved.

Human sex hormone-binding globulin binding affinities of 125 structurally diverse chemicals and comparison with their binding to androgen receptor, estrogen receptor, and α-fetoprotein.

PubMed

Hong, Huixiao; Branham, William S; Ng, Hui Wen; Moland, Carrie L; Dial, Stacey L; Fang, Hong; Perkins, Roger; Sheehan, Daniel; Tong, Weida

2015-02-01

One endocrine disruption mechanism is through binding to nuclear receptors such as the androgen receptor (AR) and estrogen receptor (ER) in target cells. The concentration of a chemical in serum is important for its entry into the target cells to bind the receptors, which is regulated by the serum proteins. Human sex hormone-binding globulin (SHBG) is the major transport protein in serum that can bind androgens and estrogens and thus change a chemical's availability to enter the target cells. Sequestration of an androgen or estrogen in the serum can alter the chemical elicited AR- and ER-mediated responses. To better understand the chemical-induced endocrine activity, we developed a competitive binding assay using human pregnancy plasma and measured the binding to the human SHBG for 125 structurally diverse chemicals, most of which were known to bind AR and ER. Eighty seven chemicals were able to bind the human SHBG in the assay, whereas 38 chemicals were nonbinders. Binding data for human SHBG are compared with that for rat α-fetoprotein, ER and AR. Knowing the binding profiles between serum and nuclear receptors will improve assessment of a chemical's potential for endocrine disruption. The SHBG binding data reported here represent the largest data set of structurally diverse chemicals tested for human SHBG binding. Utilization of the SHBG binding data with AR and ER binding data could enable better evaluation of endocrine disrupting potential of chemicals through AR- and ER-mediated responses since sequestration in serum could be considered. Published by Oxford University Press on behalf of the Society of Toxicology 2014. This work is written by US Government employees and is in the public domain in the US.

Flexible Label-Free Quantitative Assay for Antibodies to Influenza Virus Hemagglutinins ▿

PubMed Central

Carney, Paul J.; Lipatov, Aleksandr S.; Monto, Arnold S.; Donis, Ruben O.; Stevens, James

2010-01-01

During the initial pandemic influenza H1N1 virus outbreak, assays such as hemagglutination inhibition and microneutralization provided important information on the relative protection afforded by the population's cross-reactivity from prior infections and immunizations with seasonal vaccines. However, these assays continue to be limited in that they are difficult to automate for high throughput, such as in pandemic situations, as well as to standardize between labs. Thus, new technologies are being sought to improve standardization, reliability, and throughput by using chemically defined reagents rather than whole cells and virions. We now report the use of a cell-free and label-free flu antibody biosensor assay (f-AbBA) for influenza research and diagnostics that utilizes recombinant hemagglutinin (HA) in conjunction with label-free biolayer interferometry technology to measure biomolecular interactions between the HA and specific anti-HA antibodies or sialylated ligands. We evaluated f-AbBA to determine anti-HA antibody binding activity in serum or plasma to assess vaccine-induced humoral responses. This assay can reveal the impact of antigenic difference on antibody binding to HA and also measure binding to different subtypes of HA. We also show that the biosensor assay can measure the ability of HA to bind a model sialylated receptor-like ligand. f-AbBA could be used in global surveillance laboratories since preliminary tests on desiccated HA probes showed no loss of activity after >2 months in storage at room temperature, indicating that the same reagent lots could be used in different laboratories to minimize interlaboratory assay fluctuation. Future development of such reagents and similar technologies may offer a robust platform for future influenza surveillance activities. PMID:20660137

G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

PubMed

Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

2016-09-21

Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA

PubMed Central

Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

2016-01-01

Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5′-end also contributes essentially to the aptameric function. PMID:27650576

Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.

PubMed

Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong

2006-07-07

We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.

Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers

PubMed Central

Turek, Diane; Van Simaeys, Dimitri; Johnson, Judith; Ocsoy, Ismail; Tan, Weihong

2014-01-01

AIM To generate DNA-aptamers binding to Methicillin-resistant Staphylococcus aureus (MRSA). METHODS The Cell-Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology was used to run the selection against MRSA bacteria and develop target-specific aptamers. MRSA bacteria were targeted while Enterococcus faecalis bacteria were used for counter selection during that process. Binding assays to determine the right aptamer candidates as well as binding assays on clinical samples were performed through flow cytometry and analyzed using the FlowJo software. The characterization of the aptamers was done by determination of their Kd values and determined by analysis of flow data at different aptamer concentration using SigmaPlot. Finally, the recognition of the complex Gold-nanoparticle-aptamer to the bacteria cells was observed using transmission electron microscopy (TEM). RESULTS During the cell-SELEX selection process, 17 rounds were necessary to generate enrichment of the pool. While the selection was run using fixed cells, it was shown that the binding of the pools with live cells was giving similar results. After sequencing and analysis of the two last pools, four sequences were identified to be aptamer candidates. The characterization of those aptamers showed that based on their Kd values, DTMRSA4 presented the best binding with a Kd value of 94.61 ± 18.82 nmol/L. A total of ten clinical samples of MRSA , S. aureus and Enterococcus faecalis were obtained to test those aptamers and determine their binding on a panel of samples. DTMRSA1 and DTMRSA3 showed the best results regarding their specificity to MRSA , DTMRSA1 being the most specific of all. Finally, those aptamers were coupled with gold-nanoparticle and their binding to MRSA cells was visualized through TEM showing that adduction of nanoparticles on the aptamers did not change their binding property. CONCLUSION A total of four aptamers that bind to MRSA were obtained with Kd values ranking from 94 to 200 nmol/L. PMID:25436184

Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers.

PubMed

Turek, Diane; Van Simaeys, Dimitri; Johnson, Judith; Ocsoy, Ismail; Tan, Weihong

2013-01-01

To generate DNA-aptamers binding to Methicillin-resistant Staphylococcus aureus (MRSA) . The Cell-Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology was used to run the selection against MRSA bacteria and develop target-specific aptamers. MRSA bacteria were targeted while Enterococcus faecalis bacteria were used for counter selection during that process. Binding assays to determine the right aptamer candidates as well as binding assays on clinical samples were performed through flow cytometry and analyzed using the FlowJo software. The characterization of the aptamers was done by determination of their K d values and determined by analysis of flow data at different aptamer concentration using SigmaPlot. Finally, the recognition of the complex Gold-nanoparticle-aptamer to the bacteria cells was observed using transmission electron microscopy (TEM). During the cell-SELEX selection process, 17 rounds were necessary to generate enrichment of the pool. While the selection was run using fixed cells, it was shown that the binding of the pools with live cells was giving similar results. After sequencing and analysis of the two last pools, four sequences were identified to be aptamer candidates. The characterization of those aptamers showed that based on their K d values, DTMRSA4 presented the best binding with a K d value of 94.61 ± 18.82 nmol/L. A total of ten clinical samples of MRSA , S. aureus and Enterococcus faecalis were obtained to test those aptamers and determine their binding on a panel of samples. DTMRSA1 and DTMRSA3 showed the best results regarding their specificity to MRSA , DTMRSA1 being the most specific of all. Finally, those aptamers were coupled with gold-nanoparticle and their binding to MRSA cells was visualized through TEM showing that adduction of nanoparticles on the aptamers did not change their binding property. A total of four aptamers that bind to MRSA were obtained with K d values ranking from 94 to 200 nmol/L.

Data quality in drug discovery: the role of analytical performance in ligand binding assays

NASA Astrophysics Data System (ADS)

Wätzig, Hermann; Oltmann-Norden, Imke; Steinicke, Franziska; Alhazmi, Hassan A.; Nachbar, Markus; El-Hady, Deia Abd; Albishri, Hassan M.; Baumann, Knut; Exner, Thomas; Böckler, Frank M.; El Deeb, Sami

2015-09-01

Despite its importance and all the considerable efforts made, the progress in drug discovery is limited. One main reason for this is the partly questionable data quality. Models relating biological activity and structures and in silico predictions rely on precisely and accurately measured binding data. However, these data vary so strongly, such that only variations by orders of magnitude are considered as unreliable. This can certainly be improved considering the high analytical performance in pharmaceutical quality control. Thus the principles, properties and performances of biochemical and cell-based assays are revisited and evaluated. In the part of biochemical assays immunoassays, fluorescence assays, surface plasmon resonance, isothermal calorimetry, nuclear magnetic resonance and affinity capillary electrophoresis are discussed in details, in addition radiation-based ligand binding assays, mass spectrometry, atomic force microscopy and microscale thermophoresis are briefly evaluated. In addition, general sources of error, such as solvent, dilution, sample pretreatment and the quality of reagents and reference materials are discussed. Biochemical assays can be optimized to provide good accuracy and precision (e.g. percental relative standard deviation <10 %). Cell-based assays are often considered superior related to the biological significance, however, typically they cannot still be considered as really quantitative, in particular when results are compared over longer periods of time or between laboratories. A very careful choice of assays is therefore recommended. Strategies to further optimize assays are outlined, considering the evaluation and the decrease of the relevant error sources. Analytical performance and data quality are still advancing and will further advance the progress in drug development.

Efavirenz directly modulates the oestrogen receptor and induces breast cancer cell growth.

PubMed

Sikora, M J; Rae, J M; Johnson, M D; Desta, Z

2010-10-01

Efavirenz-based HIV therapy is associated with breast hypertrophy and gynaecomastia. Here, we tested the hypothesis that efavirenz induces gynaecomastia through direct binding and modulation of the oestrogen receptor (ER). To determine the effect of efavirenz on growth, the oestrogen-dependent, ER-positive breast cancer cell lines MCF-7, T47D and ZR-75-1 were treated with efavirenz under oestrogen-free conditions in the presence or absence of the anti-oestrogen ICI 182,780. Cells treated with 17β-oestradiol in the absence or presence of ICI 182,780 served as positive and negative controls, respectively. Cellular growth was assayed using the crystal violet staining method and an in vitro receptor binding assay was used to measure the ER binding affinity of efavirenz. Efavirenz induced growth in MCF-7 cells with an estimated effective concentration for half-maximal growth (EC(50)) of 15.7 μM. This growth was reversed by ICI 182,780. Further, efavirenz binds directly to the ER [inhibitory concentration for half maximal binding (IC(50)) of ∼52 μM] at a roughly 1000-fold higher concentration than observed with 17β-oestradiol. Our data suggest that efavirenz-induced gynaecomastia may be caused, at least in part, by drug-induced ER activation in breast tissues.

Studies of the viral binding proteins of shrimp BP53, a receptor of white spot syndrome virus.

PubMed

Li, Chen; Gao, Xiao-Xiao; Huang, Jie; Liang, Yan

2016-02-01

The specific binding between viral attachment proteins (VAPs) of a virus and its cellular receptors on host cells mediates virus entry into host cells, which triggers subsequent viral infections. Previous studies indicate that F1 ATP synthase β subunit (named BP53), is found on the surface of shrimp cells and involved in white spot syndrome virus (WSSV) infection by functioning as a potential viral receptor. Herein, in a far-western blotting assay, three WSSV proteins with molecular weights of 28 kDa, 37 kDa, and >50 kDa were found to interact with BP53. The 28 kDa and 37 kDa proteins were identified as the envelope protein VP28 and VP37 of WSSV respectively, which could be recognized by the polyclonal antibodies. Enzyme-linked immunosorbent binding assays revealed that VP37 contributed to almost 80% of the binding capability for BP53 compared with the same amount of total WSSV protein. The relationship between BP53 and its complementary interacting protein, VP37, was visualized using a co-localization assay. Bound VP37 on the cell surface co-localized with BP53 and shared a similar subcellular location on the outer surface of shrimp cells. Pearson's correlation coefficients reached to 0.67 ± 0.05 and the Mander's overlap coefficients reached 0.70 ± 0.05, which indicated a strong relationship between the localization of BP53 and bound rVP37. This provides evidence for an interaction between BP53 and VP37 obtained at the molecular and cellular levels, supporting the hypothesis that BP53 serves as a receptor for WSSV by binding to VP37. The identification of the viral binding proteins of shrimp BP53 is helpful for better understanding the pathogenic mechanisms of WSSV to infect shrimp at the cellular level. Copyright © 2016 Elsevier Inc. All rights reserved.

Bone sialoprotein does not interact with pro-gelatinase A (MMP-2) or mediate MMP-2 activation.

PubMed

Hwang, Queena; Cheifetz, Sela; Overall, Christopher M; McCulloch, Christopher A; Sodek, Jaro

2009-04-22

A recent model for activation of the zymogen form of matrix metalloproteinase 2 (MMP-2, also known as gelatinase A) has suggested that interactions between the SIBLING protein bone sialoprotein (BSP) and MMP-2 leads to conformational change in MMP-2 that initiates the conversion of the pro-enzyme into a catalytically active form. This model is particularly relevant to cancer cell metastasis to bone since BSP, bound to the alphavbeta3 integrin through its arginine-glycine-aspartic acid motif, could recruit MMP-2 to the cell surface. We critically assessed the relationship between BSP and proMMP-2 and its activation using various forms of recombinant and purified BSP and MMP-2. Gelatinase and collagenase assays, fluorescence binding assays, real-time PCR, cell culture and pull-down assays were employed to test the model. Studies with a fluorogenic substrate for MMP-2 showed no activation of proMMP-2 by BSP. Binding and pull-down assays demonstrated no interaction between MMP-2 and BSP. While BSP-mediated invasiveness has been shown to depend on its integrin-binding RGD sequence, analysis of proMMP-2 activation and the level of membrane type 1 (MT1)-MMP in cells grown on a BSP substratum showed that the BSP-alphavbeta3 integrin interaction does not induce the expression of MT1-MMP. These studies do not support a role for BSP in promoting metastasis through interactions with pro-MMP-2.

A homogeneous, Anti-dsDNA antibody-based assay for multicolor detection of cancer stem cell transcription factors.

PubMed

Ma, Jiehua; Shi, Hai; Zhang, Meiling; Li, Chao; Xiang, Yang; Liu, Ping

2018-10-31

Cancer stem cells (CSCs) are responsible for maintaining tumor growth, metastasis and recurrence. The high expression of cancer stem cell transcription factors (Oct4, Sox2 and Nanog) is a valuable prognostic factor, suggesting a higher risk of tumor recurrence and metastasis. So, the development of a convenient and cost-effective method for multiplex assay of these transcription factors (TFs) is highly required. In this work, we have proposed a universal homogeneous assay for multicolor detection of these TFs based on anti-dsDNA antibody-decorated Fe 3 O 4 magnetite nanoparticles (aadMNPs). In the presence of analytes, the dye-labeled dsDNAs are bound by specific TFs, which will inhibit the interactions between the dsDNAs and aadMNPs, generating higher fluorescence that may provide signal readout for the immunosensing process. By using the proposed method, Oct4 can be determined in a linear range from 3 to 1200 ng/mL with a detection limit of 0.035 ng/mL. Furthermore, we have presented assays for the sensitive, selective and rapid detection of Oct4, Sox2 and Nanog in cell extract, as well as the analysis of binding affinity of the mutated binding sequences. This work may provide potential applications in clinical CSCs detections, and may open new opportunity for the study of nucleotide polymorphisms in TF binding sites. Copyright © 2018 Elsevier B.V. All rights reserved.

Expression of CD44 3'-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis.

PubMed

Jeyapalan, Zina; Deng, Zhaoqun; Shatseva, Tatiana; Fang, Ling; He, Chengyan; Yang, Burton B

2011-04-01

The non-coding 3'-untranslated region (UTR) plays an important role in the regulation of microRNA (miRNA) functions, since it can bind and inactivate multiple miRNAs. Here, we show the 3'-UTR of CD44 is able to antagonize cytoplasmic miRNAs, and result in the increased translation of CD44 and downstream target mRNA, CDC42. A series of cell function assays in the human breast cancer cell line, MT-1, have shown that the CD44 3'-UTR inhibits proliferation, colony formation and tumor growth. Furthermore, it modulated endothelial cell activities, favored angiogenesis, induced tumor cell apoptosis and increased sensitivity to Docetaxel. These results are due to the interaction of the CD44 3'-UTR with multiple miRNAs. Computational algorithms have predicted three miRNAs, miR-216a, miR-330 and miR-608, can bind to both the CD44 and CDC42 3'-UTRs. This was confirmed with luciferase assays, western blotting and immunohistochemical staining and correlated with a series of siRNA assays. Thus, the non-coding CD44 3'-UTR serves as a competitor for miRNA binding and subsequently inactivates miRNA functions, by freeing the target mRNAs from being repressed.

Expression of CD44 3′-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis

PubMed Central

Jeyapalan, Zina; Deng, Zhaoqun; Shatseva, Tatiana; Fang, Ling; He, Chengyan; Yang, Burton B.

2011-01-01

The non-coding 3′-untranslated region (UTR) plays an important role in the regulation of microRNA (miRNA) functions, since it can bind and inactivate multiple miRNAs. Here, we show the 3′-UTR of CD44 is able to antagonize cytoplasmic miRNAs, and result in the increased translation of CD44 and downstream target mRNA, CDC42. A series of cell function assays in the human breast cancer cell line, MT-1, have shown that the CD44 3′-UTR inhibits proliferation, colony formation and tumor growth. Furthermore, it modulated endothelial cell activities, favored angiogenesis, induced tumor cell apoptosis and increased sensitivity to Docetaxel. These results are due to the interaction of the CD44 3′-UTR with multiple miRNAs. Computational algorithms have predicted three miRNAs, miR-216a, miR-330 and miR-608, can bind to both the CD44 and CDC42 3′-UTRs. This was confirmed with luciferase assays, western blotting and immunohistochemical staining and correlated with a series of siRNA assays. Thus, the non-coding CD44 3′-UTR serves as a competitor for miRNA binding and subsequently inactivates miRNA functions, by freeing the target mRNAs from being repressed. PMID:21149267

Distinct T cell interactions with HLA class II tetramers characterize a spectrum of TCR affinities in the human antigen-specific T cell response.

PubMed

Reichstetter, S; Ettinger, R A; Liu, A W; Gebe, J A; Nepom, G T; Kwok, W W

2000-12-15

The polyclonal nature of T cells expanding in an ongoing immune response results in a range of disparate affinities and activation potential. Recently developed human class II tetramers provide a means to analyze this diversity by direct characterization of the trimolecular TCR-peptide-MHC interaction in live cells. Two HSV-2 VP16(369-379)-specific, DQA1*0102/DQB1*0602 (DQ0602)-restricted T cell clones were compared by means of T cell proliferation assay and HLA-DQ0602 tetramer staining. These two clones were obtained from the same subject, but show different TCR gene usage. Clone 48 was 10-fold more sensitive to VP16(369-379) peptide stimulation than clone 5 as assayed by proliferation assays, correlating with differences in MHC tetramer binding. Clone 48 gave positive staining with the DQ0602/VP16(369-379) tetramer at either 23 or 37 degrees C. Weak staining was also observed at 4 degrees C. Clone 5 showed weaker staining compared with clone 48 at 37 degrees C, and no staining was observed at 23 degrees C or on ice. Receptor internalization was not required for positive staining. Competitive binding indicates that the cell surface TCR of clone 48 has higher affinity for the DQ0602/VP16(369-379) complex than clone 5. The higher binding affinity of clone 48 for the peptide-MHC complex also correlates with a slower dissociation rate compared with clone 5.

Discovery and Optimization of Novel 5-Indolyl-7-arylimidazo[1,2-a]pyridine-8-carbonitrile Derivatives as Potent Antitubulin Agents Targeting Colchicine-binding Site

NASA Astrophysics Data System (ADS)

Zhai, Xin; Wang, Xiaoqiang; Wang, Jiao; Liu, Jin; Zuo, Daiying; Jiang, Nan; Zeng, Tianfang; Yang, Xiuxiu; Jing, Tongfei; Gong, Ping

2017-02-01

Aiming at development of potent antitubulin agents targeting colchicine-binding site, a series of novel 5-indolyl-7-arylimidazo[1,2-a]pyridine-8-carbonitrilederivatives (5a-5v and 7a-7h) were designed based on bioisosterism and hybridization strategies. All these compounds were concisely synthesized via a three-step process and examined against five human cancer cell lines (HT-29, A549, MKN-45, MDA-MB-231 and SMMC-7721) along with a normal human cell (L02) in vitro. A structure-activity relationships (SARs) study was carried out and optimization towards this series of compounds in cellular assay resulted in the discovery of 5k, which displayed similar or better antitumor potency against the tested cancer cells with IC50 value ranging from 0.02 to 1.22 μM superior to CA-4 and Crolibulin. Significantly, a cell cycle study disclosed the ability of 5k to arrest cell cycle at the G2/M phase, and immunofluorescence assay as well as a colchicine competition assay revealed that tubulin polymerization was disturbed by 5k by binding to the colchicine site. Moreover, the molecular modeling mode showed the posture of 5k and Crolibulin was similar in the colchcine-binding pocket of tubulin as identified with the SARs and pharmacological results. Together, all these results rationalized 5k might serve as a promising lead for a novel class of antitubulin agents for cancer treatments.

Replacement of the V3 domain in the surface subunit of the feline immunodeficiency virus envelope glycoprotein with the equivalent region of a T cell-tropic human immunodeficiency virus type 1 results in a chimeric surface protein that efficiently binds to CXCR4.

PubMed

González, Silvia A; Falcón, Juan I; Affranchino, José L

2014-03-01

Feline immunodeficiency virus (FIV) and the T cell-tropic strains of human immunodeficiency virus type 1 (HIV-1) share the use of the chemokine receptor CXCR4 for cell entry. To study this process further we developed a cell surface binding assay based on the expression of a soluble version of the FIV SU C-terminally tagged with the influenza virus hemagglutinin epitope (HA). The specificity of the assay was demonstrated by the following evidence: (1) the SU-HA protein bound to HeLa cells that express CXCR4 but not to MDCK cells that lack this chemokine receptor; and (2) binding of the SU-HA to HeLa cells was blocked by incubation with the CXCR4 antagonist AMD3100 as well as with the anti-CXCR4 monoclonal antibody (MAb) 12G5. Deletion of the V3 region from the FIV SU glycoprotein abolished its ability to bind CXCR4-expressing cells. Remarkably, substitution of the V3 domain of the FIV SU by the equivalent region of the HIV-1 NL4-3 isolate resulted in efficient cell surface binding of the chimeric SU protein to CXCR4. Moreover, transfection of MDCK cells with a plasmid encoding human CXCR4 allowed the association of the chimeric SU-HA glycoprotein to the transfected cells. Interestingly, while cell binding of the chimeric FIV-HIV SU was inhibited by an anti-HIV-1 V3 MAb, its association with CXCR4 was found to be resistant to AMD3100. Of note, the chimeric FIV-HIV Env glycoprotein was capable of promoting CXCR4-dependent cell-to-cell fusion.

PDGF Suppresses the Sulfation of CD44v and Potentiates CD44v-Mediated Binding of Colon Carcinoma Cells to Fibrin under Flow

PubMed Central

Alves, Christina S.; Konstantopoulos, Konstantinos

2012-01-01

Fibrin(ogen) mediates sustained tumor cell adhesion and survival in the pulmonary vasculature, thereby facilitating the metastatic dissemination of tumor cells. CD44 is the major functional fibrin receptor on colon carcinoma cells. Growth factors, such as platelet-derived growth factor (PDGF), induce post-translational protein modifications, which modulate ligand binding activity. In view of the roles of PDGF, fibrin(ogen) and CD44 in cancer metastasis, we aimed to delineate the effect of PDGF on CD44-fibrin recognition. By immunoprecipitating CD44 from PDGF-treated and untreated LS174T colon carcinoma cells, which express primarily CD44v, we demonstrate that PDGF enhances the adhesion of CD44v-coated beads to immobilized fibrin. Enzymatic inhibition studies coupled with flow-based adhesion assays and autoradiography reveal that PDGF augments the binding of CD44v to fibrin by significantly attenuating the extent of CD44 sulfation primarily on chondroitin and dermatan sulfate chains. Surface plasmon resonance assays confirm that PDGF enhances the affinity of CD44v-fibrin binding by markedly reducing its dissociation rate while modestly increasing the association rate. PDGF mildly reduces the affinity of CD44v-hyaluronan binding without affecting selectin-CD44v recognition. The latter is attributed to the fact that CD44v binds to selectins via sialofucosylated O-linked residues independent of heparan, dermatan and chondroitin sulfates. Interestingly, PDGF moderately reduces the sulfation of CD44s and CD44s-fibrin recognition. Collectively, these data offer a novel perspective into the mechanism by which PGDF regulates CD44-dependent binding of metastatic colon carcinoma cells to fibrin(ogen). PMID:23056168

Efavirenz directly modulates estrogen receptor and induces breast cancer cell growth

PubMed Central

Sikora, Matthew J.; Rae, James M.; Johnson, Michael D.; Desta, Zeruesenay

2010-01-01

Objectives Efavirenz-based HIV therapy is associated with breast hypertrophy and gynecomastia. Here, we tested the hypothesis that efavirenz induces gynecomastia through direct binding and modulation of estrogen receptor (ER). Methods To determine the effect of efavirenz on growth, the estrogen-dependent, ER-positive breast cancer cell lines MCF-7, T47D and ZR-75-1 were treated with efavirenz under estrogen-free conditions in the presence or absence of the anti-estrogen ICI 182,780. Cells treated with 17β-estradiol in the absence or presence of ICI 182,780 served as positive and negative controls, respectively. Cellular growth was assayed using the crystal violet staining method and an in vitro receptor binding assay was used to measure efavirenz’s ER binding affinity. Results Efavirenz induced growth in MCF-7 cells with an estimated EC50 of 15.7µM. This growth was reversed by ICI 182,780. Further, efavirenz binds directly to ER (IC50 of ~52µM) at roughly 1000-fold higher concentration than observed with E2. Conclusions Our data suggest that efavirenz-induced gynecomastia may be due, at least in part, to drug-induced ER activation in breast tissues. PMID:20408889

Planar optical waveguide based sandwich assay sensors and processes for the detection of biological targets including protein markers, pathogens and cellular debris

DOEpatents

Martinez, Jennifer S [Santa Fe, NM; Swanson, Basil I [Los Alamos, NM; Grace, Karen M [Los Alamos, NM; Grace, Wynne K [Los Alamos, NM; Shreve, Andrew P [Santa Fe, NM

2009-06-02

An assay element is described including recognition ligands bound to a film on a single mode planar optical waveguide, the film from the group of a membrane, a polymerized bilayer membrane, and a self-assembled monolayer containing polyethylene glycol or polypropylene glycol groups therein and an assay process for detecting the presence of a biological target is described including injecting a biological target-containing sample into a sensor cell including the assay element, with the recognition ligands adapted for binding to selected biological targets, maintaining the sample within the sensor cell for time sufficient for binding to occur between selected biological targets within the sample and the recognition ligands, injecting a solution including a reporter ligand into the sensor cell; and, interrogating the sample within the sensor cell with excitation light from the waveguide, the excitation light provided by an evanescent field of the single mode penetrating into the biological target-containing sample to a distance of less than about 200 nanometers from the waveguide thereby exciting the fluorescent-label in any bound reporter ligand within a distance of less than about 200 nanometers from the waveguide and resulting in a detectable signal.

Planar optical waveguide based sandwich assay sensors and processes for the detection of biological targets including early detection of cancers

DOEpatents

Martinez, Jennifer S [Santa Fe, NM; Swanson, Basil I [Los Alamos, NM; Shively, John E [Arcadia, CA; Li, Lin [Monrovia, CA

2009-06-02

An assay element is described including recognition ligands adapted for binding to carcinoembryonic antigen (CEA) bound to a film on a single mode planar optical waveguide, the film from the group of a membrane, a polymerized bilayer membrane, and a self-assembled monolayer containing polyethylene glycol or polypropylene glycol groups therein and an assay process for detecting the presence of CEA is described including injecting a possible CEA-containing sample into a sensor cell including the assay element, maintaining the sample within the sensor cell for time sufficient for binding to occur between CEA present within the sample and the recognition ligands, injecting a solution including a reporter ligand into the sensor cell; and, interrogating the sample within the sensor cell with excitation light from the waveguide, the excitation light provided by an evanescent field of the single mode penetrating into the biological target-containing sample to a distance of less than about 200 nanometers from the waveguide thereby exciting any bound reporter ligand within a distance of less than about 200 nanometers from the waveguide and resulting in a detectable signal.

Role of receptor occupancy assays by flow cytometry in drug development.

PubMed

Stewart, Jennifer J; Green, Cherie L; Jones, Nicholas; Liang, Meina; Xu, Yuanxin; Wilkins, Danice E C; Moulard, Maxime; Czechowska, Kamila; Lanham, David; McCloskey, Thomas W; Ferbas, John; van der Strate, Barry W A; Högerkorp, Carl-Magnus; Wyant, Timothy; Lackey, Alan; Litwin, Virginia

2016-03-01

The measurement of the binding of a biotherapeutic to its cellular target, receptor occupancy (RO), is increasingly important in development of biologically-based therapeutic agents. Receptor occupancy (RO) assays by flow cytometry describe the qualitative and/or quantitative assessment of the binding of a therapeutic agent to its cell surface target. Such RO assays can be as simple as measuring the number of cell surface receptors bound by an antireceptor therapeutic agent or can be designed to address more complicated scenarios such as internalization or shedding events once a receptor engages the administered therapeutic agent. Data generated from RO assays can also be used to model whether given doses of an experimental therapeutic agent and their administration schedules lead to predicted levels of receptor occupancy and whether the receptor is modulated (up or down) on cells engaged by the therapeutic agent. There are a variety of approaches that can be used when undertaking RO assays and with the ability to measure distinct subsets in heterogeneous populations, flow cytometry is ideally suited to RO measurements. This article highlights the importance of RO assays on the flow cytometric platform in the development of biotherapeutic agents. © 2016 The Authors Cytometry Part B: Clinical Cytometry Published by Wiley Periodicals, Inc.

Differential Transcription Factor Use by the KIR2DL4 Promoter Under Constitutive and IL-2/15-Treated Conditions

PubMed Central

Presnell, Steven R.; Zhang, Lei; Chlebowy, Corrin N.; Al-Attar, Ahmad; Lutz, Charles T.

2012-01-01

KIR2DL4 is unique among human KIR genes in expression, cellular localization, structure, and function, yet the transcription factors required for its expression have not been identified. Using mutagenesis, electrophoretic mobility shift assay, and co-transfection assays, we identified two redundant Runx binding sites in the 2DL4 promoter as essential for constitutive 2DL4 transcription, with contributions by a CRE site and initiator elements. IL-2-and IL-15-stimulated human NK cell lines increased 2DL4 promoter activity, which required functional Runx, CRE, and Ets sites. Chromatin immunoprecipitation experiments show that Runx3 and Ets1 bind the 2DL4 promoter in situ. 2DL4 promoter activity had similar transcription factor requirements in T cells. Runx, CRE, and Ets binding motifs are present in 2DL4 promoters from across primate species, but other postulated transcription factor binding sites are not preserved. Differences between 2DL4 and clonally-restricted KIR promoters suggest a model that explains the unique 2DL4 expression pattern in human NK cells. PMID:22467658

Expression and purification of RHC-EGFP fusion protein and its application in hyaluronic acid assay.

PubMed

Duan, Ningjun; Lv, Wansheng; Zhu, Lingli; Zheng, Weijuan; Hua, Zichun

2017-03-16

Hyaluronan is a widely distributed glycosaminoglycan which has multiple functions. Hyaluronic acid (HA) accumulation has been reported in many human diseases. Understanding the role of hyaluronan and its binding proteins in the pathobiology of disease will facilitate the development of novel therapeutics for many critical diseases. Current techniques described for the analysis of HA are mainly for HA quantification in solutions, not for the direct detection of HA in tissues or on cell surfaces. In our study, a fusion protein, named C-terminal domain of RHAMM-enhanced green fluorescence protein (RHC-EGFP), combined the HA-binding domain, C-terminal of receptor for hyaluronan-mediated motility, with EGFP, a widely used enhanced green fluorescence protein, was expressed and purified from Escherichia coli with high purity. Based on the sensitivity and convenience of fluorescence detection, methods for direct assay of HA in solutions, on cell surface or in tissues were established using RHC-EGFP. The binding specificity was also confirmed by competitive binding experiment and hyaluronidase degradation experiment. Our results provide an alternative choice for the specific and convenient assay of HA in various samples, and maybe helpful for further understanding of the fundamental and comprehensive functions of HA.

A cell-based MHC stabilization assay for the detection of peptide binding to the canine classical class I molecule, DLA-88.

PubMed

Ross, Peter; Holmes, Jennifer C; Gojanovich, Gregory S; Hess, Paul R

2012-12-15

Identifying immunodominant CTL epitopes is essential for studying CD8+ T-cell responses in populations, but remains difficult, as peptides within antigens typically are too numerous for all to be synthesized and screened. Instead, to facilitate discovery, in silico scanning of proteins for sequences that match the motif, or binding preferences, of the restricting MHC class I allele - the largest determinant of immunodominance - can be used to predict likely candidates. The high false positive rate with this analysis ideally requires binding confirmation, which is obtained routinely by an assay using cell lines such as RMA-S that have defective transporter associated with antigen processing (TAP) machinery, and consequently, few surface class I molecules. The stabilization and resultant increased life-span of peptide-MHC complexes on the cell surface by the addition of true binders validates their identity. To determine whether a similar assay could be developed for dogs, we transfected a prevalent class I allele, DLA-88*50801, into RMA-S. In the BARC3 clone, the recombinant heavy chain was associated with murine β2-microglobulin, and importantly, could differentiate motif-matched and -mismatched peptides by surface MHC stabilization. This work demonstrates the potential to use RMA-S cells transfected with canine alleles as a tool for CTL epitope discovery in this species. Copyright © 2012 Elsevier B.V. All rights reserved.

Detection of DNA damage in individual cells by flow cytometric analysis using anti-DNA monoclonal antibody

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frankfurt, O.S.

A new method for the measurement of DNA damage in individual cells treated with alkylating agents is described. The method is based on the binding of anti-DNA monoclonal antibody to DNA in situ. Binding of antibody was evaluated by flow cytometry with indirect immunofluorescence. No binding of antibody to DNA in non-treated HeLa S3 cells was detected. Treatment of cells with HN2 or L-phenylalanine mustard induced binding of antibody to DNA in situ. Binding of antibody was observed after treating cells with doses of drugs which reduced the surviving fraction below 20%. Intensity of binding increased in proportion to themore » drug dose. In HN2-treated cells a cell subset with the lowest antibody binding was observed among cells in G1 phase. Binding of antibody to DNA in HN2-treated cells was eliminated by single-strand (ss) specific S1 nuclease. In competition assay, antibody was inhibited by thermally denatured DNA, but not by native double-stranded (ds) DNA, RNA, nucleosides and deoxyribohomopolymers. Immunoreactivity of cells with the monoclonal antibody F7-26 may be a useful probe for the assessment of cell damage induced by alkylating agents, especially in heterogeneous cell populations.« less

The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

PubMed

Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

2003-08-29

We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

Recognition of Histo-Blood Group Antigen-Like Carbohydrates in Lettuce by Human GII.4 Norovirus

PubMed Central

Gao, Xiang; Esseili, Malak A.; Lu, Zhongyan; Saif, Linda J.

2016-01-01

ABSTRACT Human norovirus (HuNoV) genogroup II genotype 4 (GII.4) strains account for about 80% of the gastroenteritis outbreaks in the United States. Contaminated food is a major transmission vehicle for this virus. In humans, pigs, and oysters, histo-blood group antigens (HBGAs) act as attachment factors for HuNoVs. In lettuce, although the virus-like particles (VLPs) of a GII.4 HuNoV were found to bind to cell wall carbohydrates, the exact binding site has not been investigated. Here, we show the presence of HBGA-like carbohydrates in the cell wall of lettuce. The digestion of lettuce leaves with cell wall-degrading enzymes exposed more binding sites and significantly increased the level of binding of GII.4 HuNoV VLPs. Competition assays showed that both the HBGA monoclonal antibody, recognizing the H type, and plant lectins, recognizing α-l-fucose in the H type, effectively inhibited VLP binding to lettuce tissues. Lettuce cell wall components were isolated and their NoV VLP binding characteristics were tested by enzyme-linked immunosorbent assays. The binding was inhibited by pretreatment of the lettuce cell wall materials with α-1,2-fucosidase. Collectively, our results indicate that H-type HBGA-like carbohydrates exist in lettuce tissues and that GII.4 HuNoV VLPs can bind the exposed fucose moiety, possibly in the hemicellulose component of the cell wall. IMPORTANCE Salad crops and fruits are increasingly recognized as vehicles for human norovirus (HuNoV) transmission. A recent study showed that HuNoVs specifically bind to the carbohydrates of the lettuce cell wall. Histo-blood group antigens (HBGAs) are carbohydrates and are known as the attachment factors for HuNoV infection in humans. In this study, we show the presence of HBGA-like carbohydrates in lettuce, to which HuNoVs specifically bind. These results suggest that specifically bound HuNoVs cannot be removed by simple washing, which may allow viral transmission to consumers. Our findings provide new information needed for developing potential inhibitors to block binding and prevent contamination. PMID:26969699

Recognition of Histo-Blood Group Antigen-Like Carbohydrates in Lettuce by Human GII.4 Norovirus.

PubMed

Gao, Xiang; Esseili, Malak A; Lu, Zhongyan; Saif, Linda J; Wang, Qiuhong

2016-05-15

Human norovirus (HuNoV) genogroup II genotype 4 (GII.4) strains account for about 80% of the gastroenteritis outbreaks in the United States. Contaminated food is a major transmission vehicle for this virus. In humans, pigs, and oysters, histo-blood group antigens (HBGAs) act as attachment factors for HuNoVs. In lettuce, although the virus-like particles (VLPs) of a GII.4 HuNoV were found to bind to cell wall carbohydrates, the exact binding site has not been investigated. Here, we show the presence of HBGA-like carbohydrates in the cell wall of lettuce. The digestion of lettuce leaves with cell wall-degrading enzymes exposed more binding sites and significantly increased the level of binding of GII.4 HuNoV VLPs. Competition assays showed that both the HBGA monoclonal antibody, recognizing the H type, and plant lectins, recognizing α-l-fucose in the H type, effectively inhibited VLP binding to lettuce tissues. Lettuce cell wall components were isolated and their NoV VLP binding characteristics were tested by enzyme-linked immunosorbent assays. The binding was inhibited by pretreatment of the lettuce cell wall materials with α-1,2-fucosidase. Collectively, our results indicate that H-type HBGA-like carbohydrates exist in lettuce tissues and that GII.4 HuNoV VLPs can bind the exposed fucose moiety, possibly in the hemicellulose component of the cell wall. Salad crops and fruits are increasingly recognized as vehicles for human norovirus (HuNoV) transmission. A recent study showed that HuNoVs specifically bind to the carbohydrates of the lettuce cell wall. Histo-blood group antigens (HBGAs) are carbohydrates and are known as the attachment factors for HuNoV infection in humans. In this study, we show the presence of HBGA-like carbohydrates in lettuce, to which HuNoVs specifically bind. These results suggest that specifically bound HuNoVs cannot be removed by simple washing, which may allow viral transmission to consumers. Our findings provide new information needed for developing potential inhibitors to block binding and prevent contamination. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Comprehensive analysis of T cell epitope discovery strategies using 17DD yellow fever virus structural proteins and BALB/c (H2d) mice model.

PubMed

Maciel, Milton; Kellathur, Srinivasan N; Chikhlikar, Pryia; Dhalia, Rafael; Sidney, John; Sette, Alessandro; August, Thomas J; Marques, Ernesto T A

2008-08-15

Immunomics research uses in silico epitope prediction, as well as in vivo and in vitro approaches. We inoculated BALB/c (H2d) mice with 17DD yellow fever vaccine to investigate the correlations between approaches used for epitope discovery: ELISPOT assays, binding assays, and prediction software. Our results showed a good agreement between ELISPOT and binding assays, which seemed to correlate with the protein immunogenicity. PREDBALB/c prediction software partially agreed with the ELISPOT and binding assay results, but presented low specificity. The use of prediction software to exclude peptides containing no epitopes, followed by high throughput screening of the remaining peptides by ELISPOT, and the use of MHC-biding assays to characterize the MHC restrictions demonstrated to be an efficient strategy. The results allowed the characterization of 2 MHC class I and 17 class II epitopes in the envelope protein of the YF virus in BALB/c (H2d) mice.

Characterization of the receptor-binding domain of Ebola glycoprotein in viral entry.

PubMed

Wang, Jizhen; Manicassamy, Balaji; Caffrey, Michael; Rong, Lijun

2011-06-01

Ebola virus infection causes severe hemorrhagic fever in human and non-human primates with high mortality. Viral entry/infection is initiated by binding of glycoprotein GP protein on Ebola virion to host cells, followed by fusion of virus-cell membrane also mediated by GP. Using an human immunodeficiency virus (HIV)-based pseudotyping system, the roles of 41 Ebola GP1 residues in the receptor-binding domain in viral entry were studied by alanine scanning substitutions. We identified that four residues appear to be involved in protein folding/structure and four residues are important for viral entry. An improved entry interference assay was developed and used to study the role of these residues that are important for viral entry. It was found that R64 and K95 are involved in receptor binding. In contrast, some residues such as I170 are important for viral entry, but do not play a major role in receptor binding as indicated by entry interference assay and/or protein binding data, suggesting that these residues are involved in post-binding steps of viral entry. Furthermore, our results also suggested that Ebola and Marburg viruses share a common cellular molecule for entry.

Diversity, Replication, Pathogenicity and Cell Biology of Crimean Congo Hemorrhagic Fever Virus

DTIC Science & Technology

2006-10-01

recombinant protein produced and purified in E . coli was able to bind to ssRNA in a dot blot filter binding assay. In order to identify domains in the N...Fig. 1. RNA binding domains of the N protein of CCHFV. The depicted GST-fusion proteins were expressed in E . coli and purified using a...detected and NSm protein produced after cleavage of the glycoprotein precursor in virus infected cells. The NSm is stable and transported to the Golgi

Highly sensitive and specific colorimetric detection of cancer cells via dual-aptamer target binding strategy.

PubMed

Wang, Kun; Fan, Daoqing; Liu, Yaqing; Wang, Erkang

2015-11-15

Simple, rapid, sensitive and specific detection of cancer cells is of great importance for early and accurate cancer diagnostics and therapy. By coupling nanotechnology and dual-aptamer target binding strategies, we developed a colorimetric assay for visually detecting cancer cells with high sensitivity and specificity. The nanotechnology including high catalytic activity of PtAuNP and magnetic separation & concentration plays a vital role on the signal amplification and improvement of detection sensitivity. The color change caused by small amount of target cancer cells (10 cells/mL) can be clearly distinguished by naked eyes. The dual-aptamer target binding strategy guarantees the detection specificity that large amount of non-cancer cells and different cancer cells (10(4) cells/mL) cannot cause obvious color change. A detection limit as low as 10 cells/mL with detection linear range from 10 to 10(5) cells/mL was reached according to the experimental detections in phosphate buffer solution as well as serum sample. The developed enzyme-free and cost effective colorimetric assay is simple and no need of instrument while still provides excellent sensitivity, specificity and repeatability, having potential application on point-of-care cancer diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

A cytoplasmic protein, bystin, interacts with trophinin, tastin, and cytokeratin and may be involved in trophinin-mediated cell adhesion between trophoblast and endometrial epithelial cells

PubMed Central

Suzuki, Nao; Zara, Jane; Sato, Takaaki; Ong, Edgar; Bakhiet, Nouna; Oshima, Robert G.; Watson, Kellie L.; Fukuda, Michiko N.

1998-01-01

Trophinin and tastin form a cell adhesion molecule complex that potentially mediates an initial attachment of the blastocyst to uterine epithelial cells at the time of implantation. Trophinin and tastin, however, do not directly bind to each other, suggesting the presence of an intermediary protein. The present study identifies a cytoplasmic protein, named bystin, that directly binds trophinin and tastin. Bystin consists of 306 amino acid residues and is predicted to contain tyrosine, serine, and threonine residues in contexts conforming to motifs for phosphorylation by protein kinases. Database searches revealed a 53% identity of the predicted peptide sequence with the Drosophila bys (mrr) gene. Direct protein–protein interactions of trophinin, tastin, and bystin analyzed by yeast two-hybrid assays and by in vitro protein binding assays indicated that binding between bystin and trophinin and between bystin and tastin is enhanced when cytokeratin 8 and 18 are present as the third molecule. Immunocytochemistry of bystin showed that bystin colocalizes with trophinin, tastin, and cytokeratins in a human trophoblastic teratocarcinoma cell, HT-H. It is therefore possible that these molecules form a complex and thus are involved in the process of embryo implantation. PMID:9560222

Bacteroides gingivalis-Actinomyces viscosus cohesive interactions as measured by a quantitative binding assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwarz, S.; Ellen, R.P.; Grove, D.A.

1987-10-01

There is limited evidence, mostly indirect, to suggest that the adherence of Bacteroides gingivalis to teeth may be enhanced by the presence of gram-positive dental plaque bacteria like Actinomyces viscosus. The purpose of this study was to carry out direct quantitative assessments of the cohesion of B gingivalis and A. viscosus by using an in vitro assay modeled on the natural sequence in which these two species colonize the teeth. The assay allowed comparisons to be made of the adherence of /sup 3/H-labeled B. gingivalis 2561 and 381 to saliva-coated hydroxyapatite beads (S-HA) and A. viscosus WVU627- or T14V-coated S-HAmore » (actinobeads) in equilibrium and kinetics binding studies. A series of preliminary binding studies with 3H-labeled A. viscosus and parallel studies by scanning electron microscopy with unlabeled A. viscosus were conducted to establish a protocol by which actinobeads suitable for subsequent Bacteroides adherence experiments could be prepared. By scanning electron microscopy, the actinobeads had only small gaps of exposed S-HA between essentially irreversibly bound A. viscosus cells. Furthermore, B. gingivalis cells appeared to bind preferentially to the Actinomyces cells instead of the exposed S-HA. B. gingivalis binding to both S-HA and actinobeads was saturable with at least 2 X 10(9) to 3 X 10(9) cells per ml, and equilibrium with saturating concentrations was reached within 10 to 20 min. B. gingivalis always bound in greater numbers to the actinobeads than to S-HA. These findings provide direct measurements supporting the concept that cohesion with dental plaque bacteria like A. viscosus may foster the establishment of B. gingivalis on teeth by enhancing its adherence.« less

Discovery of potent and selective cytotoxic activity of new quinazoline-ureas against TMZ-resistant glioblastoma multiforme (GBM).

PubMed

Elkamhawy, Ahmed; Viswanath, Ambily Nath Indu; Pae, Ae Nim; Kim, Hyeon Young; Heo, Jin-Chul; Park, Woo-Kyu; Lee, Chong-Ock; Yang, Heekyoung; Kim, Kang Ho; Nam, Do-Hyun; Seol, Ho Jun; Cho, Heeyeong; Roh, Eun Joo

2015-10-20

Herein, we report new quinazoline-urea based compounds with potent cytotoxic activities against TMZ-resistant glioblastoma multiforme (GBM) cells. Low micromolar IC₅₀ values were exhibited over a panel of three primary GBM patient-derived cell cultures belonging to proneural (GBM-1), mesenchymal (GBM-2), and classical (GBM-3) subtypes. Eight compounds showed excellent selectivity indices for GBM cells comparing to a normal astrocyte cell line. In JC-1 assay, analogues 11, 12, 20, 22, and 24 exerted promising rates of mPTP opening induction towards proneural GBM subtype. Compounds 11, 20, and 24 bound to the translocator protein 18 kDa (TSPO) in submicromolar range using [(3)H] PK-11195 binding affinity assay. A homology model was built and docked models of 11, 12, 20, 22 and 24 were generated for describing their plausible binding modes in TSPO. In 3D clonogenic assay, compound 20 manifested potent tumoricidal effects on TMZ-resistant GBM cells even at submicromolar concentrations. In addition, CYP450 and hERG assays presented a safe toxicity profile of 20. Taken as a whole, this report presents compound 20 as a potent, selective and safe GBM cytotoxic agent which constitutes a promising direction against TMZ-resistant GBM. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Endocrine disrupters--testing strategies to assess human hazard.

PubMed

Baker, V A

2001-01-01

During the last decade an hypothesis has been developed linking certain chemicals (natural and synthetic) to observed and suspected adverse effects on reproduction in both wildlife and humans. The issue of 'endocrine disruption' originally focused on chemicals that mimic the action of the natural hormone oestrogen. However, the concern is now encompassing effects on the whole endocrine system. In response to public awareness, regulatory agencies (including the US EPA) and the OECD are formulating potential testing strategies and have begun the process of validating defined tests to systematically assess chemicals for their endocrine-disrupting activities. In order to investigate chemicals that have the potential to cause endocrine disruption, a large number of in vitro and in vivo assays have been identified. In vitro test systems (particularly when used in combination) offer the possibility of providing an early screen for large numbers of chemicals and can be useful in characterising the mechanism of action and potency. In vitro assays in widespread use for the screening/characterisation of endocrine disrupting potential include hormone receptor ligand binding assays (determination of the ability of a chemical to bind to the hormone receptor), cell proliferation assays (analysis of the ability of a chemical to stimulate growth of oestrogen sensitive cells), reporter gene assays in yeast or mammalian cells (analysis of the ability of a chemical to stimulate the transcription of a reporter gene construct in cell culture), and the analysis of the regulation of endogenous oestrogen sensitive genes in cell lines. However, in vitro assays do not always reliably predict the outcome in vivo due to differences in metabolic capabilities of the test systems used and the diverse range of mechanisms by which endocrine disrupting chemicals may act. Therefore a complementary battery of short- and long-term in vitro and in vivo assays (that assess both receptor and non-receptor mediated mechanisms of action) seems the most appropriate way at present of assessing the potential endocrine disrupting activities of chemicals. At Unilever we have used a combination of in vitro assays (receptor binding, reporter gene and cell proliferation assays) together with short-term in vivo tests (uterotrophic assay in immature rodents) to examine the oestrogenic potential of a large number of chemicals. An evaluation of the advantages and limitations of these methods is provided. Finally, any potential test system needs to be validated and standardized before the information generated can be for the identification of hazard, and possibly for risk assessment purposes.

Regulation of the mouse Treacher Collins syndrome homolog (Tcof1) promoter through differential repression of constitutive expression.

PubMed

Shows, Kathryn H; Shiang, Rita

2008-11-01

Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell-specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell-specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from -253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter.

Detecting drug-target binding in cells using fluorescence-activated cell sorting coupled with mass spectrometry analysis.

PubMed

Wilson, Kris; Webster, Scott P; Iredale, John P; Zheng, Xiaozhong; Homer, Natalie Z; Pham, Nhan T; Auer, Manfred; Mole, Damian J

2017-12-15

The assessment of drug-target engagement for determining the efficacy of a compound inside cells remains challenging, particularly for difficult target proteins. Existing techniques are more suited to soluble protein targets. Difficult target proteins include those with challenging in vitro solubility, stability or purification properties that preclude target isolation. Here, we report a novel technique that measures intracellular compound-target complex formation, as well as cellular permeability, specificity and cytotoxicity-the toxicity-affinity-permeability-selectivity (TAPS) technique. The TAPS assay is exemplified here using human kynurenine 3-monooxygenase (KMO), a challenging intracellular membrane protein target of significant current interest. TAPS confirmed target binding of known KMO inhibitors inside cells. We conclude that the TAPS assay can be used to facilitate intracellular hit validation on most, if not all intracellular drug targets.

Detecting drug-target binding in cells using fluorescence-activated cell sorting coupled with mass spectrometry analysis

NASA Astrophysics Data System (ADS)

Wilson, Kris; Webster, Scott P.; Iredale, John P.; Zheng, Xiaozhong; Homer, Natalie Z.; Pham, Nhan T.; Auer, Manfred; Mole, Damian J.

2018-01-01

The assessment of drug-target engagement for determining the efficacy of a compound inside cells remains challenging, particularly for difficult target proteins. Existing techniques are more suited to soluble protein targets. Difficult target proteins include those with challenging in vitro solubility, stability or purification properties that preclude target isolation. Here, we report a novel technique that measures intracellular compound-target complex formation, as well as cellular permeability, specificity and cytotoxicity-the toxicity-affinity-permeability-selectivity (TAPS) technique. The TAPS assay is exemplified here using human kynurenine 3-monooxygenase (KMO), a challenging intracellular membrane protein target of significant current interest. TAPS confirmed target binding of known KMO inhibitors inside cells. We conclude that the TAPS assay can be used to facilitate intracellular hit validation on most, if not all intracellular drug targets.

[AntiEGFRnano inhibites proliferation and migration of estrogen-dependent Ishikawa cells of human endometrial cancer cell line].

PubMed

Diao, Zhen-yu; Lu, Wu-guang; Cao, Peng; Hu, Yun-long; Zhou, Xing; Xue, Ping-ping; Shen, Li; Sun, Hai-xiang

2012-10-01

Nanobody is a kind of antibody from camel, which misses light chain. Nanobody has the same antigen binding specificity and affinity as mAb. Moreover, because of its small molecular weight, high stability and easy preparation, nanobody has great value of biomedical applications. In this study, we successfully prepared highly pure antiEGFR nanobody in E.coli using genetic engineering techniques. Cell proliferation assay (CCK-8 assay) and migration experiments (cell scratch test and Transwell assay) indicated that the recombinant antiEGFRnano can significantly inhibit the proliferation and migration of endometrial cancer cells. These results provide a new way of thinking and methods for EGFR-targeted therapy of endometrial cancer.

Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination.

PubMed

Ren, Xiao-Min; Guo, Liang-Hong; Gao, Yu; Zhang, Bin-Tian; Wan, Bin

2013-05-01

Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effect on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2'-OH-BDE-28, 3'-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3'-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. Copyright © 2013 Elsevier Inc. All rights reserved.

In Vivo Chromatin Targets of the Transcription Factor Yin Yang 2 in Trophoblast Stem Cells

PubMed Central

Pérez-Palacios, Raquel; Macías-Redondo, Sofía; Climent, María; Contreras-Moreira, Bruno; Muniesa, Pedro; Schoorlemmer, Jon

2016-01-01

Background Yin Yang 2 (YY2) is a zinc finger protein closely related to the well-characterized Yin Yang 1 (YY1). YY1 is a DNA-binding transcription factor, with defined functions in multiple developmental processes, such as implantation, cell differentiation, X inactivation, imprinting and organogenesis. Yy2 has been treated as a largely immaterial duplication of Yy1, as they share high homology in the Zinc Finger-region and similar if not identical in vitro binding sites. In contrast to these similarities, gene expression alterations in HeLa cells with attenuated levels of either Yy1 or Yy2 were to some extent gene-specific. Moreover, the chromatin binding sites for YY2, except for its association with transposable retroviral elements (RE) and Endogenous Retroviral Elements (ERVs), remain to be identified. As a first step towards defining potential Yy2 functions matching or complementary to Yy1, we considered in vivo DNA binding sites of YY2 in trophoblast stem (TS) cells. Results We report the presence of YY2 protein in mouse-derived embryonic stem (ES) and TS cell lines. Following up on our previous report on ERV binding by YY2 in TS cells, we investigated the tissue-specificity of REX1 and YY2 binding and confirm binding to RE/ERV targets in both ES cells and TS cells. Because of the higher levels of expression, we chose TS cells to understand the role of Yy2 in gene and chromatin regulation. We used in vivo YY2 association as a measure to identify potential target genes. Sequencing of chromatin obtained in chromatin-immunoprecipitation (ChIP) assays carried out with αYY2 serum allowed us to identify a limited number of chromatin targets for YY2. Some putative binding sites were validated in regular ChIP assays and gene expression of genes nearby was altered in the absence of Yy2. Conclusions YY2 binding to ERVs is not confined to TS cells. In vivo binding sites share the presence of a consensus binding motif. Selected sites were uniquely bound by YY2 as opposed to YY1, suggesting that YY2 exerts unique contributions to gene regulation. YY2 binding was not generally associated with gene promoters. However, several YY2 binding sites are linked to long noncoding RNA (lncRNA) genes and we show that the expression levels of a few of those are Yy2-dependent. PMID:27191592

Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

PubMed Central

Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

2003-01-01

Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

The Activation of the Rat Insulin Gene II by BETA2 and PDX-1 in Rat Insulinoma Cells Is Repressed by Pax6

PubMed Central

Wolf, Gabriele; Hessabi, Behnam; Karkour, Anke; Henrion, Ulrike; Dahlhaus, Meike; Ostmann, Annett; Giese, Bernd; Fraunholz, Martin; Grabarczyk, Piotr; Jack, Robert; Walther, Reinhard

2010-01-01

The transcriptional transactivator Pax6 binds the pancreatic islet cell-specific enhancer sequence (PISCES) of the rat insulin I gene. However the human, mouse, and rat insulin gene II promoters do not contain a PISCES element. To analyze the role of Pax6 in those PISCES-less promoters, we investigated its influence on rat insulin gene II expression and included in our studies the main activators: pancreatic and duodenal homeobox protein-1 (PDX-1) and BETA2/E47. Luciferase assays, Northern blots, and RIA were used to study effects of Pax6 overexpression, gel shift and chromatin precipitation assays to study its binding to the DNA, and yeast two-hybrid assays and glutathione S transferase capture assays to investigate its interactions with PDX-1 and BETA2. Finally, glucose-dependent intracellular transport of Pax6 was demonstrated by fluorescence microscopy. Overexpression of Pax6 prevents activation of the rat insulin II gene by BETA2 and PDX-1 and hence suppresses insulin synthesis and secretion. In vitro, Pax6 binds to the A-boxes, thereby blocking binding of PDX-1, and at the same time, its paired domain interacts with BETA2. Fluorescence microscopy demonstrated that the nuclear-cytoplasmic localization of Pax6 and PDX-1 are oppositely regulated by glucose. From the results, it is suggested that at low concentrations of glucose, Pax6 is localized in the nucleus and prevents the activation of the insulin gene by occupying the PDX-1 binding site and by interacting with BETA2. PMID:20943817

Comparative reactivity of human IgE to cynomolgus monkey and human effector cells and effects on IgE effector cell potency

PubMed Central

Saul, Louise; Saul, Louise; Josephs, Debra H; Josephs, Debra H; Cutler, Keith; Cutler, Keith; Bradwell, Andrew; Bradwell, Andrew; Karagiannis, Panagiotis; Karagiannis, Panagiotis; Selkirk, Chris; Selkirk, Chris; Gould, Hannah J; Gould, Hannah J; Jones, Paul; Jones, Paul; Spicer, James F; Spicer, James F; Karagiannis, Sophia N; Karagiannis, Sophia N

2014-01-01

Background: Due to genetic similarities with humans, primates of the macaque genus such as the cynomolgus monkey are often chosen as models for toxicology studies of antibody therapies. IgE therapeutics in development depend upon engagement with the FcεRI and FcεRII receptors on immune effector cells for their function. Only limited knowledge of the primate IgE immune system is available to inform the choice of models for mechanistic and safety evaluations.   Methods: The recognition of human IgE by peripheral blood lymphocytes from cynomolgus monkey and man was compared. We used effector cells from each species in ex vivo affinity, dose-response, antibody-receptor dissociation and potency assays. Results: We report cross-reactivity of human IgE Fc with cynomolgus monkey cells, and comparable binding kinetics to peripheral blood lymphocytes from both species. In competition and dissociation assays, however, human IgE dissociated faster from cynomolgus monkey compared with human effector cells. Differences in association and dissociation kinetics were reflected in effector cell potency assays of IgE-mediated target cell killing, with higher concentrations of human IgE needed to elicit effector response in the cynomolgus monkey system. Additionally, human IgE binding on immune effector cells yielded significantly different cytokine release profiles in each species. Conclusion: These data suggest that human IgE binds with different characteristics to human and cynomolgus monkey IgE effector cells. This is likely to affect the potency of IgE effector functions in these two species, and so has relevance for the selection of biologically-relevant model systems when designing pre-clinical toxicology and functional studies. PMID:24492303

Novel Multiplexed Assay for Identifying SH2 Domain Antagonists of STAT Family Proteins

PubMed Central

Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

2013-01-01

Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z’ values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors. PMID:23977103

Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.

PubMed

Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

2013-01-01

Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.

Sequence and characterization of cytoplasmic nuclear protein import factor p97

PubMed Central

1995-01-01

Nuclear location sequence-mediated binding of karyophilic proteins to the nuclear pore complexes is one of the earliest steps in nuclear protein import. We previously identified two cytosolic proteins that reconstitute this step in a permeabilized cell assay: the 54/56-kD NLS receptor and p97. A monoclonal antibody to p97 localizes the protein to the cytoplasm and the nuclear envelope. p97 is extracted from nuclear envelopes under the same conditions as the O-glycosylated nucleoporins indicating a tight association with the pore complex. The antibody inhibits import in a permeabilized cell assay but does not affect binding of karyophiles to the nuclear pore complex. Immunodepletion of p97 renders the cytosol inactive for import and identifies at least three other cytosolic proteins that interact with p97. cDNA cloning of p97 shows that it is a unique protein containing 23 cysteine residues. Recombinant p97 binds zinc and a bound metal ion is required for the nuclear envelope binding activity of the protein. PMID:7615630

Purification of FLAG-tagged Secreted Proteins from Mammalian Cells

PubMed Central

Itakura, Eisuke; Chen, Changchun; de Bono, Mario

2017-01-01

This protocol describes a method for purifying glycosylated FLAG-tagged secreted proteins with disulfide bonds from mammalian cells. The purified products can be used for various applications, such as ligand binding assays. PMID:29075655

ApoHRP-based assay to measure intracellular regulatory heme.

PubMed

Atamna, Hani; Brahmbhatt, Marmik; Atamna, Wafa; Shanower, Gregory A; Dhahbi, Joseph M

2015-02-01

The majority of the heme-binding proteins possess a "heme-pocket" that stably binds to heme. Usually known as housekeeping heme-proteins, they participate in a variety of metabolic reactions (e.g., catalase). Heme also binds with lower affinity to the "Heme-Regulatory Motifs" (HRM) in specific regulatory proteins. This type of heme binding is known as exchangeable or regulatory heme (RH). Heme binding to HRM proteins regulates their function (e.g., Bach1). Although there are well-established methods for assaying total cellular heme (e.g., heme-proteins plus RH), currently there is no method available for measuring RH independent of the total heme (TH). The current study describes and validates a new method to measure intracellular RH. This method is based on the reconstitution of apo-horseradish peroxidase (apoHRP) with heme to form holoHRP. The resulting holoHRP activity is then measured with a colorimetric substrate. The results show that apoHRP specifically binds RH but not with heme from housekeeping heme-proteins. The RH assay detects intracellular RH. Furthermore, using conditions that create positive (hemin) or negative (N-methyl protoporphyrin IX) controls for heme in normal human fibroblasts (IMR90), the RH assay shows that RH is dynamic and independent of TH. We also demonstrated that short-term exposure to subcytotoxic concentrations of lead (Pb), mercury (Hg), or amyloid-β (Aβ) significantly alters intracellular RH with little effect on TH. In conclusion the RH assay is an effective assay to investigate intracellular RH concentration and demonstrates that RH represents ∼6% of total heme in IMR90 cells.

A cytoplasmic long noncoding RNA LINC00470 as a new AKT activator to mediate glioblastoma cell autophagy.

PubMed

Liu, Changhong; Zhang, Yan; She, Xiaoling; Fan, Li; Li, Peiyao; Feng, Jianbo; Fu, Haijuan; Liu, Qing; Liu, Qiang; Zhao, Chunhua; Sun, Yingnan; Wu, Minghua

2018-06-04

Despite the overwhelming number of investigations on AKT, little is known about lncRNA on AKT regulation, especially in GBM cells. RNA-binding protein immunoprecipitation assay (RIP) and RNA pulldown were used to confirm the binding of LINC00470 and fused in sarcoma (FUS). Confocal imaging, co-immunoprecipitation (Co-IP) and GST pulldown assays were used to detect the interaction between FUS and AKT. EdU assay, CCK-8 assay, and intracranial xenograft assays were performed to demonstrate the effect of LINC00470 on the malignant phenotype of GBM cells. RT-qPCR and Western blotting were performed to test the effect of LINC00470 on AKT and pAKT. In this study, we demonstrated that LINC00470 was a positive regulator for AKT activation in GBM. LINC00470 bound to FUS and AKT to form a ternary complex, anchoring FUS in the cytoplasm to increase AKT activity. Higher pAKT activated by LINC00470 inhibited ubiquitination of HK1, which affected glycolysis, and inhibited cell autophagy. Furthermore, higher LINC00470 expression was associated with GBM tumorigenesis and poor patient prognosis. Our findings revealed a noncanonical AKT activation signaling pathway, i.e., LINC00470 directly interacts with FUS, serving as an AKT activator to promote GBM progression. LINC00470 has an important referential significance to evaluate the prognosis of patients.

Fusobacterium nucleatum binding to complement regulatory protein CD46 modulates the expression and secretion of cytokines and matrix metalloproteinases by oral epithelial cells.

PubMed

Mahtout, Hayette; Chandad, Fatiha; Rojo, Jose M; Grenier, Daniel

2011-02-01

Periodontitis is a chronic inflammatory disease that results in the destruction of the supporting tissues of the teeth. Gingival epithelial cells are an important mechanical barrier and participate in the host inflammatory response to periodontopathogens. The aim of the present study is to investigate the capacity of Fusobacterium nucleatum to bind to the complement regulatory protein CD46 expressed by oral epithelial cells and to determine the impact of the binding on the gene expression and protein secretion of interleukin (IL)-6, IL-8, and matrix metalloproteinase (MMP)-9 by oral epithelial cells. Binding of recombinant human CD46 to the surface of F. nucleatum was demonstrated by immunologic assays. After stimulation of oral epithelial cells with F. nucleatum, gene expression was determined by real-time polymerase chain reaction analysis while protein secretion was monitored by enzyme-linked immunosorbent assays. Heat and protease treatments of bacterial cells reduced CD46 binding. F. nucleatum-bound CD46 mediated the cleavage of C3b in the presence of factor I. Stimulating oral epithelial cells with F. nucleatum at a multiplicity of infection of 50 resulted in a significant upregulation of the gene expression and protein secretion of IL-6, IL-8, and MMP-9 by oral epithelial cells. However, pretreating the epithelial cells with an anti-CD46 polyclonal antibody attenuated the production of IL-6, IL-8, and MMP-9 in response to F. nucleatum. Such an inhibitory effect was not observed with non-specific antibodies. The present study demonstrates that F. nucleatum can bind the complement regulatory protein CD46. The interaction of F. nucleatum with epithelial cell surface CD46 may contribute to increasing the levels of proinflammatory mediators and MMPs in periodontal sites and consequently modulate tissue destruction.

Stereoselective HDAC inhibition from cysteine-derived zinc-binding groups.

PubMed

Butler, Kyle V; He, Rong; McLaughlin, Kathryn; Vistoli, Giulio; Langley, Brett; Kozikowski, Alan P

2009-08-01

A series of small-molecule histone deacetylase (HDAC) inhibitors, which feature zinc binding groups derived from cysteine, were synthesized. These inhibitors were tested against multiple HDAC isoforms, and the most potent, compound 10, was determined to have IC(50) values below 1 microM. The compounds were also tested in a cellular assay of oxidative stress-induced neurodegeneration. Many of the inhibitors gave near-complete protection against cell death at 10 microM without the neurotoxicity seen with hydroxamic acid-based inhibitors, and were far more neuroprotective than HDAC inhibitors currently in clinical trials. Both enantiomers of cysteine were used in the synthesis of a variety of novel zinc-binding groups (ZBGs). Derivatives of L-cysteine were active in the HDAC inhibition assays, while the derivatives of D-cysteine were inactive. Notably, the finding that both the D- and L-cysteine derivatives were active in the neuroprotection assays suggests that multiple mechanisms are working to protect the neurons from cell death. Molecular modeling was employed to investigate the differences in inhibitory activity between the HDAC inhibitors generated from the two enantiomeric forms of cysteine.

Screening and Identification of a Phage Display Derived Peptide That Specifically Binds to the CD44 Protein Region Encoded by Variable Exons.

PubMed

Zhang, Dan; Jia, Huan; Li, Weiming; Hou, Yingchun; Lu, Shaoying; He, Shuixiang

2016-01-01

CD44, especially the isoforms with variable exons (CD44v), is a promising biomarker for the detection of cancer. To develop a CD44v-specific probe, we screened a 7-mer phage peptide library against the CD44v3-v10 protein using an improved subtractive method. The consensus sequences with the highest frequency (designated CV-1) emerged after four rounds of panning. The binding affinity and specificity of the CV-1 phage and the synthesized peptide for the region of CD44 encoded by the variable exons were confirmed using enzyme-linked immunosorbent assay and competitive inhibition assays. Furthermore, the binding of the CV-1 probe to gastric cancer cells and tissues was validated using immunofluorescence and immunohistochemistry assays. CV-1 sensitively and specifically bound to CD44v on cancer cells and tissues. Thus, CV-1 has the potential to serve as a promising probe for cancer molecular imaging and target therapy. © 2015 Society for Laboratory Automation and Screening.

Sp1-mediated transcription regulation of TAF-Ialpha gene encoding a histone chaperone.

PubMed

Asaka, Masamitsu N; Murano, Kensaku; Nagata, Kyosuke

2008-11-28

TAF-I, one of histone chaperones, consists of two subtypes, TAF-Ialpha and TAF-Ibeta. The histone chaperone activity of TAF-I is regulated by dimer patterns of these subtypes. TAF-Ibeta is expressed ubiquitously, while the expression level of TAF-Ialpha with less activity than TAF-Ibeta differs among cell types. It is, therefore, assumed that the expression level of TAF-Ialpha in a cell is important for the TAF-I activity level. Here, we found that TAF-Ialpha and TAF-Ibeta genes are under the control of distinct promoters. Reporter assays and gel shift assays demonstrated that Sp1 binds to three regions in the TAF-Ialpha promoter and two or all mutaions of the three Sp1 binding regions reduced the TAF-Ialpha promoter activity. ChIP assays demonstrated that Sp1 binds to the TAF-Ialpha promoter in vivo. Furthermore, the expression level of TAF-Ialpha mRNA was reduced by knockdown of Sp1 using siRNA method. These studies indicated that the TAF-Ialpha promoter is under the control of Sp1.

Vaccination of rhesus macaques with the anthrax vaccine adsorbed vaccine produces a serum antibody response that effectively neutralizes receptor-bound protective antigen in vitro.

PubMed

Clement, Kristin H; Rudge, Thomas L; Mayfield, Heather J; Carlton, Lena A; Hester, Arelis; Niemuth, Nancy A; Sabourin, Carol L; Brys, April M; Quinn, Conrad P

2010-11-01

Anthrax toxin (ATx) is composed of the binary exotoxins lethal toxin (LTx) and edema toxin (ETx). They have separate effector proteins (edema factor and lethal factor) but have the same binding protein, protective antigen (PA). PA is the primary immunogen in the current licensed vaccine anthrax vaccine adsorbed (AVA [BioThrax]). AVA confers protective immunity by stimulating production of ATx-neutralizing antibodies, which could block the intoxication process at several steps (binding of PA to the target cell surface, furin cleavage, toxin complex formation, and binding/translocation of ATx into the cell). To evaluate ATx neutralization by anti-AVA antibodies, we developed two low-temperature LTx neutralization activity (TNA) assays that distinguish antibody blocking before and after binding of PA to target cells (noncomplexed [NC] and receptor-bound [RB] TNA assays). These assays were used to investigate anti-PA antibody responses in AVA-vaccinated rhesus macaques (Macaca mulatta) that survived an aerosol challenge with Bacillus anthracis Ames spores. Results showed that macaque anti-AVA sera neutralized LTx in vitro, even when PA was prebound to cells. Neutralization titers in surviving versus nonsurviving animals and between prechallenge and postchallenge activities were highly correlated. These data demonstrate that AVA stimulates a myriad of antibodies that recognize multiple neutralizing epitopes and confirm that change, loss, or occlusion of epitopes after PA is processed from PA83 to PA63 at the cell surface does not significantly affect in vitro neutralizing efficacy. Furthermore, these data support the idea that the full-length PA83 monomer is an appropriate immunogen for inclusion in next-generation anthrax vaccines.

Inhibition of the EGFR/STAT3/CEBPD Axis Reverses Cisplatin Cross-resistance with Paclitaxel in the Urothelial Carcinoma of the Urinary Bladder.

PubMed

Wang, Wei-Jan; Li, Chien-Feng; Chu, Yu-Yi; Wang, Yu-Hui; Hour, Tzyh-Chyuan; Yen, Chia-Jui; Chang, Wen-Chang; Wang, Ju-Ming

2017-01-15

Cisplatin (CDDP) is frequently used in combination chemotherapy with paclitaxel for treating urothelial carcinoma of the urinary bladder (UCUB). CDDP cross-resistance has been suggested to develop with paclitaxel, thus hindering successful UCUB treatment. Therefore, elucidating the mechanisms underlying CDDP-induced anticancer drug resistance is imperative and may provide an insight in developing novel therapeutic strategy. Loss-of-function assays were performed to elucidate the role of the EGFR and STAT3 in CDDP-induced CCAAT/enhancer-binding protein delta (CEBPD) expression in UCUB cells. Reporter and in vivo DNA-binding assays were employed to determine whether CEBPD directly regulates ATP binding cassette subfamily B member 1 (ABCB1) and ATP binding cassette subfamily C member 2 (ABCC2) activation. Finally, a xenograft animal assay was used to examine the abilities of gefitinib and S3I-201 (a STAT3 inhibitor) to reverse CDDP and paclitaxel sensitivity. CEBPD expression was maintained in postoperative chemotherapy patients, and this expression was induced by CDDP even in CDDP-resistant UCUB cells. Upon CDDP treatment, CEBPD activated ABCB1 and ABCC2. Furthermore, the EGFR/STAT3 pathway contributed to CDDP-induced CEBPD expression in UCUB cells. Gefitinib and S3I-201 treatment significantly reduced the expression of CEBPD and enhanced the sensitivity of CDDP-resistant UCUB cells to CDDP and paclitaxel. Our results revealed the risk of CEBPD activation in CDDP-resistant UCUB cells and suggested a therapeutic strategy for patients with UCUB or UCUB resisted to CDDP and paclitaxel by combination with either gefitinib or S3I-201. Clin Cancer Res; 23(2); 503-13. ©2016 AACR. ©2016 American Association for Cancer Research.

Expression of σ receptors of human urinary bladder tumor cells (RT-4 cells) and development of a competitive receptor binding assay for the determination of ligand affinity to human σ(2) receptors.

PubMed

Schepmann, Dirk; Lehmkuhl, Kirstin; Brune, Stefanie; Wünsch, Bernhard

2011-07-15

A selective competitive binding assay for the determination of the affinity of compounds to the human σ(2) receptor using 96-well multiplates and a solid state scintillator was developed. In the assay system, [(3)H]ditolylguanidine (DTG) was used as radioligand and membrane homogenates from human RT-4 cells physiologically expressing σ(2) receptors served as receptor material. In order to block the interaction of the unselective radioligand [(3)H]DTG with σ(1) receptors, all experiments were performed in the presence of the σ(1) selective ligand (+)-pentazocine. The density of σ(2) receptors of the cells was analyzed by a saturation experiment with [(3)H]DTG. The radioligand [(3)H]DTG was bound to a single, saturable site on human σ(2) receptors, resulting in a B(max) value of 2108±162fmol/mg protein and K(d)-value of 8.3±2.0nM. The expression of competing σ(1) receptors was evaluated by performing a saturation experiment using the σ(1) selective radioligand [(3)H](+)-pentazocine, which resulted in a B(max) value of 279±40fmol/mg protein and K(d) value of 13.4±1.6nM. For validation of the σ(2) binding assay, the K(i)-values of four σ(2) ligands (ditolylguanidine, haloperidol, rimczole and BMY-14802) were determined with RT-4 cell membrane preparations. The K(i) values obtained from these experiments are in good accordance with the K(i)-values obtained with rat liver membrane preparations as receptor material and with K(i) values given in the literature. Copyright © 2011 Elsevier B.V. All rights reserved.

Identification of human leukemia antigen A*0201-restricted epitopes derived from epidermal growth factor pathway substrate number 8.

PubMed

Tang, Baishan; Zhou, Weijun; Du, Jingwen; He, Yanjie; Li, Yuhua

2015-08-01

T-cell-mediated immunotherapy of hematological malignancies requires selection of targeted tumor-associated antigens and T-cell epitopes contained in these tumor proteins. Epidermal growth factor receptor pathway substrate 8 (EPS8), whose function is pivotal for tumor proliferation, progression and metastasis, has been found to be overexpressed in most human tumor types, while its expression in normal tissue is low. The aim of the present study was to identify human leukemia antigen (HLA)-A*0201-restricted epitopes of EPS8 by using a reverse immunology approach. To achieve this, computer algorithms were used to predict HLA-A*0201 molecular binding, proteasome cleavage patterns as well as translocation of transporters associated with antigen processing. Candidate peptides were experimentally validated by T2 binding affinity assay and brefeldin-A decay assay. The functional avidity of peptide-specific cytotoxic T lymphocytes (CTLs) induced from peripheral blood mononuclear cells of healthy volunteers were evaluated by using an enzyme-linked immunosorbent spot assay and a cytotoxicity assay. Four peptides, designated as P455, P92, P276 and P360, had high affinity and stability of binding towards the HLA-A*0201 molecule, and specific CTLs induced by them significantly responded to the corresponding peptides and secreted IFN-γ. At the same time, the CTLs were able to specifically lyse EPS8-expressing cell lines in an HLA-A*0201-restricted manner. The present study demonstrated that P455, P92, P276 and P360 were CTL epitopes of EPS8, and were able to be used for epitope-defined adoptive T-cell transfer and multi-epitope-based vaccine design.

Discovery of a diaminoquinoxaline benzenesulfonamide antagonist of HIV-1 Nef function using a yeast-based phenotypic screen

PubMed Central

2013-01-01

Background HIV-1 Nef is a viral accessory protein critical for AIDS progression. Nef lacks intrinsic catalytic activity and binds multiple host cell signaling proteins, including Hck and other Src-family tyrosine kinases. Nef binding induces constitutive Hck activation that may contribute to HIV pathogenesis by promoting viral infectivity, replication and downregulation of cell-surface MHC-I molecules. In this study, we developed a yeast-based phenotypic screen to identify small molecules that inhibit the Nef-Hck complex. Results Nef-Hck interaction was faithfully reconstituted in yeast cells, resulting in kinase activation and growth arrest. Yeast cells expressing the Nef-Hck complex were used to screen a library of small heterocyclic compounds for their ability to rescue growth inhibition. The screen identified a dihydrobenzo-1,4-dioxin-substituted analog of 2-quinoxalinyl-3-aminobenzene-sulfonamide (DQBS) as a potent inhibitor of Nef-dependent HIV-1 replication and MHC-I downregulation in T-cells. Docking studies predicted direct binding of DQBS to Nef which was confirmed in differential scanning fluorimetry assays with recombinant purified Nef protein. DQBS also potently inhibited the replication of HIV-1 NL4-3 chimeras expressing Nef alleles representative of all M-group HIV-1 clades. Conclusions Our findings demonstrate the utility of a yeast-based growth reversion assay for the identification of small molecule Nef antagonists. Inhibitors of Nef function discovered with this assay, such as DQBS, may complement the activity of current antiretroviral therapies by enabling immune recognition of HIV-infected cells through the rescue of cell surface MHC-I. PMID:24229420

TrmFO, a Fibronectin-Binding Adhesin of Mycoplasma bovis.

PubMed

Guo, Yongpeng; Zhu, Hongmei; Wang, Jiayao; Huang, Jing; Khan, Farhan Anwar; Zhang, Jingjing; Guo, Aizhen; Chen, Xi

2017-08-09

Mycoplasma bovis is an important pathogenic mycoplasma, causing the cattle industry serious economic losses. Adhesion is a crucial step in the mycoplasmas' infection and colonization process; fibronectin (Fn), an extracellular matrix glycoprotein, is a molecular bridge between the bacterial adhesins and host cell receptors. The present study was designed to characterize the Fn-binding ability of methylenetetrahydrofolate-tRNA-(uracil-5-)-methyltransferase (TrmFO) and its role in M. bovis cytoadherence. The trmFO ( MBOV_RS00785 ) gene was cloned and expressed in E. coli BL21, and polyclonal antibodies against the recombinant TrmFO (rTrmFO) were raised in rabbits. Immunoblotting demonstrated that TrmFO was an immunogenic component, and the TrmFO expression was conserved in different M. bovis isolates. The mycoplasmacidal assay further showed that in the presence of complement, rabbit anti-recombinant TrmFO serum exhibited remarkable mycoplasmacidal efficacy. TrmFO was detected in both the M. bovis membrane and cytoplasm. By ligand dot blot and enzyme-linked immunosorbent assay (ELISA) binding assay, we found that rTrmFO bound Fn in a dose-dependent manner. Immunostaining visualized by confocal laser scanning microscopy showed that rTrmFO had capacity to adhere to the embryonic bovine lung (EBL) cells. In addition, the adhesion of M. bovis and rTrmFO to EBL cells could be inhibited by anti-rTrmFO antibodies. To the best of our knowledge, this is the first report to characterize the Fn-binding ability of TrmFO and its role in the bacterial adhesion to host cells.

TrmFO, a Fibronectin-Binding Adhesin of Mycoplasma bovis

PubMed Central

Guo, Yongpeng; Zhu, Hongmei; Wang, Jiayao; Huang, Jing; Khan, Farhan Anwar; Zhang, Jingjing; Guo, Aizhen; Chen, Xi

2017-01-01

Mycoplasma bovis is an important pathogenic mycoplasma, causing the cattle industry serious economic losses. Adhesion is a crucial step in the mycoplasmas’ infection and colonization process; fibronectin (Fn), an extracellular matrix glycoprotein, is a molecular bridge between the bacterial adhesins and host cell receptors. The present study was designed to characterize the Fn-binding ability of methylenetetrahydrofolate-tRNA-(uracil-5-)-methyltransferase (TrmFO) and its role in M. bovis cytoadherence. The trmFO (MBOV_RS00785) gene was cloned and expressed in E. coli BL21, and polyclonal antibodies against the recombinant TrmFO (rTrmFO) were raised in rabbits. Immunoblotting demonstrated that TrmFO was an immunogenic component, and the TrmFO expression was conserved in different M. bovis isolates. The mycoplasmacidal assay further showed that in the presence of complement, rabbit anti-recombinant TrmFO serum exhibited remarkable mycoplasmacidal efficacy. TrmFO was detected in both the M. bovis membrane and cytoplasm. By ligand dot blot and enzyme-linked immunosorbent assay (ELISA) binding assay, we found that rTrmFO bound Fn in a dose-dependent manner. Immunostaining visualized by confocal laser scanning microscopy showed that rTrmFO had capacity to adhere to the embryonic bovine lung (EBL) cells. In addition, the adhesion of M. bovis and rTrmFO to EBL cells could be inhibited by anti-rTrmFO antibodies. To the best of our knowledge, this is the first report to characterize the Fn-binding ability of TrmFO and its role in the bacterial adhesion to host cells. PMID:28792486

A novel compound inhibits rHDL assembly and blocks nascent HDL biogenesis downstream of apoAI binding to ABCA1 expressing cells

PubMed Central

Lyssenko, Nicholas N.; Brubaker, Gregory; Smith, Bradley D.; Smith, Jonathan D.

2011-01-01

Objective Nascent high-density lipoprotein (HDL) particles form from cellular lipids and extracellular lipid-free apolipoprotein AI (apoAI) in a process mediated by ATP-binding cassette transporter A1 (ABCA1). We have sought out compounds that inhibit nascent HDL biogenesis without affecting ABCA1 activity. Methods and Results Reconstituted HDL (rHDL) formation and cellular cholesterol efflux assays were used to show that two compounds that bond via hydrogen with phospholipids inhibit rHDL and nascent HDL production. In rHDL formation assays, the inhibitory effect of compound 1 (methyl 3α-acetoxy-7α,12α-di[(phenylaminocarbonyl)amino]-5β-cholan-24-oate), the more active of the two, depended on its ability to associate with phospholipids. In cell assays, compound 1 suppressed ABCA1-mediated cholesterol efflux to apoAI, the 18A peptide, and taurocholate with high specificity, without affecting ABCA1-independent cellular cholesterol efflux to HDL and endocytosis of acetylated low-density lipoprotein (AcLDL) and transferrin. Furthermore, compound 1 did not affect ABCA1 activity adversely, as ABCA1-mediated shedding of microparticles proceeded unabated and apoAI binding to ABCA1-expressing cells increased in its presence. Conclusions The inhibitory effects of compound 1 support a three-step model of nascent HDL biogenesis: plasma membrane remodeling by ABCA1, apoAI binding to ABCA1, and lipoprotein particle assembly. The compound inhibits the final step, causing accumulation of apoAI in ABCA1-expressing cells. PMID:21836073

Glycosylation-dependent binding of galectin-8 to activated leukocyte cell adhesion molecule (ALCAM/CD166) promotes its surface segregation on breast cancer cells.

PubMed

Fernández, Marisa M; Ferragut, Fátima; Cárdenas Delgado, Víctor M; Bracalente, Candelaria; Bravo, Alicia I; Cagnoni, Alejandro J; Nuñez, Myriam; Morosi, Luciano G; Quinta, Héctor R; Espelt, María V; Troncoso, María F; Wolfenstein-Todel, Carlota; Mariño, Karina V; Malchiodi, Emilio L; Rabinovich, Gabriel A; Elola, María T

2016-10-01

We previously demonstrated that the activated leukocyte cell adhesion molecule (ALCAM/CD166) can interact with galectin-8 (Gal-8) in endothelial cells. ALCAM is a member of the immunoglobulin superfamily that promotes homophilic and heterophilic cell-cell interactions. Gal-8 is a "tandem-repeat"-type galectin, known as a matricellular protein involved in cell adhesion. Here, we analyzed the physical interaction between both molecules in breast cancer cells and the functional relevance of this phenomenon. We performed binding assays by surface plasmon resonance to study the interaction between Gal-8 and the recombinant glycosylated ALCAM ectodomain or endogenous ALCAM from MDA-MB-231 breast cancer cells. We also analyzed the binding of ALCAM-silenced or control breast cancer cells to immobilized Gal-8 by SPR. In internalization assays, we evaluated the influence of Gal-8 on ALCAM surface localization. We showed that recombinant glycosylated ALCAM and endogenous ALCAM from breast carcinoma cells physically interacted with Gal-8 in a glycosylation-dependent fashion displaying a differential behavior compared to non-glycosylated ALCAM. Moreover, ALCAM-silenced breast cancer cells exhibited reduced binding to Gal-8 relative to control cells. Importantly, exogenously added Gal-8 provoked ALCAM segregation, probably trapping this adhesion molecule at the surface of breast cancer cells. Our data indicate that Gal-8 interacts with ALCAM at the surface of breast cancer cells through glycosylation-dependent mechanisms. A novel heterophilic interaction between ALCAM and Gal-8 is demonstrated here, suggesting its physiologic relevance in the biology of breast cancer cells. Copyright © 2016 Elsevier B.V. All rights reserved.

Pheromone induction of agglutination in Saccharomyces cerevisiae a cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Terrance, K.; Lipke, P.N.

1987-10-01

a-Agglutinin, the cell surface sexual agglutinin of yeast a cells, was assayed by its ability to bind its complementary agglutinin, ..cap alpha..-agglutinin. The specific binding of /sup 125/I-..cap alpha..-agglutinin to a cells treated with the sex pheromone ..cap alpha..-factor was 2 to 2.5 times that of binding to a cells not treated with ..cap alpha..-factor. Competition with unlabeled ..cap alpha..-agglutinin revealed that the increased binding was due to increased cell surface expression of a-agglutinin, with no apparent change in the binding constant. The increase in site number was similar to the increase in cellular agglutinability. Increased expression of a-agglutinin followedmore » the same kinetics as the increase in cellular agglutinability, with a 10-min lag followed by a 15- to 20-min response time. Induction kinetics were similar in cells in phases G1 and G2 of the cell cycle. Maximal expression levels were similar in cells treated with excess pheromone and in cells exposed to pheromone after destruction of constitutively expressed a-agglutinin.« less

Bone sialoprotein does not interact with pro-gelatinase A (MMP-2) or mediate MMP-2 activation

PubMed Central

2009-01-01

Background A recent model for activation of the zymogen form of matrix metalloproteinase 2 (MMP-2, also known as gelatinase A) has suggested that interactions between the SIBLING protein bone sialoprotein (BSP) and MMP-2 leads to conformational change in MMP-2 that initiates the conversion of the pro-enzyme into a catalytically active form. This model is particularly relevant to cancer cell metastasis to bone since BSP, bound to the αvβ3 integrin through its arginine-glycine-aspartic acid motif, could recruit MMP-2 to the cell surface. Methods We critically assessed the relationship between BSP and proMMP-2 and its activation using various forms of recombinant and purified BSP and MMP-2. Gelatinase and collagenase assays, fluorescence binding assays, real-time PCR, cell culture and pull-down assays were employed to test the model. Results Studies with a fluorogenic substrate for MMP-2 showed no activation of proMMP-2 by BSP. Binding and pull-down assays demonstrated no interaction between MMP-2 and BSP. While BSP-mediated invasiveness has been shown to depend on its integrin-binding RGD sequence, analysis of proMMP-2 activation and the level of membrane type 1 (MT1)-MMP in cells grown on a BSP substratum showed that the BSP-αvβ3 integrin interaction does not induce the expression of MT1-MMP. Conclusion These studies do not support a role for BSP in promoting metastasis through interactions with pro-MMP-2. PMID:19386107

Two complementary fluorimetric assays for the determination of aminoquinoline binding and uptake by human erythrocytes in vitro.

PubMed

Basilico, Nicoletta; Cortelezzi, Lucia; Serpellini, Chiara; Taramelli, Donatella; Omodeo-Salè, Fausta; Salè, Fausta

2009-02-15

We provide two simple low-cost and low-tech procedures to measure with good precision and accuracy the binding and internalization into human erythrocytes of chloroquine and other aminoquinolines. The methods are based on the high fluorescence of the quinoline ring and are complementary. Method A evaluates residual drugs in the supernatants of treated erythrocytes, whereas method B quantifies the total uptake by whole cells and the fraction bound to the membranes. Drug uptake is dose dependent and related to the number of erythrocytes. These assays could be useful when studying the cell interaction of quinoline-type compounds not available in the radioactive form.

Bisphenol AF and Bisphenol B Exert Higher Estrogenic Effects than Bisphenol A via G Protein-Coupled Estrogen Receptor Pathway.

PubMed

Cao, Lin-Ying; Ren, Xiao-Min; Li, Chuan-Hai; Zhang, Jing; Qin, Wei-Ping; Yang, Yu; Wan, Bin; Guo, Liang-Hong

2017-10-03

Numerous studies have indicated estrogenic disruption effects of bisphenol A (BPA) analogues. Previous mechanistic studies were mainly focused on their genomic activities on nuclear estrogen receptor pathway. However, their nongenomic effects through G protein-coupled estrogen receptor (GPER) pathway remain poorly understood. Here, using a SKBR3 cell-based fluorescence competitive binding assay, we found six BPA analogues bound to GPER directly, with bisphenol AF (BPAF) and bisphenol B (BPB) displaying much higher (∼9-fold) binding affinity than BPA. Molecular docking also demonstrated the binding of these BPA analogues to GPER. By measuring calcium mobilization and cAMP production in SKBR3 cells, we found the binding of these BPA analogues to GPER lead to the activation of subsequent signaling pathways. Consistent with the binding results, BPAF and BPB presented higher agonistic activity than BPA with the lowest effective concentration (LOEC) of 10 nM. Moreover, based on the results of Boyden chamber and wound-healing assays, BPAF and BPB displayed higher activity in promoting GPER mediated SKBR3 cell migration than BPA with the LOEC of 100 nM. Overall, we found two BPA analogues BPAF and BPB could exert higher estrogenic effects than BPA via GPER pathway at nanomolar concentrations.

Downregulation of HuR Inhibits the Progression of Esophageal Cancer through Interleukin-18.

PubMed

Xu, Xiaohui; Song, Cheng; Chen, Zhihua; Yu, Chenxiao; Wang, Yi; Tang, Yiting; Luo, Judong

2018-01-01

The purpose of this study was to investigate the effect of human antigen R (HuR) downregulation and the potential target genes of HuR on the progression of esophageal squamous cell carcinoma (ESCC). In this study, a proteomics assay was used to detect the expression of proteins after HuR downregulation, and a luciferase assay was used to detect the potential presence of a HuR binding site on the 3'-untranslated region (3'-UTR) of interleukin 18 (IL-18). In addition, colony formation assay, MTT, EdU incorporation assay, Western blot, flow cytometry, immunohistochemistry, transwell invasion assay, and wound healing assay were used. In the present study, we found that the expression of both HuR protein and mRNA levels were higher in tumor tissues than in the adjacent tissues. HuR downregulation significantly suppressed cell proliferation. In addition, the metastasis of esophageal cancer cells was inhibited, while the expression of E-cadherin was increased and the expression of matrix metalloproteinase (MMP) 2, MMP9, and vimentin was decreased after HuR knockdown. Moreover, silencing of HuR disturbed the cell cycle of ESCC cells mainly by inducing G1 arrest. Furthermore, proteomics analysis showed that downregulation of HuR in TE-1 cells resulted in 100 upregulated and 122 downregulated proteins, including IL-18 as a significantly upregulated protein. The expression of IL-18 was inversely regulated by HuR. IL-18 expression was decreased in ESCC tissues, and exogenous IL-18 significantly inhibited the proliferation and metastasis of ESCC cells. The 3'-UTR of IL-18 harbored a HuR binding site, as shown by an in vitro luciferase assay. HuR plays an important role in the progression of esophageal carcinoma by targeting IL-18, which may be a potential therapeutic target for the treatment of ESCC.

Candida albicans Adheres to Chitin by Recognizing N-acetylglucosamine (GlcNAc).

PubMed

Ishijima, Sanae A; Yamada, Tsuyoshi; Maruyama, Naho; Abe, Shigeru

2017-01-01

The binding of Candida albicans cells to chitin was examined in a cell-binding assay. Microscopic observations indicated that both living and heat-killed Candida cells bound to chitin-coated substrates. C. albicans preferentially bound to chitin-coated plastic plates over chitosan-coated and uncoated plates. We prepared 125 I-labeled Candida cells for quantitative analysis of their binding to chitin. Heat-killed 125 I-labeled Candida cells bound to chitin-coated plates in a time-dependent manner until 1.5 hours after start of incubation at 4℃. The binding of 125 I-labeled Candida cells to chitin-coated plates was inhibited by adding unlabeled living or unlabeled heat-killed Candida cells. The binding of Candida to chitin was also reduced by addition of 25 mg/ml chitin or chitosan up to 10%. N-acetylglucosamine (GlcNAc), which is a constituent of chitin, inhibited binding of Candida to chitin in a dose-dependent manner between 12.5 and 200 mM. Glucosamine, which is a constituent of chitosan, showed no such inhibitory effect. These findings suggest that the binding of Candida to chitin may be mediated by recognition of GlcNAc.

Fluorescent cellular assay for screening agents inhibiting Pseudomonas aeruginosa adherence.

PubMed

Nosková, Libuše; Kubíčková, Božena; Vašková, Lucie; Bláhová, Barbora; Wimmerová, Michaela; Stiborová, Marie; Hodek, Petr

2015-01-16

Antibodies against Pseudomonas aeruginosa (PA) lectin, PAIIL, which is a virulence factor mediating the bacteria binding to epithelium cells, were prepared in chickens and purified from egg yolks. To examine these antibodies as a prophylactic agent preventing the adhesion of PA we developed a well plate assay based on fluorescently labeled bacteria and immortalized epithelium cell lines derived from normal and cystic fibrosis (CF) human lungs. The antibodies significantly inhibited bacteria adhesion (up to 50%) in both cell lines. In agreement with in vivo data, our plate assay showed higher susceptibility of CF cells towards the PA adhesion as compared to normal epithelium. This finding proved the reliability of the developed experimental system.

A Novel Antiviral Target Structure Involved in the RNA Binding, Dimerization, and Nuclear Export Functions of the Influenza A Virus Nucleoprotein

PubMed Central

Yamada, Kazunori; Kondoh, Yasumitsu; Hikono, Hirokazu; Osada, Hiroyuki; Tomii, Kentaro; Saito, Takehiko; Aida, Yoko

2015-01-01

Developing antiviral therapies for influenza A virus (IAV) infection is an ongoing process because of the rapid rate of antigenic mutation and the emergence of drug-resistant viruses. The ideal strategy is to develop drugs that target well-conserved, functionally restricted, and unique surface structures without affecting host cell function. We recently identified the antiviral compound, RK424, by screening a library of 50,000 compounds using cell-based infection assays. RK424 showed potent antiviral activity against many different subtypes of IAV in vitro and partially protected mice from a lethal dose of A/WSN/1933 (H1N1) virus in vivo. Here, we show that RK424 inhibits viral ribonucleoprotein complex (vRNP) activity, causing the viral nucleoprotein (NP) to accumulate in the cell nucleus. In silico docking analysis revealed that RK424 bound to a small pocket in the viral NP. This pocket was surrounded by three functionally important domains: the RNA binding groove, the NP dimer interface, and nuclear export signal (NES) 3, indicating that it may be involved in the RNA binding, oligomerization, and nuclear export functions of NP. The accuracy of this binding model was confirmed in a NP-RK424 binding assay incorporating photo-cross-linked RK424 affinity beads and in a plaque assay evaluating the structure-activity relationship of RK424. Surface plasmon resonance (SPR) and pull-down assays showed that RK424 inhibited both the NP-RNA and NP-NP interactions, whereas size exclusion chromatography showed that RK424 disrupted viral RNA-induced NP oligomerization. In addition, in vitro nuclear export assays confirmed that RK424 inhibited nuclear export of NP. The amino acid residues comprising the NP pocket play a crucial role in viral replication and are highly conserved in more than 7,000 NP sequences from avian, human, and swine influenza viruses. Furthermore, we found that the NP pocket has a surface structure different from that of the pocket in host molecules. Taken together, these results describe a promising new approach to developing influenza virus drugs that target a novel pocket structure within NP. PMID:26222066

Alternatives to in vivo tests to detect endocrine disrupting chemicals (EDCs) in fish and amphibians--screening for estrogen, androgen and thyroid hormone disruption.

PubMed

Scholz, S; Renner, P; Belanger, S E; Busquet, F; Davi, R; Demeneix, B A; Denny, J S; Léonard, M; McMaster, M E; Villeneuve, D L; Embry, M R

2013-01-01

Endocrine disruption is considered a highly relevant hazard for environmental risk assessment of chemicals, plant protection products, biocides and pharmaceuticals. Therefore, screening tests with a focus on interference with estrogen, androgen, and thyroid hormone pathways in fish and amphibians have been developed. However, they use a large number of animals and short-term alternatives to animal tests would be advantageous. Therefore, the status of alternative assays for endocrine disruption in fish and frogs was assessed by a detailed literature analysis. The aim was to (i) determine the strengths and limitations of alternative assays and (ii) present conclusions regarding chemical specificity, sensitivity, and correlation with in vivo data. Data from 1995 to present were collected related to the detection/testing of estrogen-, androgen-, and thyroid-active chemicals in the following test systems: cell lines, primary cells, fish/frog embryos, yeast and cell-free systems. The review shows that the majority of alternative assays measure effects directly mediated by receptor binding or resulting from interference with hormone synthesis. Other mechanisms were rarely analysed. A database was established and used for a quantitative and comparative analysis. For example, a high correlation was observed between cell-free ligand binding and cell-based reporter cell assays, between fish and frog estrogenic data and between fish embryo tests and in vivo reproductive effects. It was concluded that there is a need for a more systematic study of the predictive capacity of alternative tests and ways to reduce inter- and intra-assay variability.

SH2 Binding Site Protection Assay: A Method for Identification of SH2 Domain Interaction Partners by Exploiting SH2 Mediated Phosphosite Protection.

PubMed

Jadwin, Joshua A

2017-01-01

Over the last two decades there has been a significant effort in the field to characterize the phosphosite binding specificities of SH2 domains with the goal of deciphering the pY signaling code. Although high throughput studies in various formats using most SH2 domains have collectively provided a rich resource of in vitro SH2-pTyr site specificity maps, this data can only be used approximate what is happening in the cell where protein concentrations and localization are not homogenous, as they are for in vitro experiments. Here we describe an in vivo approach, SH2 site protection assay, which can capture the pTyr binding specificity of SH2 domains in the cell. The basis of this approach is SH2-pY site protection, the ability of SH2 domains to prevent the PTP-dependent dephosphorylation of their pY site binding partners. We overexpress a tracer SH2 domain in cells and quantify the change in abundance of tyrosine phosphorylated sites using MS. Since the method is performed in vivo, it has the advantage of identifying SH2-pY interactions as they occur within in the cell.

Enhanced Peptide Radiotherapy of Prostate Cancer Using Targeted Adenoviral Vectors

DTIC Science & Technology

2004-06-01

regard to binding of 64Cu - octreotide. In vitro experiments were performed with DU-145 and PC-3 human prostate cancer cells. Expression levels of SSTR2...were determined using a 64Cu -octreotide saturation binding assay on cell membrane preparations. In vivo experiments were conducted in scid mice bearing...subcutaneous DU-l45 or PC-3 cells. AdSSTR2 was injected intratumorally followed 48 h later by an i.v. injection of 64Cu -octreotide. The mice were

NFκB- and AP-1-mediated DNA looping regulates matrix metalloproteinase-9 transcription in TNF-α-treated human leukemia U937 cells.

PubMed

Chen, Ying-Jung; Chang, Long-Sen

2015-10-01

The aim of this study is to explore the spatial association of critical genomic elements in the effect of TNF-α on matrix metalloproteinase-9 (MMP-9) expression in human leukemia U937 cells. TNF-α up-regulated MMP-9 protein expression and mRNA level in U937 cells, and Akt-mediated-NFκB/p65 activation and JNK-mediated c-Jun activation were proven to be involved in TNF-α-induced MMP-9 up-regulation. Promoter luciferase activity assay revealed that NFκB (nt-600) and AP-1 (nt-79) binding sites were crucial for TNF-α-induced transcription of MMP-9 gene. The results of a chromatin immunoprecipitation assay indicated that TNF-α reduced histone deacetylase-1 (HDAC-1) recruitment but increased p300 (a histone acetyltransferase) recruitment to MMP-9 promoter regions surrounding NFκB and AP-1 binding sites. Consistently, TNF-α increased enrichment of the acetylated histone H3 mark on MMP-9 promoter regions. DNA affinity purification assay revealed that p300 and HDAC1 could bind oligonucleotides containing AP-1/c-Jun and NFκB/p65 binding sites. Chromosome conformation capture assay showed that TNF-α stimulated chromosomal loops in the MMP-9 promoter via NFκB/p65 and AP-1/c-Jun. The p300-associated acetyltransferase activity was crucial for p65/c-Jun-mediated DNA looping, and inhibition of HDAC activity increased the level of DNA looping. Reduction in the level of DNA looping eliminated all TNF-α-stimulated MMP-9 up-regulation. Taken together, our data suggest that p65/c-Jun-mediated DNA looping is involved in TNF-α-induced MMP-9 up-regulation and that the recruitment of p300 or HDAC1 to NFκB and AP-1 binding sites modifies the level of DNA looping. Copyright © 2015 Elsevier B.V. All rights reserved.

Nuclear factor I-A represses expression of the cell adhesion molecule L1

PubMed Central

2009-01-01

Background The neural cell adhesion molecule L1 plays a crucial role in development and plasticity of the nervous system. Neural cells thus require precise control of L1 expression. Results We identified a full binding site for nuclear factor I (NFI) transcription factors in the regulatory region of the mouse L1 gene. Electrophoretic mobility shift assay (EMSA) showed binding of nuclear factor I-A (NFI-A) to this site. Moreover, for a brain-specific isoform of NFI-A (NFI-A bs), we confirmed the interaction in vivo using chromatin immunoprecipitation (ChIP). Reporter gene assays showed that in neuroblastoma cells, overexpression of NFI-A bs repressed L1 expression threefold. Conclusion Our findings suggest that NFI-A, in particular its brain-specific isoform, represses L1 gene expression, and might act as a second silencer of L1 in addition to the neural restrictive silencer factor (NRSF). PMID:20003413

Developing a novel fiber optic fluorescence device for multiplexed high-throughput cytotoxic screening.

PubMed

Lee, Dennis; Barnes, Stephen

2010-01-01

The need for new pharmacological agents is unending. Yet the drug discovery process has changed substantially over the past decade and continues to evolve in response to new technologies. There is presently a high demand to reduce discovery time by improving specific lab disciplines and developing new technology platforms in the area of cell-based assay screening. Here we present the developmental concept and early stage testing of the Ab-Sniffer, a novel fiber optic fluorescence device for high-throughput cytotoxicity screening using an immobilized whole cell approach. The fused silica fibers are chemically functionalized with biotin to provide interaction with fluorescently labeled, streptavidin functionalized alginate-chitosan microspheres. The microspheres are also functionalized with Concanavalin A to facilitate binding to living cells. By using lymphoma cells and rituximab in an adaptation of a well-known cytotoxicity protocol we demonstrate the utility of the Ab-Sniffer for functional screening of potential drug compounds rather than indirect, non-functional screening via binding assay. The platform can be extended to any assay capable of being tied to a fluorescence response including multiple target cells in each well of a multi-well plate for high-throughput screening.

Regulation of AR and (beta)-Catenin Signaling by Pin 1 in Prostate Cancer

DTIC Science & Technology

2006-10-01

hrs. cells were harvested for Luciferase reporter Assay. C, CV-1 cells were transfected with Renilla (2.5ng), G5-Luc (10ng), pBIND-LBD (50ng), pACT-AR...stimulation, cells were cultured in 5 to 10% CDS-FBS. Firefly and internal control Renilla lucif- erase activities were determined using a dual luciferase...reporter assay kit (Pro- mega, Madison, WI), and Renilla activities were not consistently affected by any of the cotransfected vectors. The firefly

Light-controlled cellular internalization and cytotoxicity of nucleic acid-binding agents. Studies in vitro and in zebrafish embryos

PubMed Central

Penas, Cristina; Sánchez, Mateo I.; Guerra-Varela, Jorge; Sanchez-Piñón, Laura; Vázquez, M. Eugenio; Mascareñas, José L.

2016-01-01

We have synthesized oligoarginine conjugates of selected DNA-binding agents (a bisbenzamidine, acridine and thiazole orange) and demonstrated that the DNA binding and cell internalization properties of such conjugates can be inhibited by appending a negatively charged oligoglutamic tail through a photolabile linker. Irradiation with UV light releases the parent octaarginine conjugates, thus restoring their cell internalization and biological activity. Preliminary assays using zebrafish embryos demonstrates the potential of this prodrug strategy for controlling in vivo cytotoxicity. PMID:26534774

Cytotoxic effect of achatinin(H) (lectin) from Achatina fulica against a human mammary carcinoma cell line (MCF7).

PubMed

Dharmu, Indra; Ramamurty, N; Kannan, Ramalingam; Babu, Mary

2007-01-01

The hemolymph-derived achatinin(H) (lectin) from Achatina fulica showed a marked cytotoxic effect on MCF7, a human mammary carcinoma cell line. IC(50) values as measured by the 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide assay for achatinin(H) ranged from 6 to 10 microg/ml in the MCF7 cells. MCF7 cells showed significant morphological changes leading to cell death. The above cell death was observed after 48 h of treatment with 8 microg/ml when compared to untreated cells. Alterations in the tumor marker enzymes, as well as in antioxidant enzymes, were observed after achatinin(H) treatment. The specificity and purity of the achatinin(H) was confirmed by the Western blot assay. Achatinin(H) binding to MCF7 cells was detected by anti-achatinin(H), and visualization of the achatinin(H) binding sites on confluent MCF7 cells was confirmed by flourescein isothiocyanate conjugated secondary antibody. MCF7-treated cells fluoresced, indicating the presence of achatinin(H) binding sites. Fluorescence-activated cell sorting analysis of the cell cycle showed a significant increase in S-phase in MCF7 cells after 48 h of achatinin(H) treatment. The cells were arrested in G(2)/M phase of the cell cycle after 48 h with significant changes in cell viability. Cellular damage was confirmed by agarose gel electrophoresis with the characteristic appearance of a DNA streak in treated MCF7 cells indicating the ongoing apoptosis.

Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction

PubMed Central

Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K.; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G.; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H.

2017-01-01

The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. PMID:27899623

Synthesis and biological evaluation of guanylhydrazone coactivator binding inhibitors for the estrogen receptor.

PubMed

LaFrate, Andrew L; Gunther, Jillian R; Carlson, Kathryn E; Katzenellenbogen, John A

2008-12-01

Most patients with hormone-responsive breast cancer eventually develop resistance to traditional antiestrogens such as tamoxifen, and this has become a major obstacle in their treatment. We prepared and characterized the activity of a series of 16 guanylhydrazone small molecules that are designed to block estrogen receptor (ER) activity through a non-traditional mechanism, by directly interfering with coactivator binding to agonist-liganded ER. The inhibitory activity of these compounds was determined in cell-based transcription assays using ER-responsive reporter gene and mammalian two-hybrid assays. Several of the compounds gave IC(50) values in the low micromolar range. Two secondary assays were used to confirm that these compounds were acting through the proposed non-traditional mode of estrogen inhibitory action and not as conventional antagonists at the ligand binding site.

Oleamide activates peroxisome proliferator-activated receptor gamma (PPARγ) in vitro.

PubMed

Dionisi, Mauro; Alexander, Stephen P H; Bennett, Andrew J

2012-05-14

Oleamide (ODA) is a fatty acid primary amide first identified in the cerebrospinal fluid of sleep-deprived cats, which exerts effects on vascular and neuronal tissues, with a variety of molecular targets including cannabinoid receptors and gap junctions. It has recently been reported to exert a hypolipidemic effect in hamsters. Here, we have investigated the nuclear receptor family of peroxisome proliferator-activated receptors (PPARs) as potential targets for ODA action. Activation of PPARα, PPARβ and PPARγ was assessed using recombinant expression in Chinese hamster ovary cells with a luciferase reporter gene assay. Direct binding of ODA to the ligand binding domain of each of the three PPARs was monitored in a cell-free fluorescent ligand competition assay. A well-established assay of PPARγ activity, the differentiation of 3T3-L1 murine fibroblasts into adipocytes, was assessed using an Oil Red O uptake-based assay. ODA, at 10 and 50 μM, was able to transactivate PPARα, PPARβ and PPARγ receptors. ODA bound to the ligand binding domain of all three PPARs, although complete displacement of fluorescent ligand was only evident for PPARγ, at which an IC50 value of 38 μM was estimated. In 3T3-L1 cells, ODA, at 10 and 20 μM, induced adipogenesis. We have, therefore, identified a novel site of action of ODA through PPAR nuclear receptors and shown how ODA should be considered as a weak PPARγ ligand in vitro.

Single-Cell Droplet Microfluidic Screening for Antibodies Specifically Binding to Target Cells.

PubMed

Shembekar, Nachiket; Hu, Hongxing; Eustace, David; Merten, Christoph A

2018-02-20

Monoclonal antibodies are a main player in modern drug discovery. Many antibody screening formats exist, each with specific advantages and limitations. Nonetheless, it remains challenging to screen antibodies for the binding of cell-surface receptors (the most important class of all drug targets) or for the binding to target cells rather than purified proteins. Here, we present a high-throughput droplet microfluidics approach employing dual-color normalized fluorescence readout to detect antibody binding. This enables us to obtain quantitative data on target cell recognition, using as little as 33 fg of IgG per assay. Starting with an excess of hybridoma cells releasing unspecific antibodies, individual clones secreting specific binders (of target cells co-encapsulated into droplets) could be enriched 220-fold after sorting 80,000 clones in a single experiment. This opens the way for therapeutic antibody discovery, especially since the single-cell approach is in principle also applicable to primary human plasma cells. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

S100A6 Protein Negatively Regulates CacyBP/SIP-Mediated Inhibition of Gastric Cancer Cell Proliferation and Tumorigenesis

PubMed Central

Zhang, Kun; Liang, Jie; Chuai, Yucai; Li, Yuan; Wang, Xiaoming

2012-01-01

Calcyclin-binding protein (CacyBP/SIP), identified on the basis of its ability to interact with S100 proteins in a calcium-dependent manner, was previously found to inhibit the proliferation and tumorigenesis of gastric cancer cells in our laboratory. Importantly, the effects of S100 proteins on the biological behavior of CacyBP/SIP in gastric cancer remain unclear. Herein, we report the construction of eukaryotic expression vectors for wild-type CacyBP/SIP and a truncated mutant lacking the S100 protein binding domain (CacyBP/SIPΔS100). The expressions of the wild-type and truncated recombinant proteins were demonstrated by transfection of MKN45 gastric cancer cells. Co-immunoprecipitation assays demonstrated interaction between S100A6 and wild-type CacyBP/SIP in MKN45 cells. Removal of the S100 protein binding domain dramatically reduced the affinity of CacyBP/SIP for S100 proteins as indicated by reduced co-immunoprecipitation of S100A6 by CacyBP/SIPΔS100. The MTT assay, FACS assay, clonogenic assay and tumor xenograft experiment were performed to assess the effect of CacyBP/SIP on cell growth and tumorigenesis in vitro and in vivo. Overexpression of CacyBP/SIP inhibited the proliferation and tumorigenesis of MKN45 gastric cancer cells; the proliferation and tumorigenesis rates were even further reduced by the expression of CacyBP/SIPΔS100. We also showed that S100 proteins negatively regulate CacyBP/SIP-mediated inhibition of gastric cancer cell proliferation, through an effect on β-catenin protein expression and transcriptional activation of Tcf/LEF. Although the underlying mechanism of action requires further investigation, this study provides new insight into the interaction between S100 proteins and CacyBP/SIP, which might enrich our knowledge of S100 proteins and be helpful for our understanding of the development of gastric cancer. PMID:22295074

Adhesive interactions of human multiple myeloma cell lines with different extracellular matrix molecules.

PubMed

Kibler, C; Schermutzki, F; Waller, H D; Timpl, R; Müller, C A; Klein, G

1998-06-01

Multiple myeloma represents a human B cell malignancy which is characterized by a predominant localization of the malignant cell clone within the bone marrow. With the exception of the terminal stage of the disease the myeloma tumor cells do not circulate in the peripheral blood. The bone marrow microenvironment is believed to play an important role in homing, proliferation and terminal differentiation of myeloma cells. Here we have studied the expression of several extracellular matrix (ECM) molecules in the bone marrow of multiple myeloma patients and analyzed their adhesive capacities with four different human myeloma-derived cell lines. All ECM molecules analyzed (tenascin, laminin, fibronectin, collagen types I, III, V and VI) could be detected in bone marrow cryostat sections of multiple myeloma patients. Adhesion assays showed that only laminin, the microfibrillar collagen type VI and fibronectin were strong adhesive components for the myeloma cell lines U266, IM-9, OPM-2 and NCI-H929. Tenascin and collagen type I were only weak adhesive substrates for these myeloma cells. Adhesion to laminin and fibronectin was beta 1-integrin-mediated since addition of anti-beta 1-integrin antibodies could inhibit the binding of the four different cell types to both matrix molecules. In contrast, integrins do not seem to be involved in binding of the myeloma cells to collagen type VI. Instead, inhibition of binding by heparin suggested that membrane-bound heparan sulfate proteoglycans are responsible ligands for binding to collagen type VI. Adhesion assays with several B-cell lines resembling earlier differentiation stages revealed only weak interactions with tenascin and no interactions with collagen type VI, laminin or fibronectin. In summary, the interactions of human myeloma cells with the extracellular matrix may explain the specific retention of the plasma cells within the bone marrow.

Assessing cellular efficacy of bromodomain inhibitors using fluorescence recovery after photobleaching

PubMed Central

2014-01-01

Background Acetylation of lysine residues in histone tails plays an important role in the regulation of gene transcription. Bromdomains are the readers of acetylated histone marks, and, consequently, bromodomain-containing proteins have a variety of chromatin-related functions. Moreover, they are increasingly being recognised as important mediators of a wide range of diseases. The first potent and selective bromodomain inhibitors are beginning to be described, but the diverse or unknown functions of bromodomain-containing proteins present challenges to systematically demonstrating cellular efficacy and selectivity for these inhibitors. Here we assess the viability of fluorescence recovery after photobleaching (FRAP) assays as a target agnostic method for the direct visualisation of an on-target effect of bromodomain inhibitors in living cells. Results Mutation of a conserved asparagine crucial for binding to acetylated lysines in the bromodomains of BRD3, BRD4 and TRIM24 all resulted in reduction of FRAP recovery times, indicating loss of or significantly reduced binding to acetylated chromatin, as did the addition of known inhibitors. Significant differences between wild type and bromodomain mutants for ATAD2, BAZ2A, BRD1, BRD7, GCN5L2, SMARCA2 and ZMYND11 required the addition of the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) to amplify the binding contribution of the bromodomain. Under these conditions, known inhibitors decreased FRAP recovery times back to mutant control levels. Mutation of the bromodomain did not alter FRAP recovery times for full-length CREBBP, even in the presence of SAHA, indicating that other domains are primarily responsible for anchoring CREBBP to chromatin. However, FRAP assays with multimerised CREBBP bromodomains resulted in a good assay to assess the efficacy of bromodomain inhibitors to this target. The bromodomain and extraterminal protein inhibitor PFI-1 was inactive against other bromodomain targets, demonstrating the specificity of the method. Conclusions Viable FRAP assays were established for 11 representative bromodomain-containing proteins that broadly cover the bromodomain phylogenetic tree. Addition of SAHA can overcome weak binding to chromatin, and the use of tandem bromodomain constructs can eliminate masking effects of other chromatin binding domains. Together, these results demonstrate that FRAP assays offer a potentially pan-bromodomain method for generating cell-based assays, allowing the testing of compounds with respect to cell permeability, on-target efficacy and selectivity. PMID:25097667

Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

PubMed Central

Pikler, G M; Webster, R A; Spelsberg, T C

1976-01-01

Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

Mannan-Binding Lectin Inhibits Candida albicans-Induced Cellular Responses in PMA-Activated THP-1 Cells through Toll-Like Receptor 2 and Toll-Like Receptor 4

PubMed Central

Yang, Jianbin; Zhao, Dongfang; Wang, Hongpo; Shao, Feng; Wang, Wenjun; Sun, Ruili; Ling, Mingzhi; Zhai, Jingjing; Song, Shijun

2013-01-01

Background Candida albicans (C. albicans), the most common human fungal pathogen, can cause fatal systemic infections under certain circumstances. Mannan-binding lectin (MBL),a member of the collectin family in the C-type lectin superfamily, is an important serum component associated with innate immunity. Toll-like receptors (TLRs) are expressed extensively, and have been shown to be involved in C. albicans-induced cellular responses. We first examined whether MBL modulated heat-killed (HK) C. albicans-induced cellular responses in phorbol 12-myristate 13-acetate (PMA)-activated human THP-1 macrophages. We then investigated the possible mechanisms of its inhibitory effect. Methodology/Principal Finding Enzyme-linked immunosorbent assay (ELISA) and reverse transcriptasepolymerase chain reaction (RT-PCR) analysis showed that MBL at higher concentrations (10–20 µg/ml) significantly attenuated C. albicans-induced chemokine (e.g., IL-8) and proinflammatory cytokine (e.g., TNF-α) production from PMA-activated THP-1 cells at both protein and mRNA levels. Electrophoretic mobility shift assay (EMSA) and Western blot (WB) analysis showed that MBL could inhibit C. albicans-induced nuclear factor-κB (NF-κB) DNA binding and its translocation in PMA-activated THP-1 cells. MBL could directly bind to PMA-activated THP-1 cells in the presence of Ca2+, and this binding decreased TLR2 and TLR4 expressions in C. albicans-induced THP-1 macrophages. Furthermore, the binding could be partially inhibited by both anti-TLR2 monoclonal antibody (clone TL2.1) and anti-TLR4 monoclonal antibody (clone HTA125). In addition, co-immunoprecipitation experiments and microtiter wells assay showed that MBL could directly bind to the recombinant soluble form of extracellular TLR2 domain (sTLR2) and sTLR4. Conclusions/Significance Our study demonstrates that MBL can affect proinflammatory cytokine and chemokine expressions by modifying C. albicans-/TLR-signaling pathways. This study supports an important role for MBL on the regulation of C. albicans-induced cellular responses. PMID:24391778

Solid-phase receptor binding assay for /sup 125/I-hCG

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bortolussi, M.; Selmin, O.; Colombatti, A.

1987-01-01

A solid-phase radioligand-receptor assay (RRA) to measure the binding of /sup 125/I-labelled human chorionic gonadotropin (/sup 125/I-hCG) to target cell membranes has been developed. The binding of /sup 125/I-hCG to membranes immobilized on the wells of microtitration plates reached a maximum at about 3 hours at 37 degrees C, was saturable, displayed a high affinity (Ka = 2.4 X 10(9) M-1) and was specifically inhibited by unlabelled hCG. In comparison with RRAs carried out with membranes in suspension, the solid-phase RRA is significantly simpler and much faster to perform as it avoids centrifugation or filtration procedures. The solid-phase RRA wasmore » adapted profitably to process large numbers of samples at the same time. It proved particularly useful as a screening assay to detect anti-hCG monoclonal antibodies with high inhibitory activity for binding of /sup 125/I-hCG to its receptors.« less

Changes in cell surface structure by viral transformation studied by binding of lectins differing in sugar specificity.

PubMed

Tsuda, M; Kurokawa, T; Takeuchi, M; Sugino, Y

1975-10-01

Changes in cell surface structure by viral transformation were studied by examining changes in the binding of various lectins differing in carbohydrate specificities. Binding of lectins was assayed directly using cells grown in coverslips. The following 125I-lectins were used: Concanavalin-A (specific for glucose and mannose), wheat germ agglutinin (specific for N-acetylglucosamine), castor bean agglutinin (specific for galactose), Wistaria floribunda agglutinin (specific for N-acetylgalactosamine), and soybean agglutinin (specific for N-acetyl-galactosamine). Cells for a clone, SS7, transformed by bovine adenovirus type-3, were found to bind 5 to 6 times more Wistaria floribunda agglutinin than the normal counterpart cells (clone C31, from C3H mouse kidney). In contrast, the binding of soybean agglutinin, which has a sugar specificity similar to Wistaria floribunda agglutinin, to normal and transformed cells was similar. The binding of wheat germ agglutinin and castor bean agglutinin, respectively, to normal and transformed cells was also similar. However, normal cells bound twice as much concanavalin-A as transformed cells. Only half as much Wistaria floribunda agglutinin was bound to transformed cells when they had been dispersed with EDTA. These changes in the number of lectin binding sites on transformation are thought to reflect alteration of the cell surface structure. The amount of lectins bound per cell decreased with increase in cell density, especially in the case of binding of Wistaria floribunda agglutinin to normal cells.

Lipid-binding analysis using a fat blot assay.

PubMed

Munnik, Teun; Wierzchowiecka, Magdalena

2013-01-01

Protein-lipid interactions play an important role in lipid metabolism, membrane trafficking and cell -signaling by regulating protein localization, activation, and function. The Fat Blot assay is a relatively simple and inexpensive method to examine these interactions using nitrocellulose membrane-immobilized lipids. The assay is adapted from the method by Dowler et al. (Sci STKE 129:pl6, 2002) and provides qualitative and quantitative information on the relative affinity with which a protein binds to a particular lipid. To perform a Fat Blot assay, serial dilutions of different phospholipids are spotted onto a nitrocellulose membrane. These membranes are then incubated with a lipid-binding protein possessing a GST (or other epitope) tag. The membranes are washed and the protein, which is bound to the membrane by virtue of its interaction with the lipid's head group, is detected by immunoblotting with an antibody against GST (or other epitope). The procedure only requires a few micrograms of protein and is quick, simple and cheap to perform.

Assaying Cellular Viability Using the Neutral Red Uptake Assay.

PubMed

Ates, Gamze; Vanhaecke, Tamara; Rogiers, Vera; Rodrigues, Robim M

2017-01-01

The neutral red uptake assay is a cell viability assay that allows in vitro quantification of xenobiotic-induced cytotoxicity. The assay relies on the ability of living cells to incorporate and bind neutral red, a weak cationic dye, in lysosomes. As such, cytotoxicity is expressed as a concentration-dependent reduction of the uptake of neutral red after exposure to the xenobiotic under investigation. The neutral red uptake assay is mainly used for hazard assessment in in vitro toxicology applications. This method has also been introduced in regulatory recommendations as part of 3T3-NRU-phototoxicity-assay, which was regulatory accepted in all EU member states in 2000 and in the OECD member states in 2004 as a test guideline (TG 432). The present protocol describes the neutral red uptake assay using the human hepatoma cell line HepG2, which is often employed as an alternative in vitro model for human hepatocytes. As an example, the cytotoxicity of acetaminophen and acetyl salicylic acid is assessed.

Mechanisms of diminished natural killer cell activity in pregnant women and neonates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baley, J.E.; Schacter, B.Z.

1985-05-01

Because alterations in natural killer (NK) activity in the perinatal period may be important in the maintenance of a healthy pregnancy, the mechanisms by which these alterations are mediated in neonates and in pregnant and postpartum women was examined. NK activity, as measured in a 4-hr /sup 51/Cr-release assay and compared with adult controls, is significantly diminished in all three trimesters of pregnancy and in immediately postpartum women. In postpartum women, NK activity appears to be higher than in pregnant women, although this does not reach statistical significance. Pregnant and postpartum women have normal numbers of large granular lymphocytes andmore » normal target cell binding in an agarose single cell assay but decreased lysis of the bound target cells. NK activity of mononuclear cells from postpartum women, in addition, demonstrate a shift in distribution to higher levels of resistance to gamma-irradiation. Further, sera from postpartum women cause a similar shift to increased radioresistance in mononuclear cells from adult controls. Because radioresistance is a property of interleukin 2-stimulated NK, the shift to radioresistance may represent lymphokine-mediated stimulation occurring during parturition. In contrast, cord blood cells have a more profound decrease in NK activity as determined by /sup 51/Cr-release assay and decreases in both binding and lysis of bound target cells in the single cell assay. The resistance of NK activity in cord cells to gamma-irradiation is also increased, as seen in postpartum women. Cord blood serum, however, did not alter radioresistance or inhibit NK activity. The results suggest that the observed diminished NK activity in pregnant women and neonates arise by different mechanisms: an absence of mature NK cells in the neonate and an alteration of the NK cell in pregnancy leading to decreased killing.« less

Respiratory Syncytial Virus (RSV): Neutralizing Antibody, a Correlate of Immune Protection.

PubMed

Piedra, Pedro A; Hause, Anne M; Aideyan, Letisha

2016-01-01

Assays that measure RSV-specific neutralizing antibody activity are very useful for evaluating vaccine candidates, performing seroprevalence studies, and detecting infection. Neutralizing antibody activity is normally measured by a plaque reduction neutralization assay or by a microneutralization assay with or without complement. These assays measure the functional capacity of serum (or other fluids) to neutralize virus infectivity in cells as compared to ELISA assays that only measure the binding capacity against an antigen. This chapter discusses important elements in standardization of the RSV-specific microneutralization assay for use in the laboratory.

B7H6-derived peptides trigger TNF-α-dependent immunostimulatory activity of lymphocytic NK92-MI cells.

PubMed

Phillips, Mariana; Romeo, Francesca; Bitsaktsis, Constantine; Sabatino, David

2016-09-01

The rise of biologics that can stimulate immune responses towards the eradication of tumors has led to the evolution of cancer-based immunotherapy. Representatively, B7H6 has been recently identified as a protein ligand on tumor cells that binds specifically to the NKp30 receptor and triggers NK cell-derived cytokine production, which ultimately leads to tumor cell lysis and death. In an effort to develop effective immunotherapy approaches, the rational design of a novel class of immunostimulatory peptides (IPs) derived from the binding interface of B7H6:NKp30 is described in this study. The IPs comprised the B7H6 active site sequence for NKp30 binding and immunostimulatory activity. An aminohexanoic acid linker was also introduced at the N-terminus of the peptides for FITC-labeling by Fmoc-solid phase peptide synthesis. The peptides were characterized by LCMS to confirm identities and purities >95%. The secondary structures of the peptides were examined by CD spectroscopy in H2 O, PBS and a H2 O:TFE mixture which demonstrated versatile peptide structures which transitioned from random coil (H2 O) to α-helical (PBS) and turn-type (H2 O:TFE) conformations. Their biological properties were then evaluated by flow cytometry, enzyme-linked immunosorbent assays (ELISAs), and cell death assays. The occupancy of the synthetic peptides to a human NK cell line demonstrated comparable binding relative to the natural NKp30 ligand, B7H6, and the human anti-NKp30 monoclonal antibody (mAb), in a concentration dependent manner. A competitive binding assay between the human anti-NKp30 mAb or B7H6, and the synthetic peptides, demonstrated partial displacement of the ligands upon anti-NKp30 mAb treatment, suggesting NKp30 receptor specificities by the synthetic peptides. Moreover, the immunostimulatory activity of B7H6 was demonstrated by the secretion of the pro-inflammatory cytokines tumor necrosis factor-alfa (TNF-α) and interferon gamma (IFN-γ) by the human NK cell line. The immunostimulatory effects of IPs on the NK cells was assessed by the production of TNF-α alone as IFN-γ was undetectable. In a cell death assay, the IPs were found to be nontoxic, without any observable evidence of early or late stage apoptosis within the NK92-MI cells. Taking these findings together, this novel class of synthetic peptides may prove to be a promising lead in the development of a peptide-based immunotherapy approach, especially against B7H6 expressing tumors. © 2016 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 658-672, 2016. © 2016 Wiley Periodicals, Inc.

The novel BH3 α-helix mimetic JY-1-106 induces apoptosis in a subset of cancer cells (lung cancer, colon cancer and mesothelioma) by disrupting Bcl-xL and Mcl-1 protein–protein interactions with Bak

PubMed Central

2013-01-01

Background It has been shown in many solid tumors that the overexpression of the pro-survival Bcl-2 family members Bcl-2/Bcl-xL and Mcl-1 confers resistance to a variety of chemotherapeutic agents. We designed the BH3 α-helix mimetic JY-1-106 to engage the hydrophobic BH3-binding grooves on the surfaces of both Bcl-xL and Mcl-1. Methods JY-1-106–protein complexes were studied using molecular dynamics (MD) simulations and the SILCS methodology. We have evaluated the in vitro effects of JY-1-106 by using a fluorescence polarization (FP) assay, an XTT assay, apoptosis assays, and immunoprecipitation and western-blot assays. A preclinical human cancer xenograft model was used to test the efficacy of JY-1-106 in vivo. Results MD and SILCS simulations of the JY-1-106–protein complexes indicated the importance of the aliphatic side chains of JY-1-106 to binding and successfully predicted the improved affinity of the ligand for Bcl-xL over Mcl-1. Ligand binding affinities were measured via an FP assay using a fluorescently labeled Bak-BH3 peptide in vitro. Apoptosis induction via JY-1-106 was evidenced by TUNEL assay and PARP cleavage as well as by Bax–Bax dimerization. Release of multi-domain Bak from its inhibitory binding to Bcl-2/Bcl-xL and Mcl-1 using JY-1-106 was detected via immunoprecipitation (IP) western blotting. At the cellular level, we compared the growth proliferation IC50s of JY-1-106 and ABT-737 in multiple cancer cell lines with various Bcl-xL and Mcl-1 expression levels. JY-1-106 effectively induced cell death regardless of the Mcl-1 expression level in ABT-737 resistant solid tumor cells, whilst toxicity toward normal human endothelial cells was limited. Furthermore, synergistic effects were observed in A549 cells using a combination of JY-1-106 and multiple chemotherapeutic agents. We also observed that JY-1-106 was a very effective agent in inducing apoptosis in metabolically stressed tumors. Finally, JY-1-106 was evaluated in a tumor-bearing nude mouse model, and was found to effectively repress tumor growth. Strong TUNEL signals in the tumor cells demonstrated the effectiveness of JY-1-106 in this animal model. No significant side effects were observed in mouse organs after multiple injections. Conclusions Taken together, these observations demonstrate that JY-1-106 is an effective pan-Bcl-2 inhibitor with very promising clinical potential. PMID:23680104

Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

PubMed

Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

2015-09-01

The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

Brittle Culm1, a COBRA-Like Protein, Functions in Cellulose Assembly through Binding Cellulose Microfibrils

PubMed Central

Zhang, Baocai; Liu, Xiangling; Yan, Meixian; Zhang, Lanjun; Shi, Yanyun; Zhang, Mu; Qian, Qian; Li, Jiayang; Zhou, Yihua

2013-01-01

Cellulose represents the most abundant biopolymer in nature and has great economic importance. Cellulose chains pack laterally into crystalline forms, stacking into a complicated crystallographic structure. However, the mechanism of cellulose crystallization is poorly understood. Here, via functional characterization, we report that Brittle Culm1 (BC1), a COBRA-like protein in rice, modifies cellulose crystallinity. BC1 was demonstrated to be a glycosylphosphatidylinositol (GPI) anchored protein and can be released into cell walls by removal of the GPI anchor. BC1 possesses a carbohydrate-binding module (CBM) at its N-terminus. In vitro binding assays showed that this CBM interacts specifically with crystalline cellulose, and several aromatic residues in this domain are essential for binding. It was further demonstrated that cell wall-localized BC1 via the CBM and GPI anchor is one functional form of BC1. X-ray diffraction (XRD) assays revealed that mutations in BC1 and knockdown of BC1 expression decrease the crystallite width of cellulose; overexpression of BC1 and the CBM-mutated BC1s caused varied crystallinity with results that were consistent with the in vitro binding assay. Moreover, interaction between the CBM and cellulose microfibrils was largely repressed when the cell wall residues were pre-stained with two cellulose dyes. Treating wild-type and bc1 seedlings with the dyes resulted in insensitive root growth responses in bc1 plants. Combined with the evidence that BC1 and three secondary wall cellulose synthases (CESAs) function in different steps of cellulose production as revealed by genetic analysis, we conclude that BC1 modulates cellulose assembly by interacting with cellulose and affecting microfibril crystallinity. PMID:23990797

Brittle Culm1, a COBRA-like protein, functions in cellulose assembly through binding cellulose microfibrils.

PubMed

Liu, Lifeng; Shang-Guan, Keke; Zhang, Baocai; Liu, Xiangling; Yan, Meixian; Zhang, Lanjun; Shi, Yanyun; Zhang, Mu; Qian, Qian; Li, Jiayang; Zhou, Yihua

2013-01-01

Cellulose represents the most abundant biopolymer in nature and has great economic importance. Cellulose chains pack laterally into crystalline forms, stacking into a complicated crystallographic structure. However, the mechanism of cellulose crystallization is poorly understood. Here, via functional characterization, we report that Brittle Culm1 (BC1), a COBRA-like protein in rice, modifies cellulose crystallinity. BC1 was demonstrated to be a glycosylphosphatidylinositol (GPI) anchored protein and can be released into cell walls by removal of the GPI anchor. BC1 possesses a carbohydrate-binding module (CBM) at its N-terminus. In vitro binding assays showed that this CBM interacts specifically with crystalline cellulose, and several aromatic residues in this domain are essential for binding. It was further demonstrated that cell wall-localized BC1 via the CBM and GPI anchor is one functional form of BC1. X-ray diffraction (XRD) assays revealed that mutations in BC1 and knockdown of BC1 expression decrease the crystallite width of cellulose; overexpression of BC1 and the CBM-mutated BC1s caused varied crystallinity with results that were consistent with the in vitro binding assay. Moreover, interaction between the CBM and cellulose microfibrils was largely repressed when the cell wall residues were pre-stained with two cellulose dyes. Treating wild-type and bc1 seedlings with the dyes resulted in insensitive root growth responses in bc1 plants. Combined with the evidence that BC1 and three secondary wall cellulose synthases (CESAs) function in different steps of cellulose production as revealed by genetic analysis, we conclude that BC1 modulates cellulose assembly by interacting with cellulose and affecting microfibril crystallinity.

Toward low-cost affinity reagents: lyophilized yeast-scFv probes specific for pathogen antigens.

PubMed

Gray, Sean A; Weigel, Kris M; Ali, Ibne K M; Lakey, Annie A; Capalungan, Jeremy; Domingo, Gonzalo J; Cangelosi, Gerard A

2012-01-01

The generation of affinity reagents, usually monoclonal antibodies, remains a critical bottleneck in biomedical research and diagnostic test development. Recombinant antibody-like proteins such as scFv have yet to replace traditional monoclonal antibodies in antigen detection applications, in large part because of poor performance of scFv in solution. To address this limitation, we have developed assays that use whole yeast cells expressing scFv on their surfaces (yeast-scFv) in place of soluble purified scFv or traditional monoclonal antibodies. In this study, a nonimmune library of human scFv displayed on the surfaces of yeast cells was screened for clones that bind to recombinant cyst proteins of Entamoeba histolytica, an enteric pathogen of humans. Selected yeast-scFv clones were stabilized by lyophilization and used in detection assay formats in which the yeast-scFv served as solid support-bound monoclonal antibodies. Specific binding of antigen to the yeast-scFv was detected by staining with rabbit polyclonal antibodies. In flow cytometry-based assays, lyophilized yeast-scFv reagents retained full binding activity and specificity for their cognate antigens after 4 weeks of storage at room temperature in the absence of desiccants or stabilizers. Because flow cytometry is not available to all potential assay users, an immunofluorescence assay was also developed that detects antigen with similar sensitivity and specificity. Antigen-specific whole-cell yeast-scFv reagents can be selected from nonimmune libraries in 2-3 weeks, produced in vast quantities, and packaged in lyophilized form for extended shelf life. Lyophilized yeast-scFv show promise as low cost, renewable alternatives to monoclonal antibodies for diagnosis and research.

Fatty Acid Binding Proteins Expressed at the Human Blood-Brain Barrier Bind Drugs in an Isoform-Specific Manner.

PubMed

Lee, Gordon S; Kappler, Katharina; Porter, Christopher J H; Scanlon, Martin J; Nicolazzo, Joseph A

2015-10-01

To examine the expression of fatty acid binding proteins (FABPs) at the human blood-brain barrier (BBB) and to assess their ability to bind lipophilic drugs. mRNA and protein expression of FABP subtypes in immortalized human brain endothelial (hCMEC/D3) cells were examined by RT-qPCR and Western blot, respectively. FABPs that were found in hCMEC/D3 cells (hFABPs) were recombinantly expressed and purified from Escherichia coli C41(DE3) cells. Drug binding to these hFABPs was assessed using a fluorescence assay, which measured the ability of a panel of lipophilic drugs to displace the fluorescent probe compound 1-anilinonaphthalene-8-sulfonic acid (ANS). hFABP3, 4 and 5 were expressed in hCMEC/D3 cells at the mRNA and protein level. The competitive ANS displacement assay demonstrated that, in general, glitazones preferentially bound to hFABP5 (Ki: 1.0-28 μM) and fibrates and fenamates preferentially bound to hFABP4 (Ki: 0.100-17 μM). In general, lipophilic drugs appeared to show weaker affinities for hFABP3 relative to hFABP4 and hFABP5. No clear correlation was observed between the molecular structure or physicochemical properties of the drugs and their ability to displace ANS from hFABP3, 4 and 5. hFABP3, 4 and 5 are expressed at the human BBB and bind differentially to a diverse range of lipophilic drugs. The unique expression and binding patterns of hFABPs at the BBB may therefore influence drug disposition into the brain.

Osthole inhibits the invasive ability of human lung adenocarcinoma cells via suppression of NF-κB-mediated matrix metalloproteinase-9 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kao, Shang-Jyh; School of Respiratory Therapy, Taipei Medical University, Taipei Taiwan; Su, Jen-Liang

The induction of matrix metalloproteinase (MMP)-9 is particularly important for the invasiveness of various cancer cells. Osthole, a natural coumarin derivative extracted from traditional Chinese medicines, is known to inhibit the proliferation of a variety of tumor cells, but the effect of osthole on the invasiveness of tumor cells is largely unknown. This study determines whether and by what mechanism osthole inhibits invasion in CL1-5 human lung adenocarcinoma cells. Herein, we found that osthole effectively inhibited the migratory and invasive abilities of CL1-5 cells. A zymographic assay showed that osthole inhibited the proteolytic activity of MMP-9 in CL1-5 cells. Inhibitionmore » of migration, invasion, and MMP2 and/or MMP-9 proteolytic activities was also observed in other lung adenocarcinoma cell lines (H1299 and A549). We further found that osthole inhibited MMP-9 expression at the messenger RNA and protein levels. Moreover, a chromatin immunoprecipitation assay showed that osthole inhibited the transcriptional activity of MMP-9 by suppressing the DNA binding activity of nuclear factor (NF)-κB in the MMP-9 promoter. Using reporter assays with point-mutated promoter constructs further confirmed that the inhibitory effect of osthole requires an NF-κB binding site on the MMP-9 promoter. Western blot and immunofluorescence assays demonstrated that osthole inhibited NF-κB activity by inhibiting IκB-α degradation and NF-κB p65 nuclear translocation. In conclusion, we demonstrated that osthole inhibits NF-κB-mediated MMP-9 expression, resulting in suppression of lung cancer cell invasion and migration, and osthole might be a potential agent for preventing the invasion and metastasis of lung cancer. -- Highlights: ► Osthole treatment inhibits lung adenocarcinoma cells migration and invasion. ► Osthole reduces the expression and proteolytic activity of MMP-9. ► Osthole inhibits MMP-9 transcription via suppression of NF-κB binding activity. ► Osthole inhibits IκBα degradation and NF-κB nucleus translocation. ► Osthole suppresses EMT by repressing vimentin and inducing E-cadherin expression.« less

Effects of egg-adaptation on receptor-binding and antigenic properties of recent influenza A (H3N2) vaccine viruses.

PubMed

Parker, Lauren; Wharton, Stephen A; Martin, Stephen R; Cross, Karen; Lin, Yipu; Liu, Yan; Feizi, Ten; Daniels, Rodney S; McCauley, John W

2016-06-01

Influenza A virus (subtype H3N2) causes seasonal human influenza and is included as a component of influenza vaccines. The majority of vaccine viruses are isolated and propagated in eggs, which commonly results in amino acid substitutions in the haemagglutinin (HA) glycoprotein. These substitutions can affect virus receptor-binding and alter virus antigenicity, thereby, obfuscating the choice of egg-propagated viruses for development into candidate vaccine viruses. To evaluate the effects of egg-adaptive substitutions seen in H3N2 vaccine viruses on sialic acid receptor-binding, we carried out quantitative measurement of virus receptor-binding using surface biolayer interferometry with haemagglutination inhibition (HI) assays to correlate changes in receptor avidity with antigenic properties. Included in these studies was a panel of H3N2 viruses generated by reverse genetics containing substitutions seen in recent egg-propagated vaccine viruses and corresponding cell culture-propagated wild-type viruses. These assays provide a quantitative approach to investigating the importance of individual amino acid substitutions in influenza receptor-binding. Results show that viruses with egg-adaptive HA substitutions R156Q, S219Y, and I226N, have increased binding avidity to α2,3-linked receptor-analogues and decreased binding avidity to α2,6-linked receptor-analogues. No measurable binding was detected for the viruses with amino acid substitution combination 156Q+219Y and receptor-binding increased in viruses where egg-adaptation mutations were introduced into cell culture-propagated virus. Substitutions at positions 156 and 190 appeared to be primarily responsible for low reactivity in HI assays with post-infection ferret antisera raised against 2012-2013 season H3N2 viruses. Egg-adaptive substitutions at position 186 caused substantial differences in binding avidity with an insignificant effect on antigenicity.

Discovery of a polystyrene binding peptide isolated from phage display library and its application in peptide immobilization.

PubMed

Qiang, Xu; Sun, Keyong; Xing, Lijun; Xu, Yifeng; Wang, Hong; Zhou, Zhengpin; Zhang, Juan; Zhang, Fang; Caliskan, Bilgen; Wang, Min; Qiu, Zheng

2017-06-01

Phage peptide display is a powerful technique for discovery of various target-specific ligands. However, target-unrelated peptides can often be obtained and cause ambiguous results. Peptide PB-TUP has been isolated repeatedly in our laboratory on different targets and we conducted a research on PB-TUP phage to investigate their binding properties and rate of propagation. ELISA and phage recovery assay demonstrated that PB-TUP phage had a significant superior affinity to polystyrene solid surface compared with control phage clones. In this study, some incidental bindings are excluded like blocking agents and non-specific binding of secondary antibodies. Propagation rate assays of the selected phage clones showed that the growth rate of PB-TUP phage was not superior to the control phages. Furthermore, the binding of PB-TUB to polystyrene was concentration dependent and varied with solution pH. Molecular modeling revealed that stable structures of α-helix and β-turn may contribute to the binding of PB-TUP to polystyrene plate. The PB-TUP sequence was fused to the N-terminus of peptide P2 and the fusion peptide significantly increased the binding affinity to polystyrene. The fusion peptide also enhanced the cell adhesion ability of peptide P2 with human umbilical vein endothelial cell (HUVEC). The addition of the polystyrene binding peptide provided a convenient method for peptide immobilization.

Binding determinants in the interplay between porcine aminopeptidase N and enterotoxigenic Escherichia coli F4 fimbriae.

PubMed

Xia, Pengpeng; Quan, Guomei; Yang, Yi; Zhao, Jing; Wang, Yiting; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Jianzhong; Liu, Siguo; Zhu, Guoqiang

2018-02-26

The binding of F4 + enterotoxigenic Escherichia coli (ETEC) and the specific receptor on porcine intestinal epithelial cells is the initial step in F4 + ETEC infection. Porcine aminopeptidase N (APN) is a newly discovered receptor for F4 fimbriae that binds directly to FaeG adhesin, which is the major subunit of the F4 fimbriae variants F4ab, F4ac, and F4ad. We used overlapping peptide assays to map the APN-FaeG binding sites, which has facilitated in the identifying the APN-binding amino acids that are located in the same region of FaeG variants, thereby limiting the major binding regions of APN to 13 peptides. To determine the core sequence motif, a panel of FaeG peptides with point mutations and FaeG mutants were constructed. Pull-down and binding reactivity assays using piglet intestines determined that the amino acids G159 of F4ab, N209 and L212 of F4ac, and A200 of F4ad were the critical residues for APN binding of FaeG. We further show using ELISA and confocal microscopy assay that amino acids 553-568, and 652-670 of the APN comprise the linear epitope for FaeG binding in all three F4 fimbriae variants.

SHP-1 Binds and Negatively Modulates the c-Kit Receptor by Interaction with Tyrosine 569 in the c-Kit Juxtamembrane Domain

PubMed Central

Kozlowski, Maya; Larose, Louise; Lee, Fai; Le, Duc Mingh; Rottapel, Robert; Siminovitch, Katherine A.

1998-01-01

The SH2 domain-containing SHP-1 tyrosine phosphatase has been shown to negatively regulate a broad spectrum of growth factor- and cytokine-driven mitogenic signaling pathways. Included among these is the cascade of intracellular events evoked by stem cell factor binding to c-Kit, a tyrosine kinase receptor which associates with and is dephosphorylated by SHP-1. Using a series of glutathione S-transferase (GST) fusion proteins containing either tyrosine-phosphorylated segments of the c-Kit cytosolic region or the SH2 domains of SHP-1, we have shown that SHP-1 interacts with c-Kit by binding selectively to the phosphorylated c-Kit juxtamembrane region and that the association of c-Kit with the larger of the two SHP-1 isoforms may be mediated through either the N-terminal or C-terminal SHP-1 SH2 domain. The results of binding assays with mutagenized GST-Kit juxtamembrane fusion proteins and competitive inhibition assays with phosphopeptides encompassing each c-Kit juxtamembrane region identified the tyrosine residue at position 569 as the major site for binding of SHP-1 to c-Kit and suggested that tyrosine 567 contributes to, but is not required for, this interaction. By analysis of Ba/F3 cells retrovirally transduced to express c-Kit receptors, phenylalanine substitution of c-Kit tyrosine residue 569 was shown to be associated with disruption of c-Kit–SHP-1 binding and induction of hyperproliferative responses to stem cell factor. Although phenylalanine substitution of c-Kit tyrosine residue 567 in the Ba/F3–c-Kit cells did not alter SHP-1 binding to c-Kit, the capacity of a second c-Kit-binding tyrosine phosphatase, SHP-2, to associate with c-Kit was markedly reduced, and the cells again showed hyperproliferative responses to stem cell factor. These data therefore identify SHP-1 binding to tyrosine 569 on c-Kit as an interaction pivotal to SHP-1 inhibitory effects on c-Kit signaling, but they indicate as well that cytosolic protein tyrosine phosphatases other than SHP-1 may also negatively regulate the coupling of c-Kit engagement to proliferation. PMID:9528781

Entry Inhibition of Influenza Viruses with High Mannose Binding Lectin ESA-2 from the Red Alga Eucheuma serra through the Recognition of Viral Hemagglutinin

PubMed Central

Sato, Yuichiro; Morimoto, Kinjiro; Kubo, Takanori; Sakaguchi, Takemasa; Nishizono, Akira; Hirayama, Makoto; Hori, Kanji

2015-01-01

Lectin sensitivity of the recent pandemic influenza A virus (H1N1-2009) was screened for 12 lectins with various carbohydrate specificity by a neutral red dye uptake assay with MDCK cells. Among them, a high mannose (HM)-binding anti-HIV lectin, ESA-2 from the red alga Eucheuma serra, showed the highest inhibition against infection with an EC50 of 12.4 nM. Moreover, ESA-2 exhibited a wide range of antiviral spectrum against various influenza strains with EC50s of pico molar to low nanomolar levels. Besides ESA-2, HM-binding plant lectin ConA, fucose-binding lectins such as fungal AOL from Aspergillus oryzae and AAL from Aleuria aurantia were active against H1N1-2009, but the potency of inhibition was of less magnitude compared with ESA-2. Direct interaction between ESA-2 and a viral envelope glycoprotein, hemagglutinin (HA), was demonstrated by ELISA assay. This interaction was effectively suppressed by glycoproteins bearing HM-glycans, indicating that ESA-2 binds to the HA of influenza virus through HM-glycans. Upon treatment with ESA-2, no viral antigens were detected in the host cells, indicating that ESA-2 inhibited the initial steps of virus entry into the cells. ESA-2 would thus be useful as a novel microbicide to prevent penetration of viruses such as HIV and influenza viruses to the host cells. PMID:26035023

RNA-binding Protein Trinucleotide repeat-containing 6A Regulates the Formation of Circular RNA 0006916, with Important Functions in Lung Cancer Cells.

PubMed

Dai, Xin; Zhang, Nan; Cheng, Ying; Yang, Ti; Chen, Yingnan; Liu, Zhenzhong; Wang, Zhishan; Yang, Chengfeng; Jiang, Yiguo

2018-05-03

Circular RNAs (circRNAs) are widespread and diverse endogenous RNAs distinct from traditional linear RNAs, which may regulate gene expression in eukaryotes. However, the function of human circRNAs, including their potential role in lung cancer, remains largely unknown. We screened the circRNA circ0006916, which was evidently down-regulated in 16HBE-T cells (anti-benzopyrene-trans-7, 8-dihydrodiol-9, 10-epoxide-transformed human bronchial epithelial cells), and in A549 and H460 cell lines. Silencing of circ0006916, but not its parental gene homer scaffolding protein 1 (HOMER1), promoted cell proliferation via speeding up the cell cycle process rather than by inhibiting apoptosis; conversely, overexpression of circ0006916 had the opposite effect. Luciferase screening assay indicated that circ0006916 bound to miR-522-3p and inhibited pleckstrin homology domain and leucine rich repeat protein phosphatase 1 (PHLPP1) activity. We also explored the effect of the RNA-binding protein trinucleotide repeat-containing 6A (TNRC6A) on circ0006916 production. Circ0006916 expression was decreased after silencing TNRC6A. TNRC6A bound to the intron regions around the circRNA-forming exons of circ0006916, as shown by RNA immunoprecipitation assay combined with sequencing analysis. The association of circ0006916 with TNRC6A was further verified by RNA pull-down assays. We then constructed a carrier and confirmed that TNRC6A binding to the flanked intron region of circ0006916 was necessary for generation of circ0006916. These results demonstrate that TNRC6A regulates the biogenesis of the circRNA circ0006916, which has a regulatory role in cell growth.

Volatile anesthetics, not intravenous anesthetic propofol bind to and attenuate the activation of platelet receptor integrin αIIbβ3.

PubMed

Yuki, Koichi; Bu, Weiming; Shimaoka, Motomu; Eckenhoff, Roderic

2013-01-01

In clinical reports, the usage of isoflurane and sevoflurane was associated with more surgical field bleeding in endoscopic sinus surgeries as compared to propofol. The activation of platelet receptor αIIbβ3 is a crucial event for platelet aggregation and clot stability. Here we studied the effect of isoflurane, sevoflurane, and propofol on the activation of αIIbβ3. The effect of anesthetics on the activation of αIIbβ3 was probed using the activation sensitive antibody PAC-1 in both cell-based (platelets and αIIbβ3 transfectants) and cell-free assays. The binding sites of isoflurane on αIIbβ3 were explored using photoactivatable isoflurane (azi-isoflurane). The functional implication of revealed isoflurane binding sites were studied using alanine-scanning mutagenesis. Isoflurane and sevoflurane diminished the binding of PAC-1 to wild-type αIIbβ3 transfectants, but not to the high-affinity mutant, β3-N305T. Both anesthetics also impaired PAC-1 binding in a cell-free assay. In contrast, propofol did not affect the activation of αIIbβ3. Residues adducted by azi-isoflurane were near the calcium binding site (an important regulatory site termed SyMBS) just outside of the ligand binding site. The mutagenesis experiments demonstrated that these adducted residues were important in regulating integrin activation. Isoflurane and sevoflurane, but not propofol, impaired the activation of αIIbβ3. Azi-isoflurane binds to the regulatory site of integrin αIIbβ3, thereby suggesting that isoflurane blocks ligand binding of αIIbβ3 in not a competitive, but an allosteric manner.

Cellular distribution of calmodulin and calmodulin-binding proteins in Vicia faba L

NASA Technical Reports Server (NTRS)

Ling, V.; Assmann, S. M.

1992-01-01

The distribution of calmodulin (CaM) and CaM-binding proteins within Vicia faba was investigated. Both CaM and CaM-binding proteins were found to be differentially distributed among organs, tissues, and protoplast types. CaM levels, on a per protein basis, were found to be the highest in leaf epidermis, containing 3-fold higher levels of CaM than in total leaf. Similarly, guard cell and epidermal cell protoplasts were also found to have higher levels of CaM than mesophyll cell protoplasts. 125I-CaM blot overlay assays were performed to qualitatively examine CaM-binding proteins in these protoplast types as well as in whole tissues and organs. CaM-binding proteins with Mr 52,000, 78,000, and 115,000 were common in all metabolically active plant parts. Unique CaM-binding protein bands were detected in guard cell protoplasts (Mr 39,000, 88,000), stems (Mr 45,000, 60,000, 64,000), and roots (Mr 62,000), suggesting the presence of specialized CaM-dependent processes in these cells and organs.

A novel carbohydrate derived compound FCP5 causes DNA strand breaks and oxidative modifications of DNA bases in cancer cells.

PubMed

Czubatka, Anna; Sarnik, Joanna; Lucent, Del; Blasiak, Janusz; Witczak, Zbigniew J; Poplawski, Tomasz

2015-02-05

1,5-Anhydro-6-deoxy-methane-sulfamido-D-glucitol (FCP5) is a functionalized carbohydrate containing functional groups that render it potentially therapeutically useful. According to our concept of 'functional carb-pharmacophores' (FCPs) incorporation of the methanesulfonamido pharmacophore to 1,5 glucitol could create a therapeutically useful compound. Our previous studies revealed that FCP5 was cytotoxic to cancer cells. Therefore, in this work we assessed the cytotoxic mechanisms of FCP5 in four cancer cell lines - HeLa, LoVo, A549 and MCF-7, with particular focus on DNA damage and repair. A broad spectrum of methods, including comet assay with modifications, DNA repair enzyme assay, plasmid relaxation assay, and DNA fragmentation assay, were used. We also checked the potential for FCP5 to induce apoptosis. The results show that FCP5 can induce DNA strand breaks as well as oxidative modifications of DNA bases. DNA lesions induced by FCP5 were not entirely repaired in HeLa cells and DNA repair kinetics differs from other cell lines. Results from molecular docking and plasmid relaxation assay suggest that FCP5 binds to the major groove of DNA with a preference for adenosine-thymine base pair sequences and directly induces DNA strand breaks. Thus, FCP5 may represent a novel lead for the design of new major groove-binding compounds. The results also confirmed the validity of functional carb-pharmacophores as a new source of innovative drugs. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

GingisKHAN™ protease cleavage allows a high-throughput antibody to Fab conversion enabling direct functional assessment during lead identification of human monoclonal and bispecific IgG1 antibodies

PubMed Central

Moelleken, Jörg; Gassner, Christian; Lingke, Sabine; Tomaschek, Simone; Tyshchuk, Oksana; Lorenz, Stefan; Mølhøj, Michael

2017-01-01

ABSTRACT The determination of the binding strength of immunoglobulins (IgGs) to targets can be influenced by avidity when the targets are soluble di- or multimeric proteins, or associated to cell surfaces, including surfaces introduced from heterogeneous assays. However, for the understanding of the contribution of a second drug-to-target binding site in molecular design, or for ranking of monovalent binders during lead identification, affinity-based assessment of the binding strength is required. Typically, monovalent binders like antigen-binding fragments (Fabs) are generated by proteolytic cleavage with papain, which often results in a combination of under- and over-digestion, and requires specific optimization and chromatographic purification of the desired Fabs. Alternatively, the Fabs are produced by recombinant approaches. Here, we report a lean approach for the functional assessment of human IgG1s during lead identification based on an in-solution digestion with the GingisKHAN™ protease, generating a homogenous pool of intact Fabs and Fcs and enabling direct assaying of the Fab in the digestion mixture. The digest with GingisKHAN™ is highly specific and quantitative, does not require much optimization, and the protease does not interfere with methods typically applied for lead identification, such as surface plasmon resonance or cell-based assays. GingisKHAN™ is highly suited to differentiate between affinity and avidity driven binding of human IgG1 monoclonal and bispecific antibodies during lead identification. PMID:28805498

Paraffin section immunocytochemistry and cytosol-based ligand-binding assays for ER and PR detection in breast cancer: the time has come for more objectivity.

PubMed

Goussard, J

1998-10-23

The importance of the receptor level in breast cancer as an indicator of hormone response has been extensively studied for more than 20 years. Besides cytosol-based ligand-binding assays (dextran-coated charcoal assay, DCC), new methods using monoclonal antibodies raised against estrogen and progesterone receptors allow for the detection of receptors both in cytosol extracts (enzyme immunoassay, EIA) and in tissue sections (immunocytochemical assay, ICA). The biochemical assays (DCC and EIA) as well as the immunochemical detection (ICA) have specific qualities and produce original information which is useful for the therapeutic decision. While DCC gives a measure of the receptor level, whatever the real source of synthesis (normal and/or neoplastic tissue), ICA locates the positive cells and their relative proportion in the tumor. Both methods present their own advantages and disadvantages which are summarized in this study.

F104S c-Mpl responds to a transmembrane domain-binding thrombopoietin receptor agonist: proof of concept that selected receptor mutations in congenital amegakaryocytic thrombocytopenia can be stimulated with alternative thrombopoietic agents.

PubMed

Fox, Norma E; Lim, Jihyang; Chen, Rose; Geddis, Amy E

2010-05-01

To determine whether specific c-Mpl mutations might respond to thrombopoietin receptor agonists. We created cell line models of type II c-Mpl mutations identified in congenital amegakaryocytic thrombocytopenia. We selected F104S c-Mpl for further study because it exhibited surface expression of the receptor. We measured proliferation of cell lines expressing wild-type or F104S c-Mpl in response to thrombopoietin receptor agonists targeting the extracellular (m-AMP4) or transmembrane (LGD-4665) domains of the receptor by 1-methyltetrazole-5-thiol assay. We measured thrombopoietin binding to the mutant receptor using an in vitro thrombopoietin uptake assay and identified F104 as a potentially critical residue for the interaction between the receptor and its ligand by aligning thrombopoietin and erythropoietin receptors from multiple species. Cells expressing F104S c-Mpl proliferated in response to LGD-4665, but not thrombopoietin or m-AMP4. Compared to thrombopoietin, LGD-4665 stimulates signaling with delayed kinetics in both wild-type and F104S c-Mpl-expressing cells. Although F104S c-Mpl is expressed on the cell surface in our BaF3 cell line model, the mutant receptor does not bind thrombopoietin. Comparison to the erythropoietin receptor suggests that F104 engages in hydrogen-bonding interactions that are critical for binding to thrombopoietin. These findings suggest that a small subset of patients with congenital amegakaryocytic thrombocytopenia might respond to treatment with thrombopoietin receptor agonists, but that responsiveness will depend on the type of mutation and agonist used. We postulate that F104 is critical for thrombopoietin binding. The kinetics of signaling in response to a transmembrane domain-binding agonist are delayed in comparison to thrombopoietin. 2010 ISEH Society for Hematology and Stem Cells. Published by Elsevier Inc. All rights reserved.

Transcription control and neuronal differentiation by agents that activate the LXR nuclear receptor family.

PubMed

Schmidt, A; Vogel, R; Holloway, M K; Rutledge, S J; Friedman, O; Yang, Z; Rodan, G A; Friedman, E

1999-09-10

LXR and PPAR receptors belong to the nuclear receptor superfamily of transcriptional activating factors. Using ligand-dependent transcription assays, we found that 5-tetradecyloxy-2-furancarboxylic acid (TOFA) transactivates chimeric receptors composed of the glucocorticoid receptor DNA binding domain and the ligand binding regions of PPARalpha, PPARbeta (NUC-1) and LXRbeta (NER) receptors. In the same assays, ligands for PPARs (oleic acid, WY-14643 and L-631,033) and LXRs (hydroxycholesterols) maintain their respective receptor selectivity. TOFA and hydroxycholesterols also stimulate transcription from a minimal fibrinogen promoter that is under the control of AP-1 or NF-kappaB transcription factor binding sites. In addition to their effects on transcription, these LXRbeta activators induce neuronal differentiation in rat pheochromocytoma cells. TOFA and the natural LXR agonist, 22 (R)-hydroxycholesterol, stimulate neurite outgrowth in 55 and 28% of cells, respectively. No neurite outgrowth was induced by the related 22(S)-hydroxycholesterol, which does not activate the LXR family. These results suggest that the hydroxycholesterol signaling pathway has a complex effect on transcription that mediates the activity of TOFA and hydroxycholesterol on neuronal differentiation in pheochromocytoma cells.

Bisphenol A induces corticotropin-releasing hormone expression in the placental cells JEG-3.

PubMed

Huang, Hui; Tan, Wenjuan; Wang, C C; Leung, Lai K

2012-11-01

Bisphenol A is utilized to make polycarbonate plastics and is an environmental pollutant. Recent research has indicated that it is an endocrine disruptor and may interfere with reproduction. Placental corticotrophin-releasing hormone (CRH) is a peptide hormone which is involved in fetal development. Increased plasma CRH is associated with elevated risk of premature delivery. In the present study, we demonstrated that bisphenol A increased CRH mRNA expression in the placental JEG-3 cells at or above 25μM. Reporter gene assay also demonstrated that bisphenol A could induce CRH gene transactivity. Since cyclic AMP response element (CRE) is a major regulatory element located in CRH promoter, the sequence-specific binding activity was investigated by using electrophoretic mobility shift assay. Our data indicated that bisphenol A increased the CRE binding activity. Western analysis further illustrated that PKA could be the signal triggering the CRE binding and CRH gene transactivation. In summary, the present study demonstrated that bisphenol A could induce CRH expression in placental cells and the underlying signal transduction pathway was also described. Copyright © 2012 Elsevier Inc. All rights reserved.

Selection of homeotic proteins for binding to a human DNA replication origin.

PubMed

de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G

2000-06-09

We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.

75 FR 48355 - Prospective Grant of Exclusive License: Griffithsin, Glycosylation-Resistant Griffithsin, and...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-10

... infections where those viral infections are human immunodeficiency virus (HIV) or hepatitis C virus (HCV... Griffithsin inhibits viral binding, fusion and entry into the host cells by binding to viral envelope gp120... a viral infection (incl. HIV), as well as vaccine development, and screening assays. The second...

In vitro binding and receptor-mediated activity of terlipressin at vasopressin receptors V1 and V2

PubMed Central

Jamil, Khurram; Pappas, Stephen Chris; Devarakonda, Krishna R

2018-01-01

Terlipressin, a synthetic, systemic vasoconstrictor with selective activity at vasopressin-1 (V1) receptors, is a pro-drug for the endogenous/natural porcine hormone [Lys8]-vasopressin (LVP). We investigated binding and receptor-mediated cellular activities of terlipressin, LVP, and endogenous human hormone [Arg8]-vasopressin (AVP) at V1 and vasopressin-2 (V2) receptors. Cell membrane homogenates of Chinese hamster ovary cells expressing human V1 and V2 receptors were used in competitive binding assays to measure receptor-binding activity. These cells were used in functional assays to measure receptor-mediated cellular activity of terlipressin, LVP, and AVP. Binding was measured by [3H]AVP counts, and the activity was measured by fluorometric detection of intracellular calcium mobilization (V1) and cyclic adenosine monophosphate (V2). Binding potency at V1 and V2 was AVP>LVP>>terlipressin. LVP and terlipressin had approximately sixfold higher affinity for V1 than for V2. Cellular activity potency was also AVP>LVP>>terlipressin. Terlipressin was a partial agonist at V1 and a full agonist at V2; LVP was a full agonist at both V1 and V2. The in vivo response to terlipressin is likely due to the partial V1 agonist activity of terlipressin and full V1 agonist activity of its metabolite, LVP. These results provide supportive evidence for previous findings and further establish terlipressin pharmacology for vasopressin receptors. PMID:29302194

In vitro binding and receptor-mediated activity of terlipressin at vasopressin receptors V1 and V2.

PubMed

Jamil, Khurram; Pappas, Stephen Chris; Devarakonda, Krishna R

2018-01-01

Terlipressin, a synthetic, systemic vasoconstrictor with selective activity at vasopressin-1 (V 1 ) receptors, is a pro-drug for the endogenous/natural porcine hormone [Lys 8 ]-vasopressin (LVP). We investigated binding and receptor-mediated cellular activities of terlipressin, LVP, and endogenous human hormone [Arg 8 ]-vasopressin (AVP) at V 1 and vasopressin-2 (V 2 ) receptors. Cell membrane homogenates of Chinese hamster ovary cells expressing human V 1 and V 2 receptors were used in competitive binding assays to measure receptor-binding activity. These cells were used in functional assays to measure receptor-mediated cellular activity of terlipressin, LVP, and AVP. Binding was measured by [ 3 H]AVP counts, and the activity was measured by fluorometric detection of intracellular calcium mobilization (V 1 ) and cyclic adenosine monophosphate (V 2 ). Binding potency at V 1 and V 2 was AVP>LVP>terlipressin. LVP and terlipressin had approximately sixfold higher affinity for V 1 than for V 2 . Cellular activity potency was also AVP>LVP>terlipressin. Terlipressin was a partial agonist at V 1 and a full agonist at V 2 ; LVP was a full agonist at both V 1 and V 2 . The in vivo response to terlipressin is likely due to the partial V 1 agonist activity of terlipressin and full V 1 agonist activity of its metabolite, LVP. These results provide supportive evidence for previous findings and further establish terlipressin pharmacology for vasopressin receptors.

Key learnings from performance of the U.S. EPA Endocrine Disruptor Screening Program (EDSP) Tier 1 in vitro assays.

PubMed

LeBaron, Matthew J; Coady, Katie K; O'Connor, John C; Nabb, Diane L; Markell, Lauren K; Snajdr, Suzanne; Sue Marty, M

2014-02-01

Tier 1 of the U.S. EPA Endocrine Disruptor Screening Program comprises 11 studies: five in vitro assays, four in vivo mammalian assays, and two in vivo nonmammalian assays. The battery is designed to detect compounds with the potential to interact with the estrogen, androgen, or thyroid signaling pathways. This article examines the procedures, results, and data interpretation for the five Tier 1 in vitro assays: estrogen receptor (ER) and androgen receptor binding assays, an ER transactivation assay, an aromatase assay, and a steroidogenesis assay. Data are presented from two laboratories that have evaluated approximately 11 compounds in the Tier 1 in vitro assays. Generally, the ER and androgen receptor binding assays and the aromatase assay showed good specificity and reproducibility. As described in the guideline for the ER transactivation assay, a result is considered positive when the test compound induces a reporter gene signal that reaches 10% of the response seen with 1 nM 17β-estradiol (positive control). In the experience of these laboratories, this cutoff criterion may result in false-positive responses. For the steroidogenesis assay, there is variability in the basal and stimulated production of testosterone and estradiol by the H295R cells. This variability in responsiveness, coupled with potential cell stress at high concentrations of test compound, may make it difficult to discern whether hormone alterations are specific steroidogenesis alterations (i.e., endocrine active). Lastly, both laboratories had difficulty meeting some recommended performance criteria for each Tier 1 in vitro assay. Data with only minor deviations were deemed valid. © 2014 Wiley Periodicals, Inc.

Effects of vitamin D-binding protein-derived macrophage-activating factor on human breast cancer cells.

PubMed

Pacini, Stefania; Punzi, Tiziana; Morucci, Gabriele; Gulisano, Massimo; Ruggiero, Marco

2012-01-01

Searching for additional therapeutic tools to fight breast cancer, we investigated the effects of vitamin D-binding protein-derived macrophage activating factor (DBP-MAF, also known as GcMAF) on a human breast cancer cell line (MCF-7). The effects of DBP-MAF on proliferation, morphology, vimentin expression and angiogenesis were studied by cell proliferation assay, phase-contrast microscopy, immunohistochemistry and western blotting, and chorioallantoic membrane (CAM) assay. DBP-MAF inhibited human breast cancer cell proliferation and cancer cell-stimulated angiogenesis. MCF-7 cells treated with DBP-MAF predominantly grew in monolayer and appeared to be well adherent to each other and to the well surface. Exposure to DBP-MAF significantly reduced vimentin expression, indicating a reversal of the epithelial/mesenchymal transition, a hallmark of human breast cancer progression. These results are consistent with the hypothesis that the known anticancer efficacy of DBP-MAF can be ascribed to different biological properties of the molecule that include inhibition of tumour-induced angiogenesis and direct inhibition of cancer cell proliferation, migration and metastatic potential.

Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter Through Differential Repression of Constitutive Expression

PubMed Central

Shiang, Rita

2008-01-01

Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell–specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell–specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from −253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter. PMID:18771418

Efficient Identification of Novel Hla-A*0201–Presented Cytotoxic T Lymphocyte Epitopes in the Widely Expressed Tumor Antigen Prame by Proteasome-Mediated Digestion Analysis

PubMed Central

Kessler, Jan H.; Beekman, Nico J.; Bres-Vloemans, Sandra A.; Verdijk, Pauline; van Veelen, Peter A.; Kloosterman-Joosten, Antoinette M.; Vissers, Debby C.J.; ten Bosch, George J.A.; Kester, Michel G.D.; Sijts, Alice; Drijfhout, Jan Wouter; Ossendorp, Ferry; Offringa, Rienk; Melief, Cornelis J.M.

2001-01-01

We report the efficient identification of four human histocompatibility leukocyte antigen (HLA)-A*0201–presented cytotoxic T lymphocyte (CTL) epitopes in the tumor-associated antigen PRAME using an improved “reverse immunology” strategy. Next to motif-based HLA-A*0201 binding prediction and actual binding and stability assays, analysis of in vitro proteasome-mediated digestions of polypeptides encompassing candidate epitopes was incorporated in the epitope prediction procedure. Proteasome cleavage pattern analysis, in particular determination of correct COOH-terminal cleavage of the putative epitope, allows a far more accurate and selective prediction of CTL epitopes. Only 4 of 19 high affinity HLA-A*0201 binding peptides (21%) were found to be efficiently generated by the proteasome in vitro. This approach avoids laborious CTL response inductions against high affinity binding peptides that are not processed and limits the number of peptides to be assayed for binding. CTL clones induced against the four identified epitopes (VLDGLDVLL, PRA100–108; SLYSFPEPEA, PRA142–151; ALYVDSLFFL, PRA300–309; and SLLQHLIGL, PRA425–433) lysed melanoma, renal cell carcinoma, lung carcinoma, and mammary carcinoma cell lines expressing PRAME and HLA-A*0201. This indicates that these epitopes are expressed on cancer cells of diverse histologic origin, making them attractive targets for immunotherapy of cancer. PMID:11136822

Discovery of a Series of Acridinones as Mechanism-Based Tubulin Assembly Inhibitors with Anticancer Activity

PubMed Central

Magalhaes, Luma G.; Marques, Fernando B.; da Fonseca, Marina B.; Rogério, Kamilla R.; Graebin, Cedric S.; Andricopulo, Adriano D.

2016-01-01

Microtubules play critical roles in vital cell processes, including cell growth, division, and migration. Microtubule-targeting small molecules are chemotherapeutic agents that are widely used in the treatment of cancer. Many of these compounds are structurally complex natural products (e.g., paclitaxel, vinblastine, and vincristine) with multiple stereogenic centers. Because of the scarcity of their natural sources and the difficulty of their partial or total synthesis, as well as problems related to their bioavailability, toxicity, and resistance, there is an urgent need for novel microtubule binding agents that are effective for treating cancer but do not have these disadvantages. In the present work, our lead discovery effort toward less structurally complex synthetic compounds led to the discovery of a series of acridinones inspired by the structure of podophyllotoxin, a natural product with important microtubule assembly inhibitory activity, as novel mechanism-based tubulin assembly inhibitors with potent anticancer properties and low toxicity. The compounds were evaluated in vitro by wound healing assays employing the metastatic and triple negative breast cancer cell line MDA-MB-231. Four compounds with IC50 values between 0.294 and 1.7 μM were identified. These compounds showed selective cytotoxicity against MDA-MB-231 and DU-145 cancer cell lines and promoted cell cycle arrest in G2/M phase and apoptosis. Consistent with molecular modeling results, the acridinones inhibited tubulin assembly in in vitro polymerization assays with IC50 values between 0.9 and 13 μM. Their binding to the colchicine-binding site of tubulin was confirmed through competitive assays. PMID:27508497

E-selectin ligand-1 (ESL-1) is a novel adiponectin binding protein on cell adhesion.

PubMed

Yamamoto, Hiroyasu; Kuroda, Nana; Uekita, Hiromi; Kochi, Ikoi; Matsumoto, Akane; Niinaga, Ryu; Funahashi, Tohru; Shimomura, Iichiro; Kihara, Shinji

2016-02-05

Adiponectin (APN) is an adipocyte-derived bioactive molecule with anti-diabetic and anti-atherogenic properties. Although anti-diabetic effects are mostly mediated by the adiponectin receptors AdipoR1 and AdipoR2, the anti-atherogenic mechanisms have not been fully elucidated. In this study, we identified E-selectin ligand (ESL)-1 as a novel APN-binding protein by mass spectrometry analysis of HepG2 cell-derived immunoprecipitant with an anti-APN antibody. Cell adhesion assays using fluorescence-labelled monocyte cell line THP-1 cells and human umbilical vein endothelial cells (HUVECs) revealed that APN-pre-treated THP-1 cells had reduced binding ability to HUVECs. This APN-mediated suppressive effect on monocyte binding to endothelial cells was partially abrogated by targeting ESL-1 with shRNA in THP-1 cells. In addition, serial mutagenesis analysis disclosed that five extracellular amino acids close to the N-terminus of ESL-1 were essential for binding with APN. Our results highlight the fact that interaction between APN and ESL-1 could provide a fundamental mechanism underlying the anti-atherogenic properties of APN. Copyright © 2016 Elsevier Inc. All rights reserved.

Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction.

PubMed

Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H

2017-01-09

The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Cholera toxin binding affinity and specificity for gangliosides determined by surface plasmon resonance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuziemko, G.M.; Stroh, M.; Stevens, R.C.

1996-05-21

The present study determines the affinity of cholera toxin for the ganglioside series GM1, GM2, GM3, GD1A, GD1B, GT1B, asialo GM1, globotriosyl ceramide, and lactosyl ceramide using real time biospecific interaction analysis (surface plasmon resonance, SPR). SPR shows that cholera toxin preferably binds to gangliosides in the following sequence: GM1 > GM2 > GD1A > GM3 > GT1B > GD1B > asialo-GM1. The measured binding affinity of cholera toxin for the ganglioside sequence ranges from 4.61 {times} 10{sup {minus}12} M for GM1 to 1.88 {times} 10{sup {minus}10} M for asialo GM1. The picomolar values obtained by surface plasmon resonance aremore » similar to K{sub d} values determined with whole-cell binding assays. Both whole-cell assays ans SPR measurements on synthetic membranes are higher than free solution measurements by several orders of magnitude. This difference may be caused by the effects of avidity and charged lipid head-groups, which may play a major role in the binding between cholera toxin, the receptor, and the membrane surface. The primary difference between free solution binding studies and surface plasmon resonance studies is that the latter technique is performed on surfaces resembling the cell membrane. Surface plasmon resonance has the further advantage of measuring apparent kinetic association and dissociation rates in real time, providing direct information about binding events at the membrane surface. 34 refs., 8 figs., 2 tabs.« less

Targeting Phosphatidylserine with a 64Cu-Labeled Peptide for Molecular Imaging of Apoptosis.

PubMed

Perreault, Amanda; Richter, Susan; Bergman, Cody; Wuest, Melinda; Wuest, Frank

2016-10-03

Molecular imaging of programmed cell death (apoptosis) in vivo is an innovative strategy for early assessment of treatment response and treatment efficacy in cancer patients. Externalization of phosphatidylserine (PS) to the cell membrane surface of dying cells makes this phospholipid an attractive molecular target for the development of apoptosis imaging probes. In this study, we have radiolabeled PS-binding 14-mer peptide FNFRLKAGAKIRFG (PSBP-6) with positron-emitter copper-64 ( 64 Cu) for PET imaging of apoptosis. Peptide PSBP-6 was conjugated with radiometal chelator 1,4,7-triazacyclononane-1,4,7-triacetic acid (NOTA) through an aminovaleric acid (Ava) linker for subsequent radiolabeling with 64 Cu to prepare radiotracer 64 Cu-NOTA-Ava-PSBP-6. PS-binding potencies of PSBP-6, NOTA-Ava-PSBP-6, and nat Cu-NOTA-Ava-PSBP-6 were determined in a competitive radiometric PS-binding assay. Radiotracer 64 Cu-NOTA-Ava-PSBP-6 was studied in camptothecin-induced apoptotic EL4 mouse lymphoma cells and in a murine EL4 tumor model of apoptosis using dynamic PET imaging. Peptide PSBP-6 was also conjugated via an Ava linker with fluorescein isothiocyanate (FITC). FITC-Ava-PSBP-6 was evaluated in flow cytometry and fluorescence confocal microscopy experiments. Radiopeptide 64 Cu-NOTA-Ava-PSBP-6 was synthesized in high radiochemical yields of >95%. The IC 50 values for PS-binding potency of PSBP-6, NOTA-Ava-PSBP-6, and nat Cu-NOTA-PSBP-6 were 600 μM, 30 μM, and 23 μM, respectively. A competitive radiometric cell binding assay confirmed binding of 64 Cu-NOTA-Ava-PSBP-6 to camptothecin-induced apoptotic EL4 cells in a Ca 2+ -independent manner. PET imaging studies demonstrated significantly higher uptake of 64 Cu-NOTA-Ava-PSBP-6 in apoptotic EL4 tumors (SUV 5min 0.95 ± 0.04) compared to control tumors (SUV 5min 0.74 ± 0.03). Flow cytometry studies showed significantly higher binding of FITC-Ava-PSBP-6 to EL4 cells treated with camptothecin compared to untreated cells. Fluorescence microscopy studies revealed that FITC-Ava-PSBP-6 was binding to cell membranes of early apoptotic cells, but was internalized in late apoptotic and necrotic cells. The present study showed that radiotracer 64 Cu-NOTA-Ava-PSBP-6 holds promise as a first peptide-based PET imaging agent for molecular imaging of apoptosis. However, additional "fine-tuning" of 64 Cu-NOTA-Ava-PSBP-6 is required to enhance PS-binding potency and in vivo stability to improve tumor uptake and retention.

Evaluation of Phosphatidylserine-Binding Peptides Radiolabeled with Fluorine 18 for in vivo Imaging of Apoptosis

NASA Astrophysics Data System (ADS)

Kapty, Janice Sarah

We currently do not have a clinical method to directly assess apoptosis induced by cancer therapies. Phosphatidylserine (PS) is an attractive target for imaging apoptosis since it is on the exterior of the apoptotic cells and PS externalization is an early marker of apoptosis. PS-binding peptides are an attractive option for developing an imaging probe to detect apoptosis using positron emission tomography. In this study we evaluated binding characteristics of PS-binding peptides for ability to bind to PS, radiolabeled PS-binding peptides with fluorine-18, and performed in vitro and in vivo analysis of 18F radiolabeled PS-binding peptides including biodistribution analysis and dynamic PET imaging in a murine tumor model of apoptosis. Four peptides were evaluated for PS binding characteristics using a plate based assay system, a liposome mimic of cell membrane PS presentation, and a cell assay of apoptosis. The results indicate that all four peptides bind to PS and are specific to apoptotic cells. The widely used 18 F prosthetic group N-succinimidyl-4-[18F]fluorobenzoate ([18F]SFB) and the recently developed N-[6-(4-[ 18F]fluorobenzylidene) aminooxyhexyl]maleimide ([18F]FBAM) were investigated for radiolabeling of two representative phosphatidylserine-binding peptides. The prosthetic groups were compared with respect to required reaction conditions for optimum labeling, radiolabeling yield and chemoselectivity. The N-terminus labeled product produced by reaction of [18F]SFB with binding peptide LIKKPF was produced in 18% radiochemical yield while no N-terminus labeled product could be isolated following [18F]SFB reaction with PDGLSR. When the peptides were modified by addition of a cysteine residue at the N-terminus they provided almost quantitative radiochemical yields with [18F]FBAM. Results indicate that for the peptides in this study, [18F]FBAM is a more useful prosthetic group compared to [18F]SFB due to its excellent chemo-selectivity and high radiochemical yield. We report the first experiments where PS-binding peptides were radiolabeled with 18F and evaluated as possible radiotracers for imaging apoptosis. We investigated two radio-peptides ([ 18F]FBAM-CLIKKPF and [18F]FBAM-CPGDLSR) in vitro and in vivo as possible radiotracers able to bind to apoptotic cells and to image chemotherapy induced apoptosis.

A glass fiber/diethylaminoethyl double filter binding assay that measures apoptotic internucleosomal DNA fragmentation.

PubMed

Erusalimsky, J D; John, J; Hong, Y; Moore, M

1996-11-15

A filter binding assay that measures internucleosomal DNA fragmentation associated with apoptosis is described. The assay is based on a novel principle that consists of using simultaneously two kinds of glass fiber filters to harvest [3H]thymidine-prelabeled cells following their incubation with inducers of apoptosis. One filter, which is neutral, traps intact chromatin and high-molecular-weight DNA. The other filter, which is positively charged with DEAE active groups, traps low-molecular-weight DNA fragments. DNA fragmentation is quantified by measuring the radioactivity retained by each of the filters. The assay was evaluated with the histiocytic lymphoma cell line U937 and the topoisomerase inhibitors camptothecin, etoposide, and doxorubicin. These agents caused a dose-dependent decrease of radioactivity in the neutral filter and a parallel increase of radioactivity in the DEAE filter. Irradiation-induced single strand breaks and topoisomerase-mediated primary DNA damage were not detected by this method. Consistent with the detection of internucleosomal DNA fragmentation, the effects measured by this assay were prevented by the endonuclease inhibitor zinc acetate and by the metabolic inhibitor sodium azide. Results obtained using this assay were validated by observation of DNA ladders on agarose gels and by morphologic examination of apoptotic features. Evaluation of the assay in a mock screen demonstrated that the introduction of the DEAE filter increases the assay sensitivity and eliminates false positives. Thus, this assay may be used in high-throughput screening approaches to discover novel modulators of apoptosis.

Antigen-binding cells in the peripheral blood of sockeye salmon, Oncorhynchus nerka Walbaum, induced by immersion or intraperitoneal injection of Vibrio languilarum bacterin

USGS Publications Warehouse

1981-01-01

We used an immunocytoadherence assay to monitor the response of antigen-binding cells (ABC) in the peripheral blood of sockeye salmon, Oncorhynchus nerka, after immersion in, or intraperitoneal injection of, Vibrio anguillarum LS 1–74 bacterin. Both methods initiated an elevated ABC response in less than one day; this response persisted one week longer in the injected than in the immersed fish.

MBD2 is a critical component of a methyl cytosine-binding protein complex isolated from primary erythroid cells

PubMed Central

Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.

2006-01-01

The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143

Osthole inhibits the invasive ability of human lung adenocarcinoma cells via suppression of NF-κB-mediated matrix metalloproteinase-9 expression.

PubMed

Kao, Shang-Jyh; Su, Jen-Liang; Chen, Chi-Kuan; Yu, Ming-Chih; Bai, Kuan-Jen; Chang, Jer-Hua; Bien, Mauo-Ying; Yang, Shun-Fa; Chien, Ming-Hsien

2012-05-15

The induction of matrix metalloproteinase (MMP)-9 is particularly important for the invasiveness of various cancer cells. Osthole, a natural coumarin derivative extracted from traditional Chinese medicines, is known to inhibit the proliferation of a variety of tumor cells, but the effect of osthole on the invasiveness of tumor cells is largely unknown. This study determines whether and by what mechanism osthole inhibits invasion in CL1-5 human lung adenocarcinoma cells. Herein, we found that osthole effectively inhibited the migratory and invasive abilities of CL1-5 cells. A zymographic assay showed that osthole inhibited the proteolytic activity of MMP-9 in CL1-5 cells. Inhibition of migration, invasion, and MMP2 and/or MMP-9 proteolytic activities was also observed in other lung adenocarcinoma cell lines (H1299 and A549). We further found that osthole inhibited MMP-9 expression at the messenger RNA and protein levels. Moreover, a chromatin immunoprecipitation assay showed that osthole inhibited the transcriptional activity of MMP-9 by suppressing the DNA binding activity of nuclear factor (NF)-κB in the MMP-9 promoter. Using reporter assays with point-mutated promoter constructs further confirmed that the inhibitory effect of osthole requires an NF-κB binding site on the MMP-9 promoter. Western blot and immunofluorescence assays demonstrated that osthole inhibited NF-κB activity by inhibiting IκB-α degradation and NF-κB p65 nuclear translocation. In conclusion, we demonstrated that osthole inhibits NF-κB-mediated MMP-9 expression, resulting in suppression of lung cancer cell invasion and migration, and osthole might be a potential agent for preventing the invasion and metastasis of lung cancer. Copyright © 2012 Elsevier Inc. All rights reserved.

EGCG reverses human neutrophil elastase-induced migration in A549 cells by directly binding to HNE and by regulating α1-AT

NASA Astrophysics Data System (ADS)

Xiaokaiti, Yilixiati; Wu, Haoming; Chen, Ya; Yang, Haopeng; Duan, Jianhui; Li, Xin; Pan, Yan; Tie, Lu; Zhang, Liangren; Li, Xuejun

2015-07-01

Lung carcinogenesis is a complex process that occurs in unregulated inflammatory environment. EGCG has been extensively investigated as a multi-targeting anti-tumor and anti-inflammatory compound. In this study, we demonstrated a novel mechanism by which EGCG reverses the neutrophil elastase-induced migration of A549 cells. We found that neutrophil elastase directly triggered human adenocarcinoma A549 cell migration and that EGCG suppressed the elevation of tumor cell migration induced by neutrophil elastase. We observed that EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity based on the CDOCKER algorithm, MD stimulation by GROMACS, SPR assay and elastase enzymatic activity assay. As the natural inhibitor of neutrophil elastase, α1-antitrypsin is synthesized in tumor cells. We further demonstrated that the expression of α1-antitrypsin was up-regulated after EGCG treatment in neutrophil elastase-treated A549 cells. We preliminarily discovered that the EGCG-mediated induction of α1-antitrypsin expression might be correlated with the regulatory effect of EGCG on the PI3K/Akt pathway. Overall, our results suggest that EGCG ameliorates the neutrophil elastase-induced migration of A549 cells. The mechanism underlying this effect may include two processes: EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity; EGCG enhances the expression of α1-antitrypsin by regulating the PI3K/AKT pathway.

EGCG reverses human neutrophil elastase-induced migration in A549 cells by directly binding to HNE and by regulating α1-AT.

PubMed

Xiaokaiti, Yilixiati; Wu, Haoming; Chen, Ya; Yang, Haopeng; Duan, Jianhui; Li, Xin; Pan, Yan; Tie, Lu; Zhang, Liangren; Li, Xuejun

2015-07-16

Lung carcinogenesis is a complex process that occurs in unregulated inflammatory environment. EGCG has been extensively investigated as a multi-targeting anti-tumor and anti-inflammatory compound. In this study, we demonstrated a novel mechanism by which EGCG reverses the neutrophil elastase-induced migration of A549 cells. We found that neutrophil elastase directly triggered human adenocarcinoma A549 cell migration and that EGCG suppressed the elevation of tumor cell migration induced by neutrophil elastase. We observed that EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity based on the CDOCKER algorithm, MD stimulation by GROMACS, SPR assay and elastase enzymatic activity assay. As the natural inhibitor of neutrophil elastase, α1-antitrypsin is synthesized in tumor cells. We further demonstrated that the expression of α1-antitrypsin was up-regulated after EGCG treatment in neutrophil elastase-treated A549 cells. We preliminarily discovered that the EGCG-mediated induction of α1-antitrypsin expression might be correlated with the regulatory effect of EGCG on the PI3K/Akt pathway. Overall, our results suggest that EGCG ameliorates the neutrophil elastase-induced migration of A549 cells. The mechanism underlying this effect may include two processes: EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity; EGCG enhances the expression of α1-antitrypsin by regulating the PI3K/AKT pathway.

Identification of lipid-phosphatidylserine (PS) as the target of unbiasedly selected cancer specific peptide-peptoid hybrid PPS1.

PubMed

Desai, Tanvi J; Toombs, Jason E; Minna, John D; Brekken, Rolf A; Udugamasooriya, Damith Gomika

2016-05-24

Phosphatidylserine (PS) is an anionic phospholipid maintained on the inner-leaflet of the cell membrane and is externalized in malignant cells. We previously launched a careful unbiased selection targeting biomolecules (e.g. protein, lipid or carbohydrate) distinct to cancer cells by exploiting HCC4017 lung cancer and HBEC30KT normal epithelial cells derived from the same patient, identifying HCC4017 specific peptide-peptoid hybrid PPS1. In this current study, we identified PS as the target of PPS1. We validated direct PPS1 binding to PS using ELISA-like assays, lipid dot blot and liposome based binding assays. In addition, PPS1 recognized other negatively charged and cancer specific lipids such as phosphatidic acid, phosphatidylinositol and phosphatidylglycerol. PPS1 did not bind to neutral lipids such as phosphatidylethanolamine found in cancer and phosphatidylcholine and sphingomyelin found in normal cells. Further we found that the dimeric version of PPS1 (PPS1D1) displayed strong cytotoxicity towards lung cancer cell lines that externalize PS, but not normal cells. PPS1D1 showed potent single agent anti-tumor activity and enhanced the efficacy of docetaxel in mice bearing H460 lung cancer xenografts. Since PS and anionic phospholipid externalization is common across many cancer types, PPS1 may be an alternative to overcome limitations of protein targeted agents.

ω-Conotoxin GVIA Mimetics that Bind and Inhibit Neuronal Cav2.2 Ion Channels

PubMed Central

Tranberg, Charlotte Elisabet; Yang, Aijun; Vette, Irina; McArthur, Jeffrey R.; Baell, Jonathan B.; Lewis, Richard J.; Tuck, Kellie L.; Duggan, Peter J.

2012-01-01

The neuronal voltage-gated N-type calcium channel (Cav2.2) is a validated target for the treatment of neuropathic pain. A small library of anthranilamide-derived ω-Conotoxin GVIA mimetics bearing the diphenylmethylpiperazine moiety were prepared and tested using three experimental measures of calcium channel blockade. These consisted of a 125I-ω-conotoxin GVIA displacement assay, a fluorescence-based calcium response assay with SH-SY5Y neuroblastoma cells, and a whole-cell patch clamp electrophysiology assay with HEK293 cells stably expressing human Cav2.2 channels. A subset of compounds were active in all three assays. This is the first time that compounds designed to be mimics of ω-conotoxin GVIA and found to be active in the 125I-ω-conotoxin GVIA displacement assay have also been shown to block functional ion channels in a dose-dependent manner. PMID:23170089

P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

PubMed

He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

2010-08-27

P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

PubMed Central

He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

2010-01-01

P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy. PMID:20957096

Identification and Validation of Novel Small Molecule Disruptors of HuR-mRNA Interaction

PubMed Central

Wu, Xiaoqing; Lan, Lan; Wilson, David Michael; Marquez, Rebecca T.; Tsao, Wei-chung; Gao, Philip; Roy, Anuradha; Turner, Benjamin Andrew; McDonald, Peter; Tunge, Jon A; Rogers, Steven A; Dixon, Dan A.; Aubé, Jeffrey; Xu, Liang

2015-01-01

HuR, an RNA binding protein, binds to adenine- and uridine-rich elements (ARE) in the 3′-untranslated region (UTR) of target mRNAs, regulating their stability and translation. HuR is highly abundant in many types of cancer, and it promotes tumorigenesis by interacting with cancer-associated mRNAs, which encode proteins that are implicated in different tumor processes including cell proliferation, cell survival, angiogenesis, invasion, and metastasis. Drugs that disrupt the stabilizing effect of HuR upon mRNA targets could have dramatic effects on inhibiting cancer growth and persistence. In order to identify small molecules that directly disrupt the HuR–ARE interaction, we established a fluorescence polarization (FP) assay optimized for high throughput screening (HTS) using HuR protein and an ARE oligo from Musashi RNA-binding protein 1 (Msi1) mRNA, a HuR target. Following the performance of an HTS of ~6000 compounds, we discovered a cluster of potential disruptors, which were then validated by AlphaLISA (Amplified Luminescent Proximity Homogeneous Assay), surface plasmon resonance (SPR), ribonucleoprotein immunoprecipitation (RNP IP) assay, and luciferase reporter functional studies. These compounds disrupted HuR–ARE interactions at the nanomolar level and blocked HuR function by competitive binding to HuR. These results support future studies toward chemical probes for a HuR function study and possibly a novel therapy for HuR-overexpressing cancers. PMID:25750985

Characterization of the complex formed between a potent neutralizing ovine-derived polyclonal anti-TNFα Fab fragment and human TNFα

PubMed Central

Abbott, W. Mark; Snow, Melanie; Eckersley, Sonia; Renshaw, Jonathan; Davies, Gareth; Norman, Richard A.; Ceuppens, Peter; Slootstra, Jerry; Benschop, Joris J.; Hamuro, Yoshitomo; Lee, Jessica E.; Newham, Peter

2013-01-01

TNFα (tumour necrosis factor α) is an early mediator in the systemic inflammatory response to infection and is therefore a therapeutic target in sepsis. AZD9773 is an ovine-derived, polyclonal anti-TNFα Fab fragment derived from a pool of serum and currently being developed as a treatment for severe sepsis and septic shock. In the present study, we show that although AZD9773 has a modest affinity for TNFα in a binding assay, the Ki in a cell-based assay is approximately four orders of magnitude lower. We show using SEC (size exclusion chromatography) that the maximum size of the complex between AZD9773 and TNFα is consistent with approximately 12 Fabs binding to one TNFα trimer. A number of approaches were taken to map the epitopes recognized by AZD9773. These revealed that a number of different regions on TNFα are involved in binding to the polyclonal Fab. The data suggest that there are probably three epitopes per monomer that are responsible for most of the inhibition by AZD9773 and that all three can be occupied at the same time in the complex. We conclude that AZD9773 is clearly demonstrated to bind to multiple epitopes on TNFα and suggest that the polyclonal nature may account, at least in part, for the very high potency observed in cell-based assays. PMID:23863106

T-cell memory responses elicited by yellow fever vaccine are targeted to overlapping epitopes containing multiple HLA-I and -II binding motifs.

PubMed

de Melo, Andréa Barbosa; Nascimento, Eduardo J M; Braga-Neto, Ulisses; Dhalia, Rafael; Silva, Ana Maria; Oelke, Mathias; Schneck, Jonathan P; Sidney, John; Sette, Alessandro; Montenegro, Silvia M L; Marques, Ernesto T A

2013-01-01

The yellow fever vaccines (YF-17D-204 and 17DD) are considered to be among the safest vaccines and the presence of neutralizing antibodies is correlated with protection, although other immune effector mechanisms are known to be involved. T-cell responses are known to play an important role modulating antibody production and the killing of infected cells. However, little is known about the repertoire of T-cell responses elicited by the YF-17DD vaccine in humans. In this report, a library of 653 partially overlapping 15-mer peptides covering the envelope (Env) and nonstructural (NS) proteins 1 to 5 of the vaccine was utilized to perform a comprehensive analysis of the virus-specific CD4(+) and CD8(+) T-cell responses. The T-cell responses were screened ex-vivo by IFN-γ ELISPOT assays using blood samples from 220 YF-17DD vaccinees collected two months to four years after immunization. Each peptide was tested in 75 to 208 separate individuals of the cohort. The screening identified sixteen immunodominant antigens that elicited activation of circulating memory T-cells in 10% to 33% of the individuals. Biochemical in-vitro binding assays and immunogenetic and immunogenicity studies indicated that each of the sixteen immunogenic 15-mer peptides contained two or more partially overlapping epitopes that could bind with high affinity to molecules of different HLAs. The prevalence of the immunogenicity of a peptide in the cohort was correlated with the diversity of HLA-II alleles that they could bind. These findings suggest that overlapping of HLA binding motifs within a peptide enhances its T-cell immunogenicity and the prevalence of the response in the population. In summary, the results suggests that in addition to factors of the innate immunity, "promiscuous" T-cell antigens might contribute to the high efficacy of the yellow fever vaccines.

T-Cell Memory Responses Elicited by Yellow Fever Vaccine are Targeted to Overlapping Epitopes Containing Multiple HLA-I and -II Binding Motifs

PubMed Central

de Melo, Andréa Barbosa; Nascimento, Eduardo J. M.; Braga-Neto, Ulisses; Dhalia, Rafael; Silva, Ana Maria; Oelke, Mathias; Schneck, Jonathan P.; Sidney, John; Sette, Alessandro; Montenegro, Silvia M. L.; Marques, Ernesto T. A.

2013-01-01

The yellow fever vaccines (YF-17D-204 and 17DD) are considered to be among the safest vaccines and the presence of neutralizing antibodies is correlated with protection, although other immune effector mechanisms are known to be involved. T-cell responses are known to play an important role modulating antibody production and the killing of infected cells. However, little is known about the repertoire of T-cell responses elicited by the YF-17DD vaccine in humans. In this report, a library of 653 partially overlapping 15-mer peptides covering the envelope (Env) and nonstructural (NS) proteins 1 to 5 of the vaccine was utilized to perform a comprehensive analysis of the virus-specific CD4+ and CD8+ T-cell responses. The T-cell responses were screened ex-vivo by IFN-γ ELISPOT assays using blood samples from 220 YF-17DD vaccinees collected two months to four years after immunization. Each peptide was tested in 75 to 208 separate individuals of the cohort. The screening identified sixteen immunodominant antigens that elicited activation of circulating memory T-cells in 10% to 33% of the individuals. Biochemical in-vitro binding assays and immunogenetic and immunogenicity studies indicated that each of the sixteen immunogenic 15-mer peptides contained two or more partially overlapping epitopes that could bind with high affinity to molecules of different HLAs. The prevalence of the immunogenicity of a peptide in the cohort was correlated with the diversity of HLA-II alleles that they could bind. These findings suggest that overlapping of HLA binding motifs within a peptide enhances its T-cell immunogenicity and the prevalence of the response in the population. In summary, the results suggests that in addition to factors of the innate immunity, “promiscuous” T-cell antigens might contribute to the high efficacy of the yellow fever vaccines. PMID:23383350

SUMO-Modification of the La Protein Facilitates Binding to mRNA In Vitro and in Cells.

PubMed

Kota, Venkatesh; Sommer, Gunhild; Durette, Chantal; Thibault, Pierre; van Niekerk, Erna A; Twiss, Jeffery L; Heise, Tilman

2016-01-01

The RNA-binding protein La is involved in several aspects of RNA metabolism including the translational regulation of mRNAs and processing of pre-tRNAs. Besides its well-described phosphorylation by Casein kinase 2, the La protein is also posttranslationally modified by the Small Ubiquitin-like MOdifier (SUMO), but the functional outcome of this modification has not been defined. The objective of this study was to test whether sumoylation changes the RNA-binding activity of La. Therefore, we established an in vitro sumoylation assay for recombinant human La and analyzed its RNA-binding activity by electrophoretic mobility shift assays. We identified two novel SUMO-acceptor sites within the La protein located between the RNA recognition motif 1 and 2 and we demonstrate for the first time that sumoylation facilitates the RNA-binding of La to small RNA oligonucleotides representing the oligopyrimidine tract (TOP) elements from the 5' untranslated regions (UTR) of mRNAs encoding ribosomal protein L22 and L37 and to a longer RNA element from the 5' UTR of cyclin D1 (CCND1) mRNA in vitro. Furthermore, we show by RNA immunoprecipitation experiments that a La mutant deficient in sumoylation has impaired RNA-binding activity in cells. These data suggest that modulating the RNA-binding activity of La by sumoylation has important consequences on its functionality.

SUMO-Modification of the La Protein Facilitates Binding to mRNA In Vitro and in Cells

PubMed Central

Kota, Venkatesh; Sommer, Gunhild; Durette, Chantal; Thibault, Pierre; van Niekerk, Erna A.; Twiss, Jeffery L.

2016-01-01

The RNA-binding protein La is involved in several aspects of RNA metabolism including the translational regulation of mRNAs and processing of pre-tRNAs. Besides its well-described phosphorylation by Casein kinase 2, the La protein is also posttranslationally modified by the Small Ubiquitin-like MOdifier (SUMO), but the functional outcome of this modification has not been defined. The objective of this study was to test whether sumoylation changes the RNA-binding activity of La. Therefore, we established an in vitro sumoylation assay for recombinant human La and analyzed its RNA-binding activity by electrophoretic mobility shift assays. We identified two novel SUMO-acceptor sites within the La protein located between the RNA recognition motif 1 and 2 and we demonstrate for the first time that sumoylation facilitates the RNA-binding of La to small RNA oligonucleotides representing the oligopyrimidine tract (TOP) elements from the 5’ untranslated regions (UTR) of mRNAs encoding ribosomal protein L22 and L37 and to a longer RNA element from the 5’ UTR of cyclin D1 (CCND1) mRNA in vitro. Furthermore, we show by RNA immunoprecipitation experiments that a La mutant deficient in sumoylation has impaired RNA-binding activity in cells. These data suggest that modulating the RNA-binding activity of La by sumoylation has important consequences on its functionality. PMID:27224031

Small-Molecule Inhibitor of the Shigella flexneri Master Virulence Regulator VirF

PubMed Central

Koppolu, Veerendra; Osaka, Ichie; Skredenske, Jeff M.; Kettle, Bria; Hefty, P. Scott; Li, Jiaqin

2013-01-01

VirF is an AraC family transcriptional activator that is required for the expression of virulence genes associated with invasion and cell-to-cell spread by Shigella flexneri, including multiple components of the type three secretion system (T3SS) machinery and effectors. We tested a small-molecule compound, SE-1 (formerly designated OSSL_051168), which we had identified as an effective inhibitor of the AraC family proteins RhaS and RhaR, for its ability to inhibit VirF. Cell-based reporter gene assays with Escherichia coli and Shigella, as well as in vitro DNA binding assays with purified VirF, demonstrated that SE-1 inhibited DNA binding and transcription activation (likely by blocking DNA binding) by VirF. Analysis of mRNA levels using real-time quantitative reverse transcription-PCR (qRT-PCR) further demonstrated that SE-1 reduced the expression of the VirF-dependent virulence genes icsA, virB, icsB, and ipaB in Shigella. We also performed eukaryotic cell invasion assays and found that SE-1 reduced invasion by Shigella. The effect of SE-1 on invasion required preincubation of Shigella with SE-1, in agreement with the hypothesis that SE-1 inhibited the expression of VirF-activated genes required for the formation of the T3SS apparatus and invasion. We found that the same concentrations of SE-1 had no detectable effects on the growth or metabolism of the bacterial cells or the eukaryotic host cells, respectively, indicating that the inhibition of invasion was not due to general toxicity. Overall, SE-1 appears to inhibit transcription activation by VirF, exhibits selectivity toward AraC family proteins, and has the potential to be developed into a novel antibacterial agent. PMID:24002059

Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform

PubMed Central

Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P.; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

2015-01-01

A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10–100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven. PMID:26193329

Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform.

PubMed

Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

2015-07-16

A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10-100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven.

Binding and Signaling Studies Disclose a Potential Allosteric Site for Cannabidiol in Cannabinoid CB2 Receptors.

PubMed

Martínez-Pinilla, Eva; Varani, Katia; Reyes-Resina, Irene; Angelats, Edgar; Vincenzi, Fabrizio; Ferreiro-Vera, Carlos; Oyarzabal, Julen; Canela, Enric I; Lanciego, José L; Nadal, Xavier; Navarro, Gemma; Borea, Pier Andrea; Franco, Rafael

2017-01-01

The mechanism of action of cannabidiol (CBD), the main non-psychotropic component of Cannabis sativa L., is not completely understood. First assumed that the compound was acting via cannabinoid CB 2 receptors (CB 2 Rs) it is now suggested that it interacts with non-cannabinoid G-protein-coupled receptors (GPCRs); however, CBD does not bind with high affinity to the orthosteric site of any GPCR. To search for alternative explanations, we tested CBD as a potential allosteric ligand of CB 2 R. Radioligand and non-radioactive homogeneous binding, intracellular cAMP determination and ERK1/2 phosphorylation assays were undertaken in heterologous systems expressing the human version of CB 2 R. Using membrane preparations from CB 2 R-expressing HEK-293T (human embryonic kidney 293T) cells, we confirmed that CBD does not bind with high affinity to the orthosteric site of the human CB 2 R where the synthetic cannabinoid, [ 3 H]-WIN 55,212-2, binds. CBD was, however, able to produce minor but consistent reduction in the homogeneous binding assays in living cells using the fluorophore-conjugated CB 2 R-selective compound, CM-157. The effect on binding to CB 2 R-expressing living cells was different to that exerted by the orthosteric antagonist, SR144528, which decreased the maximum binding without changing the K D . CBD at nanomolar concentrations was also able to significantly reduce the effect of the selective CB 2 R agonist, JWH133, on forskolin-induced intracellular cAMP levels and on activation of the MAP kinase pathway. These results may help to understand CBD mode of action and may serve to revisit its therapeutic possibilities.

Binding and Signaling Studies Disclose a Potential Allosteric Site for Cannabidiol in Cannabinoid CB2 Receptors

PubMed Central

Martínez-Pinilla, Eva; Varani, Katia; Reyes-Resina, Irene; Angelats, Edgar; Vincenzi, Fabrizio; Ferreiro-Vera, Carlos; Oyarzabal, Julen; Canela, Enric I.; Lanciego, José L.; Nadal, Xavier; Navarro, Gemma; Borea, Pier Andrea; Franco, Rafael

2017-01-01

The mechanism of action of cannabidiol (CBD), the main non-psychotropic component of Cannabis sativa L., is not completely understood. First assumed that the compound was acting via cannabinoid CB2 receptors (CB2Rs) it is now suggested that it interacts with non-cannabinoid G-protein-coupled receptors (GPCRs); however, CBD does not bind with high affinity to the orthosteric site of any GPCR. To search for alternative explanations, we tested CBD as a potential allosteric ligand of CB2R. Radioligand and non-radioactive homogeneous binding, intracellular cAMP determination and ERK1/2 phosphorylation assays were undertaken in heterologous systems expressing the human version of CB2R. Using membrane preparations from CB2R-expressing HEK-293T (human embryonic kidney 293T) cells, we confirmed that CBD does not bind with high affinity to the orthosteric site of the human CB2R where the synthetic cannabinoid, [3H]-WIN 55,212-2, binds. CBD was, however, able to produce minor but consistent reduction in the homogeneous binding assays in living cells using the fluorophore-conjugated CB2R-selective compound, CM-157. The effect on binding to CB2R-expressing living cells was different to that exerted by the orthosteric antagonist, SR144528, which decreased the maximum binding without changing the KD. CBD at nanomolar concentrations was also able to significantly reduce the effect of the selective CB2R agonist, JWH133, on forskolin-induced intracellular cAMP levels and on activation of the MAP kinase pathway. These results may help to understand CBD mode of action and may serve to revisit its therapeutic possibilities. PMID:29109685

Investigation of molecular mechanism of recognition between citral and MARK4: A newer therapeutic approach to attenuate cancer cell progression.

PubMed

Naz, Farha; Khan, Faez Iqbal; Mohammad, Taj; Khan, Parvez; Manzoor, Saaliqa; Hasan, Gulam Mustafa; Lobb, Kevin A; Luqman, Suaib; Islam, Asimul; Ahmad, Faizan; Hassan, Md Imtaiyaz

2018-02-01

Microtubule affinity regulating kinase 4 (MARK4) is a member of AMP-activated protein kinase, found to be involved in apoptosis, inflammation and many other regulatory pathways. Since, its aberrant expression is directly associated with the cell cycle and thus cancer. Therefore, MARK4 is being considered as a potential drug target for cancer therapy. Here, we investigated the mechanism of inhibition of MARK4 activity by citral. Docking studies suggested that citral effectively binds to the active site cavity, and complex is stabilized by several interactions. We further performed molecular dynamics simulation of MARK4-citral complex under explicit water condition for 100ns and observed that binding of citral to MARK4 was quite stable. Fluorescence binding studies suggested that citral strongly binds to MARK4 and thereby inhibits its enzyme activity which was measured by the kinase inhibition assay. We further performed MTT assay and observed that citral inhibits proliferation of breast cancer cell line MCF-7. This work provides a newer insight into the use of citral as novel cancer therapeutics through the MARK4 inhibition. Results may be employed to design novel therapeutic molecule using citral as a scaffold for MARK4 inhibition to fight related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

Recombinant phage probes for Listeria monocytogenes

NASA Astrophysics Data System (ADS)

Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

2007-10-01

Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

DLG1 is an anchor for the E3 ligase MARCH2 at sites of cell-cell contact

PubMed Central

Cao, Zhifang; Huett, Alan; Kuballa, Petric; Giallourakis, Cosmas; Xavier, Ramnik J.

2008-01-01

PDZ domain containing molecular scaffolds play a central role in organizing synaptic junctions. Observations in Drosophila and mammalian cells have implicated that ubiquitination and endosomal trafficking, of molecular scaffolds are critical to the development and maintenance of cell-cell junctions and cell polarity. To elucidate if there is a connection between these pathways, we applied an integrative genomic strategy, which combined comparative genomics and proteomics with cell biological assays. Given the importance of ubiquitin in regulating endocytic processes, we first identified the subset of E3 ligases with conserved PDZ binding motifs. Among this subset, the MARCH family ubiquitin ligases account for the largest family and MARCH2 has been previously implicated in endosomal trafficking. Next, we tested in an unbiased fashion, if MARCH2 binds PDZ proteins in vivo using a modified tandem affinity purification strategy followed by mass spectrometry. Of note, DLG1 was co-purified from MARCH2, with subsequent confirmation that MARCH2 interacts with full-length DLG1 in a PDZ domain dependent manner. Furthermore, we demonstrated that MARCH2 co-localized with DLG1 at sites of cell-cell contact. In addition, loss of the MARCH2 PDZ binding motif led to loss of MARCH2 localization at cell-cell contact sites and MARCH2 appeared to localize away from cell-cell junctions. In in vivo ubiquitination assays we show that MARCH2 promotes DLG1 ubiquitination Overall, these results suggest that PDZ ligands with E3 ligase activity may link PDZ domain containing tumor suppressors to endocytic pathways and cell polarity determination. PMID:17980554

Structure-function analysis of soluble forms of herpes simplex virus glycoprotein D.

PubMed Central

Nicola, A V; Willis, S H; Naidoo, N N; Eisenberg, R J; Cohen, G H

1996-01-01

Glycoprotein D (gD) of herpes simplex virus (HSV) is essential for virus entry. Truncated forms of gD lacking the transmembrane and cytoplasmic tail regions have been shown to bind to cells and block plaque formation. Using complementation analysis and a panel of gD mutants, we previously identified four regions of gD (regions I to IV) which are important for virus entry. Here, we used baculovirus vectors to overexpress truncated forms of wild-type gD from HSV type 1 (HSV-1) [gD-1(306t)] and HSV-2 [gD-2(306t)] and four mutants, gD-1(inverted delta 34t), gD-1(inverted delta 126t), gD-1(inverted delta 243t), and gD-1(delta 290-299t), each having a mutation in one of the four functional regions. We used an enzyme-linked immunosorbent assay and circular dichroism to analyze the structure of these proteins, and we used functional assays to study the role of gD in binding, penetration, and cell-to-cell spread. gD-1 and gD-2 are similar in antigenic structure and thermal stability but vary in secondary structure. Mutant proteins with insertions in region I or II were most altered in structure and stability, while mutants with insertions in region III or IV were less altered. gD-1(306t) and gD-2(306t) inhibited both plaque formation and cell-to-cell transmission of HSV-1. In spite of obvious structural differences, all of the mutant proteins bound to cells, confirming that binding is not the only function of gD. The region I mutant did not inhibit HSV plaque formation or cell-to-cell spread, suggesting that this region is necessary for the function of gD in these processes. Surprisingly, the other three mutant proteins functioned in all of the in vitro assays, indicating that the ability of gD to bind to cells and inhibit infection does not correlate with its ability to initiate infection as measured by the complementation assay. The region IV mutant, gD-1(delta 290-299t), had an unexpected enhanced inhibitory effect on HSV infection. Taken together, the results argue against a single functional domain in gD. It is likely that different gD structural elements are involved in successive steps of infection. PMID:8648717

Soy lecithin replaces egg yolk for cryopreservation of human sperm without adversely affecting postthaw motility, morphology, sperm DNA integrity, or sperm binding to hyaluronate.

PubMed

Reed, Michael L; Ezeh, Peace C; Hamic, Amanda; Thompson, Douglas J; Caperton, Charles L

2009-11-01

Semen specimens (one ejaculate from each of 20 consenting study participants) were subjected to routine semen analysis, an in vitro sperm binding assay (HBA), and a sperm chromatin dispersion assay (HaloSperm), both before and after cryopreservation using cryoprotectant media supplemented with either egg yolk or soy lecithin. Comparing the equivalency of the two phospholipid cryopreservation supplements with regard to postthaw functional parameters demonstrated that there were no statistically significant differences between the two supplements for [1] recovery of motile sperm, [2] maintenance of sperm cell morphology, [3] maintenance of the ability of sperm to bind to hyaluronate in vitro, or [4] maintenance of sperm DNA integrity.

An antibody to the lutheran glycoprotein (Lu) recognizing the LU4 blood type variant inhibits cell adhesion to laminin α5.

PubMed

Kikkawa, Yamato; Miwa, Takahiro; Tohara, Yukiko; Hamakubo, Takayuki; Nomizu, Motoyoshi

2011-01-01

The Lutheran blood group glycoprotein (Lu), an Ig superfamily (IgSF) transmembrane receptor, is also known as basal cell adhesion molecule (B-CAM). Lu/B-CAM is a specific receptor for laminin α5, a major component of basement membranes in various tissues. Previous reports have shown that Lu/B-CAM binding to laminin α5 contributes to sickle cell vaso-occlusion. However, as there are no useful tools such as function-blocking antibodies or drugs, it is unclear how epithelial and sickled red blood cells adhere to laminin α5 via Lu/B-CAM. In this study, we discovered a function-blocking antibody that inhibits Lu binding to laminin α5 using a unique binding assay on tissue sections. To characterize the function-blocking antibody, we identified the site on Lu/B-CAM recognized by this antibody. The extracellular domain of Lu/B-CAM contains five IgSF domains, D1-D2-D3-D4-D5. The antibody epitope was localized to D2, but not to the D3 domain containing the major part of the laminin α5 binding site. Furthermore, mutagenesis studies showed that Arg(175), the LU4 blood group antigenic site, was crucial for forming the epitope and the antibody bound sufficiently close to sterically hinder the interaction with α5. Cell adhesion assay using the antibody also showed that Lu/B-CAM serves as a secondary receptor for the adhesion of carcinoma cells to laminin α5. This function-blocking antibody against Lu/B-CAM should be useful for not only investigating cell adhesion to laminin α5 but also for developing drugs to inhibit sickle cell vaso-occlusion.

Activation of Toll-like receptor-9 promotes cellular migration via up-regulating MMP-2 expression in oral squamous cell carcinoma.

PubMed

Ruan, Min; Zhang, Zun; Li, Siyi; Yan, Min; Liu, Shengwen; Yang, Wenjun; Wang, Lizheng; Zhang, Chenping

2014-01-01

Activation of Toll like receptors (TLRs) signaling has been implicated in promoting malignant cell invasion and metastatic potential. Previously we demonstrated that increased TLR-9 expression predicted poor survival in oral cancer patients. The objective of this study is to further investigate the roles and potential molecular mechanisms of TLR-9 signaling in human oral cancer cell invasion. Cell migration, invasion and protein expression were detected by wound healing assay, Transwell chambers model and western blot. The secretion and activity levels of metalloproteinases-2/9 were quantified by ELISA and Gelatin zymography. EMSA and ChIP assays were employed to detect the activity of AP-1signal pathway. TLR-9 siRNA transfection was used to regulate the expression and activity of TLR-9 in oral cancer cell line HB cells. The results of both wound healing assay and in vitro Transwell assay revealed that activation of TLR-9 induced dose- and time- dependent migration and invasion of HB cells. An increased expression, secretion and activity of MMP-2 were observed upon the treatment of CpG-ODN. The TLR-9 signaling-mediated MMP-2 expression appeared to be a consequence of AP-1 activation, because that their DNA binding activity was enhanced by CpG-ODN treatment. All these influences were efficiently repressed by the knockdown of TLR-9 through siRNA or pretreatment of an AP-1 inhibitor. Activation of TLR-9 signaling could promote human oral cancer HB cells invasion with the induction of MMP-2 presentation by attenuating AP-1 binding activity, suggesting a novel anti-metastatic application for TLR-9 targeted therapy in oral cancer in the future.

GATA-1 directly regulates Nanog in mouse embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100

2015-09-25

Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less

Ligand-receptor assay for evaluation of functional activity of human recombinant VEGF and VEGFR-1 extracellular fragment.

PubMed

Leopol'd, A V; Baklaushev, V P; Korchagina, A A; Shein, S A; Grinenko, N F; Pavlov, K A; Ryabukhin, I A; Chekhonin, V P

2012-04-01

cDNA encoding VEGF and Ig-like extracellular domains 2-4 of VEGFR-1 (sFlt-1(2-4)) were cloned into prokaryotic expression vectors pET32a and pQE60. Recombinant proteins were purified (metal affinity chromatography) and renatured. Chemiluminescent study for the interaction of recombinant VEGF and sFlt-1(2-4) showed that biotinylated VEGF specifically binds to the polystyrene-immobilized receptor extracellular fragment. Biotinylated recombinant sFlt-1 interacts with immobilized VEGF. Analysis of the interaction of immobilized recombinant VEGFR-1 and VEGF with C6 glioma cells labeled with CFDA-SE (vital fluorescent dye) showed that recombinant VEGFR-1 also binds to native membrane-associated VEGF. Recombinant VEGF was shown to bind to specific receptors expressed on the surface of C6 glioma cells. Functional activity of these proteins was confirmed by ligand-receptor assay for VEGF and VEGFR-1 (sFlt-1) and quantitative chemiluminescent detection.

Dynamics of TBP binding to the TATA box

NASA Astrophysics Data System (ADS)

Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.

2008-02-01

Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.

Contribution of the 37-kDa laminin receptor precursor in the anti-metastatic PSP94-derived peptide PCK3145 cell surface binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Annabi, Borhane; Currie, Jean-Christophe; Bouzeghrane, Mounia

Purpose: PCK3145 is an anti-metastatic synthetic peptide with promising therapeutic efficacy against hormone-refractory prostate cancer. The characterization of the PCK3145 peptide cell surface binding/internalization mechanisms and of the receptors involved remained to be explored. Results: [{sup 14}C]PCK3145 cell surface binding assays showed rapid and transient kinetic profile, that was inhibited by RGD peptides, laminin, hyaluronan, and type-I collagen. RGD peptides were however unable to inhibit PCK3145 intracellular uptake. Far-Western ligand binding studies enabled the identification of the 37-kDa laminin receptor precursor (37LRP) as a potential ligand for PCK3145. Overexpression of the recombinant 37LRP indeed led to an increase in PCK3145more » binding but unexpectedly not to its uptake. Conclusions: Our data support the implication of laminin receptors in cell surface binding and in transducing PCK3145 anti-metastatic effects, and provide a rational for targeting cancers that express high levels of such laminin receptors.« less

Single cell kinase signaling assay using pinched flow coupled droplet microfluidics.

PubMed

Ramji, Ramesh; Wang, Ming; Bhagat, Ali Asgar S; Tan Shao Weng, Daniel; Thakor, Nitish V; Teck Lim, Chwee; Chen, Chia-Hung

2014-05-01

Droplet-based microfluidics has shown potential in high throughput single cell assays by encapsulating individual cells in water-in-oil emulsions. Ordering cells in a micro-channel is necessary to encapsulate individual cells into droplets further enhancing the assay efficiency. This is typically limited due to the difficulty of preparing high-density cell solutions and maintaining them without cell aggregation in long channels (>5 cm). In this study, we developed a short pinched flow channel (5 mm) to separate cell aggregates and to form a uniform cell distribution in a droplet-generating platform that encapsulated single cells with >55% encapsulation efficiency beating Poisson encapsulation statistics. Using this platform and commercially available Sox substrates (8-hydroxy-5-(N,N-dimethylsulfonamido)-2-methylquinoline), we have demonstrated a high throughput dynamic single cell signaling assay to measure the activity of receptor tyrosine kinases (RTKs) in lung cancer cells triggered by cell surface ligand binding. The phosphorylation of the substrates resulted in fluorescent emission, showing a sigmoidal increase over a 12 h period. The result exhibited a heterogeneous signaling rate in individual cells and showed various levels of drug resistance when treated with the tyrosine kinase inhibitor, gefitinib.

Human amniotic epithelial cells inhibit CD4+ T cell activation in acute kidney injury patients by influencing the miR-101-c-Rel-IL-2 pathway.

PubMed

Liu, Junfeng; Hua, Rong; Gong, Zhangbin; Shang, Bin; Huang, Yongyi; Guo, Lihe; Liu, Te; Xue, Jun

2017-01-01

In the pathogenesis of acute kidney injury (AKI), the release of multiple interleukins can lead to increased kidney damage. Human amniotic epithelial cells (HuAECs) can inhibit immune cell activation in vivo and in vitro. We hypothesized that HuAECs could weaken patient-derived peripheral blood CD4+ T-cell activation and decreasing the ability of these cells to express and release IL-2. -Cell proliferation assay revealed that under the same culture conditions, activated AKI patient-derived CD4+ T cells had a significantly reduced proliferation rate when were co-cultured with HuAECs. And the level of IL-2 released was also significantly reduced. Western blot and qRT-PCR assays showed that the expression of c-Rel in the CD4+ T cells was also significantly reduced. However, the expression level of endogenous miR-101 in the CD4+ T cells co-cultured with HuAECs was significantly increased. Luciferase reporter assay results suggested that miR-101 could bind to a specific site in the c-Rel 3' UTR and induce the post-transcriptional silencing of c-Rel. Subsequently, we over-expressed miR-101 in AKI patient-derived CD4+ T cells. The qRT-PCR and western blot assay results revealed that the expression of endogenous c-Rel was significantly reduced, while the ELISA results indicated that the level of IL-2 released was also significantly decreased. Finally, ChIP-PCR assay results showed that the miR-101-overexpressing CD4+ T-cell group and the HuAEC co-culture CD4+ T-cell group exhibited significantly decreased binding capacities between the 'c-Rel-NFκB' complex and the IL-2 gene promoter, and the transcriptional activity of IL-2 was also significantly decreased. Therefore, we confirmed that HuAECs can stimulate miR-101 expression in AKI patient-derived peripheral blood CD4+ T cells, thus inhibiting the expression of the miR-101 target gene c-Rel and leading to a reduction in IL-2 expression and release. Copyright © 2016 Elsevier Ltd. All rights reserved.

A novel cell-based assay for measuring neutralizing autoantibodies against type I interferons in patients with autoimmune polyendocrine syndrome type 1.

PubMed

Breivik, Lars; Oftedal, Bergithe E V; Bøe Wolff, Anette S; Bratland, Eirik; Orlova, Elizaveta M; Husebye, Eystein S

2014-07-01

An important characteristic of autoimmune polyendocrine syndrome type 1 (APS 1) is the existence of neutralizing autoantibodies (nAbs) against the type I interferons (IFN) -α2 and -ω at frequencies close to 100%. Type 1 IFN autoantibodies are detected by antiviral neutralizing assays (AVA), binding assays with radiolabelled antigens (RLBA), enzyme-linked immunosorbent assay (ELISA), or by reporter-based cell assays. We here present a simple and reliable version of the latter utilizing a commercially available cell line (HEK-Blue IFN-α/β). All 67 APS 1 patients were positive for IFN-ω nAbs, while 90% were positive for IFN-α2 nAbs, a 100% and 96% correlation with RLBA, respectively. All blood donors and non-APS 1 patients were negative. The dilution titer required to reduce the effect of IFN-ω nAbs correlated with the RLBA index. This cell-based autoantibody assay (CBAA) is easy to perform, suitable for high throughput, while providing high specificity and sensitivity. Copyright © 2014 Elsevier Inc. All rights reserved.

Nucleolin: acharan sulfate–binding protein on the surface of cancer cells

PubMed Central

Joo, Eun Ji; ten Dam, Gerdy B.; van Kuppevelt, Toin H.; Toida, Toshihiko; Linhardt, Robert J.; Kim, Yeong Shik

2005-01-01

Glycosaminoglycans (GAGs) are complex polysaccharides that participate in the regulation of physiological processes through the interactions with a wide variety of proteins. Acharan sulfate (AS), isolated from the giant African snail Achatina fulica, primarily consists of the repeating disaccharide structure α-D-N-acetylglucosaminyl (1→4) 2-sulfoiduronic acid. Exogenous AS was injected subcutaneously near the tumor tissue in C57BL/6 mice that had been implanted with Lewis lung carcinoma cells (LLCs). The location of AS in the tumor was assessed by staining of sectioned tissues with alcian blue and periodic acid–Schiff (PAS) reagent. In vitro assays indicated binding of cells to 50 μg/ml AS (or heparin) after a 5-h incubation. Immunofluorescence assays, using anti-AS antibody, detected AS at the cell surface. The outer-surface of LLCs were next biotinylated to identify the AS-binding proteins. Biotinylated cells were lysed, and the lysates were fractionated on the AS affinity column using a stepwise salt gradient (0, 0.1, 0.3, 0.5, 0.7, 1.0, and 2.0 M). The fractions were analyzed by SDS–PAGE with silver staining and western blotting. We focused on the proteins with high affinity for AS (eluting at 1 M NaCl) and detected only two bands by western blotting. ESI Q-TOF MS analysis of one of these bands, molecular weight ~110 kDa, showed it to be nucleolin. A phosphorylated form of nucleolin on the surface of cells acts as a cell surface receptor for a variety of ligands, including growth factors (i.e., basic fibroblast growth factor) and chemokines (i.e., midkine). These results show that nucleolin is one of several AS-binding proteins and suggest that AS might demonstrate its tumor growth inhibitory activity by binding the nucleolin receptor protein on the surface of cancer cells. PMID:15329357

Lipid Microarray Biosensor for Biotoxin Detection.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Anup K.; Throckmorton, Daniel J.; Moran-Mirabal, Jose C.

2006-05-01

We present the use of micron-sized lipid domains, patterned onto planar substrates and within microfluidic channels, to assay the binding of bacterial toxins via total internal reflection fluorescence microscopy (TIRFM). The lipid domains were patterned using a polymer lift-off technique and consisted of ganglioside-populated DSPC:cholesterol supported lipid bilayers (SLBs). Lipid patterns were formed on the substrates by vesicle fusion followed by polymer lift-off, which revealed micron-sized SLBs containing either ganglioside GT1b or GM1. The ganglioside-populated SLB arrays were then exposed to either Cholera toxin subunit B (CTB) or Tetanus toxin fragment C (TTC). Binding was assayed on planar substrates bymore » TIRFM down to 1 nM concentration for CTB and 100 nM for TTC. Apparent binding constants extracted from three different models applied to the binding curves suggest that binding of a protein to a lipid-based receptor is strongly affected by the lipid composition of the SLB and by the substrate on which the bilayer is formed. Patterning of SLBs inside microfluidic channels also allowed the preparation of lipid domains with different compositions on a single device. Arrays within microfluidic channels were used to achieve segregation and selective binding from a binary mixture of the toxin fragments in one device. The binding and segregation within the microfluidic channels was assayed with epifluorescence as proof of concept. We propose that the method used for patterning the lipid microarrays on planar substrates and within microfluidic channels can be easily adapted to proteins or nucleic acids and can be used for biosensor applications and cell stimulation assays under different flow conditions. KEYWORDS. Microarray, ganglioside, polymer lift-off, cholera toxin, tetanus toxin, TIRFM, binding constant.4« less

Reconfiguring the AR-TIF2 Protein–Protein Interaction HCS Assay in Prostate Cancer Cells and Characterizing the Hits from a LOPAC Screen

PubMed Central

Fancher, Ashley T.; Hua, Yun; Camarco, Daniel P.; Close, David A.; Strock, Christopher J.

2016-01-01

Abstract The continued activation of androgen receptor (AR) transcription and elevated expression of AR and transcriptional intermediary factor 2 (TIF2) coactivator observed in prostate cancer (CaP) recurrence and the development of castration-resistant CaP (CRPC) support a screening strategy for small-molecule inhibitors of AR-TIF2 protein–protein interactions (PPIs) to find new drug candidates. Small molecules can elicit tissue selective effects, because the cells of distinct tissues express different levels and cohorts of coregulatory proteins. We reconfigured the AR-TIF2 PPI biosensor (PPIB) assay in the PC-3 CaP cell line to determine whether AR modulators and hits from an AR-TIF2 PPIB screen conducted in U-2 OS cells would behave differently in the CaP cell background. Although we did not observe any significant differences in the compound responses between the assay performed in osteosarcoma and CaP cells, the U-2 OS AR-TIF2 PPIB assay would be more amenable to screening, because both the virus and cell culture demands are lower. We implemented a testing paradigm of counter-screens and secondary hit characterization assays that allowed us to identify and deprioritize hits that inhibited/disrupted AR-TIF2 PPIs and AR transcriptional activation (AR-TA) through antagonism of AR ligand binding or by non-specifically blocking nuclear receptor trafficking. Since AR-TIF2 PPI inhibitor/disruptor molecules act distally to AR ligand binding, they have the potential to modulate AR-TA in a cell-specific manner that is distinct from existing anti-androgen drugs, and to overcome the development of resistance to AR antagonism. We anticipate that the application of this testing paradigm to characterize the hits from an AR-TIF2 PPI high-content screening campaign will enable us to prioritize the AR-TIF2 PPI inhibitor/disruptor leads that have potential to be developed into novel therapeutics for CaP and CRPC. PMID:27606620

c-Myb Binds to a Sequence in the Proximal Region of the RAG-2 Promoter and Is Essential for Promoter Activity in T-Lineage Cells

PubMed Central

Wang, Qian-Fei; Lauring, Josh; Schlissel, Mark S.

2000-01-01

The RAG-2 gene encodes a component of the V(D)J recombinase which is essential for the assembly of antigen receptor genes in B and T lymphocytes. Previously, we reported that the transcription factor BSAP (PAX-5) regulates the murine RAG-2 promoter in B-cell lines. A partially overlapping but distinct region of the proximal RAG-2 promoter was also identified as an important element for promoter activity in T cells; however, the responsible factor was unknown. In this report, we present data demonstrating that c-Myb binds to a Myb consensus site within the proximal promoter and is critical for its activity in T-lineage cells. We show that c-Myb can transactivate a RAG-2 promoter-reporter construct in cotransfection assays and that this transactivation depends on the proximal promoter Myb consensus site. By using a chromatin immunoprecipitation (ChIP) strategy, fractionation of chromatin with anti-c-Myb antibody specifically enriched endogenous RAG-2 promoter DNA sequences. DNase I genomic footprinting revealed that the c-Myb site is occupied in a tissue-specific fashion in vivo. Furthermore, an integrated RAG-2 promoter construct with mutations at the c-Myb site was not enriched in the ChIP assay, while a wild-type integrated promoter construct was enriched. Finally, this lack of binding of c-Myb to a chromosomally integrated mutant RAG-2 promoter construct in vivo was associated with a striking decrease in promoter activity. We conclude that c-Myb regulates the RAG-2 promoter in T cells by binding to this consensus c-Myb binding site. PMID:11094072

Milk Inhibits the Biological Activity of Ricin

PubMed Central

Rasooly, Reuven; He, Xiaohua; Friedman, Mendel

2012-01-01

Ricin is a highly toxic protein produced by the castor plant Ricinus communis. The toxin is relatively easy to isolate and can be used as a biological weapon. There is great interest in identifying effective inhibitors for ricin. In this study, we demonstrated by three independent assays that a component of reconstituted powdered milk has a high binding affinity to ricin. We discovered that milk can competitively bind to and reduce the amount of toxin available to asialofetuin type II, which is used as a model to study the binding of ricin to galactose cell-surface receptors. Milk also removes ricin bound to the microtiter plate. In parallel experiments, we demonstrated by activity assay and by immuno-PCR that milk can bind competitively to 1 ng/ml ricin, reducing the amount of toxin uptake by the cells, and thus inhibit the biological activity of ricin. The inhibitory effect of milk on ricin activity in Vero cells was at the same level as by anti-ricin antibodies. We also found that (a) milk did not inhibit ricin at concentrations of 10 or 100 ng/ml; (b) autoclaving 10 and 100 ng/ml ricin in DMEM at 121 °C for 30 min completely abolished activity; and (c) milk did not affect the activity of another ribosome inactivating protein, Shiga toxin type 2 (Stx2), produced by pathogenic Escherichia coli O157:H7. Unlike ricin, which is internalized into the cells via a galactose-binding site, Stx2 is internalized through the cell surface receptor glycolipid globotriasylceramides Gb3 and Gb4. These observations suggest that ricin toxicity may possibly be reduced at room temperature by a widely consumed natural liquid food. PMID:22733821

UV damage-specific DNA-binding protein in xeroderma pigmentosum complementation group E

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kataoka, H.; Fujiwara, Y.

1991-03-29

The gel mobility shift assay method revealed a specifically ultraviolet (UV) damage recognizing, DNA-binding protein in nuclear extracts of normal human cells. The resulted DNA/protein complexes caused the two retarded mobility shifts. Four xeroderma pigmentosum complementation group E (XPE) fibroblast strains derived from unrelated Japanese families were not deficient in such a DNA damage recognition/binding protein because of the normal complex formation and gel mobility shifts, although we confirmed the reported lack of the protein in the European XPE (XP2RO and XP3RO) cells. Thus, the absence of this binding protein is not always commonly observed in all the XPE strains,more » and the partially repair-deficient and intermediately UV-hypersensitive phenotype of XPE cells are much similar whether or not they lack the protein.« less

Endoplasmic reticulum stress is involved in the lidocaine-induced apoptosis in SH-SY5Y neuroblastoma cells.

PubMed

Li, Kehan; Han, Xuechang

2015-05-01

Lidocaine has been indicated to promote apoptosis and to promote endoplasmic reticulum (ER) stress. However, the mechanism underlining ER stress-mediated apoptosis is unclear. In the present study, we investigated the promotion to ER stress in the lidocaine-induced apoptosis in human neuroblastoma SH-SY5Y cells. Firstly, we confirmed that lidocaine treatment induced apoptosis in SH-SY5Y cells, time-dependently and dose-dependently, via MTT cell viability assay and annexin V/FITC apoptosis detection with a FACScan flow cytometer. And the anti-apoptosis Bcl-2 and Bcl-xL were downregulated, whereas the apoptosis-executive caspase 3 was promoted through Western blot assay and caspase 3 activity assay. Moreover, the ER stress-associated binding immunoglobulin protein (BiP), PKR-like ER kinase (PERK), activating transcription factor 4 (ATF4) and CCAAT/enhancer-binding protein homologous protein (CHOP) were also upregulated at both mRNA and protein levels by lidocaine treatment. On the other hand, downregulation of the ER stress-associated BiP by RNAi method not only blocked the lidocaine-promoted ER stress but also attenuated the lidocaine-induced SH-SY5Y cell apoptosis. In conclusion, the present study confirmed the involvement of ER stress in the lidocaine-induced apoptosis in human neuroblastoma SH-SY5Y cells. Our study provides a better understanding on the mechanism of lidocaine's neurovirulence.

Characterization of a unique motif in LIM mineralization protein-1 that interacts with jun activation-domain-binding protein 1.

PubMed

Sangadala, Sreedhara; Yoshioka, Katsuhito; Enyo, Yoshio; Liu, Yunshan; Titus, Louisa; Boden, Scott D

2014-01-01

Development and repair of the skeletal system and other organs are highly dependent on precise regulation of the bone morphogenetic protein (BMP) pathway. The use of BMPs clinically to induce bone formation has been limited in part by the requirement of much higher doses of recombinant proteins in primates than were needed in cell culture or rodents. Therefore, increasing cellular responsiveness to BMPs has become our focus. We determined that an osteogenic LIM mineralization protein, LMP-1 interacts with Smurf1 (Smad ubiquitin regulatory factor 1) and prevents ubiquitination of Smads resulting in potentiation of BMP activity. In the region of LMP-1 responsible for bone formation, there is a motif that directly interacts with the Smurf1 WW2 domain and thus effectively competes for binding with Smad1 and Smad5, key signaling proteins in the BMP pathway. Here we show that the same region also contains a motif that interacts with Jun activation-domain-binding protein 1 (Jab1) which targets a common Smad, Smad4, shared by both the BMP and transforming growth factor-β (TGF-β) pathways, for proteasomal degradation. Jab1 was first identified as a coactivator of the transcription factor c-Jun. Jab1 binds to Smad4, Smad5, and Smad7, key intracellular signaling molecules of the TGF-β superfamily, and causes ubiquitination and/or degradation of these Smads. We confirmed a direct interaction of Jab1 with LMP-1 using recombinantly expressed wild-type and mutant proteins in slot-blot-binding assays. We hypothesized that LMP-1 binding to Jab1 prevents the binding and subsequent degradation of these Smads causing increased accumulation of osteogenic Smads in cells. We identified a sequence motif in LMP-1 that was predicted to interact with Jab1 based on the MAME/MAST sequence analysis of several cellular signaling molecules that are known to interact with Jab-1. We further mutated the potential key interacting residues in LMP-1 and showed loss of binding to Jab1 in binding assays in vitro. The activities of various wild-type and mutant LMP-1 proteins were evaluated using a BMP-responsive luciferase reporter and alkaline phosphatase assay in mouse myoblastic cells that were differentiated toward the osteoblastic phenotype. Finally, to strengthen physiological relevance of LMP-1 and Jab1 interaction, we showed that overexpression of LMP-1 caused nuclear accumulation of Smad4 upon BMP treatment which is reflective of increased Smad signaling in cells.

Berberine-induced autophagic cell death by elevating GRP78 levels in cancer cells.

PubMed

La, Xiaoqin; Zhang, Lichao; Li, Zhuoyu; Yang, Peng; Wang, Yingying

2017-03-28

Berberine, an isoquinoline alkaloid extracted from Coptidis Rhizoma, has been shown to induce cancer cell autophagic death. Glucose regulated protein 78 (GRP78) is associated with stress-induced autophagy. However, the related mechanisms between berberine-induced cancer cell autophagy and GRP78 remain to be elucidated. Here, we report that berberine can induce autophagic cancer cell death by elevating levels of GRP78. These results further demonstrated that berberine enhanced GRP78 by suppression of ubiquitination / proteasomal degradation of GRP78 and activation of ATF6. Moreover, fluorescence spectrum assay revealed that berberine could bind to GRP78 and form complexes. Finally, co-IP analysis showed that the ability of GRP78 to bind to VPS34 was increased with berberine treatment. Taken together, our results suggest that berberine induces autophagic cancer cell death via enhancing GRP78 levels and the ability of GRP78 to bind to VPS34.

Berberine-induced autophagic cell death by elevating GRP78 levels in cancer cells

PubMed Central

Li, Zhuoyu; Yang, Peng; Wang, Yingying

2017-01-01

Berberine, an isoquinoline alkaloid extracted from Coptidis Rhizoma, has been shown to induce cancer cell autophagic death. Glucose regulated protein 78 (GRP78) is associated with stress-induced autophagy. However, the related mechanisms between berberine-induced cancer cell autophagy and GRP78 remain to be elucidated. Here, we report that berberine can induce autophagic cancer cell death by elevating levels of GRP78. These results further demonstrated that berberine enhanced GRP78 by suppression of ubiquitination / proteasomal degradation of GRP78 and activation of ATF6. Moreover, fluorescence spectrum assay revealed that berberine could bind to GRP78 and form complexes. Finally, co-IP analysis showed that the ability of GRP78 to bind to VPS34 was increased with berberine treatment. Taken together, our results suggest that berberine induces autophagic cancer cell death via enhancing GRP78 levels and the ability of GRP78 to bind to VPS34. PMID:28157699

Specific DNA binding activity of T antigen subclasses varies among different SV40-transformed cell lines.

PubMed

Burger, C; Fanning, E

1983-04-15

Large tumor antigen (T antigen) occurs in at least three different oligomeric subclasses in cells infected or transformed by simian virus 40 (SV40): 5-7 S, 14-16 S, and 23-25 S. The 23-25 S form is complexed with a host phosphoprotein (p53). The DNA binding properties of these three subclasses of T antigen from nine different cell lines and free p53 protein were compared using an immunoprecipitation assay. All three subclasses of T antigen bound specifically to SV40 DNA sequences near the origin of replication. However, the DNA binding activity varied between different cell lines over a 40- to 50-fold range. The 23-25 S and 14-16 S forms from most of the cell lines tested bound much less SV40 origin DNA than 5-7 S T antigen. The free p53 phosphoprotein did not bind specifically to any SV40 DNA sequences.

Modeling techniques and fluorescence imaging investigation of the interactions of an anthraquinone derivative with HSA and ctDNA

NASA Astrophysics Data System (ADS)

Fu, Zheng; Cui, Yanrui; Cui, Fengling; Zhang, Guisheng

2016-01-01

A new anthraquinone derivative (AORha) was synthesized. Its interactions with human serum albumin (HSA) and calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopy, UV-visible absorption spectroscopy and molecular modeling. Cell viability assay and cell imaging experiment were performed using cervical cancer cells (HepG2 cells). The fluorescence results revealed that the quenching mechanism was static quenching. At different temperatures (290, 300, 310 K), the binding constants (K) and the number of binding sites (n) were determined, respectively. The positive ΔH and ΔS values showed that the binding of AORha with HSA was hydrophobic force, which was identical with the molecular docking result. Studying the fluorescence spectra, UV spectra and molecular modeling also verified that the binding mode of AORha and ctDNA might be intercalative. When HepG2 cells were treated with AORha, the fluorescence became brighter and turned green, which could be used for bioimaging.

Modeling techniques and fluorescence imaging investigation of the interactions of an anthraquinone derivative with HSA and ctDNA.

PubMed

Fu, Zheng; Cui, Yanrui; Cui, Fengling; Zhang, Guisheng

2016-01-15

A new anthraquinone derivative (AORha) was synthesized. Its interactions with human serum albumin (HSA) and calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopy, UV-visible absorption spectroscopy and molecular modeling. Cell viability assay and cell imaging experiment were performed using cervical cancer cells (HepG2 cells). The fluorescence results revealed that the quenching mechanism was static quenching. At different temperatures (290, 300, 310 K), the binding constants (K) and the number of binding sites (n) were determined, respectively. The positive ΔH and ΔS values showed that the binding of AORha with HSA was hydrophobic force, which was identical with the molecular docking result. Studying the fluorescence spectra, UV spectra and molecular modeling also verified that the binding mode of AORha and ctDNA might be intercalative. When HepG2 cells were treated with AORha, the fluorescence became brighter and turned green, which could be used for bioimaging. Copyright © 2015 Elsevier B.V. All rights reserved.

Analysis of molecular determinants of affinity and relative efficacy of a series of R- and S-2-(dipropylamino)tetralins at the 5-HT1A serotonin receptor

PubMed Central

Alder, J Tracy; Hacksell, Uli; Strange, Philip G

2003-01-01

Factors influencing agonist affinity and relative efficacy have been studied for the 5-HT1A serotonin receptor using membranes of CHO cells expressing the human form of the receptor and a series of R-and S-2-(dipropylamino)tetralins (nonhydroxylated and monohydroxylated (5-OH, 6-OH, 7-OH, 8-OH) species). Ligand binding studies were used to determine dissociation constants for agonist binding to the 5-HT1A receptor: Ki values for agonists were determined in competition versus the binding of the agonist [3H]-8-OH DPAT. Competition data were all fitted best by a one-binding site model.Ki values for agonists were also determined in competition versus the binding of the antagonist [3H]-NAD-199. Competition data were all fitted best by a two-binding site model, and agonist affinities for the higher (Kh) and lower affinity (Kl) sites were determined. The ability of the agonists to activate the 5-HT1A receptor was determined using stimulation of [35S]-GTPγS binding. Maximal effects of agonists (Emax) and their potencies (EC50) were determined from concentration/response curves for stimulation of [35S]-GTPγS binding. Kl/Kh determined from ligand binding assays correlated with the relative efficacy (relative Emax) of agonists determined in [35S]-GTPγS binding assays. There was also a correlation between Kl/Kh and Kl/EC50 for agonists determined from ligand binding and [35S]-GTPγS binding assays. Simulations of agonist binding and effect data were performed using the Ternary Complex Model in order to assess the use of Kl/Kh for predicting the relative efficacy of agonists. PMID:12684269

Porcine aminopeptidase N binds to F4+ enterotoxigenic Escherichia coli fimbriae.

PubMed

Xia, Pengpeng; Wang, Yiting; Zhu, Congrui; Zou, Yajie; Yang, Ying; Liu, Wei; Hardwidge, Philip R; Zhu, Guoqiang

2016-02-09

F4(+) enterotoxigenic Escherichia coli (ETEC) strains cause diarrheal disease in neonatal and post-weaned piglets. Several different host receptors for F4 fimbriae have been described, with porcine aminopeptidase N (APN) reported most recently. The FaeG subunit is essential for the binding of the three F4 variants to host cells. Here we show in both yeast two-hybrid and pulldown assays that APN binds directly to FaeG, the major subunit of F4 fimbriae, from three serotypes of F4(+) ETEC. Modulating APN gene expression in IPEC-J2 cells affected ETEC adherence. Antibodies raised against APN or F4 fimbriae both reduced ETEC adherence. Thus, APN mediates the attachment of F4(+) E. coli to intestinal epithelial cells.

Telomere 1 (POT1) gene expression and its association with telomerase activity in colorectal tumor samples with different pathological features.

PubMed

Izgi, Ahu; Gunal, Armagan; Yalcin, Serap; Gunduz, Ufuk

2014-09-01

The ends of chromosoms, telomeres are bound with a number of proteins which protect and stabilize telomeres against degredation, end to end fusion and aberrant recombinations. Telomeric DNA is bound of two groups of proteins, which are double-stranded telomeric DNA bindings proteins, and single stranded telomeric binding proteins. Among telomere binding proteins, protections of telomere 1 protein is a single stranded telomere binding proteins and suggested to be a significant player for telomere elongation and has an association with an enzyme called as telomerase which is an intrinsic reverse transcriptase. Telomerase synthesizes hexameric telomeric repeats onto the chromosomes thereby compansating telomere loss in immortal cells, such as tumor cells, whereas telomeres are shorthened with each division in normal cells. PCR-based TRAP (telomeric repeat amplification protocol) assay is a very sensitive assay for the detection of enzymatic activity of telomerase even if a few numbers of cancerous cells are available. The association between telomerase activity and hPOT1 expression in colorectal cancer is still unclear. Protein extraction was performed from specimens of matched normal and colorectal cancer specimens. Protein concentrations were determined by Bradford assay. Optimized protein concentrations were used for TRAP Assay. TRAP products were seperated by vertical gel electrophoresis on 12.5% polyacrylamide gels and visualized by silver staining. Gene expression of hPOT1 was determined by qPCR analysis. The results demonstrated that all tumor tissues were telomerase positive whereas all corresponding normal tissue was telomerase negative. Among clinicopathological findings, telomerase activity was found to be associated with stage, histology, localization, distant metastasis and lymph node metastasis of tumor in the current study. Although all of the clinicopathological findings differed in the expression of hPOT1 compared to normal tissues, they did not differ from each other significantly, except side of tumor and lymph node metastasis. Telomerase activity and hPOT1 gene expression may serve as a promising tumor marker for colorectal cancer and there is a close association between the enzymatic activty of telomerase and the expression of human protection of telomere 1 gene. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.

PubMed

Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H

2001-12-21

We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rimmaudo, Laura Elizabeth; Torre, Eulalia de la; Sacerdote de Lustig, Eugenia

Angiogenesis is a process of new blood vessel development from pre-existing vasculature and it plays an essential role in tumor growth and metastases. Here, we investigate the expression of muscarinic acetylcholine receptors (mAchR) and their participation in tumor cell proliferation and angiogenesis ability. Saturation binding assays with the tritiated muscarinic antagonist quinuclidinyl benzilate indicate that LMM3 cells derived from a murine mammary adenocarcinoma express a single class of functional mAchR. Competition binding assays with selective muscarinic antagonists indicate a predominance of M{sub 3} receptor subtype. The muscarinic agonist carbachol (CARB) stimulates LMM3 cell proliferation in a concentration dependent manner. Themore » maximal effect induced by 10{sup -9} M CARB was totally blunted by atropine and by the selective M{sub 3} and M{sub 1} antagonists, para-fluoro hexahydro sila-difenidol (pf-HHSiD) and pirenzepine, respectively. In addition, pf-HHSiD completely blocked in vivo CARB-induced neovascular formation and vascular endothelial growth factor-A in LMM3 tumor cells. We can conclude that mAchR expressed in LMM3 mammary tumor cells positively regulate proliferation and angiogenesis required for tumor progression.« less

An assay to image neuronal microtubule dynamics in mice.

PubMed

Kleele, Tatjana; Marinković, Petar; Williams, Philip R; Stern, Sina; Weigand, Emily E; Engerer, Peter; Naumann, Ronald; Hartmann, Jana; Karl, Rosa M; Bradke, Frank; Bishop, Derron; Herms, Jochen; Konnerth, Arthur; Kerschensteiner, Martin; Godinho, Leanne; Misgeld, Thomas

2014-09-12

Microtubule dynamics in neurons play critical roles in physiology, injury and disease and determine microtubule orientation, the cell biological correlate of neurite polarization. Several microtubule binding proteins, including end-binding protein 3 (EB3), specifically bind to the growing plus tip of microtubules. In the past, fluorescently tagged end-binding proteins have revealed microtubule dynamics in vitro and in non-mammalian model organisms. Here, we devise an imaging assay based on transgenic mice expressing yellow fluorescent protein-tagged EB3 to study microtubules in intact mammalian neurites. Our approach allows measurement of microtubule dynamics in vivo and ex vivo in peripheral nervous system and central nervous system neurites under physiological conditions and after exposure to microtubule-modifying drugs. We find an increase in dynamic microtubules after injury and in neurodegenerative disease states, before axons show morphological indications of degeneration or regrowth. Thus increased microtubule dynamics might serve as a general indicator of neurite remodelling in health and disease.

Glycolipid-Dependent, Protease Sensitive Internalization of Pseudomonas aeruginosa Into Cultured Human Respiratory Epithelial Cells

PubMed Central

Emam, Aufaugh; Carter, William G; Lingwood, Clifford

2010-01-01

Internalization of PAK strain Pseudomonas aeruginosa into human respiratory epithelial cell lines and HeLa cervical cancer cells in vitro was readily demonstrable via a gentamycin protection assay. Depletion of target cell glycosphingolipids (GSLs) using a glucosyl ceramide synthase inhibitor, P4, completely prevented P. aeruginosa internalization. In contrast, P4 treatment had no effect on the internalization of Salmonella typhimurium into HeLa cells. Internalized P. aeruginosa were within membrane vacuoles, often containing microvesicles, between the bacterium and the limiting membrane. P. aeruginosa internalization was markedly enhanced by target cell pretreatment with the exogenous GSL, deacetyl gangliotetraosyl ceramide (Gg4). Gg4 binds the lipid raft marker, GM1 ganglioside. Target cell pretreatment with TLCK, but not other (serine) protease inhibitors, prevented both P. aeruginosa host cell binding and internalization. NFkB inhibition also prevented internalization. A GSL-containing lipid-raft model of P. aeruginosa host cell binding/internalization is proposed PMID:21270937

Biological evaluation, docking and molecular dynamic simulation of some novel diaryl urea derivatives bearing quinoxalindione moiety

PubMed Central

Sadeghian-Rizi, Sedighe; Khodarahmi, Ghadamali Ali; Sakhteman, Amirhossein; Jahanian-Najafabadi, Ali; Rostami, Mahboubeh; Mirzaei, Mahmoud; Hassanzadeh, Farshid

2017-01-01

In this study a series of diarylurea derivatives containing quinoxalindione group were biologically evaluated for their cytotoxic activities using MTT assay against MCF-7 and HepG2 cell lines. Antibacterial activities of these compounds were also evaluated by Microplate Alamar Blue Assay (MABA) against three Gram-negative (Escherichia coli, Pseudomonas aeruginosa and Salmonella typhi), three Gram-positive (Staphylococcus aureus, Bacillus subtilis and Listeria monocitogenes) and one yeast-like fungus (Candida albicans) strain. Furthermore, molecular docking was carried out to study the binding pattern of the compounds to the active site of B-RAF kinase (PDB code: 1UWH). Molecular dynamics simulation was performed on the best ligand (16e) to investigate the ligand binding dynamics in the physiological environment. Cytotoxic evaluation revealed the most prominent cytotoxicity for 6 compounds with IC50 values of 10-18 μM against two mentioned cell lines. None of the synthesized compounds showed significant antimicrobial activity. The obtained results of the molecular docking study showed that all compounds fitted in the binding site of enzyme with binding energy range of -11.22 to -12.69 kcal/mol vs sorafenib binding energy -11.74 kcal/mol as the lead compound. Molecular dynamic simulation indicated that the binding of ligand (16e) was stable in the active site of B-RAF during the simulation. PMID:29204178

Establishment of a robust dengue virus NS3-NS5 binding assay for identification of protein-protein interaction inhibitors.

PubMed

Takahashi, Hirotaka; Takahashi, Chikako; Moreland, Nicole J; Chang, Young-Tae; Sawasaki, Tatsuya; Ryo, Akihide; Vasudevan, Subhash G; Suzuki, Youichi; Yamamoto, Naoki

2012-12-01

Whereas the dengue virus (DENV) non-structural (NS) proteins NS3 and NS5 have been shown to interact in vitro and in vivo, the biological relevance of this interaction in viral replication has not been fully clarified. Here, we first applied a simple and robust in vitro assay based on AlphaScreen technology in combination with the wheat-germ cell-free protein production system to detect the DENV-2 NS3-NS5 interaction in a 384-well plate. The cell-free-synthesized NS3 and NS5 recombinant proteins were soluble and in possession of their respective enzymatic activities in vitro. In addition, AlphaScreen assays using the recombinant proteins detected a specific interaction between NS3 and NS5 with a robust Z' factor of 0.71. By employing the AlphaScreen assay, we found that both the N-terminal protease and C-terminal helicase domains of NS3 are required for its association with NS5. Furthermore, a competition assay revealed that the binding of full-length NS3 to NS5 was significantly inhibited by the addition of an excess of NS3 protease or helicase domains. Our results demonstrate that the AlphaScreen assay can be used to discover novel antiviral agents targeting the interactions between DENV NS proteins. Copyright © 2012 Elsevier B.V. All rights reserved.

Apolipoprotein E Is a Ligand for Triggering Receptor Expressed on Myeloid Cells 2 (TREM2)*

PubMed Central

Atagi, Yuka; Liu, Chia-Chen; Painter, Meghan M.; Chen, Xiao-Fen; Verbeeck, Christophe; Zheng, Honghua; Li, Xia; Rademakers, Rosa; Kang, Silvia S.; Xu, Huaxi; Younkin, Steven; Das, Pritam; Fryer, John D.; Bu, Guojun

2015-01-01

Several heterozygous missense mutations in the triggering receptor expressed on myeloid cells 2 (TREM2) have recently been linked to risk for a number of neurological disorders including Alzheimer disease (AD), Parkinson disease, and frontotemporal dementia. These discoveries have re-ignited interest in the role of neuroinflammation in the pathogenesis of neurodegenerative diseases. TREM2 is highly expressed in microglia, the resident immune cells of the central nervous system. Along with its adaptor protein, DAP12, TREM2 regulates inflammatory cytokine release and phagocytosis of apoptotic neurons. Here, we report apolipoprotein E (apoE) as a novel ligand for TREM2. Using a biochemical assay, we demonstrated high-affinity binding of apoE to human TREM2. The functional significance of this binding was highlighted by increased phagocytosis of apoE-bound apoptotic N2a cells by primary microglia in a manner that depends on TREM2 expression. Moreover, when the AD-associated TREM2-R47H mutant was used in biochemical assays, apoE binding was vastly reduced. Our data demonstrate that apoE-TREM2 interaction in microglia plays critical roles in modulating phagocytosis of apoE-bound apoptotic neurons and establish a critical link between two proteins whose genes are strongly linked to the risk for AD. PMID:26374899

Growth inhibition of tumor cells in vitro by using monoclonal antibodies against gonadotropin-releasing hormone receptor.

PubMed

Lee, Gregory; Ge, Bixia

2010-07-01

As the continuation of a previous study, synthetic peptides corresponding to the extracellular domains of human gonadotropin-releasing hormone (GnRH) receptor were used to generate additional monoclonal antibodies which were further characterized biochemically and immunologically. Among those identified to recognize GnRH receptor, monoclonal antibodies designated as GHR-103, GHR-106 and GHR-114 were found to exhibit high affinity (Kd < or = 1 x 10(-8) M) and specificity to GnRH receptor as judged by the whole cell binding immunoassay and Western blot assay. Both anti-GnRH receptor monoclonal antibodies and GnRH were shown to compete for the same binding site of GnRH receptor on the surface of cultured cancer cells. Growth inhibitions of cancer cells cultured in vitro were demonstrated by cellular apoptosis experiments (TUNEL and MTT assays) under different conditions of treatment with GHR-106 monoclonal antibody or GnRH analogs. It was generally observed that both GnRH I and GHR-106 effectively induce the apoptosis of cultured cancer cells as determined by TUNEL and MTT assays. Consistently, suppressions of gene expressions at mRNA levels were demonstrated with several ribosomal proteins (P0, P1, P2 and L37), when cancer cells were incubated with GnRH or GHR-106. The widespread expressions of GnRH receptor in almost all of the studied human cancer cell lines were also demonstrated by RT-PCR and Western blot assay, as well as indirect immunofluorescence assay with either of these monoclonal antibodies as the primary antibody. In view of the longer half life of antibodies as compared to that of GnRH or its analogs, anti-GnRH receptor monoclonal antibodies in humanized forms could function as GnRH analogs and serve as an ideal candidate of anti-cancer drugs for therapeutic treatments of various cancers in humans as well as for fertility regulations.

Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.

PubMed

Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi

2009-04-01

Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns.

Roles of Polypyrimidine Tract Binding Proteins in Major Immediate-Early Gene Expression and Viral Replication of Human Cytomegalovirus▿

PubMed Central

Cosme, Ruth S. Cruz; Yamamura, Yasuhiro; Tang, Qiyi

2009-01-01

Human cytomegalovirus (HCMV), a member of the β subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns. PMID:19144709

The organic solute transporters alpha and beta are induced by hypoxia in human hepatocytes

PubMed Central

Schaffner, Carlos A; Mwinyi, Jessica; Gai, Zhibo; Thasler, Wolfgang E; Eloranta, Jyrki J; Kullak-Ublick, Gerd A

2015-01-01

Background & Aims The organic solute transporters alpha and beta (OSTα-OSTβ) form a heterodimeric transporter located at the basolateral membrane of intestinal epithelial cells and hepatocytes. Liver injury caused by ischaemia-reperfusion, cancer, inflammation or cholestasis can induce a state of hypoxia in hepatocytes. Here, we studied the effect of hypoxia on the expression of OSTα-OSTβ. Methods OSTα-OSTβ expression was measured in Huh7 cells and primary human hepatocytes (PHH) exposed to chenodeoxycholic acid (CDCA), hypoxia or both. OSTα-OSTβ promoter activity was analysed in luciferase reporter gene assays. Binding of hypoxia-inducible factor-1 alpha (HIF-1α) to the OSTα-OSTβ gene promoters was studied in electrophoretic mobility shift assays (EMSA). Results Expression of OSTα and OSTβ increased in PHH under conditions of hypoxia. Exposure of Huh7 cells or PHH to CDCA (50 μM) enhanced the effect of hypoxia on OSTα mRNA levels. In luciferase assays and EMSA, the inducing effect of low oxygen could be assigned to HIF-1α, which binds to hypoxia responsive elements (HRE) in the OSTα and OSTβ gene promoters. Site-directed mutagenesis of either the predicted HRE or the bile acid responsive FXR binding site abolished inducibility of the OSTα promoter, indicating that both elements need to be intact for induction by hypoxia and CDCA. In a rat model of chronic renal failure, the known increase in hepatic OSTα expression was associated with an increase in HIF-1α protein levels. Conclusion OSTα-OSTβ expression is induced by hypoxia. FXR and HIF-1α bind in close proximity to the OSTα gene promoter and produce synergistic effects on OSTα expression. PMID:24703425

Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Xiao-Min, E-mail: rxm200318@gmail.com; Guo, Liang-Hong, E-mail: LHGuo@rcees.ac.cn; Gao, Yu, E-mail: francesscototti@gmail.com

2013-05-01

Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effectmore » on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2′-OH-BDE-28, 3′-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3′-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. - Highlights: ► Thyroid hormone (TH) activity of OH-PBDEs with different Br number was evaluated. ► Four different experimental approaches were employed to investigate the mechanism. ► Low-brominated OH-PBDEs were agonists, but high-brominated ones were antagonists. ► Low-brominated OH-PBDEs bind to TH receptor differently than high-brominated ones.« less

ACTIVATION ASSAY FOR PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR- ALPHA (PPARÁ) BY PERFLUOROALKYL ACIDS (PFAAS) IN COS-1 CELLS

EPA Science Inventory

PFAAs have been found to elicit various physiological effects including peroxisome proliferation, indicating the mechanism of action for these chemicals could involve PPAR. This study investigates the ability of PFAAs to bind and activate mouse and human PPARα in COS-1 cell...

Synthesis and Biological Evaluation of Apogossypolone Derivatives as Pan-active Inhibitors of Anti-apoptotic B-Cell Lymphoma/Leukemia-2 (Bcl-2) Family Proteins

PubMed Central

Wei, Jun; Kitada, Shinichi; Stebbins, John L.; Placzek, William; Zhai, Dayong; Wu, Bainan; Rega, Michele F.; Zhang, Ziming; Cellitti, Jason; Yang, Li; Dahl, Russell; Reed, John C.; Pellecchia, Maurizio

2010-01-01

Overexpression of anti-apoptotic Bcl-2 family proteins is commonly related with tumor maintenance, progression, and chemoresistance. Inhibition of these anti-apoptotic proteins is an attractive approach for cancer therapy. Guided by nuclear magnetic resonance (NMR) binding assays, a series of 5, 5′ substituted compound 6a (Apogossypolone) derivatives was synthesized and identified pan-active antagonists of anti-apoptotic Bcl-2 family proteins, with binding potency in the low micromolar to nanomolar range. Compound 6f inhibits the binding of BH3 peptides to Bcl-XL, Bcl-2 and Mcl-1 with IC50 values of 3.10, 3.12 and 2.05 μM, respectively. In a cellular assay, 6f potently inhibits cell growth in several human cancer cell lines in a dose-dependent manner. Compound 6f further displays in vivo efficacy in transgenic mice and demonstrated superior single-agent antitumor efficacy in a PPC-1 mouse xenograft model. Together with its negligible toxicity, compound 6f represents a promising drug lead for the development of novel apoptosis-based therapies for cancer. PMID:21033669

Detection of the CLOCK/BMAL1 heterodimer using a nucleic acid probe with cycling probe technology.

PubMed

Nakagawa, Kazuhiro; Yamamoto, Takuro; Yasuda, Akio

2010-09-15

An isothermal signal amplification technique for specific DNA sequences, known as cycling probe technology (CPT), has enabled rapid acquisition of genomic information. Here we report an analogous technique for the detection of an activated transcription factor, a transcription element-binding assay with fluorescent amplification by apurinic/apyrimidinic (AP) site lysis cycle (TEFAL). This simple amplification assay can detect activated transcription factors by using a unique nucleic acid probe containing a consensus binding sequence and an AP site, which enables the CPT reaction with AP endonuclease. In this article, we demonstrate that this method detects the functional CLOCK/BMAL1 heterodimer via the TEFAL probe containing the E-box consensus sequence to which the CLOCK/BMAL1 heterodimer binds. Using TEFAL combined with immunoassays, we measured oscillations in the amount of CLOCK/BMAL1 heterodimer in serum-stimulated HeLa cells. Furthermore, we succeeded in measuring the circadian accumulation of the functional CLOCK/BMAL1 heterodimer in human buccal mucosa cells. TEFAL contributes greatly to the study of transcription factor activation in mammalian tissues and cell extracts and is a powerful tool for less invasive investigation of human circadian rhythms. 2010 Elsevier Inc. All rights reserved.

The transcription of the human fructose-bisphosphate aldolase C gene is activated by nerve-growth-factor-induced B factor in human neuroblastoma cells.

PubMed Central

Buono, P; Conciliis, L D; Izzo, P; Salvatore, F

1997-01-01

A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889

Galline Ex-FABP is an Antibacterial Siderocalin and a Lysophosphatidic Acid Sensor Functioning through Dual Ligand Specificities

PubMed Central

Correnti, Colin; Clifton, Matthew C.; Abergel, Rebecca J.; Allred, Ben; Hoette, Trisha M.; Ruiz, Mario; Cancedda, Ranieri; Raymond, Kenneth N.; Descalzi, Fiorella; Strong, Roland K.

2011-01-01

SUMMARY Galline Ex-FABP was identified as another candidate antibacterial, catecholate siderophore binding lipocalin (siderocalin) based on structural parallels with the family archetype, mammalian Siderocalin. Binding assays show that Ex-FABP retains iron in a siderophore-dependent manner in both hypertrophic and dedifferentiated chondrocytes, where Ex-FABP expression is induced after treatment with proinflammatory agents, and specifically binds ferric complexes of enterobactin, parabactin, bacillibactin and, unexpectedly, monoglucosylated enterobactin, which does not bind to Siderocalin. Growth arrest assays functionally confirm the bacteriostatic effect of Ex-FABP in vitro under iron-limiting conditions. The 1.8Å crystal structure of Ex-FABP explains the expanded specificity, but also surprisingly reveals an extended, multi-chambered cavity extending through the protein and encompassing two separate ligand specificities, one for bacterial siderophores (as in Siderocalin) at one end and one specifically binding co-purified lysophosphatidic acid, a potent cell signaling molecule, at the other end, suggesting Ex-FABP employs dual functionalities to explain its diverse endogenous activities. PMID:22153502

Heat shock factor 1 upregulates transcription of Epstein-Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju

Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determinedmore » by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.« less

Two novel GPER agonists induce gene expression changes and growth effects in cancer cells.

PubMed

Lappano, R; Rosano, C; Santolla, M F; Pupo, M; De Francesco, E M; De Marco, P; Ponassi, M; Spallarossa, A; Ranise, A; Maggiolini, M

2012-06-01

Although the action of estrogens has been traditionally explained by the binding to and transactivation of the nuclear estrogen receptor (ER)α and ERβ, recently the G protein-coupled receptor GPR30/GPER has been involved in the rapid estrogen signaling. We investigated the ability of two original molecules, which were named GPER-L1 and GPERL2, to bind to and activate the GPER transduction pathway in cancer cells. Competition assays, docking simulations, transfection experiments, real-time PCR, immunoblotting, gene silencing technology and growth assays were performed to ascertain the selective action of GPER-L1 and GPER-L2 in activating the GPER-mediated signaling. Both compounds, which did not show any ability to bind to and activate the classical ERs, were able to bind to GPER and to trigger the rapid activation of the GPER/EGFR/ERK transduction pathway which led to the up-regulation of GPER-target genes. Notably, GPER-L1 and GPER-L2 induced the proliferation of SkBr3 breast and Ishikawa endometrial cancer cells at nM concentrations through GPER, hence providing further evidence on their capability to elicit relevant biological responses mediated by GPER. The identification and characterization of these novel compounds as selective GPER agonists represent a valuable tool to further dissect the pharmacology of this novel estrogen receptor and to better differentiate the specific functions elicited by each estrogen receptor subtype in cancer cells.

The insulin and islet amyloid polypeptide genes contain similar cell-specific promoter elements that bind identical beta-cell nuclear complexes.

PubMed Central

German, M S; Moss, L G; Wang, J; Rutter, W J

1992-01-01

The pancreatic beta cell makes several unique gene products, including insulin, islet amyloid polypeptide (IAPP), and beta-cell-specific glucokinase (beta GK). The functions of isolated portions of the insulin, IAPP, and beta GK promoters were studied by using transient expression and DNA binding assays. A short portion (-247 to -197 bp) of the rat insulin I gene, the FF minienhancer, contains three interacting transcriptional regulatory elements. The FF minienhancer binds at least two nuclear complexes with limited tissue distribution. Sequences similar to that of the FF minienhancer are present in the 5' flanking DNA of the human IAPP and rat beta GK genes and also the rat insulin II and mouse insulin I and II genes. Similar minienhancer constructs from the insulin and IAPP genes function as cell-specific transcriptional regulatory elements and compete for binding of the same nuclear factors, while the beta GK construct competes for protein binding but functions poorly as a minienhancer. These observations suggest that the patterns of expression of the beta-cell-specific genes result in part from sharing the same transcriptional regulators. Images PMID:1549125

Gonadotropin stimulation of cyclic adenosine monophosphate and testosterone production without detectable high-affinity binding sites in purified Leydig cells from rat testis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Browne, E.S.; Bhalla, V.K.

1991-02-01

Rat testicular interstitial cells were separated by three different gradient-density procedures and, with each, two biochemically and morphologically distinct cell fractions were isolated. The lighter density cells in fraction-I bound iodine 125-labeled human chorionic gonadotropin (hCG) with high-affinity (apparent equilibrium dissociation constant, Kd, approximately 10{sup {minus} 10} M) without producing either cyclic adenosine monophosphate or testosterone in response to hormone action. The heavier-density cells displayed morphologic features typical of Leydig cells and produced cyclic adenosine monophosphate and testosterone in the presence of hCG without detectable {sup 125}I-labeled hCG high-affinity binding. These cell fractions were further characterized by studies using deglycosylatedmore » hCG, a known antagonist to hCG action. Cell concentration-dependent studies with purified Leydig cells revealed that maximal testosterone production was achieved when lower cell concentrations (0.5 x 10(6) cells/250 microliters) were used for in vitro hCG stimulation assays. Under these conditions, the {sup 125}I-labeled hCG binding was barely detectable (2.24 fmol; 2,698 sites/cell). Furthermore, these studies revealed that the hCG-specific binding in Leydig cells is overestimated by the classic method for nonspecific binding correction using excess unlabeled hormone. An alternate method is presented.« less

EGCG reverses human neutrophil elastase-induced migration in A549 cells by directly binding to HNE and by regulating α1-AT

PubMed Central

Xiaokaiti, Yilixiati; Wu, Haoming; Chen, Ya; Yang, Haopeng; Duan, Jianhui; Li, Xin; Pan, Yan; Tie, Lu; Zhang, Liangren; Li, Xuejun

2015-01-01

Lung carcinogenesis is a complex process that occurs in unregulated inflammatory environment. EGCG has been extensively investigated as a multi-targeting anti-tumor and anti-inflammatory compound. In this study, we demonstrated a novel mechanism by which EGCG reverses the neutrophil elastase-induced migration of A549 cells. We found that neutrophil elastase directly triggered human adenocarcinoma A549 cell migration and that EGCG suppressed the elevation of tumor cell migration induced by neutrophil elastase. We observed that EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity based on the CDOCKER algorithm, MD stimulation by GROMACS, SPR assay and elastase enzymatic activity assay. As the natural inhibitor of neutrophil elastase, α1-antitrypsin is synthesized in tumor cells. We further demonstrated that the expression of α1-antitrypsin was up-regulated after EGCG treatment in neutrophil elastase-treated A549 cells. We preliminarily discovered that the EGCG-mediated induction of α1-antitrypsin expression might be correlated with the regulatory effect of EGCG on the PI3K/Akt pathway. Overall, our results suggest that EGCG ameliorates the neutrophil elastase-induced migration of A549 cells. The mechanism underlying this effect may include two processes: EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity; EGCG enhances the expression of α1-antitrypsin by regulating the PI3K/AKT pathway. PMID:26177797

Interaction between the cellular protein eEF1A and the 3'-terminal stem-loop of West Nile virus genomic RNA facilitates viral minus-strand RNA synthesis.

PubMed

Davis, William G; Blackwell, Jerry L; Shi, Pei-Yong; Brinton, Margo A

2007-09-01

RNase footprinting and nitrocellulose filter binding assays were previously used to map one major and two minor binding sites for the cell protein eEF1A on the 3'(+) stem-loop (SL) RNA of West Nile virus (WNV) (3). Base substitutions in the major eEF1A binding site or adjacent areas of the 3'(+) SL were engineered into a WNV infectious clone. Mutations that decreased, as well as ones that increased, eEF1A binding in in vitro assays had a negative effect on viral growth. None of these mutations affected the efficiency of translation of the viral polyprotein from the genomic RNA, but all of the mutations that decreased in vitro eEF1A binding to the 3' SL RNA also decreased viral minus-strand RNA synthesis in transfected cells. Also, a mutation that increased the efficiency of eEF1A binding to the 3' SL RNA increased minus-strand RNA synthesis in transfected cells, which resulted in decreased synthesis of genomic RNA. These results strongly suggest that the interaction between eEF1A and the WNV 3' SL facilitates viral minus-strand synthesis. eEF1A colocalized with viral replication complexes (RC) in infected cells and antibody to eEF1A coimmunoprecipitated viral RC proteins, suggesting that eEF1A facilitates an interaction between the 3' end of the genome and the RC. eEF1A bound with similar efficiencies to the 3'-terminal SL RNAs of four divergent flaviviruses, including a tick-borne flavivirus, and colocalized with dengue virus RC in infected cells. These results suggest that eEF1A plays a similar role in RNA replication for all flaviviruses.

An easily accessible sulfated saccharide mimetic inhibits in vitro human tumor cell adhesion and angiogenesis of vascular endothelial cells

PubMed Central

Marano, Grazia; Gronewold, Claas; Frank, Martin; Merling, Anette; Kliem, Christian; Sauer, Sandra; Wiessler, Manfred; Frei, Eva

2012-01-01

Summary Oligosaccharides aberrantly expressed on tumor cells influence processes such as cell adhesion and modulation of the cell’s microenvironment resulting in an increased malignancy. Schmidt’s imidate strategy offers an effective method to synthesize libraries of various oligosaccharide mimetics. With the aim to perturb interactions of tumor cells with extracellular matrix proteins and host cells, molecules with 3,4-bis(hydroxymethyl)furan as core structure were synthesized and screened in biological assays for their abilities to interfere in cell adhesion and other steps of the metastatic cascade, such as tumor-induced angiogenesis. The most active compound, (4-{[(β-D-galactopyranosyl)oxy]methyl}furan-3-yl)methyl hydrogen sulfate (GSF), inhibited the activation of matrix-metalloproteinase-2 (MMP-2) as well as migration of the human melanoma cells of the lines WM-115 and WM-266-4 in a two-dimensional migration assay. GSF inhibited completely the adhesion of WM-115 cells to the extracellular matrix (ECM) proteins, fibrinogen and fibronectin. In an in vitro angiogenesis assay with human endothelial cells, GSF very effectively inhibited endothelial tubule formation and sprouting of blood vessels, as well as the adhesion of endothelial cells to ECM proteins. GSF was not cytotoxic at biologically active concentrations; neither were 3,4-bis{[(β-D-galactopyranosyl)oxy]methyl}furan (BGF) nor methyl β-D-galactopyranoside nor 3,4-bis(hydroxymethyl)furan, which were used as controls, eliciting comparable biological activity. In silico modeling experiments, in which binding of GSF to the extracellular domain of the integrin αvβ3 was determined, revealed specific docking of GSF to the same binding site as the natural peptidic ligands of this integrin. The sulfate in the molecule coordinated with one manganese ion in the binding site. These studies show that this chemically easily accessible molecule GSF, synthesized in three steps from 3,4-bis(hydroxymethyl)furan and benzoylated galactose imidate, is nontoxic and antagonizes cell physiological processes in vitro that are important for the dissemination and growth of tumor cells in vivo. PMID:23015827

Curcumin enhances the effects of irinotecan on colorectal cancer cells through the generation of reactive oxygen species and activation of the endoplasmic reticulum stress pathway.

PubMed

Huang, Yan-Feng; Zhu, Da-Jian; Chen, Xiao-Wu; Chen, Qi-Kang; Luo, Zhen-Tao; Liu, Chang-Chun; Wang, Guo-Xin; Zhang, Wei-Jie; Liao, Nv-Zhu

2017-06-20

Although initially effective against metastatic colorectal cancer (CRC), irinotecan-based chemotherapy leads to resistance and adverse toxicity. Curcumin is well known for its anti-cancer effects in many cancers, including CRC. Here, we describe reactive oxygen species (ROS) generation and endoplasmic reticulum (ER) stress as important mechanisms by which curcumin enhances irinotecan's effects on CRC cells. CRC cell lines were treated with curcumin and/or irinotecan for 24 h, and then evaluated using cell proliferation assays, cell apoptosis assays, cell cycle analysis, intracellular Ca2+ measurements, ROS measurements and immunoblotting for key ER stress-related proteins. We found that cell viability was inhibited and apoptosis was increased, accompanied by ROS generation and ER stress activation in CRC cells treated with curcumin alone or in combination with irinotecan. Blocking ROS production attenuated the expression of two markers of ER stress: binding of immunoglobulin protein (BIP) and CCAAT/enhancer-binding protein homologous protein (CHOP). Blocking CHOP expression using RNA interference also inhibited ROS generation. These results demonstrated that curcumin could enhance the effects of irinotecan on CRC cells by inhibiting cell viability and inducing cell cycle arrest and apoptosis, and that these effects may be mediated, in part, by ROS generation and activation of the ER stress pathway.

2-Styrylindolium based fluorescent probes visualize neurofibrillary tangles in Alzheimer's disease.

PubMed

Gu, Jiamin; Anumala, Upendra Rao; Lo Monte, Fabio; Kramer, Thomas; Heyny von Haußen, Roland; Hölzer, Jana; Goetschy-Meyer, Valérie; Mall, Gerhard; Hilger, Ingrid; Czech, Christian; Schmidt, Boris

2012-12-15

We evaluated 2-styrylindolium derivatives (6-11) as novel and selective probes for neurofibrillary tangles (NFTs) on brain sections of AD patients. The staining experiments indicated that these compounds may bind selectively to NFTs in the presence of ß-amyloid (Aß) plaques. Cell free binding assays confirmed that 2-[2-[4-(1-pyrrolidinyl)phenyl]ethenyl]-1,3,3-trimethyl-3H-indolium iodide (9) and 2-[2-[4-(diethylamino)phenyl]ethenyl]-1-butyl-3,3-dimethyl-3H-indolium iodide (11) display excellent affinities to Tau-aggregates (IC(50) values of 5.1 and 1.4 nM, respectively) in the displacement of Thiazin Red R. These probes have good solubility in distilled water and low or no cytotoxicity in zebrafish embryo and liver hepatocellular carcinoma cell assays. Copyright © 2012 Elsevier Ltd. All rights reserved.

Identification and Characterization of a Broadly Cross-Reactive HIV-1 Human Monoclonal Antibody That Binds to Both gp120 and gp41

PubMed Central

Zhang, Mei-Yun; Yuan, Tingting; Li, Jingjing; Rosa Borges, Andrew; Watkins, Jennifer D.; Guenaga, Javier; Yang, Zheng; Wang, Yanping; Wilson, Richard; Li, Yuxing; Polonis, Victoria R.; Pincus, Seth H.; Ruprecht, Ruth M.; Dimitrov, Dimiter S.

2012-01-01

Identification of broadly cross-reactive HIV-1-neutralizing antibodies (bnAbs) may assist vaccine immunogen design. Here we report a novel human monoclonal antibody (mAb), designated m43, which co-targets the gp120 and gp41 subunits of the HIV-1 envelope glycoprotein (Env). M43 bound to recombinant gp140 s from various primary isolates, to membrane-associated Envs on transfected cells and HIV-1 infected cells, as well as to recombinant gp120 s and gp41 fusion intermediate structures containing N-trimer structure, but did not bind to denatured recombinant gp140 s and the CD4 binding site (CD4bs) mutant, gp120 D368R, suggesting that the m43 epitope is conformational and overlaps the CD4bs on gp120 and the N-trimer structure on gp41. M43 neutralized 34% of the HIV-1 primary isolates from different clades and all the SHIVs tested in assays based on infection of peripheral blood mononuclear cells (PBMCs) by replication-competent virus, but was less potent in cell line-based pseudovirus assays. In contrast to CD4, m43 did not induce Env conformational changes upon binding leading to exposure of the coreceptor binding site, enhanced binding of mAbs 2F5 and 4E10 specific for the membrane proximal external region (MPER) of gp41 Envs, or increased gp120 shedding. The overall modest neutralization activity of m43 is likely due to the limited binding of m43 to functional Envs which could be increased by antibody engineering if needed. M43 may represent a new class of bnAbs targeting conformational epitopes overlapping structures on both gp120 and gp41. Its novel epitope and possibly new mechanism(s) of neutralization could helpdesign improved vaccine immunogens and candidate therapeutics. PMID:22970187

Discovery of high-affinity BCL6-binding peptide and its structure-activity relationship

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakamoto, Kotaro; Sogabe, Satoshi; Kamada, Yusuke

B cell lymphoma 6 (BCL6) is a transcriptional repressor that interacts with its corepressors BcoR and SMRT. Since this protein-protein interaction (PPI) induces activation and differentiation of B lymphocytes, BCL6 has been an attractive drug target for potential autoimmune disease treatments. Here we report a novel BCL6 inhibitory peptide, F1324 (Ac-LWYTDIRMSWRVP-OH), which we discovered using phage display technology; we also discuss this peptide's structure-activity relationship (SAR). For BCL6(5-129) binding, K{sub D} and IC{sub 50} values of F1324 were 0.57 nM and 1 nM according to the results of an SPR analysis and cell-free ELISA assay, respectively. In contrast, BcoR(Arg498-514Pro) and SMRT(Leu1422-Arg1438) exhibitedmore » relatively weak micromole-order binding to BCL6. Furthermore, Fusion protein AcGFP-F1324 transiently expressed in HEK293T cells inhibited intracellular PPI in cell-based M2H assay. By examination of the truncation and fragmentation of F1324, the C-terminal sequence WRVP, which is similar to the BcoR(509-512) sequence WVVP, was identified as being critical for BCL6 binding. In addition, subsequent single-crystal X-ray diffraction analysis of F1324/BCL6(5-129) complex revealed that the high affinity of F1324 was caused by effective interaction of its side chains while its main chain structure was similar to that of BcoR(Arg498-514Pro). To our knowledge, F1324 is the strongest BCL6-binding peptide yet reported. - Highlights: • F1324 was discovered as 5000-times higher affinity peptide to BCL6 than that of BcoR(R498-P514). • X-ray crystal structure analysis revealed the binding mode. • To our knowledge, F1324 is the strongest BCL6-binding and -inhibition peptide so far.« less

The VBP and a1/EBP leucine zipper factors bind overlapping subsets of avian retroviral long terminal repeat CCAAT/enhancer elements.

PubMed

Smith, C D; Baglia, L A; Curristin, S M; Ruddell, A

1994-10-01

Two long terminal repeat (LTR) enhancer-binding proteins which may regulate high rates of avian leukosis virus (ALV) LTR-enhanced c-myc transcription during bursal lymphomagenesis have been identified (A. Ruddell, M. Linial, and M. Groudine, Mol. Cell. Biol. 9:5660-5668, 1989). The genes encoding the a1/EBP and a3/EBP binding factors were cloned by expression screening of a lambda gt11 cDNA library from chicken bursal lymphoma cells. The a1/EBP cDNA encodes a novel leucine zipper transcription factor (W. Bowers and A. Ruddell, J. Virol. 66:6578-6586, 1992). The partial a3/EBP cDNA clone encodes amino acids 84 to 313 of vitellogenin gene-binding protein (VBP), a leucine zipper factor that binds the avian vitellogenin II gene promoter (S. Iyer, D. Davis, and J. Burch, Mol. Cell. Biol. 11:4863-4875, 1991). Multiple VBP mRNAs are expressed in B cells in a pattern identical to that previously observed for VBP in other cell types. The LTR-binding activities of VBP, a1/EBP, and B-cell nuclear extract protein were compared and mapped by gel shift, DNase I footprinting, and methylation interference assays. The purified VBP and a1/EBP bacterial fusion proteins bind overlapping but distinct subsets of CCAAT/enhancer elements in the closely related ALV and Rous sarcoma virus (RSV) LTR enhancers. Protein binding to these CCAAT/enhancer elements accounts for most of the labile LTR enhancer-binding activity observed in B-cell nuclear extracts. VBP and a1/EBP could mediate the high rates of ALV and RSV LTR-enhanced transcription in bursal lymphoma cells and many other cell types.

Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis.

PubMed

Koshino-Kimura, Yoshihiro; Wada, Takuji; Tachibana, Tatsuhiko; Tsugeki, Ryuji; Ishiguro, Sumie; Okada, Kiyotaka

2005-06-01

Epidermal cell differentiation in Arabidopsis root is studied as a model system for understanding cell fate specification. Two types of MYB-related transcription factors are involved in this cell differentiation. One of these, CAPRICE (CPC), encoding an R3-type MYB protein, is a positive regulator of hair cell differentiation and is preferentially transcribed in hairless cells. We analyzed the regulatory mechanism of CPC transcription. Deletion analyses of the CPC promoter revealed that hairless cell-specific transcription of the CPC gene required a 69 bp sequence, and a tandem repeat of this region was sufficient for its expression in epidermis. This region includes two MYB-binding sites, and the epidermis-specific transcription of CPC was abolished when base substitutions were introduced in these sites. We showed by gel mobility shift experiments and by yeast one-hybrid assay that WEREWOLF (WER), which is an R2R3-type MYB protein, directly binds to this region. We showed that WER also binds to the GL2 promoter region, indicating that WER directly regulates CPC and GL2 transcription by binding to their promoter regions.

An Organotypic Liver System for Tumor Progression

DTIC Science & Technology

2007-04-01

involvement and growth dynamics – in progress Additional tasks accepted after Year 1: 9. determine whether breast cancer cell E -cadherin form...heterotypic interactions – completed 10. determine whether hepatocytes modulate cancer cell E -cadherin expression – completed Wells, Alan W81XWH-04...cancer cells that express E - cadherin form heterotypic binding to a monolayer of hepatocytes as determined by centrifugal assay for cell adhesion

Antiandrogenic activities of diesel exhaust particle extracts in PC3/AR human prostate carcinoma cells.

PubMed

Kizu, Ryoichi; Okamura, Kazumasa; Toriba, Akira; Mizokami, Atsushi; Burnstein, Kerry L; Klinge, Carolyn M; Hayakawa, Kazuichi

2003-12-01

We collected diesel exhaust particles (DEPs) emitted from three diesel-engine vehicles--a car, a bus, and a truck--in daily use, and prepared DEP extracts (DEPEs), designated as EC, EB, or ET, respectively. The androgenic and antiandrogenic effects of the DEPE samples were examined by a luciferase reporter assay in human prostate carcinoma PC3/AR cells transiently transfected with a prostate specific antigen gene promoter-driven luciferase expression vector pGLPSA5.8. PC3/AR is a subline of human prostate carcinoma PC3 transformed to stably express wild-type human androgen receptor (AR). While DEPE samples did not exhibit any androgenic effect, they exerted antiandrogenic effect, inhibiting dihydrotestosterone (10 pM) -induced luciferase activity by 24 to 52% at an extract concentration of 10 microg/ml. The antiandrogenic effect was greater in the following order: ET > EB > EC. Co-treatment of PC3/AR cells with SKF-525A, a nonselective inhibitor of cytochrome P450 (CYP) enzymes, enhanced the antiandrogenic effect, indicating that the antiandrogenic effect is caused by intact species of DEPE constituents. The antiandrogenic effect of DEPE samples was reversed by alpha-naphthoflavone, an aryl hydrocarbon receptor (AhR) antagonist. The antiandrogenic activity of a DEPE sample correlated with its AhR agonist activity assayed in PC3/AR cells transiently transfected with CYP1A1 gene promoter-driven luciferase expression vector pLUC1A1. Equimolar mixtures of ten polycyclic aromatic hydrocarbons (PAHs) having four or more rings, structures found in the DEPEs, showed significant antiandrogenic effects and AhR agonist activity at concentrations equivalent to those found in DEPE samples. Further, DEPE samples elicited only antiandrogenic effects in recombinant yeast cells, which express beta-galactosidase in response to androgen. A competitive AR binding assay showed that AR-binding constituents exist in DEPE samples, indicating that greater part of AR-binding constituents in DEPEs are AR antagonists. All these findings show that DEPE samples exhibit significant antiandrogenic effect in cell-based transcription assay and that this effect is due in part to the constituents with AhR agonist activity including PAHs and to the constituents with AR antagonist activity.

Glutamine deprivation induces interleukin-8 expression in ataxia telangiectasia fibroblasts.

PubMed

Kim, Min-Hyun; Kim, Aryung; Yu, Ji Hoon; Lim, Joo Weon; Kim, Hyeyoung

2014-05-01

To investigate whether glutamine deprivation induces expression of inflammatory cytokine interleukin-8 (IL-8) by determining NF-κB activity and levels of oxidative indices (ROS, reactive oxygen species; hydrogen peroxide; GSH, glutathione) in fibroblasts isolated from patients with ataxia telangiectasia (A-T). We used A-T fibroblasts stably transfected with empty vector (Mock) or with human full-length ataxia telangiectasia mutated (ATM) cDNA (YZ5) and mouse embryonic fibroblasts (MEFs) transiently transfected with ATM small interfering RNA (siRNA) or with non-specific control siRNA. The cells were cultured with or without glutamine or GSH. ROS levels were determined using a fluorescence reader and confocal microscopy. IL-8 or murine IL-8 homolog, keratinocyte chemoattractant (KC), and hydrogen peroxide levels in the medium were determined by enzyme-linked immunosorbent assay and colorimetric assay. GSH level was assessed by enzymatic assay, while IL-8 (KC) mRNA level was measured by reverse transcription-polymerase chain reaction (RT-PCR) and/or quantitative real-time PCR. NF-κB DNA-binding activity was determined by electrophoretic mobility shift assay. Catalase activity and ATM protein levels were determined by O2 generation and Western blotting. While glutamine deprivation induced IL-8 expression and increased NF-κB DNA-binding activity in Mock cells, both processes were decreased by treatment of cells with glutamine or GSH or both glutamine and GSH. Glutamine deprivation had no effect on IL-8 expression or NF-κB DNA-binding activity in YZ5 cells. Glutamine-deprived Mock cells had higher oxidative stress indices (increases in ROS and hydrogen peroxide, reduction in GSH) than glutamine-deprived YZ5 cells. In Mock cells, glutamine deprivation-induced oxidative stress indices were suppressed by treatment with glutamine or GSH or both glutamine and GSH. GSH levels and catalase activity were lower in Mock cells than YZ5 cells. MEFs transfected with ATM siRNA and cultured without glutamine showed higher levels of ROS and IL-8 than those transfected with negative control siRNA; increased levels of ROS and IL-8 were suppressed by the treatment of glutamine. Glutamine deprivation induces ROS production, NF-κB activation, and IL-8 expression as well as a reduction in GSH in A-T fibroblasts, all of which are attenuated by glutamine supplementation.

Coriolus versicolor mushroom polysaccharides exert immunoregulatory effects on mouse B cells via membrane Ig and TLR-4 to activate the MAPK and NF-κB signaling pathways.

PubMed

Yang, Shu-fa; Zhuang, Tai-feng; Si, Yan-mei; Qi, Ke-yan; Zhao, Juan

2015-03-01

This study aimed to characterize the immunopotentiating effects and immune receptors for Coriolus versicolor mushroom polysaccharides (CVP), a Chinese medicinal fungus that exerts anti-tumor activities by enhancing host immunity. Proliferation assays were used to determine whether CVP could activate splenocytes. Flow cytometry analysis and IgM and IgG detection were used to characterize CVP-binding cells. Immune receptors were analyzed in immunoprecipitation and western blot assays. The downstream signaling pathways were identified by western blotting or immunostaining. CVP significantly stimulated the proliferation of mouse splenocytes. Fluorescence-labeled CVP (fl-CVP) selectively stained mouse B cells, but not T cells. CVP induced the production of IgM and IgG1 with or without exogenous IL-4. Membrane Ig (B cell antigen-receptor, BCR) was identified as a CVP-binding protein in immunoprecipitation and western blot experiments. CVP-induced B cell proliferation could be significantly inhibited by anti-mouse immunoglobulin (Ig) blocking antibody (Fab) or in cells from TLR4-mutant mice (C3H/HeJ). Phosphorylation of ERK-1/2 and p38 MAPK were clearly increased in a time-dependent manner, as was the nuclear translocation of the cytosolic NF-κB p65 subunit after CVP stimulation. Together, we demonstrate that CVP can bind and induce B cell activation using membrane Ig and TLR-4 as potential immune receptors. CVP activates mouse B cells through the MAPK and NF-κB signaling pathways. Copyright © 2014 Elsevier Ltd. All rights reserved.

The apoptosis induced by HMME-based photodynamic therapy in rabbit vascular smooth muscle cells

NASA Astrophysics Data System (ADS)

Yin, Huijuan; Li, Xiaoyuan; Lin, Hong; Liu, Jianzhong; Yu, Hongkui

2007-02-01

Objective To study the effects of HMME-based photodynamic therapy on proliferation and apoptosis of rabbit vascular smooth muscle cells(VSMCs). Method The cytotoxic effect of HMME-PDT on rabbit vascular smooth muscle cells was studied by means of Trypan Blue assay, HMME at 10μg/ml concentration and the light dose at 2.4~4.8 J/cm2 were selected in the studies. The morphological character 24h post-PDT was investigated by HE Staining. Annexin V and propidium iodide (PI) binding assays were performed to analyze the characteristics of cell death after HMME-PDT. Furthermore, The intracellular distributions of the HMME were measured by the confocal laser scanning microscope. Result It was showed the photocytotoxity to VSMC cells was dose related by Trypan Blue assay. Histology observing suggests HMME-PDT could induce cell death through apoptosis or necrosis, and the apoptosic rate was up to 50.5% by AnnexinV /PI assay. Moreover, the fluorescence images of HMME intracellular localization demonstrated that the HMME diffused into the mitochondria. Conclusion HMME-PDT could significantly inhibite VSMC proliferation and induce apoptosis.

Analysis of peripheral B cells and autoantibodies against the anti-nicotinic acetylcholine receptor derived from patients with myasthenia gravis using single-cell manipulation tools

PubMed Central

Terakawa, Maki; Muneoka, Satoshi; Nagahira, Kazuhiro; Nagane, Yuriko; Yamate, Jyoji; Motomura, Masakatsu; Utsugisawa, Kimiaki

2017-01-01

The majority of patients with myasthenia gravis (MG), an organ-specific autoimmune disease, harbor autoantibodies that attack the nicotinic acetylcholine receptor (nAChR-Abs) at the neuromuscular junction of skeletal muscles, resulting in muscle weakness. Single cell manipulation technologies coupled with genetic engineering are very powerful tools to examine T cell and B cell repertoires and the dynamics of adaptive immunity. These tools have been utilized to develop mAbs in parallel with hybridomas, phage display technologies and B-cell immortalization. By applying a single cell technology and novel high-throughput cell-based binding assays, we identified peripheral B cells that produce pathogenic nAChR-Abs in patients with MG. Although anti-nAChR antibodies produced by individual peripheral B cells generally exhibited low binding affinity for the α-subunit of the nAChR and great sequence diversity, a small fraction of these antibodies bound with high affinity to native-structured nAChRs on cell surfaces. B12L, one such Ab isolated here, competed with a rat Ab (mAb35) for binding to the human nAChR and thus considered to recognize the main immunogenic region (MIR). By evaluating the Ab in in vitro cell-based assays and an in vivo rat passive transfer model, B12L was found to act as a pathogenic Ab in rodents and presumably in humans.These findings suggest that B cells in peripheral blood may impact MG pathogenicity. Our methodology can be applied not only to validate pathogenic Abs as molecular target of MG treatment, but also to discover and analyze Ab production systems in other human diseases. PMID:29040265

Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions

PubMed Central

Burkhart, Deborah L.; Wirt, Stacey E.; Zmoos, Anne-Flore; Kareta, Michael S.; Sage, Julien

2010-01-01

The retinoblastoma tumor suppressor (Rb) is a potent and ubiquitously expressed cell cycle regulator, but patients with a germline Rb mutation develop a very specific tumor spectrum. This surprising observation raises the possibility that mechanisms that compensate for loss of Rb function are present or activated in many cell types. In particular, p107, a protein related to Rb, has been shown to functionally overlap for loss of Rb in several cellular contexts. To investigate the mechanisms underlying this functional redundancy between Rb and p107 in vivo, we used gene targeting in embryonic stem cells to engineer point mutations in two consensus E2F binding sites in the endogenous p107 promoter. Analysis of normal and mutant cells by gene expression and chromatin immunoprecipitation assays showed that members of the Rb and E2F families directly bound these two sites. Furthermore, we found that these two E2F sites controlled both the repression of p107 in quiescent cells and also its activation in cycling cells, as well as in Rb mutant cells. Cell cycle assays further indicated that activation of p107 transcription during S phase through the two E2F binding sites was critical for controlled cell cycle progression, uncovering a specific role for p107 to slow proliferation in mammalian cells. Direct transcriptional repression of p107 by Rb and E2F family members provides a molecular mechanism for a critical negative feedback loop during cell cycle progression and tumorigenesis. These experiments also suggest novel therapeutic strategies to increase the p107 levels in tumor cells. PMID:20585628

Analysis of peripheral B cells and autoantibodies against the anti-nicotinic acetylcholine receptor derived from patients with myasthenia gravis using single-cell manipulation tools.

PubMed

Makino, Tomohiro; Nakamura, Ryuichi; Terakawa, Maki; Muneoka, Satoshi; Nagahira, Kazuhiro; Nagane, Yuriko; Yamate, Jyoji; Motomura, Masakatsu; Utsugisawa, Kimiaki

2017-01-01

The majority of patients with myasthenia gravis (MG), an organ-specific autoimmune disease, harbor autoantibodies that attack the nicotinic acetylcholine receptor (nAChR-Abs) at the neuromuscular junction of skeletal muscles, resulting in muscle weakness. Single cell manipulation technologies coupled with genetic engineering are very powerful tools to examine T cell and B cell repertoires and the dynamics of adaptive immunity. These tools have been utilized to develop mAbs in parallel with hybridomas, phage display technologies and B-cell immortalization. By applying a single cell technology and novel high-throughput cell-based binding assays, we identified peripheral B cells that produce pathogenic nAChR-Abs in patients with MG. Although anti-nAChR antibodies produced by individual peripheral B cells generally exhibited low binding affinity for the α-subunit of the nAChR and great sequence diversity, a small fraction of these antibodies bound with high affinity to native-structured nAChRs on cell surfaces. B12L, one such Ab isolated here, competed with a rat Ab (mAb35) for binding to the human nAChR and thus considered to recognize the main immunogenic region (MIR). By evaluating the Ab in in vitro cell-based assays and an in vivo rat passive transfer model, B12L was found to act as a pathogenic Ab in rodents and presumably in humans.These findings suggest that B cells in peripheral blood may impact MG pathogenicity. Our methodology can be applied not only to validate pathogenic Abs as molecular target of MG treatment, but also to discover and analyze Ab production systems in other human diseases.

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A

PubMed Central

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5’-end including the 5’-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer. PMID:26221730

In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

PubMed

Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

2015-01-01

A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

The peroxisomal multifunctional protein interacts with cortical microtubules in plant cells

PubMed Central

2005-01-01

Background The plant peroxisomal multifunctional protein (MFP) possesses up to four enzymatic activities that are involved in catalyzing different reactions of fatty acid β-oxidation in the peroxisome matrix. In addition to these peroxisomal activities, in vitro assays revealed that rice MFP possesses microtubule- and RNA-binding activities suggesting that this protein also has important functions in the cytosol. Results We demonstrate that MFP is an authentic microtubule-binding protein, as it localized to the cortical microtubule array in vivo, in addition to its expected targeting to the peroxisome matrix. MFP does not, however, interact with the three mitotic microtubule arrays. Microtubule co-sedimentation assays of truncated versions of MFP revealed that multiple microtubule-binding domains are present on the MFP polypeptide. This indicates that these regions function together to achieve high-affinity binding of the full-length protein. Real-time imaging of a transiently expressed green fluorescent protein-MFP chimera in living plant cells illustrated that a dynamic, spatial interaction exits between peroxisomes and cortical microtubules as peroxisomes move along actin filaments or oscillate at fixed locations. Conclusion Plant MFP is associated with the cortical microtubule array, in addition to its expected localization in the peroxisome. This observation, coupled with apparent interactions that frequently occur between microtubules and peroxisomes in the cell cortex, supports the hypothesis that MFP is concentrated on microtubules in order to facilitate the regulated import of MFP into peroxisomes. PMID:16313672

Lactobacillus acidophilus binds to MUC3 component of cultured intestinal epithelial cells with highest affinity.

PubMed

Das, Jugal Kishore; Mahapatra, Rajani Kanta; Patro, Shubhransu; Goswami, Chandan; Suar, Mrutyunjay

2016-04-01

Lactobacillus strains have been shown to adhere to the mucosal components of intestinal epithelial cells. However, established in vitro adhesion assays have several drawbacks in assessing the adhesion of new Lactobacillus strains. The present study aimed to compare the adhesion of four different Lactobacillus strains and select the most adherent microbe, based on in silico approach supported by in vitro results. The mucus-binding proteins in Lactobacillus acidophilus, L. plantarum, L. brevis and L. fermentum were identified and their capacities to interact with intestinal mucin were compared by molecular docking analysis. Lactobacillus acidophilus had the maximal affinity of binding to mucin with predicted free energy of -6.066 kcal mol(-1) Further, in vitro experimental assay of adhesion was performed to validate the in silico results. The adhesion of L. acidophilus to mucous secreting colon epithelial HT-29 MTX cells was highest at 12%, and it formed biofilm with maximum depth (Z = 84 μm). Lactobacillus acidophilus was determined to be the most adherent strain in the study. All the Lactobacillus strains tested in this study, displayed maximum affinity of binding to MUC3 component of mucus as compared to other gastrointestinal mucins. These findings may have importance in the design of probiotics and health care management. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Yeast Surface Display of Two Proteins Previously Shown to Be Protective Against White Spot Syndrome Virus (WSSV) in Shrimp.

PubMed

Ananphongmanee, Vorawit; Srisala, Jiraporn; Sritunyalucksana, Kallaya; Boonchird, Chuenchit

2015-01-01

Cell surface display using the yeasts Saccharomyces cerevisiae and Pichia pastoris has been extensively developed for application in bioindustrial processes. Due to the rigid structure of their cell walls, a number of proteins have been successfully displayed on their cell surfaces. It was previously reported that the viral binding protein Rab7 from the giant tiger shrimp Penaeus monodon (PmRab7) and its binding partner envelope protein VP28 of white spot syndrome virus (WSSV) could independently protect shrimp against WSSV infection. Thus, we aimed to display these two proteins independently on the cell surfaces of 2 yeast clones with the ultimate goal of using a mixture of the two clones as an orally deliverable, antiviral agent to protect shrimp against WSSV infection. PmRab7 and VP28 were modified by N-terminal tagging to the C-terminal half of S. cerevisiae α-agglutinin. DNA fragments, harboring fused-gene expression cassettes under control of an alcohol oxidase I (AOX1) promoter were constructed and used to transform the yeast cells. Immunofluorescence microscopy with antibodies specific to both proteins demonstrated that mutated PmRab7 (mPmRab7) and partial VP28 (pVP28) were localized on the cell surfaces of the respective clones, and fluorescence intensity for each was significantly higher than that of control cells by flow cytometry. Enzyme-linked immunosorbant assay (ELISA) using cells displaying mPmRab7 or pVP28 revealed that the binding of specific antibodies for each was dose-dependent, and could be saturated. In addition, the binding of mPmRab7-expressing cells with free VP28, and vice versa was dose dependent. Binding between the two surface-expressed proteins was confirmed by an assay showing agglutination between cells expressing complementary mPmRab7 and pVP28. In summary, our genetically engineered P. pastoris can display biologically active mPmRab7 and pVP28 and is now ready for evaluation of efficacy in protecting shrimp against WSSV by oral administration.

CLASPs are required for proper microtubule localization of End-binding proteins

PubMed Central

Grimaldi, Ashley D.; Maki, Takahisa; Fitton, Benjamin P.; Roth, Daniel; Yampolsky, Dmitry; Davidson, Michael W.; Svitkina, Tatyana; Straube, Anne; Hayashi, Ikuko; Kaverina, Irina

2014-01-01

Summary Microtubule (MT) plus-end tracking proteins (+TIPs) preferentially localize to MT plus-ends. End-binding proteins (EBs) are master regulators of the +TIP complex; however, it is unknown whether EBs are regulated by other +TIPs. Here, we show that Cytoplasmic linker associated proteins (CLASPs) modulate EB localization at MTs. In CLASP-depleted cells, EBs localized along the MT lattice in addition to plus-ends. The MT-binding region of CLASP was sufficient for restoring normal EB localization, while neither EB-CLASP interactions nor EB tail-binding proteins are involved. In vitro assays revealed that CLASP directly functions to remove EB from MTs. Importantly, this effect occurs specifically during MT polymerization, but not at pre-formed MTs. Increased GTP-tubulin content within MTs in CLASP-depleted cells suggests that CLASPs facilitate GTP-hydrolysis to reduce EB lattice binding. Together, these findings suggest that CLASPs influence the MT lattice itself to regulate EB and determine exclusive plus-end localization of EBs in cells. PMID:25117684

Transforming growth factor-beta 1 (TGF-beta1) promotes IL-2 mRNA expression through the up-regulation of NF-kappaB, AP-1 and NF-AT in EL4 cells.

PubMed

Han, S H; Yea, S S; Jeon, Y J; Yang, K H; Kaminski, N E

1998-12-01

Transforming growth factor beta1 (TGF-beta1) has been previously shown to modulate interleukin 2 (IL-2) secretion by activated T-cells. In the present studies, we determined that TGF-beta1 induced IL-2 mRNA expression in the murine T-cell line EL4, in the absence of other stimuli. IL-2 mRNA expression was significantly induced by TGF-beta1 (0.1-1 ng/ml) over a relatively narrow concentration range, which led to the induction of IL-2 secretion. Under identical condition, we examined the effect of TGF-beta1 on the activity of nuclear factor AT (NF-AT), nuclear factor kappaB (NF-kappaB), activator protein-1 (AP-1) and octamer, all of which contribute to the regulation of IL-2 gene expression. Electrophoretic mobility shift assays showed that TGF-beta1 markedly increased NF-AT, NF-kappaB and AP-1 binding to their respective cognate DNA binding sites, whereas octamer binding remained constant, as compared with untreated cells. Employing a reporter gene expression system with p(NF-kappaB)3-CAT, p(NF-AT)3-CAT and p(AP-1)3-CAT, TGF-beta1 treatment of transfected EL4 cells induced a dose-related increase in chloramphenicol acetyltransferase activity that correlated well with the DNA binding profile found in the electrophoretic mobility shift assay studies. These results show that TGF-beta1, in the absence of any additional stimuli, up-regulates the activity of key transcription factors involved in IL-2 gene expression, including NF-AT, NF-kappaB and AP-1, to help promote IL-2 mRNA expression by EL4 cells.

Long non-coding RNA H19 suppresses retinoblastoma progression via counteracting miR-17-92 cluster.

PubMed

Zhang, Aihui; Shang, Weiwei; Nie, Qiaoli; Li, Ting; Li, Suhui

2018-04-01

Long non-coding RNAs (lncRNAs) are frequently dysregulated and play important roles in many cancers. lncRNA H19 is one of the earliest discovered lncRNAs which has diverse roles in different cancers. However, the expression, roles, and action mechanisms of H19 in retinoblastoma are still largely unknown. In this study, we found that H19 is downregulated in retinoblastoma tissues and cell lines. Gain-of-function and loss-of-function assays showed that H19 inhibits retinoblastoma cell proliferation, induces retinoblastoma cell cycle arrest and cell apoptosis. Mechanistically, we identified seven miR-17-92 cluster binding sites on H19, and found that H19 directly bound to miR-17-92 cluster via these seven binding sites. Through binding to miR-17-92 cluster, H19 relieves the suppressing roles of miR-17-92 cluster on p21. Furthermore, H19 represses STAT3 activation induced by miR-17-92 cluster. Hence, our results revealed that H19 upregulates p21 expression, inhibits STAT3 phosphorylation, and downregulates the expression of STAT3 target genes BCL2, BCL2L1, and BIRC5. In addition, functional assays demonstrated that the mutation of miR-17-92 cluster binding sites on H19 abolished the proliferation inhibiting, cell cycle arrest and cell apoptosis inducing roles of H19 in retinoblastoma. In conclusion, our data suggested that H19 inhibits retinoblastoma progression via counteracting the roles of miR-17-92 cluster, and implied that enhancing the action of H19 may be a promising therapeutic strategy for retinoblastoma. © 2017 Wiley Periodicals, Inc.

Kinetic Measurements Reveal Enhanced Protein-Protein Interactions at Intercellular Junctions

PubMed Central

Shashikanth, Nitesh; Kisting, Meridith A.; Leckband, Deborah E.

2016-01-01

The binding properties of adhesion proteins are typically quantified from measurements with soluble fragments, under conditions that differ radically from the confined microenvironment of membrane bound proteins in adhesion zones. Using classical cadherin as a model adhesion protein, we tested the postulate that confinement within quasi two-dimensional intercellular gaps exposes weak protein interactions that are not detected in solution binding assays. Micropipette-based measurements of cadherin-mediated, cell-cell binding kinetics identified a unique kinetic signature that reflects both adhesive (trans) bonds between cadherins on opposing cells and lateral (cis) interactions between cadherins on the same cell. In solution, proposed lateral interactions were not detected, even at high cadherin concentrations. Mutations postulated to disrupt lateral cadherin association altered the kinetic signatures, but did not affect the adhesive (trans) binding affinity. Perturbed kinetics further coincided with altered cadherin distributions at junctions, wound healing dynamics, and paracellular permeability. Intercellular binding kinetics thus revealed cadherin interactions that occur within confined, intermembrane gaps but not in solution. Findings further demonstrate the impact of these revealed interactions on the organization and function of intercellular junctions. PMID:27009566

Binding of selected extracellular matrix proteins to enterococci and Streptococcus bovis of animal origin.

PubMed

Styriak, I; Lauková, A; Fallgren, C; Wadström, T

1999-12-01

Thirty-three enterococcal strains and 10 Streptococcus bovis strains were investigated for their protein-binding cell surface components. Seven extracellular matrix (ECM) proteins were immobilized on Difco latex beads to detect these components on the surface of all enterococcal strains and eight non-autoaggregating S. bovis strains by a particle agglutination assay (PAA). Twenty-three selected strains were also examined in microtiter plate assays. According to the absorbance readings (A(570nm)), 11 strains were classified as nonadherent (A(570nm) < 0.1), 10 strains as weakly adherent (0.1 < A(570nm) > 0.3), and 2 strains as strongly adherent (A(570nm) > 0.3) in these assays. A direct correlation was found between the values obtained in PAA and A(570nm) readings of microtiter plate assays. Binding of (125)I-labeled bovine lactoferrin to enterococci and streptococci was in the range of 6%-30% and of (125)I-labeled human vitronectin in the range of 9%-33% to streptococci. The binding of(125)I-labeled ECM proteins to selected strains was much more effectively inhibited by sulfated carbohydrates than by non-sulfated hyaluronic acid, indicating the importance of the sulfate groups of these inhibitors. An inhibition effect of heparin on bLf binding to four selected strains was higher in comparison with fucoidan in the microtiter plates. Thirty-five out of 44 strains had agglutinated rabbit erythrocytes. However, these strains showed no ability to agglutinate bovine or sheep erythrocytes.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

The acetylation of transcription factor HBP1 by p300/CBP enhances p16INK4A expression

PubMed Central

Wang, Weibin; Pan, Kewu; Chen, Yifan; Huang, Chunyin; Zhang, Xiaowei

2012-01-01

HBP1 is a sequence-specific DNA-binding transcription factor with many important biological roles. It activates or represses the expression of some specific genes during cell growth and differentiation. Previous studies have exhibited that HBP1 binds to p16INK4A promoter and activates p16INK4A expression. We found that trichostatin A (TSA), an inhibitor of HDAC (histone deacetylase), induces p16INK4A expression in an HBP1-dependent manner. This result was drawn from a transactivation experiment by measuring relative luciferase activities of p16INK4A promoter with HBP1-binding site in comparison with that of the wild-type p16INK4A promoter by transient cotransfection with HBP1 into HEK293T cells and 2BS cells. HBP1 acetylation after TSA treatment was confirmed by immunoprecipitation assay. Our data showed that HBP1 interacted with histone acetyltransferase p300 and CREB-binding protein (CBP) and also recruited p300/CBP to p16INK4A promoter. HBP1 was acetylated by p300/CBP in two regions: repression domain (K297/305/307) and P domain (K171/419). Acetylation of Repression domain was not required for HBP1 transactivation on p16INK4A. However, luciferase assay and western blotting results indicate that acetylation of P domain, especially K419 acetylation is essential for HBP1 transactivation on p16INK4A. As assayed by SA-beta-gal staining, the acetylation of HBP1 at K419 enhanced HBP1-induced premature senescence in 2BS cells. In addition, HDAC4 repressed HBP1-induced premature senescence through permanently deacetylating HBP1. We conclude that our data suggest that HBP1 acetylation at K419 plays an important role in HBP1-induced p16INK4A expression. PMID:21967847

Identification of small molecule inhibitors of the Chikungunya virus nsP1 RNA capping enzyme.

PubMed

Feibelman, Kristen M; Fuller, Benjamin P; Li, Linfeng; LaBarbera, Daniel V; Geiss, Brian J

2018-06-01

Chikungunya virus (CHIKV) is an arthropod-borne alphavirus. Alphaviruses are positive strand RNA viruses that require a 5' cap structure to direct translation of the viral polyprotein and prevent degradation of the viral RNA genome by host cell nucleases. Formation of the 5' RNA cap is orchestrated by the viral protein nsP1, which binds GTP and provides the N-7 methyltransferase and guanylyltransferase activities that are necessary for cap formation. Viruses with aberrant nsP1 activity are unable to replicate effectively suggesting that nsP1 is a promising target for antiviral drug discovery. Given the absence of commercially available antiviral therapies for CHIKV, it is imperative to identify compounds that could be developed as potential therapeutics. This study details a high-throughput screen of 3051 compounds from libraries containing FDA-approved drugs, natural products, and known bioactives against CHIKV nsP1 using a fluorescence polarization-based GTP competition assay. Several small molecule hits from this screen were able to compete with GTP for the CHIKV nsP1 GTP binding site at low molar concentrations. Compounds were also evaluated with an orthogonal assay that measured the ability of nsP1 to perform the guanylation step of the capping reaction in the presence of inhibitor. In addition, live virus assays with CHIKV and closely related alphavirus, Sindbis virus, were used in conjunction with cell toxicity assays to determine the antiviral activity of compounds in cell culture. The naturally derived compound lobaric acid was found to inhibit CHIKV nsP1 GTP binding and guanylation as well as attenuate viral growth in vitro at both 24 hpi and 48 hpi in hamster BHK21 and human Huh 7 cell lines. These data indicate that development of lobaric acid and further exploration of CHIKV nsP1 as a drug target may aid in the progress of anti-alphaviral drug development strategies. Copyright © 2018. Published by Elsevier B.V.

miRNA-1297 induces cell proliferation by targeting phosphatase and tensin homolog in testicular germ cell tumor cells.

PubMed

Yang, Nian-Qin; Zhang, Jian; Tang, Qun-Ye; Guo, Jian-Ming; Wang, Guo-Min

2014-01-01

To investigate the role of miR-1297 and the tumor suppressor gene PTEN in cell proliferation of testicular germ cell tumors (TGCT). MTT assays were used to test the effect of miR-1297 on proliferation of the NCCIT testicular germ cell tumor cell line. In NCCIT cells, the expression of PTEN was assessed by Western blotting further. In order to confirm target association between miR-1297 and 3'-UTR of PTEN, a luciferase reporter activity assay was employed. Moreover, roles of PTEN in proliferation of NCCIT cells were evaluated by transfection of PTEN siRNA. Proliferation of NCCIT cells was promoted by miR-1297 in a concentration-dependent manner. In addition, miR-1297 could bind to the 3'-UTR of PTEN based on luciferase reporter activity assay, and reduced expression of PTEN at protein level was found. Proliferation of NCCIT cells was significantly enhanced after knockdown of PTEN by siRNA. miR-1297 as a potential oncogene could induce cell proliferation by targeting PTEN in NCCIT cells.

FOXD3 inhibits SCN2A gene transcription in intractable epilepsy cell models.

PubMed

Xiang, Jun; Wen, Fang; Zhang, Lingyun; Zhou, Yu

2018-04-01

The expression of sodium voltage-gated channel alpha subunit 2 (SCN2A) is closely related to the development of epilepsy. This study investigated regulatory element of the SCN2A gene involved in epilepsy. An intractable epilepsy cell model was constructed using hippocampal primary neurons and the SH-SY5Y cell line. SCN2A protein and gene expression in cells as well as the level of lactic acid dehydrogenase (LDH) in the cell culture supernatants was detected. Potential regulatory factors of SCN2A and its upstream regulatory elements were identified using the dual-luciferase reporter assay. Finally, the role of the hypothetical transcription factor in epilepsy was examined by using its small interfering RNA (siRNA). Results found that levels of LDH and expression of the hypothetical transcription factor, Forkhead box D3 (FOXD3), was both increased in the model cells, whereas that of SCN2A was decreased. The results of dual-luciferase reporter assays revealed that an upstream region of SCN2A gene spanning from nucleotides -1617 to -1470 was a transcription factor binding region and a trans-acting factor role of FOXD3 was identified in the core region (GGCAAAATTAT). Then the FOXD3 binding site was further verified by the chromatin immunoprecipitation (ChIP) assay and electrophoretic mobility shift assay (EMSA). After SH-SY5Y cells were transfected with FOXD3 siRNA, the release of LDH into culture supernatants and the LDH expression levels in cells were significantly decreased. SCN2A expression in model cells was increased by knockdown of FOXD3. Therefore, this study demonstrated that FOXD3 is a trans-acting factor of SCN2A, and this mechanism may play a role in cell injury after epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

High-throughput screening and mechanism-based evaluation of estrogenic botanical extracts

PubMed Central

Overk, Cassia R.; Yao, Ping; Chen, Shaonong; Deng, Shixing; Imai, Ayano; Main, Matthew; Schinkovitz, Andreas; Farnsworth, Norman R.; Pauli, Guido F.; Bolton, Judy L.

2009-01-01

Symptoms associated with menopause can greatly affect the quality of life for women. Botanical dietary supplements have been viewed by the public as safe and effective despite a lack of evidence indicating a urgent necessity to standardize these supplements chemically and biologically. Seventeen plants were evaluated for estrogenic biological activity using standard assays: competitive estrogen receptor (ER) binding assay for both alpha and beta subtypes, transient transfection of the estrogen response element luciferase plasmid into MCF-7 cells expressing either ER alpha or ER beta, and the Ishikawa alkaline phosphatase induction assay for both estrogenic and antiestrogenic activities. Based on the combination of data pooled from these assays, the following was determined: a) a high rate of false positive activity for the competitive binding assays, b) some extracts had estrogenic activity despite a lack of ability to bind the ER, c) one extract exhibited selective estrogen receptor modulator (SERM) activity, and d) several extracts show additive/synergistic activity. Taken together, these data indicate a need to reprioritize the order in which the bioassays are performed for maximal efficiency of programs involving bioassay-guided fractionation. In addition, possible explanations for the conflicts in the literature over the estrogenicity of Cimicifuga racemosa (black cohosh) are suggested. PMID:18473738

24-Methylenecycloartanyl ferulate, a major compound of γ-oryzanol, promotes parvin-beta expression through an interaction with peroxisome proliferator-activated receptor-gamma 2 in human breast cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Heon Woong; Lim, Eun Joung; Jang, Hwan Hee

2015-12-25

Parvin-β is an adaptor protein that binds to integrin-linked kinase (ILK) and is significantly downregulated in breast tumors and breast cancer cell lines. We treated the breast cancer cell line MCF7 with 24-methylenecycloartanyl ferulate (24-MCF), a γ-oryzanol compound. We observed upregulation of parvin-β (GenBank Accession No. (AF237769)) and peroxisome proliferator-activated receptor (PPAR)-γ2 (GenBank Accession No. (NM-015869)). Among γ-oryzanol compounds, only treatment with 24-MCF led to the formation of reverse transcription-PCR products of parvin-β (650 and 500 bp) and PPAR-γ2 (580 bp) in MCF7 cells, but not in T47D, SK-BR-3, or MDA-MB-231 cells. 24-MCF treatment increased the mRNA and protein levels of parvin-β inmore » MCF7 cells in a dose-dependent manner. We hypothesized that there is a correlation between parvin-β expression and induction of PPAR-γ2. This hypothesis was investigated by using a promoter-reporter assay, chromatin immunoprecipitation, and an electrophoretic mobility shift assay. 24-MCF treatment induced binding of PPAR-γ2 to a peroxisome proliferator response element-like cis-element (ACTAGGACAAAGGACA) in the parvin-β promoter in MCF7 cells in a dose-dependent manner. 24-MCF treatment significantly decreased anchorage-independent growth and inhibited cell movement in comparison to control treatment with dimethyl sulfoxide. 24-MCF treatment reduced the levels of GTP-bound Rac1 and Cdc42. Evaluation of Akt1 inhibition by 24-MCF revealed that the half maximal effective concentration was 33.3 μM. Docking evaluations revealed that 24-MCF binds to the ATP-binding site of Akt1(PDB ID: (3OCB)) and the compound binding energy is -8.870 kcal/mol. Taken together, our results indicate that 24-MCF treatment increases parvin-β expression, which may inhibit ILK downstream signaling. - Highlights: • Treatment with 24-MCF increases gene expression of parvin-β and PPAR-ϒ2 in MCF7 cells. • PPAR-ϒ2 interacts with the parvin-β gene via its peroxisome proliferator response element-like cis-element. • 24-MCF treatment inhibits anchorage-dependent growth of MCF7 cells. • 24-MCF treatment inhibits MCF7 cell migration and Rac1 and Cdc42 activation. • 24-MCF may be a new ATP-competitive Akt1 inhibitor that binds to the ATP-binding site of Akt1.« less

Interleukin 2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles

PubMed Central

1994-01-01

Elevation of cAMP can cause gene-specific inhibition of interleukin 2 (IL-2) expression. To investigate the mechanism of this effect, we have combined electrophoretic mobility shift assays and in vivo genomic footprinting to assess both the availability of putative IL-2 transcription factors in forskolin-treated cells and the functional capacity of these factors to engage their sites in vivo. All observed effects of forskolin depended upon protein kinase A, for they were blocked by introduction of a dominant negative mutant subunit of protein kinase A. In the EL4.E1 cell line, we report specific inhibitory effects of cAMP elevation both on NF-kappa B/Rel family factors binding at -200 bp, and on a novel, biochemically distinct "TGGGC" factor binding at -225 bp with respect to the IL-2 transcriptional start site. Neither NF-AT nor AP-1 binding activities are detectably inhibited in gel mobility shift assays. Elevation of cAMP inhibits NF-kappa B activity with delayed kinetics in association with a delayed inhibition of IL-2 RNA accumulation. Activation of cells in the presence of forskolin prevents the maintenance of stable protein- DNA interactions in vivo, not only at the NF-kappa B and TGGGC sites of the IL-2 enhancer, but also at the NF-AT, AP-1, and other sites. This result, and similar results in cyclosporin A-treated cells, imply that individual IL-2 transcription factors cannot stably bind their target sequences in vivo without coengagement of all other distinct factors at neighboring sites. It is proposed that nonhierarchical, cooperative enhancement of binding is a structural basis of combinatorial transcription factor action at the IL-2 locus. PMID:8113685

UPregulated single-stranded DNA-binding protein 1 induces cell chemoresistance to cisplatin in lung cancer cell lines.

PubMed

Zhao, Xiang; He, Rong; Liu, Yu; Wu, Yongkai; Kang, Leitao

2017-07-01

Cisplatin and its analogues are widely used as anti-tumor drugs in lung cancer but many cisplatin-resistant lung cancer cases have been identified in recent years. Single-stranded DNA-binding protein 1 (SSDBP1) can effectively induce H69 cell resistance to cisplatin in our previous identification; thus, it is necessary to explore the mechanism underlying the effects of SSDBP1-induced resistance to cisplatin. First, SSDBP1-overexpressed or silent cell line was constructed and used to analyze the effects of SSDBP1 on chemoresistance of lung cancer cells to cisplatin. SSDBP1 expression was assayed by real-time PCR and Western blot. Next, the effects of SSDBP1 on cisplatin sensitivity, proliferation, and apoptosis of lung cancer cell lines were assayed by MTT and flow cytometry, respectively; ABC transporters, apoptosis-related genes, and cell cycle-related genes by real-time PCR, and DNA wound repair by comet assay. Low expression of SSDBP1 was observed in H69 cells, while increased expression in cisplatin-resistant H69 cells. Upregulated expression of SSDBP1 in H69AR cells was identified to promote proliferation and cisplatin resistance and inhibit apoptosis, while downregulation of SSDBP1 to inhibit cisplatin resistance and proliferation and promoted apoptosis. Moreover, SSDBP1 promoted the expression of P2gp, MRP1, Cyclin D1, and CDK4 and inhibited the expression of caspase 3 and caspase 9. Furthermore, SSDBP1 promoted the DNA wound repair. These results indicated that SSDBP1 may induce cell chemoresistance of cisplatin through promoting DNA repair, resistance-related gene expression, cell proliferation, and inhibiting apoptosis.

Identification of a 27.8 kDa protein from flounder gill cells involved in lymphocystis disease virus binding and infection.

PubMed

Wang, Mu; Sheng, Xiu-Zhen; Xing, Jing; Tang, Xiao-Qian; Zhan, Wen-Bin

2011-03-16

In vitro, lymphocystis disease virus (LCDV) infection of flounder gill (FG) cell cultures causes obvious cytopathic effect (CPE). We describe attempts to isolate and characterize the LCDV-binding molecule(s) on the plasma membrane of FG cells that were responsible for virus entry. The results showed that the co-immunoprecipitation assay detected a 27.8 kDa molecule from FG cells that bound to LCDV. In a blocking ELISA, pre-incubation of FG cell membrane proteins with the specific antiserum developed against the 27.8 kDa protein could block LCDV binding. Similarly, antiserum against 27.8 kDa protein could also inhibit LCDV infection of FG cells in vitro. Mass spectrometric analysis established that the 27.8 kDa protein and beta-actin had a strong association. These results strongly supported the possibility that the 27.8 kDa protein was the putative receptor specific for LCDV infection of FG cells.

A Small-Molecule Inhibitor of BCL6 Kills DLBCL Cells In Vitro and In Vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cerchietti, L.C.; Ghetu, A.F.; Zhu, X.

2010-09-22

The BCL6 transcriptional repressor is the most frequently involved oncogene in diffuse large B cell lymphoma (DLBCL). We combined computer-aided drug design with functional assays to identify low-molecular-weight compounds that bind to the corepressor binding groove of the BCL6 BTB domain. One such compound disrupted BCL6/corepressor complexes in vitro and in vivo, and was observed by X-ray crystallography and NMR to bind the critical site within the BTB groove. This compound could induce expression of BCL6 target genes and kill BCL6-positive DLBCL cell lines. In xenotransplantation experiments, the compound was nontoxic and potently suppressed DLBCL tumors in vivo. The compoundmore » also killed primary DLBCLs from human patients.« less

Production and characterization of monoclonal antibodies to the protective antigen component of Bacillus anthracis toxin.

PubMed Central

Little, S F; Leppla, S H; Cora, E

1988-01-01

Thirty-six monoclonal antibodies to the protective antigen protein of Bacillus anthracis exotoxin have been characterized for affinity, antibody subtype, competitive binding to antigenic regions, and ability to neutralize lethal and edema toxin activities. At least 23 antigenic regions were detected on protective antigen by a blocking, enzyme-linked immunosorbent assay. Two clones, 3B6 and 14B7, competed for a single antigenic region and neutralized the activity of both the lethal toxin in vivo (Fisher 344 rat) and the edema toxin in vitro (CHO cells). These two antibodies blocked the binding of 125I-labeled protective antigen to FRL-103 cells. Our results support the proposal that binding of protective antigen to cell receptors is required for expression of toxicity. Images PMID:3384478

Critical ligand binding reagent preparation/selection: when specificity depends on reagents.

PubMed

Rup, Bonita; O'Hara, Denise

2007-05-11

Throughout the life cycle of biopharmaceutical products, bioanalytical support is provided using ligand binding assays to measure the drug product for pharmacokinetic, pharmacodynamic, and immunogenicity studies. The specificity and selectivity of these ligand binding assays are highly dependent on the ligand binding reagents. Thus the selection, characterization, and management processes for ligand binding reagents are crucial to successful assay development and application. This report describes process considerations for selection and characterization of ligand binding reagents that are integral parts of the different phases of assay development. Changes in expression, purification, modification, and storage of the ligand binding reagents may have a profound effect on the ligand binding assay performance. Thus long-term management of the critical ligand binding assay reagents is addressed including suggested characterization criteria that allow ligand binding reagents to be used in as consistent a manner as possible. Examples of challenges related to the selection, modification, and characterization of ligand binding reagents are included.

Analysis of Ethylene Receptors: Ethylene-Binding Assays.

PubMed

Binder, Brad M; Schaller, G Eric

2017-01-01

Plant ethylene receptors bind ethylene with high affinity. Most of the characterization of ethylene binding to the receptors has been carried out using a radioligand-binding assay on functional receptors expressed in yeast. In this chapter, we describe methods for expressing ethylene receptors in yeast and conducting ethylene-binding assays on intact yeast and yeast membranes. The ethylene-binding assays can be modified to analyze ethylene binding to intact plants and other organisms as well as membranes isolated from any biological source.

Monoclonal antibodies to human vitamin D-binding protein.

PubMed Central

Pierce, E A; Dame, M C; Bouillon, R; Van Baelen, H; DeLuca, H F

1985-01-01

Monoclonal antibodies to vitamin D-binding protein isolated from human serum have been produced. The antibodies obtained have been shown to be specific for human vitamin D-binding protein by three independent assays. The antibodies recognize human vitamin D-binding protein specifically in an enzyme-linked immunosorbent assay. Human vitamin D-binding protein is detected specifically in both pure and crude samples by a radiometric immunosorbent assay (RISA) and by an immunoprecipitation assay. The anti-human vitamin D-binding protein antibodies cross-react with monkey and pig vitamin D-binding protein, but not with vitamin D-binding protein from rat, mouse, or chicken, as determined by the RISA and immunoprecipitation assays. Images PMID:3936035

Spatial biomarker of disease and detection of spatial organization of cellular receptors

DOEpatents

Salaita, Khalid S.; Nair, Pradeep M.; Das, Debopriya; Gray, Joe W.; Groves, John T.

2017-07-18

A signature of a condition of a live cell is established in an assay that allows distribution of the receptors on the cell surface in response to binding a ligand. The receptors can be optically detected and quantified to provide a value for the condition, Test drugs can be screened for therapeutic potential in the assay: a potentially efficacious drug is identified by an ability to modulate an established signature. The receptor distribution signature can be corroborated with an mRNA expression profile of several genes, indicating, for example, metastasis.

STANDARDIZATION OF A FLUORESCENT-BASED QUANTITATIVE ADHESION ASSAY TO STUDY ATTACHMENT OF Taenia solium ONCOSPHERE TO EPITHELIAL CELLS In Vitro

PubMed Central

Chile, Nancy; Evangelista, Julio; Gilman, Robert H.; Arana, Yanina; Palma, Sandra; Sterling, Charles R; Garcia, Hector H.; Gonzalez, Armando; Verastegui, Manuela

2012-01-01

To fully understand the preliminary stages of Taenia solium oncosphere attachment in the gut, adequate tools and assays are necessary to observe and quantify this event that leads to infection. A fluorescent-based quantitative adhesion assay, using biotinylated activated-oncospheres and monolayers of Chinese hamster ovary cells (CHO-K1) or human intestinal monolayer cells (INT-407, HCT-8 or HT-29), was developed to study initial events during the infection of target cells and to rapidly quantify the in vitro adhesion of T. solium oncospheres. Fluorescein streptavidin was used to identify biotinylated activated-oncospheres adhered to cells. This adherence was quantified using an automated fluorescence plate reader, and the results were expressed as fluorescence intensity values. A series of three assays were performed. The first was to identify the optimum number of biotinylated activated-oncospheres to be used in the adhesion assay. The goal of the second assay was to validate this novel method with the established oncosphere-binding system using the immunofluorescent-antibody assay (IFA) method to quantify oncosphere adhesion. A total of 10,000 biotinylated activated-oncospheres were utilized to assess the role of sera and laminin (LM) in oncosphere adherence to a CHO-K1 cell monolayer. The findings that sera and LM increase the adhesion of oncospheres to monolayer cells were similar to results that were previously obtained using the IFA method. The third assay compared the adherence of biotinylated activated-oncospheres to different types of human intestinal monolayer cells. In this case, the fluorescence intensity was greatest when using the INT-407 cell monolayer. We believe this new method of quantification offers the potential for rapid, large-scale screening to study and elucidate specific molecules and mechanisms involved in oncosphere-host cell attachment. PMID:22178422

CFS-1686 causes cell cycle arrest at intra-S phase by interference of interaction of topoisomerase 1 with DNA.

PubMed

Lin, Ru-Wei; Yang, Chia-Ning; Ku, ShengYu; Ho, Cheng-Jung; Huang, Shih-Bo; Yang, Min-Chi; Chang, Hsin-Wen; Lin, Chun-Mao; Hwang, Jaulang; Chen, Yeh-Long; Tzeng, Cherg-Chyi; Wang, Chihuei

2014-01-01

CFS-1686 (chemical name (E)-N-(2-(diethylamino)ethyl)-4-(2-(2-(5-nitrofuran-2-yl)vinyl)quinolin-4-ylamino)benzamide) inhibits cell proliferation and triggers late apoptosis in prostate cancer cell lines. Comparing the effect of CFS-1686 on cell cycle progression with the topoisomerase 1 inhibitor camptothecin revealed that CFS-1686 and camptothecin reduced DNA synthesis in S-phase, resulting in cell cycle arrest at the intra-S phase and G1-S boundary, respectively. The DNA damage in CFS-1686 and camptothecin treated cells was evaluated by the level of ATM phosphorylation, γH2AX, and γH2AX foci, showing that camptothecin was more effective than CFS-1686. However, despite its lower DNA damage capacity, CFS-1686 demonstrated 4-fold higher inhibition of topoisomerase 1 than camptothecin in a DNA relaxation assay. Unlike camptothecin, CFS-1686 demonstrated no activity on topoisomerase 1 in a DNA cleavage assay, but nevertheless it reduced the camptothecin-induced DNA cleavage of topoisomerase 1 in a dose-dependent manner. Our results indicate that CFS-1686 might bind to topoisomerase 1 to inhibit this enzyme from interacting with DNA relaxation activity, unlike campothecin's induction of a topoisomerase 1-DNA cleavage complex. Finally, we used a computer docking strategy to localize the potential binding site of CFS-1686 to topoisomerase 1, further indicating that CFS-1686 might inhibit the binding of Top1 to DNA.

Long noncoding RNA PVT1 enhances the viability and invasion of papillary thyroid carcinoma cells by functioning as ceRNA of microRNA-30a through mediating expression of insulin like growth factor 1 receptor.

PubMed

Feng, Kun; Liu, Yu; Xu, Li-Juan; Zhao, Ling-Fei; Jia, Chao-Wen; Xu, Ming-Yan

2018-08-01

Invasion and metastasis of papillary thyroid carcinoma (PTC) significantly affects prognosis and quality of life of patients. Herein, we explored the binding relationship of long noncoding RNA PVT1 as ceRNA to microRNA-30a (miR-30a), and their effect on the development of PTC through regulating insulin like growth factor 1 receptor (IGF1R). PTC and adjacent normal tissues were collected, where the qRT-PCR and western blot assay were employed to evaluate the expression levels of PVT1, miR-30a and IGF1R. The correlation between PVT1 expression and clinicopathological characteristics of PTC patients was observed. PTC cell lines with the most/least significant difference from normal thyroid cells were selected and treated with siRNA PVT1 or overexpression PVT1 plasmids, miR-30a mimics or miR-30a inhibitors. Nucleus and cytoplasm segmentation was used to identify subcellular fractionation of PVT1. The binding relationship of PVT1 to miR-30a and the targeting relationship of miR-30a to IGF1R were confirmed by using bioinformatic prediction program, dual-luciferase reporter gene assay and RNA-pull down. Cell viability, cell cycle and apoptosis, invasion and migration capacities were assessed by MTT, flow cytometry, Transwell assay and scratch test, respectively. Western blot assay was employed to examine protein expression of IGF1R, apoptosis-related factors (caspase-3, cleaved capase-3) and epithelial-mesenchymal transition (EMT)-related factors (E-cadherin, Vimentin). In the PTC tissues and cells, PVT1 and IGF1R were highly expressed and miR-30a was poorly expressed. PVT1 exerted its effects on PTC mainly in the cytoplasm. The PVT1 expression was correlated with TNM staging, LNM and tumor infiltration of PTC. The competitive binding of PVT1 to miR-30a enhanced expression of IGF1R. In the in vitro experiments, BCPAP and TPC-1 cells were selected. When subjected to siRNA PVT1 or miR-30a mimics, BCPAP and TPC-1 cells exhibited inhibited proliferation, cell cycle progression, invasion, migration, EMT (increased E-cadherin and reduced Vimentin) and promoted apoptosis (reduced caspase-3 and increased cleaved capase-3), and moreover, the expression of IGF1R was reduced. This study provides evidence that long noncoding RNA PVT1 enhances the expression of IGF1R through competitive binding to miR-30a, whereby PVT1 facilitates the development of PTC. Copyright © 2018. Published by Elsevier Masson SAS.

Studying Mucin Secretion from Human Bronchial Epithelial Cell Primary Cultures

PubMed Central

Abdullah, Lubna H.; Wolber, Cédric; Kesimer, Mehmet; Sheehan, John K.; Davis, C. William

2016-01-01

Mucin secretion is regulated by extracellular signaling molecules emanating from local, neuronal, or endocrine sources. Quantifying the rate of this secretion is important to understanding how the exocytic process is regulated, and also how goblet/mucous cells synthesize and release mucins under control and pathological conditions. Consequently, measuring mucins in a quantitatively accurate manner is the key to many experiments addressing these issues. This paper describes procedures used to determine agonist-induced mucin secretion from goblet cells in human bronchial epithelial (HBE) cell cultures. It begins with primary epithelial cell culture, offers methods for purifying MUC5AC and MUC5B mucins for standards, and describes five different microtiter plate binding assays which use various probes for mucins. A polymeric mucin-specific antibody is used in standard and sandwich ELISA formats for two assays while the others target the extensive glycosylated domains of mucins with lectin, periodate oxidation, and antibody-based probes. Comparing the data derived from the different assays applied to the same set of samples of HBE cell cultures indicates a qualitative agreement between baseline and agonist stimulated mucin release; however, the polymeric mucin-specific assays yield substantially lower values than the assays using nonspecific molecular reporters. These results indicate that the more non-specific assays are suitable to assess overall secretory responses by goblet cells, but are likely unsuited for specific measurements of polymeric mucins, per se. PMID:22259142

Long non-coding RNA MALAT1 interacts with transcription factor Foxo1 to regulate SIRT1 transcription in high glucose-induced HK-2 cells injury.

PubMed

Zhou, Ling; Xu, De-Yu; Sha, Wen-Gang; Shen, Lei; Lu, Guo-Yuan

2018-06-18

Tubular injury is considered as a crucial pathological feature of diabetic nephropathy. LncRNA MALAT1 is involved in diabetic complications. Hence the role of MALAT1 in high glucose-induced renal tubular epithelial cells (HK-2) injury deserves investigation. The diabetic mice model was established with streptozotocin (STZ) injection. The expression of NEAT1, SIRT1, and Foxo1 mRNA and protein was determined with qRT-PCR and western blot, respectively. The serum creatinine and urinary albumin were examined by enzyme linked immunosorbent assay (ELISA). Interaction between MALAT1 and Foxo1 was detected with RIP and RNA pull-down assay, respectively. Dual luciferase reporter assay was used to evaluate the binding between Foxo1 and SIRT1. LncRNA MALAT1 was up-regulated in kidney tissues of diabetic mice and in HK-2 cells treated with high glucose, while the expression of SIRT1 was decreased. Interaction between MALAT1 and Foxo1 was observed in HK-2 cells and the interaction was promoted by high glucose treatment. Foxo1 activated SIRT1 transcription by binding to its promoter, and MALAT1 repressed SIRT1 expression through targeting Foxo1. LncRNA MALAT1 interacts with transcription factor Foxo1 to represses SIRT1 transcription in high glucose incubated HK-2 cells, which promotes high glucose-induced HK-2 cells injury. Copyright © 2018. Published by Elsevier Inc.

Zinc finger transcription factor CASZ1 interacts with histones, DNA repair proteins and recruits NuRD complex to regulate gene transcription.

PubMed

Liu, Zhihui; Lam, Norris; Thiele, Carol J

2015-09-29

The zinc finger transcription factor CASZ1 has been found to control neural fate-determination in flies, regulate murine and frog cardiac development, control murine retinal cell progenitor expansion and function as a tumor suppressor gene in humans. However, the molecular mechanism by which CASZ1 regulates gene transcription to exert these diverse biological functions has not been described. Here we identify co-factors that are recruited by CASZ1b to regulate gene transcription using co-immunoprecipitation (co-IP) and mass spectrometry assays. We find that CASZ1b binds to the nucleosome remodeling and histone deacetylase (NuRD) complex, histones and DNA repair proteins. Mutagenesis of the CASZ1b protein assay demonstrates that the N-terminus of CASZ1b is required for NuRD binding, and a poly(ADP-ribose) binding motif in the CASZ1b protein is required for histone H3 and DNA repair proteins binding. The N-terminus of CASZ1b fused to an artificial DNA-binding domain (GAL4DBD) causes a significant repression of transcription (5xUAS-luciferase assay), which could be blocked by treatment with an HDAC inhibitor. Realtime PCR results show that the transcriptional activity of CASZ1b mutants that abrogate NuRD or histone H3/DNA binding is significantly decreased. This indicates a model in which CASZ1b binds to chromatin and recruits NuRD complexes to orchestrate epigenetic-mediated transcriptional programs.

Structural basis for the recognition of Asef by adenomatous polyposis coli

PubMed Central

Zhang, Zhenyi; Chen, Leyi; Gao, Lei; Lin, Kui; Zhu, Liang; Lu, Yang; Shi, Xiaoshan; Gao, Yuan; Zhou, Jing; Xu, Ping; Zhang, Jian; Wu, Geng

2012-01-01

Adenomatous polyposis coli (APC) regulates cell-cell adhesion and cell migration through activating the APC-stimulated guanine nucleotide-exchange factor (GEF; Asef), which is usually autoinhibited through the binding between its Src homology 3 (SH3) and Dbl homology (DH) domains. The APC-activated Asef stimulates the small GTPase Cdc42, which leads to decreased cell-cell adherence and enhanced cell migration. In colorectal cancers, truncated APC constitutively activates Asef and promotes cancer cell migration and angiogenesis. Here, we report crystal structures of the human APC/Asef complex. We find that the armadillo repeat domain of APC uses a highly conserved surface groove to recognize the APC-binding region (ABR) of Asef, conformation of which changes dramatically upon binding to APC. Key residues on APC and Asef for the complex formation were mutated and their importance was demonstrated by binding and activity assays. Structural superimposition of the APC/Asef complex with autoinhibited Asef suggests that the binding between APC and Asef might create a steric clash between Asef-DH domain and APC, which possibly leads to a conformational change in Asef that stimulates its GEF activity. Our structures thus elucidate the molecular mechanism of Asef recognition by APC, as well as provide a potential target for pharmaceutical intervention against cancers. PMID:21788986

Glycosaminoglycans mediate retention of the poxvirus type I interferon binding protein at the cell surface to locally block interferon antiviral responses

PubMed Central

Montanuy, Imma; Alejo, Ali; Alcami, Antonio

2011-01-01

Eradication of smallpox was accomplished 30 yr ago, but poxviral infections still represent a public health concern due to the potential release of variola virus or the emergence of zoonotic poxviruses, such as monkeypox virus. A critical determinant of poxvirus virulence is the inhibition of interferons (IFNs) by the virus-encoded type I IFN-binding protein (IFNα/βBP). This immunomodulatory protein is secreted and has the unique property of interacting with the cell surface in order to prevent IFN-mediated antiviral responses. However, the mechanism of its attachment to the cell surface remains unknown. Using surface plasmon resonance and cell-binding assays, we report that the IFNα/βBP from vaccinia virus, the smallpox vaccine, interacts with cell surface glycosaminoglycans (GAGs). Analysis of the contribution of different regions of the protein to cell surface binding demonstrated that clusters of basic residues in the first immunoglobulin domain mediate GAG interactions. Furthermore, mutation of the GAG-interaction motifs does not affect its IFN-binding and -blocking capacity. Functional conservation of GAG-binding sites is demonstrated for the IFNα/βBP from variola and monkeypox viruses, extending our understanding of immune modulation by the most virulent human poxviruses. These results are relevant for the design of improved vaccines and intervention strategies.—Montanuy, I., Alejo, A., Alcami, A. Glycosaminoglycans mediate retention of the poxvirus type I interferon binding protein at the cell surface to locally block interferon antiviral responses. PMID:21372110

Alternative Methods for the Detection of Emerging Marine Toxins: Biosensors, Biochemical Assays and Cell-Based Assays

PubMed Central

Reverté, Laia; Soliño, Lucía; Carnicer, Olga; Diogène, Jorge; Campàs, Mònica

2014-01-01

The emergence of marine toxins in water and seafood may have a considerable impact on public health. Although the tendency in Europe is to consolidate, when possible, official reference methods based on instrumental analysis, the development of alternative or complementary methods providing functional or toxicological information may provide advantages in terms of risk identification, but also low cost, simplicity, ease of use and high-throughput analysis. This article gives an overview of the immunoassays, cell-based assays, receptor-binding assays and biosensors that have been developed for the screening and quantification of emerging marine toxins: palytoxins, ciguatoxins, cyclic imines and tetrodotoxins. Their advantages and limitations are discussed, as well as their possible integration in research and monitoring programs. PMID:25431968

Thyroid receptor ligands. Part 8: Thyromimetics derived from N-acylated-alpha-amino acid derivatives displaying modulated pharmacological selectivity compared with KB-141.

PubMed

Garg, Neeraj; Li, Yi-Lin; Garcia Collazo, Ana Maria; Litten, Chris; Ryono, Denis E; Zhang, Minsheng; Caringal, Yolanda; Brigance, Robert P; Meng, Wei; Washburn, William N; Agback, Peter; Mellström, Karin; Rehnmark, Stefan; Rahimi-Ghadim, Mahmoud; Norin, Thomas; Grynfarb, Marlena; Sandberg, Johnny; Grover, Gary; Malm, Johan

2007-08-01

Based on the scaffold of the pharmacologically selective thyromimetic 2b, structurally a close analog to KB-141 (2a), a number of novel N-acylated-alpha-amino acid derivatives were synthesized and tested in a TR radioligand binding assay as well as in a reporter cell assay. On the basis of TRbeta(1)-isoform selectivity and affinity, as well as affinity to the reporter cell assay, 3d was selected for further studies in the cholesterol-fed rat model. In this model 3d revealed an improved therapeutic window between cholesterol and TSH lowering but decreased margins versus tachycardia compared with 2a.

The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Varnum, Susan M.

2012-03-01

Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was foundmore » to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.« less

Targeting Prostate Cancer with Bifunctional Modulators of the Androgen Receptor

DTIC Science & Technology

2013-10-01

linker lengths were prepared and assessed to determine the impact of linker length on the activity of the molecules. HEK293T cells were transfected as...M. Determination of...15 derivatives were determined experimentally by radiolabeled competition binding assays using an extract 16 from Hi5 insect cells expressing an N

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carmen Herranz, Ma; Sanchez-Navarro, Jesus-Angel; Sauri, Ana

2005-08-15

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutantsmore » and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.« less

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement.

PubMed

Carmen Herranz, Ma; Sanchez-Navarro, Jesús-Angel; Saurí, Ana; Mingarro, Ismael; Pallás, Vicente

2005-08-15

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.

Phytoestrogenic effect of Inula racemosa Hook f - A cardioprotective root drug in traditional medicine.

PubMed

Kalachaveedu, Mangathayaru; Raghavan, Divya; Telapolu, Srivani; Kuruvilla, Sarah; Kedike, Balakrishna

2018-01-10

Roots of Inula racemosa are used as a cardio protective in Ayurveda in India, being prescribed as a medicine for precordial chest pain, cough and dyspnoea, both singly and as a poly herbal. Evaluation of Phytoestrogenic activity of the root extracts of Inula racemosa and compounds isolated therefrom in vivo, in silico and in vitro. Alcohol (IrA) and hexane (IrH) extracts characterized by HPTLC/GC-MS analysis respectively and processed for compound isolation were evaluated for estrogenic activity (100 & 250mg/kg bw) by the Immature rat uterotrophic assay using ethinylestradiol (EE -30µg/kg bw) as standard drug. Alantolactone (ALT), Isoalantolactone (IALT) and Stigmasterolglucoside (SG) isolated from the extracts were characterized and screened in silico for ERα, ERβ binding affinity, assessed in vitro for growth modulatory effects on MCF-7 cells by MTT assay and cell cycle distribution analysis using Flow cytometry. RT-PCR analysis evaluated the mRNA expression of pS2 in these cells post exposure to ALT, IALT and SG. In the IrA treated groups there has been a statistically significant increase (P < 0.05) in absolute and normalised uterine weight, uterine diameter, endometrial thickness, luminal epithelial cell height,diameter of ovary and in the number of primary and secondary ovarian follicles relative to untreated controls. Presence of ciliated epithelial cells in the oviduct, elevated number of early growing follicles characterized by an increased oocyte diameter, and signs of vascularization in the cortex of ovarian sections in this group relative to EE treated group are indicative of pervasive activation of follicular growth and initiation. Virtual docking demonstrated ERα affinity for IALT, ERβ affinity for ALT, while SG showed a high binding affinity to both with a relatively greater ERβ binding affinity. Dose dependent decrease in cell viability mediated by IALT and SG in the MTT assay is corroborated by a statistically significant increase (p < 0.05) in sub G0-G1 cells by SG at 200 and 400µM in cell cycle analysis and there has been an induction of pS2 by IALT and SG in the ER regulated MCF-7 cells. Demonstration of classical morphological changes induced by estrogen stimulation mediated by IrA in vivo at both the tested doses, isolation of the antioxidant SG from IrA and its dose dependent growth inhibitory effect on estrogen sensitive MCF-7 cells through apoptotic induction and an up regulation of pS2 are suggestive of an anti-estrogenic effect through estrogen receptor binding affinity, typical of phytoestrogens that bind to ER but do not elicit a full estrogenic response. The observed estrogenic effect of IrA suggests a multi mechanistic molecular action involving antioxidant as well as redox signalling pathways acting in consonance with their anti-estrogenic effects owing to the weak estrogen like competitive receptor binding of SG. Copyright © 2017 Elsevier B.V. All rights reserved.

Functional Elements on SIRPα IgV domain Mediate Cell Surface Binding to CD47

PubMed Central

Liu, Yuan; Tong, Qiao; Zhou, Yubin; Lee, Hsiau-Wei; Yang, Jenny J.; Bühring, Hans-Jörg; Chen, Yi-Tien; Ha, Binh; Chen, Celia X-J.; Zen, Ke

2007-01-01

Summary SIRPα and SIRPβ1, the two major isoforms of the signal regulatory protein (SIRP) family, are co-expressed in human leukocytes but mediate distinct extracellular binding interactions and divergent cell signaling responses. Previous studies have demonstrated that binding of SIRPα with CD47, another important cell surface molecule, through the extracellular IgV domain regulates important leukocyte functions including macrophage recognition, leukocyte adhesion and transmigration. Although SIRPβ1 shares highly homologous extracellular IgV structure with SIRPα, it does not bind to CD47. In this study, we defined key amino acid residues exclusively expressing in the IgV domain of SIRPα, but not SIRPβ1, which determine the extracellular binding interaction of SIRPα to CD47. These key residues include Gln67, a small hydrophobic amino acid (Ala or Val) at the 57th position and Met102. We found that Gln67 and Ala/Val57 are critical. Mutation of either of these residues abates SIRPα directly binding to CD47. Functional cell adhesion and leukocyte transmigration assays further demonstrated central roles of Gln67 and Ala/Val57 in SIRPα extracellular binding mediated cell interactions and cell migration. Another SIRPα-specific residue, Met102, appears to assist SIRPα IgV binding through Gln67 and Ala/Val57. An essential role of these amino acids in SIRPα binding to CD47 was further confirmed by introducing these residues into the SIRPβ1 IgV domain, which dramatically converts SIRPβ1 into a CD47-binding molecule. Our results thus revealed the molecular basis by which SIRPα selectively binds to CD47 and shed new light into the structural mechanisms of SIRP isoform mediated distinctive extracellular interactions and cellular responses. PMID:17070842

Functional elements on SIRPalpha IgV domain mediate cell surface binding to CD47.

PubMed

Liu, Yuan; Tong, Qiao; Zhou, Yubin; Lee, Hsiau-Wei; Yang, Jenny J; Bühring, Hans-Jörg; Chen, Yi-Tien; Ha, Binh; Chen, Celia X-J; Yang, Yang; Zen, Ke

2007-01-19

SIRPalpha and SIRPbeta1, the two major isoforms of the signal regulatory protein (SIRP) family, are co-expressed in human leukocytes but mediate distinct extracellular binding interactions and divergent cell signaling responses. Previous studies have demonstrated that binding of SIRPalpha with CD47, another important cell surface molecule, through the extracellular IgV domain regulates important leukocyte functions including macrophage recognition, leukocyte adhesion and transmigration. Although SIRPbeta1 shares highly homologous extracellular IgV structure with SIRPalpha, it does not bind to CD47. Here, we defined key amino acid residues exclusively expressing in the IgV domain of SIRPalpha, but not SIRPbeta1, which determine the extracellular binding interaction of SIRPalpha to CD47. These key residues include Gln67, a small hydrophobic amino acid (Ala or Val) at the 57th position and Met102. We found that Gln67 and Ala/Val57 are critical. Mutation of either of these residues abates SIRPalpha directly binding to CD47. Functional cell adhesion and leukocyte transmigration assays further demonstrated central roles of Gln67 and Ala/Val57 in SIRPalpha extracellular binding mediated cell interactions and cell migration. Another SIRPalpha-specific residue, Met102, appears to assist SIRPalpha IgV binding through Gln67 and Ala/Val57. An essential role of these amino acid residues in SIRPalpha binding to CD47 was further confirmed by introducing these residues into the SIRPbeta1 IgV domain, which dramatically converts SIRPbeta1 into a CD47-binding molecule. Our results thus revealed the molecular basis by which SIRPalpha binds to CD47 and shed new light into the structural mechanisms of SIRP isoform mediated distinctive extracellular interactions and cellular responses.

Cross-linking staphylococcal enterotoxin A bound to major histocompatibility complex class I is required for TNF-alpha secretion

NASA Technical Reports Server (NTRS)

Wright, A. D.; Chapes, S. K.

1999-01-01

The mechanism of how superantigens function to activate cells has been linked to their ability to bind and cross-link the major histocompatibility complex class II (MHCII) molecule. Cells that lack the MHCII molecule also respond to superantigens, however, with much less efficiency. Therefore, the purpose of this study was to confirm that staphylococcal enterotoxin A (SEA) could bind the MHCI molecule and to test the hypothesis that cross-linking SEA bound to MHCII-deficient macrophages would induce a more robust cytokine response than without cross-linking. We used a capture enzyme-linked immunosorbent assay and an immunprecipitation assay to directly demonstrate that MHCI molecules bind SEA. Directly cross-linking MHCI using monoclonal antibodies or cross-linking bound SEA with an anti-SEA antibody or biotinylated SEA with avidin increased TNF-alpha and IL-6 secretion by MHCII(-/-) macrophages. The induction of a vigorous macrophage cytokine response by SEA/anti-SEA cross-linking of MHCI offers a mechanism to explain how MHCI could play an important role in superantigen-mediated pathogenesis. Copyright 1999 Academic Press.

Negative modulation of the chicken infectious anemia virus promoter by COUP-TF1 and an E box-like element at the transcription start site binding deltaEF1.

PubMed

Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A

2008-12-01

Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.

Demonstration of specific binding of heparin to Plasmodium falciparum-infected vs. non-infected red blood cells by single-molecule force spectroscopy

NASA Astrophysics Data System (ADS)

Valle-Delgado, Juan José; Urbán, Patricia; Fernàndez-Busquets, Xavier

2013-04-01

Glycosaminoglycans (GAGs) play an important role in the sequestration of Plasmodium falciparum-infected red blood cells (pRBCs) in the microvascular endothelium of different tissues, as well as in the formation of small clusters (rosettes) between infected and non-infected red blood cells (RBCs). Both sequestration and rosetting have been recognized as characteristic events in severe malaria. Here we have used heparin and pRBCs infected by the 3D7 strain of P. falciparum as a model to study GAG-pRBC interactions. Fluorescence microscopy and fluorescence-assisted cell sorting assays have shown that exogenously added heparin has binding specificity for pRBCs (preferentially for those infected with late forms of the parasite) vs. RBCs. Heparin-pRBC adhesion has been probed by single-molecule force spectroscopy, obtaining an average binding force ranging between 28 and 46 pN depending on the loading rate. No significant binding of heparin to non-infected RBCs has been observed in control experiments. This work represents the first approach to quantitatively evaluate GAG-pRBC molecular interactions at the individual molecule level.Glycosaminoglycans (GAGs) play an important role in the sequestration of Plasmodium falciparum-infected red blood cells (pRBCs) in the microvascular endothelium of different tissues, as well as in the formation of small clusters (rosettes) between infected and non-infected red blood cells (RBCs). Both sequestration and rosetting have been recognized as characteristic events in severe malaria. Here we have used heparin and pRBCs infected by the 3D7 strain of P. falciparum as a model to study GAG-pRBC interactions. Fluorescence microscopy and fluorescence-assisted cell sorting assays have shown that exogenously added heparin has binding specificity for pRBCs (preferentially for those infected with late forms of the parasite) vs. RBCs. Heparin-pRBC adhesion has been probed by single-molecule force spectroscopy, obtaining an average binding force ranging between 28 and 46 pN depending on the loading rate. No significant binding of heparin to non-infected RBCs has been observed in control experiments. This work represents the first approach to quantitatively evaluate GAG-pRBC molecular interactions at the individual molecule level. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr32821f

Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

PubMed

Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

2015-08-01

Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Targeting androgen receptor and JunD interaction for prevention of prostate cancer progression.

PubMed

Mehraein-Ghomi, Farideh; Kegel, Stacy J; Church, Dawn R; Schmidt, Joseph S; Reuter, Quentin R; Saphner, Elizabeth L; Basu, Hirak S; Wilding, George

2014-05-01

Multiple studies show that reactive oxygen species (ROS) play a major role in prostate cancer (PCa) development and progression. Previously, we reported an induction of Spermidine/Spermine N(1) -Acetyl Transferase (SSAT) by androgen-activated androgen receptor (AR)-JunD protein complex that leads to over-production of ROS in PCa cells. In our current research, we identify small molecules that specifically block AR-JunD in this ROS-generating metabolic pathway. A high throughput assay based on Gaussia Luciferase reconstitution was used to identify inhibitors of the AR-JunD interaction. Selected hits were further screened using a fluorescence polarization competitor assay to eliminate those that bind to the AR Ligand Binding Domain (LBD), in order to identify molecules that specifically target events downstream to androgen activation of AR. Eleven molecules were selected for studies on their efficacy against ROS generation and growth of cultured human PCa cells by DCFH dye-oxidation assay and DNA fluorescence assay, respectively. In situ Proximity Ligation Assay (PLA), SSAT promoter-luciferase reporter assay, and western blotting of apoptosis and cell cycle markers were used to study mechanism of action of the lead compound. Selected lead compound GWARJD10 with EC(50) 10 μM against ROS production was shown to block AR-JunD interaction in situ as well as block androgen-induced SSAT gene expression at IC(50) 5 μM. This compound had no effect on apoptosis markers, but reduced cyclin D1 protein level. Inhibitor of AR-JunD interaction, GWARJD10 shows promise for prevention of progression of PCa at an early stage of the disease by blocking growth and ROS production. © 2014 Wiley Periodicals, Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Wenfei; Wang, Ying; Wang, Nianshuang

Middle East respiratory syndrome coronavirus (MERS-CoV) infects host cells through binding the receptor binding domain (RBD) on its spike glycoprotein to human receptor dipeptidyl peptidase 4 (hDPP4). Here, we report identification of critical residues on hDPP4 for RBD binding and virus entry through analysis of a panel of hDPP4 mutants. Based on the RBD–hDPP4 crystal structure we reported, the mutated residues were located at the interface between RBD and hDPP4, which potentially changed the polarity, hydrophobic or hydrophilic properties of hDPP4, thereby interfering or disrupting their interaction with RBD. Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay,more » we showed that several residues in hDPP4–RBD binding interface were important on hDPP4–RBD binding and viral entry. These results provide atomic insights into the features of interactions between hDPP4 and MERS-CoV RBD, and also provide potential explanation for cellular and species tropism of MERS-CoV infection. - Highlights: • It has been demonstrated that MERS-CoV infects host cells through binding its envelope spike (S) glycoprotein to the host cellular receptor dipeptidyl peptidase 4 (DPP4). • To identify the critical residues on hDPP4 for RBD binding and virus entry, we constructed a panel of hDPP4 mutants based on structure-guided mutagenesis. • Using surface plasmon resonance (SPR) binding analysis and pseudovirus infection assay, we showed that several residues on hDPP4 had significant impacts on virus/receptor interactions and viral entry. • Our study has provided new insights into the features of interactions between hDPP4 and MERS-CoV RBD, and provides potential explanation for cellular and species tropism of MERS-CoV infection.« less

A mechanism for negative gene regulation in Autographa californica multinucleocapsid nuclear polyhedrosis virus

USGS Publications Warehouse

Leisy, D.J.; Rasmussen, C.; Owusu, E.O.; Rohrmann, G.F.

1997-01-01

The Autographa californica multinucleocapsid nuclear polyhedrosis virus (AcMNPV) ie-1 gene product (IE-1) is thought to play a central role in stimulating early viral transcription. IE-1 has been demonstrated to activate several early viral gene promoters and to negatively regulate the promoters of two other AcMNPV regulatory genes, ie-0 and ie-2. Our results indicate that IE-1 negatively regulates the expression of certain genes by binding directly, or as part of a complex, to promoter regions containing a specific IE-1-binding motif (5'-ACBYGTAA-3') near their mRNA start sites. The IE-1 binding motif was also found within the palindromic sequences of AcMNPV homologous repeat (hr) regions that have been shown to bind IE-1. The role of this IE-1 binding motif in the regulation of the ie-2 and pe-38 promoters was examined by introducing mutations in these promoters in which the central 6 bp were replaced with Bg/II sites. GUS reporter constructs containing ie-2 and pe-38 promoter fragments with and without these specific mutations were cotransfected into Sf9 cells with various amounts of an ie-1-containing plasmid (ple-1). Comparisons of GUS expression produced by the mutant and wild-type constructs demonstrated that the IE-1 binding motif mediated a significant decrease in expression from the ie-2 and pe-38 promoters in response to increasing pIe-1 concentrations. Electrophoretic mobility shift assays with pIe-1-transfected cell extracts and supershift assays with IE-1- specific antiserum demonstrated that IE-1 binds to promoter fragments containing the IE-1 binding motif but does not bind to promoter fragments lacking this motif.

A novel transferrin receptor-targeted hybrid peptide disintegrates cancer cell membrane to induce rapid killing of cancer cells

PubMed Central

2011-01-01

Background Transferrin receptor (TfR) is a cell membrane-associated glycoprotein involved in the cellular uptake of iron and the regulation of cell growth. Recent studies have shown the elevated expression levels of TfR on cancer cells compared with normal cells. The elevated expression levels of this receptor in malignancies, which is the accessible extracellular protein, can be a fascinating target for the treatment of cancer. We have recently designed novel type of immunotoxin, termed "hybrid peptide", which is chemically synthesized and is composed of target-binding peptide and lytic peptide containing cationic-rich amino acids components that disintegrates the cell membrane for the cancer cell killing. The lytic peptide is newly designed to induce rapid killing of cancer cells due to conformational change. In this study, we designed TfR binding peptide connected with this novel lytic peptide and assessed the cytotoxic activity in vitro and in vivo. Methods In vitro: We assessed the cytotoxicity of TfR-lytic hybrid peptide for 12 cancer and 2 normal cell lines. The specificity for TfR is demonstrated by competitive assay using TfR antibody and siRNA. In addition, we performed analysis of confocal fluorescence microscopy and apoptosis assay by Annexin-V binding, caspase activity, and JC-1 staining to assess the change in mitochondria membrane potential. In vivo: TfR-lytic was administered intravenously in an athymic mice model with MDA-MB-231 cells. After three weeks tumor sections were histologically analyzed. Results The TfR-lytic hybrid peptide showed cytotoxic activity in 12 cancer cell lines, with IC50 values as low as 4.0-9.3 μM. Normal cells were less sensitive to this molecule, with IC50 values > 50 μM. Competition assay using TfR antibody and knockdown of this receptor by siRNA confirmed the specificity of the TfR-lytic hybrid peptide. In addition, it was revealed that this molecule can disintegrate the cell membrane of T47D cancer cells just in 10 min, to effectively kill these cells and induce approximately 80% apoptotic cell death but not in normal cells. The intravenous administration of TfR-lytic peptide in the athymic mice model significantly inhibited tumor progression. Conclusions TfR-lytic peptide might provide a potent and selective anticancer therapy for patients. PMID:21849092

A complex between contactin-1 and the protein tyrosine phosphatase PTPRZ controls the development of oligodendrocyte precursor cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lamprianou, Smaragda; Chatzopoulou, Elli; Thomas, Jean-Léon

The six members of the contactin (CNTN) family of neural cell adhesion molecules are involved in the formation and maintenance of the central nervous system (CNS) and have been linked to mental retardation and neuropsychiatric disorders such as autism. Five of the six CNTNs bind to the homologous receptor protein tyrosine phosphatases gamma (PTPRG) and zeta (PTPRZ), but the biological roles of these interactions remain unclear. We report here the cocrystal structure of the carbonic anhydrase-like domain of PTPRZ bound to tandem Ig repeats of CNTN1 and combine these structural data with binding assays to show that PTPRZ binds specificallymore » to CNTN1 expressed at the surface of oligodendrocyte precursor cells. Furthermore, analyses of glial cell populations in wild-type and PTPRZ-deficient mice show that the binding of PTPRZ to CNTN1 expressed at the surface of oligodendrocyte precursor cells inhibits their proliferation and promotes their development into mature oligodendrocytes. Overall, these results implicate the PTPRZ/CNTN1 complex as a previously unknown modulator of oligodendrogenesis.« less

Receptors for aggregated IgG on mouse lymphocytes: their presence on thymocytes, thymus-derived, and bone marrow-derived lymphocytes.

PubMed

Anderson, C L; Grey, H M

1974-05-01

An autoradiographic binding assay employing (125)I-labeled heat-aggregated mouse IgG2b myeloma protein (MOPC 141) was used to demonstrate receptors for IgG on 20-45% of Balb/c thymocytes and on 70-80% of splenocytes. Binding could also be shown with heat or BDB aggregates of another IgG2b (MOPC 195), with IgG1 and with human gamma-globulin, but not with aggregated chicken gamma-globulin, IgA, BSA, nor with aggregated Fab fragments of IgG2b. Optimum binding was obtained at 37 degrees C. Detection of binding was dependent upon aggregate size with complexes of more than 100 IgG molecules being optimal, aggregates of 6-25 detecting splenocytes but not thymocytes, and aggregates of less than 6 binding to a negligible extent. Comparison of grain counts on various cell types showed mastocytoma cells (P815) and macrophages averaging 40-50 grains/cell/day, allogeneically activated thymocytes 20-30, splenocytes 2-3, L5178 lymphoma cells 1, and positive thymocytes 0.6 grains/cell/day. Double labeling experiments for surface Ig, theta-antigen, and agg IgG receptor on mouse spleen cells indicated that a relatively high density of receptor was present on about 80% of B cells, 30% of T cells, and 60% of SIg(-), theta(-), null cells.

Partial alanine scan of mast cell degranulating peptide (MCD): importance of the histidine- and arginine residues.

PubMed

Buku, Angeliki; Mendlowitz, Milton; Condie, Barry A; Price, Joseph A

2004-06-01

The influence of the two histidine and two arginine residues of mast cell degranulating peptide (MCD) in activity and binding was studied by replacing these amino acids in the MCD sequence with L-alanine. Their histamine releasing activity was determined on rat peritoneal mast cells. Their binding affinity to the FcepsilonRIalpha binding subunit of the human mast cell receptor protein, was carried out using fluorescence polarization. The histamine assay showed that replacement of His13 by Ala o ccurred without loss of activity compared with the activity of MCD. Alanine substitutions for Arg7 and His8 resulted in an approximately 40 fold increase, and for Arg16 in a 14-fold increase in histamine-releasing activity of MCD. The binding affinities of the analogs were tested by competitive displacement of bound fluorescent MCD peptide from the FcepsilonRIalpha binding protein of the mast cell receptor by the Ala analogs using fluorescence polarization. The analogs Ala8 (for His) and Ala16 (for Arg) showed the same binding affinities as MCD, whereas analog Ala7 (for Arg) and analog Ala13 (for His) showed slightly better binding affinity than the parent compound. This study showed that the introduction of alanine residues in these positions resulted in MCD agonists of diverse potency. These findings will be useful in further MCD structure-activity studies.

F4+ enterotoxigenic Escherichia coli (ETEC) adhesion mediated by the major fimbrial subunit FaeG.

PubMed

Xia, Pengpeng; Song, Yujie; Zou, Yajie; Yang, Ying; Zhu, Guoqiang

2015-09-01

The FaeG subunit is the major constituent of F4(+) fimbriae, associated with glycoprotein and/or glycolipid receptor recognition and majorly contributes to the pathogen attachment to the host cells. To investigate the key factor involved in the fimbrial binding of F4(+) Escherichia coli, both the recombinant E. coli SE5000 strains carrying the fae operon gene clusters that express the different types of fimbriae in vitro, named as rF4ab, rF4ac, and rF4ad, respectively, corresponding to the fimbrial types F4ab, F4ac, and F4ad, and the three isogenic in-frame faeG gene deletion mutants were constructed. The adhesion assays and adhesion inhibition assays showed that ΔfaeG mutants had a significant reduction in the binding to porcine brush border as well as the intestinal epithelial cell lines, while the complemented strain ΔfaeG/pfaeG restored the adhesion function. The recombinant bacterial strains rF4ab, rF4ac, and rF4ad have the same binding property as wild-type F4(+) E. coli strains do and improvement in terms of binding to porcine brush border and the intestinal epithelial cells, and the adherence was blocked by the monoclonal antibody anti-F4 fimbriae. These data demonstrate that the fimbrial binding of F4(+) E. coli is directly mediated by the major FaeG subunit. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Characterization of the rat RALDH1 promoter. A functional CCAAT and octamer motif are critical for basal promoter activity.

PubMed

Guimond, Julie; Devost, Dominic; Brodeur, Helene; Mader, Sylvie; Bhat, Pangala V

2002-12-12

Retinal dehydrogenase type 1 (RALDH1) catalyzes the oxidation of retinal to retinoic acid (RA), a metabolite of vitamin A important for embryogenesis and tissue differentiation. Rat RALDH1 is expressed to high levels in developing kidney, and in stomach, intestine epithelia. To understand the mechanisms of the transcriptional regulation of rat RALDH1, we cloned a 1360-base pair (bp) 5'-flanking region of RALDH1 gene. Using luciferase reporter constructs transfected into HEK 293 and LLCPK (kidney-derived) cells, basal promoter activity was associated with sequences between -80 and +43. In this minimal promoter region, TATA and CCAAT cis-acting elements as well as SP1, AP1 and octamer (Oct)-binding sites were present. The CCAAT box and Oct-binding site, located between positions -72 and -68 and -56 and -49, respectively, were shown by deletion analysis and site-directed mutation to be critical for promoter activity. Nuclear extracts from kidney cells contain proteins specifically binding the Oct and CCAAT sequences, resulting in the formation of six complexes, while different patterns of complexes were observed with non-kidney cell extracts. Gel shift assays using either single or double mutations of the Oct and CCAAT sequences as well as super shift assays demonstrated single and double occupancy of these two sites by Oct-1 and CBF-A. In addition, unidentified proteins also bound the Oct motif specifically in the absence of CBF-A binding. These results demonstrate specific involvement of Oct and CCAAT-binding proteins in the regulation of RALDH1 gene.

Computer-assisted prediction of HLA-DR binding and experimental analysis for human promiscuous Th1-cell peptides in the 24 kDa secreted lipoprotein (LppX) of Mycobacterium tuberculosis.

PubMed

Al-Attiyah, R; Mustafa, A S

2004-01-01

The secreted 24 kDa lipoprotein (LppX) is an antigen that is specific for Mycobacterium tuberculosis complex and M. leprae. The present study was carried out to identify the promiscuous T helper 1 (Th1)-cell epitopes of the M. tuberculosis LppX (MT24, Rv2945c) antigen by using 15 overlapping synthetic peptides (25 mers overlapping by 10 residues) covering the sequence of the complete protein. The analysis of Rv2945c sequence for binding to 51 alleles of nine serologically defined HLA-DR molecules, by using a virtual matrix-based prediction program (propred), showed that eight of the 15 peptides of Rv2945c were predicted to bind promiscuously to >/=10 alleles from more than or equal to three serologically defined HLA-DR molecules. The Th1-cell reactivity of all the peptides was assessed in antigen-induced proliferation and interferon-gamma (IFN-gamma)-secretion assays with peripheral blood mononuclear cells (PBMCs) from 37 bacille Calmette-Guérin (BCG)-vaccinated healthy subjects. The results showed that 17 of the 37 donors, which represented an HLA-DR-heterogeneous group, responded to one or more peptides of Rv2945c in the Th1-cell assays. Although each peptide stimulated PBMCs from one or more donors in the above assays, the best positive responses (12/17 (71%) responders) were observed with the peptide p14 (aa 196-220). This suggested a highly promiscuous presentation of p14 to Th1 cells. In addition, the sequence of p14 is completely identical among the LppX of M. tuberculosis, M. bovis and M. leprae, which further supports the usefulness of Rv2945c and p14 in the subunit vaccine design against both tuberculosis and leprosy.

Characterization of C-type lectins reveals an unexpectedly limited interaction between Cryptococcus neoformans spores and Dectin-1

PubMed Central

Walsh, Naomi M.; Wuthrich, Marcel; Wang, Huafeng; Klein, Bruce; Hull, Christina M.

2017-01-01

Phagocytosis by innate immune cells is an important process for protection against multiple pathologies and is particularly important for resistance to infection. However, phagocytosis has also been implicated in the progression of some diseases, including the dissemination of the human fungal pathogen, Cryptococcus neoformans. Previously, we identified Dectin-1 as a likely phagocytic receptor for C. neoformans spores through the use of soluble components in receptor-ligand blocking experiments. In this study, we used gain-of-function and loss-of-function assays with intact cells to evaluate the in vivo role of Dectin-1 and other C-type lectins in interactions with C. neoformans spores and discovered stark differences in outcome when compared with previous assays. First, we found that non-phagocytic cells expressing Dectin-1 were unable to bind spores and that highly sensitive reporter cells expressing Dectin-1 were not stimulated by spores. Second, we determined that some phagocytes from Dectin-1-/- mice interacted with spores differently than wild type (WT) cells, but the effects varied among assays and were modest overall. Third, while we detected small but statistically significant reductions in phagocytosis by primary alveolar macrophages from Dectin-1-/- mice compared to WT, we found no differences in survival between WT and Dectin-1-/- mice challenged with spores. Further analyses to assess the roles of other C-type lectins and their adapters revealed very weak stimulation of Dectin-2 reporter cells by spores and modest differences in binding and phagocytosis by Dectin-2-/- bone marrow-derived phagocytes. There were no discernable defects in binding or phagocytosis by phagocytes lacking Mannose Receptor, Mincle, Card-9, or FcRγ. Taken together, these results lead to the conclusion that Dectin-1 and other C-type lectins do not individually play a major roles in phagocytosis and innate defense by phagocytes against C. neoformans spores and highlight challenges in using soluble receptor/ligand blocking experiments to recapitulate biologically relevant interactions. PMID:28282442

Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

PubMed

Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

1996-01-01

Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

Approaches for Investigating Translational Regulation Controlled by PARP1: Biotin-Based UV Cross-Linking and Luciferase Reporter Assay.

PubMed

Ji, Yingbiao

2017-01-01

The RNA-binding proteins (RBPs) play a pivotal role in controlling gene expression through posttranscriptional processes. As the trans-acting factors, RBPs interact with the cis-regulatory elements located within mRNAs to regulate mRNA translational efficiency. Adding a new-layer regulation, recent studies suggest that poly(ADP-ribosyl)ation of the RNA-binding proteins often inhibit the RNA-binding ability of RBPs, thus regulating RBP-dependent mRNA metabolism including translational control. Here, we describe a biotin-based UV cross-linking method to determine if excessive accumulation of pADPr in the cell disrupts the interaction between RBPs and their target mRNAs. In addition, we illustrate the protocol of using the luciferase reporter assay to determine the effect of poly(ADP-ribosyl)ation on mRNA translation.

Abalone Hemocyanin Blocks the Entry of Herpes Simplex Virus 1 into Cells: a Potential New Antiviral Strategy

PubMed Central

Talaei Zanjani, Negar; Miranda-Saksena, Monica; Valtchev, Peter; Hueston, Linda; Diefenbach, Eve; Sairi, Fareed; Gomes, Vincent G.

2015-01-01

A marine-derived compound, abalone hemocyanin, from Haliotis rubra was shown to have a unique mechanism of antiviral activity against herpes simplex virus 1 (HSV-1) infections. In vitro assays demonstrated the dose-dependent and inhibitory effect of purified hemocyanin against HSV-1 infection in Vero cells with a 50% effective dose (ED50) of 40 to 50 nM and no significant toxicity. In addition, hemocyanin specifically inhibited viral attachment and entry by binding selectively to the viral surface glycoproteins gD, gB, and gC, probably by mimicking their receptors. However, hemocyanin had no effect on postentry events and did not block infection by binding to cellular receptors for HSV. By the use of different mutants of gD and gB and a competitive heparin binding assay, both protein charge and conformation were shown to be the driving forces of the interaction between hemocyanin and viral glycoproteins. These findings also suggested that hemocyanin may have different motifs for binding to each of the viral glycoproteins B and D. The dimer subunit of hemocyanin with a 10-fold-smaller molecular mass exhibited similar binding to viral surface glycoproteins, showing that the observed inhibition did not require the entire multimer. Therefore, a small hemocyanin analogue could serve as a new antiviral candidate for HSV infections. PMID:26643336

Core-binding factor beta interacts with Runx2 and is required for skeletal development.

PubMed

Yoshida, Carolina A; Furuichi, Tatsuya; Fujita, Takashi; Fukuyama, Ryo; Kanatani, Naoko; Kobayashi, Shinji; Satake, Masanobu; Takada, Kenji; Komori, Toshihisa

2002-12-01

Core-binding factor beta (CBFbeta, also called polyomavirus enhancer binding protein 2beta (PEBP2B)) is associated with an inversion of chromosome 16 and is associated with acute myeloid leukemia in humans. CBFbeta forms a heterodimer with RUNX1 (runt-related transcription factor 1), which has a DNA binding domain homologous to the pair-rule protein runt in Drosophila melanogaster. Both RUNX1 and CBFbeta are essential for hematopoiesis. Haploinsufficiency of another runt-related protein, RUNX2 (also called CBFA1), causes cleidocranial dysplasia in humans and is essential in skeletal development by regulating osteoblast differentiation and chondrocyte maturation. Mice deficient in Cbfb (Cbfb(-/-)) die at midgestation, so the function of Cbfbeta in skeletal development has yet to be ascertained. To investigate this issue, we rescued hematopoiesis of Cbfb(-/-) mice by introducing Cbfb using the Gata1 promoter. The rescued Cbfb(-/-) mice recapitulated fetal liver hematopoiesis in erythroid and megakaryocytic lineages and survived until birth, but showed severely delayed bone formation. Although mesenchymal cells differentiated into immature osteoblasts, intramembranous bones were poorly formed. The maturation of chondrocytes into hypertrophic cells was markedly delayed, and no endochondral bones were formed. Electrophoretic mobility shift assays and reporter assays showed that Cbfbeta was necessary for the efficient DNA binding of Runx2 and for Runx2-dependent transcriptional activation. These findings indicate that Cbfbeta is required for the function of Runx2 in skeletal development.

Identification of an inducible regulator of c-myb expression during T-cell activation.

PubMed Central

Phan, S C; Feeley, B; Withers, D; Boxer, L M

1996-01-01

Resting T cells express very low levels of c-Myb protein. During T-cell activation, c-myb expression is induced and much of the increase in expression occurs at the transcriptional level. We identified a region of the c-myb 5' flanking sequence that increased c-myb expression during T-cell activation. In vivo footprinting by ligation-mediated PCR was performed to correlate in vivo protein binding with functional activity. A protein footprint was visible over this region of the c-myb 5' flanking sequence in activated T cells but not in unactivated T cells. An electrophoretic mobility shift assay (EMSA) with nuclear extract from activated T cells and an oligonucleotide of this binding site demonstrated a new protein-DNA complex, referred to as CMAT for c-myb in activated T cells; this complex was not present in unactivated T cells. Because the binding site showed some sequence similarity with the nuclear factor of activated T cells (NFAT) binding site, we compared the kinetics of induction of the two binding complexes and the molecular masses of the two proteins. Studies of the kinetics of induction showed that the NFAT EMSA binding complex appeared earlier than the CMAT complex. The NFAT protein migrated more slowly in a sodium dodecyl sulfate-polyacrylamide gel than the CMAT protein did. In addition, an antibody against NFAT did not cross-react with the CMAT protein. The appearance of the CMAT binding complex was inhibited by both cyclosporin A and rapamycin. The CMAT protein appears to be a novel inducible protein involved in the regulation of c-myb expression during T-cell activation. PMID:8628306

Inadequate Reference Datasets Biased toward Short Non-epitopes Confound B-cell Epitope Prediction*

PubMed Central

Rahman, Kh. Shamsur; Chowdhury, Erfan Ullah; Sachse, Konrad; Kaltenboeck, Bernhard

2016-01-01

X-ray crystallography has shown that an antibody paratope typically binds 15–22 amino acids (aa) of an epitope, of which 2–5 randomly distributed amino acids contribute most of the binding energy. In contrast, researchers typically choose for B-cell epitope mapping short peptide antigens in antibody binding assays. Furthermore, short 6–11-aa epitopes, and in particular non-epitopes, are over-represented in published B-cell epitope datasets that are commonly used for development of B-cell epitope prediction approaches from protein antigen sequences. We hypothesized that such suboptimal length peptides result in weak antibody binding and cause false-negative results. We tested the influence of peptide antigen length on antibody binding by analyzing data on more than 900 peptides used for B-cell epitope mapping of immunodominant proteins of Chlamydia spp. We demonstrate that short 7–12-aa peptides of B-cell epitopes bind antibodies poorly; thus, epitope mapping with short peptide antigens falsely classifies many B-cell epitopes as non-epitopes. We also show in published datasets of confirmed epitopes and non-epitopes a direct correlation between length of peptide antigens and antibody binding. Elimination of short, ≤11-aa epitope/non-epitope sequences improved datasets for evaluation of in silico B-cell epitope prediction. Achieving up to 86% accuracy, protein disorder tendency is the best indicator of B-cell epitope regions for chlamydial and published datasets. For B-cell epitope prediction, the most effective approach is plotting disorder of protein sequences with the IUPred-L scale, followed by antibody reactivity testing of 16–30-aa peptides from peak regions. This strategy overcomes the well known inaccuracy of in silico B-cell epitope prediction from primary protein sequences. PMID:27189949

STAT3-activated CD36 facilitates fatty acid uptake in chronic lymphocytic leukemia cells

PubMed Central

Rozovski, Uri; Harris, David M.; Li, Ping; Liu, Zhiming; Jain, Preetesh; Ferrajoli, Alessandra; Burger, Jan; Thompson, Phillip; Jain, Nitin; Wierda, William; Keating, Michael J.; Estrov, Zeev

2018-01-01

Although several studies established that unlike normal B cells chronic lymphocytic leukemia (CLL) cells metabolize fatty acids (FA), how CLL cells internalize FA is poorly understood. Because in various cell types CD36 facilitates FA uptake, we wondered whether a similar mechanism is operative CLL. We found that CD36 levels are higher in CLL cells than in normal B cells, and that small interfering RNA, CD36 neutralizing antibodies or sulfosuccinimidyl oleate (SSO) that inhibits CD36 significantly reduced the oxygen consumption of CLL cells incubated with FA. Because CD36 is oeverexpressed and STAT3 is constitutively activated in CLL cells, we wondered whether STAT3 induces CD36 expression. Sequence analysis identified putative STAT3 binding sites in the CD36 gene promoter. Chromatin immunoprecipitation and an electrophoretic mobility shift assay revealed that STAT3 binds to the CD36 gene promoter. A luciferase assay and STAT3-small hairpin RNA, that significantly decreased the levels of CD36 in CLL cells, established that STAT3 activates the transcription of the CD36 gene. Furthermore, SSO induced a dose-dependent apoptosis of CLL cells. Taken together, our data suggest that STAT3 activates CD36 and that CD36 facilitates FA uptake in CLL cells. Whether CD36 inhibition would provide clinical benefits in CLL remains to be determined. PMID:29765537

Functional assignment of solute-binding proteins of ABC transporters using a fluorescence-based thermal shift assay.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giulliani, S. E.; Frank, A. E.; Collart, F. R.

2008-12-08

We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less

An in vivo imaging-based assay for detecting protein interactions over a wide range of binding affinities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fowlkes, Jason Davidson; Owens, Elizabeth T; Standaert, Robert F

2009-01-01

Identifying and characterizing protein interactions are fundamental steps towards understanding and modeling biological networks. Methods that detect protein interactions in intact cells rather than buffered solutions are likely more relevant to natural systems since molecular crowding events in the cytosol can influence the diffusion and reactivity of individual proteins. One in vivo, imaging-based method relies on the co-localization of two proteins of interest fused to DivIVA, a cell division protein from Bacillus subtilis, and green fluorescent protein (GFP). We have modified this imaging-based assay to facilitate rapid cloning by constructing new vectors encoding N- and C-terminal DivIVA or GFP molecularmore » tag fusions based on site-specific recombination technology. The sensitivity of the assay was defined using a well-characterized protein interaction system involving the eukaryotic nuclear import receptor subunit, Importin (Imp ) and variant nuclear localization signals (NLS) representing a range of binding affinities. These data demonstrate that the modified co-localization assay is sensitive enough to detect protein interactions with Kd values that span over four orders of magnitude (1nM to 15 M). Lastly, this assay was used to confirm numerous protein interactions identified from mass spectrometry-based analyses of affinity isolates as part of an interactome mapping project in Rhodopseudomonas palustris« less

Simultaneous Multiple MS Binding Assays Addressing D1 and D2 Dopamine Receptors.

PubMed

Schuller, Marion; Höfner, Georg; Wanner, Klaus T

2017-10-09

MS Binding Assays are a label-free alternative to radioligand binding assays. They provide basically the same capabilities as the latter, but use a non-labeled reporter ligand instead of a radioligand. In contrast to radioligand binding assays, MS Binding Assays offer-owing to the selectivity of mass spectrometric detection-the opportunity to monitor the binding of different reporter ligands at different targets simultaneously. The present study shows a proof of concept for this strategy as exemplified for MS Binding Assays selectively addressing D 1 and D 2 dopamine receptors in a single binding experiment. A highly sensitive, rapid and robust LC-ESI-MS/MS quantification method capable of quantifying both SCH23390 and raclopride, selectively addressing D 1 and D 2 receptors, respectively, was established and validated for this purpose. Based thereon, simultaneous saturation and competition experiments with SCH23390 and raclopride in the presence of both D 1 and D 2 receptors were performed and analyzed by LC-MS/MS within a single chromatographic cycle. The present study thus demonstrates the feasibility of this strategy and the high versatility of MS Binding Assays that appears to surpass that common for conventional radioligand binding assays. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comparison of functional assays used in the clinical development of a placental malaria vaccine.

PubMed

Pehrson, Caroline; Heno, Kristine K; Adams, Yvonne; Resende, Mafalda; Mathiesen, Line; Soegaard, Max; de Jongh, Willem A; Theander, Thor G; Salanti, Ali; Nielsen, Morten A

2017-01-23

Malaria in pregnancy is associated with significant morbidity in pregnant women and their offspring. Plasmodium falciparum infected erythrocytes (IE) express VAR2CSA that mediates binding to chondroitin sulphate A (CSA) in the placenta. Two VAR2CSA-based vaccines for placental malaria are in clinical development. The purpose of this study was to evaluate the robustness and comparability of binding inhibition assays used in the clinical development of placental malaria vaccines. The ability of sera from animals immunised with different VAR2CSA constructs to inhibit IE binding to CSA was investigated in three in vitro assays using 96-well plates, petri dishes, capillary flow and an ex vivo placental perfusion assay. The inter-assay variation was not uniform between assays and ranged from above ten-fold in the flow assay to two-fold in the perfusion assay. The intra-assay variation was highest in the petri dish assay. A positive correlation between IE binding avidity and the level of binding after antibody inhibition in the petri dish assay indicate that high avidity IE binding is more difficult to inhibit. The highest binding inhibition sensitivity was found in the 96-well and petri dish assays compared to the flow and perfusion assays where binding inhibition required higher antibody titers. The inhibitory capacity of antibodies is not easily translated between assays and the high sensitivity of the 96-well and petri dish assays stresses the need for comparing serial dilutions of serum. Furthermore, IE binding avidity must be in the same range when comparing data from different days. There was an overall concordance in the capacity of antibody-mediated inhibition, when comparing the in vitro assays with the perfusion assay, which more closely represents in vivo conditions. Importantly the ID1-ID2a protein in a liposomal formulation, currently in a phase I trial, effectively induced antibodies that inhibited IE adhesion in placental tissue. Copyright © 2016. Published by Elsevier Ltd.

[Ala12]MCD peptide: a lead peptide to inhibitors of immunoglobulin E binding to mast cell receptors.

PubMed

Buku, A; Condie, B A; Price, J A; Mezei, M

2005-09-01

An effort was made to discover mast cell degranulating (MCD) peptide analogs that bind with high affinity to mast cell receptors without triggering secretion of histamine or other mediators of the allergic reaction initiated by immunoglobulin E (IgE) after mast cell activation. Such compounds could serve as inhibitors of IgE binding to mast cell receptors. An alanine scan of MCD peptide reported previously showed that the analog [Ala12]MCD was 120-fold less potent in histamine-releasing activity and fivefold more potent in binding affinity to mast cell receptors than the parent MCD peptide. Because this analog showed marginal intrinsic activity and good binding affinity it was subsequently tested in the present study as an IgE inhibitor. In contrast to MCD peptide, [Ala12]MCD showed a 50% inhibition of IgE binding to the Fc epsilon RI alpha mast cell receptor by using rat basophilic leukemia (RBL-2H3) mast cells and fluorescence polarization. Furthermore, in a beta-hexosaminidase secretory assay, the peptide also showed a 50% inhibition of the secretion of this enzyme caused by IgE. An attempt was made to relate structural changes and biologic differences between the [Ala12]MCD analog and the parent MCD peptide. The present results show that [Ala12]MCD may provide a base for designing agents to prevent IgE/Fc epsilon RI alpha interactions and, consequently, allergic conditions.

24-Methylenecycloartanyl ferulate, a major compound of γ-oryzanol, promotes parvin-beta expression through an interaction with peroxisome proliferator-activated receptor-gamma 2 in human breast cancer cells.

PubMed

Kim, Heon Woong; Lim, Eun Joung; Jang, Hwan Hee; Cui, XueLei; Kang, Da Rae; Lee, Sung Hyen; Kim, Haeng Ran; Choe, Jeong Sook; Yang, Young Mok; Kim, Jung Bong; Park, Jong Hwan

2015-12-25

Parvin-β is an adaptor protein that binds to integrin-linked kinase (ILK) and is significantly downregulated in breast tumors and breast cancer cell lines. We treated the breast cancer cell line MCF7 with 24-methylenecycloartanyl ferulate (24-MCF), a γ-oryzanol compound. We observed upregulation of parvin-β (GenBank Accession No. AF237769) and peroxisome proliferator-activated receptor (PPAR)-γ2 (GenBank Accession No. NM_015869). Among γ-oryzanol compounds, only treatment with 24-MCF led to the formation of reverse transcription-PCR products of parvin-β (650 and 500 bp) and PPAR-γ2 (580 bp) in MCF7 cells, but not in T47D, SK-BR-3, or MDA-MB-231 cells. 24-MCF treatment increased the mRNA and protein levels of parvin-β in MCF7 cells in a dose-dependent manner. We hypothesized that there is a correlation between parvin-β expression and induction of PPAR-γ2. This hypothesis was investigated by using a promoter-reporter assay, chromatin immunoprecipitation, and an electrophoretic mobility shift assay. 24-MCF treatment induced binding of PPAR-γ2 to a peroxisome proliferator response element-like cis-element (ACTAGGACAAAGGACA) in the parvin-β promoter in MCF7 cells in a dose-dependent manner. 24-MCF treatment significantly decreased anchorage-independent growth and inhibited cell movement in comparison to control treatment with dimethyl sulfoxide. 24-MCF treatment reduced the levels of GTP-bound Rac1 and Cdc42. Evaluation of Akt1 inhibition by 24-MCF revealed that the half maximal effective concentration was 33.3 μM. Docking evaluations revealed that 24-MCF binds to the ATP-binding site of Akt1(PDB ID: 3OCB) and the compound binding energy is -8.870 kcal/mol. Taken together, our results indicate that 24-MCF treatment increases parvin-β expression, which may inhibit ILK downstream signaling. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

MET-activating Residues in the B-repeat of the Listeria monocytogenes Invasion Protein InlB*

PubMed Central

Bleymüller, Willem M.; Lämmermann, Nina; Ebbes, Maria; Maynard, Daniel; Geerds, Christina; Niemann, Hartmut H.

2016-01-01

The facultative intracellular pathogen Listeria monocytogenes causes listeriosis, a rare but life-threatening disease. Host cell entry begins with activation of the human receptor tyrosine kinase MET through the bacterial invasion protein InlB, which contains an internalin domain, a B-repeat, and three GW domains. The internalin domain is known to bind MET, but no interaction partner is known for the B-repeat. Adding the B-repeat to the internalin domain potentiates MET activation and is required to stimulate Madin-Darby canine kidney (MDCK) cell scatter. Therefore, it has been hypothesized that the B-repeat may bind a co-receptor on host cells. To test this hypothesis, we mutated residues that might be important for binding an interaction partner. We identified two adjacent residues in strand β2 of the β-grasp fold whose mutation abrogated induction of MDCK cell scatter. Biophysical analysis indicated that these mutations do not alter protein structure. We then tested these mutants in human HT-29 cells that, in contrast to the MDCK cells, were responsive to the internalin domain alone. These assays revealed a dominant negative effect, reducing the activity of a construct of the internalin domain and mutated B-repeat below that of the individual internalin domain. Phosphorylation assays of MET and its downstream targets AKT and ERK confirmed the dominant negative effect. Attempts to identify a host cell receptor for the B-repeat were not successful. We conclude that there is limited support for a co-receptor hypothesis and instead suggest that the B-repeat contributes to MET activation through low affinity homodimerization. PMID:27789707

Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

PubMed

Seal, S N; Davis, D L; Burch, J B

1991-05-01

The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

Glucose-dependent downregulation of glucagon gene expression mediated by selective interactions between ALX3 and PAX6 in mouse alpha cells.

PubMed

Mirasierra, Mercedes; Vallejo, Mario

2016-04-01

The stimulation of glucagon secretion in response to decreased glucose levels has been studied extensively. In contrast, little is known about the regulation of glucagon gene expression in response to fluctuations in glucose concentration. Paired box 6 (PAX6) is a key transcription factor that regulates the glucagon promoter by binding to the G1 and G3 elements. Here, we investigated the role of the transcription factor aristaless-like homeobox 3 (ALX3) as a glucose-dependent modulator of PAX6 activity in alpha cells. Experiments were performed in wild-type or Alx3-deficient islets and alphaTC1 cells. We used chromatin immunoprecipitations and electrophoretic mobility shift assays for DNA binding, immunoprecipitations and pull-down assays for protein interactions, transfected cells for promoter activity, and small interfering RNA and quantitative RT-PCR for gene expression. Elevated glucose concentration resulted in stimulated expression of Alx3 and decreased glucagon gene expression in wild-type islets. In ALX3-deficient islets, basal glucagon levels were non-responsive to changes in glucose concentration. In basal conditions ALX3 bound to the glucagon promoter at G3, but not at G1. ALX3 could form heterodimers with PAX6 that were permissive for binding to G3 but not to G1. Thus, increasing the levels of ALX3 in response to glucose resulted in the sequestration of PAX6 by ALX3 for binding to G1, thus reducing glucagon promoter activation and glucagon gene expression. Glucose-stimulated expression of ALX3 in alpha cells provides a regulatory mechanism for the downregulation of glucagon gene expression by interfering with PAX6-mediated transactivation on the glucagon G1 promoter element.

C/EBPβ Promotes STAT3 Expression and Affects Cell Apoptosis and Proliferation in Porcine Ovarian Granulosa Cells.

PubMed

Yuan, Xiaolong; Zhou, Xiaofeng; He, Yingting; Zhong, Yuyi; Zhang, Ailing; Zhang, Zhe; Zhang, Hao; Li, Jiaqi

2018-06-13

Previous studies suggest that signal transducer and activator of transcription 3 (STAT3) and CCAAT/enhancer binding protein beta (C/EBPβ) play an essential role in ovarian granulosa cells (GCs) for mammalian follicular development. Several C/EBPβ putative binding sites were previously predicted on the STAT3 promoter in mammals. However, the molecular regulation of C/EBPβ on STAT3 and their effects on cell proliferation and apoptosis remain virtually unexplored in GCs. Using porcine GCs as a model, the 5′-deletion, luciferase report assay, mutation, chromatin immunoprecipitation, Annexin-V/PI staining and EdU assays were applied to investigate the molecular mechanism for C/EBPβ regulating the expression of STAT3 and their effects on the cell proliferation and apoptosis ability. We found that over and interfering with the expression of C/EBPβ significantly increased and decreased the messenger RNA (mRNA) and protein levels of STAT3 , respectively. The dual luciferase reporter assay showed that C/EBPβ directly bound at −1397/−1387 of STAT3 to positively regulate the mRNA and protein expressions of STAT3 . Both C/EBPβ and STAT3 were observed to inhibit cell apoptosis and promote cell proliferation. Furthermore, C/EBPβ might enhance the antiapoptotic and pro-proliferative effects of STAT3 . These results would be of great insight in further exploring the molecular mechanism of C/EBPβ and STAT3 on the function of GCs and the development of ovarian follicles in mammals.

High-Throughput Screens To Identify Autophagy Inducers That Function by Disrupting Beclin 1/Bcl-2 Binding.

PubMed

Chiang, Wei-Chung; Wei, Yongjie; Kuo, Yi-Chun; Wei, Shuguang; Zhou, Anwu; Zou, Zhongju; Yehl, Jenna; Ranaghan, Matthew J; Skepner, Adam; Bittker, Joshua A; Perez, Jose R; Posner, Bruce A; Levine, Beth

2018-06-21

Autophagy, a lysosomal degradation pathway, plays a crucial role in cellular homeostasis, development, immunity, tumor suppression, metabolism, prevention of neurodegeneration, and lifespan extension. Thus, pharmacological stimulation of autophagy may be an effective approach for preventing or treating certain human diseases and/or aging. We sought to establish a method for developing new chemical compounds that specifically induce autophagy. To do this, we developed two assays to identify compounds that target a key regulatory node of autophagy induction-specifically, the binding of Bcl-2 (a negative regulator of autophagy) to Beclin 1 (an allosteric modulator of the Beclin 1/VPS34 lipid kinase complex that functions in autophagy initiation). These assays use either a split-luciferase assay to measure Beclin 1/Bcl-2 binding in cells or an AlphaLISA assay to directly measure direct Beclin 1/Bcl-2 binding in vitro. We screened two different chemical compound libraries, comprising ∼300 K compounds, to identify small molecules that disrupt Beclin 1/Bcl-2 binding and induce autophagy. Three novel compounds were identified that directly inhibit Beclin 1/Bcl-2 interaction with an IC 50 in the micromolar range and increase autophagic flux. These compounds do not demonstrate significant cytotoxicity, and they exert selectivity for disruption of Bcl-2 binding to the BH3 domain of Beclin 1 compared with the BH3 domain of the pro-apoptotic Bcl-2 family members, Bax and Bim. Thus, we have identified candidate molecules that serve as lead templates for developing potent and selective Beclin 1/Bcl-2 inhibitors that may be clinically useful as autophagy-inducing agents.

Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

PubMed

Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

1997-03-14

Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

Immunogenicity and safety of different injection routes and schedules of IC41, a Hepatitis C virus (HCV) peptide vaccine.

PubMed

Firbas, Christa; Boehm, Thomas; Buerger, Vera; Schuller, Elisabeth; Sabarth, Nicolas; Jilma, Bernd; Klade, Christoph S

2010-03-11

An effective vaccine would be a significant progress in the management of chronic HCV infections. This study was designed to examine whether different application schedules and injection routes may enhance the immunogenicity of the HCV peptide vaccine IC41. In this randomized trial 54 healthy subjects received either subcutaneous (s.c.) or intradermal (i.d.) vaccinations weekly (16 injections) or every other week (8 injections). One group additionally received imiquimod, an activator of the toll-like receptor (TLR) 7. The T cell epitope-specific immune response to IC41 was assessed using [(3)H]-thymidine CD4+ T cell proliferation, interferon-gamma (IFN-gamma) CD8+ and CD4+ ELIspot and HLA-A*0201 fluorescence-activated cell sorting (FACS) tetramer-binding assays. More than 60% of vaccinees responded in the CD4+ T cell proliferation assay in all groups. An HLA-A*0201 FACS tetramer-binding assay and IFN-gamma CD8+ ELIspot class I response of more than 70% was induced in four and three groups, respectively. IC41 induced significant immunological responses in all groups with responder rates of up to 100%. Interestingly, topical imiquimod was not able to enhance immunogenicity but was associated with a lower immune response. Local injection site reactions were mostly transient. Intradermal injections caused more pronounced reactions compared to s.c., especially erythema and edema. Compared to a previous study intensified dosing and/or i.d. injections enhanced the response rates to the vaccine IC41 in three assays measuring T cell function. Immunization with IC41 was generally safe in this study. These results justify testing IC41 in further clinical trials with HCV-infected individuals.

Molecular galactose-galectin association in neuroblastoma cells: An unconventional tool for qualitative/quantitative screening.

PubMed

Pastorino, Fabio; Ponzoni, Mirco; Simone, Giuseppina

2017-05-01

Galectin decorates the cell membrane and forms an extracellular molecular association with galactoside units. Here, galactoside probes have been used to study galectin expression in neuroblastoma cells. The hypothesis behind this investigation has been that the molecular mechanisms by which glycans modulate neural metastatic cells involve a protein-carbohydrate association, galectin-galactose. Preliminary screening to validate the hypothesis has been performed with galactose moieties anchored to beads. The molecular association has been studied by FACS. In vitro experiments reveal the molecular binding preferences of the metastatic neuroblastoma cells. Ex vivo, the galactose probes discriminate healthy tissues. The unconventional assay in microfluidics used in this study displayed results analogous to the above (GI-LI-N cell capture efficiency overcomes IMR-32). At the point of equilibrium of shear and binding forces, the capture yield inside the chamber was measured to 60 ± 4.4% in GI-LI-N versus 40 ± 2.1% in IMR-32. Staining of the fished cells and subsequent conjugation with red beads bearing the galactose also have evidenced that microfluidics can be used to study and quantify the molecular association of galectin-galactose. Most importantly, a crucial insight for obtaining single-cell qualitative/quantitative glycome analysis has been achieved. Finally, the specificity of the assay performed in microfluidics is demonstrated by comparing GI-LI-N fishing efficiency in galactose and fucose environments. The residual adhesion to fucose confirmed the existence of receptors for this glycan and that its eventual unspecific binding (i.e. due to electrostatic interactions) is insignificant compared with the molecular binding. Identification and understanding of this mechanism of discrimination can be relevant for diagnostic monitoring and for producing probes tailored to interfere with galectin activities associated with the malignant phenotype. Besides, the given strategy has implications for the rational design of galectin-specific ligands. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Expression of endogenous retroviruses is negatively regulated by the pluripotency marker Rex1/Zfp42

PubMed Central

Guallar, D.; Pérez-Palacios, R.; Climent, M.; Martínez-Abadía, I.; Larraga, A.; Fernández-Juan, M.; Vallejo, C.; Muniesa, P.; Schoorlemmer, J.

2012-01-01

Rex1/Zfp42 is a Yy1-related zinc-finger protein whose expression is frequently used to identify pluripotent stem cells. We show that depletion of Rex1 levels notably affected self-renewal of mouse embryonic stem (ES) cells in clonal assays, in the absence of evident differences in expression of marker genes for pluripotency or differentiation. By contrast, marked differences in expression of several endogenous retroviral elements (ERVs) were evident upon Rex1 depletion. We demonstrate association of REX1 to specific elements in chromatin-immunoprecipitation assays, most strongly to muERV-L and to a lower extent to IAP and musD elements. Rex1 regulates muERV-L expression in vivo, as we show altered levels upon transient gain-and-loss of Rex1 function in pre-implantation embryos. We also find REX1 can associate with the lysine-demethylase LSD1/KDM1A, suggesting they act in concert. Similar to REX1 binding to retrotransposable elements (REs) in ES cells, we also detected binding of the REX1 related proteins YY1 and YY2 to REs, although the binding preferences of the two proteins were slightly different. Altogether, we show that Rex1 regulates ERV expression in mouse ES cells and during pre-implantation development and suggest that Rex1 and its relatives have evolved as regulators of endogenous retroviral transcription. PMID:22844087

Live-cell monitoring of periodic gene expression in synchronous human cells identifies Forkhead genes involved in cell cycle control

PubMed Central

Grant, Gavin D.; Gamsby, Joshua; Martyanov, Viktor; Brooks, Lionel; George, Lacy K.; Mahoney, J. Matthew; Loros, Jennifer J.; Dunlap, Jay C.; Whitfield, Michael L.

2012-01-01

We developed a system to monitor periodic luciferase activity from cell cycle–regulated promoters in synchronous cells. Reporters were driven by a minimal human E2F1 promoter with peak expression in G1/S or a basal promoter with six Forkhead DNA-binding sites with peak expression at G2/M. After cell cycle synchronization, luciferase activity was measured in live cells at 10-min intervals across three to four synchronous cell cycles, allowing unprecedented resolution of cell cycle–regulated gene expression. We used this assay to screen Forkhead transcription factors for control of periodic gene expression. We confirmed a role for FOXM1 and identified two novel cell cycle regulators, FOXJ3 and FOXK1. Knockdown of FOXJ3 and FOXK1 eliminated cell cycle–dependent oscillations and resulted in decreased cell proliferation rates. Analysis of genes regulated by FOXJ3 and FOXK1 showed that FOXJ3 may regulate a network of zinc finger proteins and that FOXK1 binds to the promoter and regulates DHFR, TYMS, GSDMD, and the E2F binding partner TFDP1. Chromatin immunoprecipitation followed by high-throughput sequencing analysis identified 4329 genomic loci bound by FOXK1, 83% of which contained a FOXK1-binding motif. We verified that a subset of these loci are activated by wild-type FOXK1 but not by a FOXK1 (H355A) DNA-binding mutant. PMID:22740631

pH and reduction dual-responsive dipeptide cationic lipids with α-tocopherol hydrophobic tail for efficient gene delivery.

PubMed

Liu, Qiang; Su, Rong-Chuan; Yi, Wen-Jing; Zheng, Li-Ting; Lu, Shan-Shan; Zhao, Zhi-Gang

2017-03-31

A series of tocopherol-based cationic lipid 3a-3f bearing a pH-sensitive imidazole moiety in the dipeptide headgroup and a reduction-responsive disulfide linkage were designed and synthesized. Acid-base titration of these lipids showed good buffering capacities. The liposomes formed from 3 and co-lipid 1, 2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) could efficiently bind and condense DNA into nanoparticles. Gel binding and HPLC assays confirmed the encapsulated DNA could release from lipoplexes 3 upon addition of 10 mM glutathione (GSH). MTT assays in HEK 293 cells demonstrated that lipoplexes 3 had low cytotoxicity. The in vitro gene transfection studies showed cationic dipeptide headgroups clearly affected the transfection efficiency (TE), and arginine-histidine based dipeptide lipid 3f give the best TE, which was 30.4 times higher than Lipofectamine 3000 in the presence of 10% serum. Cell-uptake assays indicated that basic amino acid containing dipeptide cationic lipids exhibited more efficient cell uptake than serine and aromatic amino acids based dipeptide lipids. Confocal laser scanning microscopy (CLSM) studies corroborated that 3 could efficiently deliver and release DNA into the nuclei of HeLa cells. These results suggest that tocopherol-based dipeptide cationic lipids with pH and reduction dual-sensitive characteristics might be promising non-viral gene delivery vectors. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Design, discovery, modelling, synthesis, and biological evaluation of novel and small, low toxicity s-triazine derivatives as HIV-1 non-nucleoside reverse transcriptase inhibitors.

PubMed

Viira, Birgit; Selyutina, Anastasia; García-Sosa, Alfonso T; Karonen, Maarit; Sinkkonen, Jari; Merits, Andres; Maran, Uko

2016-06-01

A set of top-ranked compounds from a multi-objective in silico screen was experimentally tested for toxicity and the ability to inhibit the activity of HIV-1 reverse transcriptase (RT) in cell-free assay and in cell-based assay using HIV-1 based virus-like particles. Detailed analysis of a commercial sample that indicated specific inhibition of HIV-1 reverse transcription revealed that a minor component that was structurally similar to that of the main compound was responsible for the strongest inhibition. As a result, novel s-triazine derivatives were proposed, modelled, discovered, and synthesised, and their antiviral activity and cellular toxicity were tested. Compounds 18a and 18b were found to be efficient HIV-1 RT inhibitors, with an IC50 of 5.6±1.1μM and 0.16±0.05μM in a cell-based assay using infectious HIV-1, respectively. Compound 18b also had no detectable toxicity for different human cell lines. Their binding mode and interactions with the RT suggest that there was strong and adaptable binding in a tight (NNRTI) hydrophobic pocket. In summary, this iterative study produced structural clues and led to a group of non-toxic, novel compounds to inhibit HIV-RT with up to nanomolar potency. Copyright © 2016 Elsevier Ltd. All rights reserved.

The long non-coding RNA MALAT1 promotes the migration and invasion of hepatocellular carcinoma by sponging miR-204 and releasing SIRT1.

PubMed

Hou, Zhouhua; Xu, Xuwen; Zhou, Ledu; Fu, Xiaoyu; Tao, Shuhui; Zhou, Jiebin; Tan, Deming; Liu, Shuiping

2017-07-01

Increasing evidence supports the significance of long non-coding RNA in cancer development. Several recent studies suggest the oncogenic activity of long non-coding RNA metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) in hepatocellular carcinoma. In this study, we explored the molecular mechanisms by which MALAT1 modulates hepatocellular carcinoma biological behaviors. We found that microRNA-204 was significantly downregulated in sh-MALAT1 HepG2 cell and 15 hepatocellular carcinoma tissues by quantitative real-time polymerase chain reaction analysis. Through bioinformatic screening, luciferase reporter assay, RNA-binding protein immunoprecipitation, and RNA pull-down assay, we identified microRNA-204 as a potential interacting partner for MALAT1. Functionally, wound-healing and transwell assays revealed that microRNA-204 significantly inhibited the migration and invasion of hepatocellular carcinoma cells. Notably, sirtuin 1 was recognized as a direct downstream target of microRNA-204 in HepG2 cells. Moreover, si-SIRT1 significantly inhibited cell invasion and migration process. These data elucidated, by sponging and competitive binding to microRNA-204, MALAT1 releases the suppression on sirtuin 1, which in turn promotes hepatocellular carcinoma migration and invasion. This study reveals a novel mechanism by which MALAT1 stimulates hepatocellular carcinoma progression and justifies targeting metastasis-associated lung adenocarcinoma transcript 1 as a potential therapy for hepatocellular carcinoma.

Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer

PubMed Central

2014-01-01

Background Protein coding genes account for only about 2% of the human genome, whereas the vast majority of transcripts are non-coding RNAs including long non-coding RNAs. A growing volume of literature has proposed that lncRNAs are important players in cancer. HOTAIR was previously shown to be an oncogene and negative prognostic factor in a variety of cancers. However, the factors that contribute to its upregulation and the interaction between HOTAIR and miRNAs are largely unknown. Methods A computational screen of HOTAIR promoter was conducted to search for transcription-factor-binding sites. HOTAIR promoter activities were examined by luciferase reporter assay. The function of the c-Myc binding site in the HOTAIR promoter region was tested by a promoter assay with nucleotide substitutions in the putative E-box. The association of c-Myc with the HOTAIR promoter in vivo was confirmed by chromatin immunoprecipitation assay and Electrophoretic mobility shift assay. A search for miRNAs with complementary base paring with HOTAIR was performed utilizing online software program. Gain and loss of function approaches were employed to investigate the expression changes of HOTAIR or miRNA-130a. The expression levels of HOTAIR, c-Myc and miRNA-130a were examined in 65 matched pairs of gallbladder cancer tissues. The effects of HOTAIR and miRNA-130a on gallbladder cancer cell invasion and proliferation was tested using in vitro cell invasion and flow cytometric assays. Results We demonstrate that HOTAIR is a direct target of c-Myc through interaction with putative c-Myc target response element (RE) in the upstream region of HOTAIR in gallbladder cancer cells. A positive correlation between c-Myc and HOTAIR mRNA levels was observed in gallbladder cancer tissues. We predicted that HOTAIR harbors a miRNA-130a binding site. Our data showed that this binding site is vital for the regulation of miRNA-130a by HOTAIR. Moreover, a negative correlation between HOTAIR and miRNA-130a was observed in gallbladder cancer tissues. Finally, we demonstrate that the oncogenic activity of HOTAIR is in part through its negative regulation of miRNA-130a. Conclusion Together, these results suggest that HOTAIR is a c-Myc-activated driver of malignancy, which acts in part through repression of miRNA-130a. PMID:24953832

Inhibition of melanoma cell motility by the snake venom disintegrin eristostatin

PubMed Central

Tian, Jing; Paquette-Straub, Carrie; Sage, E. Helene; Funk, Sarah E.; Patel, Vivek; Galileo, Deni; McLane, Mary Ann

2007-01-01

Eristostatin, an RGD-containing disintegrin isolated from the venom of Eristicophis macmahoni, inhibits lung or liver colonization of melanoma cells in a mouse model. In this study, transwell migration and in vitro wound closure assays were used to determine the effect of eristostatin on the migration of melanoma cells. Eristostatin significantly impaired the migration of 5 human melanoma cell lines. Furthermore, it specifically inhibited cell migration on fibronectin in a concentration-dependent manner, but not that on collagen IV or laminin. In contrast, eristostatin was found to have no effect on cell proliferation or angiogenesis. These results indicate that the interaction between eristostatin and melanoma cells may involve fibronectin-binding integrins that mediate cell migration. Mutations to alanine of seven residues within the RGD loop of eristostatin and four residues outside the RGD loop of eristostatin resulted in significantly less potency in both platelet aggregation and wound closure assays. For six of the mutations, however, decreased activity was found only in the latter assay. We conclude that a different mechanism and/or integrin is involved in these two cell activities. PMID:17316731

Screening and characterization of a Annenix A2 binding aptamer that inhibits the proliferation of myeloma cells.

PubMed

Zhou, Weihua; Zhang, Yibin; Zeng, Yayue; Peng, Minyuan; Li, Hui; Sun, Shuming; Ma, Bianying; Wang, Yanpeng; Ye, Mao; Liu, Jing

2018-06-12

Multiple myeloma (MM) is a malignant plasma cell disease and is considered incurable. Annexin A2 (ANXA2) is closely related to the proliferation and adhesion of MM. Using protein-SELEX, we performed a screen for aptamers that bind GST-ANXA2 from a library, and GST protein was used for negative selection. The enrichment of the ssDNA pool was monitored by filter-binding assay during selection. After nine rounds of screening and high-throughput sequencing, we obtained six candidate aptamers that bind to the ANXA2 protein. The affinities of the candidate aptamers for ANXA2 were determined by ELONA. Binding of aptamer wh6 to the ANXA2 protein and to the MM cell was verified by aptamer pulldown experiment and flow cytometry, respectively. Aptamer wh6 binds the ANXA2 protein with good stability and has a dissociation constant in the nanomolar range. The binding specificity of aptamer wh6 was confirmed in vivo in nude mouse xenografts with MM cells and with MM bone marrow aspirates. Furthermore, aptamer wh6 can block MM cell adhesion to ANXA2 and block the proliferation of MM cells induced by ANXA2. In summary, wh6 can be considered a promising candidate tool for MM diagnosis and treatment. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Synthesis and biological evaluation of pyrimidine bridged combretastatin derivatives as potential anticancer agents and mechanistic studies.

PubMed

Kumar, Bhupinder; Sharma, Praveen; Gupta, Vivek Prakash; Khullar, Madhu; Singh, Sandeep; Dogra, Nilambra; Kumar, Vinod

2018-08-01

A number of pyrimidine bridged combretastatin derivatives were designed, synthesized and evaluated for anticancer activities against breast cancer (MCF-7) and lung cancer (A549) cell lines using MTT assays. Most of the synthesized compounds displayed good anticancer activity with IC 50 values in low micro-molar range. Compounds 4a and 4p were found most potent in the series with IC 50 values of 4.67 µM & 3.38 µM and 4.63 µM & 3.71 µM against MCF7 and A549 cancer cell lines, respectively. Biological evaluation of these compounds showed that selective cancer cell toxicity (in vitro using human lung and breast cancer cell lines) might be due to the inhibition of antioxidant enzymes instigating elevated ROS levels which triggers intrinsic apoptotic pathways. These compounds were found nontoxic to the normal human primary cells. Compound 4a, was found to be competitive inhibitor of colchicine and in the tubulin binding assay it showed tubulin polymerization inhibition potential comparable to colchicine. The molecular modeling studies also showed that the synthesized compounds fit well in the colchicine-binding pocket. Copyright © 2018 Elsevier Inc. All rights reserved.

Studies on Changes of β-Adrenergic Receptors in Polymorphonuclear Cell and Mononuclear Cell with the Changes of Thyroid Function

PubMed Central

Lee, Jong Do; You, Myung Hee; Kim, Young Seol; Kim, Jin Woo; Kim, Kwang Won; Kim, Sun Woo; Choi, Young Kil

1986-01-01

Although it has been well established that thyroid hormones increase β-adrenergic receptors of various tissues in the animal studies, there are controversies about the β-adrenergic receptor changes of human mononuclear cells and polymorphonuclear cells. The present study was performed to analyze the change of β-adrenergic receptor of those cells according to the thyroid functional status and to evaluate their usefulness in assessment of sympathetic hyperactivity. We measured [3H]-dihydroalprenolol binding to circulating mononuclear and polymorphonuclear cells from 18 patients with hyperthyrodism, 7 with hypothyroidism, 8 with euthyroid goiter and 21 normal controls. Only with polymorphonuclear cells the receptor concentration was significantly higher (P<0.01) in hyperthyroidism (46.07±4.78 fmol/mg protein) than in the normal control (28.42±2.06 fmol/mg protein) and the affinity constants of both cells were comparable to normal control values. And serum concentrations of T3 were not correlated well with the changes of receptor concentrations in hyperthyroidism. The patients with hypothyroidism and euthyroid goiter showed no significant difference in the receptor concentration and the affinity constants with both cell binding assays. These results indicate that thyroid hormones increase the receptor concentration in polymorphonuclear cells which might be responsible for the symptoms of sympathetic hyperactivity and the polymorphornuclear cells are useful for β-adrenergic receptor assay. PMID:15759381

Identification of Litopenaeus vannamei BiP as a novel cellular attachment protein for white spot syndrome virus by using a biotinylation based affinity chromatography method.

PubMed

Yuan, Zengzhi; Chen, Meng; Wang, Jingting; Li, Zhuoyu; Geng, Xuyun; Sun, Jinsheng

2018-05-05

White spot syndrome virus (WSSV) is a dangerous threat to shrimp farming that also attacks a wide range of crustaceans. Knowledge of the surface protein-protein interactions between the pathogen and host is very crucial to unraveling the molecular pathogenesis mechanisms of WSSV. In this study, LvBiP (Litopenaeus vannamei immunoglobulin heavy-chain-binding protein) was identified as a novel WSSV binding protein of L. vannamei by a biotinylation based affinity chromatography method. By using pull-down and ELISA assays, the binding of recombinant LvBiP to WSSV was proved to be specific and ATP- dependent. The interaction was also confirmed by the result of co-immunoprecipitation assay. Immunofluorescence studies revealed the co-localization of LvBiP with WSSV on the cell surface of shrimp haemocytes. Additionally, LvBiP is likely to play an important role in WSSV infection. Treatment of gill cellular membrane proteins (CMPs) with purified rLvBiP and antibody that specifically recognizes LvBiP, led to a significant reduction in the binding of WSSV to gill CMPs. In the in vivo neutralization assay, rLvBiP and anti-LvBiP polyclonal antibody partially blocked the infection of WSSV. Taken together, the results indicate that LvBiP, a molecular chaperon of the HSP70 family, is a novel host factor involved at the step of attachment of the WSSV to the host cells and a potential candidate of therapeutic target. Copyright © 2018. Published by Elsevier Ltd.

Mouse pharmacokinetics and metabolism of the curcumin analog, 4-piperidinone,3,5-bis[(2-fluorophenyl)methylene]-acetate(3E,5E) (EF-24; NSC 716993).

PubMed

Reid, Joel M; Buhrow, Sarah A; Gilbert, Judith A; Jia, Lee; Shoji, Mamoru; Snyder, James P; Ames, Matthew M

2014-06-01

Curcumin, a keto-enol constituent of turmeric, has in vitro and in vivo antitumor activity. However, in vivo potency is low due to poor oral absorption. The mono-carbonyl analog, 3,5-bis[(2-fluorophenyl)methylene]-4-piperidinone acetate (EF-24, NSC 716993), exhibited broad-spectrum activity in the NCI anticancer cell line screen and potent antiangiogenesis activity in a HUVEC cell migration assay. The purpose of this study was to characterize the preclinical pharmacology of EF-24 in mice. EF-24 plasma stability, protein binding, pharmacokinetics, and metabolism were characterized utilizing an LC/MS/MS assay. An LC/MS/MS assay incorporated protein precipitation with methanol, reverse-phase HPLC separation under gradient elution using an aqueous methanol mobile phase containing 0.1 % formic acid, and positive electrospray ionization detection of the m/z 312 > 149 transition for EF-24. The assay was linear over the range 7.8-1,000 nM. Plasma protein binding was >98 % with preferential binding to albumin. EF-24 plasma disposition in mice after i.v. administration of a 10 mg/kg dose was best fit to a 3-compartment open model. The terminal elimination half-life and plasma clearance values were 73.6 min and 0.482 L/min/kg, respectively. EF-24 bioavailability was 60 and 35 % after oral and i.p. administration, respectively. NADPH-dependent metabolism of EF-24 loss in liver microsomal preparations yielded several metabolites consistent with EF-24 hydroxylation and reduction.

Integration of cell-free protein coexpression with an enzyme-linked immunosorbent assay enables rapid analysis of protein–protein interactions directly from DNA

PubMed Central

Layton, Curtis J; Hellinga, Homme W

2011-01-01

Assays that integrate detection of binding with cell-free protein expression directly from DNA can dramatically increase the pace at which protein–protein interactions (PPIs) can be analyzed by mutagenesis. In this study, we present a method that combines in vitro protein production with an enzyme-linked immunosorbent assay (ELISA) to measure PPIs. This method uses readily available commodity instrumentation and generic antibody–affinity tag interactions. It is straightforward and rapid to execute, enabling many interactions to be assessed in parallel. In traditional ELISAs, reporter complexes are assembled stepwise with one layer at a time. In the method presented here, all the members of the reporter complex are present and assembled together. The signal strength is dependent on all the intercomponent interaction affinities and concentrations. Although this assay is straightforward to execute, establishing proper conditions and analysis of the results require a thorough understanding of the processes that determine the signal strength. The formation of the fully assembled reporter sandwich can be modeled as a competition between Langmuir adsorption isotherms for the immobilized components and binding equilibria of the solution components. We have shown that modeling this process provides semiquantitative understanding of the effects of affinity and concentration and can guide strategies for the development of experimental protocols. We tested the method experimentally using the interaction between a synthetic ankyrin repeat protein (Off7) and maltose-binding protein. Measurements obtained for a collection of alanine mutations in the interface between these two proteins demonstrate that a range of affinities can be analyzed. PMID:21674663

Mouse pharmacokinetics and metabolism of the curcumin analog, 4-Piperidione,3,5-bis[(2-fluorophenyl)methylene]-acetate(3E,5E) (EF-24; NSC 716993)

PubMed Central

Reid, Joel M.; Buhrow, Sarah A.; Gilbert, Judith A.; Jia, Lee; Shoji, Mamoru; Snyder, James P.; Ames, Matthew M.

2015-01-01

Purpose Curcumin, a keto-enol constituent of turmeric, has in vitro and in vivo antitumor activity. However, in vivo potency is low due to poor oral absorption. The mono-carbonyl analog, 3,5-bis[(2-fluorophenyl)methylene]-4-piperidinone acetate (EF-24, NSC 716993), exhibited broad spectrum activity in the NCI anti-cancer cell line screen and potent anti-angiogenesis activity in a HUVEC cell migration assay. The purpose of this study was to characterize the preclinical pharmacology of EF-24 in mice. Methods EF-24 plasma stability, protein binding, pharmacokinetics and metabolism were characterized utilizing an LC/MS/MS assay. Results An LC/MS/MS assay that incorporated protein precipitation with methanol, reverse-phase HPLC separation under gradient elution using an aqueous methanol mobile phase containing 0.1% formic acid and positive electrospray ionization detection of the m/z 312 > 149 transition for EF-24. The assay was linear over the range 7.8-1000 nM. Plasma protein binding was > 98% with preferential binding to albumin. EF-24 plasma disposition in mice after i.v. administration of a 10 mg/kg dose was best fit to a 3-compartment open model. The terminal elimination half-life and plasma clearance values were 73.6 min and 0.482 L/min/kg, respectively. EF-24 bioavailability was 60% and 35% after oral and i.p. administration, respectively. NADPH-dependent metabolism of EF-24 loss in liver microsomal preparations yielded several metabolites consistent with EF-24 hydroxylation and reduction. PMID:24760417

Nuclear factors that bind to the enhancer region of nondefective Friend murine leukemia virus.

PubMed Central

Manley, N R; O'Connell, M A; Sharp, P A; Hopkins, N

1989-01-01

Nondefective Friend murine leukemia virus (MuLV) causes erythroleukemia when injected into newborn NFS mice, while Moloney MuLV causes T-cell lymphoma. Exchange of the Friend virus enhancer region, a sequence of about 180 nucleotides including the direct repeat and a short 3'-adjacent segment, for the corresponding region in Moloney MuLV confers the ability to cause erythroid disease on Moloney MuLV. We have used the electrophoretic mobility shift assay and methylation interference analysis to identify cellular factors which bind to the Friend virus enhancer region and compared these with factors, previously identified, that bind to the Moloney virus direct repeat (N. A. Speck and D. Baltimore, Mol. Cell. Biol. 7:1101-1110, 1987). We identified five binding sites for sequence-specific DNA-binding proteins in the Friend virus enhancer region. While some binding sites are present in both the Moloney and Friend virus enhancers, both viruses contain unique sites not present in the other. Although none of the factors identified in this report which bind to these unique sites are present exclusively in T cells or erythroid cells, they bind to three regions of the enhancer shown by genetic analysis to encode disease specificity and thus are candidates to mediate the tissue-specific expression and distinct disease specificities encoded by these virus enhancer elements. Images PMID:2778872

Cross-linking of surface Ig receptors on murine B lymphocytes stimulates the expression of nuclear tetradecanoyl phorbol acetate-response element-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiles, T.C.; Liu, J.L.; Rothstein, T.L.

1991-03-15

Cross-linking of sIg on primary B lymphocytes leads to increased nuclear DNA-binding activity specific for the tetradecanoyl phorbol acetate-response element (TRE), as judged by gel mobility shift assays. Stimulation of B cells to enter S phase of the cell cycle by treatment with the combination of phorbol ester plus calcium ionophore also stimulated nuclear TRE-binding activity within 2 h, with maximal expression at 4 h; however, phorbol ester and calcium ionophore were not as effective in stimulating binding activity when examined separately. Stimulated nuclear expression of TRE-binding activity appears to require protein synthesis. Fos- and Jun/AP-1-related proteins participate directly inmore » the identified nucleoprotein complex, as shown by the ability of c-fos- and c-jun-specific antisera to either alter or completely abolish electrophoretic migration of the complex in native gels. Further, UV photo-cross-linking studies identified two major TRE-binding protein species, whose sizes correspond to TRE-binding proteins derived from HeLa cell nuclear extracts. The results suggest that in primary B cells nuclear TRE-binding activity represents a downstream signaling event that occurs subsequent to changes in protein kinase C activity and intracellular Ca2+ but that can be triggered physiologically through sIg.« less

Evidence of the neuron-restrictive silencer factor (NRSF) interaction with Sp3 and its synergic repression to the mu opioid receptor (MOR) gene

PubMed Central

Kim, Chun Sung; Choi, Hack Sun; Hwang, Cheol Kyu; Song, Kyu Young; Lee, Byung-Kwon; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H.

2006-01-01

Previously, we reported that the neuron-restrictive silencer element (NRSE) of mu opioid receptor (MOR) functions as a critical regulator to repress the MOR transcription in specific neuronal cells, depending on neuron-restriction silence factor (NRSF) expression levels [C.S.Kim, C.K.Hwang, H.S.Choi, K.Y.Song, P.Y.Law, L.N.Wei and H.H.Loh (2004) J. Biol. Chem., 279, 46464–46473]. Herein, we identify a conserved GC sequence next to NRSE region in the mouse MOR gene. The inhibition of Sp family factors binding to this GC box by mithramycin A led to a significant increase in the endogenous MOR transcription. In the co-immunoprecipitation experiment, NRSF interacted with the full-length Sp3 factor, but not with Sp1 or two short Sp3 isoforms. The sequence specific and functional binding by Sp3 at this GC box was confirmed by in vitro gel-shift assays using either in vitro translated proteins or nuclear extract, and by in vivo chromatin immunoprecipitation assays. Transient transfection assays showed that Sp3-binding site of the MOR gene is a functionally synergic repressor element with NRSE in NS20Y cells, but not in the NRSF negative PC12 cells. The results suggest that the synergic interaction between NRSF and Sp3 is required to negatively regulate MOR gene transcription and that transcription of MOR gene would be governed by the context of available transcription factors rather than by a master regulator. PMID:17130167

Evaluation of Staphylococcus aureus DNA aptamer by enzyme-linked aptamer assay and isothermal titration calorimetry.

PubMed

Bayraç, Ceren; Öktem, Hüseyin Avni

2017-02-01

To monitor the specificity of Staphylococcus aureus aptamer (SA-31) against its target cell, we used enzyme-linked aptamer assay. In the presence of target cell, horseradish peroxidase-conjugated streptavidin bound to biotin-labeled SA-31 showed specific binding to S  aureus among 3 different bacteria with limit of detection of 10 3 colony-forming unit per milliliter. The apparent K a was 1.39 μM -1  ± 0.3 μM -1 . The binding of SA-31 to membrane proteins extracted from cell surface was characterized using isothermal titration calorimetry, and the effect of changes in binding temperature and salt concentrations of binding buffer was evaluated based on thermodynamic parameters (K a , ΔH, and ΔG). Since binding of aptamer to its targets solely depends on its 3-dimensional structure under experimental conditions used in selection process, the change in temperature and ion concentration changed the affinity of SA-31 to its target on surface of bacteria. At 4°C, SA-31 did not show an affinity to its target with poor heat change upon injection of membrane fraction to aptamer solution. However, the apparent association constants of SA-31 slightly varied from K a  = 1.56 μM -1  ± 0.69 μM -1 at 25°C to K a  = 1.03 μM -1  ± 0.9 μM -1 at 37°C. At spontaneously occurring exothermic binding reactions, affinities of S aureus aptamer to its target were also 9.44 μM -1  ± 0.38 μM -1 at 50mM, 1.60 μM -1  ± 0.11 μM -1 at 137mM, and 3.28 μM -1  ± 0.46 μM -1 at 200 mM of salt concentration. In this study, it was demonstrated that enzyme-linked aptamer assay and isothermal titration calorimetry were useful tools for studying the fundamental binding mechanism between a DNA aptamer and its target on the outer surface of S aureus. Copyright © 2016 John Wiley & Sons, Ltd.

MC3T3-E1 cell adhesion to hydroxyapatite with adsorbed bone sialoprotein, bone osteopontin, and bovine serum albumin.

PubMed

Bernards, Matthew T; Qin, Chunlin; Jiang, Shaoyi

2008-07-15

Native bone tissue is composed of a complex matrix of collagen, non-collagenous proteins, and hydroxyapatite (HAP). Bone sialoprotein (BSP) and bone osteopontin (OPN) are members of the non-collagenous protein family termed the SIBLING (small integrin-binding ligand, N-linked glycoproteins) proteins, which are primarily found in mineralized tissues. Previously, OPN was shown to exhibit a preferential orientation for MC3T3-E1 cell adhesion when it was specifically bound to collagen, while the MC3T3-E1 cell adhesion was shown to be dependant on the conformational flexibility of BSP specifically bound to collagen. Additionally, OPN was shown to play a greater role than BSP for cell binding to collagen. In this work, the orientations and conformations of BSP and OPN specifically bound to HAP are probed under similar conditions. Radiolabeled adsorption isotherms were obtained for BSP and OPN on HAP formed from a simulated body fluid, and the results show that HAP has the capacity to bind significantly more BSP than OPN. An in vitro MC3T3-E1 cell adhesion assay was then performed to compare the cell binding ability of adsorbed BSP and OPN specifically bound to HAP. It was found that there is a preference for cell binding to HAP with adsorbed BSP as compared to OPN, but not to a statistically significant level. However, the maximum cell binding was observed on HAP substrates with adsorbed heat denatured bovine serum albumin (BSA). The influence of BSA on cell binding was shown to be concentration dependant and it is believed that the adsorbed BSA modulates the proliferation state of the bound cells.

MC3T3-E1 Cell Adhesion to Hydroxyapatite with Adsorbed Bone Sialoprotein, Bone Osteopontin, and Bovine Serum Albumin

PubMed Central

Bernards, Matthew T.; Qin, Chunlin; Jiang, Shaoyi

2008-01-01

Native bone tissue is composed of a complex matrix of collagen, non-collagenous proteins, and hydroxyapatite (HAP). Bone sialoprotein (BSP) and bone osteopontin (OPN) are members of the non-collagenous protein family termed the SIBLING (small integrin-binding ligand, N-linked glycoproteins) proteins, which are primarily found in mineralized tissues. Previously, OPN was shown to exhibit a preferential orientation for MC3T3-E1 cell adhesion when it was specifically bound to collagen, while the MC3T3-E1 cell adhesion was shown to be dependant on the conformational flexibility of BSP specifically bound to collagen. Additionally, OPN was shown to play a greater role than BSP for cell binding to collagen. In this work, the orientations and conformations of BSP and OPN specifically bound to HAP are probed under similar conditions. Radiolabeled adsorption isotherms were obtained for BSP and OPN on HAP formed from a simulated body fluid, and the results show that HAP has the capacity to bind significantly more BSP than OPN. An in vitro MC3T3-E1 cell adhesion assay was then performed to compare the cell binding ability of adsorbed BSP and OPN specifically bound to HAP. It was found that there is a preference for cell binding to HAP with adsorbed BSP as compared to OPN, but not to a statistically significant level. However, the maximum cell binding was observed on HAP substrates with adsorbed heat denatured bovine serum albumin (BSA). The influence of BSA on cell binding was shown to be concentration dependant and it is believed that the adsorbed BSA modulates the proliferation state of the bound cells. PMID:18420388

The orphan nuclear receptor NR4A1 attenuates oxidative stress-induced β cells apoptosis via up-regulation of glutathione peroxidase 1.

PubMed

Yang, Yingfeng; Xie, Fangyu; Qin, Dandan; Zong, Chen; Han, Feng; Pu, Zeqing; Liu, Dong; Li, Xia; Zhang, Yuchao; Liu, Yuantao; Wang, Xiangdong

2018-06-15

Our previous study showed that NR4A1 protects against oxidative stress-induced cell apoptosis. However, the targets downstream of NR4A1 are incompletely known. Glutathione peroxidase 1 (GPX1) is the most common antioxidant enzyme in the glutathione peroxidase class. In this study, we aimed to investigate whether GPX1 is a mediator of the protective effects of NR4A1 in pancreatic β cells. A pancreatic β cell line, MIN6, was used to generate NR4A1 over-expression cell line. GPX1 expression and GPX1 promoter trans-activation in these cells was determined. These cells were then treated with H 2 O 2 , and the active caspase3 level was determined. NR4A1 over-expression in MIN6 cells resulted in increased GPX1 expression at both mRNA and protein levels. Dual luciferase assay showed that NR4A1 over-expression was able to enhance the trans-activation of GPX1 promoter, and the critical regulatory elements were narrowed down between 0 to -2000 bp in GPX1 promoter with a putative NR4A1 binding site (-273 to -268). ChIP assays demonstrated that NR4A1 physically associates with the GPX1 promoter. Over-expression of GPX1 reduced the active level of Caspase3 after H 2 O 2 treatment. NR4A1 increases the expression of GPX1 by enhancing the trans-activation of GPX1 promoter through binding to the putative binding site on GPX1 promoter. NR4A1 potentially protects pancreatic β cells against oxidative stress-induced apoptosis by increasing GPX1 expression. Copyright © 2018 Elsevier Inc. All rights reserved.

Fisetin inhibits epidermal growth factor-induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression.

PubMed

Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen; Hsieh, Yi-Hsien; Yang, Shun-Fa

2017-01-01

Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)-induced cell migration and the underlying mechanisms remain unclear. Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription-PCR (RT-PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1-dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases.

Fisetin inhibits epidermal growth factor–induced migration of ARPE-19 cells by suppression of AKT activation and Sp1-dependent MMP-9 expression

PubMed Central

Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen

2017-01-01

Purpose Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)–induced cell migration and the underlying mechanisms remain unclear. Methods Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription–PCR (RT–PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Results Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Conclusions Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1–dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases. PMID:29296070

Multi-modal in cellulo evaluation of NPR-C targeted C-ANF-peptide and C-ANF-comb nanoparticles

NASA Astrophysics Data System (ADS)

Shokeen, Monica; Pressly, Eric; Connal, Luke; Liu, Yongjian; Hawker, Craig J.; Woodard, Pamela K.; Anderson, Carolyn J.; Achilefu, Samuel; Welch, Michael J.

2012-03-01

Natriuretic peptides (NPs) are clinical markers of heart disease that have anti-proliferative and anti-migratory effects on vascular smooth-muscle cells (VSMCs). In atherosclerosis, NPs participate in vascular remodeling, where the expression of NP clearance receptors (NPR-Cs) is upregulated both in the endothelium and in VSMCs[1-3]. In this study, we investigated the enhanced targeting potential of novel multifunctional nanoprobes conjugated with multiple copies of a C-type atrial natriuretic factor (C-ANF) peptide fragment to target NPR-C transfected cells. The cell binding results of the NPR-C targeted nanoprobes were compared with that of the C-ANF peptide fragment alone. The nanoprobe and peptide structures contain the chelator DOTA (1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid) for labeling with the PET tracer, 64Cu, for radioactive assays and luminescent Eu (III) for confocal cell imaging. Cell assays performed with the radioactive nanoprobe and peptide demonstrated higher cell binding of the targeted nanoprobe comapred with the peptide alone (8.63+/-1.67 vs. 1.13+/-0.06). The targeting specificity of both moieties was tested by using the control cell lines NPR-A and NPR-B, and receptor mediated uptake was demonstrated by reduced uptake in the presence of excess unlabeled respective probes.

Heparin-binding growth factor isolated from human prostatic extracts.

PubMed

Mydlo, J H; Bulbul, M A; Richon, V M; Heston, W D; Fair, W R

1988-01-01

Prostatic tissue extracts from patients with benign prostatic hyperplasia (BPH) and prostatic carcinoma were fractionated using heparin-Sepharose chromatography. The mitogenic activity of eluted fractions on quiescent subconfluent Swiss Albino 3T3 fibroblasts was tested employing a tritiated-thymidine-incorporation assay. Two peaks of activity were consistently noted--one in the void volume and a second fraction which eluted with 1.3-1.6 M NaCl and contained the majority of the mitogenic activity. Both non-heparin- and heparin-binding fractions increased tritiated incorporation into a mouse osteoblast cell line (MC3T3), while only the heparin-binding fractions stimulated a human umbilical vein endothelial cell line (HUV). No increased uptake of thymidine was seen using a human prostatic carcinoma cell line (PC-3). Sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS/PAGE) of lyophilized active fractions showed a persistent band at 17,500 daltons. The purified protein demonstrated angiogenic properties using the chick embryo chorioallantoic membrane (CAM) assay. Western blot analysis using antibodies specific to basic fibroblast growth factor (bFGF) or acidic FGF (aFGF) demonstrated that the former, but not the latter, bound to prostatic growth factor (PrGF), and inhibited its mitogenic activity as well. It appears that PrGF shares homology with basic fibroblast growth factors.

Discovery of 4-Methyl-N-(4-((4-methylpiperazin-1-yl)methyl)-3-(trifluoromethyl)phenyl)-3-((1-nicotinoylpiperidin-4-yl)oxy)benzamide (CHMFL-ABL/KIT-155) as a Novel Highly Potent Type II ABL/KIT Dual Kinase Inhibitor with a Distinct Hinge Binding.

PubMed

Wang, Qiang; Liu, Feiyang; Wang, Beilei; Zou, Fengming; Qi, Ziping; Chen, Cheng; Yu, Kailin; Hu, Chen; Qi, Shuang; Wang, Wenchao; Hu, Zhenquan; Liu, Juan; Wang, Wei; Wang, Li; Liang, Qianmao; Zhang, Shanchun; Ren, Tao; Liu, Qingsong; Liu, Jing

2017-01-12

The discovery of a novel potent type II ABL/c-KIT dual kinase inhibitor compound 34 (CHMFL-ABL/KIT-155), which utilized a hydrogen bond formed by NH on the kinase backbone and carbonyl oxygen of 34 as a unique hinge binding, is described. 34 potently inhibited purified ABL (IC 50 : 46 nM) and c-KIT kinase (IC 50 : 75 nM) in the biochemical assays and displayed high selectivity (S Score (1) = 0.03) at the concentration of 1 μM among 468 kinases/mutants in KINOMEscan assay. It exhibited strong antiproliferative activities against BCR-ABL/c-KIT driven CML/GISTs cancer cell lines through blockage of the BCR-ABL/c-KIT mediated signaling pathways, arresting cell cycle progression and induction of apoptosis. 34 possessed a good oral PK property and effectively suppressed the tumor progression in the K562 (CML) and GIST-T1 (GISTs) cells mediated xenograft mouse model. The distinct hinge-binding mode of 34 provided a novel pharmacophore for expanding the chemical structure diversity for the type II kinase inhibitors discovery.

The effects of cytosine methylation on general transcription factors

NASA Astrophysics Data System (ADS)

Jin, Jianshi; Lian, Tengfei; Gu, Chan; Yu, Kai; Gao, Yi Qin; Su, Xiao-Dong

2016-07-01

DNA methylation on CpG sites is the most common epigenetic modification. Recently, methylation in a non-CpG context was found to occur widely on genomic DNA. Moreover, methylation of non-CpG sites is a highly controlled process, and its level may vary during cellular development. To study non-CpG methylation effects on DNA/protein interactions, we have chosen three human transcription factors (TFs): glucocorticoid receptor (GR), brain and muscle ARNT-like 1 (BMAL1) - circadian locomotor output cycles kaput (CLOCK) and estrogen receptor (ER) with methylated or unmethylated DNA binding sequences, using single-molecule and isothermal titration calorimetry assays. The results demonstrated that these TFs interact with methylated DNA with different effects compared with their cognate DNA sequences. The effects of non-CpG methylation on transcriptional regulation were validated by cell-based luciferase assay at protein level. The mechanisms of non-CpG methylation influencing DNA-protein interactions were investigated by crystallographic analyses and molecular dynamics simulation. With BisChIP-seq assays in HEK-293T cells, we found that GR can recognize highly methylated sites within chromatin in cells. Therefore, we conclude that non-CpG methylation of DNA can provide a mechanism for regulating gene expression through directly affecting the binding of TFs.

Nerve cell-mimicking liposomes as biosensor for botulinum neurotoxin complete physiological activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weingart, Oliver G., E-mail: Oliver.Weingart@hest.

Botulinum neurotoxins (BoNT) are the most toxic substances known, and their neurotoxic properties and paralysing effects are exploited for medical treatment of a wide spectrum of disorders. To accurately quantify the potency of a pharmaceutical BoNT preparation, its physiological key activities (binding to membrane receptor, translocation, and proteolytic degradation of SNARE proteins) need to be determined. To date, this was only possible using animal models, or, to a limited extent, cell-based assays. We here report a novel in vitro system for BoNT/B analysis, based on nerve-cell mimicking liposomes presenting motoneuronal membrane receptors required for BoNT binding. Following triggered membrane translocationmore » of the toxin's Light Chain, the endopeptidase activity can be quantitatively monitored employing a FRET-based reporter assay within the functionalized liposomes. We were able to detect BoNT/B physiological activity at picomolar concentrations in short time, opening the possibility for future replacement of animal experimentation in pharmaceutical BoNT testing. - Highlights: • A cell-free in vitro system was used to measure BoNT/B physiological function. • The system relies on nerve-cell mimicking liposomes as a novel detection system. • A FRET-based reporter assay is used as final readout of the test system. • BoNT/B physiological activity was detected at picogram quantities in short time. • The method opens the possibility to replace animal experimentation in BoNT testing.« less

Krit 1 interactions with microtubules and membranes are regulated by Rap1 and integrin cytoplasmic domain associated protein-1

PubMed Central

Béraud-Dufour, Sophie; Gautier, Romain; Albiges-Rizo, Corinne; Chardin, Pierre; Faurobert, Eva

2007-01-01

The small G protein Rap1 regulates diverse cellular processes such as integrin activation, cell adhesion, cell-cell junction formation and cell polarity. It is crucial to identify Rap1 effectors to better understand signalling pathways controlling these processes. Krit1, a FERM protein, was identified as a Rap1 partner in a yeast two-hydrid screen, but this interaction was not confirmed in subsequent studies. As evidence suggests a role for Krit1 in Rap1-dependent pathways, we readdressed this question. Here, we demonstrate by biochemical assays that Krit1 is a specific Rap1 effector. We show that, like other FERM proteins, Krit1 adopts two conformations: a closed conformation in which its N-terminal NPAY motif interacts with its C-terminus and an opened conformation bound to ICAP-1, a negative regulator of focal adhesion assembly. We show that a ternary complex can form in vitro between Krit1, Rap1 and ICAP-1 and that Rap1 binds Krit1 FERM domain in both closed and opened conformations. Unlike ICAP-1, Rap1 does not open Krit1. Using sedimentation assays, we show that Krit1 binds in vitro to microtubules through its N and C-termini and that Rap1 and ICAP-1 inhibit Krit1 binding to microtubules. Consistently, YFP-Krit1 localizes on CFP-labelled microtubules in BHK cells and is delocalized from microtubules upon co-expression with activated Rap1V12. Finally, we show that Krit1 binds to PIP2 containing liposomes and that Rap1 enhances this binding. Based on these results, we propose a model in which Krit1 would be delivered by microtubules to the plasma membrane where it would be captured by Rap1 and ICAP-1. PMID:17916086

Non-Cell-Autonomous Regulation of Root Hair Patterning Genes by WRKY75 in Arabidopsis1[W

PubMed Central

Rishmawi, Louai; Pesch, Martina; Juengst, Christian; Schauss, Astrid C.; Schrader, Andrea; Hülskamp, Martin

2014-01-01

In Arabidopsis (Arabidopsis thaliana), root hairs are formed in cell files over the cleft of underlying cortex cells. This pattern is established by a well-known gene regulatory network of transcription factors. In this study, we show that WRKY75 suppresses root hair development in nonroot hair files and that it represses the expression of TRIPTYCHON and CAPRICE. The WRKY75 protein binds to the CAPRICE promoter in a yeast one-hybrid assay. Binding to the promoter fragment requires an intact WRKY protein-binding motif, the W box. A comparison of the spatial expression of WRKY75 and the localization of the WRKY75 protein revealed that WRKY75 is expressed in the pericycle and vascular tissue and that the WRKY75 RNA or protein moves into the epidermis. PMID:24676857

Molecular Characterization of Severin from Clonorchis sinensis Excretory/Secretory Products and Its Potential Anti-apoptotic Role in Hepatocarcinoma PLC Cells

PubMed Central

He, Lei; Wang, Xiaoyun; Liang, Pei; Chen, Wenjun; Bian, Meng; Ren, Mengyu; Lin, Jinsi; Liang, Chi; Xu, Jin; Wu, Zhongdao; Li, Xuerong; Huang, Yan; Yu, Xinbing

2013-01-01

Background Clonorchiasis, caused by the infection of Clonorchis sinensis (C. sinensis), is a kind of neglected tropical disease, but it is highly related to cholangiocarcinoma and hepatocellular carcinoma (HCC). It has been well known that the excretory/secretory products of C. sinensis (CsESPs) play key roles in clonorchiasis associated carcinoma. From genome and transcriptome of C. sinensis, we identified one component of CsESPs, severin (Csseverin), which had three putative gelsolin domains. Its homologues are supposed to play a vital role in apoptosis resistance of tumour cell. Methodology/Principal Findings There was significant similarity in tertiary structures between human gelsolin and Csseverin by bioinformatics analysis. We identified that Csseverin expressed at life stage of adult worm, metacercaria and egg by the method of quantitative real-time PCR and western blotting. Csseverin distributed in vitellarium and intrauterine eggs of adult worm and tegument of metacercaria by immunofluorence assay. We obtained recombinant Csseverin (rCsseverin) and confirmed that rCsseverin could bind with calciumion in circular dichroism spectrum analysis. It was demonstrated that rCsseverin was of the capability of actin binding by gel overlay assay and immunocytochemistry. Both Annexin V/PI assay and mitochondrial membrane potential assay of human hepatocarcinoma cell line PLC showed apoptosis resistance after incubation with different concentrations of rCsseverin. Morphological analysis, apoptosis-associated changes of mitochondrial membrane potential and Annexin V/PI apoptosis assay showed that co-incubation of PLC cells with rCsseverin in vitro led to an inhibition of apoptosis induced by serum-starved for 24 h. Conclusions/Significance Collectively, the molecular properties of Csseverin, a molecule of CsESPs, were characterized in our study. rCsseverin could cause obvious apoptotic inhibition in human HCC cell line. Csseverin might exacerbate the process of HCC patients combined with C. sinensis infection. PMID:24367717

Development and application of a quantitative multiplexed small GTPase activity assay using targeted proteomics.

PubMed

Zhang, Cheng-Cheng; Li, Ru; Jiang, Honghui; Lin, Shujun; Rogalski, Jason C; Liu, Kate; Kast, Juergen

2015-02-06

Small GTPases are a family of key signaling molecules that are ubiquitously expressed in various types of cells. Their activity is often analyzed by western blot, which is limited by its multiplexing capability, the quality of isoform-specific antibodies, and the accuracy of quantification. To overcome these issues, a quantitative multiplexed small GTPase activity assay has been developed. Using four different binding domains, this assay allows the binding of up to 12 active small GTPase isoforms simultaneously in a single experiment. To accurately quantify the closely related small GTPase isoforms, a targeted proteomic approach, i.e., selected/multiple reaction monitoring, was developed, and its functionality and reproducibility were validated. This assay was successfully applied to human platelets and revealed time-resolved coactivation of multiple small GTPase isoforms in response to agonists and differential activation of these isoforms in response to inhibitor treatment. This widely applicable approach can be used for signaling pathway studies and inhibitor screening in many cellular systems.

Synthesis of photothermal nanocomposites and their application to antibacterial assays

NASA Astrophysics Data System (ADS)

Yang, Ning; Wang, Chun; Wang, Xiaoyu; Li, Lidong

2018-04-01

In this work, we report a novel gold nanorod (AuNR)-based nanocomposite that shows strong binding to bacterium and high antibacterial efficiency. The AuNRs were used as a photothermal material to transform near-infrared radiation (NIR) into heat. We selected poly (acrylic acid) to modify the surface of the AuNRs based on a simple self-assembly method. After conjugation of the bacterium-binding molecule vancomycin, the nanocomposites were capable of efficiently gathering on the cell walls of bacteria. The nanocomposites exhibited a high bacterial inhibition capability owing to NIR-induced heat generation in situ. Therefore, the prepared photothermal nanocomposites show great potential for use in antibacterial assays.

The juxtamembrane domain of the E-cadherin cytoplasmic tail contributes to its interaction with Myosin VI

PubMed Central

Mangold, Sabine; Norwood, Suzanne J.; Yap, Alpha S.; Collins, Brett M.

2012-01-01

We recently identified the atypical myosin, Myosin VI, as a component of epithelial cell-cell junctions that interacts with E-cadherin. Recombinant proteins bearing the cargo-binding domain of Myosin VI (Myo VI-CBD) or the cytoplasmic tail of E-cadherin can interact directly with one another. In this report we further investigate the molecular requirements of the interaction between Myo VI-CBD and E-cadherin combining truncation mutation analysis with in vitro binding assays. We report that a short (28 amino acid) juxtamembrane region of the cadherin cytoplasmic tail is sufficient to bind Myo VI-CBD. However, central regions of the cadherin tail adjacent to the juxtamembrane sequence also display binding activity for Myo VI-CBD. It is therefore possible that the cadherin tail bears two binding sites for Myosin VI, or an extended binding site that includes the juxtamembrane region. Nevertheless, our biochemical data highlight the capacity for the juxtamembrane region to interact with functionally-significant cytoplasmic proteins. PMID:23007415

Occludin confers adhesiveness when expressed in fibroblasts.

PubMed

Van Itallie, C M; Anderson, J M

1997-05-01

Occludin is an integral membrane protein specifically associated with tight junctions. Previous studies suggest it is likely to function in forming the intercellular seal. In the present study, we expressed occludin under an inducible promotor in occludin-null fibroblasts to determine whether this protein confers intercellular adhesion. When human occludin is stably expressed in NRK and Rat-1 fibroblasts, which lack endogenous occludin and tight junctions but do have well developed ZO-1-containing adherens-like junctions, occludin colocalizes with ZO-1 to points of cell-cell contact. In contrast, L-cell fibroblasts which lack cadherin-based adherens junctions, target neither ZO-1 nor occludin to sites of cell contact. Occludin-induced adhesion was next quantified using a suspended cell assay. In NRK and Rat-1 cells, occludin expression induces adhesion in the absence of calcium, thus independent of cadherin-cadherin contacts. In contrast, L-cells are nonadhesive in this assay and show no increase in adhesion after induction of occludin expression. Binding of an antibody to the first of the putative extracellular loops of occludin confirmed that this sequence was exposed on the cell surface, and synthetic peptides containing the amino acid sequence of this loop inhibit adhesion induced by occludin expression. These results suggest that the extracellular surface of occludin is directly involved in cell-cell adhesion and the ability to confer adhesiveness correlates with the ability to colocalize with its cytoplasmic binding protein, ZO-1.

Induction of dystrophin Dp71 expression during neuronal differentiation: opposite roles of Sp1 and AP2alpha in Dp71 promoter activity.

PubMed

Morales-Lázaro, Sara Luz; González-Ramírez, Ricardo; Gómez, Pablo; Tapia-Ramírez, Victor; de León, Mario Bermúdez; Cisneros, Bulmaro

2010-01-01

In this study, we delineated the molecular mechanisms that modulate Dp71 expression during neuronal differentiation, using the N1E-115 cell line. We demonstrated that Dp71 expression is up-regulated in response to cAMP-mediated neuronal differentiation of these cells, and that this induction is controlled at promoter level. Functional deletion analysis of the Dp71 promoter revealed that a 5'-flanking 159-bp DNA fragment that contains Sp1 and AP2 binding sites is necessary and sufficient for basal expression of this TATA-less promoter, as well as for its induction during neuronal differentiation. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that Sp1 and AP2alpha bind to their respective DNA elements within the Dp71 basal promoter. Overall, mutagenesis assays on the Sp1 and AP2 binding sites, over-expression of Sp1 and AP2alpha, as well as knock-down experiments on Sp1 and AP2alpha gene expression established that Dp71 basal expression is controlled by the combined action of Sp1 and AP2alpha, which act as activator and repressor, respectively. Furthermore, we demonstrated that induction of Dp71 expression in differentiated cells is the result of the maintenance of positive regulation exerted by Sp1, as well as of the loss of AP2alpha binding, which ultimately releases the promoter from repression.

Fluorescent rhodanine-3-acetic acids visualize neurofibrillary tangles in Alzheimer's disease brains.

PubMed

Anumala, Upendra Rao; Gu, Jiamin; Lo Monte, Fabio; Kramer, Thomas; Heyny-von Haußen, Roland; Hölzer, Jana; Goetschy-Meyer, Valerie; Schön, Christian; Mall, Gerhard; Hilger, Ingrid; Czech, Christian; Herms, Jochen; Schmidt, Boris

2013-09-01

There is a high demand for the development of an imaging agent for neurofibrillary tangles (NFTs) detection in Alzheimer's diagnosis. In the present study, a series of rhodanine-3-acetic acids was synthesized and evaluated for fluorescence imaging of NFTs in brain tissues of AD patients. Five out of seven probes have shown excellent binding affinity to NFTs over amyloid plaques in the Thiazine red R displacement assay. However, the selectivity in this in vitro assay is not confirmed by the histopathological evaluation, which indicates significant differences in the binding sites in the assays. Probe 6 showed binding affinity (IC50=19nM) to tau aggregates which is the highest among this series. Probes 2, 3, 4 and 5 display IC50 values of lower than 100nM to tau aggregates to displace Thiazine red R. Evaluation of the cytotoxicity of these five probes with human liver carcinoma cells revealed that these compounds excert negligible cytotoxicity. The in vivo studies with zebrafish embryos confirmed negligible cytotoxicity at 24 and 72h post fertilization. Copyright © 2013 Elsevier Ltd. All rights reserved.

[Cell-ELA-based determination of binding affinity of DNA aptamer against U87-EGFRvIII cell].

PubMed

Tan, Yan; Liang, Huiyu; Wu, Xidong; Gao, Yubo; Zhang, Xingmei

2013-05-01

A15, a DNA aptamer with binding specificity for U87 glioma cells stably overexpressing the epidermal growth factor receptor variant III (U87-EGFRvIII), was generated by cell systematic evolution of ligands by exponential enrichment (cell-SELEX) using a random nucleotide library. Subsequently, we established a cell enzyme-linked assay (cell-ELA) to detect the affinity of A15 compared to an EGFR antibody. We used A15 as a detection probe and cultured U87-EGFRvIII cells as targets. Our data indicate that the equilibrium dissociation constants (K(d)) for A15 were below 100 nmol/L and had similar affinity compared to an EGFR antibody for U87-EGFRvIII. We demonstrated that the cell-ELA was a useful method to determine the equilibrium dissociation constants (K(d)) of aptamers generated by cell-SELEX.

Expression of receptors for atrial natriuretic peptide on the murine bone marrow-derived stromal cells.

PubMed

Agui, T; Yamada, T; Legros, G; Nakajima, T; Clark, M; Peschel, C; Matsumoto, K

1992-05-01

Atrial natriuretic peptide (ANP) receptors were identified on both murine bone marrow-derived stromal cell lines A-3 and ALC and primary cultured cells using [125I]ANP binding assays and Northern blot analyses. The binding of [125I] ANP to the stromal cells was rapid, saturable, and of high affinity. The dissociation constants between ANP and its receptors on these cells showed no difference among cell types, while maximal binding capacity values were different among cell types. Competitive inhibition of [125I]ANP binding with C-atrial natriuretic factor, specific for ANP clearance receptor (ANPR-C), revealed that most of [125I]ANP-binding sites corresponded to ANPR-C. Northern blotting data corroborated that bone marrow-derived stromal cells expressed ANPR-C. However, in ALC cells, ANP biological receptors (either ANPR-A or ANPR-B), the mol wt of which is approximately 130K, were detected, and cGMP was accumulated after stimulation with ANP. On the other hand, in another stromal cell clone, A-3 cells, the expression of biological receptor was not detected in the affinity cross-linking and competitive inhibition experiments using [125I]ANP. However, A-3 cells accumulated cGMP by responding to ANPR-B-specific ligand, C-type natriuretic peptide. These results suggest that ALC cells equally express ANPR-A and ANPR-B, while A-3 cells express ANPR-B dominantly. Although the physiological roles of these receptors in the bone marrow is still not resolved, ANP is expected to play a role in the regulation of stromal cell functions in bone marrow.

Effect of single point mutations of the human tachykinin NK1 receptor on antagonist affinity.

PubMed

Lundstrom, K; Hawcock, A B; Vargas, A; Ward, P; Thomas, P; Naylor, A

1997-10-15

Molecular modelling and site-directed mutagenesis were used to identify eleven amino acid residues which may be involved in antagonist binding of the human tachykinin NK1 receptor. Recombinant receptors were expressed in mammalian cells using the Semliki Forest virus system. Wild type and mutant receptors showed similar expression levels in BHK and CHO cells, verified by metabolic labelling. Binding affinities were determined for a variety of tachykinin NK1 receptor antagonists in SFV-infected CHO cells. The binding affinity for GR203040, CP 99,994 and CP 96,345 was significantly reduced by mutant Q165A. The mutant F268A significantly reduced the affinity for GR203040 and CP 99,994 and the mutant H197A had reduced affinity for CP 96,345. All antagonists seemed to bind in a similar region of the receptor, but do not all rely on the same binding site interactions. Functional coupling to G-proteins was assayed by intracellular Ca2+ release in SFV-infected CHO cells. The wild type receptor and all mutants except A162L and F268A responded to substance P stimulation.

Cyto-adherence of Mycoplasma mycoides subsp. mycoides to bovine lung epithelial cells.

PubMed

Aye, Racheal; Mwirigi, Martin Kiogora; Frey, Joachim; Pilo, Paola; Jores, Joerg; Naessens, Jan

2015-02-07

Mycoplasma mycoides subsp. mycoides (Mmm) is the causative agent of contagious bovine pleuropneumonia (CBPP), a respiratory disease of cattle, whereas the closely related Mycoplasma mycoides subsp. capri (Mmc) is a goat pathogen. Cyto-adherence is a crucial step in host colonization by mycoplasmas and subsequent pathogenesis. The aim of this study was to investigate the interactions between Mmm and mammalian host cells by establishing a cyto-adherence flow cytometric assay and comparing tissue and species specificity of Mmm and Mmc strains. There were little significant differences in the adherence patterns of eight different Mmm strains to adult bovine lung epithelial cells. However, there was statistically significant variation in binding to different host cells types. Highest binding was observed with lung epithelial cells, intermediate binding with endothelial cells and very low binding with fibroblasts, suggesting the presence of effective adherence of Mmm on cells lining the airways of the lung, which is the target organ for this pathogen, possibly by high expression of a specific receptor. However, binding to bovine fetal lung epithelial cells was comparably low; suggesting that the lack of severe pulmonary disease seen in many infected young calves can be explained by reduced expression of a specific receptor. Mmm bound with high efficiency to adult bovine lung cells and less efficiently to calves or goat lung cells. The data show that cyto-adherence of Mmm is species- and tissue- specific confirming its role in colonization of the target host and subsequent infection and development of CBPP.

Immunological characterization of eristostatin and echistatin binding sites on alpha IIb beta 3 and alpha V beta 3 integrins.

PubMed Central

Marcinkiewicz, C; Rosenthal, L A; Mosser, D M; Kunicki, T J; Niewiarowski, S

1996-01-01

Two disintegrins with a high degree of amino acid sequence similarity, echistatin and eristostatin, showed a low level of interaction with Chinese hamster ovary (CHO) cells, but they bound to CHO cells transfected with alpha IIb beta 3 genes (A5 cells) and to CHO cells transfected with alpha v beta 3 genes (VNRC3 cells) in a reversible and saturable manner. Scatchard analysis revealed that eristostatin bound to 816000 sites per A5 cell (Kd 28 nM) and to 200000 sites (Kd 14 nM) per VNRC3 cell respectively. However, VNRC3 cells did not bind to immobilized eristostatin. Echistatin bound to 495000 sites (Kd 53 nM) per A5 cell and to 443000 sites (Kd 20 nM) per VNRC3 cell. As determined by flow cytometry, radiobinding assay and adhesion studies, binding of both disintegrins to A5 cells and resting platelets and binding of echistatin to VNRC3 cells resulted in the expression of ligand-induced binding sites (LIBS) on the beta 3 subunit. Eristostatin inhibited, more strongly than echistatin, the binding of three monoclonal antibodies: OPG2 (RGD motif dependent), A2A9 (alpha IIb beta 3 complex dependent) and 7E3 (alpha IIb beta 3 and alpha v beta 3 complex dependent) to A5 cells, to resting and to activated platelets and to purified alpha IIb beta 3. Experiments in which echistatin and eristostatin were used alone or in combination to inhibit the binding of 7E3 and OPG2 antibodies to resting platelets suggested that these two disintegrins bind to different but overlapping sites on alpha IIb beta 3 integrin. Monoclonal antibody LM 609 and echistatin seemed to bind to different sites on alpha v beta 3 integrin. However, echistatin inhibited binding of 7E3 antibody to VNRC3 cells and to purified alpha v beta 3 suggesting that alpha v beta 3 and alpha IIb beta 3 might share the same epitope to which both echistatin and 7E3 bind. Eristostatin had no effect in these systems, providing further evidence that it binds to a different epitope on alpha v beta 3. PMID:8760368

Concanavalin A-mediated polyclonal helper assay of normal thymocytes and its use for the analysis of ontogeny.

PubMed

Kina, T; Nishikawa, S; Amagai, T; Katsura, Y

1987-01-01

A concanavalin A (Con A)-mediated polyclonal helper assay system was established by using the thymus cells or splenic T cells as a source of helper T cells. When splenic B cells were cocultured with thymus cells or splenic Lyt-2- T cells in the presence of an optimal dose of Con A, B Cells were polyclonally activated and differentiated into immunoglobulin-secreting cells. This Con A-mediated helper activity was completely inhibited by the addition of alpha-methyl-D-mannoside and could not be substituted by culture supernatant of Con A-stimulated thymocytes or splenic T cells. Almost all the activity of the thymus cells was carried by peanut agglutinin low binding population. Genetic restriction between T and B cells was not observed in this helper function. In ontogeny, Con A-mediated helper activity in the thymus was first detected at a few days after birth and reached the adult level at about 1 week of age. The polyclonal helper assay system developed in the present study provides a sensitive system to analyse the helper function of thymus cells and also to delineate the early phase of the differentiation of helper T cell population.

Fully Automated RNAscope In Situ Hybridization Assays for Formalin‐Fixed Paraffin‐Embedded Cells and Tissues

PubMed Central

Anderson, Courtney M.; Zhang, Bingqing; Miller, Melanie; Butko, Emerald; Wu, Xingyong; Laver, Thomas; Kernag, Casey; Kim, Jeffrey; Luo, Yuling; Lamparski, Henry; Park, Emily; Su, Nan

2016-01-01

ABSTRACT Biomarkers such as DNA, RNA, and protein are powerful tools in clinical diagnostics and therapeutic development for many diseases. Identifying RNA expression at the single cell level within the morphological context by RNA in situ hybridization provides a great deal of information on gene expression changes over conventional techniques that analyze bulk tissue, yet widespread use of this technique in the clinical setting has been hampered by the dearth of automated RNA ISH assays. Here we present an automated version of the RNA ISH technology RNAscope that is adaptable to multiple automation platforms. The automated RNAscope assay yields a high signal‐to‐noise ratio with little to no background staining and results comparable to the manual assay. In addition, the automated duplex RNAscope assay was able to detect two biomarkers simultaneously. Lastly, assay consistency and reproducibility were confirmed by quantification of TATA‐box binding protein (TBP) mRNA signals across multiple lots and multiple experiments. Taken together, the data presented in this study demonstrate that the automated RNAscope technology is a high performance RNA ISH assay with broad applicability in biomarker research and diagnostic assay development. J. Cell. Biochem. 117: 2201–2208, 2016. © 2016 The Authors. Journal of Cellular Biochemistry Published by Wiley Periodicals, Inc. PMID:27191821

Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

PubMed Central

Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

2018-01-01

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

Perception of the plant immune signal salicylic acid

PubMed Central

Yan, Shunping; Dong, Xinnian

2014-01-01

Salicylic acid (SA) plays a central role in plant innate immunity. The diverse functions of this simple phenolic compound suggest that plants may have multiple SA receptors. Several SA-binding proteins have been identified using biochemical approaches. However, genetic evidence supporting that they are the bona fide SA receptors has not been forthcoming. Mutant screens revealed that NPR1 is a master regulator of SA-mediated responses. Although NPR1 cannot bind SA in a conventional ligand-binding assay, its homologs NPR3 and NPR4 bind SA and function as SA receptors. During pathogen challenge, the SA gradient generated at the infection site is sensed by NPR3 and NPR4, which serve as the adaptors for the Cullin 3-based E3 ubiquitin ligase to regulate NPR1 degradation. Consequently, NPR1 is degraded at the infection site to remove its inhibition on effector-triggered cell death and defense, whereas NPR1 accumulates in neighboring cells to promote cell survival and SA-mediated resistance. PMID:24840293

Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

2010-02-19

Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

Synthesis and evaluation of 7-substituted-5,6-dihydrobenzo[c]acridine derivatives as new c-KIT promoter G-quadruplex binding ligands.

PubMed

Guo, Qian-Liang; Su, Hua-Fei; Wang, Ning; Liao, Sheng-Rong; Lu, Yu-Ting; Ou, Tian-Miao; Tan, Jia-Heng; Li, Ding; Huang, Zhi-Shu

2017-04-21

It has been shown that treatment of cancer cells with c-KIT G-quadruplex binding ligands can reduce their c-KIT expression levels thus inhibiting cell proliferation and inducing cell apoptosis. Herein, a series of new 7-substituted-5,6-dihydrobenzo[c]acridine derivatives were designed and synthesized. Subsequent biophysical evaluation demonstrated that the derivatives could effectively bind to and stabilize c-KIT G-quadruplex with good selectivity against duplex DNA. It was found that 12-N-methylated derivatives with a positive charge introduced at 12-position of 5,6-dihydrobenzo[c]acridine ring had similar binding affinity but lower stabilizing ability to c-KIT G-quadruplex DNA, compared with those of nonmethylated derivatives. Further molecular modeling studies showed possible binding modes of G-quadruplex with the ligands. RT-PCR assay and Western blot showed that compound 2b suppressed transcription and translation of c-KIT gene in K562 cells, which was consistent with the property of an effective G-quadruplex binding ligand targeting c-KIT oncogene promoter. Further biological evaluation showed that compound 2b could induce apoptosis through activation of the caspase-3 cascade pathway. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Indirect radioimmunoassay for thymus leukemia (TL) antigens. [Mice, /sup 125/I tracer technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Esmon, N.L.; Little, J.R.

1976-09-01

An indirect radioimmunoassay for thymus leukemia TL antigens has been developed and its specificity documented. The assay makes use of anti-TL antibodies produced in congenic mice (A-Tla/sup b/) and radioiodinated purified rabbit anti-mouse IgG. Using this assay, differences can be detected in the amounts of antigen expressed on thymocytes of the three known phenotypes (TL.1,2,3; TL.2; TL/sup -/) of inbred mouse strains. Significant differences are also detected in comparison of the thymocytes from homozygous TL.1,2,3 mice (A-Tla/sup a/) and heterozygotes from Tla/sup a/ and Tla/sup b/ parents. Optimum conditions for the assay have been established. Its ability to detect antigensmore » on glutaraldehyde-fixed cells and the binding of noncytolytic antibodies on both viable and fixed cells are documented. The assay has also been used to quantitate the changes in TL antigen expression on cells incubated in anti-TL antisera under conditions of antigenic modulation.« less

High resolution melting analysis (HRM) for the assessment of clonality in feline B-cell lymphomas.

PubMed

Henrich, Manfred; Scheffold, Svenja; Hecht, Werner; Reinacher, Manfred

2018-06-01

Analysis of clonality is gaining importance in diagnosing lymphomas in veterinary medicine. Usually, PCR for the analysis of antigen receptor rearrangement (PARR) is followed by electrophoretic separation of the PCR products. Aim of this study was to test the feasibility of HRM for the assessment of clonality in B-cell lymphomas of cats. High resolution melting analysis differentiates PCR products by their different melting point using the decrease in fluorescence of an intercalating dye during melting of the PCR product. Additionally, the method is easy to use with no post-PCR manipulation of the samples. Forty-seven feline B-cell lymphomas and 31 reactive lymphatic proliferations of cats were investigated by PARR followed either by capillary electrophoresis or an HRM assay. To objectify the interpretation of the HRM results a recently published mathematical approach was applied to the melting curve. To overcome discrepancies between the visual interpretation and the mathematical approach, the latter was modified to include testing of reproducibility and recognition of pseudoclonality. In 11 of 47 lymphoma cases clonal populations were detectable by HRM assay compared to 14 of 47 lymphomas in which clonal populations were detected by capillary electrophoresis assay. Neither of the methods showed a clonal pattern in any of the reactive samples. However, the HRM assay showed a unique pattern in cases of follicular lymphatic hyperplasia that had no corresponding pattern in capillary electrophoresis. The capillary electrophoresis assay could identify 3 lymphomas that were not detected by the HRM assay and is therefore regarded superior to the HRM assay. The comparison however, was hampered by the overall bad performance of the PARR, that might be the consequence of insufficient primer binding due to somatic hypermutation of the binding sites during antigen stimulated proliferation of the B lymphocytes. Copyright © 2018 Elsevier B.V. All rights reserved.

Mammalian transcription factor LSF is a target of ERK signaling

PubMed Central

Pagon, Zrinka; Volker, Janet; Cooper, Geoffrey M.; Hansen, Ulla

2012-01-01

LSF is a mammalian transcription factor that is rapidly and quantitatively phosphorylated upon growth induction of resting, peripheral human T cells, as assayed by a reduction in its electrophoretic mobility. The DNA-binding activity of LSF in primary T cells is greatly increased after this phosphorylation event [Volker et al., 1997]. We demonstrate here that LSF is also rapidly and quantitatively phosphorylated upon growth induction in NIH 3T3 cells, although its DNA-binding activity is not significantly altered. Three lines of experimentation established that ERK is responsible for phosphorylating LSF upon growth induction in both cell types. First, phosphorylation of LSF by ERK is sufficient to cause the reduced electrophoretic mobility of LSF. Second, the amount of ERK activity correlates with the extent of LSF phosphorylation in both primary human T cells and NIH 3T3 cells. Finally, specific inhibitors of the Ras/Raf/MEK/ERK pathway inhibit LSF modification in vivo. This phosphorylation by ERK is not sufficient for activation of LSF DNA-binding activity, as evidenced both in vitro and in mouse fibroblasts. Nonetheless, activation of ERK is a prerequisite for the substantial increase in LSF DNA-binding activity upon activation of resting T cells, indicating that ERK phosphorylation is necessary but not sufficient for activation of LSF in this cell type. PMID:12858339

Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.

We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNAmore » staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.« less

Genome-wide identification and characterization of Notch transcription complex-binding sequence-paired sites in leukemia cells.

PubMed

Severson, Eric; Arnett, Kelly L; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S; Shirley Liu, X; Blacklow, Stephen C; Aster, Jon C

2017-05-02

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and have been linked to the Notch responsiveness of a few genes. To assess the overall contribution of SPSs to Notch-dependent gene regulation, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay and applied insights from these in vitro studies to Notch-"addicted" T cell acute lymphoblastic leukemia (T-ALL) cells. We found that SPSs contributed to the regulation of about a third of direct Notch target genes. Although originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5 expression. Our work provides a general method for identifying SPSs in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. Copyright © 2017, American Association for the Advancement of Science.

Eldecalcitol (ED-71), an analog of 1α,25(OH)2D3, inhibits the growth of squamous cell carcinoma (SCC) cells in vitro and in vivo by down-regulating expression of heparin-binding protein 17/fibroblast growth factor-binding protein-1 (HBp17/FGFBP-1) and FGF-2.

PubMed

Shintani, T; Takatsu, F; Rosli, S N Z; Usui, E; Hamada, A; Sumi, K; Hayashido, Y; Toratani, S; Okamoto, Tetsuji

2017-10-01

Heparin-binding protein 17 (HBp17)/fibroblast growth factor-binding protein-1 (FGFBP-1) was first purified from medium conditioned by A431 cells for its capacity to bind to fibroblast growth factors 1 and 2 (FGF-1 and -2). Among FGF family members, FGF-2 is a potent mitogen for various cell types, including vascular endothelial cells, fibroblasts, and cancer cells such as oral squamous cell carcinoma (OSCC) cells. Besides being well known in bone metabolism, the active form of vitamin D 3 , i.e., 1α,25(OH) 2 D 3 (1,25D 3 ), was reported to have protective effects for heart disease and cancer. Previously, we reported that 1,25D 3 inhibited HBp17/FGFBP-1 expression in OSCC cell lines through NF-κB inhibition (IκBα activation) and resulted in the inactivation of FGF-2. In this study, we examined the potential anti-tumor effect of ED-71, an analog of 1α,25(OH) 2 D 3 , for squamous cell carcinoma cells in vitro and in vivo. The cell lines used were OSCC cell lines (NA-HO-1-n-1 and UE-HO-1-u-1), established from oral cancer patients in our laboratory, and an epidermoid carcinoma/SCC cell line (A431). The growth assay in serum-free culture revealed that ED-71 inhibited the growth of the cancer cell lines in a dose-dependent manner. In addition, ED-71 suppressed HBp17/FGFBP-1 expression by inhibiting the NF-κB pathway as did 1,25D 3 . Furthermore, a luciferase reporter assay revealed that the promoter activity of HBp17/FGFBP-1 (region between -217 and +61) was down-regulated by ED-71. Oral administration of ED-71 significantly inhibited the growth of A431-derived tumors in athymic nude mice. Immunohistochemical analysis revealed that the expression of HBp17/FGFBP-1, FGF-2, CD31, and Ki-67 in the tumors of ED71-treated group was down-regulated in comparison to control. These results suggest that ED-71 possesses potential anti-tumor activity for SCCs both in vitro and in vivo. This compound may act directly on the tumor cells or on endothelial cells by modulating the tumor microenvironment.

Human Prostate Side Population Cells Demonstrate Stem Cell Properties in Recombination with Urogenital Sinus Mesenchyme

PubMed Central

Foster, Barbara A.; Gangavarapu, Kalyan J.; Mathew, Grinu; Azabdaftari, Gissou; Morrison, Carl D.; Miller, Austin; Huss, Wendy J.

2013-01-01

Stem cell enrichment provides a tool to examine prostate stem cells obtained from benign and malignant tissue. Functional assays can enrich stem cells based on common stem cell phenotypes, such as high ATP binding cassette (ABC) transporter mediated efflux of Hoechst substrates (side population assay). This functional assay is based upon mechanisms that protect cells from environmental insult thus contributing to the survival and protection of the stem cell population. We have isolated and analyzed cells digested from twelve clinical prostate specimens based on the side population assay. Prostate stem cell properties of the isolated cells were tested by serial recombination with rat urogenital mesenchyme. Recombinants with side population cells demonstrate an increase in the frequency of human ductal growth and the number of glands per recombinant when compared to recombinants with non-side population cells. Isolated cells were capable of prostatic growth for up to three generations in the recombination assay with as little as 125 sorted prostate cells. The ability to reproducibly use cells isolated by fluorescence activated cell sorting from human prostate tissue is an essential step to a better understanding of human prostate stem cell biology. ABC transporter G2 (ABCG2) was expressed in recombinants from side population cells indicating the side population cells have self-renewal properties. Epithelial cell differentiation of recombinants was determined by immunohistochemical analysis for expression of the basal, luminal, and neuroendocrine markers, p63, androgen receptor, prostate specific antigen, and chromogranin A, respectively. Thus, the ABCG2 expressing side population demonstrates multipotency and self-renewal properties indicating stem cells are within this population. PMID:23383057

Fluorescent carbohydrate probes for cell lectins

NASA Astrophysics Data System (ADS)

Galanina, Oxana; Feofanov, Alexei; Tuzikov, Alexander B.; Rapoport, Evgenia; Crocker, Paul R.; Grichine, Alexei; Egret-Charlier, Marguerite; Vigny, Paul; Le Pendu, Jacques; Bovin, Nicolai V.

2001-09-01

Fluorescein labeled carbohydrate (Glyc) probes were synthesized as analytical tools for the study of cellular lectins, i.e. SiaLe x-PAA-flu, Sia 2-PAA-flu, GlcNAc 2-PAA-flu, LacNAc-PAA-flu and a number of similar ones, with PAA a soluble polyacrylamide carrier. The binding of SiaLe x-PAA-flu was assessed using CHO cells transfected with E-selectin, and the binding of Sia 2-PAA-flu was assessed by COS cells transfected with siglec-9. In flow cytometry assays, the fluorescein probes demonstrated a specific binding to the lectin-transfected cells that was inhibited by unlabeled carbohydrate ligands. The intense binding of SiaLe x-PAA- 3H to the E-selectin transfected cells and the lack of binding to both native and permeabilized control cells lead to the conclusion that the polyacrylamide carrier itself and the spacer arm connecting the carbohydrate moiety with PAA did not contribute anymore to the binding. Tumors were obtained from nude mice by injection of CHO E-selectin or mock transfected cells. The fluorescent SiaLe x-PAA-flu probe could bind to the tumor sections from E-selectin positive CHO cells, but not from the control ones. Thus, these probes can be used to reveal specifically the carbohydrate binding sites on cells in culture as well as cells in tissue sections. The use of the confocal spectral imaging technique with Glyc-PAA-flu probes offered the unique possibility to detect lectins in different cells, even when the level of lectin expression was rather low. The confocal mode of spectrum recording provided an analysis of the probe localization with 3D submicron resolution. The spectral analysis (as a constituent part of the confocal spectral imaging technique) enabled interfering signals of the probe and intrinsic cellular fluorescence to be accurately separated, the distribution of the probe to be revealed and its local concentration to be measured.

Salmonella enterica serotype Typhimurium Std fimbriae bind terminal alpha(1,2)fucose residues in the cecal mucosa.

PubMed

Chessa, Daniela; Winter, Maria G; Jakomin, Marcello; Bäumler, Andreas J

2009-02-01

The std operon encodes a fimbrial adhesin of Salmonella enterica serotype Typhimurium that is required for attachment to intestinal epithelial cells and for cecal colonization in the mouse. To study the mechanism by which this virulence factor contributes to colonization we characterized its binding specificity. Std-mediated binding to human colonic epithelial (Caco-2) cells could be abrogated by removing N-linked glycans. Adherence of Std fimbriated S. Typhimurium to Caco-2 cells could be blocked by co-incubation with H type 2 oligosaccharide (Fucalpha1-2Galbeta1-4GlcNAc) or by pretreatment of cells with alpha1-2 fucosidase. In contrast, pretreatment of Caco-2 cells with neuraminidase or co-incubation with the type 2 disaccharide precursor (Galbeta1-4GlcNAc) did not reduce adherence of Std fimbriated S. Typhimurium. Binding of purified Std fimbriae to Fucalpha1-2Galbeta1-4GlcNAc in a solid phase binding assay was competitively inhibited by Ulex europaeus agglutinin-I (UEA-I), a lectin specific for Fucalpha1-2 moieties. Purified Std fimbriae and UEA both bound to a receptor localized in the mucus layer of the murine cecum. These data suggest that the std operon encodes an adhesin that binds an alpha1-2 fucosylated receptor(s) present in the cecal mucosa.

Salmonella enterica serotype Typhimurium Std fimbriae bind terminal α (1,2)fucose residues in the cecal mucosa

PubMed Central

Chessa, Daniela; Winter, Maria G.; Jakomin, Marcello; Bäumler, Andreas J.

2013-01-01

SUMMARY The std operon encodes a fimbrial adhesin of Salmonella enterica serotype Typhimurium that is required for attachment to intestinal epithelial cells and for cecal colonization in the mouse. To study the mechanism by which this virulence factor contributes to colonization we characterized its binding specificity. Std-mediated binding to human colonic epithelial (Caco-2) cells could be abrogated by removing N-linked glycans. Adherence of Std fimbriated S. Typhimurium to Caco-2 cells could be blocked by co-incubation with H type 2 oligosaccharide (Fucα1-2Galβ1-4GlcNAc) or by pretreatment of cells with α1-2 fucosidase. In contrast, pretreatment of Caco-2 cells with neuraminidase or co-incubation with the type 2 disaccharide precursor (Galβ1-4GlcNAc) did not reduce adherence of Std fimbriated S. Typhimurium. Binding of purified Std fimbriae to Fucα1-2Galβ1-4GlcNAc in a solid phase binding assay was competitively inhibited by Ulex europaeus agglutinin-I (UEA-I), a lectin specific for Fucα1-2 moieties. Purified Std fimbriae and UEA both bound to a receptor localized in the mucus layer of the murine cecum. These data suggest that the std operon encodes an adhesin that binds an α1-2 fucosylated receptor(s) present in the cecal mucosa. PMID:19183274

Visualizing double-stranded RNA distribution and dynamics in living cells by dsRNA binding-dependent fluorescence complementation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Xiaofei; College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou, Zhejiang 310036; Deng, Ping

Double-stranded RNA (dsRNA) is an important type of RNA that plays essential roles in diverse cellular processes in eukaryotic organisms and a hallmark in infections by positive-sense RNA viruses. Currently, no in vivo technology has been developed for visualizing dsRNA in living cells. Here, we report a dsRNA binding-dependent fluorescence complementation (dRBFC) assay that can be used to efficiently monitor dsRNA distribution and dynamics in vivo. The system consists of two dsRNA-binding proteins, which are fused to the N- and C-terminal halves of the yellow fluorescent protein (YFP). Binding of the two fusion proteins to a common dsRNA brings themore » split YFP halves in close proximity, leading to the reconstitution of the fluorescence-competent structure and restoration of fluorescence. Using this technique, we were able to visualize the distribution and trafficking of the replicative RNA intermediates of positive-sense RNA viruses in living cells. - Highlights: • A live-cell imaging system was developed for visualizing dsRNA in vivo. • It uses dsRNA binding proteins fused with two halves of a fluorescent protein. • Binding to a common dsRNA enables the reporter to become fluorescent. • The system can efficiently monitor viral RNA replication in living cells.« less

Characterization of protein--DNA interactions using surface plasmon resonance spectroscopy with various assay schemes.

PubMed

Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S

2007-02-27

Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.

Tumor protein D52 expression is post-transcriptionally regulated by T-cell intercellular antigen (TIA) 1 and TIA-related protein via mRNA stability.

PubMed

Motohashi, Hiromi; Mukudai, Yoshiki; Ito, Chihiro; Kato, Kosuke; Shimane, Toshikazu; Kondo, Seiji; Shirota, Tatsuo

2017-05-04

Although tumor protein D52 (TPD52) family proteins were first identified nearly 20 years ago, their molecular regulatory mechanisms remain unclear. Therefore, we investigated the post-transcriptional regulation of TPD52 family genes. An RNA immunoprecipitation (RIP) assay showed the potential binding ability of TPD52 family mRNAs to several RNA-binding proteins, and an RNA degradation assay revealed that TPD52 is subject to more prominent post-transcriptional regulation than are TPD53 and TPD54. We subsequently focused on the 3'-untranslated region (3'-UTR) of TPD52 as a cis -acting element in post-transcriptional gene regulation. Several deletion mutants of the 3'-UTR of TPD52 mRNA were constructed and ligated to the 3'-end of a reporter green fluorescence protein gene. An RNA degradation assay revealed that a minimal cis -acting region, located in the 78-280 region of the 5'-proximal region of the 3'-UTR, stabilized the reporter mRNA. Biotin pull-down and RIP assays revealed specific binding of the region to T-cell intracellular antigen 1 (TIA-1) and TIA-1-related protein (TIAR). Knockdown of TIA-1/TIAR decreased not only the expression, but also the stability of TPD52 mRNA; it also decreased the expression and stability of the reporter gene ligated to the 3'-end of the 78-280 fragment. Stimulation of transforming growth factor-β and epidermal growth factor decreased the binding ability of these factors, resulting in decreased mRNA stability. These results indicate that the 78-280 fragment and TIA-1/TIAR concordantly contribute to mRNA stability as a cis -acting element and trans -acting factor(s), respectively. Thus, we here report the specific interactions between these elements in the post-transcriptional regulation of the TPD52 gene. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

PubMed

Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

2018-05-05

The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

A Polarized Cell Model for Chikungunya Virus Infection: Entry and Egress of Virus Occurs at the Apical Domain of Polarized Cells

PubMed Central

Lim, Pei Jin; Chu, Justin Jang Hann

2014-01-01

Chikungunya virus (CHIKV) has resulted in several outbreaks in the past six decades. The clinical symptoms of Chikungunya infection include fever, skin rash, arthralgia, and an increasing incidence of encephalitis. The re-emergence of CHIKV with more severe pathogenesis highlights its potential threat on our human health. In this study, polarized HBMEC, polarized Vero C1008 and non-polarized Vero cells grown on cell culture inserts were infected with CHIKV apically or basolaterally. Plaque assays, viral binding assays and immunofluorescence assays demonstrated apical entry and release of CHIKV in polarized HBMEC and Vero C1008. Drug treatment studies were performed to elucidate both host cell and viral factors involved in the sorting and release of CHIKV at the apical domain of polarized cells. Disruption of host cell myosin II, microtubule and microfilament networks did not disrupt the polarized release of CHIKV. However, treatment with tunicamycin resulted in a bi-directional release of CHIKV, suggesting that N-glycans of CHIKV envelope glycoproteins could serve as apical sorting signals. PMID:24587455

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamamoto, Hiroyasu; Kuroda, Nana; Uekita, Hiromi

Background: Adiponectin (APN) is an adipocyte-derived bioactive molecule with anti-diabetic and anti-atherogenic properties. Although anti-diabetic effects are mostly mediated by the adiponectin receptors AdipoR1 and AdipoR2, the anti-atherogenic mechanisms have not been fully elucidated. Methods and Results: In this study, we identified E-selectin ligand (ESL)-1 as a novel APN-binding protein by mass spectrometry analysis of HepG2 cell-derived immunoprecipitant with an anti-APN antibody. Cell adhesion assays using fluorescence-labelled monocyte cell line THP-1 cells and human umbilical vein endothelial cells (HUVECs) revealed that APN-pre-treated THP-1 cells had reduced binding ability to HUVECs. This APN-mediated suppressive effect on monocyte binding to endothelial cells was partiallymore » abrogated by targeting ESL-1 with shRNA in THP-1 cells. In addition, serial mutagenesis analysis disclosed that five extracellular amino acids close to the N-terminus of ESL-1 were essential for binding with APN. Conclusion: Our results highlight the fact that interaction between APN and ESL-1 could provide a fundamental mechanism underlying the anti-atherogenic properties of APN. - Highlights: • E-selectin ligand (ESL)-1 was identified as an adiponectin (APN)-binding protein. • ESL-1 bound to APN at its N-terminal 6th-10th amino acids. • shESL-1 reduced the suppressive effect of APN on adhesion of THP-1 cells to HUVECs. • Interaction with ESL may be involved in the anti-atherogenic effects of APN.« less

Identification of amino acids important for binding of Clostridium perfringens epsilon toxin to host cells and to HAVCR1.

PubMed

Ivie, Susan E; McClain, Mark S

2012-09-25

Clostridium perfringens epsilon toxin belongs to the aerolysin-like family of pore-forming toxins and is one of the most potent bacterial toxins known. The epsilon toxin causes fatal enterotoxemia in sheep, goats, and possibly humans. Evidence indicates that the toxin binds to protein receptors including hepatitis A virus cellular receptor 1 (HAVCR1), but the region of the toxin responsible for cell binding has not been identified. In the present study, we identify amino acids within the epsilon toxin important for this cell interaction. Site-specific mutagenesis was used to investigate the role of a surface-accessible cluster of aromatic amino acids, and purified mutant proteins were tested in a series of cell-culture assays to assess cytotoxic activity and cell binding. When added to cells, four mutant proteins (Etx-Y29E, Etx-Y30E, Etx-Y36E and Etx-Y196E) were severely impaired in their ability to not only kill host cells, but also in their ability to permeabilize the plasma membrane. Circular dichroism spectroscopy and thermal stability studies revealed that the wild-type and mutant proteins were similarly folded. Additional experiments revealed that these mutant proteins were defective in binding to host cells and to HAVCR1. These data indicate that an amino acid motif including Y29, Y30, Y36, and Y196 is important for the ability of epsilon toxin to interact with cells and HAVCR1.

Identification of amino acids important for binding of Clostridium perfringens epsilon toxin to host cells and to HAVCR1

PubMed Central

Ivie, Susan E.; McClain, Mark S.

2012-01-01

Clostridium perfringens epsilon toxin belongs to the aerolysin-like family of pore-forming toxins and is one of the most potent bacterial toxins known. The epsilon toxin causes fatal enterotoxemia in sheep, goats, and possibly humans. Evidence indicates that the toxin binds to protein receptors including hepatitis A virus cellular receptor 1 (HAVCR1), but the region of the toxin responsible for cell binding has not been identified. In the present study, we identify amino acids within the epsilon toxin important for this cell interaction. Site-specific mutagenesis was used to investigate the role of a surface-accessible cluster of aromatic amino acids, and purified mutant proteins were tested in a series of cell-culture assays to assess cytotoxic activity and cell binding. When added to cells, four mutant proteins (Etx-Y29E, Etx-Y30E, Etx-Y36E and Etx-Y196E) were severely impaired in their ability to not only kill host cells, but also in their ability to permeabilize the plasma membrane. Circular dichroism spectroscopy and thermal stability studies revealed that the wild-type and mutant proteins were similarly folded. Additional experiments revealed that these mutant proteins were defective in binding to host cells and to HAVCR1. These data indicate that an amino acid motif including Y29, Y30, Y36, and Y196 is important for the ability of epsilon toxin to interact with cells and HAVCR1. PMID:22938730

Ligand binding to 2΄-deoxyguanosine sensing riboswitch in metabolic context

PubMed Central

Kim, Yong-Boum; Wacker, Anna; von Laer, Karl; Rogov, Vladimir V.; Suess, Beatrix

2017-01-01

Abstract The mfl-riboswitch is a transcriptional off-switch, which down-regulates expression of subunit β of ribonucleotide reductase in Mesoplasma florum upon 2΄-deoxyguanosine binding. We characterized binding of 2΄-deoxyguanosine to the mfl-aptamer domain (WT aptamer) and a sequence-stabilized aptamer (MT aptamer) under in vitro and ‘in-cell-like’ conditions by isothermal titration calorimetry (ITC) and nuclear magnetic resonance (NMR) spectroscopy. ‘In-cell-like’ environment was simulated by Bacillus subtilis cell extract, in which both aptamers remained sufficiently stable to detect the resonances of structural elements and ligand binding in 2D NMR experiments. Under ‘in-cell-like’-environment, (i) the WT aptamer bound the endogenous metabolite guanosine and (ii) 2΄-deoxyguanosine efficiently displaced guanosine from the WT aptamer. In contrast, MT aptamer exhibited moderate binding to 2΄-deoxyguanosine and weak binding to guanosine. NMR experiments indicated that binding of guanosine was not limited to the aptamer domain of the riboswitch but also the full-length mfl-riboswitch bound guanosine, impacting on the regulation efficiency of the riboswitch and hinting that, in addition to 2΄-deoxyguanosine, guanosine plays a role in riboswitch function in vivo. Reporter gene assays in B. subtilis demonstrated the regulation capacity of the WT aptamer, whereas the MT aptamer with lower affinity to 2΄-deoxyguanosine was not able to regulate gene expression. PMID:28115631

Autoregulation and Virulence Control by the Toxin-Antitoxin System SavRS in Staphylococcus aureus

PubMed Central

Wen, Wen; Liu, Banghui; Xue, Lu; Zhu, Zhongliang; Niu, Liwen

2018-01-01

ABSTRACT Toxin-antitoxin (TA) systems play diverse physiological roles, such as plasmid maintenance, growth control, and persister cell formation, but their involvement in bacterial pathogenicity remains largely unknown. Here, we have identified a novel type II toxin-antitoxin system, SavRS, and revealed the molecular mechanisms of its autoregulation and virulence control in Staphylococcus aureus. Electrophoretic mobility shift assay and isothermal titration calorimetry data indicated that the antitoxin SavR acted as the primary repressor bound to its own promoter, while the toxin SavS formed a complex with SavR to enhance the ability to bind to the operator site. DNase I footprinting assay identified the SavRS-binding site containing a short and long palindrome in the promoter region. Further, mutation and DNase I footprinting assay demonstrated that the two palindromes were crucial for DNA binding and transcriptional repression. More interestingly, genetic deletion of the savRS system led to the increased hemolytic activity and pathogenicity in a mouse subcutaneous abscess model. We further identified two virulence genes, hla and efb, by real-time quantitative reverse transcription-PCR and demonstrated that SavR and SavRS could directly bind to their promoter regions to repress virulence gene expression. PMID:29440365

A monoclonal antibody based elisa for quantitation of human leukaemia inhibitory factor.

PubMed

Taupin, J L; Gualde, N; Moreau, J F

1997-02-01

The authors report on the development of a new sandwich enzyme-linked immunoabsorbent assay (ELISA) for the quantitation of the human cytokine leukaemia inhibitory factor/human interleukin for DA cells (LIF/HILDA) with high accuracy and sensitivity (23 pg/ml), in less than 5 h and in various biological fluids. The antibodies used in this assay were raised against recombinant glycosylated LIF expressed in vivo following inoculation of recombinant vaccinia viruses, and screened with the biologically active cytokine in a flow cytometry assay using cells expressing a membrane-bound form of LIF. Furthermore, this home-made assay was compared with two commercially available ELISA kits. The results led to the conclusion that these three assays are far from being equivalent between each other, in terms of sensitivity towards non-glycosylated vs glycosylated LIF. Two major parameters must be incriminated: the glycosylation status of the LIF molecule used as the calibrator, and the binding characteristics of the monoclonal antibodies used to set up these assays toward LIF derived from Escherichia coli or from eukaryotic cells. This points out the importance of these parameters for the design of ELISAs meant for the quantitation of glycosylated cytokines in biological fluids.

Visualizing repetitive diffusion activity of double-strand RNA binding proteins by single molecule fluorescence assays.

PubMed

Koh, Hye Ran; Wang, Xinlei; Myong, Sua

2016-08-01

TRBP, one of double strand RNA binding proteins (dsRBPs), is an essential cofactor of Dicer in the RNA interference pathway. Previously we reported that TRBP exhibits repetitive diffusion activity on double strand (ds)RNA in an ATP independent manner. In the TRBP-Dicer complex, the diffusion mobility of TRBP facilitates Dicer-mediated RNA cleavage. Such repetitive diffusion of dsRBPs on a nucleic acid at the nanometer scale can be appropriately captured by several single molecule detection techniques. Here, we provide a step-by-step guide to four different single molecule fluorescence assays by which the diffusion activity of dsRBPs on dsRNA can be detected. One color assay, termed protein induced fluorescence enhancement enables detection of unlabeled protein binding and diffusion on a singly labeled RNA. Two-color Fluorescence Resonance Energy Transfer (FRET) in which labeled dsRBPs is applied to labeled RNA, allows for probing the motion of protein along the RNA axis. Three color FRET reports on the diffusion movement of dsRBPs from one to the other end of RNA. The single molecule pull down assay provides an opportunity to collect dsRBPs from mammalian cells and examine the protein-RNA interaction at single molecule platform. Copyright © 2016 Elsevier Inc. All rights reserved.

SOX2 regulates common and specific stem cell features in the CNS and endoderm derived organs.

PubMed

Hagey, Daniel W; Klum, Susanne; Kurtsdotter, Idha; Zaouter, Cecile; Topcic, Danijal; Andersson, Olov; Bergsland, Maria; Muhr, Jonas

2018-02-01

Stem cells are defined by their capacities to self-renew and generate progeny of multiple lineages. The transcription factor SOX2 has key roles in the regulation of stem cell characteristics, but whether SOX2 achieves these functions through similar mechanisms in distinct stem cell populations is not known. To address this question, we performed RNA-seq and SOX2 ChIP-seq on embryonic mouse cortex, spinal cord, stomach and lung/esophagus. We demonstrate that, although SOX2 binds a similar motif in the different cell types, its target regions are primarily cell-type-specific and enriched for the distinct binding motifs of appropriately expressed interacting co-factors. Furthermore, cell-type-specific SOX2 binding in endodermal and neural cells is most often found around genes specifically expressed in the corresponding tissue. Consistent with this, we demonstrate that SOX2 target regions can act as cis-regulatory modules capable of directing reporter expression to appropriate tissues in a zebrafish reporter assay. In contrast, SOX2 binding sites found in both endodermal and neural tissues are associated with genes regulating general stem cell features, such as proliferation. Notably, we provide evidence that SOX2 regulates proliferation through conserved mechanisms and target genes in both germ layers examined. Together, these findings demonstrate how SOX2 simultaneously regulates cell-type-specific, as well as core transcriptional programs in neural and endodermal stem cells.

Analysis of in vitro interactions of protein tyrosine phosphatase 1B with insulin receptors.

PubMed

Wang, X Y; Bergdahl, K; Heijbel, A; Liljebris, C; Bleasdale, J E

2001-02-28

One strategy to treat the insulin resistance that is central to type II diabetes mellitus may be to maintain insulin receptors (IR) in the active (tyrosine phosphorylated) form. Because protein tyrosine phosphatase 1B (PTP1B) binds and subsequently dephosphorylates IR, inhibitors of PTP1B-IR binding are potential insulin 'sensitizers.' A Scintillation Proximity Assay (SPA) was developed to characterize and quantitate PTP1B-IR binding. Human IR were solubilized and captured on wheat germ agglutinin (WGA)-coated SPA beads. Subsequent binding of human, catalytically inactive [35S] PTP1B Cys(215)/Ser (PTP1B(C215S)) to the lectin-anchored IR results in scintillation from the SPA beads that can be quantitated. Binding of PTP1B to IR was pH- and divalent cation-sensitive. Ca(2+) and Mn(2+), but not Mg(2+), dramatically attenuated the loss of PTP1B-IR binding observed when pH was raised from 6.2 to 7.8. PTP1B binding to IR from insulin-stimulated cells was much greater than to IR from unstimulated cells and was inhibited by either an antiphosphotyrosine antibody or treatment of IR with alkaline phosphatase, suggesting that tyrosine phosphorylation of IR is required for PTP1B binding. Phosphopeptides modeled after various IR phosphotyrosine domains each only partially inhibited PTP1B-IR binding, indicating that multiple domains of IR are likely involved in binding PTP1B. However, competitive displacement of [35S]PTP1B(C215S) by PTP1B(C215S) fitted best to a single binding site with a K(d) in the range 100-1000 nM, depending upon pH and divalent cations. PNU-200898, a potent and selective inhibitor of PTP1B whose orientation in the active site of PTP1B has been solved, competitively inhibited catalysis and PTP1B-IR binding with equal potency. The results of this novel assay for PTP1B-IR binding suggest that PTP1B binds preferentially to tyrosine phosphorylated IR through its active site and that binding may be susceptible to therapeutic disruption by small molecules.

Insulin-like Growth Factor 1 Regulates the Expression of ATP-Binding Cassette Transporter A1 in Pancreatic Beta Cells.

PubMed

Lyu, J; Imachi, H; Iwama, H; Zhang, H; Murao, K

2016-05-01

ATP-binding cassette transporter A1 (ABCA1) in pancreatic beta cells influences insulin secretion and cholesterol homeostasis. The present study investigates whether insulin-like growth factor 1 (IGF-1), which mediates stimulation of ABCA1 gene expression, could also interfere with the phosphatidylinositol 3-kinase (PI3-K) cascade.ABCA1 expression was examined by real-time polymerase chain reaction (PCR), Western blot analysis, and a reporter gene assay in rat insulin-secreting INS-1 cells incubated with IGF-1. The binding of forkhead box O1 (FoxO1) protein to the ABCA1 promoter was assessed by a chromatin immunoprecipitation (ChIP) assay. ABCA1 protein levels increased in response to rising concentrations of IGF-1. Real-time PCR analysis showed a significant increase in ABCA1 mRNA expression. However, both effects were suppressed after silencing the IGF-1 receptor. In parallel with its effect on endogenous ABCA1 mRNA levels, IGF-1 induced the activity of a reporter construct containing the ABCA1 promoter, while it was abrogated by LY294002, a specific inhibitor of PI3-K. Constitutively active Akt stimulated activity of the ABCA1 promoter, and a dominant-negative mutant of Akt or mutagenesis of the FoxO1 response element in the ABCA1 promoter abolished the ability of IGF-1 to stimulate promoter activity. A ChIP assay showed that FoxO1 mediated its transcriptional activity by directly binding to the ABCA1 promoter region. The knockdown of FoxO1 disrupted the effect of IGF-1 on ABCA1 expression. Furthermore, IGF-1 promoted cholesterol efflux and reduced the pancreatic lipotoxicity. These results demonstrate that the PI3-K/Akt/FoxO1 pathway contributes to the regulation of ABCA1 expression in response to IGF-1 stimulation. © Georg Thieme Verlag KG Stuttgart · New York.

Surface IgM λ light chain is involved in the binding and infection of infectious bursal disease virus (IBDV) to DT40 cells.

PubMed

Chi, Jiaqi; You, Leiming; Li, Peipei; Teng, Man; Zhang, Gaiping; Luo, Jun; Wang, Aiping

2018-04-01

Infectious bursal disease virus (IBDV) is an important immunosuppressive virus in chickens. Surface immunoglobulin M (sIgM)-bearing B lymphocytes act as the major targets of IBDV in the bursa of Fabricius, and sIgM may function as one of the membrane binding sites responsible for IBDV infection. Recently, using the virus overlay protein binding assay, the chicken λ light chain of sIgM was identified to specifically interact with IBDV in a virulence-independent manner in vitro. To further investigate sIgM λ light chain-mediated IBDV binding and infection in pre-B cells, the cell line DT40, which is susceptible to both pathogenic and attenuated IBDV, was used. Based on the RNA interference strategy, the DT40 cell line whose λ light chain of sIgM was stably knocked down, herein termed DT40LKD, was generated by the genomic integration of a specific small hairpin RNA and a green fluorescence protein co-expression construct. Flow cytometry analysis indicated that the binding of IBDV to DT40LKD cells was significantly reduced due to the loss of sIgM λ light chain. In particular, reduced viral replication was observed in IBDV-incubated DT40LKD cells, and no viral release into cell culture medium was detected by the IBDV rapid diagnostic strips. In addition, the rescue of sIgM λ light chain expression restored viral binding and replication in DT40LKD cells. These results show that sIgM λ light chain appears to be beneficial for IBDV attachment and infection, suggesting that sIgM acts as a binding site involved in IBDV infection.

Specific binding of sup 125 I-rErythropoietin to Friend polycythemia virus-transformed erythroleukemia cells purified by centrifugal elutriation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Correa, P.N.; Bard, V.; Axelrad, A.A.

1990-01-01

We have used countercurrent centrifugal elutriation (CCE) to determine the distribution of cells with respect to cell volume and buoyant density for an erythroleukemia cell line (JG6) transformed by the polycythemia strain of Friend virus (FV-P), and to determine the effect of inducing the cells to differentiate with dimethylsulfoxide (DMSO) on this distribution. CCE made it possible to obtain suspensions of modal JG6 populations virtually free of dead cells and uniform with respect to volume and buoyant density. These modal populations were assayed for specific binding of erythropoietin (Epo). Between 500 and 550 Epo receptors per cell were detected. Thesemore » belonged to a single class having a dissociation constant of 0.36 nM. DMSO induction of differentiation of the JG6 cells had no effect on the number of Epo receptors expressed.« less

Discriminating the hemolytic risk of blood type A plasmas using the complement hemolysis using human erythrocytes (CHUHE) assay.

PubMed

Cunnion, Kenji M; Hair, Pamela S; Krishna, Neel K; Sass, Megan A; Enos, Clinton W; Whitley, Pamela H; Maes, Lanne Y; Goldberg, Corinne L

2017-03-01

The agglutination-based cross-matching method is sensitive for antibody binding to red blood cells but is only partially predictive of complement-mediated hemolysis, which is important in many acute hemolytic transfusion reactions. Here, we describe complement hemolysis using human erythrocytes (CHUHE) assays that directly evaluate complement-mediated hemolysis between individual serum-plasma and red blood cell combinations. The CHUHE assay is used to evaluate correlations between agglutination titers and complement-mediated hemolysis as well as the hemolytic potential of plasma from type A blood donors. Plasma or serum from each type A blood donor was incubated with AB or B red blood cells in the CHUHE assay and measured for free hemoglobin release. CHUHE assays for serum or plasma demonstrate a wide, dynamic range and high sensitivity for complement-mediated hemolysis for individual serum/plasma and red blood cell combinations. CHUHE results suggest that agglutination assays alone are only moderately predictive of complement-mediated hemolysis. CHUHE results also suggest that plasma from particular type A blood donors produce minimal complement-mediated hemolysis, whereas plasma from other type A blood donors produce moderate to high-level complement-mediated hemolysis, depending on the red blood cell donor. The current results indicate that the CHUHE assay can be used to assess complement-mediated hemolysis for plasma or serum from a type A blood donor, providing additional risk discrimination over agglutination titers alone. © 2016 AABB.

International Validation of Two Human Recombinant Estrogen ...

EPA Pesticide Factsheets

An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay using a ligand-binding domain of the human ER. Twenty three compounds were tested in 6 laboratories for the FW assay and 5 for the CERJ assay, which included three controls (used with every run), 9 uncoded, and 14 coded chemicals across 3 subtasks. The overall goal of this validation study was to demonstrate the ability of each of the two assays to reliably classify the test chemicals as binders or non-binders. Laboratories had little trouble with the ER binders that produced a full binding curve when using either the CERI or FW assays. As is typical with all ER competitive binding assays, the weak binders proved to be more challenging. However, overall results from both the FW and CERI assays were consistent and in agreement with expected classifications regardless of the form of the hrER (i.e., full length ER versus an ER ligand binding domain) or the subtle differences in the protocols for conducting each assay. The reproducibility and accuracy for classification of chemicals as potential ER binders and non- binders using the FW and CERI hrER binding assays were comparable to that of the U.S.EPA’s existing ER binding test guideline OPPTS 890.1250, while providing an improved, highe

Glucocorticoid Induction of Occludin Expression and Endothelial Barrier Requires Transcription Factor p54 NONO

PubMed Central

Keil, Jason M.; Liu, Xuwen; Antonetti, David A.

2013-01-01

Purpose. Glucocorticoids (GCs) effectively reduce retinal edema and induce vascular barrier properties but possess unwanted side effects. Understanding GC induction of barrier properties may lead to more effective and specific therapies. Previous work identified the occludin enhancer element (OEE) as a GC-responsive cis-element in the promoters of multiple junctional genes, including occludin, claudin-5, and cadherin-9. Here, we identify two OEE-binding factors and determine their contribution to GC induction of tight junction (TJ) gene expression and endothelial barrier properties. Methods. OEE-binding factors were isolated from human retinal endothelial cells (HREC) using DNA affinity purification followed by MALDI-TOF MS/MS. Chromatin immunoprecipitation (ChIP) assays determined in situ binding. siRNA was used to evaluate the role of trans-acting factors in transcription of TJ genes in response to GC stimulation. Paracellular permeability was determined by quantifying flux through a cell monolayer, whereas transendothelial electrical resistance (TER) was measured using the ECIS system. Results. MS/MS analysis of HREC nuclear extracts identified the heterodimer of transcription factors p54/NONO (p54) and polypyrimidine tract-binding protein-associated splicing factor (PSF) as OEE-binding factors, which was confirmed by ChIP assay from GC-treated endothelial cells and rat retina. siRNA knockdown of p54 demonstrated that this factor is necessary for GC induction of occludin and claudin-5 expression. Further, p54 knockdown ablated the pro-barrier effects of GC treatment. Conclusions. p54 is essential for GC-mediated expression of occludin, claudin-5, and barrier induction, and the p54/PSF heterodimer may contribute to normal blood-retinal barrier (BRB) induction in vivo. Understanding the mechanism of GC induction of BRB properties may provide novel therapies for macular edema. PMID:23640037

Glucocorticoid induction of occludin expression and endothelial barrier requires transcription factor p54 NONO.

PubMed

Keil, Jason M; Liu, Xuwen; Antonetti, David A

2013-06-12

Glucocorticoids (GCs) effectively reduce retinal edema and induce vascular barrier properties but possess unwanted side effects. Understanding GC induction of barrier properties may lead to more effective and specific therapies. Previous work identified the occludin enhancer element (OEE) as a GC-responsive cis-element in the promoters of multiple junctional genes, including occludin, claudin-5, and cadherin-9. Here, we identify two OEE-binding factors and determine their contribution to GC induction of tight junction (TJ) gene expression and endothelial barrier properties. OEE-binding factors were isolated from human retinal endothelial cells (HREC) using DNA affinity purification followed by MALDI-TOF MS/MS. Chromatin immunoprecipitation (ChIP) assays determined in situ binding. siRNA was used to evaluate the role of trans-acting factors in transcription of TJ genes in response to GC stimulation. Paracellular permeability was determined by quantifying flux through a cell monolayer, whereas transendothelial electrical resistance (TER) was measured using the ECIS system. MS/MS analysis of HREC nuclear extracts identified the heterodimer of transcription factors p54/NONO (p54) and polypyrimidine tract-binding protein-associated splicing factor (PSF) as OEE-binding factors, which was confirmed by ChIP assay from GC-treated endothelial cells and rat retina. siRNA knockdown of p54 demonstrated that this factor is necessary for GC induction of occludin and claudin-5 expression. Further, p54 knockdown ablated the pro-barrier effects of GC treatment. p54 is essential for GC-mediated expression of occludin, claudin-5, and barrier induction, and the p54/PSF heterodimer may contribute to normal blood-retinal barrier (BRB) induction in vivo. Understanding the mechanism of GC induction of BRB properties may provide novel therapies for macular edema.

Localization in human interleukin 2 of the binding site to the alpha chain (p55) of the interleukin 2 receptor.

PubMed Central

Sauvé, K; Nachman, M; Spence, C; Bailon, P; Campbell, E; Tsien, W H; Kondas, J A; Hakimi, J; Ju, G

1991-01-01

Human interleukin 2 (IL-2) analogs with defined amino acid substitutions were used to identify specific residues that interact with the 55-kDa subunit (p55) or alpha chain of the human IL-2 receptor. Analog proteins containing specific substitutions for Lys-35, Arg-38, Phe-42, or Lys-43 were inactive in competitive binding assays for p55. All of these analogs retained substantial competitive binding to the intermediate-affinity p70 subunit (beta chain) of the receptor complex. The analogs varied in ability to interact with the high-affinity p55/p70 receptor. Despite the lack of binding to p55, all analogs exhibited significant biological activity, as assayed on the murine CTLL cell line. The dissociation constants of Arg-38 and Phe-42 analogs for p70 were consistent with intermediate-affinity binding; the Kd values were not significantly affected by the presence of p55 in binding to the high-affinity IL-2 receptor complex. These results confirm the importance of the B alpha-helix in IL-2 as the locus for p55-receptor binding and support a revised model of IL-2-IL-2 receptor interaction. PMID:2052547

Purification, characterization and anticancer activity of a polysaccharide from Panax ginseng.

PubMed

Li, Cong; Cai, Jianping; Geng, Jingshu; Li, Yinghong; Wang, Zhenyu; Li, Rui

2012-12-01

In this study, we purified a homogeneous polysaccharide (PGPW1) from the root of Panax ginseng. Its molecular weight was estimated to be 3.5×10(5) Da by high performance liquid chromatography (HPLC) and Gas chromatography (GC) analysis identified that PGPW1 contained Glc, Gal, Man and Ara in the molar ratio of 3.3:1.2:0.5:1.1. Furthermore the antitumor potential of PGPW1 on human bladder T24 cells was evaluated in vitro by MTT, lactate dehydrogenase (LDH), wound scratch and transwell motility assays. PGPW1 dose-dependently displayed potent anti-proliferation and anti-metastatic activities. Moreover the modulating effect of PGPW1 on the binding of (3)H-NMS to M3 muscarinic receptors on the surface of T24 cells was evaluated. In muscarinic receptor binding assay, the attenuated expression of M3 muscarinic receptor on the surface of T24 cells by PGPW1 would contribute to its antitumor functions. All the data indicated the potential of its clinical application for the prevention and treatment of bladder cancer metastasis. Copyright © 2012 Elsevier B.V. All rights reserved.

[NF-kappaB-induced gp96 up-regulation promotes hepatocyte growth, cell cycle progression and transition].

PubMed

Feng, Cong; Wu, Bo; Fan, Hongxia; Li, Changfei; Meng, Songdong

2014-10-04

To investigate the mechanism of gp96 raised during hepatitis B virus (HBV) infection and the pathological mechanism. The mechanism of NF-KB activating gp96 expression was determined by bioinformatics analysis, luciferase reporter assay, real-time PCR and Western blot. The effect of over-expression and knockdown gp96 expression by transfection or RNA interference on hepatocyte proliferation, apoptosis and cell cycle was examined by CCK-8 and flow cytometry. The role of gp96 for HCC development was determined by epithelial-mesenchymal transition (EMT) and colony formation assay. NF-kB significantly increased the gp96 expression by binding to the NF-kappaB binding site. Over-expression and knockdown studies both show that gp96 promoted hepatocyte proliferation, inhibited apoptosis, and induced G0/G1 to S phase cell cycle progression. Moreover, gp96 induced epithelial-mesenchymal transition and increased colony formation ability of hepatocytes. Our results therefore provide insights in chronic HBV infection-induced gp96 expression, and indicate that elevated gp96 may contribute to HCC development during chronic inflammation.

Elucidating pathways of Toxoplasma gondii invasion in the gastrointestinal tract: involvement of the tight junction protein occludin.

PubMed

Weight, Caroline M; Jones, Emily J; Horn, Nikki; Wellner, Nikolaus; Carding, Simon R

2015-10-01

Toxoplasma gondii is an obligate intracellular parasite infecting one third of the world's population. The small intestine is the parasite's primary route of infection, although the pathway of epithelium transmigration remains unclear. Using an in vitro invasion assay and live imaging we showed that T. gondii (RH) tachyzoites infect and transmigrate between adjacent intestinal epithelial cells in polarized monolayers without altering barrier integrity, despite eliciting the production of specific inflammatory mediators and chemokines. During invasion, T. gondii co-localized with occludin. Reducing the levels of endogenous cellular occludin with specific small interfering RNAs significantly reduced the ability of T. gondii to penetrate between and infect epithelial cells. Furthermore, an in vitro invasion and binding assays using recombinant occludin fragments established the capacity of the parasite to bind occludin and in particular to the extracellular loops of the protein. These findings provide evidence for occludin playing a role in the invasion of T. gondii in small intestinal epithelial cells. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Variability of cholesterol accessibility in human red blood cells measured using a bacterial cholesterol-binding toxin

PubMed Central

Chakrabarti, Rima S; Ingham, Sally A; Kozlitina, Julia; Gay, Austin; Cohen, Jonathan C; Radhakrishnan, Arun; Hobbs, Helen H

2017-01-01

Cholesterol partitions into accessible and sequestered pools in cell membranes. Here, we describe a new assay using fluorescently-tagged anthrolysin O, a cholesterol-binding bacterial toxin, to measure accessible cholesterol in human red blood cells (RBCs). Accessible cholesterol levels were stable within individuals, but varied >10 fold among individuals. Significant variation was observed among ethnic groups (Blacks>Hispanics>Whites). Variation in accessibility of RBC cholesterol was unrelated to the cholesterol content of RBCs or plasma, but was associated with the phospholipid composition of the RBC membranes and with plasma triglyceride levels. Pronase treatment of RBCs only modestly altered cholesterol accessibility. Individuals on hemodialysis, who have an unexplained increase in atherosclerotic risk, had significantly higher RBC cholesterol accessibility. Our data indicate that RBC accessible cholesterol is a stable phenotype with significant inter-individual variability. Factors both intrinsic and extrinsic to the RBC contribute to variation in its accessibility. This assay provides a new tool to assess cholesterol homeostasis among tissues in humans. DOI: http://dx.doi.org/10.7554/eLife.23355.001 PMID:28169829

Secretion and translocation signals and DspB/F-binding domains in the type III effector DspA/E of Erwinia amylovora.

PubMed

Oh, Chang-Sik; Carpenter, Sara C D; Hayes, Marshall L; Beer, Steven V

2010-04-01

DspA/E is a type III effector of Erwinia amylovora, the bacterial pathogen that causes fire blight disease in roseaceous plants. This effector is indispensable for disease development, and it is translocated into plant cells. A DspA/E-specific chaperone, DspB/F, is necessary for DspA/E secretion and possibly for its translocation. In this work, DspB/F-binding sites and secretion and translocation signals in the DspA/E protein were determined. Based on yeast two-hybrid assays, DspB/F was found to bind DspA/E within the first 210 amino acids of the protein. Surprisingly, both DspB/F and OrfA, the putative chaperone of Eop1, also interacted with the C-terminal 1059 amino acids of DspA/E; this suggests another chaperone-binding site. Secretion and translocation assays using serial N-terminal lengths of DspA/E fused with the active form of AvrRpt2 revealed that at least the first 109 amino acids, including the first N-terminal chaperone-binding motif and DspB/F, were required for efficient translocation of DspA/E, although the first 35 amino acids were sufficient for its secretion and the presence of DspB/F was not required. These results indicate that secretion and translocation signals are present in the N terminus of DspA/E, and that at least one DspB/F-binding motif is required for efficient translocation into plant cells.

Characterization of binding affinity of CJ-023,423 for human prostanoid EP4 receptor.

PubMed

Murase, Akio; Nakao, Kazunari; Takada, Junji

2008-01-01

In order to characterize the receptor binding pharmacology of CJ-023,423, a potent and selective EP4 antagonist, we performed a radioligand receptor binding assay under various assay conditions. An acidic (pH 6) and hypotonic buffer is a conventional, well-known buffer for prostaglandin E2 receptor binding assays. CJ-023,423 showed moderate binding affinity for human EP4 receptor under conventional buffer conditions. However, its binding affinity was greatly increased under neutral (pH 7.4) and isotonic buffer conditions. In this report, the binding mechanism between CJ-023,423 and human EP4 receptor is discussed based on the binding affinities determined under various assay conditions. Copyright 2008 S. Karger AG, Basel.

Medicinal activities of the leaves of Musa sapientum var. sylvesteris in vitro

PubMed Central

Sahaa, Repon Kumer; Acharyaa, Srijan; Shovon, Syed Sohidul Haque; Royb, Priyanka

2013-01-01

Objective This study is to investigate the medicinal value of methanolic extract of the leaves of Musa sapientum var. sylvesteris in Bangladesh. Methods Several biochemical assays, thin layer chormatogarphy and ultra-violet spectroscopy were used to detect the presence of various types of compounds in this extract. Antioxidant effects were measured by DPPH scavenging assay, total reducing assay and hydrogen peroxide scavenging assay. Receptor binding activities and hydrogen peroxide induced hemolysis assay were performed by hemagglutination assay and hemolysis assay using erythrocytes. Disk diffusion assay was performed to show the antibacterial effect of the extract. Results Methanolic extract of the leaves showed antioxidant and antibacterial activity in vitro. The extract showed hemaglutination inhibition activities and hydrogen peroxide induced hemolysis inhibition activity of human red blood cells. Conclusion Musa sapientum var. sylvesteris can be an useful medicinal plant. PMID:23730561

Human Krüppel-related 3 (HKR3) Is a Novel Transcription Activator of Alternate Reading Frame (ARF) Gene*

PubMed Central

Yoon, Jae-Hyeon; Choi, Won-Il; Jeon, Bu-Nam; Koh, Dong-In; Kim, Min-Kyeong; Kim, Myung-Hwa; Kim, Jungho; Hur, Sujin Susanne; Kim, Kyung-Sup; Hur, Man-Wook

2014-01-01

HKR3 (Human Krüppel-related 3) is a novel POK (POZ-domain Krüppel-like zinc-finger) family transcription factor. Recently, some of the POK (POZ-domain Krüppel-like zinc finger) family proteins have been shown to play roles in cell cycle arrest, apoptosis, cell proliferation, and oncogenesis. We investigated whether HKR3, an inhibitor of cell proliferation and an uncharacterized POK family protein, could regulate the cell cycle by controlling expression of genes within the p53 pathway (ARF-MDM2-TP53-p21WAF/CDKN1A). HKR3 potently activated the transcription of the tumor suppressor gene ARF by acting on the proximal promoter region (bp, −149∼+53), which contains Sp1 and FBI-1 binding elements (FREs). HKR3 interacted with the co-activator p300 to activate ARF transcription, which increased the acetylation of histones H3 and H4 within the proximal promoter. Oligonucleotide pull-down assays and ChIP assays revealed that HKR3 interferes with the binding of the proto-oncogenic transcription repressor FBI-1 to proximal FREs, thus derepressing ARF transcription. PMID:24382891

Alpha-synuclein aggregates activate calcium pump SERCA leading to calcium dysregulation.

PubMed

Betzer, Cristine; Lassen, Louise Berkhoudt; Olsen, Anders; Kofoed, Rikke Hahn; Reimer, Lasse; Gregersen, Emil; Zheng, Jin; Calì, Tito; Gai, Wei-Ping; Chen, Tong; Moeller, Arne; Brini, Marisa; Fu, Yuhong; Halliday, Glenda; Brudek, Tomasz; Aznar, Susana; Pakkenberg, Bente; Andersen, Jens Peter; Jensen, Poul Henning

2018-05-01

Aggregation of α-synuclein is a hallmark of Parkinson's disease and dementia with Lewy bodies. We here investigate the relationship between cytosolic Ca 2+ and α-synuclein aggregation. Analyses of cell lines and primary culture models of α-synuclein cytopathology reveal an early phase with reduced cytosolic Ca 2+ levels followed by a later Ca 2+ increase. Aggregated but not monomeric α-synuclein binds to and activates SERCA in vitro , and proximity ligation assays confirm this interaction in cells. The SERCA inhibitor cyclopiazonic acid (CPA) normalises both the initial reduction and the later increase in cytosolic Ca 2+ CPA protects the cells against α-synuclein-aggregate stress and improves viability in cell models and in Caenorhabditis elegans in vivo Proximity ligation assays also reveal an increased interaction between α-synuclein aggregates and SERCA in human brains affected by dementia with Lewy bodies. We conclude that α-synuclein aggregates bind SERCA and stimulate its activity. Reducing SERCA activity is neuroprotective, indicating that SERCA and down-stream processes may be therapeutic targets for treating α-synucleinopathies. © 2018 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

Mitochondrial-nuclear communication by prohibitin shuttling under oxidative stress.

PubMed

Sripathi, Srinivas R; He, Weilue; Atkinson, Cameron L; Smith, Joseph J; Liu, Zhicong; Elledge, Beth M; Jahng, Wan Jin

2011-10-04

Mitochondrial-nuclear communication is critical for maintaining mitochondrial activity under stress conditions. Adaptation of the mitochondrial-nuclear network to changes in the intracellular oxidation and reduction milieu is critical for the survival of retinal and retinal pigment epithelial (RPE) cells, in relation to their high oxygen demand and rapid metabolism. However, the generation and transmission of the mitochondrial signal to the nucleus remain elusive. Previously, our in vivo study revealed that prohibitin is upregulated in the retina, but downregulated in RPE cells in the aging and diabetic model. In this study, the functional role of prohibitin in the retina and RPE cells was examined using biochemical methods, including a lipid binding assay, two-dimensional gel electrophoresis, immunocytochemistry, Western blotting, and a knockdown approach. Protein depletion by siRNA characterized prohibitin as an anti-apoptotic molecule in mitochondria, while the lipid binding assay demonstrated subcellular communication between mitochondria and the nucleus under oxidative stress. The changes in the expression and localization of mitochondrial prohibitin triggered by reactive oxygen species are crucial for mitochondrial integrity. We propose that prohibitin shuttles between mitochondria and the nucleus as an anti-apoptotic molecule and a transcriptional regulator in a stress environment in the retina and RPE cells.

Nuclear blebbing of biologically active organoselenium compound towards human cervical cancer cell (HeLa): in vitro DNA/HSA binding, cleavage and cell imaging studies.

PubMed

Rizvi, Masood Ahmad; Zaki, Mehvash; Afzal, Mohd; Mane, Manoj; Kumar, Manjeet; Shah, Bhahwal Ali; Srivastav, Saurabh; Srikrishna, Saripella; Peerzada, Ghulam Mustafa; Tabassum, Sartaj

2015-01-27

New pharmacophore organoselenium compound (1) was designed, synthesized and characterized by various spectroscopic methods (IR, ESI-MS, (1)H, (13)C and (77)Se NMR) and further confirmed by X-ray crystallography. Compound 1 consists of two 3,5-bis(trifluoromethyl)phenyl units which are connected to the selenium atom via the organometallic C-Se bond. In vitro DNA binding studies of 1 was investigated by absorption and emission titration methods which revealed that 1 recognizes the minor groove of DNA in accordance with molecular docking studies with the DNA duplex. Gel electrophoretic assay demonstrates the ability of 1 to cleave pBR322 DNA through hydrolytic process which was further validated by T4 religation assay. To understand the drug-protein interaction of which ultimate molecular target was DNA, the affinity of 1 towards HSA was also investigated by the spectroscopic and molecular modeling techniques which showed hydrophobic interaction in the subdomain IIA of HSA. Furthermore, the intracellular localization of 1 was evidenced by cell imaging studies using HeLa cells. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Curcumin Regulates Low-Linear Energy Transfer {gamma}-Radiation-Induced NF{kappa}B-Dependent Telomerase Activity in Human Neuroblastoma Cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aravindan, Natarajan, E-mail: naravind@ouhsc.ed; Veeraraghavan, Jamunarani; Madhusoodhanan, Rakhesh

2011-03-15

Purpose: We recently reported that curcumin attenuates ionizing radiation (IR)-induced survival signaling and proliferation in human neuroblastoma cells. Also, in the endothelial system, we have demonstrated that NF{kappa}B regulates IR-induced telomerase activity (TA). Accordingly, we investigated the effect of curcumin in inhibiting IR-induced NF{kappa}B-dependent hTERT transcription, TA, and cell survival in neuroblastoma cells. Methods and Materials: SK-N-MC or SH-SY5Y cells exposed to IR and treated with curcumin (10-100 nM) with or without IR were harvested after 1 h through 24 h. NF{kappa}B-dependent regulation was investigated either by luciferase reporter assays using pNF{kappa}B-, pGL3-354-, pGL3-347-, or pUSE-I{kappa}B{alpha}-Luc, p50/p65, or RelA siRNA-transfectedmore » cells. NF{kappa}B activity was analyzed using an electrophoretic mobility shift assay and hTERT expression using the quantitative polymerase chain reaction. TA was determined using the telomerase repeat amplification protocol assay and cell survival using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltertrazolium bromide and clonogenic assay. Results: Curcumin profoundly inhibited IR-induced NF{kappa}B. Consequently, curcumin significantly inhibited IR-induced TA and hTERT mRNA at all points investigated. Furthermore, IR-induced TA is regulated at the transcriptional level by triggering telomerase reverse transcriptase (TERT) promoter activation. Moreover, NF{kappa}B becomes functionally activated after IR and mediates TA upregulation by binding to the {kappa}B-binding region in the promoter region of the TERT gene. Consistently, elimination of the NF{kappa}B-recognition site on the telomerase promoter or inhibition of NF{kappa}B by the I{kappa}B{alpha} mutant compromises IR-induced telomerase promoter activation. Significantly, curcumin inhibited IR-induced TERT transcription. Consequently, curcumin inhibited hTERT mRNA and TA in NF{kappa}B overexpressed cells. Furthermore, curcumin enhanced the IR-induced inhibition of cell survival. Conclusions: These results strongly suggest that curcumin inhibits IR-induced TA in an NF{kappa}B dependent manner in human neuroblastoma cells.« less

TW-01, a piperazinedione-derived compound, inhibits Ras-mediated cell proliferation and angioplasty-induced vascular restenosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Chao-Feng

Purpose: Vascular smooth muscle cell (VSMC) proliferation plays a critical role in the pathogenesis of atherosclerosis and restenosis. This study investigated piperazinedione derived compound TW-01-mediated inhibitory effects on VSMC proliferation and intimal hyperplasia. Methods: Cell proliferation was determined using [{sup 3}H]-thymidine incorporation and MTT assay; cell cycle distribution was measured using flow cytometry; proteins and mRNA expression were determined using western blotting and RT-PCR analyses; DNA binding activity of nuclear factor-κB (NF-κB), as measured using enzyme-linked immunosorbent assays (ELISA); in vivo effects of TW-01 were determined using balloon angioplasty in the rat. Results: TW-01 significantly inhibited cell proliferation. At themore » concentrations used, no cytotoxic effects were observed. Three predominant signaling pathways were inhibited by TW-01: (a) extracellular signal-regulated kinase (ERK)1/2 mitogen-activated protein kinase (MAPK) activation and its downstream effectors of c-fos, c-jun, and c-myc; (b) DNA binding activity of nuclear factor-κB (NF-κB); and, (c) Akt/protein kinase B (PKB) and cell cycle progression. Furthermore, TW-01 also inhibited Ras activation, a shared upstream event of each of these signaling cascades. In vascular injury studies, oral administration of TW-01 significantly suppressed intimal hyperplasia induced by balloon angioplasty. Conclusion: The present study suggests that TW-01 might be a potential candidate for atherosclerosis treatment. - Highlights: • TW-01significantly inhibits vascular smooth muscle cell proliferation. • TW-01 inhibits ERK, Akt and Ras pathway and DNA binding activity of NF-κB. • TW-01 significantly suppresses intimal hyperplasia induced by balloon angioplasty. • TW-01 might be a potential candidate for atherosclerosis treatment.« less

Validation of chemical compound library screening for transcriptional co-activator with PDZ-binding motif inhibitors using GFP-fused transcriptional co-activator with PDZ-binding motif.

PubMed

Nagashima, Shunta; Maruyama, Junichi; Kawano, Shodai; Iwasa, Hiroaki; Nakagawa, Kentaro; Ishigami-Yuasa, Mari; Kagechika, Hiroyuki; Nishina, Hiroshi; Hata, Yutaka

2016-06-01

Transcriptional co-activator with PDZ-binding motif (TAZ) plays versatile roles in cell proliferation and differentiation. It is phosphorylated by large tumor suppressor kinases, the core kinases of the tumor-suppressive Hippo pathway. Phosphorylation induces the cytoplasmic accumulation of TAZ and its degradation. In human cancers, the deregulation of the Hippo pathway and gene amplification enhance TAZ activity. TAZ interacts with TEA domain family members (TEAD), and upregulates genes implicated in epithelial-mesenchymal transition. It also confers stemness to cancer cells. Thus, TAZ activation provides cancer cells with malignant properties and worsens the clinical prognosis. Therefore, TAZ attracts attention as a therapeutic target in cancer therapy. We applied 18 606 small chemical compounds to human osteosarcoma U2OS cells expressing GFP-fused TAZ (GFP-TAZ), monitored the subcellular localization of GFP-TAZ, and selected 33 compounds that shifted GFP-TAZ to the cytoplasm. Unexpectedly, only a limited number of compounds suppressed TAZ-mediated enhancement of TEAD-responsive reporter activity. Moreover, the compounds that weakened TEAD reporter activity did not necessarily decrease the unphosphorylated TAZ. In this study, we focused on three compounds that decreased both TEAD reporter activity and unphosphorylated TAZ, and treated several human cancer cells with these compounds. One compound did not show a remarkable effect, whereas the other two compounds compromised the cell viability in certain cancer cells. In conclusion, the GFP-TAZ-based assay can be used as the first screening for compounds that inhibit TAZ and show anticancer properties. To develop anticancer drugs, we need additional assays to select the compounds. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Hsp90 Binds Directly to Fibronectin (FN) and Inhibition Reduces the Extracellular Fibronectin Matrix in Breast Cancer Cells

PubMed Central

Kenyon, Amy; Dhanani, Karim C. H.; Prinsloo, Earl; Edkins, Adrienne L.

2014-01-01

Heat shock protein 90 (Hsp90) has been identified in the extracellular space and has been shown to chaperone a finite number of extracellular proteins involved in cell migration and invasion. We used chemical cross-linking and immunoprecipitation followed by tandem mass spectrometry (MS/MS) to isolate a complex containing Hsp90 and the matrix protein fibronectin (FN) from breast cancer cells. Further analysis showed direct binding of Hsp90 to FN using an in vitro co-immunoprecipitation assay, a solid phase binding assay and surface plasmon resonance (SPR) spectroscopy. Confocal microscopy showed regions of co-localisation of Hsp90 and FN in breast cancer cell lines. Exogenous Hsp90β was shown to increase the formation of extracellular FN matrix in the Hs578T cell line, whilst knockdown or inhibition of Hsp90 led to a reduction in the levels of both soluble and insoluble FN and could be partially rescued by addition of exogenous Hsp90β. Treatment of cells with novobiocin led to internalization of FN into vesicles that were positive for the presence of the lysosomal marker, LAMP-1. Taken together, the direct interaction between FN and Hsp90, as well as the decreased levels of both soluble and insoluble FN upon Hsp90 inhibition or knockdown, suggested that FN may be a new client protein for Hsp90 and that Hsp90 was involved in FN matrix assembly and/or stability. The identification of FN as a putative client protein of Hsp90 suggests a role for Hsp90 in FN matrix stability, which is important for a number of fundamental cellular processes including embryogenesis, wound healing, cell migration and metastasis. PMID:24466266

Hsp90 binds directly to fibronectin (FN) and inhibition reduces the extracellular fibronectin matrix in breast cancer cells.

PubMed

Hunter, Morgan C; O'Hagan, Kyle L; Kenyon, Amy; Dhanani, Karim C H; Prinsloo, Earl; Edkins, Adrienne L

2014-01-01

Heat shock protein 90 (Hsp90) has been identified in the extracellular space and has been shown to chaperone a finite number of extracellular proteins involved in cell migration and invasion. We used chemical cross-linking and immunoprecipitation followed by tandem mass spectrometry (MS/MS) to isolate a complex containing Hsp90 and the matrix protein fibronectin (FN) from breast cancer cells. Further analysis showed direct binding of Hsp90 to FN using an in vitro co-immunoprecipitation assay, a solid phase binding assay and surface plasmon resonance (SPR) spectroscopy. Confocal microscopy showed regions of co-localisation of Hsp90 and FN in breast cancer cell lines. Exogenous Hsp90β was shown to increase the formation of extracellular FN matrix in the Hs578T cell line, whilst knockdown or inhibition of Hsp90 led to a reduction in the levels of both soluble and insoluble FN and could be partially rescued by addition of exogenous Hsp90β. Treatment of cells with novobiocin led to internalization of FN into vesicles that were positive for the presence of the lysosomal marker, LAMP-1. Taken together, the direct interaction between FN and Hsp90, as well as the decreased levels of both soluble and insoluble FN upon Hsp90 inhibition or knockdown, suggested that FN may be a new client protein for Hsp90 and that Hsp90 was involved in FN matrix assembly and/or stability. The identification of FN as a putative client protein of Hsp90 suggests a role for Hsp90 in FN matrix stability, which is important for a number of fundamental cellular processes including embryogenesis, wound healing, cell migration and metastasis.