Sample records for cell binding sites

  1. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  2. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  3. Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

    PubMed

    Barnert, R H; Zeichhardt, H; Habermehl, K O

    1992-02-01

    Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

  4. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  5. Immunological characterization of eristostatin and echistatin binding sites on alpha IIb beta 3 and alpha V beta 3 integrins.

    PubMed Central

    Marcinkiewicz, C; Rosenthal, L A; Mosser, D M; Kunicki, T J; Niewiarowski, S

    1996-01-01

    Two disintegrins with a high degree of amino acid sequence similarity, echistatin and eristostatin, showed a low level of interaction with Chinese hamster ovary (CHO) cells, but they bound to CHO cells transfected with alpha IIb beta 3 genes (A5 cells) and to CHO cells transfected with alpha v beta 3 genes (VNRC3 cells) in a reversible and saturable manner. Scatchard analysis revealed that eristostatin bound to 816000 sites per A5 cell (Kd 28 nM) and to 200000 sites (Kd 14 nM) per VNRC3 cell respectively. However, VNRC3 cells did not bind to immobilized eristostatin. Echistatin bound to 495000 sites (Kd 53 nM) per A5 cell and to 443000 sites (Kd 20 nM) per VNRC3 cell. As determined by flow cytometry, radiobinding assay and adhesion studies, binding of both disintegrins to A5 cells and resting platelets and binding of echistatin to VNRC3 cells resulted in the expression of ligand-induced binding sites (LIBS) on the beta 3 subunit. Eristostatin inhibited, more strongly than echistatin, the binding of three monoclonal antibodies: OPG2 (RGD motif dependent), A2A9 (alpha IIb beta 3 complex dependent) and 7E3 (alpha IIb beta 3 and alpha v beta 3 complex dependent) to A5 cells, to resting and to activated platelets and to purified alpha IIb beta 3. Experiments in which echistatin and eristostatin were used alone or in combination to inhibit the binding of 7E3 and OPG2 antibodies to resting platelets suggested that these two disintegrins bind to different but overlapping sites on alpha IIb beta 3 integrin. Monoclonal antibody LM 609 and echistatin seemed to bind to different sites on alpha v beta 3 integrin. However, echistatin inhibited binding of 7E3 antibody to VNRC3 cells and to purified alpha v beta 3 suggesting that alpha v beta 3 and alpha IIb beta 3 might share the same epitope to which both echistatin and 7E3 bind. Eristostatin had no effect in these systems, providing further evidence that it binds to a different epitope on alpha v beta 3. PMID:8760368

  6. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  7. Expression of Ulex europaeus agglutinin I lectin-binding sites in squamous cell carcinomas and their absence in basal cell carcinomas. Indicator of tumor type and differentiation.

    PubMed

    Heng, M C; Fallon-Friedlander, S; Bennett, R

    1992-06-01

    Lectins bind tightly to carbohydrate moieties on cell surfaces. Alterations in lectin binding have been reported to accompany epidermal cell differentiation, marking alterations in membrane sugars during this process. The presence of UEA I (Ulex europaeus agglutinin I) L-fucose-specific lectin-binding sites has been used as a marker for terminally differentiated (committed) keratinocytes. In this article, we report the presence of UEA-I-binding sites on squamous keratinocytes of well-differentiated squamous cell carcinomas, with patchy loss of UEA I positivity on poorly differentiated cells of squamous cell carcinomas, suggesting a possible use for this technique in the rapid assessment of less differentiated areas within the squamous cell tumor. The absence of UEA-I-binding sites on basal cell carcinomas may be related to an inability of cells comprising this tumor to convert the L-D-pyranosyl moiety on basal cells to the L-fucose moiety, resulting in an inability of basal cell carcinoma cell to undergo terminal differentiation into a committed keratinocyte.

  8. The correlation between ouabain binding and potassium pump inhibition in human and sheep erythrocytes.

    PubMed Central

    Joiner, C H; Lauf, P K

    1978-01-01

    1. [3H]Ouabain binding to human and sheep red blood cells was shown to be specific for receptors associated with Na/K transport. Virtually all tritium binding was abolished by dilution with unlabelled drug. Saturation levels of binding were independent of glycoside concentration and were identical to those associated with 100% inhibition of K pumping. 2. [3H]Ouabain binding and 42K influx were measured simultaneously in order to correlate the degree of K pump inhibition with the amount of glycoside bound. Results by this method agreed exactly with those obtained by pre-exposing cells to drug, followed by washing and then measuring K influx. 3. Plots of [3H]oubain binding vs. K pump inhibition were rectilinear for human and low K (LK) sheep red cells, indicating one glycoside receptor per K pump site and functional homogeneity of pump sites. High K (HK) sheep red cells exhibited curved plots of binding versus inhibition, which were best explained in terms of one receptor per pump, but a heterogeneous population of pump sites. 4. External K reduced the rate of glycoside binding, but did not alter the relationship between binding and inhibition. 5. The number of K pump sites was estimated as 450--500 per human cell and 30--50 per LK sheep cell. HK sheep cells had 90--130 sites per cell, of which eighty to ninety were functionally dominant. The number of K pump sites on LK sheep cells was not changed by anti-L, although the maximum velocity of pump turnover was increased. PMID:722573

  9. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  10. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  11. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  12. Comprehensive meta-analysis of Signal Transducers and Activators of Transcription (STAT) genomic binding patterns discerns cell-specific cis-regulatory modules

    PubMed Central

    2013-01-01

    Background Cytokine-activated transcription factors from the STAT (Signal Transducers and Activators of Transcription) family control common and context-specific genetic programs. It is not clear to what extent cell-specific features determine the binding capacity of seven STAT members and to what degree they share genetic targets. Molecular insight into the biology of STATs was gained from a meta-analysis of 29 available ChIP-seq data sets covering genome-wide occupancy of STATs 1, 3, 4, 5A, 5B and 6 in several cell types. Results We determined that the genomic binding capacity of STATs is primarily defined by the cell type and to a lesser extent by individual family members. For example, the overlap of shared binding sites between STATs 3 and 5 in T cells is greater than that between STAT5 in T cells and non-T cells. Even for the top 1,000 highly enriched STAT binding sites, ~15% of STAT5 binding sites in mouse female liver are shared by other STATs in different cell types while in T cells ~90% of STAT5 binding sites are co-occupied by STAT3, STAT4 and STAT6. In addition, we identified 116 cis-regulatory modules (CRM), which are recognized by all STAT members across cell types defining a common JAK-STAT signature. Lastly, in liver STAT5 binding significantly coincides with binding of the cell-specific transcription factors HNF4A, FOXA1 and FOXA2 and is associated with cell-type specific gene transcription. Conclusions Our results suggest that genomic binding of STATs is primarily determined by the cell type and further specificity is achieved in part by juxtaposed binding of cell-specific transcription factors. PMID:23324445

  13. The N-Terminal Domain of the Flo1 Flocculation Protein from Saccharomyces cerevisiae Binds Specifically to Mannose Carbohydrates ▿

    PubMed Central

    Goossens, Katty V. Y.; Stassen, Catherine; Stals, Ingeborg; Donohue, Dagmara S.; Devreese, Bart; De Greve, Henri; Willaert, Ronnie G.

    2011-01-01

    Saccharomyces cerevisiae cells possess a remarkable capacity to adhere to other yeast cells, which is called flocculation. Flocculation is defined as the phenomenon wherein yeast cells adhere in clumps and sediment rapidly from the medium in which they are suspended. These cell-cell interactions are mediated by a class of specific cell wall proteins, called flocculins, that stick out of the cell walls of flocculent cells. The N-terminal part of the three-domain protein is responsible for carbohydrate binding. We studied the N-terminal domain of the Flo1 protein (N-Flo1p), which is the most important flocculin responsible for flocculation of yeast cells. It was shown that this domain is both O and N glycosylated and is structurally composed mainly of β-sheets. The binding of N-Flo1p to d-mannose, α-methyl-d-mannoside, various dimannoses, and mannan confirmed that the N-terminal domain of Flo1p is indeed responsible for the sugar-binding activity of the protein. Moreover, fluorescence spectroscopy data suggest that N-Flo1p contains two mannose carbohydrate binding sites with different affinities. The carbohydrate dissociation constants show that the affinity of N-Flo1p for mono- and dimannoses is in the millimolar range for the binding site with low affinity and in the micromolar range for the binding site with high affinity. The high-affinity binding site has a higher affinity for low-molecular-weight (low-MW) mannose carbohydrates and no affinity for mannan. However, mannan as well as low-MW mannose carbohydrates can bind to the low-affinity binding site. These results extend the cellular flocculation model on the molecular level. PMID:21076009

  14. Binding of fluoresceinated epidermal growth factor to A431 cell sub-populations studied using a model-independent analysis of flow cytometric fluorescence data.

    PubMed Central

    Chatelier, R C; Ashcroft, R G; Lloyd, C J; Nice, E C; Whitehead, R H; Sawyer, W H; Burgess, A W

    1986-01-01

    A method is developed for determining ligand-cell association parameters from a model-free analysis of data obtained with a flow cytometer. The method requires measurement of the average fluorescence per cell as a function of ligand and cell concentration. The analysis is applied to data obtained for the binding of fluoresceinated epidermal growth factor to a human epidermoid carcinoma cell line, A431. The results indicate that the growth factor binds to two classes of sites on A431 cells: 4 X 10(4) sites with a dissociation constant (KD) of less than or equal to 20 pM, and 1.5 X 10(6) sites with a KD of 3.7 nM. A derived plot of the average fluorescence per cell versus the average number of bound ligands per cell is used to construct binding isotherms for four sub-populations of A431 cells fractionated on the basis of low-angle light scatter. The four sub-populations bind the ligand with equal affinity but differ substantially in terms of the number of binding sites per cell. We also use this new analysis to critically evaluate the use of 'Fluorotrol' as a calibration standard in flow cytometry. PMID:3015587

  15. In Vivo Chromatin Targets of the Transcription Factor Yin Yang 2 in Trophoblast Stem Cells

    PubMed Central

    Pérez-Palacios, Raquel; Macías-Redondo, Sofía; Climent, María; Contreras-Moreira, Bruno; Muniesa, Pedro; Schoorlemmer, Jon

    2016-01-01

    Background Yin Yang 2 (YY2) is a zinc finger protein closely related to the well-characterized Yin Yang 1 (YY1). YY1 is a DNA-binding transcription factor, with defined functions in multiple developmental processes, such as implantation, cell differentiation, X inactivation, imprinting and organogenesis. Yy2 has been treated as a largely immaterial duplication of Yy1, as they share high homology in the Zinc Finger-region and similar if not identical in vitro binding sites. In contrast to these similarities, gene expression alterations in HeLa cells with attenuated levels of either Yy1 or Yy2 were to some extent gene-specific. Moreover, the chromatin binding sites for YY2, except for its association with transposable retroviral elements (RE) and Endogenous Retroviral Elements (ERVs), remain to be identified. As a first step towards defining potential Yy2 functions matching or complementary to Yy1, we considered in vivo DNA binding sites of YY2 in trophoblast stem (TS) cells. Results We report the presence of YY2 protein in mouse-derived embryonic stem (ES) and TS cell lines. Following up on our previous report on ERV binding by YY2 in TS cells, we investigated the tissue-specificity of REX1 and YY2 binding and confirm binding to RE/ERV targets in both ES cells and TS cells. Because of the higher levels of expression, we chose TS cells to understand the role of Yy2 in gene and chromatin regulation. We used in vivo YY2 association as a measure to identify potential target genes. Sequencing of chromatin obtained in chromatin-immunoprecipitation (ChIP) assays carried out with αYY2 serum allowed us to identify a limited number of chromatin targets for YY2. Some putative binding sites were validated in regular ChIP assays and gene expression of genes nearby was altered in the absence of Yy2. Conclusions YY2 binding to ERVs is not confined to TS cells. In vivo binding sites share the presence of a consensus binding motif. Selected sites were uniquely bound by YY2 as opposed to YY1, suggesting that YY2 exerts unique contributions to gene regulation. YY2 binding was not generally associated with gene promoters. However, several YY2 binding sites are linked to long noncoding RNA (lncRNA) genes and we show that the expression levels of a few of those are Yy2-dependent. PMID:27191592

  16. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  17. HMG I(Y) interferes with the DNA binding of NF-AT factors and the induction of the interleukin 4 promoter in T cells

    PubMed Central

    Klein-Hessling, Stefan; Schneider, Günter; Heinfling, Annette; Chuvpilo, Sergei; Serfling, Edgar

    1996-01-01

    HMG I(Y) proteins bind to double-stranded A+T oligonucleotides longer than three base pairs. Such motifs form part of numerous NF-AT-binding sites of lymphokine promoters, including the interleukin 4 (IL-4) promoter. NF-AT factors share short homologous peptide sequences in their DNA-binding domain with NF-κB factors and bind to certain NF-κB sites. It has been shown that HMG I(Y) proteins enhance NF-κB binding to the interferon β promoter and virus-mediated interferon β promoter induction. We show that HMG I(Y) proteins exert an opposite effect on the DNA binding of NF-AT factors and the induction of the IL-4 promoter in T lymphocytes. Introduction of mutations into a high-affinity HMG I(Y)-binding site of the IL-4 promoter, which decreased HMG I(Y)-binding to a NF-AT-binding sequence, the Pu-bB (or P) site, distinctly increased the induction of the IL-4 promoter in Jurkat T leukemia cells. High concentrations of HMG I(Y) proteins are able to displace NF-ATp from its binding to the Pu-bB site. High HMG I(Y) concentrations are typical for Jurkat cells and peripheral blood T lymphocytes, whereas El4 T lymphoma cells and certain T helper type 2 cell clones contain relatively low HMG I(Y) concentrations. Our results indicate that HMG I(Y) proteins do not cooperate, but instead compete with NF-AT factors for the binding to DNA even though NF-AT factors share some DNA-binding properties with NF-kB factors. This competition between HMG I(Y) and NF-AT proteins for DNA binding might be due to common contacts with minor groove nucleotides of DNA and may be one mechanism contributing to the selective IL-4 expression in certain T lymphocyte populations, such as T helper type 2 cells. PMID:8986808

  18. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  19. Characterization of the increased binding of acetaldehyde to red blood cells in alcoholics.

    PubMed

    Hernández-Muñoz, R; Baraona, E; Blacksberg, I; Lieber, C S

    1989-10-01

    Using equilibrium dialysis, we found that acetaldehyde, at the levels commonly occurring after ethanol ingestion, did not bind detectably to plasma proteins, but there was significant binding to red blood cells, more in alcoholics than in nonalcoholics. The binding to red blood cells was inhibited by pyridoxal phosphate and N-ethylmaleimide, suggesting adduction to amino and thiol groups. Binding kinetics were consistent with at least two sites. The one with the highest affinity for acetaldehyde corresponded to hemoglobin. Its affinity and Bmax were not changed in alcoholics, but these binding sites accounted for only 44% of the sites available in the red blood cells of alcoholics and 80% of those in controls. Moreover, this binding was not inhibited by N-ethylmaleimide. There was no detectable binding to red cell ghosts. Nonprotein binding was then assessed by changes in NADH produced by the addition of protein-free fractions of the cells to an alcohol dehydrogenase system in equilibrium; this revealed a second binder of lower affinity, larger capacity and with sensitivity to both inhibitors. This binding (possibly due to thiazolidine formation with cysteine) was enhanced in alcoholics, whose red blood cell cysteine content was doubled. Levels of red blood cell cysteine and acetaldehyde remained high for 2 weeks after withdrawal. Because of the prolonged persistence after withdrawal, these changes may provide new markers of alcoholism.

  20. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  1. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  2. Tannic acid and chromic chloride-induced binding of protein to red cells: a preliminary study of possible binding sites and reaction mechanisms.

    PubMed

    Hunt, A F; Reed, M I

    1990-07-01

    The binding mechanisms and binding sites involved in the tannic acid and chromic chloride-induced binding of protein to red cells were investigated using the binding of IgA paraprotein to red cells as model systems. Inhibition studies of these model systems using amino acid homopolymers and compounds (common as red cell membrane constituents) suggest that the mechanisms involved are similar to those proposed for the conversion of hide or skin collagen to leather, as in commercial tanning. These studies also suggest that tannic acid-induced binding of IgA paraprotein to red cells involves the amino acid residues of L-arginine, L-lysine, L-histidine, and L-proline analogous to tanning with phenolic plant extracts. The amino acid residues of L-aspartate, L-glutamate and L-asparagine are involved in a similar manner in chronic chloride-induced binding of protein to red cells.

  3. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  4. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  5. Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shima, K.; Kitayama, S.; Nakano, R.

    Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less

  6. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  7. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  8. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  9. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  10. Genome-wide analysis of AR binding and comparison with transcript expression in primary human fetal prostate fibroblasts and cancer associated fibroblasts.

    PubMed

    Nash, Claire; Boufaied, Nadia; Mills, Ian G; Franco, Omar E; Hayward, Simon W; Thomson, Axel A

    2017-05-05

    The androgen receptor (AR) is a transcription factor, and key regulator of prostate development and cancer, which has discrete functions in stromal versus epithelial cells. AR expressed in mesenchyme is necessary and sufficient for prostate development while loss of stromal AR is predictive of prostate cancer progression. Many studies have characterized genome-wide binding of AR in prostate tumour cells but none have used primary mesenchyme or stroma. We applied ChIPseq to identify genomic AR binding sites in primary human fetal prostate fibroblasts and patient derived cancer associated fibroblasts, as well as the WPMY1 cell line overexpressing AR. We identified AR binding sites that were specific to fetal prostate fibroblasts (7534), cancer fibroblasts (629), WPMY1-AR (2561) as well as those common among all (783). Primary fibroblasts had a distinct AR binding profile versus prostate cancer cell lines and tissue, and showed a localisation to gene promoter binding sites 1 kb upstream of the transcriptional start site, as well as non-classical AR binding sequence motifs. We used RNAseq to define transcribed genes associated with AR binding sites and derived cistromes for embryonic and cancer fibroblasts as well as a cistrome common to both. These were compared to several in vivo ChIPseq and transcript expression datasets; which identified subsets of AR targets that were expressed in vivo and regulated by androgens. This analysis enabled us to deconvolute stromal AR targets active in stroma within tumour samples. Taken together, our data suggest that the AR shows significantly different genomic binding site locations in primary prostate fibroblasts compared to that observed in tumour cells. Validation of our AR binding site data with transcript expression in vitro and in vivo suggests that the AR target genes we have identified in primary fibroblasts may contribute to clinically significant and biologically important AR-regulated changes in prostate tissue. Copyright © 2017. Published by Elsevier B.V.

  11. A rigorous multiple independent binding site model for determining cell-based equilibrium dissociation constants.

    PubMed

    Drake, Andrew W; Klakamp, Scott L

    2007-01-10

    A new 4-parameter nonlinear equation based on the standard multiple independent binding site model (MIBS) is presented for fitting cell-based ligand titration data in order to calculate the ligand/cell receptor equilibrium dissociation constant and the number of receptors/cell. The most commonly used linear (Scatchard Plot) or nonlinear 2-parameter model (a single binding site model found in commercial programs like Prism(R)) used for analysis of ligand/receptor binding data assumes only the K(D) influences the shape of the titration curve. We demonstrate using simulated data sets that, depending upon the cell surface receptor expression level, the number of cells titrated, and the magnitude of the K(D) being measured, this assumption of always being under K(D)-controlled conditions can be erroneous and can lead to unreliable estimates for the binding parameters. We also compare and contrast the fitting of simulated data sets to the commonly used cell-based binding equation versus our more rigorous 4-parameter nonlinear MIBS model. It is shown through these simulations that the new 4-parameter MIBS model, when used for cell-based titrations under optimal conditions, yields highly accurate estimates of all binding parameters and hence should be the preferred model to fit cell-based experimental nonlinear titration data.

  12. Genome-Wide Progesterone Receptor Binding: Cell Type-Specific and Shared Mechanisms in T47D Breast Cancer Cells and Primary Leiomyoma Cells

    PubMed Central

    Huang, Lei; Owen, Jonas K.; Xie, Anna; Navarro, Antonia; Monsivais, Diana; Coon V, John S.; Kim, J. Julie; Dai, Yang; Bulun, Serdar E.

    2012-01-01

    Background Progesterone, via its nuclear receptor (PR), exerts an overall tumorigenic effect on both uterine fibroid (leiomyoma) and breast cancer tissues, whereas the antiprogestin RU486 inhibits growth of these tissues through an unknown mechanism. Here, we determined the interaction between common or cell-specific genome-wide binding sites of PR and mRNA expression in RU486-treated uterine leiomyoma and breast cancer cells. Principal Findings ChIP-sequencing revealed 31,457 and 7,034 PR-binding sites in breast cancer and uterine leiomyoma cells, respectively; 1,035 sites overlapped in both cell types. Based on the chromatin-PR interaction in both cell types, we statistically refined the consensus progesterone response element to G•ACA• • •TGT•C. We identified two striking differences between uterine leiomyoma and breast cancer cells. First, the cis-regulatory elements for HSF, TEF-1, and C/EBPα and β were statistically enriched at genomic RU486/PR-targets in uterine leiomyoma, whereas E2F, FOXO1, FOXA1, and FOXF sites were preferentially enriched in breast cancer cells. Second, 51.5% of RU486-regulated genes in breast cancer cells but only 6.6% of RU486-regulated genes in uterine leiomyoma cells contained a PR-binding site within 5 kb from their transcription start sites (TSSs), whereas 75.4% of RU486-regulated genes contained a PR-binding site farther than 50 kb from their TSSs in uterine leiomyoma cells. RU486 regulated only seven mRNAs in both cell types. Among these, adipophilin (PLIN2), a pro-differentiation gene, was induced via RU486 and PR via the same regulatory region in both cell types. Conclusions Our studies have identified molecular components in a RU486/PR-controlled gene network involved in the regulation of cell growth, cell migration, and extracellular matrix function. Tissue-specific and common patterns of genome-wide PR binding and gene regulation may determine the therapeutic effects of antiprogestins in uterine fibroids and breast cancer. PMID:22272226

  13. Plant cell pH-static circuit mediated by fusicoccin-binding proteins.

    PubMed

    Drabkin, A V; Trofimova, M S; Smolenskaya, I N; Klychnikov, O I; Chelysheva, V V; Babakov, A V

    1997-03-24

    On sugar beet protoplasts that carry two types of fusicoccin-binding sites, a pH downshift in a physiological range (7.0-6.6) markedly enhanced the efficiency of fusicoccin (FC) binding, mainly owing to increased avidity of low-affinity FC-binding sites. This may allow the FC-binding proteins to act as pH-sensitive modulators of cell activity, for instance, via plasma membrane H+-ATPase or potassium channels.

  14. Expression of eukaryotic polypeptides in chloroplasts

    DOEpatents

    Mayfield, Stephen P.

    2013-06-04

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  15. Botulinum neurotoxin serotype C associates with dual ganglioside receptors to facilitate cell entry.

    PubMed

    Karalewitz, Andrew P-A; Fu, Zhuji; Baldwin, Michael R; Kim, Jung-Ja P; Barbieri, Joseph T

    2012-11-23

    How botulinum neurotoxin serotype C (BoNT/C) enters neurons is unclear. BoNT/C utilizes dual gangliosides as host cell receptors. BoNT/C accesses gangliosides on the plasma membrane. Plasma membrane accessibility of the dual ganglioside receptors suggests synaptic vesicle exocytosis may not be necessary to expose BoNT/C receptors. Botulinum neurotoxins (BoNTs) cleave SNARE proteins in motor neurons that inhibits synaptic vesicle (SV) exocytosis, resulting in flaccid paralysis. There are seven BoNT serotypes (A-G). In current models, BoNTs initially bind gangliosides on resting neurons and upon SV exocytosis associate with the luminal domains of SV-associated proteins as a second receptor. The entry of BoNT/C is less clear. Characterizing the heavy chain receptor binding domain (HCR), BoNT/C was shown to utilize gangliosides as dual host receptors. Crystallographic and biochemical studies showed that the two ganglioside binding sites, termed GBP2 and Sia-1, were independent and utilized unique mechanisms to bind complex gangliosides. The GBP2 binding site recognized gangliosides that contained a sia5 sialic acid, whereas the Sia-1 binding site recognized gangliosides that contained a sia7 sialic acid and sugars within the backbone of the ganglioside. Utilizing gangliosides that uniquely recognized the GBP2 and Sia-1 binding sites, HCR/C entry into Neuro-2A cells required both functional ganglioside binding sites. HCR/C entered cells differently than the HCR of tetanus toxin, which also utilizes dual gangliosides as host receptors. A point-mutated HCR/C that lacked GBP2 binding potential retained the ability to bind and enter Neuro-2A cells. This showed that ganglioside binding at the Sia-1 site was accessible on the plasma membrane, suggesting that SV exocytosis may not be required to expose BoNT/C receptors. These studies highlight the utility of BoNT HCRs as probes to study the role of gangliosides in neurotransmission.

  16. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  17. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

    1986-06-01

    (+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

  18. Influence of differentiation on muscarinic receptors in N1E 115 neuroblastoma cells.

    PubMed

    Buyse, M A; Lefebvre, R A; Fraeyman, N H

    1989-01-01

    The effect of inducing morphological differentiation in N1E 115 mouse neuroblastoma cells on the number of muscarinic receptors and the ligand binding affinity was investigated using the lipophylic quinuclidinyl benzylate and the hydrophylic N-methylscopolamine as tritiated ligands. Induction of morphological differentiation was accompanied by a two- to three-fold increase of the number of receptors when assayed in a broken cell preparation; the ligand binding affinity was unaffected by differentiation. Using intact cells, this increase was not paralleled by a similar increase in binding sites accessible for N-methylscopolamine, which binds preferentially to extracellular sites.

  19. Massive GGAAs in genomic repetitive sequences serve as a nuclear reservoir of NF-κB.

    PubMed

    Wu, Jian; Wang, Qiao; Dai, Wei; Wang, Wei; Yue, Ming; Wang, Jinke

    2018-04-13

    Nuclear factor κB (NF-κB) is a DNA-binding transcription factor. Characterizing its genomic binding sites is crucial for understanding its gene regulatory function and mechanism in cells. This study characterized the binding sites of NF-κB RelA/p65 in the tumor neurosis factor-α (TNFα) stimulated HeLa cells by a precise chromatin immunoprecipitation-sequencing (ChIP-seq). The results revealed that NF-κB binds nontraditional motifs (nt-motifs) containing conserved GGAA quadruplet. Moreover, nt-motifs mainly distribute in the peaks nearby centromeres that contain a larger number of repetitive elements such as satellite, simple repeats and short interspersed nuclear elements (SINEs). This intracellular binding pattern was then confirmed by the in vitro detection, indicating that NF-κB dimers can bind the nontraditional κB (nt-κB) sites with low affinity. However, this binding hardly activates transcription. This study thus deduced that NF-κB binding nt-motifs may realize functions other than gene regulation as NF-κB binding traditional motifs (t-motifs). To testify the deduction, many ChIP-seq data of other cell lines were then analyzed. The results indicate that NF-κB binding nt-motifs is also widely present in other cells. The ChIP-seq data analysis also revealed that nt-motifs more widely distribute in the peaks with low-fold enrichment. Importantly, it was also found that NF-κB binding nt-motifs is mainly present in the resting cells, whereas NF-κB binding t-motifs is mainly present in the stimulated cells. Astonishingly, no known function was enriched by the gene annotation of nt-motif peaks. Based on these results, this study proposed that the nt-κB sites that extensively distribute in larger numbers of repeat elements function as a nuclear reservoir of NF-κB. The nuclear NF-κB proteins stored at nt-κB sites in the resting cells may be recruited to the t-κB sites for regulating its target genes upon stimulation. Copyright © 2018 Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

  20. Ulex europaeus agglutinin-I binds to developing gastrin cells.

    PubMed

    Ge, Z H; Blom, J; Larsson, L I

    1998-03-01

    We have previously reported that antropyloric gastrin (G) and somatostatin (D) cells derive from precursor (G/D) cells that coexpress both hormones. We have now analyzed this endocrine cell pedigree for binding of Ulex europaeus agglutinin-I (UEA-I), which previously has been reported to represent a useful marker for cell differentiation. Subpopulations of G/D, D, and G cells were all found to express UEA-I binding. Labelling with bromodeoxyuridine showed that UEA-I positive G cells possessed a higher labelling index than UEA-I negative G cells. These data suggest that the UEA-I positive G cells represent maturing cells still involved in DNA synthesis and cell division. Electron microscopically, specific UEA-I binding sites were localized to the secretory granules and the apical cell membrane of G cells. We conclude that UEA-I represents a differentiation marker for G cells. Moreover, the presence of UEA-I binding sites in these cells may be relevant for Helicobacter pylori-mediated disturbances of gastric acid secretion and gastrin hypersecretion.

  1. Genome-wide activity of unliganded estrogen receptor-α in breast cancer cells

    PubMed Central

    Caizzi, Livia; Ferrero, Giulio; Cutrupi, Santina; Cordero, Francesca; Ballaré, Cecilia; Miano, Valentina; Reineri, Stefania; Ricci, Laura; Friard, Olivier; Testori, Alessandro; Corà, Davide; Caselle, Michele; Di Croce, Luciano; De Bortoli, Michele

    2014-01-01

    Estrogen receptor-α (ERα) has central role in hormone-dependent breast cancer and its ligand-induced functions have been extensively characterized. However, evidence exists that ERα has functions that are independent of ligands. In the present work, we investigated the binding of ERα to chromatin in the absence of ligands and its functions on gene regulation. We demonstrated that in MCF7 breast cancer cells unliganded ERα binds to more than 4,000 chromatin sites. Unexpectedly, although almost entirely comprised in the larger group of estrogen-induced binding sites, we found that unliganded-ERα binding is specifically linked to genes with developmental functions, compared with estrogen-induced binding. Moreover, we found that siRNA-mediated down-regulation of ERα in absence of estrogen is accompanied by changes in the expression levels of hundreds of coding and noncoding RNAs. Down-regulated mRNAs showed enrichment in genes related to epithelial cell growth and development. Stable ERα down-regulation using shRNA, which caused cell growth arrest, was accompanied by increased H3K27me3 at ERα binding sites. Finally, we found that FOXA1 and AP2γ binding to several sites is decreased upon ERα silencing, suggesting that unliganded ERα participates, together with other factors, in the maintenance of the luminal-specific cistrome in breast cancer cells. PMID:24639548

  2. Cytosine arabinoside influx and nucleoside transport sites in acute leukemia.

    PubMed

    Wiley, J S; Jones, S P; Sawyer, W H; Paterson, A R

    1982-02-01

    Although cytosine arabinoside (araC) can induce a remission in a majority of patients presenting with acute myeloblastic leukemia (AML), a minority fail to respond and moreover the drug has less effect in acute lymphoblastic leukemia (ALL). The carrier-mediated influx of araC into purified blasts from patients with AML, ALL, and acute undifferentiated leukemia (AUL) has been compared to that of normal lymphocytes and polymorphs. Blasts showed a larger mediated influx of araC than mature cells, since mean influxes for myeloblasts and lymphoblasts were 6- and 2.3-fold greater than polymorphs and lymphocytes, respectively. Also, the mean influx for myeloblasts was fourfold greater than the mean for lymphoblasts. The number of nucleoside transport sites was estimated for each cell type by measuring the equilibrium binding of [(3)H]nitrobenzylthioinosine (NBMPR), which inhibits nucleoside fluxes by binding with high affinity to specific sites on the transport mechanism. The mean binding site numbers for myeloblasts and lymphoblasts were 5- and 2.8-fold greater, respectively, than for the mature cells of the same maturation series. The mean number of NBMPR binding sites for myeloblasts was fourfold greater than for lymphoblasts. Patients with AUL were heterogeneous since blasts from some gave values within the myeloblastic range and others within the lymphoblastic range. The araC influx correlated closely with the number of NBMPR binding sites measured in the same cells on the same day. Transport parameters were measured on blasts from 15 patients with AML or AUL who were then treated with standard induction therapy containing araC. Eight patients entered complete remission, while seven failed therapy, among whom were the three patients with the lowest araC influx (<0.4 pmol/10(7) cells per min) and NBMPR binding (<3,000 sites/cell) for the treated group. In summary, myeloblasts have both higher araC transport rates and more nucleoside transport sites than lymphoblasts and this factor may contribute to the greater sensitivity of AML to this drug. AraC transport varied >10-fold between leukemic blasts and normal leukocytes, but transport capacity related directly to the number of nucleoside transport sites on the cell. Finally, low araC transport rates or few NBMPR binding sites on blasts were observed in a subset of patients with acute leukemia who failed to achieve remission with drug combinations containing araC.

  3. Pertussis toxin modifies the characteristics of both the inhibitory GTP binding proteins and the somatostatin receptor in anterior pituitary tumor cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mahy, N.; Woolkalis, M.; Thermos, K.

    1988-08-01

    The effects of pertussis toxin treatment on the characteristics of somatostatin receptors in the anterior pituitary tumor cell line AtT-20 were examined. Pertussis toxin selectively catalyzed the ADP ribosylation of the alpha subunits of the inhibitory GTP binding proteins in AtT-20 cells. Toxin treatment abolished somatostatin inhibition of forskolin-stimulated adenylyl cyclase activity and somatostatin stimulation of GTPase activity. To examine the effects of pertussis toxin treatment on the characteristics of the somatostatin receptor, the receptor was labeled by the somatostatin analog (125I)CGP 23996. (125I)CGP 23996 binding to AtT-20 cell membranes was saturable and within a limited concentration range was tomore » a single high affinity site. Pertussis toxin treatment reduced the apparent density of the high affinity (125I)CGP 23996 binding sites in AtT-20 cell membranes. Inhibition of (125I)CGP 23996 binding by a wide concentration range of CGP 23996 revealed the presence of two binding sites. GTP predominantly reduced the level of high affinity sites in control membranes. Pertussis toxin treatment also diminished the amount of high affinity sites. GTP did not affect (125I)CGP 23996 binding in the pertussis toxin-treated membranes. The high affinity somatostatin receptors were covalently labeled with (125I) CGP 23996 and the photoactivated crosslinking agent n-hydroxysuccinimidyl-4-azidobenzoate. No high affinity somatostatin receptors, covalently bound to (125I)CGP 23996, were detected in the pertussis toxin-treated membranes. These results are most consistent with pertussis toxin uncoupling the inhibitory G proteins from the somatostatin receptor thereby converting the receptor from a mixed population of high and low affinity sites to only low affinity receptors.« less

  4. Cytochemical analysis of alkaline phosphatase and esterase activities and of lectin-binding and anionic sites in rat and mouse Peyer's patch M cells.

    PubMed

    Owen, R L; Bhalla, D K

    1983-10-01

    M cells in Peyer's patch follicle epithelium endocytose and transport luminal materials to intraepithelial lymphocytes. We examined (1) enzymatic characteristics of the epithelium covering mouse and rat Peyer's patches by using cytochemical techniques, (2) distribution of lectin-binding sites by peroxidase-labeled lectins, and (3) anionic site distribution by using cationized ferritin to develop a profile of M cell surface properties. Alkaline phosphatase activity resulted in deposits of dense reaction product over follicle surfaces but was markedly reduced over M cells, unlike esterase which formed equivalent or greater product over M cells. Concanavalin A, ricinus communis agglutinin, wheat germ agglutinin and peanut agglutinin reacted equally with M cells and with surrounding enterocytes over follicle surfaces. Cationized ferritin distributed in a random fashion along microvillus membranes of both M cells and enterocytes, indicating equivalent anionic site distribution. Staining for alkaline phosphatase activity provides a new approach for distinguishing M cells from enterocytes at the light microscopic level. Identical binding of lectins indicates that M cells and enterocytes share common glycoconjugates even though molecular groupings may differ. Lectin binding and anionic charge similarities of M cells and enterocytes may facilitate antigen sampling by M cells of particles and compounds that adhere to intestinal surfaces in non-Peyer's patch areas.

  5. SKLB060 Reversibly Binds to Colchicine Site of Tubulin and Possesses Efficacy in Multidrug-Resistant Cell Lines.

    PubMed

    Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan

    2018-05-22

    Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.

  6. Apigenin shows synergistic anticancer activity with curcumin by binding at different sites of tubulin.

    PubMed

    Choudhury, Diptiman; Ganguli, Arnab; Dastidar, Debabrata Ghosh; Acharya, Bipul R; Das, Amlan; Chakrabarti, Gopal

    2013-06-01

    Apigenin, a natural flavone, present in many plants sources, induced apoptosis and cell death in lung epithelium cancer (A549) cells with an IC50 value of 93.7 ± 3.7 μM for 48 h treatment. Target identification investigations using A549 cells and also in cell-free system demonstrated that apigenin depolymerized microtubules and inhibited reassembly of cold depolymerized microtubules of A549 cells. Again apigenin inhibited polymerization of purified tubulin with an IC50 value of 79.8 ± 2.4 μM. It bounds to tubulin in cell-free system and quenched the intrinsic fluorescence of tubulin in a concentration- and time-dependent manner. The interaction was temperature-dependent and kinetics of binding was biphasic in nature with binding rate constants of 11.5 × 10(-7) M(-1) s(-1) and 4.0 × 10(-9) M(-1) s(-1) for fast and slow phases at 37 °C, respectively. The stoichiometry of tubulin-apigenin binding was 1:1 and binding the binding constant (Kd) was 6.08 ± 0.096 μM. Interestingly, apigenin showed synergistic anti-cancer effect with another natural anti-tubulin agent curcumin. Apigenin and curcumin synergistically induced cell death and apoptosis and also blocked cell cycle progression at G2/M phase of A549 cells. The synergistic activity of apigenin and curcumin was also apparent from their strong depolymerizing effects on interphase microtubules and inhibitory effect of reassembly of cold depolymerized microtubules when used in combinations, indicating that these ligands bind to tubulin at different sites. In silico modeling suggested apigenin bounds at the interphase of α-β-subunit of tubulin. The binding site is 19 Å in distance from the previously predicted curcumin binding site. Binding studies with purified protein also showed both apigenin and curcumin can simultaneously bind to purified tubulin. Understanding the mechanism of synergistic effect of apigenin and curcumin could be helped to develop anti-cancer combination drugs from cheap and readily available nutraceuticals. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  7. The PUF binding landscape in metazoan germ cells

    PubMed Central

    Prasad, Aman; Porter, Douglas F.; Kroll-Conner, Peggy L.; Mohanty, Ipsita; Ryan, Anne R.; Crittenden, Sarah L.; Wickens, Marvin; Kimble, Judith

    2016-01-01

    PUF (Pumilio/FBF) proteins are RNA-binding proteins and conserved stem cell regulators. The Caenorhabditis elegans PUF proteins FBF-1 and FBF-2 (collectively FBF) regulate mRNAs in germ cells. Without FBF, adult germlines lose all stem cells. A major gap in our understanding of PUF proteins, including FBF, is a global view of their binding sites in their native context (i.e., their “binding landscape”). To understand the interactions underlying FBF function, we used iCLIP (individual-nucleotide resolution UV crosslinking and immunoprecipitation) to determine binding landscapes of C. elegans FBF-1 and FBF-2 in the germline tissue of intact animals. Multiple iCLIP peak-calling methods were compared to maximize identification of both established FBF binding sites and positive control target mRNAs in our iCLIP data. We discovered that FBF-1 and FBF-2 bind to RNAs through canonical as well as alternate motifs. We also analyzed crosslinking-induced mutations to map binding sites precisely and to identify key nucleotides that may be critical for FBF–RNA interactions. FBF-1 and FBF-2 can bind sites in the 5′UTR, coding region, or 3′UTR, but have a strong bias for the 3′ end of transcripts. FBF-1 and FBF-2 have strongly overlapping target profiles, including mRNAs and noncoding RNAs. From a statistically robust list of 1404 common FBF targets, 847 were previously unknown, 154 were related to cell cycle regulation, three were lincRNAs, and 335 were shared with the human PUF protein PUM2. PMID:27165521

  8. Nuclear factors that bind to the enhancer region of nondefective Friend murine leukemia virus.

    PubMed Central

    Manley, N R; O'Connell, M A; Sharp, P A; Hopkins, N

    1989-01-01

    Nondefective Friend murine leukemia virus (MuLV) causes erythroleukemia when injected into newborn NFS mice, while Moloney MuLV causes T-cell lymphoma. Exchange of the Friend virus enhancer region, a sequence of about 180 nucleotides including the direct repeat and a short 3'-adjacent segment, for the corresponding region in Moloney MuLV confers the ability to cause erythroid disease on Moloney MuLV. We have used the electrophoretic mobility shift assay and methylation interference analysis to identify cellular factors which bind to the Friend virus enhancer region and compared these with factors, previously identified, that bind to the Moloney virus direct repeat (N. A. Speck and D. Baltimore, Mol. Cell. Biol. 7:1101-1110, 1987). We identified five binding sites for sequence-specific DNA-binding proteins in the Friend virus enhancer region. While some binding sites are present in both the Moloney and Friend virus enhancers, both viruses contain unique sites not present in the other. Although none of the factors identified in this report which bind to these unique sites are present exclusively in T cells or erythroid cells, they bind to three regions of the enhancer shown by genetic analysis to encode disease specificity and thus are candidates to mediate the tissue-specific expression and distinct disease specificities encoded by these virus enhancer elements. Images PMID:2778872

  9. Studies on the cellular localization of spinal cord substance P receptors.

    PubMed

    Helke, C J; Charlton, C G; Wiley, R G

    1986-10-01

    Substance P-immunoreactivity and specific substance P binding sites are present in the spinal cord. Receptor autoradiography showed the discrete localization of substance P binding sites in both sensory and motor regions of the spinal cord and functional studies suggested an important role for substance P receptor activation in autonomic outflow, nociception, respiration and somatic motor function. In the current studies, we investigated the cellular localization of substance P binding sites in rat spinal cord using light microscopic autoradiography combined with several lesioning techniques. Unilateral injections of the suicide transport agent, ricin, into the superior cervical ganglion reduced substance P binding and cholinesterase-stained preganglionic sympathetic neurons in the intermediolateral cell column. However, unilateral electrolytic lesions of ventral medullary substance P neurons which project to the intermediolateral cell column did not alter the density of substance P binding in the intermediolateral cell column. Likewise, 6-hydroxydopamine and 5,7-dihydroxytryptamine, which destroy noradrenergic and serotonergic nerve terminals, did not reduce the substance P binding in the intermediolateral cell column. It appears, therefore, that the substance P binding sites are located postsynaptically on preganglionic sympathetic neurons rather than presynaptically on substance P-immunoreactive processes (i.e. as autoreceptors) or on monoamine nerve terminals. Unilateral injections of ricin into the phrenic nerve resulted in the unilateral destruction of phrenic motor neurons in the cervical spinal cord and caused a marked reduction in the substance P binding in the nucleus. Likewise, sciatic nerve injections of ricin caused a loss of associated motor neurons in the lateral portion of the ventral horn of the lumbar spinal cord and a reduction in the substance P binding. Sciatic nerve injections of ricin also destroyed afferent nerves of the associated dorsal root ganglia and increased the density of substance P binding in the dorsal horn. Capsaicin, which destroys small diameter primary sensory neurons, similarly increased the substance P binding in the dorsal horn. These studies show that the cellular localization of substance P binding sites can be determined by analysis of changes in substance P binding to discrete regions of spinal cord after selective lesions of specific groups of neurons. The data show the presence of substance P binding sites on preganglionic sympathetic neurons in the intermediolateral cell column and on somatic motor neurons in the ventral horn, including the phrenic motor nucleus.(ABSTRACT TRUNCATED AT 400 WORDS)

  10. Monoclonal and anti-idiotypic anti-EBV/C3d receptor antibodies detect two binding sites, one for EBV and one for C3d on glycoprotein 140, the EBV/C3dR, expressed on human B lymphocytes.

    PubMed

    Barel, M; Fiandino, A; Delcayre, A X; Lyamani, F; Frade, R

    1988-09-01

    Glycoprotein (gp) 140, the EBV/C3dR of B lymphocytes, is a membrane site involved in human cell regulation. To analyze the specificities of the binding sites for EBV and for C3d on the gp 140 molecule, two distinct approaches were used. First, anti-EBV/C3dR mAb were prepared against highly purified EBV/C3dR. Nine anti-EBV/C3dR mAb were obtained. Four of these anti-EBV/C3dR mAb inhibited C3d binding but not EBV binding on gp 140, whereas four others exerted an inverse effect. These differences could not be due to differences in isotype, antibody concentration, affinity constant, and number of molecules bound on cell surface, as these parameters were identical for the nine used mAb. Second, polyclonal anti-idiotypic antibodies (Ab2) were prepared against F(ab)'2 fragments of polyclonal anti-EBV/C3dR (Ab1). Ab2 recognized the variable portion of Ab1 as controlled by immunoblotting experiments. Ab2, which did not react with the cell surface, inhibited Ab1 binding on Raji cells. Ab2 mimicked the EBV/C3dR by its properties to bind to particle-bound C3d and EBV, preventing their binding on Raji cell surface. C3d binding specificities contained in Ab2 were isolated by affinity chromatography on C3b/C3bi-Sepharose. These specificities, being the internal image of C3d binding site of EBV/C3dR, reacted with Ab1 and inhibited particle-bound C3d binding on Raji cells but did not react with EBV. Taken together, these data support strongly that gp 140, the EBV/C3dR, carried two distinct binding sites, one for EBV and one for C3d.

  11. CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

    PubMed Central

    Qiao, Huan; May, James M.

    2013-01-01

    SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

  12. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  13. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  14. Benzodiazepines modulate the A2 adenosine binding sites on 108CC15 neuroblastoma X glioma hybrid cells.

    PubMed Central

    Snell, C. R.; Snell, P. H.

    1984-01-01

    We have demonstrated high affinity diazepam binding sites of the Ro5-4864 benzodiazepine receptor subtype on 108CC15 neuroblastoma X glioma hybrid cells. These cells were previously shown to have purinoceptors of the A2 adenosine subtype and we have now found that [3H]-adenosine can be displaced from this binding site by the benzodiazepines and related compounds that can also bind to the Ro5-4864 site. Diazepam was found to have no intrinsic activity at the A2-receptor as measured by the stimulation of adenosine 3':5'-cyclic monophosphate (cyclic AMP) production in this cell line. At concentrations sufficient to compete for the A2-receptor, diazepam was shown to facilitate, by approximately 2 fold, the stimulation of cyclic AMP by adenosine. These effects are not due to inhibition of adenosine uptake or phosphodiesterase activity, but are probably a consequence of modulation of the coupling of the A2-receptor to cyclic AMP production in this hybrid cell line. PMID:6150742

  15. The elusive permeability barriers and binding sites for proflavine in Escherichia coli.

    PubMed

    Gravelle, M J; Mehta, B M; Kushner, D J

    1972-06-01

    Cells of proflavine-sensitive and -resistant Escherichia coli strains were altered in different ways, and the proflavine binding of the changed material was studied. Spheroplasts prepared from sensitive and resistant cells bound similar amounts of proflavine at saturation, whether or not they were osmotically protected by 10% sucrose. Intact cells bound approximately the same amounts of proflavine as spheroplasts. On addition of glucose, osmotically protected resistant but not sensitive spheroplasts released proflavine; unprotected spheroplasts did not release bound proflavine. Thus, osmotically protected membranes are not required for proflavine binding (a passive process) but are required for proflavine release (an active process). The presence of sucrose reduced proflavine binding by resistant cells. Adding glucose to cells in 20% sucrose did not cause a release of residual proflavine, though glucose caused a release of proflavine from cells suspended in 0 or 10% sucrose. On treatment of heated cells or ruptured spheroplasts with nucleases and Pronase, practically all nucleic acids were removed. Proflavine-binding ability of such preparations fell by only 30 to 50%. Washing heated cells with ethanol did not reduce their proflavine-binding ability. There appear to be important binding sites in cells aside from nucleic acids.

  16. The Elusive Permeability Barriers and Binding Sites for Proflavine in Escherichia coli

    PubMed Central

    Gravelle, M. Joan; Mehta, B. M.; Kushner, D. J.

    1972-01-01

    Cells of proflavine-sensitive and -resistant Escherichia coli strains were altered in different ways, and the proflavine binding of the changed material was studied. Spheroplasts prepared from sensitive and resistant cells bound similar amounts of proflavine at saturation, whether or not they were osmotically protected by 10% sucrose. Intact cells bound approximately the same amounts of proflavine as spheroplasts. On addition of glucose, osmotically protected resistant but not sensitive spheroplasts released proflavine; unprotected spheroplasts did not release bound proflavine. Thus, osmotically protected membranes are not required for proflavine binding (a passive process) but are required for proflavine release (an active process). The presence of sucrose reduced proflavine binding by resistant cells. Adding glucose to cells in 20% sucrose did not cause a release of residual proflavine, though glucose caused a release of proflavine from cells suspended in 0 or 10% sucrose. On treatment of heated cells or ruptured spheroplasts with nucleases and Pronase, practically all nucleic acids were removed. Proflavine-binding ability of such preparations fell by only 30 to 50%. Washing heated cells with ethanol did not reduce their proflavine-binding ability. There appear to be important binding sites in cells aside from nucleic acids. PMID:4618456

  17. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  18. Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

    PubMed

    Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

    2015-09-01

    The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

  19. The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

    DTIC Science & Technology

    positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

  20. Trichloroethylene-induced alterations in DNA methylation were enriched in polycomb protein binding sites in effector/memory CD4+ T cells

    PubMed Central

    Gilbert, Kathleen M.; Blossom, Sarah J.; Reisfeld, Brad; Erickson, Stephen W.; Vyas, Kanan; Maher, Mary; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A.; Bhattacharyya, Sudeepa

    2017-01-01

    Abstract Exposure to industrial solvent and water pollutant trichloroethylene (TCE) can promote autoimmunity, and expand effector/memory (CD62L) CD4+ T cells. In order to better understand etiology reduced representation bisulfite sequencing was used to study how a 40-week exposure to TCE in drinking water altered methylation of ∼337 770 CpG sites across the entire genome of effector/memory CD4+ T cells from MRL+/+ mice. Regardless of TCE exposure, 62% of CpG sites in autosomal chromosomes were hypomethylated (0–15% methylation), and 25% were hypermethylated (85–100% methylation). In contrast, only 6% of the CpGs on the X chromosome were hypomethylated, and 51% had mid-range methylation levels. In terms of TCE impact, TCE altered (≥ 10%) the methylation of 233 CpG sites in effector/memory CD4+ T cells. Approximately 31.7% of these differentially methylated sites occurred in regions known to bind one or more Polycomb group (PcG) proteins, namely Ezh2, Suz12, Mtf2 or Jarid2. In comparison, only 23.3% of CpG sites not differentially methylated by TCE were found in PcG protein binding regions. Transcriptomics revealed that TCE altered the expression of ∼560 genes in the same effector/memory CD4+ T cells. At least 80% of the immune genes altered by TCE had binding sites for PcG proteins flanking their transcription start site, or were regulated by other transcription factors that were in turn ordered by PcG proteins at their own transcription start site. Thus, PcG proteins, and the differential methylation of their binding sites, may represent a new mechanism by which TCE could alter the function of effector/memory CD4+ T cells. PMID:29129997

  1. Structural Requirements for Outside-In and Inside-Out Signaling by Drosophila Neuroglian, a Member of the L1 Family of Cell Adhesion Molecules

    PubMed Central

    Hortsch, Michael; Homer, Diahann; Malhotra, Jyoti Dhar; Chang, Sherry; Frankel, Jason; Jefford, Gregory; Dubreuil, Ronald R.

    1998-01-01

    Expression of the Drosophila cell adhesion molecule neuroglian in S2 cells leads to cell aggregation and the intracellular recruitment of ankyrin to cell contact sites. We localized the region of neuroglian that interacts with ankyrin and investigated the mechanism that limits this interaction to cell contact sites. Yeast two-hybrid analysis and expression of neuroglian deletion constructs in S2 cells identified a conserved 36-amino acid sequence that is required for ankyrin binding. Mutation of a conserved tyrosine residue within this region reduced ankyrin binding and extracellular adhesion. However, residual recruitment of ankyrin by this mutant neuroglian molecule was still limited to cell contacts, indicating that the lack of ankyrin binding at noncontact sites is not caused by tyrosine phosphorylation. A chimeric molecule, in which the extracellular domain of neuroglian was replaced with the corresponding domain from the adhesion molecule fasciclin II, also selectively recruited ankyrin to cell contacts. Thus, outside-in signaling by neuroglian in S2 cells depends on extracellular adhesion, but does not depend on any unique property of its extracellular domain. We propose that the recruitment of ankyrin to cell contact sites depends on a physical rearrangement of neuroglian in response to cell adhesion, and that ankyrin binding plays a reciprocal role in stabilizing the adhesive interaction. PMID:9660878

  2. Structural requirements for outside-in and inside-out signaling by Drosophila neuroglian, a member of the L1 family of cell adhesion molecules.

    PubMed

    Hortsch, M; Homer, D; Malhotra, J D; Chang, S; Frankel, J; Jefford, G; Dubreuil, R R

    1998-07-13

    Expression of the Drosophila cell adhesion molecule neuroglian in S2 cells leads to cell aggregation and the intracellular recruitment of ankyrin to cell contact sites. We localized the region of neuroglian that interacts with ankyrin and investigated the mechanism that limits this interaction to cell contact sites. Yeast two-hybrid analysis and expression of neuroglian deletion constructs in S2 cells identified a conserved 36-amino acid sequence that is required for ankyrin binding. Mutation of a conserved tyrosine residue within this region reduced ankyrin binding and extracellular adhesion. However, residual recruitment of ankyrin by this mutant neuroglian molecule was still limited to cell contacts, indicating that the lack of ankyrin binding at noncontact sites is not caused by tyrosine phosphorylation. A chimeric molecule, in which the extracellular domain of neuroglian was replaced with the corresponding domain from the adhesion molecule fasciclin II, also selectively recruited ankyrin to cell contacts. Thus, outside-in signaling by neuroglian in S2 cells depends on extracellular adhesion, but does not depend on any unique property of its extracellular domain. We propose that the recruitment of ankyrin to cell contact sites depends on a physical rearrangement of neuroglian in response to cell adhesion, and that ankyrin binding plays a reciprocal role in stabilizing the adhesive interaction.

  3. Fibronectin tetrapeptide is target for syphilis spirochete cytadherence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thomas, D.D.; Baseman, J.B.; Alderete, J.F.

    1985-11-01

    The syphilis bacterium, Treponema pallidum, parasitizes host cells through recognition of fibronectin (Fn) on cell surfaces. The active site of the Fn molecule has been identified as a four-amino acid sequence, arg-gly-asp-ser (RGDS), located on each monomer of the cell-binding domain. The synthetic heptapeptide gly-arg-gly-asp-ser-pro-cys (GRGDSPC), with the active site sequence RGDS, specifically competed with SVI-labeled cell-binding domain acquisition by T. pallidum. Additionally, the same heptapeptide with the RGDS sequence diminished treponemal attachment to HEp-2 and HT1080 cell monolayers. Related heptapeptides altered in one key amino acid within the RGDS sequence failed to inhibit Fn cell-binding domain acquisition or parasitismmore » of host cells by T. pallidum. The data support the view that T. pallidum cytadherence of host cells is through recognition of the RGDS sequence also important for eukaryotic cell-Fn binding.« less

  4. Iron depletion strategy for targeted cancer therapy: utilizing the dual roles of neutrophil gelatinase-associated lipocalin protein.

    PubMed

    Tang, Hsin-Chieh; Chang, Pei-Chun; Chen, Yu-Chian

    2016-01-01

    Decreasing iron uptake and increasing iron efflux may result in cell death by oxidative inactivation of vital enzymes. Applying the dual function of neutrophil gelatinase-associated lipocalin (NGAL) could achieve the goal of iron depletion in the cancer cells. Tyr106, Lys125 or Lys134 was the key binding site for NGAL protein to sequester iron-chelating siderophores. In this study, we employed all bioactive peptides in peptide databank to dock with the siderophore-binding sites of NGAL protein by virtual screening. In addition, we performed molecular dynamics (MD) simulation to observe the molecular character and structural variation of ligand-protein interaction. Glu-Glu-Lys-Glu (EEKE), Glu-Glu-Asp-Cys-Lys (EEDCK), and Gly-Glu-Glu-Cys-Asp (GEECD) were selected preliminarily by rigorous scoring functions for further investigation. GEECD was excluded due to higher binding total energy than the others. Moreover, we also excluded EEKE due to larger influence to the stability of binding residues by the information of root mean square fluctuation (RMSF) and principal component analysis (PCA). Thus, we suggested that EEDCK was the potential bioactive peptide which had been proved to inhibit malignant cells for targeted cancer therapy. Graphical Abstract Perspective drug design of occupying the siderophore-binding sites of NGAL outside the cell temporarily by a potential short peptide until NGAL enters into the cell, and releasing the siderophore-binding sites inside the cell.

  5. Development of sodium channel protein during chemically induced differentiation of neuroblastoma cells.

    PubMed

    Baumgold, J; Spector, I

    1987-04-01

    We have previously shown that the [3H]saxitoxin binding site of the sodium channel is expressed independently of the [125I]scorpion toxin binding site in chick muscle cultures and in rat brain. In the present work, we studied the development of the sodium channel protein during chemically induced differentiation of N1E-115 neuroblastoma cells, using [3H]saxitoxin binding, [125I]scorpion toxin binding, and 22Na uptake techniques. When grown in their normal culture medium, these cells are mostly undifferentiated, bind 90 +/- 10 fmol of [3H]saxitoxin/mg of protein and 112 +/- 14 fmol of [125I]scorpion toxin/mg protein, and, when stimulated with scorpion toxin and batrachotoxin, take up 70 +/- 5 nmol of 22Na/min/mg of protein. Cells treated with dimethyl sulfoxide (DMSO) or hexamethylene-bis-acetamide (HMBA) differentiate morphologically within 3 days. At this time, the [3H]saxitoxin binding, the [125I]scorpion toxin binding, and the 22Na uptake values are not very different from those of undifferentiated cells. With subsequent time in DMSO or HMBA, these values continue to increase, a result indicating that the main period of sodium channel expression occurs well after the cells have assumed the morphologically differentiated state. The data indicate that the expression of sodium channels and morphological differentiation are independently regulated neuronal properties, that the attainment of morphological differentiation is necessary but not in itself sufficient for full expression of the sodium channel proteins, and that, in contrast to the chick muscle cultures and rat brain, the [3H]saxitoxin site and [125I]scorpion toxin site appear to be coregulated in N1E-115 cells.

  6. Characterization of insulin-like growth factor I receptor on human erythrocytes.

    PubMed

    Hizuka, N; Takano, K; Tanaka, I; Honda, N; Tsushima, T; Shizume, K

    1985-12-01

    [125I]Insulin-like growth factor I (IGF-I) specifically bound to erythrocytes; the binding was saturable, and time and temperature dependent. Steady state binding was reached at 16 h at 4 C, and specific binding averaged 14.3 +/- 0.7% (+/- SEM) at a concentration of 3.6 X 10(9) cells/ml in seven normal subjects. [125I]IGF-I binding to the cells was displaced by unlabeled IGF-I in a dose-dependent manner. Scatchard analysis indicated a linear plot, and Ka and number of binding sites/cell were 1.43 +/- 0.07 X 10(9) M-1 and 20.7 +/- 2.2, respectively. Compared to IGF-I, the relative potencies of multiplication-stimulating activity and insulin for displacing [125I]IGF-I binding were 20% and 1%, respectively. [125I]IGF-I binding to erythrocytes from patients with acromegaly was lower than binding to cells from pituitary dwarfs. An inverse correlation between plasma IGF-I level and the number of IGF-I-binding sites per cell was found (r = -0.75; P less than 0.005). These results demonstrate that [125I]IGF-I binding to erythrocytes can be used for clinical measurement of the IGF-I receptor.

  7. Identification of cation-binding sites on actin that drive polymerization and modulate bending stiffness

    PubMed Central

    Kang, Hyeran; Bradley, Michael J.; McCullough, Brannon R.; Pierre, Anaëlle; Grintsevich, Elena E.; Reisler, Emil; De La Cruz, Enrique M.

    2012-01-01

    The assembly of actin monomers into filaments and networks plays vital roles throughout eukaryotic biology, including intracellular transport, cell motility, cell division, determining cellular shape, and providing cells with mechanical strength. The regulation of actin assembly and modulation of filament mechanical properties are critical for proper actin function. It is well established that physiological salt concentrations promote actin assembly and alter the overall bending mechanics of assembled filaments and networks. However, the molecular origins of these salt-dependent effects, particularly if they involve nonspecific ionic strength effects or specific ion-binding interactions, are unknown. Here, we demonstrate that specific cation binding at two discrete sites situated between adjacent subunits along the long-pitch helix drive actin polymerization and determine the filament bending rigidity. We classify the two sites as “polymerization” and “stiffness” sites based on the effects that mutations at the sites have on salt-dependent filament assembly and bending mechanics, respectively. These results establish the existence and location of the cation-binding sites that confer salt dependence to the assembly and mechanics of actin filaments. PMID:23027950

  8. ADENOVIRUS INTERACTION WITH ITS CELLULAR RECEPTOR CAR.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    HOWITT,J.; ANDERSON,C.W.; FREIMUTH,P.

    The mechanism of adenovirus attachment to the host cell plasma membrane has been revealed in detail by research over the past 10 years. It has long been known that receptor binding activity is associated with the viral fibers, trimeric spike proteins that protrude radially from the vertices of the icosahedral capsid (Philipson et al. 1968). In some adenovirus serotypes, fiber and other virus structural proteins are synthesized in excess and accumulate in the cell nucleus during late stages of infection. Fiber protein can be readily purified from lysates of cells infected with subgroup C viruses, for example Ad2 and Ad5more » (Boulanger and Puvion 1973). Addition of purified fiber protein to virus suspensions during adsorption strongly inhibits infection, indicating that fiber and intact virus particles compete for binding sites on host cells (Philipson et al. 1968; Hautala et al. 1998). Cell binding studies using purified radiolabeled fiber demonstrated that fiber binds specifically and with high affinity to the cell plasma membrane, and that cell lines typically used for laboratory propagation of adenovirus have approximately 10{sup 4} high-affinity receptor sites per cell (Persson et al. 1985; Freimuth 1996). Similar numbers of high-affinity binding sites for radiolabeled intact virus particles also were observed (Seth et al. 1994).« less

  9. The SPOR Domain, a Widely Conserved Peptidoglycan Binding Domain That Targets Proteins to the Site of Cell Division.

    PubMed

    Yahashiri, Atsushi; Jorgenson, Matthew A; Weiss, David S

    2017-07-15

    Sporulation-related repeat (SPOR) domains are small peptidoglycan (PG) binding domains found in thousands of bacterial proteins. The name "SPOR domain" stems from the fact that several early examples came from proteins involved in sporulation, but SPOR domain proteins are quite diverse and contribute to a variety of processes that involve remodeling of the PG sacculus, especially with respect to cell division. SPOR domains target proteins to the division site by binding to regions of PG devoid of stem peptides ("denuded" glycans), which in turn are enriched in septal PG by the intense, localized activity of cell wall amidases involved in daughter cell separation. This targeting mechanism sets SPOR domain proteins apart from most other septal ring proteins, which localize via protein-protein interactions. In addition to SPOR domains, bacteria contain several other PG-binding domains that can exploit features of the cell wall to target proteins to specific subcellular sites. Copyright © 2017 American Society for Microbiology.

  10. Two signaling molecules share a phosphotyrosine-containing binding site in the platelet-derived growth factor receptor.

    PubMed

    Nishimura, R; Li, W; Kashishian, A; Mondino, A; Zhou, M; Cooper, J; Schlessinger, J

    1993-11-01

    Autophosphorylation sites of growth factor receptors with tyrosine kinase activity function as specific binding sites for Src homology 2 (SH2) domains of signaling molecules. This interaction appears to be a crucial step in a mechanism by which receptor tyrosine kinases relay signals to downstream signaling pathways. Nck is a widely expressed protein consisting exclusively of SH2 and SH3 domains, the overexpression of which causes cell transformation. It has been shown that various growth factors stimulate the phosphorylation of Nck and its association with autophosphorylated growth factor receptors. A panel of platelet-derived growth factor (PDGF) receptor mutations at tyrosine residues has been used to identify the Nck binding site. Here we show that mutation at Tyr-751 of the PDGF beta-receptor eliminates Nck binding both in vitro and in living cells. Moreover, the Y751F PDGF receptor mutant failed to mediate PDGF-stimulated phosphorylation of Nck in intact cells. A phosphorylated Tyr-751 is also required for binding of phosphatidylinositol-3 kinase to the PDGF receptor. Hence, the SH2 domains of p85 and Nck share a binding site in the PDGF receptor. Competition experiments with different phosphopeptides derived from the PDGF receptor suggest that binding of Nck and p85 is influenced by different residues around Tyr-751. Thus, a single tyrosine autophosphorylation site is able to link the PDGF receptor to two distinct SH2 domain-containing signaling molecules.

  11. Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

    1988-09-01

    To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

  12. Small Molecule Interactome Mapping by Photoaffinity Labeling Reveals Binding Site Hotspots for the NSAIDs.

    PubMed

    Gao, Jinxu; Mfuh, Adelphe; Amako, Yuka; Woo, Christina M

    2018-03-28

    Many therapeutics elicit cell-type specific polypharmacology that is executed by a network of molecular recognition events between a small molecule and the whole proteome. However, measurement of the structures that underpin the molecular associations between the proteome and even common therapeutics, such as the nonsteroidal anti-inflammatory drugs (NSAIDs), is limited by the inability to map the small molecule interactome. To address this gap, we developed a platform termed small molecule interactome mapping by photoaffinity labeling (SIM-PAL) and applied it to the in cellulo direct characterization of specific NSAID binding sites. SIM-PAL uses (1) photochemical conjugation of NSAID derivatives in the whole proteome and (2) enrichment and isotope-recoding of the conjugated peptides for (3) targeted mass spectrometry-based assignment. Using SIM-PAL, we identified the NSAID interactome consisting of over 1000 significantly enriched proteins and directly characterized nearly 200 conjugated peptides representing direct binding sites of the photo-NSAIDs with proteins from Jurkat and K562 cells. The enriched proteins were often identified as parts of complexes, including known targets of NSAID activity (e.g., NF-κB) and novel interactions (e.g., AP-2, proteasome). The conjugated peptides revealed direct NSAID binding sites from the cell surface to the nucleus and a specific binding site hotspot for the three photo-NSAIDs on histones H2A and H2B. NSAID binding stabilized COX-2 and histone H2A by cellular thermal shift assay. Since small molecule stabilization of protein complexes is a gain of function regulatory mechanism, it is conceivable that NSAIDs affect biological processes through these broader proteomic interactions. SIM-PAL enabled characterization of NSAID binding site hotspots and is amenable to map global binding sites for virtually any molecule of interest.

  13. The mannose 6-phosphate-binding sites of M6P/IGF2R determine its capacity to suppress matrix invasion by squamous cell carcinoma cells

    PubMed Central

    Probst, Olivia C.; Karayel, Evren; Schida, Nicole; Nimmerfall, Elisabeth; Hehenberger, Elisabeth; Puxbaum, Verena; Mach, Lukas

    2013-01-01

    The M6P (mannose 6-phosphate)/IGF2R (insulin-like growth factor II receptor) interacts with a variety of factors that impinge on tumour invasion and metastasis. It has been shown that expression of wild-type M6P/IGF2R reduces the tumorigenic and invasive properties of receptor-deficient SCC-VII squamous cell carcinoma cells. We have now used mutant forms of M6P/IGF2R to assess the relevance of the different ligand-binding sites of the receptor for its biological activities in this cellular system. The results of the present study demonstrate that M6P/IGF2R does not require a functional binding site for insulin-like growth factor II for inhibition of anchorage-independent growth and matrix invasion by SCC-VII cells. In contrast, the simultaneous mutation of both M6P-binding sites is sufficient to impair all cellular functions of the receptor tested. These findings highlight that the interaction between M6P/IGF2R and M6P-modified ligands is not only important for intracellular accumulation of lysosomal enzymes and formation of dense lysosomes, but is also crucial for the ability of the receptor to suppress SCC-VII growth and invasion. The present study also shows that some of the biological activities of M6P/IGF2R in SCC-VII cells strongly depend on a functional M6P-binding site within domain 3, thus providing further evidence for the non-redundant cellular functions of the individual carbohydrate-binding domains of the receptor. PMID:23347038

  14. Specific receptors for phorbol diesters on freshly isolated human myeloid and lymphoid leukemia cells: comparable binding characteristics despite different cellular responses.

    PubMed

    Goodwin, B J; Moore, J O; Weinberg, J B

    1984-02-01

    Freshly isolated human leukemia cells have been shown in the past to display varying in vitro responses to phorbol diesters, depending on their cell type. Specific receptors for the phorbol diesters have been demonstrated on numerous different cells. This study was designed to characterize the receptors for phorbol diesters on leukemia cells freshly isolated from patients with different kinds of leukemia and to determine if differences in binding characteristics for tritium-labeled phorbol 12,13-dibutyrate (3H-PDBu) accounted for the different cellular responses elicited in vitro by phorbol diesters. Cells from 26 patients with different kinds of leukemia were studied. PDBu or phorbol 12-myristate 13-acetate (PMA) caused cells from patients with acute myeloblastic leukemia (AML), acute promyelocytic (APML), acute myelomonocytic (AMML), acute monocytic (AMoL), acute erythroleukemia (AEL), chronic myelocytic leukemia (CML) in blast crisis (myeloid), acute undifferentiated leukemia (AUL), and hairy cell leukemia (HCL) (n = 15) to adhere to plastic and spread. However, they caused no adherence or spreading and only slight aggregation of cells from patients with acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), or CML-blast crisis (lymphoid) (n = 11). All leukemia cells studied, irrespective of cellular type, displayed specific receptors for 3H-PDBu. The time courses for binding by all leukemia types were similar, with peak binding at 5-10 min at 37 degrees C and 120 min at 4 degrees C. The binding affinities were similar for patients with ALL (96 +/- 32 nM, n = 4), CLL (126 +/- 32 nM, n = 6), and acute nonlymphoid leukemia (73 +/- 14 nM, n = 11). Likewise, the numbers of specific binding sites/cell were comparable for the patients with ALL (6.2 +/- 1.3 X 10(5) sites/cell, n = 4), CLL (5.0 +/- 2.0 X 10(5) sites/cell, n = 6), and acute nonlymphoid leukemia (4.4 +/- 1.9 X 10(5) sites/cell, n = 11). Thus, the differing responses to phorbol diesters of various types of freshly isolated leukemia cells appear to be due to differences other than initial ligand-receptor binding.

  15. Identification of an inducible regulator of c-myb expression during T-cell activation.

    PubMed Central

    Phan, S C; Feeley, B; Withers, D; Boxer, L M

    1996-01-01

    Resting T cells express very low levels of c-Myb protein. During T-cell activation, c-myb expression is induced and much of the increase in expression occurs at the transcriptional level. We identified a region of the c-myb 5' flanking sequence that increased c-myb expression during T-cell activation. In vivo footprinting by ligation-mediated PCR was performed to correlate in vivo protein binding with functional activity. A protein footprint was visible over this region of the c-myb 5' flanking sequence in activated T cells but not in unactivated T cells. An electrophoretic mobility shift assay (EMSA) with nuclear extract from activated T cells and an oligonucleotide of this binding site demonstrated a new protein-DNA complex, referred to as CMAT for c-myb in activated T cells; this complex was not present in unactivated T cells. Because the binding site showed some sequence similarity with the nuclear factor of activated T cells (NFAT) binding site, we compared the kinetics of induction of the two binding complexes and the molecular masses of the two proteins. Studies of the kinetics of induction showed that the NFAT EMSA binding complex appeared earlier than the CMAT complex. The NFAT protein migrated more slowly in a sodium dodecyl sulfate-polyacrylamide gel than the CMAT protein did. In addition, an antibody against NFAT did not cross-react with the CMAT protein. The appearance of the CMAT binding complex was inhibited by both cyclosporin A and rapamycin. The CMAT protein appears to be a novel inducible protein involved in the regulation of c-myb expression during T-cell activation. PMID:8628306

  16. Distribution of cyclophilin B-binding sites in the subsets of human peripheral blood lymphocytes.

    PubMed

    Denys, A; Allain, F; Foxwell, B; Spik, G

    1997-08-01

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway and released in biological fluids. We have recently demonstrated that both free CyPB and CyPB-CsA complex specifically bind to peripheral blood T lymphocytes and are internalized. These results suggest that CyPB might promote the targeting of the drug into sensitive cells. Peripheral blood lymphocytes are subdivided in several populations according to their biological functions and sensitivity to CsA. We have investigated the binding of CyPB to these different subsets using a CyPB derivatized by fluorescein through its single cysteine which retains its binding properties. We have confirmed that only T cells were involved in the interaction with CyPB. The ligand binding was found to be heterogeneously distributed on the different T-cell subsets and surface-bound CyPB was mainly associated with the CD4-positive cells. No significant difference was noted between the CD45RA and CD45RO subsets, demonstrating that CyPB-binding sites were equally distributed between native and memory T cells. CD3 stimulation of T lymphocytes led to a decrease in the CyPB-binding capacity, that may be explained by a down-regulation of the CyPB-receptor expression upon T-cell activation. Finally, we demonstrated that CyPB-receptor-positive cells, isolated on CyPB sulphydryl-coupled affinity matrices, are more sensitive to CyPB-complexed CsA than mixed peripheral blood lymphocytes, suggesting that CyPB potentiates CsA activity through the binding of the complex. Taken together, our results demonstrate that CyPB-binding sites are mainly associated with resting cells of the helper T lymphocyte, and that CyPB might modulate the distribution of CsA through the drug targeting to sensitive cells.

  17. Structural and mutational analyses of the receptor binding domain of botulinum D/C mosaic neurotoxin: Insight into the ganglioside binding mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nuemket, Nipawan; Tanaka, Yoshikazu; Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810

    2011-07-29

    Highlights: {yields} We determined the crystal structure of the receptor binding domain of BoNT in complex with 3'-sialyllactose. {yields} An electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. {yields} Alanine site-directed mutagenesis showed that GBS and GBL are important for ganglioside binding. {yields} A cell binding mechanism, which involves cooperative contribution of two sites, was proposed. -- Abstract: Clostridium botulinum type D strain OFD05, which produces the D/C mosaic neurotoxin, was isolated from cattle killed by the recent botulism outbreak in Japan. The D/C mosaic neurotoxin is the most toxic of the botulinummore » neurotoxins (BoNT) characterized to date. Here, we determined the crystal structure of the receptor binding domain of BoNT from strain OFD05 in complex with 3'-sialyllactose at a resolution of 3.0 A. In the structure, an electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. Alanine site-directed mutagenesis showed the significant contribution of the residues surrounding the cleft to ganglioside recognition. In addition, a loop adjoining the cleft also plays an important role in ganglioside recognition. In contrast, little effect was observed when the residues located around the surface previously identified as the protein receptor binding site in other BoNTs were substituted. The results of cell binding analysis of the mutants were significantly correlated with the ganglioside binding properties. Based on these observations, a cell binding mechanism of BoNT from strain OFD05 is proposed, which involves cooperative contribution of two ganglioside binding sites.« less

  18. Volatile anesthetics, not intravenous anesthetic propofol bind to and attenuate the activation of platelet receptor integrin αIIbβ3.

    PubMed

    Yuki, Koichi; Bu, Weiming; Shimaoka, Motomu; Eckenhoff, Roderic

    2013-01-01

    In clinical reports, the usage of isoflurane and sevoflurane was associated with more surgical field bleeding in endoscopic sinus surgeries as compared to propofol. The activation of platelet receptor αIIbβ3 is a crucial event for platelet aggregation and clot stability. Here we studied the effect of isoflurane, sevoflurane, and propofol on the activation of αIIbβ3. The effect of anesthetics on the activation of αIIbβ3 was probed using the activation sensitive antibody PAC-1 in both cell-based (platelets and αIIbβ3 transfectants) and cell-free assays. The binding sites of isoflurane on αIIbβ3 were explored using photoactivatable isoflurane (azi-isoflurane). The functional implication of revealed isoflurane binding sites were studied using alanine-scanning mutagenesis. Isoflurane and sevoflurane diminished the binding of PAC-1 to wild-type αIIbβ3 transfectants, but not to the high-affinity mutant, β3-N305T. Both anesthetics also impaired PAC-1 binding in a cell-free assay. In contrast, propofol did not affect the activation of αIIbβ3. Residues adducted by azi-isoflurane were near the calcium binding site (an important regulatory site termed SyMBS) just outside of the ligand binding site. The mutagenesis experiments demonstrated that these adducted residues were important in regulating integrin activation. Isoflurane and sevoflurane, but not propofol, impaired the activation of αIIbβ3. Azi-isoflurane binds to the regulatory site of integrin αIIbβ3, thereby suggesting that isoflurane blocks ligand binding of αIIbβ3 in not a competitive, but an allosteric manner.

  19. Atrial natriuretic peptide receptor heterogeneity and effects on cyclic GMP accumulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leitman, D.C.

    1988-01-01

    The effects of atrial natriuretic peptide (ANP), oxytocin (OT) and vasopressin (AVP) on guanylate cyclase activity and cyclic GMP accumulation were examined, since these hormones appear to be intimately associated with blood pressure and intravascular volume homeostasis. ANP was found to increase cyclic GMP accumulation in ten cell culture systems, which were derived from blood vessels, adrenal cortex, kidney, lung, testes and mammary gland. ANP receptors were characterized in intact cultured cells using {sup 125}I-ANP{sub 8-33}. Specific {sup 125}I-ANP binding was saturable and of high affinity. Scratchard analysis of the binding data for all cell types exhibited a straight line,more » indicating that these cells possessed a single class of binding sites. Despite the presence of linear Scatchard plots, these studies demonstrated that cultured cells possess two functionally and physically distinct ANP-binding sites. Most of the ANP-binding sites in cultured cells have a molecular size of 66,000 daltons under reducing conditions. The identification of cultured cell types in which hormones (ANP and oxytocin) regulate guanylate cyclase activity and increase cyclic GMP synthesis will provide valuable systems to determine the mechanisms of hormone-receptor coupling to guanylate cyclase and the cellular processes regulated by cyclic GMP.« less

  20. The effect of interferon on the receptor sites to rabies virus on mouse neuroblastoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Briggs, D.J.

    1989-01-01

    The binding of rabies virus to mouse neuroblastoma cells (MNA) primed with alpha interferon (IFN-{alpha}), beta interferon (IFN-{beta}), or alpha bungarotoxin (BTX) was examined. A saturable number of receptor sites to rabies virus was calculated by increasing the amount of {sup 3}H-CVS added to a constant number of untreated MNA cells. MNA cells were then exposed to 20 I.U. of IFN-{alpha}, IFN-{beta}, or 1 {mu}g of BTX and assayed to determine if these treatments had an effect on the number of receptor sites to rabies virus. Total amount of {sup 3}H-CVS bound to MNA cells was determined during a threemore » hour incubation period. Cold competition assays using 1,000 fold excess unlabeled CVS were used to determine non-specific binding for each treatment. Specific binding was then calculated by subtracting non-specific binding from the total amount of CVS bound to MNA cells. A similar amount of total viral protein bound to untreated and IFN-{beta}, and BTX treated cells after 180 minutes of incubation. The bound protein varied by only 0.07 {mu}g. However, the amount of specific and non-specific binding varied a great deal between treatments. BTX caused an increase in non-specific and a decrease in specific binding of rabies virus. IFN-{beta} produced variable results in non-specific and specific binding while IFN-{alpha} caused mainly specific binding to occur. The most significant change brought about by IFN-{alpha} was an increase in the rate of viral attachment. At 30 minutes post-infection, IFN-{alpha} treated cells had bound 90% of the total amount of virus bound to untreated cells after 180 minutes. The increased binding rate did not cause a productive infection of rabies virus. No viral production was evident after an incubation period of 48 hours in either IFN-{alpha} or IFN-{beta} treated cells.« less

  1. SH2 Binding Site Protection Assay: A Method for Identification of SH2 Domain Interaction Partners by Exploiting SH2 Mediated Phosphosite Protection.

    PubMed

    Jadwin, Joshua A

    2017-01-01

    Over the last two decades there has been a significant effort in the field to characterize the phosphosite binding specificities of SH2 domains with the goal of deciphering the pY signaling code. Although high throughput studies in various formats using most SH2 domains have collectively provided a rich resource of in vitro SH2-pTyr site specificity maps, this data can only be used approximate what is happening in the cell where protein concentrations and localization are not homogenous, as they are for in vitro experiments. Here we describe an in vivo approach, SH2 site protection assay, which can capture the pTyr binding specificity of SH2 domains in the cell. The basis of this approach is SH2-pY site protection, the ability of SH2 domains to prevent the PTP-dependent dephosphorylation of their pY site binding partners. We overexpress a tracer SH2 domain in cells and quantify the change in abundance of tyrosine phosphorylated sites using MS. Since the method is performed in vivo, it has the advantage of identifying SH2-pY interactions as they occur within in the cell.

  2. Ganglioside inhibition of sup 125 I-plasmin binding to colorectal carcinoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liepkalns, V.A.; Burtin, M.C.; Correc, P.

    1990-01-01

    The pre-incubation of human colorectal carcinoma cells SW 1116 with 25 to 100 uM purified gangliosides resulted in 35-60% inhibition of specific {sup 125}I-plasmin binding to the cell surface. After 5 to 6 days in culture, tumor cells were pre-incubated at 4 degrees for 1 to 4 h followed by post-incubation with {sup 125}I-plasmin by techniques previously described. At 25 uM the capacity for inhibition of plasmin binding was GT1b greater than GQ1b greater than or equal to GD1a greater than GM1 less than or equal to GgOse 4Cer. Thus a terminal sialyl moiety appears to be necessary (p lessmore » than 0.05) although exogenous N-acetyl neuraminic acid was ineffective (p greater than 0.05), indicating a role for the lipid portion of the ganglioside. Other (glyco)lipids such as sphingosine, fucolipid H-1 and sulfatide were without significant effect. The inhibition could not be reversed by the presence of 10 mM Ca+2, EDTA, pre-treatment of the cell with carboxypeptidase or pretreatment of plasmin with neuraminidases. The inhibition was however reversed by post-incubation in control medium without exogenous ganglioside. Cell counts determined prior to, and after ganglioside incubation showed that the effect was not due to cell death or detachment from the culture surface. The dissociation constant for {sup 125}I-plasmin binding was 5.6 x 10(-8) M (700,000 sites/cell), but in the presence of trisialoganglioside (GT1b), Scatchard plots suggested diversification of binding sites with 280,000 sites/cell at Kd 2.6 x 10(-8) M and 820,000 sites/cell at Kd 2.1 x 10(-7) M. Another interpretation of the Scatchard plot in the presence of ganglioside was that the glycolipid imposed negative cooperativity on plasmin binding to the cell surface. These results suggest that certain gangliosides can affect tumor cell invasiveness by altering protease binding to the cell surface.« less

  3. TALE activators regulate gene expression in a position- and strand-dependent manner in mammalian cells.

    PubMed

    Uhde-Stone, Claudia; Cheung, Edna; Lu, Biao

    2014-01-24

    Transcription activator-like effectors (TALEs) are a class of transcription factors that are readily programmable to regulate gene expression. Despite their growing popularity, little is known about binding site parameters that influence TALE-mediated gene activation in mammalian cells. We demonstrate that TALE activators modulate gene expression in mammalian cells in a position- and strand-dependent manner. To study the effects of binding site location, we engineered TALEs customized to recognize specific DNA sequences located in either the promoter or the transcribed region of reporter genes. We found that TALE activators robustly activated reporter genes when their binding sites were located within the promoter region. In contrast, TALE activators inhibited the expression of reporter genes when their binding sites were located on the sense strand of the transcribed region. Notably, this repression was independent of the effector domain utilized, suggesting a simple blockage mechanism. We conclude that TALE activators in mammalian cells regulate genes in a position- and strand-dependent manner that is substantially different from gene activation by native TALEs in plants. These findings have implications for optimizing the design of custom TALEs for genetic manipulation in mammalian cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Benzodiazepines: rat pinealocyte binding sites and augmentation of norepinephrine-stimulated N-acetyltransferase activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matthew, E.; Parfitt, A.G.; Sugden, D.

    1984-02-01

    Studies of (/sup 3/H)diazepam binding to intact rat pineal cells were carried out in tissue culture preparations. The binding was saturable, reversible and proportional to the number of cells used. Scatchard analysis resulted in a linear plot (Kd . 23 nM, maximum binding sites (Bmax) . 1.56 pmol/mg of protein for cells in monolayer culture; Kd . 7 nM, Bmax . 1.3 pmol/mg of protein for cells in suspension culture). Inhibition constants (Ki) for clonazepam (500 nM), flunitrazepam (38 nM) and Ro-5-4864 (5 nM) indicated that the binding sites were probably of the ''peripheral'' type. In addition, the effects ofmore » diazepam on norepinephrine-stimulated N-acetyltransferase (NAT) activity were studied in organ culture and dissociated cell culture. Diazepam (10-50 microM) both prolonged and increased the magnitude of the norepinephrine-induced increase in NAT activity but did not affect the initial rate of rise of enzyme activity. The effect was dose-dependent and was also seen with clonazepam, flunitrazepam and Ro-5-4864, but not with Ro-15-1788. Diazepam, by itself, at these concentrations, had no effect on NAT, but enzyme activity was increased by higher concentrations (0.1-1 mM). Although a relationship between the (/sup 3/H)diazepam binding sites described here and the effect of benzodiazepines on NAT cannot be established from these studies, the data suggest that the benzodiazepines may alter melatonin levels through their action on NAT.« less

  5. Localization of binding sites of Ulex europaeus I, Helix pomatia and Griffonia simplicifolia I-B4 lectins and analysis of their backbone structures by several glycosidases and poly-N-acetyllactosamine-specific lectins in human breast carcinomas.

    PubMed

    Ito, N; Imai, S; Haga, S; Nagaike, C; Morimura, Y; Hatake, K

    1996-09-01

    Several studies have shown the deletion of blood group A or B antigens and the accumulation of H antigens in human breast carcinomas. Other studies have independently demonstrated that the binding sites of lectins such as Helix pomatia agglutinin (HPA) and Griffonia simplicifolia agglutinin I-B4 (GSAI-B4) are highly expressed in these cells. In order to clarify the molecular mechanisms of malignant transformation and metastasis of carcinoma cells, it is important to understand the relationship between such phenotypically distinct events. For this purpose, we examined whether the binding sites of these lectins and Ulex europaeus agglutinin I (UEA-I) are expressed concomitantly in the same carcinoma cells and analyzed their backbone structures. The expression of the binding sites of these lectins was observed independently of the blood group (ABO) of the patients and was not affected by the histological type of the carcinomas. Observation of serial sections stained with these lectins revealed that the distribution of HPA binding sites was almost identical to that of GSAI-B4 in most cases. Furthermore, in some cases, UEA-I binding patterns were similar to those of HPA and GSAI-B4 but in other cases, mosaic staining patterns with these lectins were also observed, i.e., some cell clusters were stained with both HPA and GSAI-B4 but not with UEA-I and adjacent cell clusters were stained only with UEA-I. Digestion with endo-beta-galactosidase or N-glycosidase F markedly reduced the staining intensity of these lectins. Together with the reduction of staining by these lectins, reactivity with Griffonia simplicifolia agglutinin II appeared in carcinoma cells following endo-beta-galactosidase digestion. Among the lectins specific to poly-N-acetyllactosamine, Lycopersicon esculentum agglutinin (LEA) most vividly and consistently stained the cancer cells. Next to LEA, pokeweed mitogen agglutinin was also effective in staining these cells. Carcinoma cells reactive with these lectins corresponded well to those stained with both HPA and GSAI-B4, and in some cases, with UEA-I. These results demonstrate that the binding sites of UEA-I, HPA, and GSAI-B4 are expressed concomitantly in the same carcinoma cells and all carry linear and branched poly-N-acetyllactosamine on N-glycans, suggesting that the synthesis of this complex carbohydrate is one of the most important and basic processes leading to the malignant transformation of cells, invasion, and metastasis of carcinoma cells.

  6. Release of specific proteins from nuclei of HL-60 and MOLT-4 cells by antitumor drugs having affinity to nucleic acids.

    PubMed

    Lassota, P; Melamed, M R; Darzynkiewicz, Z

    The binding sites for mitoxantrone (MIT), Ametantrone (AMT), doxorubicin (DOX), actinomycin D (AMD) and ethidium bromide (EB) in nuclei from exponentially growing and differentiating human promyelocytic HL-60 and lymphocytic leukemic MOLT-4 cells were studied by gel electrophoresis of proteins selectively released during titration of these nuclei with the drugs. Each drug at different drug: DNA binding ratios resulted in a characteristic pattern of protein elution and/or retention. For example, in nuclei from exponentially growing HL-60 cells, MIT affected 44 nuclear proteins that were different from those affected by EB; of these 29 were progressively released at increasing MIT:DNA ratios, 11 were transiently released (i.e. only at a low MIT:DNA ratio) and 4 entrapped. Patterns of proteins displaced from nuclei of exponentially growing HL-60 cells differed from those of cells undergoing myeloid differentiation as well as from those of exponentially growing MOLT-4 cells. The first effects were seen at a binding density of approximately one drug molecule per 10-50 base pairs of DNA. The observed selective displacement of proteins may reflect drug-altered affinity of the binding sites for those proteins, for example due to a change of nucleic acid or protein conformation upon binding the ligand. The data show that the binding site(s) for each of the ligands studied is different and the differences correlate with variability in chemical structure between the ligands. The nature of the drug-affected proteins may provide clues regarding antitumor or cytotoxic mechanisms of drug action.

  7. Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

    PubMed Central

    Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

    2018-01-01

    Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

  8. Cell specific, variable density, polymer microspheres

    NASA Technical Reports Server (NTRS)

    Yen, Shiao-Ping S. (Inventor); Rembaum, Alan (Inventor); Molday, Robert S. (Inventor)

    1977-01-01

    Biocompatible polymeric microspheres having an average diameter below about 3 microns and having density at least 15% greater or lesser than organic cells and having covalent binding sites are provided in accordance with this invention. The microspheres are obtained by copolymerizing a hydroxy or amine substituted acrylic monomer such as hydroxyethylmethacrylate with a light or dense comonomer such as a fluoromonomer. A lectin or antibody is bound to the hydroxy or amine site of the bead to provide cell specificity. When added to a cell suspension the marked bead will specifically label the cell membrane by binding to specific receptor sites thereon. The labelled membrane can then be separated by density gradient centrifugation.

  9. Toxic shock syndrome toxin 1 binds to major histocompatibility complex class II molecules.

    PubMed Central

    Scholl, P; Diez, A; Mourad, W; Parsonnet, J; Geha, R S; Chatila, T

    1989-01-01

    Toxic shock syndrome toxin 1 (TSST-1) is a 22-kDa exotoxin produced by strains of Staphylococcus aureus and implicated in the pathogenesis of toxic shock syndrome. In common with other staphylococcal exotoxins, TSST-1 has diverse immunological effects. These include the induction of interleukin 2 receptor expression, interleukin 2 synthesis, proliferation of human T lymphocytes, and stimulation of interleukin 1 synthesis by human monocytes. In the present study, we demonstrate that TSST-1 binds with saturation kinetics and with a dissociation constant of 17-43 nM to a single class of binding sites on human mononuclear cells. There was a strong correlation between the number of TSST-1 binding sites and the expression of major histocompatibility complex class II molecules, and interferon-gamma induced the expression of class II molecules as well as TSST-1 binding sites on human skin-derived fibroblasts. Monoclonal antibodies to HLA-DR, but not to HLA-DP or HLA-DQ, strongly inhibited TSST-1 binding. Affinity chromatography of 125I-labeled cell membranes over TSST-1-agarose resulted in the recovery of two bands of 35 kDa and 31 kDa that comigrated, respectively, with the alpha and beta chains of HLA-DR and that could be immunoprecipitated with anti-HLA-DR monoclonal antibodies. Binding of TSST-1 was demonstrated to HLA-DR and HLA-DQ L-cell transfectants. These results indicate that major histocompatibility complex class II molecules represent the major binding site for TSST-1 on human cells. Images PMID:2542966

  10. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  11. Desleucyl-Oritavancin with a Damaged d-Ala-d-Ala Binding Site Inhibits the Transpeptidation Step of Cell-Wall Biosynthesis in Whole Cells of Staphylococcus aureus.

    PubMed

    Kim, Sung Joon; Singh, Manmilan; Sharif, Shasad; Schaefer, Jacob

    2017-03-14

    We have used solid-state nuclear magnetic resonance to characterize the exact nature of the dual mode of action of oritavancin in preventing cell-wall assembly in Staphylococcus aureus. Measurements performed on whole cells labeled selectively in vivo have established that des-N-methylleucyl-N-4-(4-fluorophenyl)benzyl-chloroeremomycin, an Edman degradation product of [ 19 F]oritavancin, which has a damaged d-Ala-d-Ala binding aglycon, is a potent inhibitor of the transpeptidase activity of cell-wall biosynthesis. The desleucyl drug binds to partially cross-linked peptidoglycan by a cleft formed between the drug aglycon and its biphenyl hydrophobic side chain. This type of binding site is present in other oritavancin-like glycopeptides, which suggests that for these drugs a similar transpeptidase inhibition occurs.

  12. Differential regulation of transcription through distinct Suppressor of Hairless DNA binding site architectures during Notch signaling in proneural clusters.

    PubMed

    Cave, John W; Xia, Li; Caudy, Michael

    2011-01-01

    In Drosophila melanogaster, achaete (ac) and m8 are model basic helix-loop-helix activator (bHLH A) and repressor genes, respectively, that have the opposite cell expression pattern in proneural clusters during Notch signaling. Previous studies have shown that activation of m8 transcription in specific cells within proneural clusters by Notch signaling is programmed by a "combinatorial" and "architectural" DNA transcription code containing binding sites for the Su(H) and proneural bHLH A proteins. Here we show the novel result that the ac promoter contains a similar combinatorial code of Su(H) and bHLH A binding sites but contains a different Su(H) site architectural code that does not mediate activation during Notch signaling, thus programming a cell expression pattern opposite that of m8 in proneural clusters.

  13. Basic Fibroblast Growth Factor Activates Serum Response Factor Gene Expression by Multiple Distinct Signaling Mechanisms

    PubMed Central

    Spencer, Jeffrey A.; Major, Michael L.; Misra, Ravi P.

    1999-01-01

    Serum response factor (SRF) plays a central role in the transcriptional response of mammalian cells to a variety of extracellular signals. It is a key regulator of many cellular early response genes which are believed to be involved in cell growth and differentiation. The mechanism by which SRF activates transcription in response to mitogenic agents has been extensively studied; however, significantly less is known about regulation of the SRF gene itself. Previously, we identified distinct regulatory elements in the SRF promoter that play a role in activation, including a consensus ETS domain binding site, a consensus overlapping Sp/Egr-1 binding site, and two SRF binding sites. We further showed that serum induces SRF by a mechanism that requires an intact SRF binding site, also termed a CArG box. In the present study we demonstrate that in response to stimulation of cells by a purified growth factor, basic fibroblast growth factor (bFGF), the SRF promoter is upregulated by a complex pathway that involves at least two independent mechanisms: a CArG box-independent mechanism that is mediated by an ETS binding site, and a novel CArG box-dependent mechanism that requires both an Sp factor binding site and the CArG motifs for maximal stimulation. Our analysis indicates that the CArG/Sp element activation mechanism is mediated by distinct signaling pathways. The CArG box-dependent component is targeted by a Rho-mediated pathway, and the Sp binding site-dependent component is targeted by a Ras-mediated pathway. Both SRF and bFGF have been implicated in playing an important role in mediating cardiogenesis during development. The implications of our findings for SRF expression during development are discussed. PMID:10330138

  14. Crystal structure of Urtica dioica agglutinin, a superantigen presented by MHC molecules of class I and class II.

    PubMed

    Saul, F A; Rovira, P; Boulot, G; Damme, E J; Peumans, W J; Truffa-Bachi, P; Bentley, G A

    2000-06-15

    Urtica dioica agglutinin (UDA), a monomeric lectin extracted from stinging nettle rhizomes, is specific for saccharides containing N-acetylglucosamine (GlcNAc). The lectin behaves as a superantigen for murine T cells, inducing the exclusive proliferation of Vbeta8.3(+) lymphocytes. UDA is unique among known T cell superantigens because it can be presented by major histocompatibility complex (MHC) molecules of both class I and II. The crystal structure of UDA has been determined in the ligand-free state, and in complex with tri-acetylchitotriose and tetra-acetylchitotetraose at 1.66 A, 1.90 A and 1.40 A resolution, respectively. UDA comprises two hevein-like domains, each with a saccharide-binding site. A serine and three aromatic residues at each site form the principal contacts with the ligand. The N-terminal domain binding site can centre on any residue of a chito-oligosaccharide, whereas that of the C-terminal domain is specific for residues at the nonreducing terminus of the ligand. We have shown previously that oligomers of GlcNAc inhibit the superantigenic activity of UDA and that the lectin binds to glycans on the MHC molecule. We show that UDA also binds to glycans on the T cell receptor (TCR). The presence of two saccharide-binding sites observed in the structure of UDA suggests that its superantigenic properties arise from the simultaneous fixation of glycans on the TCR and MHC molecules of the T cell and antigen-presenting cell, respectively. The well defined spacing between the two binding sites of UDA is probably a key factor in determining the specificity for Vbeta8.3(+) lymphocytes.

  15. Nucleosome regulatory dynamics in response to TGFβ

    PubMed Central

    Enroth, Stefan; Andersson, Robin; Bysani, Madhusudhan; Wallerman, Ola; Termén, Stefan; Tuch, Brian B.; De La Vega, Francisco M.; Heldin, Carl-Henrik; Moustakas, Aristidis; Komorowski, Jan; Wadelius, Claes

    2014-01-01

    Nucleosomes play important roles in a cell beyond their basal functionality in chromatin compaction. Their placement affects all steps in transcriptional regulation, from transcription factor (TF) binding to messenger ribonucleic acid (mRNA) synthesis. Careful profiling of their locations and dynamics in response to stimuli is important to further our understanding of transcriptional regulation by the state of chromatin. We measured nucleosome occupancy in human hepatic cells before and after treatment with transforming growth factor beta 1 (TGFβ1), using massively parallel sequencing. With a newly developed method, SuMMIt, for precise positioning of nucleosomes we inferred dynamics of the nucleosomal landscape. Distinct nucleosome positioning has previously been described at transcription start site and flanking TF binding sites. We found that the average pattern is present at very few sites and, in case of TF binding, the double peak surrounding the sites is just an artifact of averaging over many loci. We systematically searched for depleted nucleosomes in stimulated cells compared to unstimulated cells and identified 24 318 loci. Depending on genomic annotation, 44–78% of them were over-represented in binding motifs for TFs. Changes in binding affinity were verified for HNF4α by qPCR. Strikingly many of these loci were associated with expression changes, as measured by RNA sequencing. PMID:24771338

  16. Genistein and bisphenol A exposure cause estrogen receptor 1 to bind thousands of sites in a cell type-specific manner

    PubMed Central

    Gertz, Jason; Reddy, Timothy E.; Varley, Katherine E.; Garabedian, Michael J.; Myers, Richard M.

    2012-01-01

    Endogenous estrogens that are synthesized in the body impact gene regulation by activating estrogen receptors in diverse cell types. Exogenous compounds that have estrogenic properties can also be found circulating in the blood in both children and adults. The genome-wide impact of these environmental estrogens on gene regulation is unclear. To obtain an integrated view of gene regulation in response to environmental and endogenous estrogens on a genome-wide scale, we performed ChIP-seq to identify estrogen receptor 1 (ESR1; previously estrogen receptor α) binding sites, and RNA-seq in endometrial cancer cells exposed to bisphenol A (BPA; found in plastics), genistein (GEN; found in soybean), or 17β-estradiol (E2; an endogenous estrogen). GEN and BPA treatment induces thousands of ESR1 binding sites and >50 gene expression changes, representing a subset of E2-induced gene regulation changes. Genes affected by E2 were highly enriched for ribosome-associated proteins; however, GEN and BPA failed to regulate most ribosome-associated proteins and instead enriched for transporters of carboxylic acids. Treatment-dependent changes in gene expression were associated with treatment-dependent ESR1 binding sites, with the exception that many genes up-regulated by E2 harbored a BPA-induced ESR1 binding site but failed to show any expression change after BPA treatment. GEN and BPA exhibited a similar relationship to E2 in the breast cancer line T-47D, where cell type specificity played a much larger role than treatment specificity. Overall, both environmental estrogens clearly regulate gene expression through ESR1 on a genome-wide scale, although with lower potency resulting in less ESR1 binding sites and less gene expression changes compared to the endogenous estrogen, E2. PMID:23019147

  17. Evidence for in vivo phosphorylation of the Grb2 SH2-domain binding site on focal adhesion kinase by Src-family protein-tyrosine kinases.

    PubMed

    Schlaepfer, D D; Hunter, T

    1996-10-01

    Focal adhesion kinase (FAK) is a nonreceptor protein-tyrosine kinase (PTK) that associates with integrin receptors and participates in extracellular matrix-mediated signal transduction events. We showed previously that the c-Src nonreceptor PTK and the Grb2 SH2/SH3 adaptor protein bound directly to FAK after fibronectin stimulation (D. D. Schlaepfer, S.K. Hanks, T. Hunter, and P. van der Geer, Nature [London] 372:786-791, 1994). Here, we present evidence that c-Src association with FAK is required for Grb2 binding to FAK. Using a tryptic phosphopeptide mapping approach, the in vivo phosphorylation of the Grb2 binding site on FAK (Tyr-925) was detected after fibronectin stimulation of NIH 3T3 cells and was constitutively phosphorylated in v-Src-transformed NIH 3T3 cells. In vitro, c-Src phosphorylated FAK Tyr-925 in a glutathione S-transferase-FAK C-terminal domain fusion protein, whereas FAK did not. Using epitope-tagged FAK constructs, transiently expressed in human 293 cells, we determined the effect of site-directed mutations on c-Src and Grb2 binding to FAK. Mutation of FAK Tyr-925 disrupted Grb2 binding, whereas mutation of the c-Src binding site on FAK (Tyr-397) disrupted both c-Src and Grb2 binding to FAK in vivo. These results support a model whereby Src-family PTKs are recruited to FAK and focal adhesions following integrin-induced autophosphorylation and exposure of FAK Tyr-397. Src-family binding and phosphorylation of FAK at Tyr-925 creates a Grb2 SH2-domain binding site and provides a link to the activation of the Ras signal transduction pathway. In Src-transformed cells, this pathway may be constitutively activated as a result of FAK Tyr-925 phosphorylation in the absence of integrin stimulation.

  18. Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

    PubMed

    Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

    2006-07-01

    High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

  19. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  20. Removal of either N-glycan site from the envelope receptor binding domain of Moloney and Friend but not AKV mouse ecotropic gammaretroviruses alters receptor usage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Knoper, Ryan C.; Ferrarone, John; Yan Yuhe

    2009-09-01

    Three N-linked glycosylation sites were removed from the envelope glycoproteins of Friend, Moloney, and AKV mouse ecotropic gammaretroviruses: gs1 and gs2, in the receptor binding domain; and gs8, in a region implicated in post-binding cell fusion. Mutants were tested for their ability to infect rodent cells expressing 4 CAT-1 receptor variants. Three mutants (Mo-gs1, Mo-gs2, and Fr-gs1) infect NIH 3T3 and rat XC cells, but are severely restricted in Mus dunni cells and Lec8, a Chinese hamster cell line susceptible to ecotropic virus. This restriction is reproduced in ferret cells expressing M. dunni dCAT-1, but not in cells expressing NIHmore » 3T3 mCAT-1. Virus binding assays, pseudotype assays, and the use of glycosylation inhibitors further suggest that restriction is primarily due to receptor polymorphism and, in M. dunni cells, to glycosylation of cellular proteins. Virus envelope glycan size or type does not affect infectivity. Thus, host range variation due to N-glycan deletion is receptor variant-specific, cell-specific, virus type-specific, and glycan site-specific.« less

  1. Regulation of the mouse Treacher Collins syndrome homolog (Tcof1) promoter through differential repression of constitutive expression.

    PubMed

    Shows, Kathryn H; Shiang, Rita

    2008-11-01

    Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell-specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell-specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from -253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter.

  2. Understanding Transcription Factor Regulation by Integrating Gene Expression and DNase I Hypersensitive Sites.

    PubMed

    Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong

    2015-01-01

    Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.

  3. Ligand recognition by RAR and RXR receptors: binding and selectivity.

    PubMed

    Sussman, Fredy; de Lera, Angel R

    2005-10-06

    Fundamental biological functions, most notably embriogenesis, cell growth, cell differentiation, and cell apoptosis, are in part regulated by a complex genomic network that starts with the binding (and activation) of retinoids to their cognate receptors, members of the superfamily of nuclear receptors. We have studied ligand recognition of retinoic receptors (RXRalpha and RARgamma) using a molecular-mechanics-based docking method. The protocol used in this work is able to rank the affinity of pairs of ligands for a single retinoid receptor, the highest values corresponding to those that adapt better to the shape of the binding site and generate the optimal set of electrostatic and apolar interactions with the receptor. Moreover, our studies shed light onto some of the energetic contributions to retinoid receptor ligand selectivity. In this regard we show that there is a difference in polarity between the binding site regions that anchor the carboxylate in RAR and RXR, which translates itself into large differences in the energy of interaction of both receptors with the same ligand. We observe that the latter energy change is canceled off by the solvation energy penalty upon binding. This energy compensation is borne out as well by experiments that address the effect of site-directed mutagenesis on ligand binding to RARgamma. The hypothesis that the difference in binding site polarity might be exploited to build RXR-selective ligands is tested with some compounds having a thiazolidinedione anchoring group.

  4. B cell recognition of the conserved HIV-1 co-receptor binding site is altered by endogenous primate CD4.

    PubMed

    Forsell, Mattias N E; Dey, Barna; Mörner, Andreas; Svehla, Krisha; O'dell, Sijy; Högerkorp, Carl-Magnus; Voss, Gerald; Thorstensson, Rigmor; Shaw, George M; Mascola, John R; Karlsson Hedestam, Gunilla B; Wyatt, Richard T

    2008-10-03

    The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3). Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4) rabbits with envelope glycoprotein (Env) trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT) rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity) primate CD4 formed in vivo are responsible for the elicitation of the co-receptor-site-directed antibodies. They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.

  5. Structural Basis of the Interaction of a Trypanosoma cruzi Surface Molecule Implicated in Oral Infection with Host Cells and Gastric Mucin

    PubMed Central

    Cortez, Cristian; Yoshida, Nobuko; Bahia, Diana; Sobreira, Tiago J.P.

    2012-01-01

    Host cell invasion and dissemination within the host are hallmarks of virulence for many pathogenic microorganisms. As concerns Trypanosoma cruzi, which causes Chagas disease, the insect vector-derived metacyclic trypomastigotes (MT) initiate infection by invading host cells, and later blood trypomastigotes disseminate to diverse organs and tissues. Studies with MT generated in vitro and tissue culture-derived trypomastigotes (TCT), as counterparts of insect-borne and bloodstream parasites, have implicated members of the gp85/trans-sialidase superfamily, MT gp82 and TCT Tc85-11, in cell invasion and interaction with host factors. Here we analyzed the gp82 structure/function characteristics and compared them with those previously reported for Tc85-11. One of the gp82 sequences identified as a cell binding site consisted of an α-helix, which connects the N-terminal β-propeller domain to the C-terminal β-sandwich domain where the second binding site is nested. In the gp82 structure model, both sites were exposed at the surface. Unlike gp82, the Tc85-11 cell adhesion sites are located in the N-terminal β-propeller region. The gp82 sequence corresponding to the epitope for a monoclonal antibody that inhibits MT entry into target cells was exposed on the surface, upstream and contiguous to the α-helix. Located downstream and close to the α-helix was the gp82 gastric mucin binding site, which plays a central role in oral T. cruzi infection. The sequences equivalent to Tc85-11 laminin-binding sites, which have been associated with the parasite ability to overcome extracellular matrices and basal laminae, was poorly conserved in gp82, compatible with its reduced capacity to bind laminin. Our study indicates that gp82 is structurally suited for MT to initiate infection by the oral route, whereas Tc85-11, with its affinity for laminin, would facilitate the parasite dissemination through diverse organs and tissues. PMID:22860068

  6. Targeting human breast cancer cells by an oncolytic adenovirus using microRNA-targeting strategy.

    PubMed

    Shayestehpour, Mohammad; Moghim, Sharareh; Salimi, Vahid; Jalilvand, Somayeh; Yavarian, Jila; Romani, Bizhan; Mokhtari-Azad, Talat

    2017-08-15

    MicroRNA-targeting strategy is a promising approach that enables oncolytic viruses to replicate in tumor cells but not in normal cells. In this study, we targeted adenoviral replication toward breast cancer cells by inserting ten complementary binding sites for miR-145-5p downstream of E1A gene. In addition, we evaluated the effect of increasing miR-145 binding sites on inhibition of virus replication. Ad5-control and adenoviruses carrying five or ten copies of miR145-5p target sites (Ad5-5miR145T, Ad5-10miR145T) were generated and inoculated into MDA-MB-453, BT-20, MCF-7 breast cancer cell lines and human mammary epithelial cells (HMEpC). Titer of Ad5-10miR145T in HMEpC was significantly lower than Ad5-control titer. Difference between the titer of these two viruses at 12, 24, 36, and 48h after infection was 1.25, 2.96, 3.06, and 3.77 log TCID 50 . No significant difference was observed between the titer of both adenoviruses in MDA-MB-453, BT-20 and MCF-7 cells. The infectious titer of adenovirus containing 10 miR-145 binding sites in HMEpC cells at 24, 36, and 48h post-infection was 1.7, 2.08, and 4-fold, respectively, lower than the titer of adenovirus carrying 5 miR-145 targets. Our results suggest that miR-145-targeting strategy provides selectivity for adenovirus replication in breast cancer cells. Increasing the number of miRNA binding sites within the adenoviral genome confers more selectivity for viral replication in cancer cells. Copyright © 2017. Published by Elsevier B.V.

  7. SusG: A Unique Cell-Membrane-Associated [alpha]-Amylase from a Prominent Human Gut Symbiont Targets Complex Starch Molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koropatkin, Nicole M.; Smith, Thomas J.

    SusG is an {alpha}-amylase and part of a large protein complex on the outer surface of the bacterial cell and plays a major role in carbohydrate acquisition by the animal gut microbiota. Presented here, the atomic structure of SusG has an unusual extended, bilobed structure composed of amylase at one end and an unprecedented internal carbohydrate-binding motif at the other. Structural studies further demonstrate that the carbohydrate-binding motif binds maltooligosaccharide distal to, and on the opposite side of, the amylase catalytic site. SusG has an additional starch-binding site on the amylase domain immediately adjacent to the active cleft. Mutagenesis analysismore » demonstrates that these two additional starch-binding sites appear to play a role in catabolism of insoluble starch. However, elimination of these sites has only a limited effect, suggesting that they may have a more important role in product exchange with other Sus components.« less

  8. NF-κB is required for dengue virus NS5-induced RANTES expression.

    PubMed

    Khunchai, Sasiprapa; Junking, Mutita; Suttitheptumrong, Aroonroong; Kooptiwut, Suwattanee; Haegeman, Guy; Limjindaporn, Thawornchai; Yenchitsomanus, Pa-Thai

    2015-02-02

    Dengue virus (DENV) infection associates with renal disorders. Patients with dengue hemorrhagic fever and acute kidney injury have a high mortality rate. Increased levels of cytokines may contribute to the pathogenesis of DENV-induced kidney injury. Currently, molecular mechanisms how DENV induces kidney cell injury has not been thoroughly investigated. Excessive cytokine production may be involved in this process. Using human cytokine RT(2) Profiler PCR array, 14 genes including IP-10, RANTES, IL-8, CXCL-9 and MIP-1β were up-regulated more than 2 folds in DENV-infected HEK 293 cells compared to that of mock-infected HEK 293 cells. In the present study, RANTES was suppressed by the NF-κB inhibitor, compound A (CpdA), in DENV-infected HEK 293 cells implying the role of NF-κB in RANTES expression. Chromatin immunoprecipitation (ChIP) assay showed that NF-κB binds more efficiently to its binding sites on the RANTES promoter in NS5-transfected HEK 293 cells than in HEK 293 cells expressing the vector lacking NS5 gene. To further examine whether the NS5-activated RANTES promoter is mediated through NF-κB, the two NF-κB binding sites on the RANTES promoter were mutated and this promoter was coupled to the luciferase cDNA. The result showed that when both binding sites of NF-κB in the RANTES promoter were mutated, the ability of NS5 to induce the luciferase activity was significantly decreased. Therefore, DENV NS5 activates RANTES production by increasing NF-κB binding to its binding sites on the RANTES promoter. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Step-By-Step In Vitro Mutagenesis: Lessons From Fucose-Binding Lectin PA-IIL.

    PubMed

    Mrázková, Jana; Malinovská, Lenka; Wimmerová, Michaela

    2017-01-01

    Site-directed mutagenesis is a powerful technique which is used to understand the basis of interactions between proteins and their binding partners, as well as to modify these interactions. Methods of rational design that are based on detailed knowledge of the structure of a protein of interest are often used for preliminary investigations of the possible outcomes which can result from the practical application of site-directed mutagenesis. Also, random mutagenesis can be used in tandem with site-directed mutagenesis for an examination of amino acid "hotspots."Lectins are sugar-binding proteins which, among other functions, mediate the recognition of host cells by a pathogen and its adhesion to the host cell surface. Hence, lectins and their binding properties are studied and engineered using site-directed mutagenesis.In this chapter, we describe a site-directed mutagenesis method used for investigating the sugar binding pattern of the PA-IIL lectin from the pathogenic bacterium Pseudomonas aeruginosa. Moreover, procedures for the production and purification of PA-IIL mutants are described, and several basic methods for characterizing the mutants are discussed.

  10. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  11. Cell specific, variable density, polymer microspheres

    NASA Technical Reports Server (NTRS)

    Yen, Shiao-Ping S. (Inventor); Rembaum, Alan (Inventor); Molday, Robert S. (Inventor)

    1978-01-01

    Biocompatible polymeric microspheres having an average diameter below about 3 microns and having a density at least 15% greater or lesser than organic cells and having covalent binding sites are provided in accordance with this invention. The microspheres are obtained by copolymerizing a hydroxy or amine substituted acrylic monomer such as hydroxyethylmethacrylate with a light or dense comonomer such as a fluoromonomer. A lectin or antibody is bound to the hydroxy or amine site of the bead to provide cell specificity. When added to a cell suspension the marked bead will specifically label the cell membrane by binding to specific receptor sites thereon. The labelled membrane can then be separated by density gradient centrifugation.

  12. Modulation of gene expression via overlapping binding sites exerted by ZNF143, Notch1 and THAP11

    PubMed Central

    Ngondo-Mbongo, Richard Patryk; Myslinski, Evelyne; Aster, Jon C.; Carbon, Philippe

    2013-01-01

    ZNF143 is a zinc-finger protein involved in the transcriptional regulation of both coding and non-coding genes from polymerase II and III promoters. Our study deciphers the genome-wide regulatory role of ZNF143 in relation with the two previously unrelated transcription factors Notch1/ICN1 and thanatos-associated protein 11 (THAP11) in several human and murine cells. We show that two distinct motifs, SBS1 and SBS2, are associated to ZNF143-binding events in promoters of >3000 genes. Without co-occupation, these sites are also bound by Notch1/ICN1 in T-lymphoblastic leukaemia cells as well as by THAP11, a factor involved in self-renewal of embryonic stem cells. We present evidence that ICN1 binding overlaps with ZNF143 binding events at the SBS1 and SBS2 motifs, whereas the overlap occurs only at SBS2 for THAP11. We demonstrate that the three factors modulate expression of common target genes through the mutually exclusive occupation of overlapping binding sites. The model we propose predicts that the binding competition between the three factors controls biological processes such as rapid cell growth of both neoplastic and stem cells. Overall, our study establishes a novel relationship between ZNF143, THAP11 and ICN1 and reveals important insights into ZNF143-mediated gene regulation. PMID:23408857

  13. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  14. Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity

    PubMed Central

    Mazzoni, Esteban O; Mahony, Shaun; Closser, Michael; Morrison, Carolyn A; Nedelec, Stephane; Williams, Damian J; An, Disi; Gifford, David K; Wichterle, Hynek

    2013-01-01

    Efficient transcriptional programming promises to open new frontiers in regenerative medicine. However, mechanisms by which programming factors transform cell fate are unknown, preventing more rational selection of factors to generate desirable cell types. Three transcription factors, Ngn2, Isl1 and Lhx3, were sufficient to program rapidly and efficiently spinal motor neuron identity when expressed in differentiating mouse embryonic stem cells. Replacement of Lhx3 by Phox2a led to specification of cranial, rather than spinal, motor neurons. Chromatin immunoprecipitation–sequencing analysis of Isl1, Lhx3 and Phox2a binding sites revealed that the two cell fates were programmed by the recruitment of Isl1-Lhx3 and Isl1-Phox2a complexes to distinct genomic locations characterized by a unique grammar of homeodomain binding motifs. Our findings suggest that synergistic interactions among transcription factors determine the specificity of their recruitment to cell type–specific binding sites and illustrate how a single transcription factor can be repurposed to program different cell types. PMID:23872598

  15. Microtubule-stabilizing properties of the avocado-derived toxins (+)-(R)-persin and (+)-(R)-tetrahydropersin in cancer cells and activity of related synthetic analogs.

    PubMed

    Field, Jessica J; Kanakkanthara, Arun; Brooke, Darby G; Sinha, Saptarshi; Pillai, Sushila D; Denny, William A; Butt, Alison J; Miller, John H

    2016-06-01

    The avocado toxin (+)-R-persin (persin) is active at low micromolar concentrations against breast cancer cells and synergizes with the estrogen receptor modulator 4-hydroxytamoxifen. Previous studies in the estrogen receptor-positive breast cancer cell line MCF-7 indicate that persin acts as a microtubule-stabilizing agent. In the present study, we further characterize the properties of persin and several new synthetic analogues in human ovarian cancer cells. Persin and tetrahydropersin cause G2M cell cycle arrest and increase intracellular microtubule polymerization. One analog (4-nitrophenyl)-deshydroxypersin prevents cell proliferation and blocks cells in G1 of the cell cycle rather than G2M, suggesting an additional mode of action of these compounds independent of microtubules. Persin can synergize with other microtubule-stabilizing agents, and is active against cancer cells that overexpress the P-glycoprotein drug efflux pump. Evidence from Flutax-1 competition experiments suggests that while the persin binding site on β-tubulin overlaps the classical taxoid site where paclitaxel and epothilone bind, persin retains activity in cell lines with single amino acid mutations that affect these other taxoid site ligands. This implies the existence of a unique binding location for persin at the taxoid site.

  16. The allosteric citalopram binding site differentially interferes with neuronal firing rate and SERT trafficking in serotonergic neurons.

    PubMed

    Matthäus, Friederike; Haddjeri, Nasser; Sánchez, Connie; Martí, Yasmina; Bahri, Senda; Rovera, Renaud; Schloss, Patrick; Lau, Thorsten

    2016-11-01

    Citalopram is a clinically applied selective serotonin re-uptake inhibitor for antidepressant pharmacotherapy. It consists of two enantiomers, S-citalopram (escitalopram) and R-citalopram, of which escitalopram exerts the antidepressant therapeutic effect and has been shown to be one of the most efficient antidepressants, while R-citalopram antagonizes escitalopram via an unknown molecular mechanism that may depend on binding to a low-affinity allosteric binding site of the serotonin transporter. However, the precise mechanism of antidepressant regulation of the serotonin transporter by citalopram enantiomers still remains elusive. Here we investigate escitalopram׳s acute effect on (1) serotonergic neuronal firing in transgenic mice that express the human serotonin transporter without and with a mutation that disables the allosteric binding site, and (2) regulation of the serotonin transporter׳s cell surface localization in stem cell-derived serotonergic neurons. Our results demonstrate that escitalopram inhibited neuronal firing less potently in the mouse line featuring a mutation that abolishes the function of the allosteric binding site and induced serotonin transporter internalization independently of the allosteric binding site mechanism. Furthermore, citalopram enantiomers dose-dependently induced serotonin transporter internalization. In conclusion, this study provides new insight into antidepressant effects exerted by citalopram enantiomers in presence and absence of a functional allosteric binding site. Copyright © 2016 Elsevier B.V. and ECNP. All rights reserved.

  17. Methylation of an alpha-foetoprotein gene intragenic site modulates gene activity.

    PubMed Central

    Opdecamp, K; Rivière, M; Molné, M; Szpirer, J; Szpirer, C

    1992-01-01

    By comparing the methylation pattern of Mspl/Hpall sites in the 5' region of the mouse alpha-foetoprotein (AFP) gene of different cells (hepatoma cells, foetal and adult liver, fibroblasts), we found a correlation between gene expression and unmethylation of a site located in the first intron of the gene. Other sites did not show this correlation. In transfection experiments of unmethylated and methylated AFP-CAT chimeric constructions, we then showed that methylation of the intronic site negatively modulates expression of CAT activity. We also found that a DNA segment centered on this site binds nuclear proteins; however methylation did not affect protein binding. Images PMID:1371343

  18. Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism.

    PubMed

    Schuijers, Jurian; Manteiga, John Colonnese; Weintraub, Abraham Selby; Day, Daniel Sindt; Zamudio, Alicia Viridiana; Hnisz, Denes; Lee, Tong Ihn; Young, Richard Allen

    2018-04-10

    Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Quantitative autoradiography of muscarinic and benzodiazepine receptors in the forebrain of the turtle, Pseudemys scripta

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schlegel, J.R.; Kriegstein, A.R.

    1987-11-22

    The distribution of muscarinic and benzodiazepine receptors was investigated in the turtle forebrain by the technique of in vitro receptor autoradiography. Muscarinic binding sites were labeled with 1 nM /sup 3/H-quinuclidinyl benzilate (/sup 3/H-QNB), and benzodiazepine sites were demonstrated with the aid of 1 nM /sup 3/H-flunitrazepam (/sup 3/H-FLU). Autoradiograms generated on /sup 3/H-Ultrofilm apposed to tissue slices revealed regionally specific distributions of muscarinic and benzodiazepine binding sites that are comparable with those for mammalian brain. Dense benzodiazepine binding was found in the anterior olfactory nucleus, the lateral and dorsal cortices, and the dorsal ventricular ridge (DVR), a structure withmore » no clear mammalian homologue. Muscarinic binding sites were most dense in the striatum, accumbens, DVR, lateral geniculate, and the anterior olfactory nucleus. Cortical binding sites were studied in greater detail by quantitative analysis of autoradiograms generated by using emulsion-coated coverslips. Laminar gradients of binding were observed that were specific for each radioligand; /sup 3/H-QNB sites were most dense in the inner molecular layer in all cortical regions, whereas /sup 3/H-FLU binding was generally most concentrated in the outer molecular layer and was least dense through all layers in the dorsomedial cortex. Because pyramidal cells are arranged in register in turtle cortex, the laminar patterns of receptor binding may reflect different receptor density gradients along pyramidal cell dendrites.« less

  20. Overexpression of Transcription Factor Sp1 Leads to Gene Expression Perturbations and Cell Cycle Inhibition

    PubMed Central

    Deniaud, Emmanuelle; Baguet, Joël; Chalard, Roxane; Blanquier, Bariza; Brinza, Lilia; Meunier, Julien; Michallet, Marie-Cécile; Laugraud, Aurélie; Ah-Soon, Claudette; Wierinckx, Anne; Castellazzi, Marc; Lachuer, Joël; Gautier, Christian

    2009-01-01

    Background The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. Methodology and Principal Findings We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. Conclusion This study shows that the binding to DNA of overexpressed Sp1 induces an inhibition of cell cycle progression that precedes apoptosis and a transcriptional response targeting genes containing Sp1 binding sites in their promoter or not suggesting both direct Sp1-driven transcription and indirect mechanisms. PMID:19753117

  1. Substance P receptor binding sites are expressed by glia in vivo after neuronal injury

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mantyh, P.W.; Johnson, D.J.; Boehmer, C.G.

    1989-07-01

    In vitro studies have demonstrated that glia can express functional receptors for a variety of neurotransmitters. To determine whether similar neurotransmitter receptors are also expressed by glia in vivo, the authors examined the glial scar in the transected optic nerve of the albino rabbit by quantitative receptor autoradiography. Receptor binding sites for radiolabeled calcitonin gene-related peptide, cholecystokinin, galanin, glutamate, somatostatin, substance P, and vasoactive intestinal peptide were examined. Specific receptor binding sites for each of these neurotransmitters were identified in the rabbit forebrain but were not detected in the normal optic nerve or tract. In the transected optic nerve andmore » tract, only receptor binding sites for substance P were expressed at detectable levels. The density of substance P receptor binding sites observed in this glial scar is among the highest observed in the rabbit forebrain. Ligand displacement and saturation experiments indicate that the substance P receptor binding site expressed by the glial scar has pharmacological characteristics similar to those of substance P receptors in the rabbit striatum, rat brain, and rat and canine gut. The present study demonstrates that glial cells in vivo express high concentrations of substance P receptor binding sites after transection of retinal ganglion cell axons. Because substance P has been shown to regulate inflammatory and immune responses in peripheral tissues, substance P may also, by analogy, be involved in regulating the glial response to injury in the central nervous system.« less

  2. Evolution of New cis-Regulatory Motifs Required for Cell-Specific Gene Expression in Caenorhabditis

    PubMed Central

    Félix, Marie-Anne

    2016-01-01

    Patterning of C. elegans vulval cell fates relies on inductive signaling. In this induction event, a single cell, the gonadal anchor cell, secretes LIN-3/EGF and induces three out of six competent precursor cells to acquire a vulval fate. We previously showed that this developmental system is robust to a four-fold variation in lin-3/EGF genetic dose. Here using single-molecule FISH, we find that the mean level of expression of lin-3 in the anchor cell is remarkably conserved. No change in lin-3 expression level could be detected among C. elegans wild isolates and only a low level of change—less than 30%—in the Caenorhabditis genus and in Oscheius tipulae. In C. elegans, lin-3 expression in the anchor cell is known to require three transcription factor binding sites, specifically two E-boxes and a nuclear-hormone-receptor (NHR) binding site. Mutation of any of these three elements in C. elegans results in a dramatic decrease in lin-3 expression. Yet only a single E-box is found in the Drosophilae supergroup of Caenorhabditis species, including C. angaria, while the NHR-binding site likely only evolved at the base of the Elegans group. We find that a transgene from C. angaria bearing a single E-box is sufficient for normal expression in C. elegans. Even a short 58 bp cis-regulatory fragment from C. angaria with this single E-box is able to replace the three transcription factor binding sites at the endogenous C. elegans lin-3 locus, resulting in the wild-type expression level. Thus, regulatory evolution occurring in cis within a 58 bp lin-3 fragment, results in a strict requirement for the NHR binding site and a second E-box in C. elegans. This single-cell, single-molecule, quantitative and functional evo-devo study demonstrates that conserved expression levels can hide extensive change in cis-regulatory site requirements and highlights the evolution of new cis-regulatory elements required for cell-specific gene expression. PMID:27588814

  3. Differential Transcription Factor Use by the KIR2DL4 Promoter Under Constitutive and IL-2/15-Treated Conditions

    PubMed Central

    Presnell, Steven R.; Zhang, Lei; Chlebowy, Corrin N.; Al-Attar, Ahmad; Lutz, Charles T.

    2012-01-01

    KIR2DL4 is unique among human KIR genes in expression, cellular localization, structure, and function, yet the transcription factors required for its expression have not been identified. Using mutagenesis, electrophoretic mobility shift assay, and co-transfection assays, we identified two redundant Runx binding sites in the 2DL4 promoter as essential for constitutive 2DL4 transcription, with contributions by a CRE site and initiator elements. IL-2-and IL-15-stimulated human NK cell lines increased 2DL4 promoter activity, which required functional Runx, CRE, and Ets sites. Chromatin immunoprecipitation experiments show that Runx3 and Ets1 bind the 2DL4 promoter in situ. 2DL4 promoter activity had similar transcription factor requirements in T cells. Runx, CRE, and Ets binding motifs are present in 2DL4 promoters from across primate species, but other postulated transcription factor binding sites are not preserved. Differences between 2DL4 and clonally-restricted KIR promoters suggest a model that explains the unique 2DL4 expression pattern in human NK cells. PMID:22467658

  4. HRP2 determines the efficiency and specificity of HIV-1 integration in LEDGF/p75 knockout cells but does not contribute to the antiviral activity of a potent LEDGF/p75-binding site integrase inhibitor.

    PubMed

    Wang, Hao; Jurado, Kellie A; Wu, Xiaolin; Shun, Ming-Chieh; Li, Xiang; Ferris, Andrea L; Smith, Steven J; Patel, Pratiq A; Fuchs, James R; Cherepanov, Peter; Kvaratskhelia, Mamuka; Hughes, Stephen H; Engelman, Alan

    2012-12-01

    The binding of integrase (IN) to lens epithelium-derived growth factor (LEDGF)/p75 in large part determines the efficiency and specificity of HIV-1 integration. However, a significant residual preference for integration into active genes persists in Psip1 (the gene that encodes for LEDGF/p75) knockout (KO) cells. One other cellular protein, HRP2, harbors both the PWWP and IN-binding domains that are important for LEDGF/p75 co-factor function. To assess the role of HRP2 in HIV-1 integration, cells generated from Hdgfrp2 (the gene that encodes for HRP2) and Psip1/Hdgfrp2 KO mice were infected alongside matched control cells. HRP2 depleted cells supported normal infection, while disruption of Hdgfrp2 in Psip1 KO cells yielded additional defects in the efficiency and specificity of integration. These deficits were largely restored by ectopic expression of either LEDGF/p75 or HRP2. The double-KO cells nevertheless supported residual integration into genes, indicating that IN and/or other host factors contribute to integration specificity in the absence of LEDGF/p75 and HRP2. Psip1 KO significantly increased the potency of an allosteric inhibitor that binds the LEDGF/p75 binding site on IN, a result that was not significantly altered by Hdgfrp2 disruption. These findings help to rule out the host factor-IN interactions as the primary antiviral targets of LEDGF/p75-binding site IN inhibitors.

  5. Negatively Cooperative Binding of High Density Lipoprotein to the HDL Receptor SR-BI†

    PubMed Central

    Nieland, Thomas J.F.; Xu, Shangzhe; Penman, Marsha; Krieger, Monty

    2011-01-01

    Scavenger receptor class B, type I (SR-BI) is a high-density lipoprotein (HDL) receptor, which also binds low density lipoprotein (LDL), and mediates the cellular selective uptake of cholesteryl esters from lipoproteins. SR-BI also is a co-receptor for hepatitis C virus and a signaling receptor that regulates cell metabolism. Many investigators have reported that lipoproteins bind to SR-BI via a single class of independent (not interacting), high affinity binding sites (one site model). We have re-investigated the ligand concentration dependence of 125I-HDL binding to SR-BI and SR-BI-mediated specific uptake of [3H]CE from [3H]CE-HDL using an expanded range of ligand concentrations (<1 µg protein/ml, lower than previously reported). Scatchard and non-linear least squares model fitting analyses of the binding and uptake data were both inconsistent with a single class of independent binding sites binding univalent lipoprotein ligands. The data are best fit by models in which SR-BI has either two independent classes of binding sites, or one class of sites exhibiting negative cooperativity due to either classic allostery or ensemble effects (‘ lattice model’). Similar results were observed for LDL. Application of the ‘infinite dilution’ dissociation rate method established that the binding of 125I-HDL to SR-BI at 4 °C exhibits negative cooperativity. The unexpected complexity of the interactions of lipoproteins with SR-BI should be taken into account when interpreting the results of experiments that explore the mechanism(s) by which SR-BI mediates ligand binding, lipid transport and cell signaling. PMID:21254782

  6. Octasaccharide is the minimal length unit required for efficient binding of cyclophilin B to heparin and cell surface heparan sulphate.

    PubMed

    Vanpouille, Christophe; Denys, Agnès; Carpentier, Mathieu; Pakula, Rachel; Mazurier, Joël; Allain, Fabrice

    2004-09-01

    Cyclophilin B (CyPB) is a heparin-binding protein first identified as a receptor for cyclosporin A. In previous studies, we reported that CyPB triggers chemotaxis and integrin-mediated adhesion of T-lymphocytes by way of interaction with two types of binding sites. The first site corresponds to a signalling receptor; the second site has been identified as heparan sulphate (HS) and appears crucial to induce cell adhesion. Characterization of the HS-binding unit is critical to understand the requirement of HS in pro-adhesive activity of CyPB. By using a strategy based on gel mobility shift assays with fluorophore-labelled oligosaccharides, we demonstrated that the minimal heparin unit required for efficient binding of CyPB is an octasaccharide. The mutants CyPB(KKK-) [where KKK- refers to the substitutions K3A(Lys3-->Ala)/K4A/K5A] and CyPB(DeltaYFD) (where Tyr14-Phe-Asp16 has been deleted) failed to interact with octasaccharides, confirming that the Y14FD16 and K3KK5 clusters are required for CyPB binding. Molecular modelling revealed that both clusters are spatially arranged so that they may act synergistically to form a binding site for the octasaccharide. We then demonstrated that heparin-derived octasaccharides and higher degree of polymerization oligosaccharides inhibited the interaction between CyPB and fluorophore-labelled HS chains purified from T-lymphocytes, and strongly reduced the HS-dependent pro-adhesive activity of CyPB. However, oligosaccharides or heparin were unable to restore adhesion of heparinase-treated T-lymphocytes, indicating that HS has to be present on the cell membrane to support the pro-adhesive activity of CyPB. Altogether, these results demonstrate that the octasaccharide is likely to be the minimal length unit required for efficient binding of CyPB to cell surface HS and consequent HS-dependent cell responses.

  7. Octasaccharide is the minimal length unit required for efficient binding of cyclophilin B to heparin and cell surface heparan sulphate

    PubMed Central

    2004-01-01

    Cyclophilin B (CyPB) is a heparin-binding protein first identified as a receptor for cyclosporin A. In previous studies, we reported that CyPB triggers chemotaxis and integrin-mediated adhesion of T-lymphocytes by way of interaction with two types of binding sites. The first site corresponds to a signalling receptor; the second site has been identified as heparan sulphate (HS) and appears crucial to induce cell adhesion. Characterization of the HS-binding unit is critical to understand the requirement of HS in pro-adhesive activity of CyPB. By using a strategy based on gel mobility shift assays with fluorophore-labelled oligosaccharides, we demonstrated that the minimal heparin unit required for efficient binding of CyPB is an octasaccharide. The mutants CyPBKKK− [where KKK− refers to the substitutions K3A(Lys3→Ala)/K4A/K5A] and CyPBΔYFD (where Tyr14-Phe-Asp16 has been deleted) failed to interact with octasaccharides, confirming that the Y14FD16 and K3KK5 clusters are required for CyPB binding. Molecular modelling revealed that both clusters are spatially arranged so that they may act synergistically to form a binding site for the octasaccharide. We then demonstrated that heparin-derived octasaccharides and higher degree of polymerization oligosaccharides inhibited the interaction between CyPB and fluorophore-labelled HS chains purified from T-lymphocytes, and strongly reduced the HS-dependent pro-adhesive activity of CyPB. However, oligosaccharides or heparin were unable to restore adhesion of heparinase-treated T-lymphocytes, indicating that HS has to be present on the cell membrane to support the pro-adhesive activity of CyPB. Altogether, these results demonstrate that the octasaccharide is likely to be the minimal length unit required for efficient binding of CyPB to cell surface HS and consequent HS-dependent cell responses. PMID:15109301

  8. The leukemia associated ETO nuclear repressor gene is regulated by the GATA-1 transcription factor in erythroid/megakaryocytic cells

    PubMed Central

    2010-01-01

    Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545

  9. Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Souza, E.B.; Kuyatt, B.L.

    1987-01-01

    Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less

  10. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  11. Genome-wide identification and characterization of Notch transcription complex-binding sequence-paired sites in leukemia cells.

    PubMed

    Severson, Eric; Arnett, Kelly L; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S; Shirley Liu, X; Blacklow, Stephen C; Aster, Jon C

    2017-05-02

    Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and have been linked to the Notch responsiveness of a few genes. To assess the overall contribution of SPSs to Notch-dependent gene regulation, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay and applied insights from these in vitro studies to Notch-"addicted" T cell acute lymphoblastic leukemia (T-ALL) cells. We found that SPSs contributed to the regulation of about a third of direct Notch target genes. Although originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5 expression. Our work provides a general method for identifying SPSs in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. Copyright © 2017, American Association for the Advancement of Science.

  12. Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

    PubMed Central

    Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

    2016-01-01

    Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

  13. Probing site-exclusive binding of aqueous QDs and their organelle-dependent dynamics in live cells by single molecule spectroscopy.

    PubMed

    Dong, Chaoqing; Chowdhury, Basudev; Irudayaraj, Joseph

    2013-05-21

    Understanding the biophysical and chemical interactions of nanoprobes and their fate upon entering live cells is critical for developing fundamental insights related to intracellular diagnostics, drug delivery and targeting. In this article we report herein a single molecule analysis procedure to quantitate site-specific exclusive membrane binding of N-acetyl-L-cysteine (NAC)-capped cadmium telluride (CdTe) quantum dots (QDs) in A-427 lung carcinoma cells (k(eq) = 0.075 ± 0.011 nM(-1)), its relative intracellular distribution and dynamics using fluorescence correlation spectroscopy (FCS) combined with scanning confocal fluorescence lifetime imaging (FLIM). In particular, we demonstrate that the binding efficacy of QDs to the cell membrane is directly related to their size and the targeting of QDs to specific membrane sites is exclusive. We also show that QDs are efficiently internalized by endocytosis and enclosed within the endosome and organelle-dependent diffusion dynamics can be monitored in live cells.

  14. Probing the target search of DNA-binding proteins in mammalian cells using TetR as model searcher

    NASA Astrophysics Data System (ADS)

    Normanno, Davide; Boudarène, Lydia; Dugast-Darzacq, Claire; Chen, Jiji; Richter, Christian; Proux, Florence; Bénichou, Olivier; Voituriez, Raphaël; Darzacq, Xavier; Dahan, Maxime

    2015-07-01

    Many cellular functions rely on DNA-binding proteins finding and associating to specific sites in the genome. Yet the mechanisms underlying the target search remain poorly understood, especially in the case of the highly organized mammalian cell nucleus. Using as a model Tet repressors (TetRs) searching for a multi-array locus, we quantitatively analyse the search process in human cells with single-molecule tracking and single-cell protein-DNA association measurements. We find that TetRs explore the nucleus and reach their target by 3D diffusion interspersed with transient interactions with non-cognate sites, consistent with the facilitated diffusion model. Remarkably, nonspecific binding times are broadly distributed, underlining a lack of clear delimitation between specific and nonspecific interactions. However, the search kinetics is not determined by diffusive transport but by the low association rate to nonspecific sites. Altogether, our results provide a comprehensive view of the recruitment dynamics of proteins at specific loci in mammalian cells.

  15. ( sup 125 I)Bolton-Hunter neuropeptide-Y-binding sites on folliculo-stellate cells of the pars intermedia of Xenopus laevis: A combined autoradiographic and immunocytochemical study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Rijk, E.P.; Cruijsen, P.M.; Jenks, B.G.

    1991-02-01

    It has previously been established that neuropeptide-Y (NPY) is a potent inhibitor of alpha MSH release from the pars intermedia of the amphibian Xenopus laevis. The location of binding sites for NPY in the pars intermedia of the pituitary has now been studied with light microscopic autoradiography, using a dispersed cell labeling method with the specific NPY receptor ligand ({sup 125}I)Bolton-Hunter NPY. The majority of radioactive labeling was associated with folliculo-stellate cells; the percentage of labeling as well as the mean number of grains were approximately 5 times higher for folliculo-stellate cells than for melanotropes. An excess of nonlabeled NPYmore » drastically reduced radiolabeling of folliculo-stellate cells, but had no effect on the degree of labeling of melanotropes. These results show that folliculo-stellate cells of X. laevis possess specific binding sites for NPY and indicate that NPY exerts its inhibitory action on the release of alpha MSH in an indirect fashion, by acting on the folliculo-stellate cells.« less

  16. 3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

    PubMed Central

    Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

    2016-01-01

    Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

  17. [Effect of thyroid hormones on the histotopography of lectin receptors in the rat salivary gland].

    PubMed

    Lutsik, A D; Iashchenko, A M; Detiuk, E S

    1987-04-01

    Using lectin-peroxidase technique, the influence of hypo- and hyperthyroidism on histotopography of glycoconjugates has been investigated in rat submandibular gland. The following lectins were used: peanut agglutinin (PNA), wheat germ agglutinin (WGA), Laburnum anagyroides lectin (LAL) and concanavalin A (con A). It has been demonstrated that hyperthyroidism is accompanied by the loss of con A, WGA and LAL receptor sites. Hypothyrodism enhanced con A binding to granular duct cells with a parallel reduction in WGA and LAL binding to these or other duct cells. Hypothyroidism as well as hyperthyroidism markedly enhanced PNA binding to duct epitheliocytes with redistribution of these lectin binding sites from the luminal surface of salivary ducts into the cytoplasm of duct cells. Possible interpretations of the observed phenomena are discussed.

  18. c-Myb Binds to a Sequence in the Proximal Region of the RAG-2 Promoter and Is Essential for Promoter Activity in T-Lineage Cells

    PubMed Central

    Wang, Qian-Fei; Lauring, Josh; Schlissel, Mark S.

    2000-01-01

    The RAG-2 gene encodes a component of the V(D)J recombinase which is essential for the assembly of antigen receptor genes in B and T lymphocytes. Previously, we reported that the transcription factor BSAP (PAX-5) regulates the murine RAG-2 promoter in B-cell lines. A partially overlapping but distinct region of the proximal RAG-2 promoter was also identified as an important element for promoter activity in T cells; however, the responsible factor was unknown. In this report, we present data demonstrating that c-Myb binds to a Myb consensus site within the proximal promoter and is critical for its activity in T-lineage cells. We show that c-Myb can transactivate a RAG-2 promoter-reporter construct in cotransfection assays and that this transactivation depends on the proximal promoter Myb consensus site. By using a chromatin immunoprecipitation (ChIP) strategy, fractionation of chromatin with anti-c-Myb antibody specifically enriched endogenous RAG-2 promoter DNA sequences. DNase I genomic footprinting revealed that the c-Myb site is occupied in a tissue-specific fashion in vivo. Furthermore, an integrated RAG-2 promoter construct with mutations at the c-Myb site was not enriched in the ChIP assay, while a wild-type integrated promoter construct was enriched. Finally, this lack of binding of c-Myb to a chromosomally integrated mutant RAG-2 promoter construct in vivo was associated with a striking decrease in promoter activity. We conclude that c-Myb regulates the RAG-2 promoter in T cells by binding to this consensus c-Myb binding site. PMID:11094072

  19. Internalisation of the bleomycin molecules responsible for bleomycin toxicity: a receptor-mediated endocytosis mechanism.

    PubMed

    Pron, G; Mahrour, N; Orlowski, S; Tounekti, O; Poddevin, B; Belehradek, J; Mir, L M

    1999-01-01

    Bleomycin (BLM) does not diffuse through the plasma membrane but nevertheless displays cytotoxic activity due to DNA break generation. The aim of the study was to describe the mechanism of BLM internalisation. We previously provided evidence for the existence of BLM-binding sites at the surface of DC-3F Chinese hamster fibroblasts, as well as of their involvement in BLM cytotoxicity on DC-3F cells and related BLM-resistant sublines. Here we report that A253 human cells and their BLM-resistant subline C-10E also possessed a membrane protein of ca. 250 kDa specifically binding BLM. Part of this C-10E cell resistance could be explained by a decrease in the number of BLM-binding sites exposed at the cell surface with respect to A253 cells. The comparison between A253 and DC-3F cells exposing a similar number of BLM-binding sites revealed that the faster the fluid phase endocytosis, the greater the cell sensitivity to BLM. Moreover, the experimental modification of endocytotic vesicle size showed that BLM cytotoxicity was directly correlated with the flux of plasma membrane area engulfed during endocytosis rather than with the fluid phase volume incorporated. Thus, BLM would be internalised by a receptor-mediated endocytosis mechanism which would first require BLM binding to its membrane receptor and then the transfer of the complex into intracellular endocytotic vesicles, followed by BLM entry into the cytosol, probably from a nonacidic compartment.

  20. Structural determinants of ubiquitin-CXC chemokine receptor 4 interaction.

    PubMed

    Saini, Vikas; Marchese, Adriano; Tang, Wei-Jen; Majetschak, Matthias

    2011-12-23

    Ubiquitin, a post-translational protein modifier inside the cell, functions as a CXC chemokine receptor (CXCR) 4 agonist outside the cell. However, the structural determinants of the interaction between extracellular ubiquitin and CXCR4 remain unknown. Utilizing C-terminal truncated ubiquitin and ubiquitin mutants, in which surface residues that are known to interact with ubiquitin binding domains in interacting proteins are mutated (Phe-4, Leu-8, Ile-44, Asp-58, Val-70), we provide evidence that the ubiquitin-CXCR4 interaction follows a two-site binding mechanism in which the hydrophobic surfaces surrounding Phe-4 and Val-70 are important for receptor binding, whereas the flexible C terminus facilitates receptor activation. Based on these findings and the available crystal structures, we then modeled the ubiquitin-CXCR4 interface with the RosettaDock software followed by small manual adjustments, which were guided by charge complementarity and anticipation of a conformational switch of CXCR4 upon activation. This model suggests three residues of CXCR4 (Phe-29, Phe-189, Lys-271) as potential interaction sites. Binding studies with HEK293 cells overexpressing wild type and CXCR4 after site-directed mutagenesis confirm that these residues are important for ubiquitin binding but that they do not contribute to the binding of stromal cell-derived factor 1α. Our findings suggest that the structural determinants of the CXCR4 agonist activity of ubiquitin mimic the typical structure-function relationship of chemokines. Furthermore, we provide evidence for separate and specific ligand binding sites on CXCR4. As exogenous ubiquitin has been shown to possess therapeutic potential, our findings are expected to facilitate the structure-based design of new compounds with ubiquitin-mimetic actions on CXCR4.

  1. Lectin histochemistry of metastatic adenocarcinomas of the lung.

    PubMed

    Thöm, Ina; Schult-Kronefeld, Olaf; Burkholder, Iris; Goern, Michael; Andritzky, Birte; Blonski, Katharina; Kugler, Christian; Edler, Lutz; Bokemeyer, Carsten; Schumacher, Udo; Laack, Eckart

    2007-06-01

    Several clinical studies indicate that primary tumour cells with high metastatic potential often show aberrant glycosylation as detected by lectin histochemistry. However, it is unclear whether aberrant glycosylation is still present in metastatic deposits. The aim of the present investigation was thus to analyse a possible association between the presence of lectin binding sites of pulmonary adenocarcinoma cells and their lymph node and haematogenous metastatic cells. For this purpose, the expression of HPA, PHA-L and UEA-I was assessed in primary tumours, lymph node metastases and haematogenous metastases of 96 patients with metastatic adenocarcinomas of the lung that underwent surgery between 1999 and 2002. Besides, lectin-binding data and other known prognostic factors were correlated with survival. We found a significant positive correlation between the binding of the lectins HPA (p=0.002), PHA-L (p<0.00001) and UEA-I (p<0.00001) to the cells of the primary tumour and to their lymph node metastases. There was a positive correlation between the binding of HPA to the cells of the primary tumour and the haematogenous metastases as well. Patients with tumours which did not show HPA binding sites had a median overall survival of 27.9 months (95%-CI 7.7-infinity months). Patients with a HPA binding tumour had a median overall survival of 20.9 months (95%-CI 18.5-28.7 months). This is the first investigation to demonstrate a positive correlation between the binding of the lectins HPA, PHA-L and UEA-I to the cells of the primary tumour and to their lymph node metastases. Expression of HPA binding sites is also preserved in the haematogenous metastases. In summary, our results support the hypothesis that altered glycosylation of the membrane-bound glycoproteins of the tumour cells is associated with, but not sufficient for promotion of lymphogenic and haematogenous metastasis.

  2. Gonadotropin stimulation of cyclic adenosine monophosphate and testosterone production without detectable high-affinity binding sites in purified Leydig cells from rat testis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Browne, E.S.; Bhalla, V.K.

    1991-02-01

    Rat testicular interstitial cells were separated by three different gradient-density procedures and, with each, two biochemically and morphologically distinct cell fractions were isolated. The lighter density cells in fraction-I bound iodine 125-labeled human chorionic gonadotropin (hCG) with high-affinity (apparent equilibrium dissociation constant, Kd, approximately 10{sup {minus} 10} M) without producing either cyclic adenosine monophosphate or testosterone in response to hormone action. The heavier-density cells displayed morphologic features typical of Leydig cells and produced cyclic adenosine monophosphate and testosterone in the presence of hCG without detectable {sup 125}I-labeled hCG high-affinity binding. These cell fractions were further characterized by studies using deglycosylatedmore » hCG, a known antagonist to hCG action. Cell concentration-dependent studies with purified Leydig cells revealed that maximal testosterone production was achieved when lower cell concentrations (0.5 x 10(6) cells/250 microliters) were used for in vitro hCG stimulation assays. Under these conditions, the {sup 125}I-labeled hCG binding was barely detectable (2.24 fmol; 2,698 sites/cell). Furthermore, these studies revealed that the hCG-specific binding in Leydig cells is overestimated by the classic method for nonspecific binding correction using excess unlabeled hormone. An alternate method is presented.« less

  3. Localization of basic fibroblast growth factor binding sites in the chick embryonic neural retina.

    PubMed

    Cirillo, A; Arruti, C; Courtois, Y; Jeanny, J C

    1990-12-01

    We have investigated the localization of basic fibroblast growth factor (bFGF) binding sites during the development of the neural retina in the chick embryo. The specificity of the affinity of bFGF for its receptors was assessed by competition experiments with unlabelled growth factor or with heparin, as well as by heparitinase treatment of the samples. Two different types of binding sites were observed in the neural retina by light-microscopic autoradiography. The first type, localized mainly to basement membranes, was highly sensitive to heparitinase digestion and to competition with heparin. It was not developmentally regulated. The second type of binding site, resistant to heparin competition, appeared to be associated with retinal cells from the earliest stages studied (3-day-old embryo, stages 21-22 of Hamburger and Hamilton). Its distribution was found to vary during embryonic development, paralleling layering of the neural retina. Binding of bFGF to the latter sites was observed throughout the retinal neuroepithelium at early stages but displayed a distinct pattern at the time when the inner and outer plexiform layers were formed. During the development of the inner plexiform layer, a banded pattern of bFGF binding was observed. These bands, lying parallel to the vitreal surface, seemed to codistribute with the synaptic bands existing in the inner plexiform layer. The presence of intra-retinal bFGF binding sites whose distribution varies with embryonic development suggests a regulatory mechanism involving differential actions of bFGF on neural retinal cells.

  4. Quantifying the Effect of DNA Packaging on Gene Expression Level

    NASA Astrophysics Data System (ADS)

    Kim, Harold

    2010-10-01

    Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

  5. Modulation of ouabain binding and potassium pump fluxes by cellular sodium and potassium in human and sheep erythrocytes.

    PubMed Central

    Joiner, C H; Lauf, P K

    1978-01-01

    1. Erythrocytes were treated with nystatin to alter internal Na (Nai) and K (Ki) composition. Although the rates of K pumping and [3H]ouabain binding were altered dramatically, the relationship between glycoside binding and K pump inhibition was unaffected. 2. Human cells with high Nai and low Ki exhibited an increased rate of ouabain binding as compared to high Ki, low Nai cells; this paralleled the stimulated K pump activity of high Nai cells. 3. At constant Ki, increasing internal Na stimulated K pump and ouabain binding rates concomitantly. 4. At low Nai, increasing Ki inhibited both K pumping and ouabain binding. However, at high Nai, increasing Ki from 4 to 44 mM stimulated the rate of glycoside binding, parallel to its effect of increasing the rate of active K influx. 5. Anti-L, an isoantibody to low K (LK) sheep red cells, increased the rate of ouabain binding via its stimulation of K pump turnover. Since the latter effect is the result of affinity changes at the internal cation activation site(s) of the pump (Lauf, Rasmusen, Hoffman, Dunham, Cook, Parmelee & Tosteson, 1970), the antibody's effect on ouabain binding reflected the positive correlation between the rates of K pump turnover and glycoside binding. 6. These data provide the first evidence in intact cells for the occurrence of a Nai-induced conformational change in the Na/K pump during its normal operational cycle. PMID:722574

  6. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muccioli, G.; Guardabassi, A.; Pattono, P.

    1990-03-01

    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

  7. Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

    DOE PAGES

    Botcheva, Krassimira; McCorkle, Sean R.

    2014-11-21

    The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less

  8. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  9. Regeneration of Cation-Transport Capacity in HeLa Cell Membranes After Specific Blockade by Ouabain

    PubMed Central

    Vaughan, Gerald L.; Cook, John S.

    1972-01-01

    The cardiac glycoside, ouabain, inhibits alkali-cation transport in HeLa cells. It binds to 0.75 × 106 sites per cell, and the half-time for its dissociation is 16 hr. After partial blockade by ouabain, the cell generates new ouabain-binding sites, with total restoration of transport in 10% of a cell cycle(∼3 hr). This recovery requires protein synthesis and appears to be a response to altered cell-electrolyte content, since growth of cells in media with low K+ concentration enhances the titer of the transport enzyme in a fashion similar to the effect of ouabain. Totally blocked cells do not recover. PMID:4506784

  10. The Bcr Kinase Downregulates Ras Signaling by Phosphorylating AF-6 and Binding to Its PDZ Domain

    PubMed Central

    Radziwill, G.; Erdmann, R. A.; Margelisch, U.; Moelling, K.

    2003-01-01

    The protein kinase Bcr is a negative regulator of cell proliferation and oncogenic transformation. We identified Bcr as a ligand for the PDZ domain of the cell junction and Ras-interacting protein AF-6. The Bcr kinase phosphorylates AF-6, which subsequently allows efficient binding of Bcr to AF-6, showing that the Bcr kinase is a regulator of the PDZ domain-ligand interaction. Bcr and AF-6 colocalize in epithelial cells at the plasma membrane. In addition, Bcr, AF-6, and Ras form a trimeric complex. Bcr increases the affinity of AF-6 to Ras, and a mutant of AF-6 that lacks a specific phosphorylation site for Bcr shows a reduced binding to Ras. Wild-type Bcr, but not Bcr mutants defective in binding to AF-6, interferes with the Ras-dependent stimulation of the Raf/MEK/ERK pathway. Since AF-6 binds to Bcr via its PDZ domain and to Ras via its Ras-binding domain, we propose that AF-6 functions as a scaffold-like protein that links Bcr and Ras to cellular junctions. We suggest that this trimeric complex is involved in downregulation of Ras-mediated signaling at sites of cell-cell contact to maintain cells in a nonproliferating state. PMID:12808105

  11. Glucocorticoids suppress tumor necrosis factor-alpha expression by human monocytic THP-1 cells by suppressing transactivation through adjacent NF-kappa B and c-Jun-activating transcription factor-2 binding sites in the promoter.

    PubMed

    Steer, J H; Kroeger, K M; Abraham, L J; Joyce, D A

    2000-06-16

    Glucocorticoid drugs suppress tumor necrosis factor-alpha (TNF-alpha) synthesis by activated monocyte/macrophages, contributing to an anti-inflammatory action in vivo. In lipopolysaccharide (LPS)-activated human monocytic THP-1 cells, glucocorticoids acted primarily on the TNF-alpha promoter to suppress a burst of transcriptional activity that occurred between 90 min and 3 h after LPS exposure. LPS increased nuclear c-Jun/ATF-2, NF-kappaB(1)/Rel-A, and Rel-A/C-Rel transcription factor complexes, which bound specifically to oligonucleotide sequences from the -106 to -88 base pair (bp) region of the promoter. The glucocorticoid, dexamethasone, suppressed nuclear binding activity of these complexes prior to and during the critical phase of TNF-alpha transcription. Site-directed mutagenesis in TNF-alpha promoter-luciferase reporter constructs showed that the adjacent c-Jun/ATF-2 (-106 to -99 bp) and NF-kappaB (-97 to -88 bp) binding sites each contributed to the LPS-stimulated expression. Mutating both sites largely prevented dexamethasone from suppressing TNF-alpha promoter-luciferase reporters. LPS exposure also increased nuclear Egr-1 and PU.1 abundance. The Egr-1/Sp1 (-172 to -161 bp) binding sites and the PU.1-binding Ets site (-116 to -110 bp) each contributed to the LPS-stimulated expression but not to glucocorticoid response. Dexamethasone suppressed the abundance of the c-Fos/c-Jun complex in THP-1 cell nuclei, but there was no direct evidence for c-Fos/c-Jun transactivation through sites in the -172 to -52 bp region. Small contributions to glucocorticoid response were attributable to promoter sequences outside the -172 to -88 bp region and to sequences in the TNF-alpha 3'-untranslated region. We conclude that glucocorticoids suppress LPS-stimulated secretion of TNF-alpha from human monocytic cells largely through antagonizing transactivation by c-Jun/ATF-2 and NF-kappaB complexes at binding sites in the -106 to -88 bp region of the TNF-alpha promoter.

  12. NF-Y, a CCAAT box-binding protein, is one of the trans-acting factors necessary for the response of the murine ERp72 gene to protein traffic.

    PubMed

    Marcus, N; Green, M

    1997-09-01

    The accumulation of incompletely assembled immunoglobulin mu heavy chain in transfected COS cells stimulates the cellular response to protein traffic that results in the increased transcription and elevated synthesis of several ER chaperones, including ERP72, a member of the protein disulfide isomerase family of molecular chaperones. The ERp72 promoter contains an 82 bp ER protein traffic response element (ERPTRE) that is sufficient to mediate this response. Previously, it had been shown that the alteration of a putative AP-2 site and a CCAAT and inverted CCAAT site within the ERPTRE significantly decreased the response of ERp72 promoter to mu chain accumulation. We have extended these findings by demonstrating a role for NF-Y and a potentially novel DNA-binding protein in the regulation of transcription from the ERp72 promoter. The fact that NF-Y binding to the ERPTRE is observed in extracts from both control cells and cells in which the response to protein traffic has been activated indicates that the binding of NF-Y, while necessary, is not sufficient to account for the response. Each of the two CCAAT sites in the ERPTRE can bind NF-Y independently, but both sites must be intact for full ERPTRE function. A second protein can bind to the ERPTRE independently of NF-Y and at a site overlapping or close to the 3' end of the reverse CCAAT site. It is possible that interactions between NF-Y, this protein and perhaps other factors are responsible for the regulation of the protein traffic response.

  13. High level activity of the mouse CCAAT/enhancer binding protein (C/EBP alpha) gene promoter involves autoregulation and several ubiquitous transcription factors.

    PubMed Central

    Legraverend, C; Antonson, P; Flodby, P; Xanthopoulos, K G

    1993-01-01

    The promoter region of the mouse CCAAT-Enhancer Binding Protein (C/EBP alpha) gene is capable of directing high levels of expression of reporter constructs in various cell lines, albeit even in cells that do not express their endogenous C/EBP alpha gene. To understand the molecular mechanisms underlying this ubiquitous expression, we have characterized the promoter region of the mouse C/EBP alpha gene by a variety of in vitro and in vivo methods. We show that three sites related in sequence to USF, BTE and C/EBP binding sites and present in promoter region -350/+3, are recognized by proteins from rat liver nuclear extracts. The sequence of the C/EBP alpha promoter that includes the USF binding site is also capable of forming stable complexes with purified Myc+Max heterodimers and mutation of this site drastically reduces transcription of C/EBP alpha promoter luciferase constructs both in liver and non liver cell lines. In addition, we identify three novel protein-binding sites two of which display similarity to NF-1 and a NF kappa B binding sites. The region located between nucleotides -197 and -178 forms several heat-stable complexes with liver nuclear proteins in vitro which are recognized mainly by antibodies specific for C/EBP alpha. Furthermore, transient expression of C/EBP alpha and to a lesser extent C/EBP beta expression vectors, results in transactivation of a cotransfected C/EBP alpha promoter-luciferase reporter construct. These experiments support the notion that the C/EBP alpha gene is regulated by C/EBP alpha but other C/EBP-related proteins may also be involved. Images PMID:8493090

  14. Herpes simplex virus glycoprotein D relocates nectin-1 from intercellular contacts

    PubMed Central

    Bhargava, Arjun K.; Rothlauf, Paul W.; Krummenacher, Claude

    2016-01-01

    Herpes simplex virus (HSV) uses the cell adhesion molecule nectin-1 as a receptor to enter neurons and epithelial cells. The viral glycoprotein D (gD) is used as a non-canonical ligand for nectin-1. The gD binding site on nectin-1 overlaps with a functional adhesive site involved in nectin-nectin homophilic trans-interaction. Consequently, when nectin-1 is engaged with a cellular ligand at cell junctions, the gD binding site is occupied. Here we report that HSV gD is able to disrupt intercellular homophilic trans-interaction of nectin-1 and induce a rapid redistribution of nectin-1 from cell junctions. This movement does not require the receptor’s interaction with the actin-binding adaptor afadin. Interaction of nectin-1 with afadin is also dispensable for virion surfing along nectin-1-rich filopodia. Cells seeded on gD-coated surfaces also fail to accumulate nectin-1 at cell contact. These data indicate that HSV gD affects nectin-1 locally through direct interaction and more globally through signaling. PMID:27723487

  15. Herpes simplex virus glycoprotein D relocates nectin-1 from intercellular contacts.

    PubMed

    Bhargava, Arjun K; Rothlauf, Paul W; Krummenacher, Claude

    2016-12-01

    Herpes simplex virus (HSV) uses the cell adhesion molecule nectin-1 as a receptor to enter neurons and epithelial cells. The viral glycoprotein D (gD) is used as a non-canonical ligand for nectin-1. The gD binding site on nectin-1 overlaps with a functional adhesive site involved in nectin-nectin homophilic trans-interaction. Consequently, when nectin-1 is engaged with a cellular ligand at cell junctions, the gD binding site is occupied. Here we report that HSV gD is able to disrupt intercellular homophilic trans-interaction of nectin-1 and induce a rapid redistribution of nectin-1 from cell junctions. This movement does not require the receptor's interaction with the actin-binding adaptor afadin. Interaction of nectin-1 with afadin is also dispensable for virion surfing along nectin-1-rich filopodia. Cells seeded on gD-coated surfaces also fail to accumulate nectin-1 at cell contact. These data indicate that HSV gD affects nectin-1 locally through direct interaction and more globally through signaling. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Plant Lectins Targeting O-Glycans at the Cell Surface as Tools for Cancer Diagnosis, Prognosis and Therapy.

    PubMed

    Poiroux, Guillaume; Barre, Annick; van Damme, Els J M; Benoist, Hervé; Rougé, Pierre

    2017-06-09

    Aberrant O -glycans expressed at the surface of cancer cells consist of membrane-tethered glycoproteins (T and Tn antigens) and glycolipids (Lewis a, Lewis x and Forssman antigens). All of these O -glycans have been identified as glyco-markers of interest for the diagnosis and the prognosis of cancer diseases. These epitopes are specifically detected using T/Tn-specific lectins isolated from various plants such as jacalin from Artocarpus integrifola , and fungi such as the Agaricus bisporus lectin. These lectins accommodate T/Tn antigens at the monosaccharide-binding site; residues located in the surrounding extended binding-site of the lectins often participate in the binding of more extended epitopes. Depending on the shape and size of the extended carbohydrate-binding site, their fine sugar-binding specificity towards complex O -glycans readily differs from one lectin to another, resulting in a great diversity in their sugar-recognition capacity. T/Tn-specific lectins have been extensively used for the histochemical detection of cancer cells in biopsies and for the follow up of the cancer progression and evolution. T/Tn-specific lectins also induce a caspase-dependent apoptosis in cancer cells, often associated with a more or less severe inhibition of proliferation. Moreover, they provide another potential source of molecules adapted to the building of photosensitizer-conjugates allowing a specific targeting to cancer cells, for the photodynamic treatment of tumors.

  17. Plant Lectins Targeting O-Glycans at the Cell Surface as Tools for Cancer Diagnosis, Prognosis and Therapy

    PubMed Central

    Poiroux, Guillaume; Barre, Annick; van Damme, Els J. M.; Benoist, Hervé; Rougé, Pierre

    2017-01-01

    Aberrant O-glycans expressed at the surface of cancer cells consist of membrane-tethered glycoproteins (T and Tn antigens) and glycolipids (Lewis a, Lewis x and Forssman antigens). All of these O-glycans have been identified as glyco-markers of interest for the diagnosis and the prognosis of cancer diseases. These epitopes are specifically detected using T/Tn-specific lectins isolated from various plants such as jacalin from Artocarpus integrifola, and fungi such as the Agaricus bisporus lectin. These lectins accommodate T/Tn antigens at the monosaccharide-binding site; residues located in the surrounding extended binding-site of the lectins often participate in the binding of more extended epitopes. Depending on the shape and size of the extended carbohydrate-binding site, their fine sugar-binding specificity towards complex O-glycans readily differs from one lectin to another, resulting in a great diversity in their sugar-recognition capacity. T/Tn-specific lectins have been extensively used for the histochemical detection of cancer cells in biopsies and for the follow up of the cancer progression and evolution. T/Tn-specific lectins also induce a caspase-dependent apoptosis in cancer cells, often associated with a more or less severe inhibition of proliferation. Moreover, they provide another potential source of molecules adapted to the building of photosensitizer-conjugates allowing a specific targeting to cancer cells, for the photodynamic treatment of tumors. PMID:28598369

  18. Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

    PubMed

    Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

    2012-09-01

    Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

  19. Oxidation-induced Structural Changes of Ceruloplasmin Foster NGR Motif Deamidation That Promotes Integrin Binding and Signaling

    PubMed Central

    Barbariga, Marco; Curnis, Flavio; Spitaleri, Andrea; Andolfo, Annapaola; Zucchelli, Chiara; Lazzaro, Massimo; Magnani, Giuseppe; Musco, Giovanna; Corti, Angelo; Alessio, Massimo

    2014-01-01

    Asparagine deamidation occurs spontaneously in proteins during aging; deamidation of Asn-Gly-Arg (NGR) sites can lead to the formation of isoAsp-Gly-Arg (isoDGR), a motif that can recognize the RGD-binding site of integrins. Ceruloplasmin (Cp), a ferroxidase present in the cerebrospinal fluid (CSF), contains two NGR sites in its sequence: one exposed on the protein surface (568NGR) and the other buried in the tertiary structure (962NGR). Considering that Cp can undergo oxidative modifications in the CSF of neurodegenerative diseases, we investigated the effect of oxidation on the deamidation of both NGR motifs and, consequently, on the acquisition of integrin binding properties. We observed that the exposed 568NGR site can deamidate under conditions mimicking accelerated Asn aging. In contrast, the hidden 962NGR site can deamidate exclusively when aging occurs under oxidative conditions, suggesting that oxidation-induced structural changes foster deamidation at this site. NGR deamidation in Cp was associated with gain of integrin-binding function, intracellular signaling, and cell pro-adhesive activity. Finally, Cp aging in the CSF from Alzheimer disease patients, but not in control CSF, causes Cp deamidation with gain of integrin-binding function, suggesting that this transition might also occur in pathological conditions. In conclusion, both Cp NGR sites can deamidate during aging under oxidative conditions, likely as a consequence of oxidative-induced structural changes, thereby promoting a gain of function in integrin binding, signaling, and cell adhesion. PMID:24366863

  20. CCAAT-binding factor regulates expression of the beta1 subunit of soluble guanylyl cyclase gene in the BE2 human neuroblastoma cell line

    NASA Technical Reports Server (NTRS)

    Sharina, Iraida G.; Martin, Emil; Thomas, Anthony; Uray, Karen L.; Murad, Ferid

    2003-01-01

    Soluble guanylyl cyclase (sGC) is a cytosolic enzyme producing the intracellular messenger cyclic guanosine monophosphate (cGMP) on activation with nitric oxide (NO). sGC is an obligatory heterodimer composed of alpha and beta subunits. We investigated human beta1 sGC transcriptional regulation in BE2 human neuroblastoma cells. The 5' upstream region of the beta1 sGC gene was isolated and analyzed for promoter activity by using luciferase reporter constructs. The transcriptional start site of the beta1 sGC gene in BE2 cells was identified. The functional significance of consensus transcriptional factor binding sites proximal to the transcriptional start site was investigated by site deletions in the 800-bp promoter fragment. The elimination of CCAAT-binding factor (CBF) and growth factor independence 1 (GFI1) binding cores significantly diminished whereas deletion of the NF1 core elevated the transcription. Electrophoretic mobility-shift assay (EMSA) and Western analysis of proteins bound to biotinated EMSA probes confirmed the interaction of GFI1, CBF, and NF1 factors with the beta1 sGC promoter. Treatment of BE2 cells with genistein, known to inhibit the CBF binding to DNA, significantly reduced protein levels of beta1 sGC by inhibiting transcription. In summary, our study represents an analysis of the human beta1 sGC promoter regulation in human neuroblastoma BE2 cells and identifies CBF as a critically important factor in beta1 sGC expression.

  1. Genome-Wide Cell Type-Specific Mapping of In Vivo Chromatin Protein Binding Using an FLP-Inducible DamID System in Drosophila.

    PubMed

    Pindyurin, Alexey V

    2017-01-01

    A thorough study of the genome-wide binding patterns of chromatin proteins is essential for understanding the regulatory mechanisms of genomic processes in eukaryotic nuclei, including DNA replication, transcription, and repair. The DNA adenine methyltransferase identification (DamID) method is a powerful tool to identify genomic binding sites of chromatin proteins. This method does not require fixation of cells and the use of specific antibodies, and has been used to generate genome-wide binding maps of more than a hundred different proteins in Drosophila tissue culture cells. Recent versions of inducible DamID allow performing cell type-specific profiling of chromatin proteins even in small samples of Drosophila tissues that contain heterogeneous cell types. Importantly, with these methods sorting of cells of interest or their nuclei is not necessary as genomic DNA isolated from the whole tissue can be used as an input. Here, I describe in detail an FLP-inducible DamID method, namely generation of suitable transgenic flies, activation of the Dam transgenes by the FLP recombinase, isolation of DNA from small amounts of dissected tissues, and subsequent identification of the DNA binding sites of the chromatin proteins.

  2. The Binding Site of Human Adenosine Deaminase for Cd26/Dipeptidyl Peptidase IV

    PubMed Central

    Richard, Eva; Arredondo-Vega, Francisco X.; Santisteban, Ines; Kelly, Susan J.; Patel, Dhavalkumar D.; Hershfield, Michael S.

    2000-01-01

    Human, but not murine, adenosine deaminase (ADA) forms a complex with the cell membrane protein CD26/dipeptidyl peptidase IV. CD26-bound ADA has been postulated to regulate extracellular adenosine levels and to modulate the costimulatory function of CD26 on T lymphocytes. Absence of ADA–CD26 binding has been implicated in causing severe combined immunodeficiency due to ADA deficiency. Using human–mouse ADA hybrids and ADA point mutants, we have localized the amino acids critical for CD26 binding to the helical segment 126–143. Arg142 in human ADA and Gln142 in mouse ADA largely determine the capacity to bind CD26. Recombinant human ADA bearing the R142Q mutation had normal catalytic activity per molecule, but markedly impaired binding to a CD26+ ADA-deficient human T cell line. Reduced CD26 binding was also found with ADA from red cells and T cells of a healthy individual whose only expressed ADA has the R142Q mutation. Conversely, ADA with the E217K active site mutation, the only ADA expressed by a severely immunodeficient patient, showed normal CD26 binding. These findings argue that ADA binding to CD26 is not essential for immune function in humans. PMID:11067872

  3. Association between genetic variation within vitamin D receptor-DNA binding sites and risk of basal cell carcinoma.

    PubMed

    Lin, Yuan; Chahal, Harvind S; Wu, Wenting; Cho, Hyunje G; Ransohoff, Katherine J; Dai, Hongji; Tang, Jean Y; Sarin, Kavita Y; Han, Jiali

    2017-05-01

    An increasing number of studies have reported a protective association between vitamin D and cancer risk. The vitamin D endocrine system regulates transcriptional programs involved in inflammation, cell growth and differentiation through the binding of vitamin D receptor (VDR) to specific VDR elements. However, limited attention has been given to the role of variation within VDR binding sites in the development of basal cell carcinoma (BCC). Across 2,776 previously identified VDR binding sites, we identified 2,540 independent single-nucleotide polymorphisms (SNPs) and examined their associations with BCC risk in a genome-wide association meta-analysis totaling 17,187 BCC cases and 287,054 controls from two data sets. After multiple testing corrections, we identified two SNPs at new loci (rs16917546 at 10q21.1: odds ratio (OR) = 1.06, p = 3.16 × 10 -7 and rs79824801 at 12q13.3: OR = 1.10, p = 1.88 × 10 -5 ) for the first time as independently related to BCC risk in meta-analysis; and both SNPs were nominally significant in two data sets. In addition, the SNP rs3769823 within VDR binding site at a previously reported BCC susceptibility locus (2q33.1, rs13014235) also exhibited a significant association (OR = 1.12, p = 3.99 × 10 -18 ). A mutually adjusted model suggested that rs3769823 explained the signal in this region. Our findings support the hypothesis that inherited common variation in VDR binding sites affects the development of BCC. © 2017 UICC.

  4. Time-resolved multimodal analysis of Src Homology 2 (SH2) domain binding in signaling by receptor tyrosine kinases.

    PubMed

    Jadwin, Joshua A; Oh, Dongmyung; Curran, Timothy G; Ogiue-Ikeda, Mari; Jia, Lin; White, Forest M; Machida, Kazuya; Yu, Ji; Mayer, Bruce J

    2016-04-12

    While the affinities and specificities of SH2 domain-phosphotyrosine interactions have been well characterized, spatio-temporal changes in phosphosite availability in response to signals, and their impact on recruitment of SH2-containing proteins in vivo, are not well understood. To address this issue, we used three complementary experimental approaches to monitor phosphorylation and SH2 binding in human A431 cells stimulated with epidermal growth factor (EGF): 1) phospho-specific mass spectrometry; 2) far-Western blotting; and 3) live cell single-molecule imaging of SH2 membrane recruitment. Far-Western and MS analyses identified both well-established and previously undocumented EGF-dependent tyrosine phosphorylation and binding events, as well as dynamic changes in binding patterns over time. In comparing SH2 binding site phosphorylation with SH2 domain membrane recruitment in living cells, we found in vivo binding to be much slower. Delayed SH2 domain recruitment correlated with clustering of SH2 domain binding sites on the membrane, consistent with membrane retention via SH2 rebinding.

  5. Whole-Genome Analysis Reveals That Active Heat Shock Factor Binding Sites Are Mostly Associated with Non-Heat Shock Genes in Drosophila melanogaster

    PubMed Central

    Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy

    2011-01-01

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254

  6. Whole-genome analysis reveals that active heat shock factor binding sites are mostly associated with non-heat shock genes in Drosophila melanogaster.

    PubMed

    Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy

    2011-01-14

    During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.

  7. SOX10 Regulates Expression of the SH3-Domain Kinase Binding Protein 1 (Sh3kbp1) locus in Schwann Cells via an Alternative Promoter

    PubMed Central

    Hodonsky, Chani J.; Kleinbrink, Erica L.; Charney, Kira N.; Prasad, Megana; Bessling, Seneca L.; Jones, Erin A.; Srinivasan, Rajini; Svaren, John; McCallion, Andrew S.; Antonellis, Anthony

    2011-01-01

    The transcription factor SOX10 has essential roles in neural crest-derived cell populations, including myelinating Schwann cells—specialized glial cells responsible for ensheathing axons in the peripheral nervous system. Importantly, SOX10 directly regulates the expression of genes essential for proper myelin function. To date, only a handful of SOX10 target loci have been characterized in Schwann cells. Addressing this lack of knowledge will provide a better understanding of Schwann cell biology and candidate loci for relevant diseases such as demyelinating peripheral neuropathies. We have identified a highly-conserved SOX10 binding site within an alternative promoter at the SH3-domain kinase binding protein 1 (Sh3kbp1) locus. The genomic segment identified at Sh3kbp1 binds to SOX10 and displays strong promoter activity in Schwann cells in vitro and in vivo. Mutation of the SOX10 binding site ablates promoter activity, and ectopic expression of SOX10 in SOX10-negative cells promotes the expression of endogenous Sh3kbp1. Combined, these data reveal Sh3kbp1 as a novel target of SOX10 and raise important questions regarding the function of SH3KBP1 isoforms in Schwann cells. PMID:22037207

  8. Differential Sox10 Genomic Occupancy in Myelinating Glia

    PubMed Central

    Lopez-Anido, Camila; Sun, Guannan; Koenning, Matthias; Srinivasan, Rajini; Hung, Holly A.; Emery, Ben; Keles, Sunduz; Svaren, John

    2015-01-01

    Myelin is formed by specialized myelinating glia: oligodendrocytes and Schwann cells in the central and peripheral nervous systems, respectively. While there are distinct developmental aspects and regulatory pathways in these two cell types, myelination in both systems requires the transcriptional activator Sox10. Sox10 interacts with cell type-specific transcription factors at some loci to induce myelin gene expression, but it is largely unknown how Sox10 transcriptional networks globally compare between oligodendrocytes and Schwann cells. We used in vivo ChIP-Seq analysis of spinal cord and peripheral nerve (sciatic nerve) to identify unique and shared Sox10 binding sites and assess their correlation with active enhancers and transcriptional profiles in oligodendrocytes and Schwann cells. Sox10 binding sites overlap with active enhancers and critical cell type-specific regulators of myelination, such as Olig2 and Myrf in oligodendrocytes, and Egr2/Krox20 in Schwann cells. Sox10 sites also associate with genes critical for myelination in both oligodendrocytes and Schwann cells, and are found within super-enhancers previously defined in brain. In Schwann cells, Sox10 sites contain binding motifs of putative partners in the Sp/Klf, Tead, and nuclear receptor protein families. Specifically, siRNA analysis of nuclear receptors Nr2f1 and Nr2f2 revealed downregulation of myelin genes Mbp and Ndrg1 in primary Schwann cells. Our analysis highlights different mechanisms that establish cell type-specific genomic occupancy of Sox10, which reflects the unique characteristics of oligodendrocyte and Schwann cell differentiation. PMID:25974668

  9. Cyclophilin B binding to platelets supports calcium-dependent adhesion to collagen.

    PubMed

    Allain, F; Durieux, S; Denys, A; Carpentier, M; Spik, G

    1999-08-01

    We have recently reported that cyclophilin B (CyPB), a secreted cyclosporine-binding protein, could bind to T lymphocytes through interactions with two types of binding sites. The first ones, referred to as type I, involve interactions with the conserved domain of CyPB and promote the endocytosis of surface-bound ligand, while the second type of binding sites, termed type II, are represented by glycosaminoglycans (GAG). Here, we further investigated the interactions of CyPB with blood cell populations. In addition to lymphocytes, CyPB was found to interact mainly with platelets. The binding is specific, with a dissociation constant (kd) of 9 +/- 3 nmol/L and the number of sites estimated at 960 +/- 60 per cell. Platelet glycosaminoglycans are not required for the interactions, but the binding is dramatically reduced by active cyclosporine derivatives. We then analyzed the biologic effects of CyPB and found a significant increase in platelet adhesion to collagen. Concurrently, CyPB initiates a transmembranous influx of Ca(2+) and induces the phosphorylation of the P-20 light chains of myosin. Taken together, the present results demonstrate for the first time that extracellular CyPB specifically interacts with platelets through a functional receptor related to the lymphocyte type I binding sites and might act by regulating the activity of a receptor-operated membrane Ca(2+) channel.

  10. Zinc Binding and Dimerization of Streptococcus pyogenes Pyrogenic Exotoxin C Are Not Essential for T-Cell Stimulation

    DTIC Science & Technology

    2003-03-14

    streptococcal superantigen binding to MHCII on the surface of cells (7–9), suggesting an essential role in both MHCII molecular recognition and TCR-mediated...extent, mutations of side chains found in a second conserved MHCII alpha-chain-binding site consisting of a hydrophobic surface loop decreased T-cell...fraction of dimer is present at T-cell stimulatory concentrations of Spe-C following mutation of the unpaired side chain of cys- teine at residue 27 to

  11. Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter Through Differential Repression of Constitutive Expression

    PubMed Central

    Shiang, Rita

    2008-01-01

    Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell–specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell–specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from −253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter. PMID:18771418

  12. ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs.

    PubMed

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

  13. ETMB-RBF: Discrimination of Metal-Binding Sites in Electron Transporters Based on RBF Networks with PSSM Profiles and Significant Amino Acid Pairs

    PubMed Central

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059

  14. A Surface Energy Transfer Nanoruler for Measuring Binding Site Distances on Live Cell Surfaces

    PubMed Central

    Chen, Yan; O’Donoghue, Meghan B.; Huang, Yu-Fen; Kang, Huaizhi; Phillips, Joseph A.; Chen, Xiaolan; Estevez, M.-Carmen; Tan, Weihong

    2010-01-01

    Measuring distances at molecular length scales in living systems is a significant challenge. Methods like FRET have limitations due to short detection distances and strict orientations. Recently, surface energy transfer (SET) has been used in bulk solutions; however, it cannot be applied to living systems. Here, we have developed an SET nanoruler, using aptamer-gold-nanoparticle conjugates with different diameters, to monitor the distance between binding sites of a receptor on living cells. The nanoruler can measure separation distances well beyond the detection limit of FRET. Thus, for the first time, we have developed an effective SET nanoruler for live cells with long distance, easy construction, fast detection and low background. This is also the first time that the distance between the aptamer and antibody binding sites in the membrane protein PTK7 was measured accurately. The SET nanoruler represents the next leap forward to monitor structural components within living cell membranes. PMID:21038856

  15. Structural basis of RND-type multidrug exporters

    PubMed Central

    Yamaguchi, Akihito; Nakashima, Ryosuke; Sakurai, Keisuke

    2015-01-01

    Bacterial multidrug exporters are intrinsic membrane transporters that act as cellular self-defense mechanism. The most notable characteristics of multidrug exporters is that they export a wide range of drugs and toxic compounds. The overexpression of these exporters causes multidrug resistance. Multidrug-resistant pathogens have become a serious problem in modern chemotherapy. Over the past decade, investigations into the structure of bacterial multidrug exporters have revealed the multidrug recognition and export mechanisms. In this review, we primarily discuss RND-type multidrug exporters particularly AcrAB-TolC, major drug exporter in Gram-negative bacteria. RND-type drug exporters are tripartite complexes comprising a cell membrane transporter, an outer membrane channel and an adaptor protein. Cell membrane transporters and outer membrane channels are homo-trimers; however, there is no consensus on the number of adaptor proteins in these tripartite complexes. The three monomers of a cell membrane transporter have varying conformations (access, binding, and extrusion) during transport. Drugs are exported following an ordered conformational change in these three monomers, through a functional rotation mechanism coupled with the proton relay cycle in ion pairs, which is driven by proton translocation. Multidrug recognition is based on a multisite drug-binding mechanism, in which two voluminous multidrug-binding pockets in cell membrane exporters recognize a wide range of substrates as a result of permutations at numerous binding sites that are specific for the partial structures of substrate molecules. The voluminous multidrug-binding pocket may have numerous binding sites even for a single substrate, suggesting that substrates may move between binding sites during transport, an idea named as multisite-drug-oscillation hypothesis. This hypothesis is consistent with the apparently broad substrate specificity of cell membrane exporters and their highly efficient ejection of drugs from the cell. Substrates are transported through dual multidrug-binding pockets via the peristaltic motion of the substrate translocation channel. Although there are no clinically available inhibitors of bacterial multidrug exporters, efforts to develop inhibitors based on structural information are underway. PMID:25941524

  16. Structural basis of RND-type multidrug exporters.

    PubMed

    Yamaguchi, Akihito; Nakashima, Ryosuke; Sakurai, Keisuke

    2015-01-01

    Bacterial multidrug exporters are intrinsic membrane transporters that act as cellular self-defense mechanism. The most notable characteristics of multidrug exporters is that they export a wide range of drugs and toxic compounds. The overexpression of these exporters causes multidrug resistance. Multidrug-resistant pathogens have become a serious problem in modern chemotherapy. Over the past decade, investigations into the structure of bacterial multidrug exporters have revealed the multidrug recognition and export mechanisms. In this review, we primarily discuss RND-type multidrug exporters particularly AcrAB-TolC, major drug exporter in Gram-negative bacteria. RND-type drug exporters are tripartite complexes comprising a cell membrane transporter, an outer membrane channel and an adaptor protein. Cell membrane transporters and outer membrane channels are homo-trimers; however, there is no consensus on the number of adaptor proteins in these tripartite complexes. The three monomers of a cell membrane transporter have varying conformations (access, binding, and extrusion) during transport. Drugs are exported following an ordered conformational change in these three monomers, through a functional rotation mechanism coupled with the proton relay cycle in ion pairs, which is driven by proton translocation. Multidrug recognition is based on a multisite drug-binding mechanism, in which two voluminous multidrug-binding pockets in cell membrane exporters recognize a wide range of substrates as a result of permutations at numerous binding sites that are specific for the partial structures of substrate molecules. The voluminous multidrug-binding pocket may have numerous binding sites even for a single substrate, suggesting that substrates may move between binding sites during transport, an idea named as multisite-drug-oscillation hypothesis. This hypothesis is consistent with the apparently broad substrate specificity of cell membrane exporters and their highly efficient ejection of drugs from the cell. Substrates are transported through dual multidrug-binding pockets via the peristaltic motion of the substrate translocation channel. Although there are no clinically available inhibitors of bacterial multidrug exporters, efforts to develop inhibitors based on structural information are underway.

  17. Distribution of binding sites for the plant lectin Ulex europaeus agglutinin I on primary sensory neurones in seven different mammalian species.

    PubMed

    Gerke, Michelle B; Plenderleith, Mark B

    2002-01-01

    There is an increasing body of evidence to suggest that different functional classes of neurones express characteristic cell-surface carbohydrates. Previous studies have shown that the plant lectin Ulex europaeus agglutinin-I (UEA) binds to a population of small to medium diameter primary sensory neurones in rabbits and humans. This suggests that a fucose-containing glycoconjugate may be expressed by nociceptive primary sensory neurones. In order to determine the extent to which this glycoconjugate is expressed by other species, in the current study, we have examined the distribution of UEA-binding sites on primary sensory neurones in seven different mammals. Binding sites for UEA were associated with the plasma membrane and cytoplasmic granules of small to medium dorsal root ganglion cells and their axon terminals in laminae I-III of the grey matter of the spinal cord, in the rabbit, cat and marmoset monkey. However, no binding was observed in either the dorsal root ganglia or spinal cord in the mouse, rat, guinea pig or flying fox. These results indicate an inter-species variation in the expression of cell-surface glycoconjugates on mammalian primary sensory neurones.

  18. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  19. Tandem E2F Binding Sites in the Promoter of the p107 Cell Cycle Regulator Control p107 Expression and Its Cellular Functions

    PubMed Central

    Burkhart, Deborah L.; Wirt, Stacey E.; Zmoos, Anne-Flore; Kareta, Michael S.; Sage, Julien

    2010-01-01

    The retinoblastoma tumor suppressor (Rb) is a potent and ubiquitously expressed cell cycle regulator, but patients with a germline Rb mutation develop a very specific tumor spectrum. This surprising observation raises the possibility that mechanisms that compensate for loss of Rb function are present or activated in many cell types. In particular, p107, a protein related to Rb, has been shown to functionally overlap for loss of Rb in several cellular contexts. To investigate the mechanisms underlying this functional redundancy between Rb and p107 in vivo, we used gene targeting in embryonic stem cells to engineer point mutations in two consensus E2F binding sites in the endogenous p107 promoter. Analysis of normal and mutant cells by gene expression and chromatin immunoprecipitation assays showed that members of the Rb and E2F families directly bound these two sites. Furthermore, we found that these two E2F sites controlled both the repression of p107 in quiescent cells and also its activation in cycling cells, as well as in Rb mutant cells. Cell cycle assays further indicated that activation of p107 transcription during S phase through the two E2F binding sites was critical for controlled cell cycle progression, uncovering a specific role for p107 to slow proliferation in mammalian cells. Direct transcriptional repression of p107 by Rb and E2F family members provides a molecular mechanism for a critical negative feedback loop during cell cycle progression and tumorigenesis. These experiments also suggest novel therapeutic strategies to increase the p107 levels in tumor cells. PMID:20585628

  20. Binding site stoichiometry and the effects of phosphorylation on human α1 homomeric glycine receptors

    PubMed Central

    Gentet, Luc J; Clements, John D

    2002-01-01

    The kinetic properties of the human α1 homomeric glycine receptor were investigated. Receptors were expressed in HEK 293 cells, and glycine was applied to outside-out membrane patches with sub-millisecond solution exchange. The activation time course of the glycine response was used to investigate receptor stoichiometry. The unbinding of three strychnine molecules and the cooperative binding of two glycine molecules were required to activate the channel. The effects of phosphorylation on glycine receptor kinetics were investigated by pretreating cells with phosphorylators or with phosphatases. Phosphorylation accelerated desensitisation, but slowed deactivation and recovery from desensitisation. A chemical-kinetic model was developed that reproduced the experimental observations. The model suggests that only three binding sites on the glycine channel are functional, while the remaining two binding sites are ‘silent’, possibly due to strong negative cooperativity. PMID:12356883

  1. Functional synergy between DP-1 and E2F-1 in the cell cycle-regulating transcription factor DRTF1/E2F.

    PubMed Central

    Bandara, L R; Buck, V M; Zamanian, M; Johnston, L H; La Thangue, N B

    1993-01-01

    It is widely believed that the cellular transcription factor DRTF1/E2F integrates cell cycle events with the transcription apparatus because during cell cycle progression in mammalian cells it interacts with molecules that are important regulators of cellular proliferation, such as the retinoblastoma tumour suppressor gene product (pRb), p107, cyclins and cyclin-dependent kinases. Thus, pRb, which negatively regulates early cell cycle progression and is frequently mutated in tumour cells, and the Rb-related protein p107, bind to and repress the transcriptional activity of DRTF1/E2F. Viral oncoproteins, such as adenovirus E1a and SV40 large T antigen, overcome such repression by sequestering pRb and p107 and in so doing are likely to activate genes regulated by DRTF1/E2F, such as cdc2, c-myc and DHFR. Two sequence-specific DNA binding proteins, E2F-1 and DP-1, which bind to the E2F site, contain a small region of similarity. The functional relationship between them has, however, been unclear. We report here that DP-1 and E2F-1 exist in a DNA binding complex in vivo and that they bind efficiently and preferentially as a heterodimer to the E2F site. Moreover, studies in yeast and Drosophila cells indicate that DP-1 and E2F-1 interact synergistically in E2F site-dependent transcriptional activation. Images PMID:8223441

  2. Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis.

    PubMed

    Koshino-Kimura, Yoshihiro; Wada, Takuji; Tachibana, Tatsuhiko; Tsugeki, Ryuji; Ishiguro, Sumie; Okada, Kiyotaka

    2005-06-01

    Epidermal cell differentiation in Arabidopsis root is studied as a model system for understanding cell fate specification. Two types of MYB-related transcription factors are involved in this cell differentiation. One of these, CAPRICE (CPC), encoding an R3-type MYB protein, is a positive regulator of hair cell differentiation and is preferentially transcribed in hairless cells. We analyzed the regulatory mechanism of CPC transcription. Deletion analyses of the CPC promoter revealed that hairless cell-specific transcription of the CPC gene required a 69 bp sequence, and a tandem repeat of this region was sufficient for its expression in epidermis. This region includes two MYB-binding sites, and the epidermis-specific transcription of CPC was abolished when base substitutions were introduced in these sites. We showed by gel mobility shift experiments and by yeast one-hybrid assay that WEREWOLF (WER), which is an R2R3-type MYB protein, directly binds to this region. We showed that WER also binds to the GL2 promoter region, indicating that WER directly regulates CPC and GL2 transcription by binding to their promoter regions.

  3. Identification of a novel cell culture adaptation site on the capsid of foot-and-mouth disease virus.

    PubMed

    Chamberlain, Kyle; Fowler, Veronica L; Barnett, Paul V; Gold, Sarah; Wadsworth, Jemma; Knowles, Nick J; Jackson, Terry

    2015-09-01

    Vaccination remains the most effective tool for control of foot-and-mouth disease both in endemic countries and as an emergency preparedness for new outbreaks. Foot-and-mouth disease vaccines are chemically inactivated virus preparations and the production of new vaccines is critically dependent upon cell culture adaptation of field viruses, which can prove problematic. A major driver of cell culture adaptation is receptor availability. Field isolates of foot-and-mouth disease virus (FMDV) use RGD-dependent integrins as receptors, whereas cell culture adaptation often selects for variants with altered receptor preferences. Previously, two independent sites on the capsid have been identified where mutations are associated with improved cell culture growth. One is a shallow depression formed by the three major structural proteins (VP1-VP3) where mutations create a heparan sulphate (HS)-binding site (the canonical HS-binding site). The other involves residues of VP1 and is located at the fivefold symmetry axis. For some viruses, changes at this site result in HS binding; for others, the receptors are unknown. Here, we report the identification of a novel site on VP2 where mutations resulted in an expanded cell tropism of a vaccine variant of A/IRN/87 (called A - ). Furthermore, we show that introducing the same mutations into a different type A field virus (A/TUR/2/2006) resulted in the same expanded cell culture tropism as the A/IRN/87 A -  vaccine variant. These observations add to the evidence for multiple cell attachment mechanisms for FMDV and may be useful for vaccine manufacture when cell culture adaptation proves difficult.

  4. Identification of a novel cell culture adaptation site on the capsid of foot-and-mouth disease virus

    PubMed Central

    Chamberlain, Kyle; Fowler, Veronica L.; Barnett, Paul V.; Gold, Sarah; Wadsworth, Jemma; Knowles, Nick J.

    2015-01-01

    Vaccination remains the most effective tool for control of foot-and-mouth disease both in endemic countries and as an emergency preparedness for new outbreaks. Foot-and-mouth disease vaccines are chemically inactivated virus preparations and the production of new vaccines is critically dependent upon cell culture adaptation of field viruses, which can prove problematic. A major driver of cell culture adaptation is receptor availability. Field isolates of foot-and-mouth disease virus (FMDV) use RGD-dependent integrins as receptors, whereas cell culture adaptation often selects for variants with altered receptor preferences. Previously, two independent sites on the capsid have been identified where mutations are associated with improved cell culture growth. One is a shallow depression formed by the three major structural proteins (VP1–VP3) where mutations create a heparan sulphate (HS)-binding site (the canonical HS-binding site). The other involves residues of VP1 and is located at the fivefold symmetry axis. For some viruses, changes at this site result in HS binding; for others, the receptors are unknown. Here, we report the identification of a novel site on VP2 where mutations resulted in an expanded cell tropism of a vaccine variant of A/IRN/87 (called A − ). Furthermore, we show that introducing the same mutations into a different type A field virus (A/TUR/2/2006) resulted in the same expanded cell culture tropism as the A/IRN/87 A −  vaccine variant. These observations add to the evidence for multiple cell attachment mechanisms for FMDV and may be useful for vaccine manufacture when cell culture adaptation proves difficult. PMID:26296881

  5. Loss of the Otx2-Binding Site in the Nanog Promoter Affects the Integrity of Embryonic Stem Cell Subtypes and Specification of Inner Cell Mass-Derived Epiblast.

    PubMed

    Acampora, Dario; Omodei, Daniela; Petrosino, Giuseppe; Garofalo, Arcomaria; Savarese, Marco; Nigro, Vincenzo; Di Giovannantonio, Luca Giovanni; Mercadante, Vincenzo; Simeone, Antonio

    2016-06-21

    Mouse embryonic stem cells (ESCs) and the inner cell mass (ICM)-derived epiblast exhibit naive pluripotency. ESC-derived epiblast stem cells (EpiSCs) and the postimplantation epiblast exhibit primed pluripotency. Although core pluripotency factors are well-characterized, additional regulators, including Otx2, recently have been shown to function during the transition from naive to primed pluripotency. Here we uncover a role for Otx2 in the control of the naive pluripotent state. We analyzed Otx2-binding activity in ESCs and EpiSCs and identified Nanog, Oct4, and Sox2 as direct targets. To unravel the Otx2 transcriptional network, we targeted the strongest Otx2-binding site in the Nanog promoter, finding that this site modulates the size of specific ESC-subtype compartments in cultured cells and promotes Nanog expression in vivo, predisposing ICM differentiation to epiblast. Otx2-mediated Nanog regulation thus contributes to the integrity of the ESC state and cell lineage specification in preimplantation development. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  6. ADAM13 cleavage of cadherin-11 promotes CNC migration independently of the homophilic binding site.

    PubMed

    Abbruzzese, Genevieve; Becker, Sarah F; Kashef, Jubin; Alfandari, Dominique

    2016-07-15

    The cranial neural crest (CNC) is a highly motile population of cells that is responsible for forming the face and jaw in all vertebrates and perturbing their migration can lead to craniofacial birth defects. Cell motility requires a dynamic modification of cell-cell and cell-matrix adhesion. In the CNC, cleavage of the cell adhesion molecule cadherin-11 by ADAM13 is essential for cell migration. This cleavage generates a shed extracellular fragment of cadherin-11 (EC1-3) that possesses pro-migratory activity via an unknown mechanism. Cadherin-11 plays an important role in modulating contact inhibition of locomotion (CIL) in the CNC to regulate directional cell migration. Here, we show that while the integral cadherin-11 requires the homophilic binding site to promote CNC migration in vivo, the EC1-3 fragment does not. In addition, we show that increased ADAM13 activity or expression of the EC1-3 fragment increases CNC invasiveness in vitro and blocks the repulsive CIL response in colliding cells. This activity requires the presence of an intact homophilic binding site on the EC1-3 suggesting that the cleavage fragment may function as a competitive inhibitor of cadherin-11 adhesion in CIL but not to promote cell migration in vivo. Copyright © 2015. Published by Elsevier Inc.

  7. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding

    PubMed Central

    Gilad, Yoav; Pritchard, Jonathan K.; Stephens, Matthew

    2015-01-01

    Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede. PMID:26406244

  9. msCentipede: Modeling Heterogeneity across Genomic Sites and Replicates Improves Accuracy in the Inference of Transcription Factor Binding.

    PubMed

    Raj, Anil; Shim, Heejung; Gilad, Yoav; Pritchard, Jonathan K; Stephens, Matthew

    2015-01-01

    Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede.

  10. Open chromatin defined by DNaseI and FAIRE identifies regulatory elements that shape cell-type identity

    PubMed Central

    Song, Lingyun; Zhang, Zhancheng; Grasfeder, Linda L.; Boyle, Alan P.; Giresi, Paul G.; Lee, Bum-Kyu; Sheffield, Nathan C.; Gräf, Stefan; Huss, Mikael; Keefe, Damian; Liu, Zheng; London, Darin; McDaniell, Ryan M.; Shibata, Yoichiro; Showers, Kimberly A.; Simon, Jeremy M.; Vales, Teresa; Wang, Tianyuan; Winter, Deborah; Zhang, Zhuzhu; Clarke, Neil D.; Birney, Ewan; Iyer, Vishwanath R.; Crawford, Gregory E.; Lieb, Jason D.; Furey, Terrence S.

    2011-01-01

    The human body contains thousands of unique cell types, each with specialized functions. Cell identity is governed in large part by gene transcription programs, which are determined by regulatory elements encoded in DNA. To identify regulatory elements active in seven cell lines representative of diverse human cell types, we used DNase-seq and FAIRE-seq (Formaldehyde Assisted Isolation of Regulatory Elements) to map “open chromatin.” Over 870,000 DNaseI or FAIRE sites, which correspond tightly to nucleosome-depleted regions, were identified across the seven cell lines, covering nearly 9% of the genome. The combination of DNaseI and FAIRE is more effective than either assay alone in identifying likely regulatory elements, as judged by coincidence with transcription factor binding locations determined in the same cells. Open chromatin common to all seven cell types tended to be at or near transcription start sites and to be coincident with CTCF binding sites, while open chromatin sites found in only one cell type were typically located away from transcription start sites and contained DNA motifs recognized by regulators of cell-type identity. We show that open chromatin regions bound by CTCF are potent insulators. We identified clusters of open regulatory elements (COREs) that were physically near each other and whose appearance was coordinated among one or more cell types. Gene expression and RNA Pol II binding data support the hypothesis that COREs control gene activity required for the maintenance of cell-type identity. This publicly available atlas of regulatory elements may prove valuable in identifying noncoding DNA sequence variants that are causally linked to human disease. PMID:21750106

  11. Interleukin 2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles

    PubMed Central

    1994-01-01

    Elevation of cAMP can cause gene-specific inhibition of interleukin 2 (IL-2) expression. To investigate the mechanism of this effect, we have combined electrophoretic mobility shift assays and in vivo genomic footprinting to assess both the availability of putative IL-2 transcription factors in forskolin-treated cells and the functional capacity of these factors to engage their sites in vivo. All observed effects of forskolin depended upon protein kinase A, for they were blocked by introduction of a dominant negative mutant subunit of protein kinase A. In the EL4.E1 cell line, we report specific inhibitory effects of cAMP elevation both on NF-kappa B/Rel family factors binding at -200 bp, and on a novel, biochemically distinct "TGGGC" factor binding at -225 bp with respect to the IL-2 transcriptional start site. Neither NF-AT nor AP-1 binding activities are detectably inhibited in gel mobility shift assays. Elevation of cAMP inhibits NF-kappa B activity with delayed kinetics in association with a delayed inhibition of IL-2 RNA accumulation. Activation of cells in the presence of forskolin prevents the maintenance of stable protein- DNA interactions in vivo, not only at the NF-kappa B and TGGGC sites of the IL-2 enhancer, but also at the NF-AT, AP-1, and other sites. This result, and similar results in cyclosporin A-treated cells, imply that individual IL-2 transcription factors cannot stably bind their target sequences in vivo without coengagement of all other distinct factors at neighboring sites. It is proposed that nonhierarchical, cooperative enhancement of binding is a structural basis of combinatorial transcription factor action at the IL-2 locus. PMID:8113685

  12. Berberine Induces Toxicity in HeLa Cells through Perturbation of Microtubule Polymerization by Binding to Tubulin at a Unique Site.

    PubMed

    Raghav, Darpan; Ashraf, Shabeeba M; Mohan, Lakshmi; Rathinasamy, Krishnan

    2017-05-23

    Berberine has been used traditionally for its diverse pharmacological actions. It exhibits remarkable anticancer activities and is currently under clinical trials. In this study, we report that the anticancer activity of berberine could be partly due to its inhibitory actions on tubulin and microtubule assembly. Berberine inhibited the proliferation of HeLa cells with an IC 50 of 18 μM and induced significant depolymerization of interphase and mitotic microtubules. At its IC 50 , berberine exerted a moderate G2/M arrest and mitotic block as detected by fluorescence-activated cell sorting analysis and fluorescence microscopy, respectively. In a wound closure assay, berberine inhibited the migration of HeLa cells at concentrations lower than its IC 50 , indicating its excellent potential as an anticancer agent. In vitro studies with tubulin isolated from goat brain indicated that berberine binds to tubulin at a single site with a K d of 11 μM. Berberine inhibited the assembly of tubulin into microtubules and also disrupted the preformed microtubules polymerized in the presence of glutamate and paclitaxel. Competition experiments indicated that berberine could partially displace colchicine from its binding site. Results from fluorescence resonance energy transfer, computational docking, and molecular dynamics simulations suggest that berberine forms a stable complex with tubulin and binds at a novel site 24 Å from the colchicine site on the β-tubulin. Data obtained from synchronous fluorescence analysis of the tryptophan residues of tubulin and from the Fourier transform infrared spectroscopy studies revealed that binding of berberine alters the conformation of the tubulin heterodimer, which could be the molecular mechanism behind the depolymerizing effects on tubulin assembly.

  13. Cobra CRISP functions as an inflammatory modulator via a novel Zn2+- and heparan sulfate-dependent transcriptional regulation of endothelial cell adhesion molecules.

    PubMed

    Wang, Yu-Ling; Kuo, Je-Hung; Lee, Shao-Chen; Liu, Jai-Shin; Hsieh, Yin-Cheng; Shih, Yu-Tsung; Chen, Chun-Jung; Chiu, Jeng-Jiann; Wu, Wen-Guey

    2010-11-26

    Cysteine-rich secretory proteins (CRISPs) have been identified as a toxin family in most animal venoms with biological functions mainly associated with the ion channel activity of cysteine-rich domain (CRD). CRISPs also bind to Zn(2+) at their N-terminal pathogenesis-related (PR-1) domain, but their function remains unknown. Interestingly, similar the Zn(2+)-binding site exists in all CRISP family, including those identified in a wide range of organisms. Here, we report that the CRISP from Naja atra (natrin) could induce expression of vascular endothelial cell adhesion molecules, i.e. intercellular adhesion molecule-1, vascular adhesion molecule-1, and E-selectin, to promote monocytic cell adhesion in a heparan sulfate (HS)- and Zn(2+)-dependent manner. Using specific inhibitors and small interfering RNAs, the activation mechanisms are shown to involve both mitogen-activated protein kinases and nuclear factor-κB. Biophysical characterization of natrin by using fluorescence, circular dichroism, and x-ray crystallographic methods further reveals the presence of two Zn(2+)-binding sites for natrin. The strong binding site is located near the putative Ser-His-Glu catalytic triad of the N-terminal domain. The weak binding site remains to be characterized, but it may modulate HS binding by enhancing its interaction with long chain HS. Our results strongly suggest that natrin may serve as an inflammatory modulator that could perturb the wound-healing process of the bitten victim by regulating adhesion molecule expression in endothelial cells. Our finding uncovers a new aspect of the biological role of CRISP family in immune response and is expected to facilitate future development of new therapeutic strategy for the envenomed victims.

  14. Isolation of a thyroid hormone-responsive gene by immunoprecipitation of thyroid hormone receptor-DNA complexes.

    PubMed Central

    Bigler, J; Eisenman, R N

    1994-01-01

    Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476

  15. The Global Regulatory Architecture of Transcription during the Caulobacter Cell Cycle

    PubMed Central

    Zhou, Bo; Schrader, Jared M.; Kalogeraki, Virginia S.; Abeliuk, Eduardo; Dinh, Cong B.; Pham, James Q.; Cui, Zhongying Z.; Dill, David L.; McAdams, Harley H.; Shapiro, Lucy

    2015-01-01

    Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5′ RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle. PMID:25569173

  16. The global regulatory architecture of transcription during the Caulobacter cell cycle.

    PubMed

    Zhou, Bo; Schrader, Jared M; Kalogeraki, Virginia S; Abeliuk, Eduardo; Dinh, Cong B; Pham, James Q; Cui, Zhongying Z; Dill, David L; McAdams, Harley H; Shapiro, Lucy

    2015-01-01

    Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5' RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle.

  17. Evaluation of water displacement energetics in protein binding sites with grid cell theory.

    PubMed

    Gerogiokas, G; Southey, M W Y; Mazanetz, M P; Heifetz, A; Hefeitz, A; Bodkin, M; Law, R J; Michel, J

    2015-04-07

    Excess free energies, enthalpies and entropies of water in protein binding sites were computed via classical simulations and Grid Cell Theory (GCT) analyses for three pairs of congeneric ligands in complex with the proteins scytalone dehydratase, p38α MAP kinase and EGFR kinase respectively. Comparative analysis is of interest since the binding modes for each ligand pair differ in the displacement of one binding site water molecule, but significant variations in relative binding affinities are observed. Protocols that vary in their use of restraints on protein and ligand atoms were compared to determine the influence of protein-ligand flexibility on computed water structure and energetics, and to assess protocols for routine analyses of protein-ligand complexes. The GCT-derived binding affinities correctly reproduce experimental trends, but the magnitude of the predicted changes in binding affinities is exaggerated with respect to results from a previous Monte Carlo Free Energy Perturbation study. Breakdown of the GCT water free energies into enthalpic and entropic components indicates that enthalpy changes dominate the observed variations in energetics. In EGFR kinase GCT analyses revealed that replacement of a pyrimidine by a cyanopyridine perturbs water energetics up three hydration shells away from the ligand.

  18. Integrin binding and mechanical tension induce movement of mRNA and ribosomes to focal adhesions

    NASA Technical Reports Server (NTRS)

    Chicurel, M. E.; Singer, R. H.; Meyer, C. J.; Ingber, D. E.

    1998-01-01

    The extracellular matrix (ECM) activates signalling pathways that control cell behaviour by binding to cell-surface integrin receptors and inducing the formation of focal adhesion complexes (FACs). In addition to clustered integrins, FACs contain proteins that mechanically couple the integrins to the cytoskeleton and to immobilized signal-transducing molecules. Cell adhesion to the ECM also induces a rapid increase in the translation of preexisting messenger RNAs. Gene expression can be controlled locally by targeting mRNAs to specialized cytoskeletal domains. Here we investigate whether cell binding to the ECM promotes formation of a cytoskeletal microcompartment specialized for translational control at the site of integrin binding. High-resolution in situ hybridization revealed that mRNA and ribosomes rapidly and specifically localized to FACs that form when cells bind to ECM-coated microbeads. Relocation of these protein synthesis components to the FAC depended on the ability of integrins to mechanically couple the ECM to the contractile cytoskeleton and on associated tension-moulding of the actin lattice. Our results suggest a new type of gene regulation by integrins and by mechanical stress which may involve translation of mRNAs into proteins near the sites of signal reception.

  19. Gab1 Is Required for Cell Cycle Transition, Cell Proliferation, and Transformation Induced by an Oncogenic Met Receptor

    PubMed Central

    Mood, Kathleen; Saucier, Caroline; Bong, Yong-Sik; Lee, Hyun-Shik; Park, Morag

    2006-01-01

    We have shown previously that either Grb2- or Shc-mediated signaling from the oncogenic Met receptor Tpr-Met is sufficient to trigger cell cycle progression in Xenopus oocytes. However, direct binding of these adaptors to Tpr-Met is dispensable, implying that another Met binding partner mediates these responses. In this study, we show that overexpression of Grb2-associated binder 1 (Gab1) promotes cell cycle progression when Tpr-Met is expressed at suboptimal levels. This response requires that Gab1 possess an intact Met-binding motif, the pleckstrin homology domain, and the binding sites for phosphatidylinositol 3-kinase and tyrosine phosphatase SHP-2, but not the Grb2 and CrkII/phospholipase Cγ binding sites. Importantly, we establish that Gab1-mediated signals are critical for cell cycle transition promoted by the oncogenic Met and fibroblast growth factor receptors, but not by progesterone, the natural inducer of cell cycle transition in Xenopus oocytes. Moreover, Gab1 is essential for Tpr-Met–mediated morphological transformation and proliferation of fibroblasts. This study provides the first evidence that Gab1 is a key binding partner of the Met receptor for induction of cell cycle progression, proliferation, and oncogenic morphological transformation. This study identifies Gab1 and its associated signaling partners as potential therapeutic targets to impair proliferation or transformation of cancer cells in human malignancies harboring a deregulated Met receptor. PMID:16775003

  20. The effects of pH and temperature on the in vitro bindings of delta-9-tetrahydrocannabinol and other cannabinoids to bovine serum albumin.

    PubMed

    Papa, V M; Shen, M L; Ou, D W

    1990-01-01

    Albumin is a major carrier of drugs and fatty acids in biological fluids. These protein-drug complexes serve to solubilize, transport these compounds to sites of action, and have been associated with increased half-life for these compounds. The authors are interested in the pH and temperature effects of the binding of delta-9-tetrahydrocannabinol to albumin. Ultrafiltration techniques were used in the separation of free to bound compounds. Cannabinoids bind to bovine serum albumin rapidly. The cannabinoid binding sites are more sensitive to temperature changes (37-47 degrees C) than changes in pH with 37 degrees C and pH 7.4 resulting in optimal binding. These conditions would result in the greatest viability in the cells, while allowing for the use of a variety of compounds in in vitro studies for the administration of compounds to isolated cells and cell lines.

  1. Electrospray mass spectrometry of NeuAc oligomers associated with the C fragment of the tetanus toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prieto, M C; Whittal, R M; Baldwin, M A

    2005-04-03

    The Clostridial neurotoxins, botulinum and tetanus, gain entry into neuronal cells by protein recognition involving cell specific binding sites. The sialic or N-acetylneuraminic acid (NeuAc) residues of gangliosides attached to the surface of motor neurons are the suspected recognition and interaction points with Clostridial neurotoxins, although not necessarily the only ones. We have used electrospray ionization mass spectrometry (ESIMS) to examine formation of complexes between the tetanus toxin C fragment, or targeting domain, and carbohydrates containing NeuAc groups to determine how NeuAc residues contribute to ganglioside binding. ESI-MS was used to rapidly and efficiently measure dissociation constants for a numbermore » of related NeuAc-containing carbohydrates and NeuAc oligomers, information that has helped identify the structural features of gangliosides that determine their binding to tetanus toxin. The strength of the interactions between the C fragment and (NeuAc){sub n}, are consistent with the topography of the targeting domain of tetanus toxin and the nature of its carbohydrate binding sites. The results suggest that the targeting domain of tetanus toxin contains two binding sites that can accommodate NeuAc (or a dimer). This study also shows that NeuAc must play an important role in ganglioside binding and molecular recognition, a process critical for normal cell function and one frequently exploited by toxins, bacteria and viruses to facilitate their entrance into cells.« less

  2. LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

    PubMed

    Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

    2018-05-17

    Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

  3. ( sup 3 H)-DOB(4-bromo-2,5-dimethoxyphenylisopropylamine) and ( sup 3 H) ketanserin label two affinity states of the cloned human 5-hydroxytryptamine2 receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Branchek, T.; Adham, N.; Macchi, M.

    1990-11-01

    The binding properties of the 5-hydroxytryptamine2 (5-HT2) receptor have been the subject of much interest and debate in recent years. The hallucinogenic amphetamine derivative 4-bromo-2,5-dimethoxyphenylisopropylamine (DOB) has been shown to bind to a small number of binding sites with properties very similar to (3H)ketanserin-labeled 5-HT2 receptors, but with much higher agonist affinities. Some researchers have interpreted this as evidence for the existence of a new subtype of 5-HT2 receptor (termed 5-HT2A), whereas others have interpreted these data as indicative of agonist high affinity and agonist low affinity states for the 5-HT2 receptor. In this investigation, a cDNA clone encoding themore » serotonin 5-HT2 receptor was transiently transfected into monkey kidney Cos-7 cells and stably transfected into mouse fibroblast L-M(TK-) cells. In both systems, expression of this single serotonin receptor cDNA led to the appearance of both (3H)DOB and (3H)ketanserin binding sites with properties that matched their binding characteristics in mammalian brain homogenates. Addition of guanosine 5'-(beta, gamma-imido) triphosphate (Gpp(NH)p) to this system caused a rightward shift and steepening of agonist competition curves for (3H) ketanserin binding, converting a two-site binding curve to a single low affinity binding state. Gpp(NH)p addition also caused a 50% decrease in the number of high affinity (3H)DOB binding sites, with no change in the dissociation constant of the remaining high affinity states. These data on a single human 5-HT2 receptor cDNA expressed in two different transfection host cells indicate that (3H)DOB and (3H)ketanserin binding reside on the same gene product, apparently interacting with agonist and antagonist conformations of a single human 5-HT2 receptor protein.« less

  4. [125I]-GR231118: a high affinity radioligand to investigate neuropeptide Y Y1 and Y4 receptors

    PubMed Central

    Dumont, Yvan; Quirion, Rémi

    2000-01-01

    GR231118 (also known as 1229U91 and GW1229), a purported Y1 antagonist and Y4 agonist was radiolabelled using the chloramine T method. [125I]-GR231118 binding reached equilibrium within 10 min at room temperature and remained stable for at least 4 h. Saturation binding experiments showed that [125I]-GR231118 binds with very high affinity (Kd of 0.09–0.24 nM) in transfected HEK293 cells with the rat Y1 and Y4 receptor cDNA and in rat brain membrane homogenates. No specific binding sites could be detected in HEK293 cells transfected with the rat Y2 or Y5 receptor cDNA demonstrating the absence of significant affinity of GR231118 for these two receptor classes. Competition binding experiments revealed that specific [125I]-GR231118 binding in rat brain homogenates is most similar to that observed in HEK293 cells transfected with the rat Y1, but not rat Y4, receptor cDNA. Autoradiographic studies demonstrated that [125I]-GR231118 binding sites were fully inhibited by the Y1 antagonist BIBO3304 in most areas of the rat brain. Interestingly, high percentage of [125I]-GR231118/BIBO3304-insensitive binding sites were detected in few areas. These [125I]-GR231118/BIBO3304-insensitive binding sites likely represent labelling to the Y4 receptor subtype. In summary, [125I]-GR231118 is a new radiolabelled probe to investigate the Y1 and Y4 receptors; its major advantage being its high affinity. Using highly selective Y1 antagonists such as BIBO3304 or BIBP3226 it is possible to block the binding of [125I]-GR231118 to the Y1 receptor allowing for the characterization and visualization of the purported Y4 subtype. PMID:10694200

  5. ADAM13 cleavage of cadherin-11 promotes CNC migration independently of the homophilic binding site

    PubMed Central

    Kashef, Jubin; Alfandari, Dominique

    2015-01-01

    The cranial neural crest (CNC) is a highly motile population of cells that is responsible for forming the face and jaw in all vertebrates and perturbing their migration can lead to craniofacial birth defects. Cell motility requires a dynamic modification of cell–cell and cell-matrix adhesion. In the CNC, cleavage of the cell adhesion molecule cadherin-11 by ADAM13 is essential for cell migration. This cleavage generates a shed extracellular fragment of cadherin-11 (EC1-3) that possesses pro-migratory activity via an unknown mechanism. Cadherin-11 plays an important role in modulating contact inhibition of locomotion (CIL) in the CNC to regulate directional cell migration. Here, we show that while the integral cadherin-11 requires the homophilic binding site to promote CNC migration in vivo, the EC1-3 fragment does not. In addition, we show that increased ADAM13 activity or expression of the EC1-3 fragment increases CNC invasiveness in vitro and blocks the repulsive CIL response in colliding cells. This activity requires the presence of an intact homophilic binding site on the EC1-3 suggesting that the cleavage fragment may function as a competitive inhibitor of cadherin-11 adhesion in CIL but not to promote cell migration in vivo. PMID:26206614

  6. Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

    PubMed Central

    Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

    2003-01-01

    Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069

  7. Modulation of mouse Leydig cell steroidogenesis through a specific arginine-vasopressin receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tahri-Joutei, A.; Pointis, G.

    1988-01-01

    Characterization of specific vasopressin binding sites was investigated in purified mouse Leydig cells using tritiated arginine-vasopressin. Binding of radioligand was saturable, time- and temperature-dependent and reversible. (/sup 3/H)-AVP was found to bind to a single class of sites with high affinity and low capacity. Binding displacements with specific selection analogs of AVP indicated the presence of V/sub 1/ subtype receptors on Leydig cells. The ability of AVP to displace (/sup 3/H)-AVP binding was greater than LVP and oxytocin. The unrelated peptides, somatostatin and substance P, were less potent, while neurotensin and LHRH did not displace (/sup 3/H)-AVP binding. The time-coursemore » effects of AVP-pretreatment on basal and hCG-stimulated testosterone and cAMP accumulations were studied in primary culture of Leydig cells. Basal testosterone accumulation was significantly increased by a 24 h AVP-pretreatment of Leydig cells. This effect was potentiated by the phosphodiesterase inhibitor (MIX) and was concomitantly accompanied by a slight but significant increase in cAMP accumulation. AVP-pretreatment of the cells for 72 h had no effect on basal testosterone accumulation, but exerted a marked inhibitory effect on the hCG-stimulated testosterone accumulation. This reduction of testosterone accumulation occurred even in the presence of MIX and was not accompanied by any significant change of cAMP levels.« less

  8. Molecular modeling and identification of novel glucokinase activators through stepwise virtual screening.

    PubMed

    Behera, Pabitra Mohan; Behera, Deepak Kumar; Satpati, Suresh; Agnihotri, Geetanjali; Nayak, Sanghamitra; Padhi, Payodhar; Dixit, Anshuman

    2015-04-01

    The glucose phosphorylating enzyme glucokinase (GK) is a 50kD monomeric protein having 465 amino acids. It maintains glucose homeostasis inside cells, acts as a glucose sensor in pancreatic β-cells and as a rate controlling enzyme for hepatic glucose clearance and glycogen synthesis. It has two binding sites, one for binding d-glucose and the other for a putative allosteric activator named glucokinase activator (GKA). The GKAs interact with the same region of the GK enzyme that is commonly affected by naturally occurring mutations in humans. However, many GKAs do not bind to GK in the absence of glucose. Recently, it has been reported that GKAs are highly effective in patients with type 2 diabetes mellitus. In this milieu a molecular modeling study has been carried out on three natural variants of GK that lie in the GKA binding site and are known to cause maturity onset diabetes of young (MODY). Additionally, a 10ns molecular dynamics simulation was done on each of the modeled variant in order to explore the flexibility of this site. Subsequently, a systematic virtual screening study was done to identify compounds which can bind with high affinity at GKA binding site of mutant GK. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. The effect of metal loading on Cd adsorption onto Shewanella oneidensis bacterial cell envelopes: The role of sulfhydryl sites

    NASA Astrophysics Data System (ADS)

    Yu, Qiang; Fein, Jeremy B.

    2015-10-01

    The adsorption and desorption of Cd onto Shewanella oneidensis bacterial cells with and without blocking of sulfhydryl sites was measured in order to determine the effect of metal loading and to understand the role of sulfhydryl sites in the adsorption reactions. The observed adsorption/desorption behaviors display strong dependence on metal loading. Under a high loading of 40 μmol Cd/g bacterial cells, blocking the sulfhydryl sites within the cell envelope by exposure of the biomass to monobromo(trimethylammonio)bimane bromide (qBBr) does not significantly affect the extent of Cd adsorption, and we observed fully reversible adsorption under this condition. In contrast, under a low metal loading of 1.3 μmol Cd/g bacterial cells, the extent of Cd adsorption onto sulfhydryl-blocked S. oneidensis cells was significantly lower than that onto untreated cells, and only approximately 50-60% of the adsorbed Cd desorbed from the cells upon acidification. In conjunction with previous EXAFS results, our findings demonstrate that Cd adsorption onto S. oneidensis under low metal loading conditions is dominated by sulfhydryl binding, and thus is controlled by a distinct adsorption mechanism from the non-sulfhydryl site binding which controls Cd adsorption under high metal loading conditions. We use the data to develop a surface complexation model that constrains the values of the stability constants for individual Cd-sulfhydryl and Cd-non-sulfhydryl bacterial complexes, and we use this approach to account for the Cd adsorption behavior as a function of both pH and metal loading. This approach is crucial in order to predict metal adsorption onto bacteria under environmentally relevant metal loading conditions where sulfhydryl binding sites can dominate the adsorption reaction.

  10. The pathogen-related yeast protein Pry1, a member of the CAP protein superfamily, is a fatty acid-binding protein

    PubMed Central

    Darwiche, Rabih; Mène-Saffrané, Laurent; Gfeller, David; Asojo, Oluwatoyin A.; Schneiter, Roger

    2017-01-01

    Members of the CAP superfamily (cysteine-rich secretory proteins, antigen 5, and pathogenesis-related 1 proteins), also known as SCP superfamily (sperm-coating proteins), have been implicated in many physiological processes, including immune defenses, venom toxicity, and sperm maturation. Their mode of action, however, remains poorly understood. Three proteins of the CAP superfamily, Pry1, -2, and -3 (pathogen related in yeast), are encoded in the Saccharomyces cerevisiae genome. We have shown previously that Pry1 binds cholesterol in vitro and that Pry function is required for sterol secretion in yeast cells, indicating that members of this superfamily may generally bind sterols or related small hydrophobic compounds. On the other hand, tablysin-15, a CAP protein from the horsefly Tabanus yao, has been shown to bind leukotrienes and free fatty acids in vitro. Therefore, here we assessed whether the yeast Pry1 protein binds fatty acids. Computational modeling and site-directed mutagenesis indicated that the mode of fatty acid binding is conserved between tablysin-15 and Pry1. Pry1 bound fatty acids with micromolar affinity in vitro, and its function was essential for fatty acid export in cells lacking the acyl-CoA synthetases Faa1 and Faa4. Fatty acid binding of Pry1 is independent of its capacity to bind sterols, and the two sterol- and fatty acid-binding sites are nonoverlapping. These results indicate that some CAP family members, such as Pry1, can bind different lipids, particularly sterols and fatty acids, at distinct binding sites, suggesting that the CAP domain may serve as a stable, secreted protein domain that can accommodate multiple ligand-binding sites. PMID:28365570

  11. Revised Model of Calcium and Magnesium Binding to the Bacterial Cell Wall

    PubMed Central

    Thomas, Kieth J.; Rice, Charles V.

    2014-01-01

    Metals bind to the bacterial cell wall yet the binding mechanisms and affinity constants are not fully understood. The cell wall of gram positive bacteria is characterized by a thick layer of peptidoglycan and anionic teichoic acids anchored in the cytoplasmic membrane (lipoteichoic acid) or covalently bound to the cell wall (wall teichoic acid). The polyphosphate groups of teichoic acid provide one-half of the metal binding sites for calcium and magnesium, contradicting previous reports that calcium binding is 100% dependent on teichoic acid. The remaining binding sites are formed with the carboxyl units of peptidoglycan. In this work we report equilibrium association constants and total metal binding capacities for the interaction of calcium and magnesium ions with the bacterial cell wall. Metal binding is much stronger and previously reported. Curvature of Scatchard plots from the binding data and the resulting two regions of binding affinity suggest the presence of negative cooperative binding, meaning that the binding affinity decreases as more ions become bound to the sample. For Ca2+, Region I has a KA = (1.0 ± 0.2) × 106 M−1 and Region II has a KA = (0.075 ± 0.058) × 106 M−1. For Mg2+, KA1 = (1.5 ± 0.1) × 106 and KA2 = (0.17 ± 0.10) × 106. A binding capacity (η) is reported for both regions. However, since binding is still occurring in Region II, the total binding capacity is denoted by η2, which are 0.70 ± 0.04 µmol/mg and 0.67 ± 0.03 µmol/mg for Ca2+ and Mg2+ respectively. These data contradict the current paradigm of there being a single metal affinity value that is constant over a range of concentrations. We also find that measurement of equilibrium binding constants is highly sample dependent, suggesting a role for diffusion of metals through heterogeneous cell wall fragments. As a result, we are able to reconcile many contradictory theories that describe binding affinity and the binding mode of divalent metal cations. PMID:25315444

  12. CELF1 preferentially binds to exon-intron boundary and regulates alternative splicing in HeLa cells.

    PubMed

    Xia, Heng; Chen, Dong; Wu, Qijia; Wu, Gang; Zhou, Yanhong; Zhang, Yi; Zhang, Libin

    2017-09-01

    The current RIP-seq approach has been developed for the identification of genome-wide interaction between RNA binding protein (RBP) and the bound RNA transcripts, but still rarely for identifying its binding sites. In this study, we performed RIP-seq experiments in HeLa cells using a monoclonal antibody against CELF1. Mapping of the RIP-seq reads showed a biased distribution at the 3'UTR and intronic regions. A total of 15,285 and 1384 CELF1-specific sense and antisense peaks were identified using the ABLIRC software tool. Our bioinformatics analyses revealed that 5' and 3' splice site motifs and GU-rich motifs were highly enriched in the CELF1-bound peaks. Furthermore, transcriptome analyses revealed that alternative splicing was globally regulated by CELF1 in HeLa cells. For example, the inclusion of exon 16 of LMO7 gene, a marker gene of breast cancer, is positively regulated by CELF1. Taken together, we have shown that RIP-seq data can be used to decipher RBP binding sites and reveal an unexpected landscape of the genome-wide CELF1-RNA interactions in HeLa cells. In addition, we found that CELF1 globally regulates the alternative splicing by binding the exon-intron boundary in HeLa cells, which will deepen our understanding of the regulatory roles of CELF1 in the pre-mRNA splicing process. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Functional Analysis of AP-2 α and μ2 Subunits

    PubMed Central

    Motley, Alison M.; Berg, Nicola; Taylor, Marcus J.; Sahlender, Daniela A.; Hirst, Jennifer; Owen, David J.

    2006-01-01

    The AP-2 adaptor complex plays a key role in cargo recognition and clathrin-coated vesicle formation at the plasma membrane. To investigate the functions of individual binding sites and domains of the AP-2 complex in vivo, we have stably transfected HeLa cells with wild-type and mutant small interfering RNA–resistant α and μ2 subunits and then used siRNA knockdowns to deplete the endogenous proteins. Mutating the PtdIns(4,5)P2 binding site of α, the phosphorylation site of μ2, or the YXXΦ binding site of μ2 impairs AP-2 function, as assayed by transferrin uptake. In contrast, removing the C-terminal appendage domain of α, or mutating the PtdIns(4,5)P2 binding site of μ2, has no apparent effect. However, adding a C-terminal GFP tag to α renders it completely nonfunctional. These findings demonstrate that there is some functional redundancy in the binding sites of the various AP-2 subunits, because no single mutation totally abolishes function. They also help to explain why GFP-tagged AP-2 never appears to leave the plasma membrane in some live cell imaging studies. Finally, they establish a new model system that can be used both for additional structure-function analyses, and as a way of testing tagged constructs for function in vivo. PMID:17035630

  14. Designing and Testing of Novel Taxanes to Probe the Highly Complex Mechanisms by Which Taxanes Bind to Microtubules and Cause Cytotoxicity to Cancer Cells

    PubMed Central

    St. George, Marc; Ayoub, Ahmed T.; Banerjee, Asok; Churchill, Cassandra D. M.; Winter, Philip; Klobukowski, Mariusz; Cass, Carol E.; Ludueña, Richard F.; Tuszynski, Jack A.; Damaraju, Sambasivarao

    2015-01-01

    Our previous work identified an intermediate binding site for taxanes in the microtubule nanopore. The goal of this study was to test derivatives of paclitaxel designed to bind to this intermediate site differentially depending on the isotype of β-tubulin. Since β-tubulin isotypes have tissue-dependent expression—specifically, the βIII isotype is very abundant in aggressive tumors and much less common in normal tissues—this is expected to lead to tubulin targeted drugs that are more efficacious and have less side effects. Seven derivatives of paclitaxel were designed and four of these were amenable for synthesis in sufficient purity and yield for further testing in breast cancer model cell lines. None of the derivatives studied were superior to currently used taxanes, however computer simulations provided insights into the activity of the derivatives. Our results suggest that neither binding to the intermediate binding site nor the final binding site is sufficient to explain the activities of the derivative taxanes studied. These findings highlight the need to iteratively improve on the design of taxanes based on their activity in model systems. Knowledge gained on the ability of the engineered drugs to bind to targets and bring about activity in a predictable manner is a step towards personalizing therapies. PMID:26052950

  15. In brain, Axl recruits Grb2 and the p85 regulatory subunit of Pl3 kinase; in vitro mutagenesis defines th requisite binding sites for downstream Akt activation

    PubMed Central

    Weinger, Jason G.; Gohari, Pouyan; Yan, Ying; Backer, Jonathan M.; Varnum, Brian; Shafit-Zagardo, Bridget

    2010-01-01

    Axl is a receptor tyrosine kinase implicated in cell survival following growth factor withdrawal and other stressors. The binding of Axl's ligand, growth arrest-specific protein 6 (Gas6), results in Axl autophosphorylation, recruitment of signaling molecules, and activation of downstream survival pathways. Pull-down assays and immunoprecipitations using wildtype and mutant Axl transfected cells determined that Axl directly binds growth factor receptor-bound protein 2 (Grb2) at pYVN and the p85 subunit of phosphatidylinositol-3 kinase (PI3 kinase) at two pYXXM sites (pY779 and pY821). Also, p85 can indirectly bind to Axl via an interaction between p85's second proline-rich region and the N-terminal SH3 domain of Grb2. Further, Grb2 and p85 can compete for binding at the pY821VNM site. Gas6-stimulation of Axl-transfected COS7 cells recruited activated PI3 kinase and phosphorylated Akt. An interaction between Axl, p85 and Grb2 was confirmed in brain homogenates, enriched populations of O4+ oligodendrocytes, and O4– flow-through prepared from day 10 mouse brain, indicating that cells with active Gas6/Axl signal through Grb2 and the PI3 kinase/Akt pathways. PMID:18346204

  16. Nanomechanical mapping of first binding steps of a virus to animal cells

    NASA Astrophysics Data System (ADS)

    Alsteens, David; Newton, Richard; Schubert, Rajib; Martinez-Martin, David; Delguste, Martin; Roska, Botond; Müller, Daniel J.

    2017-02-01

    Viral infection is initiated when a virus binds to cell surface receptors. Because the cell membrane is dynamic and heterogeneous, imaging living cells and simultaneously quantifying the first viral binding events is difficult. Here, we show an atomic force and confocal microscopy set-up that allows the surface receptor landscape of cells to be imaged and the virus binding events within the first millisecond of contact with the cell to be mapped at high resolution (<50 nm). We present theoretical approaches to contour the free-energy landscape of early binding events between an engineered virus and cell surface receptors. We find that the first bond formed between the viral glycoprotein and its cognate cell surface receptor has relatively low lifetime and free energy, but this increases as additional bonds form rapidly (≤1 ms). The formation of additional bonds occurs with positive allosteric modulation and the three binding sites of the viral glycoprotein are quickly occupied. Our quantitative approach can be readily applied to study the binding of other viruses to animal cells.

  17. WZB117 (2-Fluoro-6-(m-hydroxybenzoyloxy) Phenyl m-Hydroxybenzoate) Inhibits GLUT1-mediated Sugar Transport by Binding Reversibly at the Exofacial Sugar Binding Site.

    PubMed

    Ojelabi, Ogooluwa A; Lloyd, Kenneth P; Simon, Andrew H; De Zutter, Julie K; Carruthers, Anthony

    2016-12-23

    WZB117 (2-fluoro-6-(m-hydroxybenzoyloxy) phenyl m-hydroxybenzoate) inhibits passive sugar transport in human erythrocytes and cancer cell lines and, by limiting glycolysis, inhibits tumor growth in mice. This study explores how WZB117 inhibits the erythrocyte sugar transporter glucose transport protein 1 (GLUT1) and examines the transporter isoform specificity of inhibition. WZB117 reversibly and competitively inhibits erythrocyte 3-O-methylglucose (3MG) uptake with K i (app) = 6 μm but is a noncompetitive inhibitor of sugar exit. Cytochalasin B (CB) is a reversible, noncompetitive inhibitor of 3MG uptake with K i (app) = 0.3 μm but is a competitive inhibitor of sugar exit indicating that WZB117 and CB bind at exofacial and endofacial sugar binding sites, respectively. WZB117 inhibition of GLUTs expressed in HEK293 cells follows the order of potency: insulin-regulated GLUT4 ≫ GLUT1 ≈ neuronal GLUT3. This may explain WZB117-induced murine lipodystrophy. Molecular docking suggests the following. 1) The WZB117 binding envelopes of exofacial GLUT1 and GLUT4 conformers differ significantly. 2) GLUT1 and GLUT4 exofacial conformers present multiple, adjacent glucose binding sites that overlap with WZB117 binding envelopes. 3) The GLUT1 exofacial conformer lacks a CB binding site. 4) The inward GLUT1 conformer presents overlapping endofacial WZB117, d-glucose, and CB binding envelopes. Interrogating the GLUT1 mechanism using WZB117 reveals that subsaturating WZB117 and CB stimulate erythrocyte 3MG uptake. Extracellular WZB117 does not affect CB binding to GLUT1, but intracellular WZB117 inhibits CB binding. These findings are incompatible with the alternating conformer carrier for glucose transport but are consistent with either a multisubunit, allosteric transporter, or a transporter in which each subunit presents multiple, interacting ligand binding sites. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. WZB117 (2-Fluoro-6-(m-hydroxybenzoyloxy) Phenyl m-Hydroxybenzoate) Inhibits GLUT1-mediated Sugar Transport by Binding Reversibly at the Exofacial Sugar Binding Site*

    PubMed Central

    Ojelabi, Ogooluwa A.; Lloyd, Kenneth P.; Simon, Andrew H.; De Zutter, Julie K.; Carruthers, Anthony

    2016-01-01

    WZB117 (2-fluoro-6-(m-hydroxybenzoyloxy) phenyl m-hydroxybenzoate) inhibits passive sugar transport in human erythrocytes and cancer cell lines and, by limiting glycolysis, inhibits tumor growth in mice. This study explores how WZB117 inhibits the erythrocyte sugar transporter glucose transport protein 1 (GLUT1) and examines the transporter isoform specificity of inhibition. WZB117 reversibly and competitively inhibits erythrocyte 3-O-methylglucose (3MG) uptake with Ki(app) = 6 μm but is a noncompetitive inhibitor of sugar exit. Cytochalasin B (CB) is a reversible, noncompetitive inhibitor of 3MG uptake with Ki(app) = 0.3 μm but is a competitive inhibitor of sugar exit indicating that WZB117 and CB bind at exofacial and endofacial sugar binding sites, respectively. WZB117 inhibition of GLUTs expressed in HEK293 cells follows the order of potency: insulin-regulated GLUT4 ≫ GLUT1 ≈ neuronal GLUT3. This may explain WZB117-induced murine lipodystrophy. Molecular docking suggests the following. 1) The WZB117 binding envelopes of exofacial GLUT1 and GLUT4 conformers differ significantly. 2) GLUT1 and GLUT4 exofacial conformers present multiple, adjacent glucose binding sites that overlap with WZB117 binding envelopes. 3) The GLUT1 exofacial conformer lacks a CB binding site. 4) The inward GLUT1 conformer presents overlapping endofacial WZB117, d-glucose, and CB binding envelopes. Interrogating the GLUT1 mechanism using WZB117 reveals that subsaturating WZB117 and CB stimulate erythrocyte 3MG uptake. Extracellular WZB117 does not affect CB binding to GLUT1, but intracellular WZB117 inhibits CB binding. These findings are incompatible with the alternating conformer carrier for glucose transport but are consistent with either a multisubunit, allosteric transporter, or a transporter in which each subunit presents multiple, interacting ligand binding sites. PMID:27836974

  19. Neural precursor cell-expressed developmentally down-regulated protein 4-2 (Nedd4-2) regulation by 14-3-3 protein binding at canonical serum and glucocorticoid kinase 1 (SGK1) phosphorylation sites.

    PubMed

    Chandran, Sindhu; Li, Hui; Dong, Wuxing; Krasinska, Karolina; Adams, Chris; Alexandrova, Ludmila; Chien, Allis; Hallows, Kenneth R; Bhalla, Vivek

    2011-10-28

    Regulation of epithelial Na(+) channel (ENaC)-mediated transport in the distal nephron is a critical determinant of blood pressure in humans. Aldosterone via serum and glucocorticoid kinase 1 (SGK1) stimulates ENaC by phosphorylation of the E3 ubiquitin ligase Nedd4-2, which induces interaction with 14-3-3 proteins. However, the mechanisms of SGK1- and 14-3-3-mediated regulation of Nedd4-2 are unclear. There are three canonical SGK1 target sites on Nedd4-2 that overlap phosphorylation-dependent 14-3-3 interaction motifs. Two of these are termed "minor," and one is termed "major," based on weak or strong binding to 14-3-3 proteins, respectively. By mass spectrometry, we found that aldosterone significantly stimulates phosphorylation of a minor, relative to the major, 14-3-3 binding site on Nedd4-2. Phosphorylation-deficient minor site Nedd4-2 mutants bound less 14-3-3 than did wild-type (WT) Nedd4-2, and minor site Nedd4-2 mutations were sufficient to inhibit SGK1 stimulation of ENaC cell surface expression. As measured by pulse-chase and cycloheximide chase assays, a major binding site Nedd4-2 mutant had a shorter cellular half-life than WT Nedd4-2, but this property was not dependent on binding to 14-3-3. Additionally, a dimerization-deficient 14-3-3ε mutant failed to bind Nedd4-2. We conclude that whereas phosphorylation at the Nedd4-2 major site is important for interaction with 14-3-3 dimers, minor site phosphorylation by SGK1 may be the relevant molecular switch that stabilizes Nedd4-2 interaction with 14-3-3 and thus promotes ENaC cell surface expression. We also propose that major site phosphorylation promotes cellular Nedd4-2 protein stability, which potentially represents a novel form of regulation for turnover of E3 ubiquitin ligases.

  20. Structure- and Modeling-based Identification of the Adenovirus E4orf4 Binding Site in the Protein Phosphatase 2A B55α Subunit*

    PubMed Central

    Horowitz, Ben; Sharf, Rakefet; Avital-Shacham, Meirav; Pechkovsky, Antonina; Kleinberger, Tamar

    2013-01-01

    The adenovirus E4orf4 protein regulates the progression of viral infection and when expressed outside the context of the virus it induces nonclassical, cancer cell-specific apoptosis. All E4orf4 functions known to date require an interaction between E4orf4 and protein phosphatase 2A (PP2A), which is mediated through PP2A regulatory B subunits. Specifically, an interaction with the B55α subunit is required for induction of cell death by E4orf4. To gain a better insight into the E4orf4-PP2A interaction, mapping of the E4orf4 interaction site in PP2A-B55α has been undertaken. To this end we used a combination of bioinformatics analyses of PP2A-B55α and of E4orf4, which led to the prediction of E4orf4 binding sites on the surface of PP2A-B55α. Mutation analysis, immunoprecipitation, and GST pulldown assays based on the theoretical predictions revealed that the E4orf4 binding site included the α1 and α2 helices described in the B55α structure and involved at least three residues located in these helices facing each other. Loss of E4orf4 binding was accompanied by reduced contribution of the B55α mutants to E4orf4-induced cell death. The identified E4orf4 binding domain lies above the previously described substrate binding site and does not overlap it, although its location could be consistent with direct or indirect effects on substrate binding. This work assigns for the first time a functional significance to the α1,α2 helices of B55α, and we suggest that the binding site defined by these helices could also contribute to interactions between PP2A and some of its cellular regulators. PMID:23530045

  1. Prediction of FAD binding sites in electron transport proteins according to efficient radial basis function networks and significant amino acid pairs.

    PubMed

    Le, Nguyen-Quoc-Khanh; Ou, Yu-Yen

    2016-07-30

    Cellular respiration is a catabolic pathway for producing adenosine triphosphate (ATP) and is the most efficient process through which cells harvest energy from consumed food. When cells undergo cellular respiration, they require a pathway to keep and transfer electrons (i.e., the electron transport chain). Due to oxidation-reduction reactions, the electron transport chain produces a transmembrane proton electrochemical gradient. In case protons flow back through this membrane, this mechanical energy is converted into chemical energy by ATP synthase. The convert process is involved in producing ATP which provides energy in a lot of cellular processes. In the electron transport chain process, flavin adenine dinucleotide (FAD) is one of the most vital molecules for carrying and transferring electrons. Therefore, predicting FAD binding sites in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. We used an independent data set to evaluate the performance of the proposed method, which had an accuracy of 69.84 %. We compared the performance of the proposed method in analyzing two newly discovered electron transport protein sequences with that of the general FAD binding predictor presented by Mishra and Raghava and determined that the accuracy of the proposed method improved by 9-45 % and its Matthew's correlation coefficient was 0.14-0.5. Furthermore, the proposed method enabled reducing the number of false positives significantly and can provide useful information for biologists. We developed a method that is based on PSSM profiles and SAAPs for identifying FAD binding sites in newly discovered electron transport protein sequences. This approach achieved a significant improvement after we added SAAPs to PSSM features to analyze FAD binding proteins in the electron transport chain. The proposed method can serve as an effective tool for predicting FAD binding sites in electron transport proteins and can help biologists understand the functions of the electron transport chain, particularly those of FAD binding sites. We also developed a web server which identifies FAD binding sites in electron transporters available for academics.

  2. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  3. Transcriptional Activation by NFκB Increases Perlecan/HSPG2 Expression in the Desmoplastic Prostate Tumor Microenvironment

    PubMed Central

    Warren, Curtis R.; Grindel, Brian J.; Francis, Lewis; Carson, Daniel D.; Farach-Carson, Mary C.

    2014-01-01

    Perlecan/HSPG2, a heparan sulfate proteoglycan typically found at tissue borders including those separating epithelia and connective tissue, increases near sites of invasion of primary prostatic tumors as previously shown for other proteins involved in desmoplastic tissue reaction. Studies of prostate cancer cells and stromal cells from both prostate and bone, the major site for prostate cancer metastasis, showed that cancer cells and a subset of stromal cells increased production of perlecan in response to cytokines present in the tumor microenvironment. In silico analysis of the HSPG2 promoter revealed two conserved NFκB binding sites, in addition to the previously reported SMAD3 binding sites. By systematically transfecting cells with a variety of reporter constructs including sequences up to 2.6 kb from the start site of transcription, we identified an active cis element in the distal region of the HSPG2 promoter, and showed that it functions in regulating transcription of HSPG2. Treatment with TNF-α and/or TGFβ1 identified TNF-α as a major cytokine regulator of perlecan production. TNF-α treatment also triggered p65 nuclear translocation and binding to the HSPG2 regulatory region in stromal cells and cancer cells. In addition to stromal induction of perlecan production in the prostate, we identified a matrix-secreting bone marrow stromal cell type that may represent the source for increases in perlecan in the metastatic bone marrow environment. These studies implicate perlecan in cytokine-mediated, innate tissue responses to cancer cell invasion, a process we suggest reflects a modified wound healing tissue response co-opted by prostate cancer cells. PMID:24700612

  4. Time-resolved multimodal analysis of Src Homology 2 (SH2) domain binding in signaling by receptor tyrosine kinases

    PubMed Central

    Jadwin, Joshua A; Oh, Dongmyung; Curran, Timothy G; Ogiue-Ikeda, Mari; Jia, Lin; White, Forest M; Machida, Kazuya; Yu, Ji; Mayer, Bruce J

    2016-01-01

    While the affinities and specificities of SH2 domain-phosphotyrosine interactions have been well characterized, spatio-temporal changes in phosphosite availability in response to signals, and their impact on recruitment of SH2-containing proteins in vivo, are not well understood. To address this issue, we used three complementary experimental approaches to monitor phosphorylation and SH2 binding in human A431 cells stimulated with epidermal growth factor (EGF): 1) phospho-specific mass spectrometry; 2) far-Western blotting; and 3) live cell single-molecule imaging of SH2 membrane recruitment. Far-Western and MS analyses identified both well-established and previously undocumented EGF-dependent tyrosine phosphorylation and binding events, as well as dynamic changes in binding patterns over time. In comparing SH2 binding site phosphorylation with SH2 domain membrane recruitment in living cells, we found in vivo binding to be much slower. Delayed SH2 domain recruitment correlated with clustering of SH2 domain binding sites on the membrane, consistent with membrane retention via SH2 rebinding. DOI: http://dx.doi.org/10.7554/eLife.11835.001 PMID:27071344

  5. Estrogen regulation of chicken riboflavin carrier protein gene is mediated by ERE half sites without direct binding of estrogen receptor.

    PubMed

    Bahadur, Urvashi; Ganjam, Goutham K; Vasudevan, Nandini; Kondaiah, Paturu

    2005-02-28

    Estrogen is an important steroid hormone that mediates most of its effects on regulation of gene expression by binding to intracellular receptors. The consensus estrogen response element (ERE) is a 13bp palindromic inverted repeat with a three nucleotide spacer. However, several reports suggest that many estrogen target genes are regulated by diverse elements, such as imperfect EREs and ERE half sites (ERE 1/2), which are either the proximal or the distal half of the palindrome. To gain more insight into ERE half site-mediated gene regulation, we used a region from the estrogen-regulated chicken riboflavin carrier protein (RCP) gene promoter that contains ERE half sites. Using moxestrol, an analogue of estrogen and transient transfection of deletion and mutation containing RCP promoter/reporter constructs in chicken hepatoma (LMH2A) cells, we identified an estrogen response unit (ERU) composed of two consensus ERE 1/2 sites and one non-consensus ERE 1/2 site. Mutation of any of these sites within this ERU abolishes moxestrol response. Further, the ERU is able to confer moxestrol responsiveness to a heterologous promoter. Interestingly, RCP promoter is regulated by moxestrol in estrogen responsive human MCF-7 cells, but not in other cell lines such as NIH3T3 and HepG2 despite estrogen receptor-alpha (ER-alpha) co transfection. Electrophoretic mobility shift assays (EMSAs) with promoter regions encompassing the half sites and nuclear extracts from LMH2A cells show the presence of a moxestrol-induced complex that is abolished by a polyclonal anti-ERalpha antibody. Surprisingly, estrogen receptor cannot bind to these promoter elements in isolation. Thus, there appears to be a definite requirement for some other factor(s) in addition to estrogen receptor, for the generation of a suitable response of this promoter to estrogen. Our studies therefore suggest a novel mechanism of gene regulation by estrogen, involving ERE half sites without direct binding of ER to the cognate elements.

  6. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  7. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  8. High-and low-affinity binding sites for Cd on the bacterial cell walls of Bacillus subtilis and Shewanella oneidensis.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mishra, B.; Boyanov, M.; Bunker, B. A.

    2010-08-01

    Bulk Cd adsorption isotherm experiments, thermodynamic equilibrium modeling, and Cd K edge EXAFS were used to constrain the mechanisms of proton and Cd adsorption to bacterial cells of the commonly occurring Gram-positive and Gram-negative bacteria, Bacillus subtilis and Shewanella oneidensis, respectively. Potentiometric titrations were used to characterize the functional group reactivity of the S. oneidensis cells, and we model the titration data using the same type of non-electrostatic surface complexation approach as was applied to titrations of B. subtilis suspensions by Fein et al. (2005). Similar to the results for B. subtilis, the S. oneidensis cells exhibit buffering behavior frommore » approximately pH 3-9 that requires the presence of four distinct sites, with pK{sub a} values of 3.3 {+-} 0.2, 4.8 {+-} 0.2, 6.7 {+-} 0.4, and 9.4 {+-} 0.5, and site concentrations of 8.9({+-}2.6) x 10{sup -5}, 1.3({+-}0.2) x 10{sup -4}, 5.9({+-}3.3) x 10{sup -5}, and 1.1({+-}0.6) x 10{sup -4} moles/g bacteria (wet mass), respectively. The bulk Cd isotherm adsorption data for both species, conducted at pH 5.9 as a function of Cd concentration at a fixed biomass concentration, were best modeled by reactions with a Cd:site stoichiometry of 1:1. EXAFS data were collected for both bacterial species as a function of Cd concentration at pH 5.9 and 10 g/L bacteria. The EXAFS results show that the same types of binding sites are responsible for Cd sorption to both bacterial species at all Cd loadings tested (1-200 ppm). Carboxyl sites are responsible for the binding at intermediate Cd loadings. Phosphoryl ligands are more important than carboxyl ligands for Cd binding at high Cd loadings. For the lowest Cd loadings studied here, a sulfhydryl site was found to dominate the bound Cd budgets for both species, in addition to the carboxyl and phosphoryl sites that dominate the higher loadings. The EXAFS results suggest that both Gram-positive and Gram-negative bacterial cell walls have a low concentration of very high-affinity sulfhydryl sites which become masked by the more abundant carboxyl and phosphoryl sites at higher metal:bacteria ratios. This study demonstrates that metal loading plays a vital role in determining the important metal-binding reactions that occur on bacterial cell walls, and that high affinity, low-density sites can be revealed by spectroscopy of biomass samples. Such sites may control the fate and transport of metals in realistic geologic settings, where metal concentrations are low.« less

  9. Binding of high molecular weight kininogen to human endothelial cells is mediated via a site within domains 2 and 3 of the urokinase receptor.

    PubMed Central

    Colman, R W; Pixley, R A; Najamunnisa, S; Yan, W; Wang, J; Mazar, A; McCrae, K R

    1997-01-01

    The urokinase receptor (uPAR) binds urokinase-type plasminogen activator (u-PA) through specific interactions with uPAR domain 1, and vitronectin through interactions with a site within uPAR domains 2 and 3. These interactions promote the expression of cell surface plasminogen activator activity and cellular adhesion to vitronectin, respectively. High molecular weight kininogen (HK) also stimulates the expression of cell surface plasminogen activator activity through its ability to serve as an acquired receptor for prekallikrein, which, after its activation, may directly activate prourokinase. Here, we report that binding of the cleaved form of HK (HKa) to human umbilical vein endothelial cells (HUVEC) is mediated through zinc-dependent interactions with uPAR. These occur through a site within uPAR domains 2 and 3, since the binding of 125I-HKa to HUVEC is inhibited by vitronectin, anti-uPAR domain 2 and 3 antibodies and soluble, recombinant uPAR (suPAR), but not by antibody 7E3, which recognizes the beta chain of the endothelial cell vitronectin receptor (integrin alphavbeta3), or fibrinogen, another alphavbeta3 ligand. We also demonstrate the formation of a zinc-dependent complex between suPAR and HKa. Interactions of HKa with endothelial cell uPAR may underlie its ability to promote kallikrein-dependent cell surface plasmin generation, and also explain, in part, its antiadhesive properties. PMID:9294114

  10. Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma

    PubMed Central

    Yan, Bin; Yang, Xinping; Lee, Tin-Lap; Friedman, Jay; Tang, Jun; Van Waes, Carter; Chen, Zhong

    2007-01-01

    Background Differentially expressed gene profiles have previously been observed among pathologically defined cancers by microarray technologies, including head and neck squamous cell carcinomas (HNSCCs). However, the molecular expression signatures and transcriptional regulatory controls that underlie the heterogeneity in HNSCCs are not well defined. Results Genome-wide cDNA microarray profiling of ten HNSCC cell lines revealed novel gene expression signatures that distinguished cancer cell subsets associated with p53 status. Three major clusters of over-expressed genes (A to C) were defined through hierarchical clustering, Gene Ontology, and statistical modeling. The promoters of genes in these clusters exhibited different patterns and prevalence of transcription factor binding sites for p53, nuclear factor-κB (NF-κB), activator protein (AP)-1, signal transducer and activator of transcription (STAT)3 and early growth response (EGR)1, as compared with the frequency in vertebrate promoters. Cluster A genes involved in chromatin structure and function exhibited enrichment for p53 and decreased AP-1 binding sites, whereas clusters B and C, containing cytokine and antiapoptotic genes, exhibited a significant increase in prevalence of NF-κB binding sites. An increase in STAT3 and EGR1 binding sites was distributed among the over-expressed clusters. Novel regulatory modules containing p53 or NF-κB concomitant with other transcription factor binding motifs were identified, and experimental data supported the predicted transcriptional regulation and binding activity. Conclusion The transcription factors p53, NF-κB, and AP-1 may be important determinants of the heterogeneous pattern of gene expression, whereas STAT3 and EGR1 may broadly enhance gene expression in HNSCCs. Defining these novel gene signatures and regulatory mechanisms will be important for establishing new molecular classifications and subtyping, which in turn will promote development of targeted therapeutics for HNSCC. PMID:17498291

  11. Effects of Iron Deficiency on Iron Binding and Internalization into Acidic Vacuoles in Dunaliella salina1[W][OA

    PubMed Central

    Paz, Yakov; Shimoni, Eyal; Weiss, Meira; Pick, Uri

    2007-01-01

    Uptake of iron in the halotolerant alga Dunaliella salina is mediated by a transferrin-like protein (TTf), which binds and internalizes Fe3+ ions. Recently, we found that iron deficiency induces a large enhancement of iron binding, which is associated with accumulation of three other plasma membrane proteins that associate with TTf. In this study, we characterized the kinetic properties of iron binding and internalization and identified the site of iron internalization. Iron deficiency induces a 4-fold increase in Fe binding, but only 50% enhancement in the rate of iron uptake and also increases the affinity for iron and bicarbonate, a coligand for iron binding. These results indicate that iron deprivation leads to accumulation and modification of iron-binding sites. Iron uptake in iron-sufficient cells is preceded by an apparent time lag, resulting from prebound iron, which can be eliminated by unloading iron-binding sites. Iron is tightly bound to surface-exposed sites and hardly exchanges with medium iron. All bound iron is subsequently internalized. Accumulation of iron inhibits further iron binding and internalization. The vacuolar inhibitor bafilomycin inhibits iron uptake and internalization. Internalized iron was localized by electron microscopy within vacuolar structures that were identified as acidic vacuoles. Iron internalization is accompanied by endocytosis of surface proteins into these acidic vacuoles. A novel kinetic mechanism for iron uptake is proposed, which includes two pools of bound/compartmentalized iron separated by a rate-limiting internalization stage. The major parameter that is modulated by iron deficiency is the iron-binding capacity. We propose that excessive iron binding in iron-deficient cells serves as a temporary reservoir for iron that is subsequently internalized. This mechanism is particularly suitable for organisms that are exposed to large fluctuations in iron availability. PMID:17513481

  12. Dexamethasone effects on creatine kinase activity and insulin-like growth factor receptors in cultured muscle cells

    NASA Technical Reports Server (NTRS)

    Whitson, Peggy A.; Stuart, Charles A.; Huls, M. H.; Sams, Clarence F.; Cintron, Nitza M.

    1989-01-01

    The effect of dexamethasone on the activity of creatine kinase (CK) and the insulin-like growth factor I (IGF-I) binding were investigated using skeletal- and cardiac-muscle-derived cultured cell lines (mouse, C2C12; rat, L6 and H9c2). It was found that, in skeletal muscle cells, dexamethasone treatment during differentiation of skeletal-muscle cells caused dose-dependent increases in CK activity and increases in the degree of myotube formation, whereas cardiac cells (H9c2) exhibited very low CK activity during culture or dexamethasone treatment. Results for IGF-I binding were similar in all three cell lines. The IGF-I binding to dexamethasone-treated cells (50 nM for 24 hr on the day prior to confluence) resulted in an increased number of available binding sites, with no effect on the binding affinities.

  13. Genome-Wide Identification of Chromatin Transitional Regions Reveals Diverse Mechanisms Defining the Boundary of Facultative Heterochromatin

    PubMed Central

    Li, Guangyao; Zhou, Lei

    2013-01-01

    Due to the self-propagating nature of the heterochromatic modification H3K27me3, chromatin barrier activities are required to demarcate the boundary and prevent it from encroaching into euchromatic regions. Studies in Drosophila and vertebrate systems have revealed several important chromatin barrier elements and their respective binding factors. However, epigenomic data indicate that the binding of these factors are not exclusive to chromatin boundaries. To gain a comprehensive understanding of facultative heterochromatin boundaries, we developed a two-tiered method to identify the Chromatin Transitional Region (CTR), i.e. the nucleosomal region that shows the greatest transition rate of the H3K27me3 modification as revealed by ChIP-Seq. This approach was applied to identify CTRs in Drosophila S2 cells and human HeLa cells. Although many insulator proteins have been characterized in Drosophila, less than half of the CTRs in S2 cells are associated with known insulator proteins, indicating unknown mechanisms remain to be characterized. Our analysis also revealed that the peak binding of insulator proteins are usually 1–2 nucleosomes away from the CTR. Comparison of CTR-associated insulator protein binding sites vs. those in heterochromatic region revealed that boundary-associated binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significant decreased nucleosome density and increased binding intensities of co-factors. Interestingly, several subgroups of boundaries have enhanced H3.3 incorporation but reduced nucleosome turnover rate. Our genome-wide study reveals that diverse mechanisms are employed to define the boundaries of facultative heterochromatin. In both Drosophila and mammalian systems, only a small fraction of insulator protein binding sites co-localize with H3K27me3 boundaries. However, boundary-associated insulator binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significantly decreased nucleosome density and increased binding of co-factors. PMID:23840609

  14. Rac1 GTPase activates the WAVE regulatory complex through two distinct binding sites.

    PubMed

    Chen, Baoyu; Chou, Hui-Ting; Brautigam, Chad A; Xing, Wenmin; Yang, Sheng; Henry, Lisa; Doolittle, Lynda K; Walz, Thomas; Rosen, Michael K

    2017-09-26

    The Rho GTPase Rac1 activates the WAVE regulatory complex (WRC) to drive Arp2/3 complex-mediated actin polymerization, which underpins diverse cellular processes. Here we report the structure of a WRC-Rac1 complex determined by cryo-electron microscopy. Surprisingly, Rac1 is not located at the binding site on the Sra1 subunit of the WRC previously identified by mutagenesis and biochemical data. Rather, it binds to a distinct, conserved site on the opposite end of Sra1. Biophysical and biochemical data on WRC mutants confirm that Rac1 binds to both sites, with the newly identified site having higher affinity and both sites required for WRC activation. Our data reveal that the WRC is activated by simultaneous engagement of two Rac1 molecules, suggesting a mechanism by which cells may sense the density of active Rac1 at membranes to precisely control actin assembly.

  15. Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less

  16. Discovery of potent cytotoxic ortho-aryl chalcones as new scaffold targeting tubulin and mitosis with affinity-based fluorescence.

    PubMed

    Zhu, Cuige; Zuo, Yinglin; Wang, Ruimin; Liang, Baoxia; Yue, Xin; Wen, Gesi; Shang, Nana; Huang, Lei; Chen, Yu; Du, Jun; Bu, Xianzhang

    2014-08-14

    A series of new ortho-aryl chalcones have been designed and synthesized. Many of these compounds were found to exhibit significant antiproliferation activity toward a panel of cancer cell lines. Selected compounds show potent cytotoxicity against several drug resistant cell lines including paclitaxel (Taxol) resistant human ovarian carcinoma cells, vincristine resistant human ileocecum carcinoma cells, and doxorubicin resistant human breast carcinoma cells. Further investigation revealed that active analogues could inhibit the microtubule polymerization by binding to colchicine site and thus induce multipolar mitosis, G2/M phase arrest, and apoptosis of cancer cells. Furthermore, affinity-based fluorescence enhancement was observed during the binding of active compounds with tubulin, which greatly facilitated the determination of tubulin binding site of the compounds. Finally, selected compound 26 was found to exhibit obvious in vivo antitumor activity in A549 tumor xenografts model. Our systematic studies implied a new scaffold targeting tubulin and mitosis for novel antitumor drug discovery.

  17. Structure of an N276-Dependent HIV-1 Neutralizing Antibody Targeting a Rare V5 Glycan Hole Adjacent to the CD4 Binding Site.

    PubMed

    Wibmer, Constantinos Kurt; Gorman, Jason; Anthony, Colin S; Mkhize, Nonhlanhla N; Druz, Aliaksandr; York, Talita; Schmidt, Stephen D; Labuschagne, Phillip; Louder, Mark K; Bailer, Robert T; Abdool Karim, Salim S; Mascola, John R; Williamson, Carolyn; Moore, Penny L; Kwong, Peter D; Morris, Lynn

    2016-11-15

    All HIV-1-infected individuals develop strain-specific neutralizing antibodies to their infecting virus, which in some cases mature into broadly neutralizing antibodies. Defining the epitopes of strain-specific antibodies that overlap conserved sites of vulnerability might provide mechanistic insights into how broadly neutralizing antibodies arise. We previously described an HIV-1 clade C-infected donor, CAP257, who developed broadly neutralizing plasma antibodies targeting an N276 glycan-dependent epitope in the CD4 binding site. The initial CD4 binding site response potently neutralized the heterologous tier 2 clade B viral strain RHPA, which was used to design resurfaced gp120 antigens for single-B-cell sorting. Here we report the isolation and structural characterization of CAP257-RH1, an N276 glycan-dependent CD4 binding site antibody representative of the early CD4 binding site plasma response in donor CAP257. The cocrystal structure of CAP257-RH1 bound to RHPA gp120 revealed critical interactions with the N276 glycan, loop D, and V5, but not with aspartic acid 368, similarly to HJ16 and 179NC75. The CAP257-RH1 monoclonal antibody was derived from the immunoglobulin-variable IGHV3-33 and IGLV3-10 genes and neutralized RHPA but not the transmitted/founder virus from donor CAP257. Its narrow neutralization breadth was attributed to a binding angle that was incompatible with glycosylated V5 loops present in almost all HIV-1 strains, including the CAP257 transmitted/founder virus. Deep sequencing of autologous CAP257 viruses, however, revealed minority variants early in infection that lacked V5 glycans. These glycan-free V5 loops are unusual holes in the glycan shield that may have been necessary for initiating this N276 glycan-dependent CD4 binding site B-cell lineage. The conserved CD4 binding site on gp120 is a major target for HIV-1 vaccine design, but key events in the elicitation and maturation of different antibody lineages to this site remain elusive. Studies have shown that strain-specific antibodies can evolve into broadly neutralizing antibodies or in some cases act as helper lineages. Therefore, characterizing the epitopes of strain-specific antibodies may help to inform the design of HIV-1 immunogens to elicit broadly neutralizing antibodies. In this study, we isolate a narrowly neutralizing N276 glycan-dependent antibody and use X-ray crystallography and viral deep sequencing to describe how gp120 lacking glycans in V5 might have elicited these early glycan-dependent CD4 binding site antibodies. These data highlight how glycan holes can play a role in the elicitation of B-cell lineages targeting the CD4 binding site. Copyright © 2016 Wibmer et al.

  18. Structure of an N276-Dependent HIV-1 Neutralizing Antibody Targeting a Rare V5 Glycan Hole Adjacent to the CD4 Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wibmer, Constantinos Kurt; Gorman, Jason; Anthony, Colin S.

    ABSTRACT All HIV-1-infected individuals develop strain-specific neutralizing antibodies to their infecting virus, which in some cases mature into broadly neutralizing antibodies. Defining the epitopes of strain-specific antibodies that overlap conserved sites of vulnerability might provide mechanistic insights into how broadly neutralizing antibodies arise. We previously described an HIV-1 clade C-infected donor, CAP257, who developed broadly neutralizing plasma antibodies targeting an N276 glycan-dependent epitope in the CD4 binding site. The initial CD4 binding site response potently neutralized the heterologous tier 2 clade B viral strain RHPA, which was used to design resurfaced gp120 antigens for single-B-cell sorting. Here we report themore » isolation and structural characterization of CAP257-RH1, an N276 glycan-dependent CD4 binding site antibody representative of the early CD4 binding site plasma response in donor CAP257. The cocrystal structure of CAP257-RH1 bound to RHPA gp120 revealed critical interactions with the N276 glycan, loop D, and V5, but not with aspartic acid 368, similarly to HJ16 and 179NC75. The CAP257-RH1 monoclonal antibody was derived from the immunoglobulin-variable IGHV3-33 and IGLV3-10 genes and neutralized RHPA but not the transmitted/founder virus from donor CAP257. Its narrow neutralization breadth was attributed to a binding angle that was incompatible with glycosylated V5 loops present in almost all HIV-1 strains, including the CAP257 transmitted/founder virus. Deep sequencing of autologous CAP257 viruses, however, revealed minority variants early in infection that lacked V5 glycans. These glycan-free V5 loops are unusual holes in the glycan shield that may have been necessary for initiating this N276 glycan-dependent CD4 binding site B-cell lineage. IMPORTANCEThe conserved CD4 binding site on gp120 is a major target for HIV-1 vaccine design, but key events in the elicitation and maturation of different antibody lineages to this site remain elusive. Studies have shown that strain-specific antibodies can evolve into broadly neutralizing antibodies or in some cases act as helper lineages. Therefore, characterizing the epitopes of strain-specific antibodies may help to inform the design of HIV-1 immunogens to elicit broadly neutralizing antibodies. In this study, we isolate a narrowly neutralizing N276 glycan-dependent antibody and use X-ray crystallography and viral deep sequencing to describe how gp120 lacking glycans in V5 might have elicited these early glycan-dependent CD4 binding site antibodies. These data highlight how glycan holes can play a role in the elicitation of B-cell lineages targeting the CD4 binding site.« less

  19. Structure of an N276-Dependent HIV-1 Neutralizing Antibody Targeting a Rare V5 Glycan Hole Adjacent to the CD4 Binding Site

    PubMed Central

    Wibmer, Constantinos Kurt; Gorman, Jason; Anthony, Colin S.; Mkhize, Nonhlanhla N.; Druz, Aliaksandr; York, Talita; Schmidt, Stephen D.; Labuschagne, Phillip; Louder, Mark K.; Bailer, Robert T.; Abdool Karim, Salim S.; Mascola, John R.; Williamson, Carolyn; Moore, Penny L.

    2016-01-01

    ABSTRACT All HIV-1-infected individuals develop strain-specific neutralizing antibodies to their infecting virus, which in some cases mature into broadly neutralizing antibodies. Defining the epitopes of strain-specific antibodies that overlap conserved sites of vulnerability might provide mechanistic insights into how broadly neutralizing antibodies arise. We previously described an HIV-1 clade C-infected donor, CAP257, who developed broadly neutralizing plasma antibodies targeting an N276 glycan-dependent epitope in the CD4 binding site. The initial CD4 binding site response potently neutralized the heterologous tier 2 clade B viral strain RHPA, which was used to design resurfaced gp120 antigens for single-B-cell sorting. Here we report the isolation and structural characterization of CAP257-RH1, an N276 glycan-dependent CD4 binding site antibody representative of the early CD4 binding site plasma response in donor CAP257. The cocrystal structure of CAP257-RH1 bound to RHPA gp120 revealed critical interactions with the N276 glycan, loop D, and V5, but not with aspartic acid 368, similarly to HJ16 and 179NC75. The CAP257-RH1 monoclonal antibody was derived from the immunoglobulin-variable IGHV3-33 and IGLV3-10 genes and neutralized RHPA but not the transmitted/founder virus from donor CAP257. Its narrow neutralization breadth was attributed to a binding angle that was incompatible with glycosylated V5 loops present in almost all HIV-1 strains, including the CAP257 transmitted/founder virus. Deep sequencing of autologous CAP257 viruses, however, revealed minority variants early in infection that lacked V5 glycans. These glycan-free V5 loops are unusual holes in the glycan shield that may have been necessary for initiating this N276 glycan-dependent CD4 binding site B-cell lineage. IMPORTANCE The conserved CD4 binding site on gp120 is a major target for HIV-1 vaccine design, but key events in the elicitation and maturation of different antibody lineages to this site remain elusive. Studies have shown that strain-specific antibodies can evolve into broadly neutralizing antibodies or in some cases act as helper lineages. Therefore, characterizing the epitopes of strain-specific antibodies may help to inform the design of HIV-1 immunogens to elicit broadly neutralizing antibodies. In this study, we isolate a narrowly neutralizing N276 glycan-dependent antibody and use X-ray crystallography and viral deep sequencing to describe how gp120 lacking glycans in V5 might have elicited these early glycan-dependent CD4 binding site antibodies. These data highlight how glycan holes can play a role in the elicitation of B-cell lineages targeting the CD4 binding site. PMID:27581986

  20. Surface IgM λ light chain is involved in the binding and infection of infectious bursal disease virus (IBDV) to DT40 cells.

    PubMed

    Chi, Jiaqi; You, Leiming; Li, Peipei; Teng, Man; Zhang, Gaiping; Luo, Jun; Wang, Aiping

    2018-04-01

    Infectious bursal disease virus (IBDV) is an important immunosuppressive virus in chickens. Surface immunoglobulin M (sIgM)-bearing B lymphocytes act as the major targets of IBDV in the bursa of Fabricius, and sIgM may function as one of the membrane binding sites responsible for IBDV infection. Recently, using the virus overlay protein binding assay, the chicken λ light chain of sIgM was identified to specifically interact with IBDV in a virulence-independent manner in vitro. To further investigate sIgM λ light chain-mediated IBDV binding and infection in pre-B cells, the cell line DT40, which is susceptible to both pathogenic and attenuated IBDV, was used. Based on the RNA interference strategy, the DT40 cell line whose λ light chain of sIgM was stably knocked down, herein termed DT40LKD, was generated by the genomic integration of a specific small hairpin RNA and a green fluorescence protein co-expression construct. Flow cytometry analysis indicated that the binding of IBDV to DT40LKD cells was significantly reduced due to the loss of sIgM λ light chain. In particular, reduced viral replication was observed in IBDV-incubated DT40LKD cells, and no viral release into cell culture medium was detected by the IBDV rapid diagnostic strips. In addition, the rescue of sIgM λ light chain expression restored viral binding and replication in DT40LKD cells. These results show that sIgM λ light chain appears to be beneficial for IBDV attachment and infection, suggesting that sIgM acts as a binding site involved in IBDV infection.

  1. Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction

    PubMed Central

    Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K.; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G.; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H.

    2017-01-01

    The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. PMID:27899623

  2. The biological activity of botulinum neurotoxin type C is dependent upon novel types of ganglioside binding sites.

    PubMed

    Strotmeier, Jasmin; Gu, Shenyan; Jutzi, Stephan; Mahrhold, Stefan; Zhou, Jie; Pich, Andreas; Eichner, Timo; Bigalke, Hans; Rummel, Andreas; Jin, Rongsheng; Binz, Thomas

    2011-07-01

    The seven botulinum neurotoxins (BoNT) cause muscle paralysis by selectively cleaving core components of the vesicular fusion machinery. Their extraordinary activity primarily relies on highly specific entry into neurons. Data on BoNT/A, B, E, F and G suggest that entry follows a dual receptor interaction with complex gangliosides via an established ganglioside binding region and a synaptic vesicle protein. Here, we report high resolution crystal structures of the BoNT/C cell binding fragment alone and in complex with sialic acid. The WY-motif characteristic of the established ganglioside binding region was located on an exposed loop. Sialic acid was co-ordinated at a novel position neighbouring the binding pocket for synaptotagmin in BoNT/B and G and the sialic acid binding site in BoNT/D and TeNT respectively. Employing synaptosomes and immobilized gangliosides binding studies with BoNT/C mutants showed that the ganglioside binding WY-loop, the newly identified sialic acid-co-ordinating pocket and the area corresponding to the established ganglioside binding region of other BoNTs are involved in ganglioside interaction. Phrenic nerve hemidiaphragm activity tests employing ganglioside deficient mice furthermore evidenced that the biological activity of BoNT/C depends on ganglioside interaction with at least two binding sites. These data suggest a unique cell binding and entry mechanism for BoNT/C among clostridial neurotoxins. © 2011 Blackwell Publishing Ltd.

  3. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  4. Nanolithographic control of the spatial organization of cellular adhesion receptors at the single-molecule level

    PubMed Central

    Schvartzman, Mark; Palma, Matteo; Sable, Julia; Abramson, Justin; Hu, Xian; Sheetz, Michael P.; Wind, Shalom J.

    2011-01-01

    The ability to control the placement of individual molecules promises to enable a wide range of applications and is a key challenge in nanoscience and nanotechnology. Many biological interactions, in particular, are sensitive to the precise geometric arrangement of proteins. We have developed a technique which combines molecular-scale nanolithography with site-selective biochemistry to create biomimetic arrays of individual protein binding sites. The binding sites can be arranged in heterogeneous patterns of virtually any possible geometry with a nearly unlimited number of degrees of freedom. We have used these arrays to explore how the geometric organization of the extracellular matrix (ECM) binding ligand RGD (Arg-Gly-Asp) affects cell adhesion and spreading. Systematic variation of spacing, density and cluster size of individual integrin binding sites was used to elicit different cell behavior. Cell spreading assays on arrays of different geometric arrangements revealed a dramatic increase in spreading efficiency when at least 4 liganded sites were spaced within 60 nm or less, with no dependence on global density. This points to the existence of a minimal matrix adhesion unit for fibronectin defined in space and stoichiometry. Developing an understanding of the ECM geometries that activate specific cellular functional complexes is a critical step toward controlling cell behavior. Potential practical applications range from new therapeutic treatments to the rational design of tissue scaffolds that can optimize healing without scarring. More broadly, spatial control at the single-molecule level can elucidate factors controlling individual molecular interactions and can enable synthesis of new systems based on molecular-scale architectures. PMID:21319842

  5. Mutational studies reveal a complex set of positive and negative control elements within the chicken vitellogenin II promoter.

    PubMed

    Seal, S N; Davis, D L; Burch, J B

    1991-05-01

    The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.

  6. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  7. Theoretical modeling of masking DNA application in aptamer-facilitated biomarker discovery.

    PubMed

    Cherney, Leonid T; Obrecht, Natalia M; Krylov, Sergey N

    2013-04-16

    In aptamer-facilitated biomarker discovery (AptaBiD), aptamers are selected from a library of random DNA (or RNA) sequences for their ability to specifically bind cell-surface biomarkers. The library is incubated with intact cells, and cell-bound DNA molecules are separated from those unbound and amplified by the polymerase chain reaction (PCR). The partitioning/amplification cycle is repeated multiple times while alternating target cells and control cells. Efficient aptamer selection in AptaBiD relies on the inclusion of masking DNA within the cell and library mixture. Masking DNA lacks primer regions for PCR amplification and is typically taken in excess to the library. The role of masking DNA within the selection mixture is to outcompete any nonspecific binding sequences within the initial library, thus allowing specific DNA sequences (i.e., aptamers) to be selected more efficiently. Efficient AptaBiD requires an optimum ratio of masking DNA to library DNA, at which aptamers still bind specific binding sites but nonaptamers within the library do not bind nonspecific binding sites. Here, we have developed a mathematical model that describes the binding processes taking place within the equilibrium mixture of masking DNA, library DNA, and target cells. An obtained mathematical solution allows one to estimate the concentration of masking DNA that is required to outcompete the library DNA at a desirable ratio of bound masking DNA to bound library DNA. The required concentration depends on concentrations of the library and cells as well as on unknown cell characteristics. These characteristics include the concentration of total binding sites on the cell surface, N, and equilibrium dissociation constants, K(nsL) and K(nsM), for nonspecific binding of the library DNA and masking DNA, respectively. We developed a theory that allows the determination of N, K(nsL), and K(nsM) based on measurements of EC50 values for cells mixed separately with the library and masking DNA (EC50 is the concentration of fluorescently labeled DNA at which half of the maximum fluorescence signal from DNA-bound cells is reached). We also obtained expressions for signals from bound DNA (measured by flow cytometry) in terms of N, K(nsL), and K(nsM). These expressions can be used for the verification of N, K(nsL), and K(nsM) values found from EC50 measurements. The developed procedure was applied to MCF-7 breast cancer cells, and corresponding values of N, K(nsL), and K(nsM) were established for the first time. The concentration of masking DNA required for AptaBiD with MCF-7 breast cancer cells was also estimated.

  8. Alcohol binding in the C1 (C1A + C1B) domain of protein kinase C epsilon

    PubMed Central

    Pany, Satyabrata; Das, Joydip

    2015-01-01

    Background Alcohol regulates the expression and function of protein kinase C epsilon (PKCε). In a previous study we identified an alcohol binding site in the C1B, one of the twin C1 subdomains of PKCε. Methods In this study, we investigated alcohol binding in the entire C1 domain (combined C1A and C1B) of PKCε. Fluorescent phorbol ester, SAPD and fluorescent diacylglycerol (DAG) analog, dansyl-DAG were used to study the effect of ethanol, butanol, and octanol on the ligand binding using fluorescence resonance energy transfer (FRET). To identify alcohol binding site(s), PKCεC1 was photolabeled with 3-azibutanol and 3-azioctanol, and analyzed by mass spectrometry. The effects of alcohols and the azialcohols on PKCε were studied in NG108-15 cells. Results In the presence of alcohol, SAPD and dansyl-DAG showed different extent of FRET, indicating differential effects of alcohol on the C1A and C1B subdomains. Effects of alcohols and azialcohols on PKCε in NG108-15 cells were comparable. Azialcohols labeled Tyr-176 of C1A and Tyr-250 of C1B. Inspection of the model structure of PKCεC1 reveals that these residues are 40 Å apart from each other indicating that these residues form two different alcohol binding sites. Conclusions The present results provide evidence for the presence of multiple alcohol-binding sites on PKCε and underscore the importance of targeting this PKC isoform in developing alcohol antagonists. PMID:26210390

  9. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

    PubMed Central

    Glinsky, Gennadi V.

    2015-01-01

    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions such as cancer, diseases of cardiovascular and reproductive systems, metabolic diseases, multiple neurological and psychological disorders. A proximity placement model is proposed explaining how a 33–47% excess of NANOG, CTCF, and POU5F1 proteins immobilized on a DNA scaffold may play a functional role at distal regulatory elements. PMID:25956794

  10. Botulinum neurotoxin serotype D attacks neurons via two carbohydrate-binding sites in a ganglioside-dependent manner.

    PubMed

    Strotmeier, Jasmin; Lee, Kwangkook; Völker, Anne K; Mahrhold, Stefan; Zong, Yinong; Zeiser, Johannes; Zhou, Jie; Pich, Andreas; Bigalke, Hans; Binz, Thomas; Rummel, Andreas; Jin, Rongsheng

    2010-10-15

    The extraordinarily high toxicity of botulinum neurotoxins primarily results from their specific binding and uptake into neurons. At motor neurons, the seven BoNT (botulinum neurotoxin) serotypes A-G inhibit acetylcholine release leading to flaccid paralysis. Uptake of BoNT/A, B, E, F and G requires a dual interaction with gangliosides and the synaptic vesicle proteins synaptotagmin or SV2 (synaptic vesicle glycoprotein 2), whereas little is known about the cell entry mechanisms of the serotypes C and D, which display the lowest amino acid sequence identity compared with the other five serotypes. In the present study we demonstrate that the neurotoxicity of BoNT/D depends on the presence of gangliosides by employing phrenic nerve hemidiaphragm preparations derived from mice expressing the gangliosides GM3, GM2, GM1 and GD1a, or only GM3 [a description of our use of ganglioside nomenclature is given in Svennerholm (1994) Prog. Brain Res. 101, XI-XIV]. High-resolution crystal structures of the 50 kDa cell-binding domain of BoNT/D alone and in complex with sialic acid, as well as biological analyses of single-site BoNT/D mutants identified two carbohydrate-binding sites. One site is located at a position previously identified in BoNT/A, B, E, F and G, but is lacking the conserved SXWY motif. The other site, co-ordinating one molecule of sialic acid, resembles the second ganglioside-binding pocket (the sialic-acid-binding site) of TeNT (tetanus neurotoxin).

  11. Involvement of the N-terminal part of cyclophilin B in the interaction with specific Jurkat T-cell binding sites.

    PubMed

    Mariller, C; Haendler, B; Allain, F; Denys, A; Spik, G

    1996-07-15

    Cyclophilin B (CyPB) is secreted in biological fluids such as blood or milk and binds to a specific receptor present on the human lymphoblastic cell line Jurkat and on human peripheral blood lymphocytes. This study was intended to specify the areas of CyPB that are involved in the interaction with the receptor. A synthetic peptide corresponding to the first 24 N-terminal amino acid residues of CyPB was shown to specifically recognize the receptor. Moreover, modification of Arg18 of CyPB by p-hydroxyphenlglyoxal led to a dramatic loss of affinity for the receptor. However, when this residue was replaced by an alanine residue using site-directed mutagenesis, no modification of the binding properties was found, suggesting that Arg18 is not directly involved but is sufficiently close to the interaction site to interfere with the binding when modified. Competitive binding experiments using a chimaeric protein made up of the 24 N-terminal amino acid residues of CyPB fused to the cyclophilin A core sequence confirmed the involvement of this region of CyPB in receptor binding.

  12. Directing stem cell trafficking via GPS.

    PubMed

    Sackstein, Robert

    2010-01-01

    The success of stem-cell-based regenerative therapeutics critically hinges on delivering relevant stem/progenitor cells to sites of tissue injury. To achieve adequate parenchymal infiltration following intravascular administration, it is first necessary that circulating cells bind to target tissue endothelium with sufficient strength to overcome the prevailing forces of hemodynamic shear. The principal mediators of these shear-resistant binding interactions consist of a family of C-type lectins known as "selectins" that bind discrete sialofucosylated glycans on their respective ligands. One member of this family, E-selectin, is an endothelial molecule that is inducibly expressed on postcapillary venules at all sites of tissue injury, but is also constitutively expressed on the luminal surface of bone marrow and dermal microvascular endothelium. Most stem/progenitor cells express high levels of CD44, and, in particular, human hematopoietic stem cells express a specialized sialofucosylated glycoform of CD44 known as "hematopoietic cell E-/L-selectin ligand" (HCELL) that functions as a potent E-selectin ligand. This chapter describes a method called "glycosyltransferase-programmed stereosubstitution" (GPS) for custom-modifying CD44 glycans to create HCELL on the surface of living cells that natively lack HCELL. Ex vivo glycan engineering of HCELL via GPS licenses trafficking of infused cells to endothelial beds that express E-selectin, thereby enabling efficient vascular delivery of stem/progenitor cells to sites where they are needed. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  13. Impairment of Fas-ligand-caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death.

    PubMed

    Glukhova, Xenia A; Trizna, Julia A; Proussakova, Olga V; Gogvadze, Vladimir; Beletsky, Igor P

    2018-01-22

    Fas-ligand/CD178 belongs to the TNF family proteins and can induce apoptosis through death receptor Fas/CD95. The important requirement for Fas-ligand-dependent cell death induction is its localization to rafts, cholesterol- and sphingolipid-enriched micro-domains of membrane, involved in regulation of different signaling complexes. Here, we demonstrate that Fas-ligand physically associates with caveolin-1, the main protein component of rafts. Experiments with cells overexpressing Fas-ligand revealed a FasL N-terminal pre-prolin-rich region, which is essential for the association with caveolin-1. We found that the N-terminal domain of Fas-ligand bears two caveolin-binding sites. The first caveolin-binding site binds the N-terminal domain of caveolin-1, whereas the second one appears to interact with the C-terminal domain of caveolin-1. The deletion of both caveolin-binding sites in Fas-ligand impairs its distribution between cellular membranes, and attenuates a Fas-ligand-induced cytotoxicity. These results demonstrate that the interaction of Fas-ligand and caveolin-1 represents a molecular basis for Fas-ligand translocation to rafts, and the subsequent induction of Fas-ligand-dependent cell death. A possibility of a similar association between other TNF family members and caveolin-1 is discussed.

  14. Effects of guanyl nucleotides on CCKB receptor binding in brain tissue and continuous cell lines: a comparative study.

    PubMed

    Kaufmann, R; Schöneberg, T; Henklein, P; Meyer, R; Martin, H; Ott, T

    1995-07-01

    The effects of non-hydrolyzable guanyl nucleotide analogue GTP-gamma S on CCKB receptor binding in human and guinea-pig cortex, Jurkat T-cells, rat pituitary GH3 cells, rat glioma C6 cells and human small cell lung cancer NCI-H69 cells were investigated by using [3H]CCK-8S saturation and competition binding studies. GTP-gamma S caused inhibition of specific [3H]CCK-8S binding in a concentration dependent manner with a plateau at 10-25 microM. 25 microM GTP-gamma S resulted in a small but significant increase in Kd and IC50 values with amount very similar in all CCKB receptor models tested. However, the maximal number of specific [3H]CCK-8S binding sites (Bmax) was unaffected. Results suggest that CCKB receptors are G-protein coupled in a similar way to human and guinea-pig cortex, Jurkat cells, GH3 cells, C6 cells and NCI-H69 cells.

  15. The binding of calcium ions by erythrocytes and `ghost'-cell membranes

    PubMed Central

    Long, C.; Mouat, Barbara

    1971-01-01

    1. Washed human erythrocytes, suspended in iso-osmotic sucrose containing 2.5mm-calcium chloride, bind about 400μg-atoms of calcium/litre of packed cells. Sucrose may be replaced by other sugars. 2. Partial replacement of sucrose by iso-osmotic potassium chloride diminishes the uptake of calcium, 50% inhibition occurring at about 50mm-potassium chloride. 3. Other univalent cations behave like potassium, whereas bivalent cations are much more inhibitory. The tervalent cations, yttrium and lanthanum, however, are the most effective inhibitors of calcium uptake. 4. An approximate correlation exists between the calcium uptake and the sialic acid content of erythrocytes of various species and of human erythrocytes that have been partially depleted of sialic acid by treatment with neuraminidase. However, even after complete removal of sialic acid, human erythrocytes still bind about 140μg-atoms of calcium/litre of packed cells. 5. A Scatchard (1949) plot of calcium uptake at various Ca2+ concentrations in the suspending media shows the presence of three different binding sites on the external surface of the human erythrocyte membrane. 6. Erythrocyte `ghost' cells, the membranes of which appear to be permeable to Ca2+ ions, can bind about 1000μg-atoms of calcium per `ghost'-cell equivalent of 1 litre of packed erythrocytes. This indicates that there are also binding sites for calcium on the internal surface of the erythrocyte membrane. PMID:5124387

  16. Tissue Elasticity Regulated Tumor Gene Expression: Implication for Diagnostic Biomarkers of Primitive Neuroectodermal Tumor

    PubMed Central

    Vu, Long T.; Keschrumrus, Vic; Zhang, Xi; Zhong, Jiang F.; Su, Qingning; Kabeer, Mustafa H.; Loudon, William G.; Li, Shengwen Calvin

    2015-01-01

    Background The tumor microenvironment consists of both physical and chemical factors. Tissue elasticity is one physical factor contributing to the microenvironment of tumor cells. To test the importance of tissue elasticity in cell culture, primitive neuroectodermal tumor (PNET) stem cells were cultured on soft polyacrylamide (PAA) hydrogel plates that mimics the elasticity of brain tissue compared with PNET on standard polystyrene (PS) plates. We report the molecular profiles of PNET grown on either PAA or PS. Methodology/Principal Findings A whole-genome microarray profile of transcriptional expression between the two culture conditions was performed as a way to probe effects of substrate on cell behavior in culture. The results showed more genes downregulated on PAA compared to PS. This led us to propose microRNA (miRNA) silencing as a potential mechanism for downregulation. Bioinformatic analysis predicted a greater number of miRNA binding sites from the 3' UTR of downregulated genes and identified as specific miRNA binding sites that were enriched when cells were grown on PAA—this supports the hypothesis that tissue elasticity plays a role in influencing miRNA expression. Thus, Dicer was examined to determine if miRNA processing was affected by tissue elasticity. Dicer genes were downregulated on PAA and had multiple predicted miRNA binding sites in its 3' UTR that matched the miRNA binding sites found enriched on PAA. Many differentially regulated genes were found to be present on PS but downregulated on PAA were mapped onto intron sequences. This suggests expression of alternative polyadenylation sites within intron regions that provide alternative 3' UTRs and alternative miRNA binding sites. This results in tissue specific transcriptional downregulation of mRNA in humans by miRNA. We propose a mechanism, driven by the physical characteristics of the microenvironment by which downregulation of genes occur. We found that tissue elasticity-mediated cytokines (TGFβ2 and TNFα) signaling affect expression of ECM proteins. Conclusions Our results suggest that tissue elasticity plays important roles in miRNA expression, which, in turn, regulate tumor growth or tumorigenicity. PMID:25774514

  17. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  18. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  19. Effect of single point mutations of the human tachykinin NK1 receptor on antagonist affinity.

    PubMed

    Lundstrom, K; Hawcock, A B; Vargas, A; Ward, P; Thomas, P; Naylor, A

    1997-10-15

    Molecular modelling and site-directed mutagenesis were used to identify eleven amino acid residues which may be involved in antagonist binding of the human tachykinin NK1 receptor. Recombinant receptors were expressed in mammalian cells using the Semliki Forest virus system. Wild type and mutant receptors showed similar expression levels in BHK and CHO cells, verified by metabolic labelling. Binding affinities were determined for a variety of tachykinin NK1 receptor antagonists in SFV-infected CHO cells. The binding affinity for GR203040, CP 99,994 and CP 96,345 was significantly reduced by mutant Q165A. The mutant F268A significantly reduced the affinity for GR203040 and CP 99,994 and the mutant H197A had reduced affinity for CP 96,345. All antagonists seemed to bind in a similar region of the receptor, but do not all rely on the same binding site interactions. Functional coupling to G-proteins was assayed by intracellular Ca2+ release in SFV-infected CHO cells. The wild type receptor and all mutants except A162L and F268A responded to substance P stimulation.

  20. High-Affinity Low-Capacity and Low-Affinity High-Capacity N-Acetyl-2-Aminofluorene (AAF) Macromolecular Binding Sites Are Revealed During the Growth Cycle of Adult Rat Hepatocytes in Primary Culture.

    PubMed

    Koch, Katherine S; Moran, Tom; Shier, W Thomas; Leffert, Hyam L

    2018-05-01

    Long-term cultures of primary adult rat hepatocytes were used to study the effects of N-acetyl-2-aminofluorene (AAF) on hepatocyte proliferation during the growth cycle; on the initiation of hepatocyte DNA synthesis in quiescent cultures; and, on hepatocyte DNA replication following the initiation of DNA synthesis. Scatchard analyses were used to identify the pharmacologic properties of radiolabeled AAF metabolite binding to hepatocyte macromolecules. Two classes of growth cycle-dependent AAF metabolite binding sites-a high-affinity low-capacity site (designated Site I) and a low-affinity high-capacity site (designated Site II)-associated with two spatially distinct classes of macromolecular targets, were revealed. Based upon radiolabeled AAF metabolite binding to purified hepatocyte genomic DNA or to DNA, RNA, proteins, and lipids from isolated nuclei, Site IDAY 4 targets (KD[APPARENT] ≈ 2-4×10-6 M and BMAX[APPARENT] ≈ 6 pmol/106 cells/24 h) were consistent with genomic DNA; and with AAF metabolized by a nuclear cytochrome P450. Based upon radiolabeled AAF binding to total cellular lysates, Site IIDAY 4 targets (KD[APPARENT] ≈ 1.5×10-3 M and BMAX[APPARENT] ≈ 350 pmol/106 cells/24 h) were consistent with cytoplasmic proteins; and with AAF metabolized by cytoplasmic cytochrome P450s. DNA synthesis was not inhibited by concentrations of AAF that saturated DNA binding in the neighborhood of the Site I KD. Instead, hepatocyte DNA synthesis inhibition required higher concentrations of AAF approaching the Site II KD. These observations raise the possibility that carcinogenic DNA adducts derived from AAF metabolites form below concentrations of AAF that inhibit replicative and repair DNA synthesis.

  1. The selectivity of receptor tyrosine kinase signaling is controlled by a secondary SH2 domain binding site.

    PubMed

    Bae, Jae Hyun; Lew, Erin Denise; Yuzawa, Satoru; Tomé, Francisco; Lax, Irit; Schlessinger, Joseph

    2009-08-07

    SH2 domain-mediated interactions represent a crucial step in transmembrane signaling by receptor tyrosine kinases. SH2 domains recognize phosphotyrosine (pY) in the context of particular sequence motifs in receptor phosphorylation sites. However, the modest binding affinity of SH2 domains to pY containing peptides may not account for and likely represents an oversimplified mechanism for regulation of selectivity of signaling pathways in living cells. Here we describe the crystal structure of the activated tyrosine kinase domain of FGFR1 in complex with a phospholipase Cgamma fragment. The structural and biochemical data and experiments with cultured cells show that the selectivity of phospholipase Cgamma binding and signaling via activated FGFR1 are determined by interactions between a secondary binding site on an SH2 domain and a region in FGFR1 kinase domain in a phosphorylation independent manner. These experiments reveal a mechanism for how SH2 domain selectivity is regulated in vivo to mediate a specific cellular process.

  2. Structural analysis of the receptor binding domain of botulinum neurotoxin serotype D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yanfeng; Buchko, Garry W.; Qin, Lin

    2010-10-28

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65 Å resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences aremore » located at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10 Å relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

  3. Structural Analysis of the Receptor Binding Domain of Botulinum Neurotoxin Serotype D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Y Zhang; G Buchko; L Qin

    2011-12-31

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65{angstrom} resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences are locatedmore » at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10{angstrom} relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

  4. Identification of high-confidence RNA regulatory elements by combinatorial classification of RNA-protein binding sites.

    PubMed

    Li, Yang Eric; Xiao, Mu; Shi, Binbin; Yang, Yu-Cheng T; Wang, Dong; Wang, Fei; Marcia, Marco; Lu, Zhi John

    2017-09-08

    Crosslinking immunoprecipitation sequencing (CLIP-seq) technologies have enabled researchers to characterize transcriptome-wide binding sites of RNA-binding protein (RBP) with high resolution. We apply a soft-clustering method, RBPgroup, to various CLIP-seq datasets to group together RBPs that specifically bind the same RNA sites. Such combinatorial clustering of RBPs helps interpret CLIP-seq data and suggests functional RNA regulatory elements. Furthermore, we validate two RBP-RBP interactions in cell lines. Our approach links proteins and RNA motifs known to possess similar biochemical and cellular properties and can, when used in conjunction with additional experimental data, identify high-confidence RBP groups and their associated RNA regulatory elements.

  5. Actin Family Proteins in the Human INO80 Chromatin Remodeling Complex Exhibit Functional Roles in the Induction of Heme Oxygenase-1 with Hemin.

    PubMed

    Takahashi, Yuichiro; Murakami, Hirokazu; Akiyama, Yusuke; Katoh, Yasutake; Oma, Yukako; Nishijima, Hitoshi; Shibahara, Kei-Ichi; Igarashi, Kazuhiko; Harata, Masahiko

    2017-01-01

    Nuclear actin family proteins, comprising of actin and actin-related proteins (Arps), are essential functional components of the multiple chromatin remodeling complexes. The INO80 chromatin remodeling complex, which is evolutionarily conserved and has roles in transcription, DNA replication and repair, consists of actin and actin-related proteins Arp4, Arp5, and Arp8. We generated Arp5 knockout (KO) and Arp8 KO cells from the human Nalm-6 pre-B cell line and used these KO cells to examine the roles of Arp5 and Arp8 in the transcriptional regulation mediated by the INO80 complex. In both of Arp5 KO and Arp8 KO cells, the oxidative stress-induced expression of HMOX1 gene, encoding for heme oxygenase-1 (HO-1), was significantly impaired. Consistent with these observations, chromatin immunoprecipitation (ChIP) assay revealed that oxidative stress caused an increase in the binding of the INO80 complex to the regulatory sites of HMOX1 in wild-type cells. The binding of INO80 complex to chromatin was reduced in Arp8 KO cells compared to that in the wild-type cells. On the other hand, the binding of INO80 complex to chromatin in Arp5 KO cells was similar to that in the wild-type cells even under the oxidative stress condition. However, both remodeling of chromatin at the HMOX1 regulatory sites and binding of a transcriptional activator to these sites were impaired in Arp5 KO cells, indicating that Arp5 is required for the activation of the INO80 complex. Collectively, these results suggested that these nuclear Arps play indispensable roles in the function of the INO80 chromatin remodeling complex.

  6. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  7. Conformational epitopes at cadherin calcium-binding sites and p120-catenin phosphorylation regulate cell adhesion

    PubMed Central

    Petrova, Yuliya I.; Spano, MarthaJoy M.; Gumbiner, Barry M.

    2012-01-01

    We investigated changes in cadherin structure at the cell surface that regulate its adhesive activity. Colo 205 cells are nonadhesive cells with a full but inactive complement of E-cadherin–catenin complexes at the cell surface, but they can be triggered to adhere and form monolayers. We were able to distinguish the inactive and active states of E-cadherin at the cell surface by using a special set of monoclonal antibodies (mAbs). Another set of mAbs binds E-cadherin and strongly activates adhesion. In other epithelial cell types these activating mAbs inhibit growth factor–induced down-regulation of adhesion and epithelial morphogenesis, indicating that these phenomena are also controlled by E-cadherin activity at the cell surface. Both types of mAbs recognize conformational epitopes at different interfaces between extracellular cadherin repeat domains (ECs), especially near calcium-binding sites. Activation also induces p120-catenin dephosphorylation, as well as changes in the cadherin cytoplasmic domain. Moreover, phospho-site mutations indicate that dephosphorylation of specific Ser/Thr residues in the N-terminal domain of p120-catenin mediate adhesion activation. Thus physiological regulation of the adhesive state of E-cadherin involves physical and/or conformational changes in the EC interface regions of the ectodomain at the cell surface that are mediated by catenin-associated changes across the membrane. PMID:22513089

  8. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Rapid characterization of a novel taspine derivative-HMQ1611 binding to EGFR by a cell membrane chromatography method.

    PubMed

    Du, Hui; Lv, Nan; Wang, Sicen; He, Langchong

    2013-05-01

    A new high-expression endothelial growth factor receptor (EGFR) cell membrane chromatography (CMC) method was applied to recognize the ligands acting on EGFR specifically, and investigate the affinity of gefitinib/HMQ1611 to EGFR. In the self and direct competitive assay, gefitinib/HMQ1611 was used as a competitor in the mobile phase to evaluate the effect of the competitor's concentrations on the retention of the ligands, respectively, and the competition between gefitinib and HMQ1611 binding to EGFR was also been examined. The retention behavior indicated that gefitinib had one type of binding sites on the EGFR, and the equilibrium dissociation constant (K(D)) was (9.11 ± 1.89) × 10(-6) M; HMQ1611 had two major binding regions on the EGFR, and the K(D) values obtained from the model were (2.39 ± 0.33) × 10(-7) and (3.87 ± 0.93) × 10(-5) M for HMQ1611 at the high- and low-affinity sites, respectively. The competition between gefitinib and HMQ1611 occurred at the low-affinity sites on the EGFR. The low-affinity sites were of higher concentrations and contributed to a much larger part of retention of HMQ1611. The results suggested that gefitinib and HMQ1611 competed for the common binding sites on the EGFR, no matter the ligand was used as an analyte or a competitor.

  10. Hormone induces binding of receptors and transcription factors to a rearranged nucleosome on the MMTV promoter in vivo.

    PubMed Central

    Truss, M; Bartsch, J; Schelbert, A; Haché, R J; Beato, M

    1995-01-01

    Hormonal induction of the mouse mammary tumour virus (MMTV) promoter is mediated by interactions between hormone receptors and other transcription factors bound to a complex array of sites. Previous results suggested that access to these sites is modulated by their precise organization into a positioned regulatory nucleosome. Using genomic footprinting, we show that MMTV promoter DNA is rotationally phased in intact cells containing either episomal or chromosomally integrated proviral fragments. Prior to induction there is no evidence for factors bound to the promoter. Following progesterone induction of cells with high levels of receptor, genomic footprinting detects simultaneous protection over the binding sites for hormone receptors, NF-I and the octamer binding proteins. Glucocorticoid or progestin induction leads to a characteristic chromatin remodelling that is independent of ongoing transcription. The centre of the regulatory nucleosome becomes more accessible to DNase I and restriction enzymes, but the limits of the nucleosome are unchanged and the 145 bp core region remains protected against micrococcal nuclease digestion. Thus, the nucleosome covering the MMTV promoter is neither removed nor shifted upon hormone induction, and all relevant transcription factors bind to the surface of the rearranged nucleosome. Since these factors cannot bind simultaneously to free DNA, maintainance of the nucleosome may be required for binding of factors to contiguous sites. Images PMID:7737125

  11. The juxtamembrane domain of the E-cadherin cytoplasmic tail contributes to its interaction with Myosin VI

    PubMed Central

    Mangold, Sabine; Norwood, Suzanne J.; Yap, Alpha S.; Collins, Brett M.

    2012-01-01

    We recently identified the atypical myosin, Myosin VI, as a component of epithelial cell-cell junctions that interacts with E-cadherin. Recombinant proteins bearing the cargo-binding domain of Myosin VI (Myo VI-CBD) or the cytoplasmic tail of E-cadherin can interact directly with one another. In this report we further investigate the molecular requirements of the interaction between Myo VI-CBD and E-cadherin combining truncation mutation analysis with in vitro binding assays. We report that a short (28 amino acid) juxtamembrane region of the cadherin cytoplasmic tail is sufficient to bind Myo VI-CBD. However, central regions of the cadherin tail adjacent to the juxtamembrane sequence also display binding activity for Myo VI-CBD. It is therefore possible that the cadherin tail bears two binding sites for Myosin VI, or an extended binding site that includes the juxtamembrane region. Nevertheless, our biochemical data highlight the capacity for the juxtamembrane region to interact with functionally-significant cytoplasmic proteins. PMID:23007415

  12. Caffeine inhibition of GLUT1 is dependent on the activation state of the transporter.

    PubMed

    Gunnink, Leesha K; Busscher, Brianna M; Wodarek, Jeremy A; Rosette, Kylee A; Strohbehn, Lauren E; Looyenga, Brendan D; Louters, Larry L

    2017-06-01

    Caffeine has been shown to be a robust uncompetitive inhibitor of glucose uptake in erythrocytes. It preferentially binds to the nucleotide-binding site on GLUT1 in its tetrameric form and mimics the inhibitory action of ATP. Here we demonstrate that caffeine is also a dose-dependent, uncompetitive inhibitor of 2-deoxyglucose (2DG) uptake in L929 fibroblasts. The inhibitory effect on 2DG uptake in these cells was reversible with a rapid onset and was additive to the competitive inhibitory effects of glucose itself, confirming that caffeine does not interfere with glucose binding. We also report for the first time that caffeine inhibition was additive to inhibition by curcumin, suggesting distinct binding sites for curcumin and caffeine. In contrast, caffeine inhibition was not additive to that of cytochalasin B, consistent with previous data that reported that these two inhibitors have overlapping binding sites. More importantly, we show that the magnitude of maximal caffeine inhibition in L929 cells is much lower than in erythrocytes (35% compared to 90%). Two epithelial cell lines, HCLE and HK2, have both higher concentrations of GLUT1 and increased basal 2DG uptake (3-4 fold) compared to L929 cells, and subsequently display greater maximal inhibition by caffeine (66-70%). Interestingly, activation of 2DG uptake (3-fold) in L929 cells by glucose deprivation shifted the responsiveness of these cells to caffeine inhibition (35%-70%) without a change in total GLUT1 concentration. These data indicate that the inhibition of caffeine is dependent on the activity state of GLUT1, not merely on the concentration. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  13. Multipoint Binding of the SLP-76 SH2 Domain to ADAP Is Critical for Oligomerization of SLP-76 Signaling Complexes in Stimulated T Cells

    PubMed Central

    Coussens, Nathan P.; Hayashi, Ryo; Brown, Patrick H.; Balagopalan, Lakshmi; Balbo, Andrea; Akpan, Itoro; Houtman, Jon C. D.; Barr, Valarie A.; Schuck, Peter; Appella, Ettore

    2013-01-01

    The adapter molecules SLP-76 and LAT play central roles in T cell activation by recruiting enzymes and other adapters into multiprotein complexes that coordinate highly regulated signal transduction pathways. While many of the associated proteins have been characterized, less is known concerning the mechanisms of assembly for these dynamic and potentially heterogeneous signaling complexes. Following T cell receptor (TCR) stimulation, SLP-76 is found in structures called microclusters, which contain many signaling complexes. Previous studies showed that a mutation to the SLP-76 C-terminal SH2 domain nearly abolished SLP-76 microclusters, suggesting that the SH2 domain facilitates incorporation of signaling complexes into microclusters. S. C. Bunnell, A. L. Singer, D. I. Hong, B. H. Jacque, M. S. Jordan, M. C. Seminario, V. A. Barr, G. A. Koretzky, and L. E. Samelson, Mol. Cell. Biol., 26:7155–7166, 2006). Using biophysical methods, we demonstrate that the adapter, ADAP, contains three binding sites for SLP-76, and that multipoint binding to ADAP fragments oligomerizes the SLP-76 SH2 domain in vitro. These results were complemented with confocal imaging and functional studies of cells expressing ADAP with various mutations. Our results demonstrate that all three binding sites are critical for SLP-76 microcluster assembly, but any combination of two sites will partially induce microclusters. These data support a model whereby multipoint binding of SLP-76 to ADAP facilitates the assembly of SLP-76 microclusters. This model has implications for the regulation of SLP-76 and LAT microclusters and, as a result, T cell signaling. PMID:23979596

  14. Multipoint binding of the SLP-76 SH2 domain to ADAP is critical for oligomerization of SLP-76 signaling complexes in stimulated T cells.

    PubMed

    Coussens, Nathan P; Hayashi, Ryo; Brown, Patrick H; Balagopalan, Lakshmi; Balbo, Andrea; Akpan, Itoro; Houtman, Jon C D; Barr, Valarie A; Schuck, Peter; Appella, Ettore; Samelson, Lawrence E

    2013-11-01

    The adapter molecules SLP-76 and LAT play central roles in T cell activation by recruiting enzymes and other adapters into multiprotein complexes that coordinate highly regulated signal transduction pathways. While many of the associated proteins have been characterized, less is known concerning the mechanisms of assembly for these dynamic and potentially heterogeneous signaling complexes. Following T cell receptor (TCR) stimulation, SLP-76 is found in structures called microclusters, which contain many signaling complexes. Previous studies showed that a mutation to the SLP-76 C-terminal SH2 domain nearly abolished SLP-76 microclusters, suggesting that the SH2 domain facilitates incorporation of signaling complexes into microclusters. S. C. Bunnell, A. L. Singer, D. I. Hong, B. H. Jacque, M. S. Jordan, M. C. Seminario, V. A. Barr, G. A. Koretzky, and L. E. Samelson, Mol. Cell. Biol., 26:7155-7166, 2006). Using biophysical methods, we demonstrate that the adapter, ADAP, contains three binding sites for SLP-76, and that multipoint binding to ADAP fragments oligomerizes the SLP-76 SH2 domain in vitro. These results were complemented with confocal imaging and functional studies of cells expressing ADAP with various mutations. Our results demonstrate that all three binding sites are critical for SLP-76 microcluster assembly, but any combination of two sites will partially induce microclusters. These data support a model whereby multipoint binding of SLP-76 to ADAP facilitates the assembly of SLP-76 microclusters. This model has implications for the regulation of SLP-76 and LAT microclusters and, as a result, T cell signaling.

  15. Bacterial SPOR domains are recruited to septal peptidoglycan by binding to glycan strands that lack stem peptides

    PubMed Central

    Yahashiri, Atsushi; Jorgenson, Matthew A.; Weiss, David S.

    2015-01-01

    Bacterial SPOR domains bind peptidoglycan (PG) and are thought to target proteins to the cell division site by binding to “denuded” glycan strands that lack stem peptides, but uncertainties remain, in part because septal-specific binding has yet to be studied in a purified system. Here we show that fusions of GFP to SPOR domains from the Escherichia coli cell-division proteins DamX, DedD, FtsN, and RlpA all localize to septal regions of purified PG sacculi obtained from E. coli and Bacillus subtilis. Treatment of sacculi with an amidase that removes stem peptides enhanced SPOR domain binding, whereas treatment with a lytic transglycosylase that removes denuded glycans reduced SPOR domain binding. These findings demonstrate unequivocally that SPOR domains localize by binding to septal PG, that the physiologically relevant binding site is indeed a denuded glycan, and that denuded glycans are enriched in septal PG rather than distributed uniformly around the sacculus. Accumulation of denuded glycans in the septal PG of both E. coli and B. subtilis, organisms separated by 1 billion years of evolution, suggests that sequential removal of stem peptides followed by degradation of the glycan backbone is an ancient feature of PG turnover during bacterial cell division. Linking SPOR domain localization to the abundance of a structure (denuded glycans) present only transiently during biogenesis of septal PG provides a mechanism for coordinating the function of SPOR domain proteins with the progress of cell division. PMID:26305949

  16. Zinc induces exposure of hydrophobic sites in the C-terminal domain of gC1q-R/p33.

    PubMed

    Kumar, Rajeev; Peerschke, Ellinor I B; Ghebrehiwet, Berhane

    2002-09-01

    Endothelial cells and platelets are known to express gC1q-R on their surface. In addition to C1q, endothelial cell gC1q-R has been shown to bind high molecular weight kininogen (HK) and factor XII (FXII). However, unlike C1q, whose interaction with gC1q-R does not require divalent ions, the binding of HK to gC1q-R is absolutely dependent on the presence of zinc. However, the mechanism by which zinc modulates this interaction is not fully understood. To investigate the role of zinc, binding studies were done using the hydrophobic dye, bis-ANS. The fluorescence intensity of bis-ANS, greatly increases and the emission maximum is blue-shifted from 525 to 485nm upon binding to hydrophobic sites on proteins. In this report, we show that a blue-shift in emission maximum is also observed when bis-ANS binds to gC1q-R in the presence but not in the absence of zinc suggesting that zinc induces exposure of hydrophobic sites in the molecule. The binding of bis-ANS to gC1q-R is specific, dose-dependent, and reversible. In the presence of zinc, this binding is abrogated by monoclonal antibody 74.5.2 directed against gC1q-R residues 204-218. This segment of gC1q-R, which corresponds to the beta6 strand in the crystal structure, has been shown previously to be the binding site for HK. A similar trend in zinc-induced gC1q-R binding was also observed using the hydrophobic matrix octyl-Sepharose. Taken together, our data suggest that zinc can induce the exposure of hydrophobic sites in the C-terminal domain of gC1q-R involved in binding to HK/FXII.

  17. Trench-shaped binding sites promote multiple classes of interactions between collagen and the adherence receptors, alpha(1)beta(1) integrin and Staphylococcus aureus cna MSCRAMM.

    PubMed

    Rich, R L; Deivanayagam, C C; Owens, R T; Carson, M; Höök, A; Moore, D; Symersky, J; Yang, V W; Narayana, S V; Höök, M

    1999-08-27

    Most mammalian cells and some pathogenic bacteria are capable of adhering to collagenous substrates in processes mediated by specific cell surface adherence molecules. Crystal structures of collagen-binding regions of the human integrin alpha(2)beta(1) and a Staphylococcus aureus adhesin reveal a "trench" on the surface of both of these proteins. This trench can accommodate a collagen triple-helical structure and presumably represents the ligand-binding site (Emsley, J., King, S. L., Bergelson, J. M., and Liddington, R. C. (1997) J. Biol. Chem. 272, 28512-28517; Symersky, J., Patti, J. M., Carson, M., House-Pompeo, K., Teale, M., Moore, D., Jin, L., Schneider, A., DeLucas, L. J., Höök, M., and Narayana, S. V. L. (1997) Nat. Struct. Biol. 4, 833-838). We report here the crystal structure of the alpha subunit I domain from the alpha(1)beta(1) integrin. This collagen-binding protein also contains a trench on one face in which the collagen triple helix may be docked. Furthermore, we compare the collagen-binding mechanisms of the human alpha(1) integrin I domain and the A domain from the S. aureus collagen adhesin, Cna. Although the S. aureus and human proteins have unrelated amino acid sequences, secondary structure composition, and cation requirements for effective ligand binding, both proteins bind at multiple sites within one collagen molecule, with the sites in collagen varying in their affinity for the adherence molecule. We propose that (i) these evolutionarily dissimilar adherence proteins recognize collagen via similar mechanisms, (ii) the multisite, multiclass protein/ligand interactions observed in these two systems result from a binding-site trench, and (iii) this unusual binding mechanism may be thematic for proteins binding extended, rigid ligands that contain repeating structural motifs.

  18. Properties of Streptococcus mutans Grown in a Synthetic Medium: Binding of Glucosyltransferase and In Vitro Adherence, and Binding of Dextran/Glucan and Glycoprotein and Agglutination

    PubMed Central

    Wu-Yuan, Christine D.; Tai, Stella; Slade, Hutton D.

    1979-01-01

    The influence of culture media on various properties of Streptococcus mutans was investigated. Strains of S. mutans (serotypes c, d, f, and g) were grown in a complex medium (Todd-Hewitt broth [THB]) or a synthetic medium (SYN). The SYN cells, in contrast to THB cells, did not bind extracellular glucosyltransferase and did not produce in vitro adherence. Both types of cells possessed constitutive levels of glucosyltransferase. B13 cells grown in SYN plus invertase-treated glucose possessed the same level of constitutive enzyme as THB cells. In contrast to THB cells, the SYN cells of seven serotype strains did not agglutinate upon the addition of high-molecular-weight dextran/glucan. Significant quantities of lower-molecular-weight (2 × 104 or 7 × 104) dextran and B13 glucan were bound by SYN cells. SYN cells agglutinated weakly in anti-glucan serum (titers, 0 to 16), whereas THB cells possessed titers of 32 to 256. Evidence for the existence of a second binding site in agglutination which does not possess a glucan-like polymer has been obtained. B13 cells grown in invertase-treated THB agglutinated to the same degree as normal THB cells. The nature of this site is unknown. SYN cells possess the type-specific polysaccharide antigen. B13 cells did not bind from THB a glycoprotein which reacts with antisera to the A, B, or T blood group antigens or which allows agglutination upon the addition of dextran. The results demonstrate that S. mutans grown in a chemically defined medium possesse markedly different biochemical and biological activities than cells grown in a complex organic medium. PMID:457252

  19. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  20. A universal surface complexation framework for modeling proton binding onto bacterial surfaces in geologic settings

    USGS Publications Warehouse

    Borrok, D.; Turner, B.F.; Fein, J.B.

    2005-01-01

    Adsorption onto bacterial cell walls can significantly affect the speciation and mobility of aqueous metal cations in many geologic settings. However, a unified thermodynamic framework for describing bacterial adsorption reactions does not exist. This problem originates from the numerous approaches that have been chosen for modeling bacterial surface protonation reactions. In this study, we compile all currently available potentiometric titration datasets for individual bacterial species, bacterial consortia, and bacterial cell wall components. Using a consistent, four discrete site, non-electrostatic surface complexation model, we determine total functional group site densities for all suitable datasets, and present an averaged set of 'universal' thermodynamic proton binding and site density parameters for modeling bacterial adsorption reactions in geologic systems. Modeling results demonstrate that the total concentrations of proton-active functional group sites for the 36 bacterial species and consortia tested are remarkably similar, averaging 3.2 ?? 1.0 (1??) ?? 10-4 moles/wet gram. Examination of the uncertainties involved in the development of proton-binding modeling parameters suggests that ignoring factors such as bacterial species, ionic strength, temperature, and growth conditions introduces relatively small error compared to the unavoidable uncertainty associated with the determination of cell abundances in realistic geologic systems. Hence, we propose that reasonable estimates of the extent of bacterial cell wall deprotonation can be made using averaged thermodynamic modeling parameters from all of the experiments that are considered in this study, regardless of bacterial species used, ionic strength, temperature, or growth condition of the experiment. The average site densities for the four discrete sites are 1.1 ?? 0.7 ?? 10-4, 9.1 ?? 3.8 ?? 10-5, 5.3 ?? 2.1 ?? 10-5, and 6.6 ?? 3.0 ?? 10-5 moles/wet gram bacteria for the sites with pKa values of 3.1, 4.7, 6.6, and 9.0, respectively. It is our hope that this thermodynamic framework for modeling bacteria-proton binding reactions will also provide the basis for the development of an internally consistent set of bacteria-metal binding constants. 'Universal' constants for bacteria-metal binding reactions can then be used in conjunction with equilibrium constants for other important metal adsorption and complexation reactions to calculate the overall distribution of metals in realistic geologic systems.

  1. CENP-B binds a novel centromeric sequence in the Asian mouse Mus caroli.

    PubMed Central

    Kipling, D; Mitchell, A R; Masumoto, H; Wilson, H E; Nicol, L; Cooke, H J

    1995-01-01

    Minor satellite DNA, found at Mus musculus centromeres, is not present in the genome of the Asian mouse Mus caroli. This repetitive sequence family is speculated to have a role in centromere function by providing an array of binding sites for the centromere-associated protein CENP-B. The apparent absence of CENP-B binding sites in the M. caroli genome poses a major challenge to this hypothesis. Here we describe two abundant satellite DNA sequences present at M. caroli centromeres. These satellites are organized as tandem repeat arrays, over 1 Mb in size, of either 60- or 79-bp monomers. All autosomes carry both satellites and small amounts of a sequence related to the M. musculus major satellite. The Y chromosome contains small amounts of both major satellite and the 60-bp satellite, whereas the X chromosome carries only major satellite sequences. M. caroli chromosomes segregate in M. caroli x M. musculus interspecific hybrid cell lines, indicating that the two sets of chromosomes can interact with the same mitotic spindle. Using a polyclonal CENP-B antiserum, we demonstrate that M. caroli centromeres can bind murine CENP-B in such an interspecific cell line, despite the absence of canonical 17-bp CENP-B binding sites in the M. caroli genome. Sequence analysis of the 79-bp M. caroli satellite reveals a 17-bp motif that contains all nine bases previously shown to be necessary for in vitro binding of CENP-B. This M. caroli motif binds CENP-B from HeLa cell nuclear extract in vitro, as indicated by gel mobility shift analysis. We therefore suggest that this motif also causes CENP-B to associate with M. caroli centromeres in vivo. Despite the sequence differences, M. caroli presents a third, novel mammalian centromeric sequence producing an array of binding sites for CENP-B. PMID:7623797

  2. Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

    PubMed Central

    Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

    2016-01-01

    A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

  3. Mutant protein of recombinant human granulocyte colony-stimulating factor for receptor binding assay.

    PubMed

    Watanabe, M; Fukamachi, H; Uzumaki, H; Kabaya, K; Tsumura, H; Ishikawa, M; Matsuki, S; Kusaka, M

    1991-05-15

    A new mutant protein of recombinant human granulocyte colony-stimulating factor (rhG-CSF) was produced for the studies on receptors for human G-CSF. The mutant protein [(Tyr1, Tyr3]rhG-CSF), the biological activity of which was almost equal to that of rhG-CSF, was prepared by the replacement of threonine-1 and leucine-3 of rhG-CSF with tyrosine. The radioiodinated preparation of the mutant protein showed high specific radioactivity and retained full biological activity for at least 3 weeks. The binding capacity of the radioiodinated ligand was compared with that of [35S]rhG-CSF. Both radiolabeled ligands showed specific binding to murine bone marrow cells. Unlabeled rhG-CSF and human G-CSF purified from the culture supernatant of the human bladder carcinoma cell line 5637 equally competed for the binding of labeled rhG-CSFs in a dose-dependent manner, demonstrating that the sugar moiety of human G-CSF made no contribution to the binding of human G-CSF to target cells. In contrast, all other colony-stimulating factors and lymphokines examined did not affect the binding. Scatchard analysis of the specific binding of both labeled ligands revealed a single class of binding site with an apparent dissociation constant (Kd) of 20-30 pM and 100-200 maximal binding sites per cell. These data indicate that the radioiodinated preparation of the mutant protein binds the same specific receptor with the same affinity as [35S]rhG-CSF. The labeled mutant protein also showed specific binding to human circulating neutrophils.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. A novel role for the integrin-binding III-10 module in fibronectin matrix assembly.

    PubMed

    Hocking, D C; Smith, R K; McKeown-Longo, P J

    1996-04-01

    Fibronectin matrix assembly is a cell-dependent process which is upregulated in tissues at various times during development and wound repair to support the functions of cell adhesion, migration, and differentiation. Previous studies have demonstrated that the alpha 5 beta 1 integrin and fibronectin's amino terminus and III-1 module are important in fibronectin polymerization. We have recently shown that fibronectin's III-1 module contains a conformationally sensitive binding site for fibronectin's amino terminus (Hocking, D.C., J. Sottile, and P.J. McKeown-Longo. 1994. J. Biol. Chem. 269: 19183-19191). The present study was undertaken to define the relationship between the alpha 5 beta 1 integrin and fibronectin polymerization. Solid phase binding assays using recombinant III-10 and III-1 modules of human plasma fibronectin indicated that the III-10 module contains a conformation-dependent binding site for the III-1 module of fibronectin. Unfolded III-10 could support the formation of a ternary complex containing both III-1 and the amino-terminal 70-kD fragment, suggesting that the III-1 module can support the simultaneous binding of III-10 and 70 kD. Both unfolded III-10 and unfolded III-1 could support fibronectin binding, but only III-10 could promote the formation of disulfide-bonded multimers of fibronectin in the absence of cells. III-10-dependent multimer formation was inhibited by both the anti-III-1 monoclonal antibody, 9D2, and amino-terminal fragments of fibronectin. A fragment of III-10, termed III-10/A, was able to block matrix assembly in fibroblast monolayers. Similar results were obtained using the III-10A/RGE fragment, in which the RGD site had been mutated to RGE, indicating that III-I0/A was blocking matrix assembly by a mechanism distinct from disruption of integrin binding. Texas red-conjugated recombinant III-1,2 localized to beta 1-containing sites of focal adhesions on cells plated on fibronectin or the III-9,10 modules of fibronectin. Monoclonal antibodies against the III-1 or the III-9,10 modules of fibronectin blocked binding of III-1,2 to cells without disrupting focal adhesions. These data suggest that a role of the alpha 5 beta 1 integrin in matrix assembly is to regulate a series of sequential self-interactions which result in the polymerization of fibronectin.

  5. The Minimal Replicator of Epstein-Barr Virus oriP

    PubMed Central

    Yates, John L.; Camiolo, Sarah M.; Bashaw, Jacqueline M.

    2000-01-01

    oriP is a 1.7-kb region of the Epstein-Barr virus (EBV) chromosome that supports the replication and stable maintenance of plasmids in human cells. oriP contains two essential components, called the DS and the FR, both of which contain multiple binding sites for the EBV-encoded protein, EBNA-1. The DS appears to function as the replicator of oriP, while the FR acts in conjunction with EBNA-1 to prevent the loss of plasmids from proliferating cells. Because of EBNA-1's role in stabilizing plasmids through the FR, it has not been entirely clear to what extent EBNA-1 might be required for replication from oriP per se, and a recent study has questioned whether EBNA-1 has any direct role in replication. In the present study we found that plasmids carrying oriP required EBNA-1 to replicate efficiently even when assayed only 2 days after plasmids were introduced into the cell lines 143B and 293. Significantly, using 293 cells it was demonstrated that the plasmid-retention function of EBNA-1 and the FR did not contribute significantly to the accumulation of replicated plasmids, and the DS supported efficient EBNA-1-dependent replication in the absence of the FR. The DS contains two pairs of closely spaced EBNA-1 binding sites, and a previous study had shown that both sites within either pair are required for activity. However, it was unclear from previous work what additional sequences within the DS might be required. We found that each “half” of the DS, including a pair of closely spaced EBNA-1 binding sites, had significant replicator activity when the other half had been deleted. The only significant DNA sequences that the two halves of the DS share in common, other than EBNA-1 binding sites, is a 9-bp sequence that is present twice in the “left half” and once in the “right half.” These nonamer repeats, while not essential for activity, contributed significantly to the activity of each half of the DS. Two thymines occur at unique positions within EBNA-1 binding sites 1 and 4 at the DS and become sensitive to oxidation by permanganate when EBNA-1 binds, but mutation of each to the consensus base, adenine, actually improved the activity of each half of the DS slightly. In conclusion, the DS of oriP is an EBNA-1-dependent replicator, and its minimal active core appears to be simply two properly spaced EBNA-1 binding sites. PMID:10775587

  6. Perception of the plant immune signal salicylic acid

    PubMed Central

    Yan, Shunping; Dong, Xinnian

    2014-01-01

    Salicylic acid (SA) plays a central role in plant innate immunity. The diverse functions of this simple phenolic compound suggest that plants may have multiple SA receptors. Several SA-binding proteins have been identified using biochemical approaches. However, genetic evidence supporting that they are the bona fide SA receptors has not been forthcoming. Mutant screens revealed that NPR1 is a master regulator of SA-mediated responses. Although NPR1 cannot bind SA in a conventional ligand-binding assay, its homologs NPR3 and NPR4 bind SA and function as SA receptors. During pathogen challenge, the SA gradient generated at the infection site is sensed by NPR3 and NPR4, which serve as the adaptors for the Cullin 3-based E3 ubiquitin ligase to regulate NPR1 degradation. Consequently, NPR1 is degraded at the infection site to remove its inhibition on effector-triggered cell death and defense, whereas NPR1 accumulates in neighboring cells to promote cell survival and SA-mediated resistance. PMID:24840293

  7. The Lymphocyte Function–associated Antigen 1 I Domain Is a Transient Binding Module for Intercellular Adhesion Molecule (ICAM)-1 and ICAM-3 in Hydrodynamic Flow

    PubMed Central

    Knorr, Ruth; Dustin, Michael L.

    1997-01-01

    The I domain of lymphocyte function–associated antigen (LFA)-1 contains an intercellular adhesion molecule (ICAM)-1 and ICAM-3 binding site, but the relationship of this site to regulated adhesion is unknown. To study the adhesive properties of the LFA-1 I domain, we stably expressed a GPI-anchored form of this I domain (I-GPI) on the surface of baby hamster kidney cells. I-GPI cells bound soluble ICAM-1 (sICAM-1) with a low avidity and affinity. Flow cell experiments demonstrated a specific rolling interaction of I-GPI cells on bilayers containing purified full length ICAM-1 or ICAM-3. The LFA-1 activating antibody MEM-83, or its Fab fragment, decreased the rolling velocity of I-GPI cells on ICAM-1–containing membranes. In contrast, the interaction of I-GPI cells with ICAM-3 was blocked by MEM-83. Rolling of I-GPI cells was dependent on the presence of Mg2+. Mn2+ only partially substituted for Mg2+, giving rise to a small fraction of rolling cells and increased rolling velocity. This suggests that the I domain acts as a transient, Mg2+-dependent binding module that cooperates with another Mn2+-stimulated site in LFA-1 to give rise to the stable interaction of intact LFA-1 with ICAM-1. PMID:9271587

  8. Nicotine Induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    PubMed Central

    Wang, Tingting; Chen, Man; Liu, Lian; Cheng, Huaiyan; Yan, You-E; Feng, Ying-Hong; Wang, Hui

    2011-01-01

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a single site CpG methylation at nt −377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. PMID:21971485

  9. Direct induction of T lymphocyte-specific gene expression by the mammalian Notch signaling pathway

    PubMed Central

    Reizis, Boris; Leder, Philip

    2002-01-01

    The Notch signaling pathway regulates the commitment and early development of T lymphocytes. We studied Notch-mediated induction of the pre-T cell receptor α (pTa) gene, a T-cell-specific transcriptional target of Notch. The pTa enhancer was activated by Notch signaling and contained binding sites for its nuclear effector, CSL. Mutation of the CSL-binding sites abolished enhancer induction by Notch and delayed the up-regulation of pTa transgene expression during T cell lineage commitment. These results show a direct mechanism of stage- and tissue-specific gene induction by the mammalian Notch/CSL signaling pathway. PMID:11825871

  10. The Rickettsia Surface Cell Antigen 4 Applies Mimicry to Bind to and Activate Vinculin*

    PubMed Central

    Park, HaJeung; Lee, Jun Hyuck; Gouin, Edith; Cossart, Pascale; Izard, Tina

    2011-01-01

    Pathogenic Rickettsia species cause high morbidity and mortality, especially R. prowazekii, the causative agent of typhus. Like many intracellular pathogens, Rickettsia exploit the cytoskeleton to enter and spread within the host cell. Here we report that the cell surface antigen sca4 of Rickettsia co-localizes with vinculin in cells at sites of focal adhesions in sca4-transfected cells and that sca4 binds to and activates vinculin through two vinculin binding sites (VBSs) that are conserved across all Rickettsia. Remarkably, this occurs through molecular mimicry of the vinculin-talin interaction that is also seen with the IpaA invasin of the intracellular pathogen Shigella, where binding of these VBSs to the vinculin seven-helix bundle head domain (Vh1) displaces intramolecular interactions with the vinculin tail domain that normally clamp vinculin in an inactive state. Finally, the vinculin·sca4-VBS crystal structures reveal that vinculin adopts a new conformation when bound to the C-terminal VBS of sca4. Collectively, our data define the mechanism by which sca4 activates vinculin and interacts with the actin cytoskeleton, and they suggest important roles for vinculin in Rickettsia pathogenesis. PMID:21841197

  11. Selective inhibition of CTCF binding by iAs directs TET-mediated reprogramming of 5-hydroxymethylation patterns in iAs-transformed cells

    PubMed Central

    Rea, Matthew; Gripshover, Tyler; Fondufe-Mittendorf, Yvonne

    2017-01-01

    Methylation at cytosine (5mC) is a fundamental epigenetic DNA modification recently associated with iAs-mediated carcinogenesis. In contrast, the role of 5-hydroxymethylcytosine (5hmC), the oxidation product of 5mC in iAs-mediated carcinogenesis is unknown. Here we assess the hydroxymethylome in iAs-transformed cells, showing that dynamic modulation of hydroxymethylated DNA is associated with specific transcriptional networks. Moreover, this pathologic iAs-mediated carcinogenesis is characterized by a shift toward a higher hydroxymethylation pattern genome-wide. At specific promoters, hydroxymethylation correlated with increased gene expression. Furthermore, this increase in hydroxymethylation occurs concurrently with an upregulation of ten-eleven translocation (TET) enzymes that oxidize 5-methylcytosine (5mC) in DNA. To gain an understanding into how iAs might impact TET expression, we found that iAs inhibits the binding of CTCF at the proximal, weak CTCF binding sites of the TET1 and TET2 gene promoters and enhances CTCF binding at the stronger distal binding site. Further analyses suggest that this distal site acts as an enhancer, thus high CTCF occupancy at the enhancer region of TET1 and TET2 possibly drives their high expression in iAs-transformed cells. These results have major implications in understanding the impact of differential CTCF binding, genome architecture and its consequences in iAs-mediated pathogenesis. PMID:29175454

  12. Endothelial stress induces the release of vitamin D-binding protein, a novel growth factor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Raymond, Marc-Andre; Desormeaux, Anik; Labelle, Andree

    2005-12-23

    Endothelial cells (EC) under stress release paracrine mediators that facilitate accumulation of vascular smooth muscle cells (VSCM) at sites of vascular injury. We found that medium conditioned by serum-starved EC increase proliferation and migration of VSCM in vitro. Fractionation of the conditioned medium followed by mass spectral analysis identified one bioactive component as vitamin D-binding protein (DBP). DBP induced both proliferation and migration of VSMC in vitro in association with increased phosphorylation of ERK 1/2. PD 98059, a biochemical inhibitor of ERK 1/2, abrogated these proliferative and migratory responses in VSMC. DBP is an important carrier for the vitamin-D sterols,more » 25-hydroxyvitamin-D, and 1{alpha},25-dihydroxyvitamin-D. Both sterols inhibited the activity of DBP on VSMC, suggesting that vitamin D binding sites are important for initiating the activities of DBP on VSMC. Release of DBP at sites of endothelial injury represents a novel pathway favoring accumulation of VSMC at sites of vascular injury.« less

  13. The Rho ADP-ribosylating C3 exoenzyme binds cells via an Arg-Gly-Asp motif.

    PubMed

    Rohrbeck, Astrid; Höltje, Markus; Adolf, Andrej; Oms, Elisabeth; Hagemann, Sandra; Ahnert-Hilger, Gudrun; Just, Ingo

    2017-10-27

    The Rho ADP-ribosylating C3 exoenzyme (C3bot) is a bacterial protein toxin devoid of a cell-binding or -translocation domain. Nevertheless, C3 can efficiently enter intact cells, including neurons, but the mechanism of C3 binding and uptake is not yet understood. Previously, we identified the intermediate filament vimentin as an extracellular membranous interaction partner of C3. However, uptake of C3 into cells still occurs (although reduced) in the absence of vimentin, indicating involvement of an additional host cell receptor. C3 harbors an Arg-Gly-Asp (RGD) motif, which is the major integrin-binding site, present in a variety of integrin ligands. To check whether the RGD motif of C3 is involved in binding to cells, we performed a competition assay with C3 and RGD peptide or with a monoclonal antibody binding to β1-integrin subunit and binding assays in different cell lines, primary neurons, and synaptosomes with C3-RGD mutants. Here, we report that preincubation of cells with the GRGDNP peptide strongly reduced C3 binding to cells. Moreover, mutation of the RGD motif reduced C3 binding to intact cells and also to recombinant vimentin. Anti-integrin antibodies also lowered the C3 binding to cells. Our results indicate that the RGD motif of C3 is at least one essential C3 motif for binding to host cells and that integrin is an additional receptor for C3 besides vimentin. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Alternative Polyadenylation Regulates CELF1/CUGBP1 Target Transcripts Following T Cell Activation

    PubMed Central

    Beisang, Daniel; Reilly, Cavan; Bohjanen, Paul R.

    2014-01-01

    Alternative polyadenylation (APA) is an evolutionarily conserved mechanism for regulating gene expression. Transcript 3′ end shortening through changes in polyadenylation site usage occurs following T cell activation, but the consequences of APA on gene expression are poorly understood. We previously showed that GU-rich elements (GREs) found in the 3′ untranslated regions of select transcripts mediate rapid mRNA decay by recruiting the protein CELF1/CUGBP1. Using a global RNA sequencing approach, we found that a network of CELF1 target transcripts involved in cell division underwent preferential 3′ end shortening via APA following T cell activation, resulting in decreased inclusion of CELF1 binding sites and increased transcript expression. We present a model whereby CELF1 regulates APA site selection following T cell activation through reversible binding to nearby GRE sequences. These findings provide insight into the role of APA in controlling cellular proliferation during biological processes such as development, oncogenesis and T cell activation PMID:25123787

  15. Snake Cytotoxins Bind to Membranes via Interactions with Phosphatidylserine Head Groups of Lipids

    PubMed Central

    Konshina, Anastasia G.; Boldyrev, Ivan A.; Utkin, Yuri N.; Omel'kov, Anton V.; Efremov, Roman G.

    2011-01-01

    The major representatives of Elapidae snake venom, cytotoxins (CTs), share similar three-fingered fold and exert diverse range of biological activities against various cell types. CT-induced cell death starts from the membrane recognition process, whose molecular details remain unclear. It is known, however, that the presence of anionic lipids in cell membranes is one of the important factors determining CT-membrane binding. In this work, we therefore investigated specific interactions between one of the most abundant of such lipids, phosphatidylserine (PS), and CT 4 of Naja kaouthia using a combined, experimental and modeling, approach. It was shown that incorporation of PS into zwitterionic liposomes greatly increased the membrane-damaging activity of CT 4 measured by the release of the liposome-entrapped calcein fluorescent dye. The CT-induced leakage rate depends on the PS concentration with a maximum at approximately 20% PS. Interestingly, the effects observed for PS were much more pronounced than those measured for another anionic lipid, sulfatide. To delineate the potential PS binding sites on CT 4 and estimate their relative affinities, a series of computer simulations was performed for the systems containing the head group of PS and different spatial models of CT 4 in aqueous solution and in an implicit membrane. This was done using an original hybrid computational protocol implementing docking, Monte Carlo and molecular dynamics simulations. As a result, at least three putative PS-binding sites with different affinities to PS molecule were delineated. Being located in different parts of the CT molecule, these anion-binding sites can potentially facilitate and modulate the multi-step process of the toxin insertion into lipid bilayers. This feature together with the diverse binding affinities of the sites to a wide variety of anionic targets on the membrane surface appears to be functionally meaningful and may adjust CT action against different types of cells. PMID:21559494

  16. Structure of Epstein-Barr Virus Glycoprotein 42 Suggests a Mechanism for Triggering Receptor-Activated Virus Entry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kirschner, Austin N.; Sorem, Jessica; Longnecker, Richard

    Epstein-Barr virus requires glycoproteins gH/gL, gB, and gp42 to fuse its lipid envelope with B cells. Gp42 is a type II membrane protein consisting of a flexible N-terminal region, which binds gH/gL, and a C-terminal lectin-like domain that binds to the B-cell entry receptor human leukocyte antigen (HLA) class II. Gp42 triggers membrane fusion after HLA binding, a process that requires simultaneous binding to gH/gL and a functional hydrophobic pocket in the lectin domain adjacent to the HLA binding site. Here we present the structure of gp42 in its unbound form. Comparisons to the previously determined structure of a gp42:HLAmore » complex reveals additional N-terminal residues forming part of the gH/gL binding site and structural changes in the receptor binding domain. Although the core of the lectin domain remains similar, significant shifts in two loops and an {alpha} helix bordering the essential hydrophobic pocket suggest a structural mechanism for triggering fusion.« less

  17. ERP, a new member of the ets transcription factor/oncoprotein family: cloning, characterization, and differential expression during B-lymphocyte development.

    PubMed

    Lopez, M; Oettgen, P; Akbarali, Y; Dendorfer, U; Libermann, T A

    1994-05-01

    The ets gene family encodes a group of proteins which function as transcription factors under physiological conditions and, if aberrantly expressed, can cause cellular transformation. We have recently identified two regulatory elements in the murine immunoglobulin heavy-chain (IgH) enhancer, pi and microB, which exhibit striking similarity to binding sites for ets-related proteins. To identify ets-related transcriptional regulators expressed in pre-B lymphocytes that may interact with either the pi or the microB site, we have used a PCR approach with degenerate oligonucleotides encoding conserved sequences in all members of the ets family. We have cloned the gene for a new ets-related transcription factor, ERP (ets-related protein), from the murine pre-B cell line BASC 6C2 and from mouse lung tissue. The ERP protein contains a region of high homology with the ETS DNA-binding domain common to all members of the ets transcription factor/oncoprotein family. Three additional smaller regions show homology to the ELK-1 and SAP-1 genes, a subgroup of the ets gene family that interacts with the serum response factor. Full-length ERP expresses only negligible DNA-binding activity by itself. Removal of the carboxy terminus enables ERP to interact with a variety of ets-binding sites including the E74 site, the IgH enhancer pi site, and the lck promoter ets site, suggesting a carboxy-terminal negative regulatory domain. At least three ERP-related transcripts are expressed in a variety of tissues. However, within the B-cell lineage, ERP is highly expressed primarily at early stages of B-lymphocyte development, and expression declines drastically upon B-cell maturation, correlating with the enhancer activity of the IgH pi site. These data suggest that ERP might play a role in B-cell development and in IgH gene regulation.

  18. Recognition of Histo-Blood Group Antigen-Like Carbohydrates in Lettuce by Human GII.4 Norovirus

    PubMed Central

    Gao, Xiang; Esseili, Malak A.; Lu, Zhongyan; Saif, Linda J.

    2016-01-01

    ABSTRACT Human norovirus (HuNoV) genogroup II genotype 4 (GII.4) strains account for about 80% of the gastroenteritis outbreaks in the United States. Contaminated food is a major transmission vehicle for this virus. In humans, pigs, and oysters, histo-blood group antigens (HBGAs) act as attachment factors for HuNoVs. In lettuce, although the virus-like particles (VLPs) of a GII.4 HuNoV were found to bind to cell wall carbohydrates, the exact binding site has not been investigated. Here, we show the presence of HBGA-like carbohydrates in the cell wall of lettuce. The digestion of lettuce leaves with cell wall-degrading enzymes exposed more binding sites and significantly increased the level of binding of GII.4 HuNoV VLPs. Competition assays showed that both the HBGA monoclonal antibody, recognizing the H type, and plant lectins, recognizing α-l-fucose in the H type, effectively inhibited VLP binding to lettuce tissues. Lettuce cell wall components were isolated and their NoV VLP binding characteristics were tested by enzyme-linked immunosorbent assays. The binding was inhibited by pretreatment of the lettuce cell wall materials with α-1,2-fucosidase. Collectively, our results indicate that H-type HBGA-like carbohydrates exist in lettuce tissues and that GII.4 HuNoV VLPs can bind the exposed fucose moiety, possibly in the hemicellulose component of the cell wall. IMPORTANCE Salad crops and fruits are increasingly recognized as vehicles for human norovirus (HuNoV) transmission. A recent study showed that HuNoVs specifically bind to the carbohydrates of the lettuce cell wall. Histo-blood group antigens (HBGAs) are carbohydrates and are known as the attachment factors for HuNoV infection in humans. In this study, we show the presence of HBGA-like carbohydrates in lettuce, to which HuNoVs specifically bind. These results suggest that specifically bound HuNoVs cannot be removed by simple washing, which may allow viral transmission to consumers. Our findings provide new information needed for developing potential inhibitors to block binding and prevent contamination. PMID:26969699

  19. Recognition of Histo-Blood Group Antigen-Like Carbohydrates in Lettuce by Human GII.4 Norovirus.

    PubMed

    Gao, Xiang; Esseili, Malak A; Lu, Zhongyan; Saif, Linda J; Wang, Qiuhong

    2016-05-15

    Human norovirus (HuNoV) genogroup II genotype 4 (GII.4) strains account for about 80% of the gastroenteritis outbreaks in the United States. Contaminated food is a major transmission vehicle for this virus. In humans, pigs, and oysters, histo-blood group antigens (HBGAs) act as attachment factors for HuNoVs. In lettuce, although the virus-like particles (VLPs) of a GII.4 HuNoV were found to bind to cell wall carbohydrates, the exact binding site has not been investigated. Here, we show the presence of HBGA-like carbohydrates in the cell wall of lettuce. The digestion of lettuce leaves with cell wall-degrading enzymes exposed more binding sites and significantly increased the level of binding of GII.4 HuNoV VLPs. Competition assays showed that both the HBGA monoclonal antibody, recognizing the H type, and plant lectins, recognizing α-l-fucose in the H type, effectively inhibited VLP binding to lettuce tissues. Lettuce cell wall components were isolated and their NoV VLP binding characteristics were tested by enzyme-linked immunosorbent assays. The binding was inhibited by pretreatment of the lettuce cell wall materials with α-1,2-fucosidase. Collectively, our results indicate that H-type HBGA-like carbohydrates exist in lettuce tissues and that GII.4 HuNoV VLPs can bind the exposed fucose moiety, possibly in the hemicellulose component of the cell wall. Salad crops and fruits are increasingly recognized as vehicles for human norovirus (HuNoV) transmission. A recent study showed that HuNoVs specifically bind to the carbohydrates of the lettuce cell wall. Histo-blood group antigens (HBGAs) are carbohydrates and are known as the attachment factors for HuNoV infection in humans. In this study, we show the presence of HBGA-like carbohydrates in lettuce, to which HuNoVs specifically bind. These results suggest that specifically bound HuNoVs cannot be removed by simple washing, which may allow viral transmission to consumers. Our findings provide new information needed for developing potential inhibitors to block binding and prevent contamination. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  20. Mutation of mapped TIA-1/TIAR binding sites in the 3' terminal stem-loop of West Nile virus minus-strand RNA in an infectious clone negatively affects genomic RNA amplification.

    PubMed

    Emara, Mohamed M; Liu, Hsuan; Davis, William G; Brinton, Margo A

    2008-11-01

    Previous data showed that the cellular proteins TIA-1 and TIAR bound specifically to the West Nile virus 3' minus-strand stem-loop [WNV3'(-)SL] RNA (37) and colocalized with flavivirus replication complexes in WNV- and dengue virus-infected cells (21). In the present study, the sites on the WNV3'(-)SL RNA required for efficient in vitro T-cell intracellular antigen-related (TIAR) and T-cell intracellular antigen-1 (TIA-1) protein binding were mapped to short AU sequences (UAAUU) located in two internal loops of the WNV3'(-)SL RNA structure. Infectious clone RNAs with all or most of the binding site nucleotides in one of the 3' (-)SL loops deleted or substituted did not produce detectable virus after transfection or subsequent passage. With one exception, deletion/mutation of a single terminal nucleotide in one of the binding sequences had little effect on the efficiency of protein binding or virus production, but mutation of a nucleotide in the middle of a binding sequence reduced both the in vitro protein binding efficiency and virus production. Plaque size, intracellular genomic RNA levels, and virus production progressively decreased with decreasing in vitro TIAR/TIA-1 binding activity, but the translation efficiency of the various mutant RNAs was similar to that of the parental RNA. Several of the mutant RNAs that inefficiently interacted with TIAR/TIA-1 in vitro rapidly reverted in vivo, indicating that they could replicate at a low level and suggesting that an interaction between TIAR/TIA-1 and the viral 3'(-)SL RNA is not required for initial low-level symmetric RNA replication but instead facilitates the subsequent asymmetric amplification of genome RNA from the minus-strand template.

  1. Binding and Signaling Studies Disclose a Potential Allosteric Site for Cannabidiol in Cannabinoid CB2 Receptors.

    PubMed

    Martínez-Pinilla, Eva; Varani, Katia; Reyes-Resina, Irene; Angelats, Edgar; Vincenzi, Fabrizio; Ferreiro-Vera, Carlos; Oyarzabal, Julen; Canela, Enric I; Lanciego, José L; Nadal, Xavier; Navarro, Gemma; Borea, Pier Andrea; Franco, Rafael

    2017-01-01

    The mechanism of action of cannabidiol (CBD), the main non-psychotropic component of Cannabis sativa L., is not completely understood. First assumed that the compound was acting via cannabinoid CB 2 receptors (CB 2 Rs) it is now suggested that it interacts with non-cannabinoid G-protein-coupled receptors (GPCRs); however, CBD does not bind with high affinity to the orthosteric site of any GPCR. To search for alternative explanations, we tested CBD as a potential allosteric ligand of CB 2 R. Radioligand and non-radioactive homogeneous binding, intracellular cAMP determination and ERK1/2 phosphorylation assays were undertaken in heterologous systems expressing the human version of CB 2 R. Using membrane preparations from CB 2 R-expressing HEK-293T (human embryonic kidney 293T) cells, we confirmed that CBD does not bind with high affinity to the orthosteric site of the human CB 2 R where the synthetic cannabinoid, [ 3 H]-WIN 55,212-2, binds. CBD was, however, able to produce minor but consistent reduction in the homogeneous binding assays in living cells using the fluorophore-conjugated CB 2 R-selective compound, CM-157. The effect on binding to CB 2 R-expressing living cells was different to that exerted by the orthosteric antagonist, SR144528, which decreased the maximum binding without changing the K D . CBD at nanomolar concentrations was also able to significantly reduce the effect of the selective CB 2 R agonist, JWH133, on forskolin-induced intracellular cAMP levels and on activation of the MAP kinase pathway. These results may help to understand CBD mode of action and may serve to revisit its therapeutic possibilities.

  2. Binding and Signaling Studies Disclose a Potential Allosteric Site for Cannabidiol in Cannabinoid CB2 Receptors

    PubMed Central

    Martínez-Pinilla, Eva; Varani, Katia; Reyes-Resina, Irene; Angelats, Edgar; Vincenzi, Fabrizio; Ferreiro-Vera, Carlos; Oyarzabal, Julen; Canela, Enric I.; Lanciego, José L.; Nadal, Xavier; Navarro, Gemma; Borea, Pier Andrea; Franco, Rafael

    2017-01-01

    The mechanism of action of cannabidiol (CBD), the main non-psychotropic component of Cannabis sativa L., is not completely understood. First assumed that the compound was acting via cannabinoid CB2 receptors (CB2Rs) it is now suggested that it interacts with non-cannabinoid G-protein-coupled receptors (GPCRs); however, CBD does not bind with high affinity to the orthosteric site of any GPCR. To search for alternative explanations, we tested CBD as a potential allosteric ligand of CB2R. Radioligand and non-radioactive homogeneous binding, intracellular cAMP determination and ERK1/2 phosphorylation assays were undertaken in heterologous systems expressing the human version of CB2R. Using membrane preparations from CB2R-expressing HEK-293T (human embryonic kidney 293T) cells, we confirmed that CBD does not bind with high affinity to the orthosteric site of the human CB2R where the synthetic cannabinoid, [3H]-WIN 55,212-2, binds. CBD was, however, able to produce minor but consistent reduction in the homogeneous binding assays in living cells using the fluorophore-conjugated CB2R-selective compound, CM-157. The effect on binding to CB2R-expressing living cells was different to that exerted by the orthosteric antagonist, SR144528, which decreased the maximum binding without changing the KD. CBD at nanomolar concentrations was also able to significantly reduce the effect of the selective CB2R agonist, JWH133, on forskolin-induced intracellular cAMP levels and on activation of the MAP kinase pathway. These results may help to understand CBD mode of action and may serve to revisit its therapeutic possibilities. PMID:29109685

  3. Negative regulation of early polyomavirus expression in mouse embryonal carcinoma cells.

    PubMed Central

    Cremisi, C; Babinet, C

    1986-01-01

    Embryonal carcinoma cells are resistant to infection by polyomavirus (Py). We showed that this block was partially removed by inhibiting protein synthesis temporarily. The block was also partially removed when Py was coinfected with simian virus 40. Cycloheximide treatment of cells infected with Py mutants able to grow on PCC4 embryonal carcinoma cells led to 3- to 10-fold increases in the production of T-antigen-positive cells. At 31 degrees C, Py T-antigen expression was enhanced when the cells were treated with cycloheximide. We suggest that a negative labile regulatory protein(s) is synthesized in PCC4 cells, preventing the initiation of early Py transcription by binding to the noncoding sequence, especially the enhancer element B and perhaps also element A, and that the Py mutants retained a binding site(s). PMID:3016339

  4. Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction.

    PubMed

    Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H

    2017-01-09

    The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Interaction of E. coli outer-membrane protein A with sugars on the receptors of the brain microvascular endothelial cells.

    PubMed

    Datta, Deepshikha; Vaidehi, Nagarajan; Floriano, Wely B; Kim, Kwang S; Prasadarao, Nemani V; Goddard, William A

    2003-02-01

    Esherichia coli, the most common gram-negative bacteria, can penetrate the brain microvascular endothelial cells (BMECs) during the neonatal period to cause meningitis with significant morbidity and mortality. Experimental studies have shown that outer-membrane protein A (OmpA) of E. coli plays a key role in the initial steps of the invasion process by binding to specific sugar moieties present on the glycoproteins of BMEC. These experiments also show that polymers of chitobiose (GlcNAcbeta1-4GlcNAc) block the invasion, while epitopes substituted with the L-fucosyl group do not. We used HierDock computational technique that consists of a hierarchy of coarse grain docking method with molecular dynamics (MD) to predict the binding sites and energies of interactions of GlcNAcbeta1-4GlcNAc and other sugars with OmpA. The results suggest two important binding sites for the interaction of carbohydrate epitopes of BMEC glycoproteins to OmpA. We identify one site as the binding pocket for chitobiose (GlcNAcbeta1-4GlcNAc) in OmpA, while the second region (including loops 1 and 2) may be important for recognition of specific sugars. We find that the site involving loops 1 and 2 has relative binding energies that correlate well with experimental observations. This theoretical study elucidates the interaction sites of chitobiose with OmpA and the binding site predictions made in this article are testable either by mutation studies or invasion assays. These results can be further extended in suggesting possible peptide antagonists and drug design for therapeutic strategies. Copyright 2002 Wiley-Liss, Inc.

  6. Induction of Epstein-Barr Virus Oncoprotein LMP1 by Transcription Factors AP-2 and Early B Cell Factor

    PubMed Central

    Noda, Chieko; Narita, Yohei; Watanabe, Takahiro; Yoshida, Masahiro; Ashio, Keiji; Sato, Yoshitaka; Goshima, Fumi; Kanda, Teru; Yoshiyama, Hironori; Tsurumi, Tatsuya; Kimura, Hiroshi

    2016-01-01

    ABSTRACT Latent membrane protein 1 (LMP1) is a major oncogene essential for primary B cell transformation by Epstein-Barr virus (EBV). Previous studies suggested that some transcription factors, such as PU.1, RBP-Jκ, NF-κB, and STAT, are involved in this expression, but the underlying mechanism is unclear. Here, we identified binding sites for PAX5, AP-2, and EBF in the proximal LMP1 promoter (ED-L1p). We first confirmed the significance of PU.1 and POU domain transcription factor binding for activation of the promoter in latency III. We then focused on the transcription factors AP-2 and early B cell factor (EBF). Interestingly, among the three AP-2-binding sites in the LMP1 promoter, two motifs were also bound by EBF. Overexpression, knockdown, and mutagenesis in the context of the viral genome indicated that AP-2 plays an important role in LMP1 expression in latency II in epithelial cells. In latency III B cells, on the other hand, the B cell-specific transcription factor EBF binds to the ED-L1p and activates LMP1 transcription from the promoter. IMPORTANCE Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) is crucial for B cell transformation and oncogenesis of other EBV-related malignancies, such as nasopharyngeal carcinoma and T/NK lymphoma. Its expression is largely dependent on the cell type or condition, and some transcription factors have been implicated in its regulation. However, these previous reports evaluated the significance of specific factors mostly by reporter assay. In this study, we prepared point-mutated EBV at the binding sites of such transcription factors and confirmed the importance of AP-2, EBF, PU.1, and POU domain factors. Our results will provide insight into the transcriptional regulation of the major oncogene LMP1. PMID:26819314

  7. Curcuminoid Binding to Embryonal Carcinoma Cells: Reductive Metabolism, Induction of Apoptosis, Senescence, and Inhibition of Cell Proliferation

    PubMed Central

    Quitschke, Wolfgang W.

    2012-01-01

    Curcumin preparations typically contain a mixture of polyphenols, collectively referred to as curcuminoids. In addition to the primary component curcumin, they also contain smaller amounts of the co-extracted derivatives demethoxycurcumin and bisdemethoxycurcumin. Curcuminoids can be differentially solubilized in serum, which allows for the systematic analysis of concentration-dependent cellular binding, biological effects, and metabolism. Technical grade curcumin was solubilized in fetal calf serum by two alternative methods yielding saturated preparations containing either predominantly curcumin (60%) or bisdemethoxycurcumin (55%). Continual exposure of NT2/D1 cells for 4–6 days to either preparation in cell culture media reduced cell division (1–5 µM), induced senescence (6–7 µM) or comprehensive cell death (8–10 µM) in a concentration-dependent manner. Some of these effects could also be elicited in cells transiently exposed to higher concentrations of curcuminoids (47 µM) for 0.5–4 h. Curcuminoids induced apoptosis by generalized activation of caspases but without nucleosomal fragmentation. The equilibrium binding of serum-solubilized curcuminoids to NT2/D1 cells incubated with increasing amounts of curcuminoid-saturated serum occurred with apparent overall dissociation constants in the 6–10 µM range. However, the presence of excess free serum decreased cellular binding in a hyperbolic manner. Cellular binding was overwhelmingly associated with membrane fractions and bound curcuminoids were metabolized in NT2/D1 cells via a previously unidentified reduction pathway. Both the binding affinities for curcuminoids and their reductive metabolic pathways varied in other cell lines. These results suggest that curcuminoids interact with cellular binding sites, thereby activating signal transduction pathways that initiate a variety of biological responses. The dose-dependent effects of these responses further imply that distinct cellular pathways are sequentially activated and that this activation is dependent on the affinity of curcuminoids for the respective binding sites. Defined serum-solubilized curcuminoids used in cell culture media are thus suitable for further investigating the differential activation of signal transduction pathways. PMID:22768090

  8. Precise small molecule recognition of a toxic CUG RNA repeat expansion

    PubMed Central

    Rzuczek, Suzanne G; Colgan, Lesley A; Nakai, Yoshio; Cameron, Michael D; Furling, Denis; Yasuda, Ryohei; Disney, Matthew D

    2017-01-01

    Excluding the ribosome and riboswitches, developing small molecules that selectively target RNA is a longstanding problem in chemical biology. A typical cellular RNA is difficult to target because it has little tertiary, but abundant secondary structure. We designed allele-selective compounds that target such an RNA, the toxic noncoding repeat expansion (r(CUG)exp) that causes myotonic dystrophy type 1 (DM1). We developed several strategies to generate allele-selective small molecules, including non-covalent binding, covalent binding, cleavage and on-site probe synthesis. Covalent binding and cleavage enabled target profiling in cells derived from individuals with DM1, showing precise recognition of r(CUG)exp. In the on-site probe synthesis approach, small molecules bound adjacent sites in r(CUG)exp and reacted to afford picomolar inhibitors via a proximity-based click reaction only in DM1-affected cells. We expanded this approach to image r(CUG)exp in its natural context. PMID:27941760

  9. Precise small-molecule recognition of a toxic CUG RNA repeat expansion.

    PubMed

    Rzuczek, Suzanne G; Colgan, Lesley A; Nakai, Yoshio; Cameron, Michael D; Furling, Denis; Yasuda, Ryohei; Disney, Matthew D

    2017-02-01

    Excluding the ribosome and riboswitches, developing small molecules that selectively target RNA is a longstanding problem in chemical biology. A typical cellular RNA is difficult to target because it has little tertiary, but abundant secondary structure. We designed allele-selective compounds that target such an RNA, the toxic noncoding repeat expansion (r(CUG) exp ) that causes myotonic dystrophy type 1 (DM1). We developed several strategies to generate allele-selective small molecules, including non-covalent binding, covalent binding, cleavage and on-site probe synthesis. Covalent binding and cleavage enabled target profiling in cells derived from individuals with DM1, showing precise recognition of r(CUG) exp . In the on-site probe synthesis approach, small molecules bound adjacent sites in r(CUG) exp and reacted to afford picomolar inhibitors via a proximity-based click reaction only in DM1-affected cells. We expanded this approach to image r(CUG) exp in its natural context.

  10. Structure of the mouse galectin-4 N-terminal carbohydrate-recognition domain reveals the mechanism of oligosaccharide recognition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krejciríková, Veronika; Pachl, Petr; Fábry, Milan

    2011-11-18

    Galectin-4, a member of the tandem-repeat subfamily of galectins, participates in cell-membrane interactions and plays an important role in cell adhesion and modulation of immunity and malignity. The oligosaccharide specificity of the mouse galectin-4 carbohydrate-recognition domains (CRDs) has been reported previously. In this work, the structure and binding properties of the N-terminal domain CRD1 were further investigated and the crystal structure of CRD1 in complex with lactose was determined at 2.1 {angstrom} resolution. The lactose-binding affinity was characterized by fluorescence measurements and two lactose-binding sites were identified: a high-affinity site with a K{sub d} value in the micromolar range (K{submore » d1} = 600 {+-} 70 {mu}M) and a low-affinity site with K{sub d2} = 28 {+-} 10 mM.« less

  11. How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

    PubMed Central

    1988-01-01

    We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099

  12. Identification of Small Molecules against Botulinum Neurotoxin B Binding to Neuronal Cells at Ganglioside GT1b Binding Site with Low to Moderate Affinity

    DTIC Science & Technology

    2014-10-01

    BoNT serotype B (BoNT/B) for the trisaccharide GT1b were identified from the x-ray crystal structure of the BoNT/B/trisaccharide (GT1b) complex ( PDB ...trisaccharide and all the water from the structure and identified four potential binding pockets (Pocket-1, Pocket-2, and Pocket-4) as shown in...four potential binding sites or pockets on BoNT serotype B (BoNT/B) for the trisaccharide GT1b were identified from the x-ray crystal structure of the

  13. COUP-TF (chicken ovalbumin upstream promoter transcription factor)-interacting protein 1 (CTIP1) is a sequence-specific DNA binding protein.

    PubMed Central

    Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark

    2002-01-01

    Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208

  14. Calmodulin binds to inv protein: implication for the regulation of inv function.

    PubMed

    Yasuhiko, Y; Imai, F; Ookubo, K; Takakuwa, Y; Shiokawa, K; Yokoyama, T

    2001-12-01

    Establishment of the left-right asymmetry of internal organs is essential for the normal development of vertebrates. The inv mutant in mice shows a constant reversal of left-right asymmetry and although the inv gene has been cloned, its biochemical and cell biological functions have not been defined. Here, we show that calmodulin binds to mouse inv protein at two sites (IQ1 and IQ2). The binding of calmodulin to the IQ2 site occurs in the absence of Ca(2+) and is not observed in the presence of Ca(2+). Injection of mouse inv mRNA into the right blastomere of Xenopus embryos at the two-cell stage randomized the left-right asymmetry of the embryo and altered the patterns of Xnr-1 and Pitx2 expression. Importantly, inv mRNA that lacked the region encoding the IQ2 site was unable to randomize left-right asymmetry in Xenopus embryos, implying that the IQ2 site is essential for inv to randomize left-right asymmetry in Xenopus. These results suggest that calmodulin binding may regulate inv function. Based on our findings, we propose a model for the regulation of inv function by calcium-calmodulin and discuss its implications.

  15. DNA Mismatch Binding and Antiproliferative Activity of Rhodium Metalloinsertors

    PubMed Central

    Ernst, Russell J.; Song, Hang; Barton, Jacqueline K.

    2009-01-01

    Deficiencies in mismatch repair (MMR) are associated with carcinogenesis. Rhodium metalloinsertors bind to DNA base mismatches with high specificity and inhibit cellular proliferation preferentially in MMR-deficient cells versus MMR-proficient cells. A family of chrysenequinone diimine complexes of rhodium with varying ancillary ligands that serve as DNA metalloinsertors has been synthesized, and both DNA mismatch binding affinities and antiproliferative activities against the human colorectal carcinoma cell lines HCT116N and HCT116O, an isogenic model system for MMR deficiency, have been determined. DNA photocleavage experiments reveal that all complexes bind to the mismatch sites with high specificities; DNA binding affinities to oligonucleotides containing single base CA and CC mismatches, obtained through photocleavage titration or competition, vary from 104 to 108 M−1 for the series of complexes. Significantly, binding affinities are found to be inversely related to ancillary ligand size and directly related to differential inhibition of the HCT116 cell lines. The observed trend in binding affinity is consistent with the metalloinsertion mode where the complex binds from the minor groove with ejection of mismatched base pairs. The correlation between binding affinity and targeting of the MMR-deficient cell line suggests that rhodium metalloinsertors exert their selective biological effects on MMR-deficient cells through mismatch binding in vivo. PMID:19175313

  16. Stoichiometry and kinetics of mercury uptake by photosynthetic bacteria.

    PubMed

    Kis, Mariann; Sipka, Gábor; Maróti, Péter

    2017-05-01

    Mercury adsorption on the cell surface and intracellular uptake by bacteria represent the key first step in the production and accumulation of highly toxic mercury in living organisms. In this work, the biophysical characteristics of mercury bioaccumulation are studied in intact cells of photosynthetic bacteria by use of analytical (dithizone) assay and physiological photosynthetic markers (pigment content, fluorescence induction, and membrane potential) to determine the amount of mercury ions bound to the cell surface and taken up by the cell. It is shown that the Hg(II) uptake mechanism (1) has two kinetically distinguishable components, (2) includes co-opted influx through heavy metal transporters since the slow component is inhibited by Ca 2+ channel blockers, (3) shows complex pH dependence demonstrating the competition of ligand binding of Hg(II) ions with H + ions (low pH) and high tendency of complex formation of Hg(II) with hydroxyl ions (high pH), and (4) is not a passive but an energy-dependent process as evidenced by light activation and inhibition by protonophore. Photosynthetic bacteria can accumulate Hg(II) in amounts much (about 10 5 ) greater than their own masses by well-defined strong and weak binding sites with equilibrium binding constants in the range of 1 (μM) -1 and 1 (mM) -1 , respectively. The strong binding sites are attributed to sulfhydryl groups as the uptake is blocked by use of sulfhydryl modifying agents and their number is much (two orders of magnitude) smaller than the number of weak binding sites. Biofilms developed by some bacteria (e.g., Rvx. gelatinosus) increase the mercury binding capacity further by a factor of about five. Photosynthetic bacteria in the light act as a sponge of Hg(II) and can be potentially used for biomonitoring and bioremediation of mercury-contaminated aqueous cultures.

  17. An antibody to the lutheran glycoprotein (Lu) recognizing the LU4 blood type variant inhibits cell adhesion to laminin α5.

    PubMed

    Kikkawa, Yamato; Miwa, Takahiro; Tohara, Yukiko; Hamakubo, Takayuki; Nomizu, Motoyoshi

    2011-01-01

    The Lutheran blood group glycoprotein (Lu), an Ig superfamily (IgSF) transmembrane receptor, is also known as basal cell adhesion molecule (B-CAM). Lu/B-CAM is a specific receptor for laminin α5, a major component of basement membranes in various tissues. Previous reports have shown that Lu/B-CAM binding to laminin α5 contributes to sickle cell vaso-occlusion. However, as there are no useful tools such as function-blocking antibodies or drugs, it is unclear how epithelial and sickled red blood cells adhere to laminin α5 via Lu/B-CAM. In this study, we discovered a function-blocking antibody that inhibits Lu binding to laminin α5 using a unique binding assay on tissue sections. To characterize the function-blocking antibody, we identified the site on Lu/B-CAM recognized by this antibody. The extracellular domain of Lu/B-CAM contains five IgSF domains, D1-D2-D3-D4-D5. The antibody epitope was localized to D2, but not to the D3 domain containing the major part of the laminin α5 binding site. Furthermore, mutagenesis studies showed that Arg(175), the LU4 blood group antigenic site, was crucial for forming the epitope and the antibody bound sufficiently close to sterically hinder the interaction with α5. Cell adhesion assay using the antibody also showed that Lu/B-CAM serves as a secondary receptor for the adhesion of carcinoma cells to laminin α5. This function-blocking antibody against Lu/B-CAM should be useful for not only investigating cell adhesion to laminin α5 but also for developing drugs to inhibit sickle cell vaso-occlusion.

  18. DLG1 is an anchor for the E3 ligase MARCH2 at sites of cell-cell contact

    PubMed Central

    Cao, Zhifang; Huett, Alan; Kuballa, Petric; Giallourakis, Cosmas; Xavier, Ramnik J.

    2008-01-01

    PDZ domain containing molecular scaffolds play a central role in organizing synaptic junctions. Observations in Drosophila and mammalian cells have implicated that ubiquitination and endosomal trafficking, of molecular scaffolds are critical to the development and maintenance of cell-cell junctions and cell polarity. To elucidate if there is a connection between these pathways, we applied an integrative genomic strategy, which combined comparative genomics and proteomics with cell biological assays. Given the importance of ubiquitin in regulating endocytic processes, we first identified the subset of E3 ligases with conserved PDZ binding motifs. Among this subset, the MARCH family ubiquitin ligases account for the largest family and MARCH2 has been previously implicated in endosomal trafficking. Next, we tested in an unbiased fashion, if MARCH2 binds PDZ proteins in vivo using a modified tandem affinity purification strategy followed by mass spectrometry. Of note, DLG1 was co-purified from MARCH2, with subsequent confirmation that MARCH2 interacts with full-length DLG1 in a PDZ domain dependent manner. Furthermore, we demonstrated that MARCH2 co-localized with DLG1 at sites of cell-cell contact. In addition, loss of the MARCH2 PDZ binding motif led to loss of MARCH2 localization at cell-cell contact sites and MARCH2 appeared to localize away from cell-cell junctions. In in vivo ubiquitination assays we show that MARCH2 promotes DLG1 ubiquitination Overall, these results suggest that PDZ ligands with E3 ligase activity may link PDZ domain containing tumor suppressors to endocytic pathways and cell polarity determination. PMID:17980554

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Daud, A.I.; Bumpus, F.M.; Husain, A.

    Ovarian angiotensin I (Ang I)-converting enzyme (ACE), estimated by the specific binding of the ACE inhibitor (125I)iodo-MK-351A, is localized on multiple ovarian structures, including follicular granulosa cells, corpora lutea, terminal epithelium, and ovarian blood vessels, but total ovarian ACE does not display a cyclic pattern of variation during the rat estrous cycle. We have previously shown that ACE is localized on the granulosa cell layer of a subpopulation of rat ovarian follicles. Our present study shows that ovarian granulosa cells contain high affinity (binding site affinity (Kd), approximately 90 pM) and low capacity (binding site density (Bmax), approximately 12 fmol/2.5more » X 10(5) cells) (125I)iodo-MK-351A-binding sites and convert (125I)iodo-Ang I to (125I)iodo-Ang II (greater than 85% of this conversion was inhibited by the ACE inhibitor captopril). Throughout the rat estrous cycle, 94-100% of developing follicles and 89-96% of atretic follicles contained high levels of ACE; however, ACE was either not observed or its levels were very low in preovulatory follicles. These findings indicate the presence of high levels of biologically active ACE on the surface of granulosa cells and suggest a potential role for follicular ACE in early stages of follicular maturation and atresia. Although ACE is known to process a variety of peptides found within the ovary, and these peptides may have opposing effects on follicular maturation, we attempted to define the cumulative effect of ACE inhibition on follicular maturation.« less

  20. Cell cycle-dependent transcription factors control the expression of yeast telomerase RNA.

    PubMed

    Dionne, Isabelle; Larose, Stéphanie; Dandjinou, Alain T; Abou Elela, Sherif; Wellinger, Raymund J

    2013-07-01

    Telomerase is a specialized ribonucleoprotein that adds repeated DNA sequences to the ends of eukaryotic chromosomes to preserve genome integrity. Some secondary structure features of the telomerase RNA are very well conserved, and it serves as a central scaffold for the binding of associated proteins. The Saccharomyces cerevisiae telomerase RNA, TLC1, is found in very low copy number in the cell and is the limiting component of the known telomerase holoenzyme constituents. The reasons for this low abundance are unclear, but given that the RNA is very stable, transcriptional control mechanisms must be extremely important. Here we define the sequences forming the TLC1 promoter and identify the elements required for its low expression level, including enhancer and repressor elements. Within an enhancer element, we found consensus sites for Mbp1/Swi4 association, and chromatin immunoprecipitation (ChIP) assays confirmed the binding of Mbp1 and Swi4 to these sites of the TLC1 promoter. Furthermore, the enhancer element conferred cell cycle-dependent regulation to a reporter gene, and mutations in the Mbp1/Swi4 binding sites affected the levels of telomerase RNA and telomere length. Finally, ChIP experiments using a TLC1 RNA-binding protein as target showed cell cycle-dependent transcription of the TLC1 gene. These results indicate that the budding yeast TLC1 RNA is transcribed in a cell cycle-dependent fashion late in G1 and may be part of the S phase-regulated group of genes involved in DNA replication.

  1. Loss of Hda activity stimulates replication initiation from I-box, but not R4 mutant origins in Escherichia coli.

    PubMed

    Riber, Leise; Fujimitsu, Kazuyuki; Katayama, Tsutomu; Løbner-Olesen, Anders

    2009-01-01

    Initiation of chromosome replication in Escherichia coli is limited by the initiator protein DnaA associated with ATP. Within the replication origin, binding sites for DnaA associated with ATP or ADP (R boxes) and the DnaA(ATP) specific sites (I-boxes, tau-boxes and 6-mer sites) are found. We analysed chromosome replication of cells carrying mutations in conserved regions of oriC. Cells carrying mutations in DnaA-boxes I2, I3, R2, R3 and R5 as well as FIS and IHF binding sites resembled wild-type cells with respect to origin concentration. Initiation of replication in these mutants occurred in synchrony or with slight asynchrony only. Furthermore, lack of Hda stimulated initiation in all these mutants. The DnaA(ATP) containing complex that leads to initiation can therefore be formed in the absence of several of the origin DnaA binding sites including both DnaA(ATP) specific I-boxes. However, competition between I-box mutant and wild-type origins, revealed a positive role of I-boxes on initiation. On the other hand, mutations affecting DnaA-box R4 were found to be compromised for initiation and could not be augmented by an increase in cellular DnaA(ATP)/DnaA(ADP) ratio. Compared with the sites tested here, R4 therefore seems to contribute to initiation most critically.

  2. Receptor-mediated transcytosis of cyclophilin B through the blood-brain barrier.

    PubMed

    Carpentier, M; Descamps, L; Allain, F; Denys, A; Durieux, S; Fenart, L; Kieda, C; Cecchelli, R; Spik, G

    1999-07-01

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein mainly located in intracellular vesicles and secreted in biological fluids. In previous works, we demonstrated that CyPB interacts with T lymphocytes and enhances in vitro cellular incorporation and activity of CsA. In addition to its immunosuppressive activity, CsA is able to promote regeneration of damaged peripheral nerves. However, the crossing of the drug from plasma to neural tissue is restricted by the relative impermeability of the blood-brain barrier. To know whether CyPB might also participate in the delivery of CsA into the brain, we have analyzed the interactions of CyPB with brain capillary endothelial cells. First, we demonstrated that CyPB binds to two types of binding sites present at the surface of capillary endothelial cells from various species of tissues. The first type of binding sites (K(D) = 300 nM; number of sites = 3 x 10(6)) is related to interactions with negatively charged compounds such as proteoglycans. The second type of binding sites, approximately 50,000 per cell, exhibits a higher affinity for CyPB (K(D) = 15 nM) and is involved in an endocytosis process, indicating it might correspond to a functional receptor. Finally, the use of an in vitro model of blood-brain barrier allowed us to demonstrate that CyPB is transcytosed by a receptor-mediated pathway (flux = 16.5 fmol/cm2/h). In these conditions, CyPB did not significantly modify the passage of CsA, indicating that it is unlikely to provide a pathway for CsA brain delivery.

  3. Characterization of the rat RALDH1 promoter. A functional CCAAT and octamer motif are critical for basal promoter activity.

    PubMed

    Guimond, Julie; Devost, Dominic; Brodeur, Helene; Mader, Sylvie; Bhat, Pangala V

    2002-12-12

    Retinal dehydrogenase type 1 (RALDH1) catalyzes the oxidation of retinal to retinoic acid (RA), a metabolite of vitamin A important for embryogenesis and tissue differentiation. Rat RALDH1 is expressed to high levels in developing kidney, and in stomach, intestine epithelia. To understand the mechanisms of the transcriptional regulation of rat RALDH1, we cloned a 1360-base pair (bp) 5'-flanking region of RALDH1 gene. Using luciferase reporter constructs transfected into HEK 293 and LLCPK (kidney-derived) cells, basal promoter activity was associated with sequences between -80 and +43. In this minimal promoter region, TATA and CCAAT cis-acting elements as well as SP1, AP1 and octamer (Oct)-binding sites were present. The CCAAT box and Oct-binding site, located between positions -72 and -68 and -56 and -49, respectively, were shown by deletion analysis and site-directed mutation to be critical for promoter activity. Nuclear extracts from kidney cells contain proteins specifically binding the Oct and CCAAT sequences, resulting in the formation of six complexes, while different patterns of complexes were observed with non-kidney cell extracts. Gel shift assays using either single or double mutations of the Oct and CCAAT sequences as well as super shift assays demonstrated single and double occupancy of these two sites by Oct-1 and CBF-A. In addition, unidentified proteins also bound the Oct motif specifically in the absence of CBF-A binding. These results demonstrate specific involvement of Oct and CCAAT-binding proteins in the regulation of RALDH1 gene.

  4. Failure in activation of the canonical NF-κB pathway by human T-cell leukemia virus type 1 Tax in non-hematopoietic cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mizukoshi, Terumi; Komori, Hideyuki; Mizuguchi, Mariko

    2013-09-01

    Human T-cell leukemia virus type 1 (HTLV-1) Tax (Tax1) plays crucial roles in leukemogenesis in part through activation of NF-κB. In this study, we demonstrated that Tax1 activated an NF-κB binding (gpκB) site of the gp34/OX40 ligand gene in a cell type-dependent manner. Our examination showed that the gpκΒ site and authentic NF-κB (IgκB) site were activated by Tax1 in hematopoietic cell lines. Non-hematopoietic cell lines including hepatoma and fibroblast cell lines were not permissive to Tax1-mediated activation of the gpκB site, while the IgκB site was activated in those cells in association with binding of RelB. However RelA bindingmore » was not observed in the gpκB and IgκB sites. Our results suggest that HTLV-1 Tax1 fails to activate the canonical pathway of NF-κB in non-hematopoietic cell lines. Cell type-dependent activation of NF-κB by Tax1 could be associated with pathogenesis by HTLV-1 infection. - Highlights: • HTLV-1 Tax1 does not activate RelA of NF-κB in non-hematopoietic cell lines. • Tax1 activates the NF-κB non-canonical pathway in non-hematopoietic cell lines. • Tax1 does not induce RelA nuclear translocation in those cell lines, unlike TNFα. • The OX40L promoter κB site is activated by ectopic, but not endogenous, RelA.« less

  5. Interaction of Trypanosoma evansi with the plasminogen-plasmin system.

    PubMed

    Acosta, Héctor; Rondón-Mercado, Rocío; Avilán, Luisana; Concepción, Juan Luis

    2016-08-15

    Trypanosoma evansi is a widely-distributed haemoflagellated parasite of veterinary importance that infects a variety of mammals including horses, mules, camels, buffalos, cattle and deer. It is the causal agent of a trypanosomiasis known as Surra which produces epidemics of great economic importance in Africa, Asia and South America. The main pathology includes an enlarged spleen with hypertrophy of lymphoid follicles, congested lungs, neuronal degeneration and meningoencephalitis, where migration of the parasites from the blood to the tissues is essential. Most cells, including pathogenic cells, use diverse strategies for tissue invasion, such as the expression of surface receptors to bind plasminogen or plasmin. In this work, we show that T. evansi is able to bind plasminogen and plasmin on its surface. The analysis of this binding revealed a high affinity dissociation constant (Kd of 0.080±0.009μM) and 1×10(5) plasminogen binding sites per cell. Also a second population of receptors with a Kd of 0.255±0.070μM and 3.2×10(4) plasminogen binding sites per cell was determined. Several proteins with molecular masses between ∼18 and ∼70kDa are responsible for this binding. This parasite-plasminogen interaction may be important in the establishment of the infection in the vertebrate host, where the physiological concentration of available plasminogen is around 2μM. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Stable nanoconjugates of transferrin with alloyed quaternary nanocrystals Ag-In-Zn-S as a biological entity for tumor recognition.

    PubMed

    Matysiak-Brynda, Edyta; Bujak, Piotr; Augustin, Ewa; Kowalczyk, Agata; Mazerska, Zofia; Pron, Adam; Nowicka, Anna M

    2018-01-18

    One way to limit the negative effects of anti-tumor drugs on healthy cells is targeted therapy employing functionalized drug carriers. Here we present a biocompatible and stable nanoconjugate of transferrin anchored to Ag-In-Zn-S quantum dots modified with 11-mercaptoundecanoic acid (Tf-QD) as a drug carrier versus typical anticancer drug, doxorubicin. Detailed investigations of Tf-QD nanoconjugates without and with doxorubicin by fluorescence studies and cytotoxic measurements showed that the biological activity of both the transferrin and doxorubicin was fully retained in the nanoconjugate. In particular, the intercalation capabilities of free doxorubicin versus ctDNA remained essentially intact upon its binding to the nanoconjugate. In order to evaluate these capabilities, we studied the binding constant of doxorubicin attached to Tf-QDs with ctDNA as well as the binding site size on the ctDNA molecule. The binding constant slightly decreased compared to that of free doxorubicin while the binding site size, describing the number of consecutive DNA lattice residues involved in the binding, increased. It was also demonstrated that the QDs alone and in the form of a nanoconjugate with Tf were not cytotoxic towards human non-small cell lung carcinoma (H460 cell line) and the tumor cell sensitivity of the DOX-Tf-QD nanoconjugate was comparable to that of doxorubicin alone.

  7. Analyzing Intracellular Binding and Diffusion with Continuous Fluorescence Photobleaching

    PubMed Central

    Wachsmuth, Malte; Weidemann, Thomas; Müller, Gabriele; Hoffmann-Rohrer, Urs W.; Knoch, Tobias A.; Waldeck, Waldemar; Langowski, Jörg

    2003-01-01

    Transport and binding of molecules to specific sites are necessary for the assembly and function of ordered supramolecular structures in cells. For analyzing these processes in vivo, we have developed a confocal fluorescence fluctuation microscope that allows both imaging of the spatial distribution of fluorescent molecules with confocal laser scanning microscopy and probing their mobility at specific positions in the cell with fluorescence correlation spectroscopy and continuous fluorescence photobleaching (CP). Because fluorescence correlation spectroscopy is restricted to rapidly diffusing particles and CP to slower processes, these two methods complement each other. For the analysis of binding-related contributions to mobility we have derived analytical expressions for the temporal behavior of CP curves from which the bound fraction and/or the dissociation rate or residence time at binding sites, respectively, can be obtained. In experiments, we investigated HeLa cells expressing different fluorescent proteins: Although enhanced green fluorescent protein (EGFP) shows high mobility, fusions of histone H2B with the yellow fluorescent protein are incorporated into chromatin, and these nuclei exhibit the presence of a stably bound and a freely diffusing species. Nonpermanent binding was found for mTTF-I, a transcription termination factor for RNA polymerase I, fused with EGFP. The cells show fluorescent nucleoli, and binding is transient. CP yields residence times for mTTF-I-EGFP of ∼13 s. PMID:12719264

  8. Analyzing intracellular binding and diffusion with continuous fluorescence photobleaching.

    PubMed

    Wachsmuth, Malte; Weidemann, Thomas; Müller, Gabriele; Hoffmann-Rohrer, Urs W; Knoch, Tobias A; Waldeck, Waldemar; Langowski, Jörg

    2003-05-01

    Transport and binding of molecules to specific sites are necessary for the assembly and function of ordered supramolecular structures in cells. For analyzing these processes in vivo, we have developed a confocal fluorescence fluctuation microscope that allows both imaging of the spatial distribution of fluorescent molecules with confocal laser scanning microscopy and probing their mobility at specific positions in the cell with fluorescence correlation spectroscopy and continuous fluorescence photobleaching (CP). Because fluorescence correlation spectroscopy is restricted to rapidly diffusing particles and CP to slower processes, these two methods complement each other. For the analysis of binding-related contributions to mobility we have derived analytical expressions for the temporal behavior of CP curves from which the bound fraction and/or the dissociation rate or residence time at binding sites, respectively, can be obtained. In experiments, we investigated HeLa cells expressing different fluorescent proteins: Although enhanced green fluorescent protein (EGFP) shows high mobility, fusions of histone H2B with the yellow fluorescent protein are incorporated into chromatin, and these nuclei exhibit the presence of a stably bound and a freely diffusing species. Nonpermanent binding was found for mTTF-I, a transcription termination factor for RNA polymerase I, fused with EGFP. The cells show fluorescent nucleoli, and binding is transient. CP yields residence times for mTTF-I-EGFP of approximately 13 s.

  9. Pheromone induction of agglutination in Saccharomyces cerevisiae a cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Terrance, K.; Lipke, P.N.

    1987-10-01

    a-Agglutinin, the cell surface sexual agglutinin of yeast a cells, was assayed by its ability to bind its complementary agglutinin, ..cap alpha..-agglutinin. The specific binding of /sup 125/I-..cap alpha..-agglutinin to a cells treated with the sex pheromone ..cap alpha..-factor was 2 to 2.5 times that of binding to a cells not treated with ..cap alpha..-factor. Competition with unlabeled ..cap alpha..-agglutinin revealed that the increased binding was due to increased cell surface expression of a-agglutinin, with no apparent change in the binding constant. The increase in site number was similar to the increase in cellular agglutinability. Increased expression of a-agglutinin followedmore » the same kinetics as the increase in cellular agglutinability, with a 10-min lag followed by a 15- to 20-min response time. Induction kinetics were similar in cells in phases G1 and G2 of the cell cycle. Maximal expression levels were similar in cells treated with excess pheromone and in cells exposed to pheromone after destruction of constitutively expressed a-agglutinin.« less

  10. Unconventional binding sites and receptors for VIP and related peptides PACAP and PHI/PHM: an update.

    PubMed

    Muller, Jean-Marc; Debaigt, Colin; Goursaud, Stéphanie; Montoni, Alicia; Pineau, Nicolas; Meunier, Annie-Claire; Janet, Thierry

    2007-09-01

    The 28-amino-acid neuropeptide VIP and related peptides PACAP and PHI/PHM modulate virtually all of the vital functions in the body. These peptides are also commonly recognized as major regulators of cell growth and differentiation. Through their trophic and cytoprotective functions, they appear to play major roles in embryonic development, neurogenesis and the progression of a number of cancer types. These peptides bind to three well-characterized subtypes of G-protein coupled receptors: VPAC1 and VPAC2 share a common high affinity in the nanomolar range for VIP and PACAP; a third receptor type, PAC1, has been characterized for its high affinity for PACAP but its low affinity for VIP. Complex effects and pharmacological behaviors of these peptides suggest that multiple subtypes of binding sites may cooperate to mediate their function in target cells and tissues. In this complex response, some of these binding sites correspond to the definition of the conventional receptors cited above, while others display unexpected pharmacological and functional properties. Here we present potential clues that may lead investigators to further characterize the molecular nature and functions of these atypical binding species.

  11. Vitamin K3 disrupts the microtubule networks by binding to tubulin: a novel mechanism of its antiproliferative activity.

    PubMed

    Acharya, Bipul R; Choudhury, Diptiman; Das, Amlan; Chakrabarti, Gopal

    2009-07-28

    Vitamin K3 (2-methyl-1,4-naphthoquinone), also known as menadione, is the synthetic precursor of all the naturally occurring vitamin K in the body. Vitamin K is necessary for the production of prothrombin and five other blood-clotting factors in humans. We have examined the effects of menadione on cellular microtubules ex vivo as well as its binding with purified tubulin and microtubules in vitro. Cell viability experiments using human cervical epithelial cancer cells (HeLa) and human oral epithelial cancer cells (KB) indicated that the IC(50) values for menadione are 25.6 +/- 0.6 and 64.3 +/- 0.36 microM, respectively, in those cells. Mendione arrests HeLa cells in mitosis. Immunofluorescence studies using an anti-alpha-tubulin antibody showed a significant irreversible depolymeriztion of the interphase microtubule network and spindle microtubule in a dose-dependent manner. In vitro polymerization of purified tubulin into microtubules is inhibited by menadione with an IC(50) value of 47 +/- 0.65 microM. The binding of menadione with tubulin was studied using menadione fluorescence and intrinsic tryptophan fluorescence of tubulin. Binding of menadione to tubulin is slow, taking 35 min for equilibration at 25 degrees C. The association reaction kinetics is biphasic in nature, and the association rate constants for fast and slow phases are 189.12 +/- 17 and 32.44 +/- 21 M(-1) s(-1) at 25 degrees C, respectively. The stoichiometry of menadione binding to tubulin is 1:1 (molar ratio) with a dissociation constant from 2.44 +/- 0.34 to 3.65 +/- 0.25 microM at 25 degrees C. Menadione competes for the colchicine binding site with a K(i) of 2.5 muM as determined from a modified Dixon plot. The obtained data suggested that menadione binds at the colchicine binding site to tubulin. Thus, we can conclude one novel mechanism of inhibition of cancer cell proliferation by menadione is through tubulin binding.

  12. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  13. Changes in cell surface structure by viral transformation studied by binding of lectins differing in sugar specificity.

    PubMed

    Tsuda, M; Kurokawa, T; Takeuchi, M; Sugino, Y

    1975-10-01

    Changes in cell surface structure by viral transformation were studied by examining changes in the binding of various lectins differing in carbohydrate specificities. Binding of lectins was assayed directly using cells grown in coverslips. The following 125I-lectins were used: Concanavalin-A (specific for glucose and mannose), wheat germ agglutinin (specific for N-acetylglucosamine), castor bean agglutinin (specific for galactose), Wistaria floribunda agglutinin (specific for N-acetylgalactosamine), and soybean agglutinin (specific for N-acetyl-galactosamine). Cells for a clone, SS7, transformed by bovine adenovirus type-3, were found to bind 5 to 6 times more Wistaria floribunda agglutinin than the normal counterpart cells (clone C31, from C3H mouse kidney). In contrast, the binding of soybean agglutinin, which has a sugar specificity similar to Wistaria floribunda agglutinin, to normal and transformed cells was similar. The binding of wheat germ agglutinin and castor bean agglutinin, respectively, to normal and transformed cells was also similar. However, normal cells bound twice as much concanavalin-A as transformed cells. Only half as much Wistaria floribunda agglutinin was bound to transformed cells when they had been dispersed with EDTA. These changes in the number of lectin binding sites on transformation are thought to reflect alteration of the cell surface structure. The amount of lectins bound per cell decreased with increase in cell density, especially in the case of binding of Wistaria floribunda agglutinin to normal cells.

  14. Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

    PubMed

    Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

    1994-12-20

    The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

  15. CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

    PubMed

    Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

    2015-12-01

    CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

  16. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  17. A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

    PubMed Central

    Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

    2017-01-01

    Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

  18. REST–Mediated Recruitment of Polycomb Repressor Complexes in Mammalian Cells

    PubMed Central

    Landt, Eskild; Agrawal-Singh, Shuchi; Bak, Mads; Tommerup, Niels; Rappsilber, Juri; Södersten, Erik; Hansen, Klaus

    2012-01-01

    Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1, and PRC2 and show that RNF2 and REST co-regulate a number of neuronal genes in human teratocarcinoma cells (NT2-D1). Using NT2-D1 cells as a model of neuronal differentiation, we furthermore showed that retinoic-acid stimulation led to displacement of PRC1 at REST binding sites, reduced H3K27Me3, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest−/− and Eed−/− mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest−/− mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context-dependent functions for PRC1- and PRC2- recruitment, which allows this transcription factor to act both as a recruiter of Polycomb as well as a limiting factor for PRC2 recruitment at CpG islands. PMID:22396653

  19. Lipid-regulated sterol transfer between closely apposed membranes by oxysterol-binding protein homologues.

    PubMed

    Schulz, Timothy A; Choi, Mal-Gi; Raychaudhuri, Sumana; Mears, Jason A; Ghirlando, Rodolfo; Hinshaw, Jenny E; Prinz, William A

    2009-12-14

    Sterols are transferred between cellular membranes by vesicular and poorly understood nonvesicular pathways. Oxysterol-binding protein-related proteins (ORPs) have been implicated in sterol sensing and nonvesicular transport. In this study, we show that yeast ORPs use a novel mechanism that allows regulated sterol transfer between closely apposed membranes, such as organelle contact sites. We find that the core lipid-binding domain found in all ORPs can simultaneously bind two membranes. Using Osh4p/Kes1p as a representative ORP, we show that ORPs have at least two membrane-binding surfaces; one near the mouth of the sterol-binding pocket and a distal site that can bind a second membrane. The distal site is required for the protein to function in cells and, remarkably, regulates the rate at which Osh4p extracts and delivers sterols in a phosphoinositide-dependent manner. Together, these findings suggest a new model of how ORPs could sense and regulate the lipid composition of adjacent membranes.

  20. Multiple sup 3 H-oxytocin binding sites in rat myometrial plasma membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Crankshaw, D.; Gaspar, V.; Pliska, V.

    1990-01-01

    The affinity spectrum method has been used to analyse binding isotherms for {sup 3}H-oxytocin to rat myometrial plasma membranes. Three populations of binding sites with dissociation constants (Kd) of 0.6-1.5 x 10(-9), 0.4-1.0 x 10(-7) and 7 x 10(-6) mol/l were identified and their existence verified by cluster analysis based on similarities between Kd, binding capacity and Hill coefficient. When experimental values were compared to theoretical curves constructed using the estimated binding parameters, good fits were obtained. Binding parameters obtained by this method were not influenced by the presence of GTP gamma S (guanosine-5'-O-3-thiotriphosphate) in the incubation medium. The bindingmore » parameters agree reasonably well with those found in uterine cells, they support the existence of a medium affinity site and may allow for an explanation of some of the discrepancies between binding and response in this system.« less

  1. Assessment of the inhibitory effects of pyrethroids against human carboxylesterases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lei, Wei

    Pyrethroids are broad-spectrum insecticides that widely used in many countries, while humans may be exposed to these toxins by drinking or eating pesticide-contaminated foods. This study aimed to investigate the inhibitory effects of six commonly used pyrethroids against two major human carboxylesterases (CES) including CES1 and CES2. Three optical probe substrates for CES1 (DME, BMBT and DMCB) and a fluorescent probe substrate for CES2 (DDAB) were used to characterize the inhibitory effects of these pyrethroids. The results demonstrated that most of the tested pyrethroids showed moderate to weak inhibitory effects against both CES1 and CES2, but deltamethrin displayed strong inhibitionmore » towards CES1. The IC{sub 50} values of deltamethrin against CES1-mediated BMBT, DME, and DMCB hydrolysis were determined as 1.58 μM, 2.39 μM, and 3.3 μM, respectively. Moreover, deltamethrin was cell membrane permeable and capable of inhibition endogenous CES1 in living cells. Further investigation revealed that deltamethrin inhibited CES1-mediated BMBT hydrolysis via competitive manner but noncompetitively inhibited DME or DMCB hydrolysis. The inhibition behaviors of deltamethrin against CES1 were also studied by molecular docking simulation. The results demonstrated that CES1 had at least two different ligand-binding sites, one was the DME site and another was the BMBT site which was identical to the binding site of deltamethrin. In summary, deltamethrin was a strong reversible inhibitor against CES1 and it could tightly bind on CES1 at the same ligand-binding site as BMBT. These findings are helpful for the deep understanding of the interactions between xenobiotics and CES1. - Highlights: • The inhibitory effects of six commonly used pyrethroids on human carboxylesterases were investigated. • Deltamethrin displayed strong inhibitory effects against human carboxylesterase 1 (CES1). • Deltamethrin was cell membrane permeable and could inhibit intracellular CES1 in living cells. • Both experimental and docking studies demonstrated that CES1 had at least two different ligand-binding sites.« less

  2. Internalization of the chemokine receptor CCR4 can be evoked by orthosteric and allosteric receptor antagonists

    PubMed Central

    Ajram, Laura; Begg, Malcolm; Slack, Robert; Cryan, Jenni; Hall, David; Hodgson, Simon; Ford, Alison; Barnes, Ashley; Swieboda, Dawid; Mousnier, Aurelie; Solari, Roberto

    2014-01-01

    The chemokine receptor CCR4 has at least two natural agonist ligands, MDC (CCL22) and TARC (CCL17) which bind to the same orthosteric site with a similar affinity. Both ligands are known to evoke chemotaxis of CCR4-bearing T cells and also elicit CCR4 receptor internalization. A series of small molecule allosteric antagonists have been described which displace the agonist ligand, and inhibit chemotaxis. The aim of this study was to determine which cellular coupling pathways are involved in internalization, and if antagonists binding to the CCR4 receptor could themselves evoke receptor internalization. CCL22 binding coupled CCR4 efficiently to β-arrestin and stimulated GTPγS binding however CCL17 did not couple to β-arrestin and only partially stimulated GTPγS binding. CCL22 potently induced internalization of almost all cell surface CCR4, while CCL17 showed only weak effects. We describe four small molecule antagonists that were demonstrated to bind to two distinct allosteric sites on the CCR4 receptor, and while both classes inhibited agonist ligand binding and chemotaxis, one of the allosteric sites also evoked receptor internalization. Furthermore, we also characterize an N-terminally truncated version of CCL22 which acts as a competitive antagonist at the orthosteric site, and surprisingly also evokes receptor internalization without demonstrating any agonist activity. Collectively this study demonstrates that orthosteric and allosteric antagonists of the CCR4 receptor are capable of evoking receptor internalization, providing a novel strategy for drug discovery against this class of target. PMID:24534492

  3. A map of human PRDM9 binding provides evidence for novel behaviors of PRDM9 and other zinc-finger proteins in meiosis

    PubMed Central

    Noor, Nudrat; Bitoun, Emmanuelle; Tumian, Afidalina; Imbeault, Michael; Chapman, J Ross; Aricescu, A Radu

    2017-01-01

    PRDM9 binding localizes almost all meiotic recombination sites in humans and mice. However, most PRDM9-bound loci do not become recombination hotspots. To explore factors that affect binding and subsequent recombination outcomes, we mapped human PRDM9 binding sites in a transfected human cell line and measured PRDM9-induced histone modifications. These data reveal varied DNA-binding modalities of PRDM9. We also find that human PRDM9 frequently binds promoters, despite their low recombination rates, and it can activate expression of a small number of genes including CTCFL and VCX. Furthermore, we identify specific sequence motifs that predict consistent, localized meiotic recombination suppression around a subset of PRDM9 binding sites. These motifs strongly associate with KRAB-ZNF protein binding, TRIM28 recruitment, and specific histone modifications. Finally, we demonstrate that, in addition to binding DNA, PRDM9's zinc fingers also mediate its multimerization, and we show that a pair of highly diverged alleles preferentially form homo-multimers. PMID:29072575

  4. Lens-Specific Gene Recruitment of ζ-Crystallin through Pax6, Nrl-Maf, and Brain Suppressor Sites

    PubMed Central

    Sharon-Friling, Ronit; Richardson, Jill; Sperbeck, Sally; Lee, Douglas; Rauchman, Michael; Maas, Richard; Swaroop, Anand; Wistow, Graeme

    1998-01-01

    ζ-Crystallin is a taxon-specific crystallin, an enzyme which has undergone direct gene recruitment as a structural component of the guinea pig lens through a Pax6-dependent mechanism. Tissue specificity arises through a combination of effects involving three sites in the lens promoter. The Pax6 site (ZPE) itself shows specificity for an isoform of Pax6 preferentially expressed in lens cells. High-level expression of the promoter requires a second site, identical to an αCE2 site or half Maf response element (MARE), adjacent to the Pax6 site. A promoter fragment containing Pax6 and MARE sites gives lens-preferred induction of a heterologous promoter. Complexes binding the MARE in lens nuclear extracts are antigenically related to Nrl, and cotransfection with Nrl elevates ζ-crystallin promoter activity in lens cells. A truncated ζ promoter containing Nrl-MARE and Pax6 sites has a high level of expression in lens cells in transgenic mice but is also active in the brain. Suppression of the promoter in the brain requires sequences between −498 and −385, and a site in this region forms specific complexes in brain extract. A three-level model for lens-specific Pax6-dependent expression and gene recruitment is suggested: (i) binding of a specific isoform of Pax6; (ii) augmentation of expression through binding of Nrl or a related factor; and (iii) suppression of promoter activity in the central nervous system by an upstream negative element in the brain but not in the lens. PMID:9528779

  5. The Bacterial Response Regulator ArcA Uses a Diverse Binding Site Architecture to Regulate Carbon Oxidation Globally

    PubMed Central

    Park, Dan M.; Akhtar, Md. Sohail; Ansari, Aseem Z.; Landick, Robert; Kiley, Patricia J.

    2013-01-01

    Despite the importance of maintaining redox homeostasis for cellular viability, how cells control redox balance globally is poorly understood. Here we provide new mechanistic insight into how the balance between reduced and oxidized electron carriers is regulated at the level of gene expression by mapping the regulon of the response regulator ArcA from Escherichia coli, which responds to the quinone/quinol redox couple via its membrane-bound sensor kinase, ArcB. Our genome-wide analysis reveals that ArcA reprograms metabolism under anaerobic conditions such that carbon oxidation pathways that recycle redox carriers via respiration are transcriptionally repressed by ArcA. We propose that this strategy favors use of catabolic pathways that recycle redox carriers via fermentation akin to lactate production in mammalian cells. Unexpectedly, bioinformatic analysis of the sequences bound by ArcA in ChIP-seq revealed that most ArcA binding sites contain additional direct repeat elements beyond the two required for binding an ArcA dimer. DNase I footprinting assays suggest that non-canonical arrangements of cis-regulatory modules dictate both the length and concentration-sensitive occupancy of DNA sites. We propose that this plasticity in ArcA binding site architecture provides both an efficient means of encoding binding sites for ArcA, σ70-RNAP and perhaps other transcription factors within the same narrow sequence space and an effective mechanism for global control of carbon metabolism to maintain redox homeostasis. PMID:24146625

  6. Lactose binding to galectin-1 modulates structural dynamics, increases conformational entropy, and occurs with apparent negative cooperativity.

    PubMed

    Nesmelova, Irina V; Ermakova, Elena; Daragan, Vladimir A; Pang, Mabel; Menéndez, Margarita; Lagartera, Laura; Solís, Dolores; Baum, Linda G; Mayo, Kevin H

    2010-04-16

    Galectins are a family of lectins with a conserved carbohydrate recognition domain that interacts with beta-galactosides. By binding cell surface glycoconjugates, galectin-1 (gal-1) is involved in cell adhesion and migration processes and is an important regulator of tumor angiogenesis. Here, we used heteronuclear NMR spectroscopy and molecular modeling to investigate lactose binding to gal-1 and to derive solution NMR structures of gal-1 in the lactose-bound and unbound states. Structure analysis shows that the beta-strands and loops around the lactose binding site, which are more open and dynamic in the unbound state, fold in around the bound lactose molecule, dampening internal motions at that site and increasing motions elsewhere throughout the protein to contribute entropically to the binding free energy. CD data support the view of an overall more open structure in the lactose-bound state. Analysis of heteronuclear single quantum coherence titration binding data indicates that lactose binds the two carbohydrate recognition domains of the gal-1 dimer with negative cooperativity, in that the first lactose molecule binds more strongly (K(1)=21+/-6 x 10(3) M(-1)) than the second (K(2)=4+/-2 x 10(3) M(-1)). Isothermal calorimetry data fit using a sequential binding model present a similar picture, yielding K(1)=20+/-10 x 10(3) M(-1) and K(2)=1.67+/-0.07 x 10(3) M(-1). Molecular dynamics simulations provide insight into structural dynamics of the half-loaded lactose state and, together with NMR data, suggest that lactose binding at one site transmits a signal through the beta-sandwich and loops to the second binding site. Overall, our results provide new insight into gal-1 structure-function relationships and to protein-carbohydrate interactions in general. Copyright (c) 2010. Published by Elsevier Ltd.

  7. Upregulation of RhoB via c-Jun N-terminal kinase signaling induces apoptosis of the human gastric carcinoma NUGC-3 cells treated with NSC12618.

    PubMed

    Kim, Bo-Kyung; Kim, Hwan Mook; Chung, Kyung-Sook; Kim, Dong-Myung; Park, Song-Kyu; Song, Alexander; Won, Kyoung-Jae; Lee, Kiho; Oh, Yu-Kyoung; Lee, Kyeong; Song, Kyung-Bin; Simon, Julian A; Han, Gyoonhee; Won, Misun

    2011-03-01

    RhoB expression is reduced in most invasive tumors, with loss of RhoB expression correlating significantly with tumor stage. Here, we demonstrate that upregulation of RhoB by the potent anticancer agent NSC126188 induces apoptosis of NUGC-3 human gastric carcinoma cells. The crucial role of RhoB in NSC126188-induced apoptosis is indicated by the rescue of NUGC-3 cells from apoptosis by knockdown of RhoB. In the presence of NSC126188, c-Jun N-terminal kinase (JNK) signaling was activated, and the JNK inhibitor SP600125 reduced RhoB expression and suppressed the apoptosis of NUGC-3 cells. Knockdowns of mitogen-activated protein kinase kinase (MKK) 4/7, JNK1/2 and c-Jun downregulated RhoB expression and rescued cells from apoptotic death in the presence of NSC126188. The JNK inhibitor SP600125 suppressed transcriptional activation of RhoB in the presence of NSC126188, as indicated by a reporter assay that used luciferase under the RhoB promoter. The ability of NSC126188 to increase luciferase activity through both the p300-binding site and the inverted CCAAT sequence (iCCAAT box) suggests that JNK signaling to upregulate RhoB expression is mediated through both the p300-binding site and the iCCAAT box. However, the JNK inhibitor SP600125 did not inhibit the upregulation of RhoB by farnesyltransferase inhibitor (FTI)-277. The p300-binding site did not affect activation of the RhoB promoter by FTI-277 in NUGC-3 cells, suggesting that the transcriptional activation of RhoB by NSC126188 occurs by a different mechanism than that reported for FTIs. Our data indicate that NSC126188 increases RhoB expression via JNK-mediated signaling through a p300-binding site and iCCAAT box resulting in apoptosis of NUGC-3 cells.

  8. Penicillin-binding site on the Escherichia coli cell envelope

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Amaral, L.; Lee, Y.; Schwarz, U.

    The binding of /sup 35/S-labeled penicillin to distinct penicillin-binding proteins (PBPs) of the cell envelope obtained from the sonication of Escherichia coli was studied at different pHs ranging from 4 to 11. Experiments distinguishing the effect of pH on penicillin binding by PBP 5/6 from its effect on beta-lactamase activity indicated that although substantial binding occurred at the lowest pH, the amount of binding increased with pH, reaching a maximum at pH 10. Based on earlier studies, it is proposed that the binding at high pH involves the formation of a covalent bond between the C-7 of penicillin and freemore » epsilon amino groups of the PBPs. At pHs ranging from 4 to 8, position 1 of penicillin, occupied by sulfur, is considered to be the site that establishes a covalent bond with the sulfhydryl groups of PBP 5. The use of specific blockers of free epsilon amino groups or sulfhydryl groups indicated that wherever the presence of each had little or no effect on the binding of penicillin by PBP 5, the presence of both completely prevented binding. The specific blocker of the hydroxyl group of serine did not affect the binding of penicillin.« less

  9. Opposite actions of transforming growth factor-beta 1 on the gene expression of atrial natriuretic peptide biological and clearance receptors in a murine thymic stromal cell line.

    PubMed

    Agui, T; Xin, X; Cai, Y; Shim, G; Muramatsu, Y; Yamada, T; Fujiwara, H; Matsumoto, K

    1995-09-01

    The regulation of the gene expression of the atrial natriuretic peptide receptor (ANPR) subtypes, ANPR-A, ANPR-B, and ANPR-C, was investigated in a murine thymic stromal cell line, MRL 104.8a. When MRL 104.8a cells were cultured with transforming growth factor (TGF)-beta1, [125I]ANP binding sites increased with increasing dose of TGF-beta1. These binding sites were identified as ANPR-C by a displacement experiment with ANPR-C-specific ligand, C-ANF, and by the affinity cross-linking of the [125I]ANP binding sites with a chemical cross-linker to determine the molecular weight of the ANPR. This augmentation of the ANPR-C expression was elucidated to occur at the transcriptional level by Northern blot experiment, comparison of the relative amounts of mRNA by reverse transcription (RT)-PCR, and in vitro nuclear transcription assay. Conversely, the expression of the ANP biological receptors, ANPR-A and ANPR-B, was shown to be down-regulated by TGF-beta1. These data suggest that TGF-beta1 regulates the gene expression of ANPRs in the thymic stromal cells and that ANP and TGF-beta1 might affect the thymic stromal cell functions.

  10. The Sequence-specific Peptide-binding Activity of the Protein Sulfide Isomerase AGR2 Directs Its Stable Binding to the Oncogenic Receptor EpCAM.

    PubMed

    Mohtar, M Aiman; Hernychova, Lenka; O'Neill, J Robert; Lawrence, Melanie L; Murray, Euan; Vojtesek, Borek; Hupp, Ted R

    2018-04-01

    AGR2 is an oncogenic endoplasmic reticulum (ER)-resident protein disulfide isomerase. AGR2 protein has a relatively unique property for a chaperone in that it can bind sequence-specifically to a specific peptide motif (TTIYY). A synthetic TTIYY-containing peptide column was used to affinity-purify AGR2 from crude lysates highlighting peptide selectivity in complex mixtures. Hydrogen-deuterium exchange mass spectrometry localized the dominant region in AGR2 that interacts with the TTIYY peptide to within a structural loop from amino acids 131-135 (VDPSL). A peptide binding site consensus of Tx[IL][YF][YF] was developed for AGR2 by measuring its activity against a mutant peptide library. Screening the human proteome for proteins harboring this motif revealed an enrichment in transmembrane proteins and we focused on validating EpCAM as a potential AGR2-interacting protein. AGR2 and EpCAM proteins formed a dose-dependent protein-protein interaction in vitro Proximity ligation assays demonstrated that endogenous AGR2 and EpCAM protein associate in cells. Introducing a single alanine mutation in EpCAM at Tyr251 attenuated its binding to AGR2 in vitro and in cells. Hydrogen-deuterium exchange mass spectrometry was used to identify a stable binding site for AGR2 on EpCAM, adjacent to the TLIYY motif and surrounding EpCAM's detergent binding site. These data define a dominant site on AGR2 that mediates its specific peptide-binding function. EpCAM forms a model client protein for AGR2 to study how an ER-resident chaperone can dock specifically to a peptide motif and regulate the trafficking a protein destined for the secretory pathway. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. The Tip of the Four N-Terminal α-Helices of Clostridium sordellii Lethal Toxin Contains the Interaction Site with Membrane Phosphatidylserine Facilitating Small GTPases Glucosylation

    PubMed Central

    Varela Chavez, Carolina; Haustant, Georges Michel; Baron, Bruno; England, Patrick; Chenal, Alexandre; Pauillac, Serge; Blondel, Arnaud; Popoff, Michel-Robert

    2016-01-01

    Clostridium sordellii lethal toxin (TcsL) is a powerful virulence factor responsible for severe toxic shock in man and animals. TcsL belongs to the large clostridial glucosylating toxin (LCGT) family which inactivates small GTPases by glucosylation with uridine-diphosphate (UDP)-glucose as a cofactor. Notably, TcsL modifies Rac and Ras GTPases, leading to drastic alteration of the actin cytoskeleton and cell viability. TcsL enters cells via receptor-mediated endocytosis and delivers the N-terminal glucosylating domain (TcsL-cat) into the cytosol. TcsL-cat was found to preferentially bind to phosphatidylserine (PS)-containing membranes and to increase the glucosylation of Rac anchored to the lipid membrane. We have previously reported that the N-terminal four helical bundle structure (1–93 domain) recognizes a broad range of lipids, but that TcsL-cat specifically binds to PS and phosphatidic acid. Here, we show using mutagenesis that the PS binding site is localized on the tip of the four-helix bundle which is rich in positively-charged amino acids. Residues Y14, V15, F17, and R18 on loop 1, between helices 1 and 2, in coordination with R68 from loop 3, between helices 3 and 4, form a pocket which accommodates L-serine. The functional PS-binding site is required for TcsL-cat binding to the plasma membrane and subsequent cytotoxicity. TcsL-cat binding to PS facilitates a high enzymatic activity towards membrane-anchored Ras by about three orders of magnitude as compared to Ras in solution. The PS-binding site is conserved in LCGTs, which likely retain a common mechanism of binding to the membrane for their full activity towards membrane-bound GTPases. PMID:27023605

  12. The Association of Myosin IB with Actin Waves in Dictyostelium Requires Both the Plasma Membrane-Binding Site and Actin-Binding Region in the Myosin Tail

    PubMed Central

    Brzeska, Hanna; Pridham, Kevin; Chery, Godefroy; Titus, Margaret A.; Korn, Edward D.

    2014-01-01

    F-actin structures and their distribution are important determinants of the dynamic shapes and functions of eukaryotic cells. Actin waves are F-actin formations that move along the ventral cell membrane driven by actin polymerization. Dictyostelium myosin IB is associated with actin waves but its role in the wave is unknown. Myosin IB is a monomeric, non-filamentous myosin with a globular head that binds to F-actin and has motor activity, and a non-helical tail comprising a basic region, a glycine-proline-glutamine-rich region and an SH3-domain. The basic region binds to acidic phospholipids in the plasma membrane through a short basic-hydrophobic site and the Gly-Pro-Gln region binds F-actin. In the current work we found that both the basic-hydrophobic site in the basic region and the Gly-Pro-Gln region of the tail are required for the association of myosin IB with actin waves. This is the first evidence that the Gly-Pro-Gln region is required for localization of myosin IB to a specific actin structure in situ. The head is not required for myosin IB association with actin waves but binding of the head to F-actin strengthens the association of myosin IB with waves and stabilizes waves. Neither the SH3-domain nor motor activity is required for association of myosin IB with actin waves. We conclude that myosin IB contributes to anchoring actin waves to the plasma membranes by binding of the basic-hydrophobic site to acidic phospholipids in the plasma membrane and binding of the Gly-Pro-Gln region to F-actin in the wave. PMID:24747353

  13. [Molecular organization of glutamate-sensitive chemoexcitatory membranes of nerve cells. Binding of L-[3H]glutamate to synaptic membranes of the rat cerebral cortex].

    PubMed

    Dambinova, S A; Gorodinskiĭ, A I

    1984-01-01

    The binding of L-[3H]glutamate to rat cerebral cortex synaptic membranes was investigated. Two types of binding sites, a Na+-independent (Kd = 140-160 nm; Bmax = 3.8-4.5 pmol-mg of protein) and a Na+-dependent (Kd = 2.0 microM; Bmax = 45-50 pmol/mg of protein) ones, were detected. The dependence of Na+-insensitive binding on time and temperature and membrane content in a sample was determined. Mono- and divalent cations (5-10 mM) potentiated specific binding by 2.1-3.3 times. The Na+-dependent binding is associated with active transport systems, while the Na+-independent one-with true receptor binding. The relationship between CNS glutamate receptors and Na+-independent binding sites is discussed.

  14. Single-strand DNA binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs

    PubMed Central

    Pandita, Raj K.; Chow, Tracy T.; Udayakumar, Durga; Bain, Amanda L.; Cubeddu, Liza; Hunt, Clayton R.; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E.; Khanna, Kum Kum; Shay, Jerry W.; Pandita, Tej K.

    2015-01-01

    Proliferating mammalian stem and cancer cells express telomerase (TERT) in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA binding protein SSB1, which has a critical role in DNA double-strand break repair. Here we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacted with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduced TERT interaction with telomeres and lead to G-overhang loss. While SSB1 was recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relied upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. PMID:25589350

  15. Binding and effects of KATP channel openers in the vascular smooth muscle cell line, A10

    PubMed Central

    Russ, Ulrich; Metzger, Friedrich; Kickenweiz, Elisabeth; Hambrock, Annette; Krippeit-Drews, Peter; Quast, Ulrich

    1997-01-01

    The ATP-sensitive K+ channel (KATP channel) in A10 cells, a cell line derived from rat thoracic aorta, was characterized by binding studies with the tritiated KATP channel opener, [3H]-P1075, and by electrophysiological techniques. Saturation binding experiments gave a KD value of 9.2±5.2 nM and a binding capacity (BMax) of 140±40 fmol mg−1 protein for [3H]-P1075 binding to A10 cells; from the BMax value a density of binding sites of 5–10 per μm2 plasmalemma was estimated. KATP channel modulators such as the openers P1075, pinacidil, levcromakalim and minoxidil sulphate and the blocker glibenclamide inhibited [3H]-P1075 binding. The extent of inhibition at saturation depended on the compound, levcromakalim inhibiting specific [3H]-P1075 binding by 85%, minoxidil sulphate and glibenclamide by 70%. The inhibition constants were similar to those determined in strips of rat aorta. Resting membrane potential, recorded with microelectrodes, was −51±1 mV. P1075 and levcromakalim produced a concentration-dependent hyperpolarization by up to −25 mV with EC50 values of 170±40 nM and 870±190 nM, respectively. The hyperpolarization induced by levcromakalim (3 μM) was completely reversed by glibenclamide with an IC50 value of 86±17 nM. Voltage clamp experiments were performed in the whole cell configuration under a physiological K+ gradient. Levcromakalim (10 μM) induced a current which reversed around −80 mV; the current-voltage relationship showed considerable outward rectification. Glibenclamide (3 μM) abolished the effect of levcromakalim. Analysis of the noise of the levcromakalim (10 μM)-induced current at −40 and −20 mV yielded estimates of the channel density, the single channel conductance and the probability of the channel to be open of 0.14 μm−2, 8.8 pS and 0.39, respectively. The experiments showed that A10 cells are endowed with functional KATP channels which resemble those in vascular tissue; hence, these cells provide an easily accessible source of channels for biochemical and pharmacological studies. The density of binding sites for [3H]-P1075 was estimated to be one order of magnitude higher than the density of functional KATP channels; assuming a plasmalemmal localization of the binding sites this suggests a large receptor reserve for the openers in A10 cells. PMID:9401776

  16. Differences in Ribosome Binding and Sarcin/Ricin Loop Depurination by Shiga and Ricin Holotoxins.

    PubMed

    Li, Xiao-Ping; Tumer, Nilgun E

    2017-04-11

    Both ricin and Shiga holotoxins display no ribosomal activity in their native forms and need to be activated to inhibit translation in a cell-free translation inhibition assay. This is because the ribosome binding site of the ricin A chain (RTA) is blocked by the B subunit in ricin holotoxin. However, it is not clear why Shiga toxin 1 (Stx1) or Shiga toxin 2 (Stx2) holotoxin is not active in a cell-free system. Here, we compare the ribosome binding and depurination activity of Stx1 and Stx2 holotoxins with the A1 subunits of Stx1 and Stx2 using either the ribosome or a 10-mer RNA mimic of the sarcin/ricin loop as substrates. Our results demonstrate that the active sites of Stx1 and Stx2 holotoxins are blocked by the A2 chain and the B subunit, while the ribosome binding sites are exposed to the solvent. Unlike ricin, which is enzymatically active, but cannot interact with the ribosome, Stx1 and Stx2 holotoxins are enzymatically inactive but can interact with the ribosome.

  17. Histatin 5 binds to Porphyromonas gingivalis hemagglutinin B (HagB) and alters HagB-induced chemokine responses

    NASA Astrophysics Data System (ADS)

    Borgwardt, Derek S.; Martin, Aaron D.; van Hemert, Jonathan R.; Yang, Jianyi; Fischer, Carol L.; Recker, Erica N.; Nair, Prashant R.; Vidva, Robinson; Chandrashekaraiah, Shwetha; Progulske-Fox, Ann; Drake, David; Cavanaugh, Joseph E.; Vali, Shireen; Zhang, Yang; Brogden, Kim A.

    2014-01-01

    Histatins are human salivary gland peptides with anti-microbial and anti-inflammatory activities. In this study, we hypothesized that histatin 5 binds to Porphyromonas gingivalis hemagglutinin B (HagB) and attenuates HagB-induced chemokine responses in human myeloid dendritic cells. Histatin 5 bound to immobilized HagB in a surface plasmon resonance (SPR) spectroscopy-based biosensor system. SPR spectroscopy kinetic and equilibrium analyses, protein microarray studies, and I-TASSER structural modeling studies all demonstrated two histatin 5 binding sites on HagB. One site had a stronger affinity with a KD1 of 1.9 μM and one site had a weaker affinity with a KD2 of 60.0 μM. Binding has biological implications and predictive modeling studies and exposure of dendritic cells both demonstrated that 20.0 μM histatin 5 attenuated (p < 0.05) 0.02 μM HagB-induced CCL3/MIP-1α, CCL4/MIP-1β, and TNFα responses. Thus histatin 5 is capable of attenuating chemokine responses, which may help control oral inflammation.

  18. The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

    PubMed

    Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J

    1992-03-01

    The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary.

  19. The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

    PubMed Central

    Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J

    1992-01-01

    The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788

  20. Host-Primed Ebola Virus GP Exposes a Hydrophobic NPC1 Receptor-Binding Pocket, Revealing a Target for Broadly Neutralizing Antibodies.

    PubMed

    Bornholdt, Zachary A; Ndungo, Esther; Fusco, Marnie L; Bale, Shridhar; Flyak, Andrew I; Crowe, James E; Chandran, Kartik; Saphire, Erica Ollmann

    2016-02-23

    The filovirus surface glycoprotein (GP) mediates viral entry into host cells. Following viral internalization into endosomes, GP is cleaved by host cysteine proteases to expose a receptor-binding site (RBS) that is otherwise hidden from immune surveillance. Here, we present the crystal structure of proteolytically cleaved Ebola virus GP to a resolution of 3.3 Å. We use this structure in conjunction with functional analysis of a large panel of pseudotyped viruses bearing mutant GP proteins to map the Ebola virus GP endosomal RBS at molecular resolution. Our studies indicate that binding of GP to its endosomal receptor Niemann-Pick C1 occurs in two distinct stages: the initial electrostatic interactions are followed by specific interactions with a hydrophobic trough that is exposed on the endosomally cleaved GP1 subunit. Finally, we demonstrate that monoclonal antibodies targeting the filovirus RBS neutralize all known filovirus GPs, making this conserved pocket a promising target for the development of panfilovirus therapeutics. Ebola virus uses its glycoprotein (GP) to enter new host cells. During entry, GP must be cleaved by human enzymes in order for receptor binding to occur. Here, we provide the crystal structure of the cleaved form of Ebola virus GP. We demonstrate that cleavage exposes a site at the top of GP and that this site binds the critical domain C of the receptor, termed Niemann-Pick C1 (NPC1). We perform mutagenesis to find parts of the site essential for binding NPC1 and map distinct roles for an upper, charged crest and lower, hydrophobic trough in cleaved GP. We find that this 3-dimensional site is conserved across the filovirus family and that antibody directed against this site is able to bind cleaved GP from every filovirus tested and neutralize viruses bearing those GPs. Copyright © 2016 Bornholdt et al.

  1. The transcription repressor, ZEB1, cooperates with CtBP2 and HDAC1 to suppress IL-2 gene activation in T cells.

    PubMed

    Wang, Jun; Lee, Seungsoo; Teh, Charis En-Yi; Bunting, Karen; Ma, Lina; Shannon, M Frances

    2009-03-01

    Activation of T cells leads to the induction of many cytokine genes that are required for appropriate immune responses, including IL-2, a key cytokine for T cell proliferation and homeostasis. The activating transcription factors such as nuclear factor of activated T cells, nuclear factor kappaB/Rel and activated protein-1 family members that regulate inducible IL-2 gene expression have been well documented. However, negative regulation of the IL-2 gene is less studied. Here we examine the role of zinc finger E-box-binding protein (ZEB) 1, a homeodomain/Zn finger transcription factor, as a repressor of IL-2 gene transcription. We show here that ZEB1 is expressed in non-stimulated and stimulated T cells and using chromatin immunoprecipitation assays we show that ZEB1 binds to the IL-2 promoter. Over-expression of ZEB1 can repress IL-2 promoter activity, as well as endogenous IL-2 mRNA production in EL-4 T cells, and this repression is dependent on the ZEB-binding site at -100. ZEB1 cooperates with the co-repressor C-terminal-binding protein (CtBP) 2 and with histone deacetylase 1 to repress the IL-2 promoter and this cooperation depends on the ZEB-binding site in the promoter as well as the Pro-X-Asp-Leu-Ser protein-protein interaction domain in CtBP2. Thus, ZEB1 may function to recruit a repressor complex to the IL-2 promoter.

  2. Microsomal receptor for steroid hormones: functional implications for nuclear activity.

    PubMed

    Muldoon, T G; Watson, G H; Evans, A C; Steinsapir, J

    1988-01-01

    Target tissues for steroid hormones are responsive by virtue of and to the extent of their content of functional intracellular receptors. Recent years have seen a shift in considerations of the cellular dynamics and distribution of these receptors, with current views favoring predominant intranuclear localization in the intact cell. This paper summarizes our analyses of the microsomal estrogen and androgen binding capability of rat uterine and ventral prostate tissue, respectively; these studies have revealed a set of high affinity sites that may act as a conduit for estrogen traversing the cell en route to the nucleus. These sites have many properties in common with cytosolic receptors, with the salient difference of a failure to activate to a more avid DNA-binding form under conditions which permit such activation of cytosolic receptors. The microsomal estrogen-binding proteins also have appreciable affinity for progesterone, another distinction from other known cellular estrogen receptor species. Various experimental approaches were employed to demonstrate that the microsomal receptors were not simply cytosol contaminants; the most convincing evidence is the recent successful separation of the cytosolic and microsomal forms by differential ammonium sulfate precipitation. Discrete subfractionation of subcellular components on successive sucrose gradients, with simultaneous assessments of binding capability and marker enzyme concentrations, indicates that the major portion of the binding is localized within the vesicles of the endoplasmic reticulum free of significant plasma membrane contamination. The microsomal receptors are readily solubilized by extraction with high- or low-salt-containing buffers or with steroid. The residual microsomes following such extraction have the characteristics of saturable acceptor sites for cytosolic estrogen-receptor complexes. The extent to which these sites will accept the cytosolic complexes is equal to the concentration of microsomal binding sites extracted. These observations suggest three possible roles for the microsomal receptor-like proteins: (a) modulation of estrogen access to nuclear binding sites; (b) formation of functional complexes which diffuse to other extranuclear sites to alter non-genomic cellular processes; (c) regulation of nuclear concentration of estrogen-receptor complexes by virtue of producing microsomal acceptor sites for uptake of free or loosely associated nuclear complexes, previously thought to exist in the cytoplasm.

  3. A phosphoinositide-binding cluster in cavin1 acts as a molecular sensor for cavin1 degradation

    PubMed Central

    Tillu, Vikas A.; Kovtun, Oleksiy; McMahon, Kerrie-Ann; Collins, Brett M.; Parton, Robert G.

    2015-01-01

    Caveolae are abundant surface organelles implicated in a range of cellular processes. Two classes of proteins work together to generate caveolae: integral membrane proteins termed caveolins and cytoplasmic coat proteins called cavins. Caveolae respond to membrane stress by releasing cavins into the cytosol. A crucial aspect of this model is tight regulation of cytosolic pools of cavin under resting conditions. We now show that a recently identified region of cavin1 that can bind phosphoinositide (PI) lipids is also a major site of ubiquitylation. Ubiquitylation of lysines within this site leads to rapid proteasomal degradation. In cells that lack caveolins and caveolae, cavin1 is cytosolic and rapidly degraded as compared with cells in which cavin1 is associated with caveolae. Membrane stretching causes caveolar disassembly, release of cavin complexes into the cytosol, and increased proteasomal degradation of wild-type cavin1 but not mutant cavin1 lacking the major ubiquitylation site. Release of cavin1 from caveolae thus leads to exposure of key lysine residues in the PI-binding region, acting as a trigger for cavin1 ubiquitylation and down-regulation. This mutually exclusive PI-binding/ubiquitylation mechanism may help maintain low levels of cytosolic cavin1 in resting cells, a prerequisite for cavins acting as signaling modules following release from caveolae. PMID:26269585

  4. Modulation of Enhancer Looping and Differential Gene Targeting by Epstein-Barr Virus Transcription Factors Directs Cellular Reprogramming

    PubMed Central

    McClellan, Michael J.; Wood, C. David; Ojeniyi, Opeoluwa; Cooper, Tim J.; Kanhere, Aditi; Arvey, Aaron; Webb, Helen M.; Palermo, Richard D.; Harth-Hertle, Marie L.; Kempkes, Bettina; Jenner, Richard G.; West, Michelle J.

    2013-01-01

    Epstein-Barr virus (EBV) epigenetically reprogrammes B-lymphocytes to drive immortalization and facilitate viral persistence. Host-cell transcription is perturbed principally through the actions of EBV EBNA 2, 3A, 3B and 3C, with cellular genes deregulated by specific combinations of these EBNAs through unknown mechanisms. Comparing human genome binding by these viral transcription factors, we discovered that 25% of binding sites were shared by EBNA 2 and the EBNA 3s and were located predominantly in enhancers. Moreover, 80% of potential EBNA 3A, 3B or 3C target genes were also targeted by EBNA 2, implicating extensive interplay between EBNA 2 and 3 proteins in cellular reprogramming. Investigating shared enhancer sites neighbouring two new targets (WEE1 and CTBP2) we discovered that EBNA 3 proteins repress transcription by modulating enhancer-promoter loop formation to establish repressive chromatin hubs or prevent assembly of active hubs. Re-ChIP analysis revealed that EBNA 2 and 3 proteins do not bind simultaneously at shared sites but compete for binding thereby modulating enhancer-promoter interactions. At an EBNA 3-only intergenic enhancer site between ADAM28 and ADAMDEC1 EBNA 3C was also able to independently direct epigenetic repression of both genes through enhancer-promoter looping. Significantly, studying shared or unique EBNA 3 binding sites at WEE1, CTBP2, ITGAL (LFA-1 alpha chain), BCL2L11 (Bim) and the ADAMs, we also discovered that different sets of EBNA 3 proteins bind regulatory elements in a gene and cell-type specific manner. Binding profiles correlated with the effects of individual EBNA 3 proteins on the expression of these genes, providing a molecular basis for the targeting of different sets of cellular genes by the EBNA 3s. Our results therefore highlight the influence of the genomic and cellular context in determining the specificity of gene deregulation by EBV and provide a paradigm for host-cell reprogramming through modulation of enhancer-promoter interactions by viral transcription factors. PMID:24068937

  5. Evidence that the novobiocin-sensitive ATP-binding site of the heat shock protein 90 (hsp90) is necessary for its autophosphorylation.

    PubMed

    Langer, T; Schlatter, H; Fasold, H

    2002-01-01

    The 90kDa heat shock protein (Hsp90) is one of the most abundant protein and essential for all eukaryotic cells. Many proteins require the interaction with Hsp90 for proper function. Upon heat stress the expression level of Hsp90 is even enhanced. It is assumed, that under these conditions Hsp90 is required to protect other proteins from aggregation. One property of Hsp90 is its ability to undergo autophosphorylation. The N-terminal domain of Hsp90 has been shown to contain an unusual ATP-binding site. A well-known inhibitor of Hsp90 function is geldanamycin binding to the N-terminal ATP-binding site with high affinity. Recently it was shown that Hsp90 possesses a second ATP-binding site in the C-terminal region, which can be competed with novobiocin. Autophosphorylation of Hsp90 was analysed by incubation with gamma(32)P-ATP. Addition of geldanamycin did not interfere with the capability for autophosphorylation, while novobiocin indeed did. These results suggest that the C-terminal ATP-binding site is required for autophosphorylation of Hsp90.

  6. Synthetic PAMAM-RGD conjugates target and bind to odontoblast-like MDPC 23 cells and the predentin in tooth organ cultures.

    PubMed

    Hill, Elliott; Shukla, Rameshwer; Park, Steve S; Baker, James R

    2007-01-01

    Screening techniques now allow for the identification of small peptides that bind specifically to molecules like cells. However, despite the enthusiasm for this approach, single peptides often lack the binding affinity to target in vivo and regulate cell function. We took peptides containing the Arg-Gly Asp(RGD) motif that bind to the alpha Vbeta 3 integrin and have shown potential as therapeutics. To improve their binding affinity, we synthesized polyamidoamine (PAMAM) dendrimer-RGD conjugates that that contain 12-13 copies of the peptide. When cultured with human dermal microvessel endothelial cells (HDMEC), human vascular endothelial cells (HUVEC), or odontoblast-like MDPC-23 cells, the PAMAM dendrimer conjugate targets this receptor in a manner that is both time- and dose-dependent. Finally, this conjugate selectively targets RGD binding sites in the predentin of human tooth organ cultures. Taken together, these studies provide proof of principle that synthetic PAMAM-RGD conjugates could prove useful as carriers for the tissue-specific delivery of integrin-targeted therapeutics or imaging agents and could be used to engineer tissue regeneration.

  7. Immobilization of concanavalin A receptors during differentiation of neuroblastoma cells.

    PubMed

    Fishman, M C; Dragsten, P R; Spector, I

    1981-04-30

    Neuroblastoma cells serve as a useful model of neuronal development because compounds such as dimethyl sulphoxide (DMSO) and dibutyryl cyclic AMP cause them to undergo a process of controlled differentiation in tissue culture, during which they can extend long processes, develop characteristic excitability mechanisms, synthesize neurotransmitters and form synapses. We have used the technique of fluorescence photobleaching recovery to study the lateral mobility of cell-surface constituents during the differentiation of neuroblastoma clone N1E-115 cells. The concanavalin A (Con A) binding sites appear as discrete patches distributed over the entire cell surface and exhibit lateral mobility in undifferentiated cells comparable with that of surface glycoproteins of other cells. After induction of differentiation, however, the vast majority of Con A binding sites become immobilized, and we present data which suggest that the mechanism of this immobilization may involve linkage to the internal actin network.

  8. Revealing multi-binding sites for taspine to VEGFR-2 by cell membrane chromatography zonal elution.

    PubMed

    Du, Hui; Wang, Sicen; Ren, Jing; Lv, Nan; He, Langchong

    2012-03-01

    A new high-expression vascular endothelial growth factor receptor-2 (VEGFR-2) cell membrane chromatography (CMC) method was developed to investigate the affinity of ligands for VEGFR-2. An HEK293 VEGFR-2/CMC system was applied to specifically recognize ligands acting on VEGFR-2. Sorafenib was used as a mobile phase additive to evaluate the effect of the marker's concentration on the retention of sorafenib and taspine, respectively. The relationship among the retention, the types of binding sites and the affinity of taspine binding to VEGFR-2 has also been concerned. The retention behavior indicated that sorafenib had two major binding regions on VEGFR-2, and that taspine might act as a multi-target VEGFR-2 inhibitor with similar biological activity to sorafenib. The equilibrium dissociation constants (K(D)) obtained from the model are (5.25 ± 0.31) × 10⁻⁷ and (9.88 ± 0.54) × 10⁻⁵ mol L⁻¹ for sorafenib at the high- and low-affinity sites, respectively, and the corresponding values for taspine are (3.88 ± 0.31) × 10⁻⁶ and (7.04 ± 0.49)×10⁻⁵ mol L⁻¹. The two types of binding sites contributed about a 1:2 ratio on the retention of taspine. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Determinants of RNA binding and translational repression by the Bicaudal-C regulatory protein.

    PubMed

    Zhang, Yan; Park, Sookhee; Blaser, Susanne; Sheets, Michael D

    2014-03-14

    Bicaudal-C (Bic-C) RNA binding proteins function as important translational repressors in multiple biological contexts within metazoans. However, their RNA binding sites are unknown. We recently demonstrated that Bic-C functions in spatially regulated translational repression of the xCR1 mRNA during Xenopus development. This repression contributes to normal development by confining the xCR1 protein, a regulator of key signaling pathways, to specific cells of the embryo. In this report, we combined biochemical approaches with in vivo mRNA reporter assays to define the minimal Bic-C target site within the xCR1 mRNA. This 32-nucleotide Bic-C target site is predicted to fold into a stem-loop secondary structure. Mutational analyses provided evidence that this stem-loop structure is important for Bic-C binding. The Bic-C target site was sufficient for Bic-C mediated repression in vivo. Thus, we describe the first RNA binding site for a Bic-C protein. This identification provides an important step toward understanding the mechanisms by which evolutionarily conserved Bic-C proteins control cellular function in metazoans.

  10. FOXM1 promotes the progression of prostate cancer by regulating PSA gene transcription.

    PubMed

    Liu, Youhong; Liu, Yijun; Yuan, Bowen; Yin, Linglong; Peng, Yuchong; Yu, Xiaohui; Zhou, Weibing; Gong, Zhicheng; Liu, Jianye; He, Leye; Li, Xiong

    2017-03-07

    Androgen/AR is the primary contributor to prostate cancer (PCa) progression by regulating Prostate Specific Antigen (PSA) gene transcription. The disease inevitably evolves to androgen-independent (AI) status. Other mechanisms by which PSA is regulated and develops to AI have not yet been fully determined. FOXM1 is a cell proliferation-specific transcription factor highly expressed in PCa cells compared to non-malignant prostate epithelial cells, suggesting that the aberrant overexpression of FOXM1 contributes to PCa development. In addition to regulating AR gene transcription and cell cycle-regulatory genes, FOXM1 selectively regulates the gene transcription of KLK2 and PSA, typical androgen responsive genes. Screening the potential FOXM1-binding sites by ChIP-PCR, we found that FOXM1 directly binds to the FHK binding motifs in the PSA promoter/enhancer regions. AI C4-2 cells have more FOXM1 binding sites than androgen dependent LNCaP cells. The depletion of FOXM1 by small molecular inhibitors significantly improves the suppression of PSA gene transcription by the anti-AR agent Cadosax. This is the first report showing that FOXM1 promotes PCa progression by regulating PSA gene transcription, particularly in AI PCa cells. The combination of anti-AR agents and FOXM1 inhibitors has the potential to greatly improve therapy for late-stage PCa patients by suppressing PSA levels.

  11. Inhibition of selectin binding

    DOEpatents

    Nagy, Jon O.; Spevak, Wayne R.; Dasgupta, Falguni; Bertozzi, Caroline

    2001-10-09

    This invention provides compositions for inhibiting the binding between two cells, one expressing P- or L-selectin on the surface and the other expressing the corresponding ligand. A covalently crosslinked lipid composition is prepared having saccharides and acidic group on separate lipids. The composition is then interposed between the cells so as to inhibit binding. Inhibition can be achieved at an effective oligosaccharide concentration as low as 10.sup.6 fold below that of the free saccharide. Since selectins are involved in recruiting cells to sites of injury, these composition scan be used to palliate certain inflammatory and immunological conditions.

  12. Inhibition of selectin binding

    DOEpatents

    Nagy, Jon O.; Spevak, Wayne R.; Dasgupta, Falguni; Bertozzi, Caroline

    1999-01-01

    This invention provides compositions for inhibiting the binding between two cells, one expressing P- or L-selectin on the surface and the other expressing the corresponding ligand. A covalently crosslinked lipid composition is prepared having saccharides and acidic group on separate lipids. The composition is then interposed between the cells so as to inhibit binding. Inhibition can be achieved at an effective oligosaccharide concentration as low as 10.sup.6 fold below that of the free saccharide. Since selectins are involved in recruiting cells to sites of injury, these composition scan be used to palliate certain inflammatory and immunological conditions.

  13. Inhibition of selectin binding

    DOEpatents

    Nagy, Jon O.; Spevak, Wayne R.; Dasgupta, Falguni; Bertozzi, Carolyn

    1999-10-05

    This invention provides a system for inhibiting the binding between two cells, one expressing P- or L-selectin on the surface and the other expressing the corresponding ligand. A covalently crosslinked lipid composition is prepared having saccharides and acidic group on separate lipids. The composition is then interposed between the cells so as to inhibit binding. Inhibition can be achieved at an effective oligosaccharide concentration as low as 10.sup.6 fold below that of the free saccharide. Since selectins are involved in recruiting cells to sites of injury, this system can be used to palliate certain inflammatory and immunological conditions.

  14. Translation of Polioviral mRNA Is Inhibited by Cleavage of Polypyrimidine Tract-Binding Proteins Executed by Polioviral 3Cpro

    PubMed Central

    Back, Sung Hoon; Kim, Yoon Ki; Kim, Woo Jae; Cho, Sungchan; Oh, Hoe Rang; Kim, Jung-Eun; Jang, Sung Key

    2002-01-01

    The translation of polioviral mRNA occurs through an internal ribosomal entry site (IRES). Several RNA-binding proteins, such as polypyrimidine tract-binding protein (PTB) and poly(rC)-binding protein (PCBP), are required for the poliovirus IRES-dependent translation. Here we report that a poliovirus protein, 3Cpro (and/or 3CDpro), cleaves PTB isoforms (PTB1, PTB2, and PTB4). Three 3Cpro target sites (one major target site and two minor target sites) exist in PTBs. PTB fragments generated by poliovirus infection are redistributed to the cytoplasm from the nucleus, where most of the intact PTBs are localized. Moreover, these PTB fragments inhibit polioviral IRES-dependent translation in a cell-based assay system. We speculate that the proteolytic cleavage of PTBs may contribute to the molecular switching from translation to replication of polioviral RNA. PMID:11836431

  15. Tumorigenic Potential of Transit Amplifying Prostate Cells

    DTIC Science & Technology

    2012-06-01

    by ChIP-Seq showed that in both the human prostate cell line LNCaP and in mouse prostate, NKX3.1 bound DNA fragments are significantly enriched in...progression. Cancer Cell. 2010;17(5):443–454. 29. Steadman DJ, Giuffrida D, Gelmann EP. DNA - binding sequence of the human prostate-specific...bind nucleosomal DNA and destabilize nucleosomes thereby allowing other transcription factors to access their sites (7),(8). BODY Aim 1: To

  16. Highly accessible AU-rich regions in 3' untranslated regions are hotspots for binding of regulatory factors.

    PubMed

    Plass, Mireya; Rasmussen, Simon H; Krogh, Anders

    2017-04-01

    Post-transcriptional regulation is regarded as one of the major processes involved in the regulation of gene expression. It is mainly performed by RNA binding proteins and microRNAs, which target RNAs and typically affect their stability. Recent efforts from the scientific community have aimed at understanding post-transcriptional regulation at a global scale by using high-throughput sequencing techniques such as cross-linking and immunoprecipitation (CLIP), which facilitates identification of binding sites of these regulatory factors. However, the diversity in the experimental procedures and bioinformatics analyses has hindered the integration of multiple datasets and thus limited the development of an integrated view of post-transcriptional regulation. In this work, we have performed a comprehensive analysis of 107 CLIP datasets from 49 different RBPs in HEK293 cells to shed light on the complex interactions that govern post-transcriptional regulation. By developing a more stringent CLIP analysis pipeline we have discovered the existence of conserved regulatory AU-rich regions in the 3'UTRs where miRNAs and RBPs that regulate several processes such as polyadenylation or mRNA stability bind. Analogous to promoters, many factors have binding sites overlapping or in close proximity in these hotspots and hence the regulation of the mRNA may depend on their relative concentrations. This hypothesis is supported by RBP knockdown experiments that alter the relative concentration of RBPs in the cell. Upon AGO2 knockdown (KD), transcripts containing "free" target sites show increased expression levels compared to those containing target sites in hotspots, which suggests that target sites within hotspots are less available for miRNAs to bind. Interestingly, these hotspots appear enriched in genes with regulatory functions such as DNA binding and RNA binding. Taken together, our results suggest that hotspots are functional regulatory elements that define an extra layer of regulation of post-transcriptional regulatory networks.

  17. Highly accessible AU-rich regions in 3’ untranslated regions are hotspots for binding of regulatory factors

    PubMed Central

    2017-01-01

    Post-transcriptional regulation is regarded as one of the major processes involved in the regulation of gene expression. It is mainly performed by RNA binding proteins and microRNAs, which target RNAs and typically affect their stability. Recent efforts from the scientific community have aimed at understanding post-transcriptional regulation at a global scale by using high-throughput sequencing techniques such as cross-linking and immunoprecipitation (CLIP), which facilitates identification of binding sites of these regulatory factors. However, the diversity in the experimental procedures and bioinformatics analyses has hindered the integration of multiple datasets and thus limited the development of an integrated view of post-transcriptional regulation. In this work, we have performed a comprehensive analysis of 107 CLIP datasets from 49 different RBPs in HEK293 cells to shed light on the complex interactions that govern post-transcriptional regulation. By developing a more stringent CLIP analysis pipeline we have discovered the existence of conserved regulatory AU-rich regions in the 3’UTRs where miRNAs and RBPs that regulate several processes such as polyadenylation or mRNA stability bind. Analogous to promoters, many factors have binding sites overlapping or in close proximity in these hotspots and hence the regulation of the mRNA may depend on their relative concentrations. This hypothesis is supported by RBP knockdown experiments that alter the relative concentration of RBPs in the cell. Upon AGO2 knockdown (KD), transcripts containing “free” target sites show increased expression levels compared to those containing target sites in hotspots, which suggests that target sites within hotspots are less available for miRNAs to bind. Interestingly, these hotspots appear enriched in genes with regulatory functions such as DNA binding and RNA binding. Taken together, our results suggest that hotspots are functional regulatory elements that define an extra layer of regulation of post-transcriptional regulatory networks. PMID:28410363

  18. Expression, subcellular localization and regulation of sigma receptor in retinal Müller cells

    PubMed Central

    Jiang, Guoliang; Mysona, Barbara; Dun, Ying; Gnana-Prakasam, Jaya P.; Pabla, Navjotsin; Li, Weiguo; Dong, Zheng; Ganapathy, Vadivel; Smith, Sylvia B.

    2013-01-01

    Purpose Sigma receptors (σR) are non-opioid, non-phencyclidine binding sites with robust neuroprotective properties. σR1 is expressed in brain oligodendrocytes, but its expression and binding capacity have not been analyzed in retinal glial cells. This study examined the expression, subcellular localization, binding activity and regulation of σR1 in retinal Müller cells. Methods Primary mouse Müller cells (1°MC) were analyzed by RT-PCR, immunoblotting and immunocytochemistry for the expression of σR1 and data were compared to the rat Müller cell line, rMC-1 and rat ganglion cell line, RGC-5. Confocal microscopy was used to determine the subcellular σR1 location in 1°MC. Membranes prepared from these cells were used for binding assays using [3H]-pentazocine (PTZ). The kinetics of binding, the ability of various σR1 ligands to compete with σR1 binding and the effects of nitric oxide (NO) and reactive oxygen species (ROS) donors on binding were examined. Results σR1 is expressed in 1°MC and is localized to the nuclear and endoplasmic reticulum membranes. Binding assays showed that in 1°MCs, rMC-1 and RGC-5 cells, the binding of PTZ was saturable. [3H]-PTZ bound with high affinity in RGC-5 and rMC-1 cells and the binding was similarly robust in 1°MC. Competition studies showed marked inhibition of [3H]-PTZ binding in the presence of σR1-specific ligands. Incubation of cells with NO and ROS donors markedly increased σR1 binding activity. Conclusions Müller cells express σR1 and demonstrate robust σR1 binding activity, which is inhibited by σR1 ligands and is stimulated during oxidative stress. The potential of Müller cells to bind σR1 ligands may prove beneficial in retinal degenerative diseases such as diabetic retinopathy. PMID:17122151

  19. Microelectronic electroporation array

    NASA Astrophysics Data System (ADS)

    Johnson, Lee J.; Shaffer, Kara J.; Skeath, Perry; Perkins, Frank K.; Pancrazio, Joseph; Scribner, Dean

    2004-06-01

    Gene Array technology has allowed for the study of gene binding by creating thousands of potential binding sites on a single device. A limitation of the current technology is that the effects of the gene and the gene-derived proteins cannot be studied in situ the same way, thousand site cell arrays are not readily available. We propose a new device structure to study the effects of gene modification on cells. This new array technology uses electroporation to target specific areas within a cell culture for transfection of genes. Electroporation arrays will allow high throughput analysis of gene effects on a given cell's response to a stress or a genes ability to restore normal cell function in disease modeling cells. Fluorescent imaging of dye labeled indicator molecules or cell viability will provide results indicating the most effective genes. The electroporation array consists of a microelectronic circuit, ancillary electronics, protecting electrode surface for cell culturing and a perfusion system for gene or drug delivery. The advantages of the current device are that there are 3200 sites for electroporation, all or any subsets of the electrodes can be activated. The cells are held in place by the electrode material. This technology could also be applied to high throughput screening of cell impermeant drugs.

  20. Opposing effects of estradiol- and testosterone-membrane binding sites on T47D breast cancer cell apoptosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kampa, Marilena; Nifli, Artemissia-Phoebe; Charalampopoulos, Ioannis

    Classical steroid mode of action involves binding to intracellular receptors, the later acting as ligand-activated nuclear transcription factors. Recently, membrane sites for different steroids have been also identified, mediating rapid, non-genomic, steroid actions. Membrane sites for estrogen and androgen have been found in a number of different cell types, bearing or not classical intracellular receptors. In the present study, with the use of radioligand binding, flow cytometry and confocal laser microscopy, we report that T47D human breast cancer cells express specific and saturable membrane receptors for both estrogen (K {sub D} 4.06 {+-} 3.31 nM) and androgen (K {sub D}more » 7.64 {+-} 3.15 nM). Upon activation with BSA-conjugated, non-permeable ligands (E{sub 2}-BSA and testosterone-BSA), membrane estrogen receptors protect cells from serum-deprivation-induced apoptosis, while androgen receptors induce apoptosis in serum-supplemented T47D cells. In addition, co-incubation of cells with a fixed concentration of one steroid and varying concentrations of the other reversed the abovementioned effect (apoptosis for androgen, and anti-apoptosis for E{sub 2}), suggesting that the fate of the cell depends on the relative concentration of either steroid in the culture medium. We also report the identification of membrane receptors for E{sub 2} and androgen in biopsy slides from breast cancer patients. Both sites are expressed, with the staining for membrane E{sub 2} being strongly present in ER-negative, less differentiated, more aggressive tumors. These findings suggest that aromatase inhibitors may exert their beneficial effects on breast cancer by also propagating the metabolism of local steroids towards androgen, inducing thus cell apoptosis through membrane androgen receptor activation.« less

  1. Cation binding at the node of Ranvier: I. Localization of binding sites during development.

    PubMed

    Zagoren, J C; Raine, C S; Suzuki, K

    1982-06-17

    Cations are known to bind to the node of Ranvier and the paranodal regions of myelinated fibers. The integrity of these specialized structures is essential for normal conduction. Sites of cation binding can be microscopically identified by the electrondense histochemical reaction product formed by the precipitate of copper sulfate/potassium ferrocyanide. This technique was used to study the distribution of cation binding during normal development of myelinating fibers. Sciatic nerves of C57B1 mice, at 1, 3, 5, 6, 7, 8, 9, 13, 16, 18, 24 and 30 days of age, were prepared for electron microscopy following fixation in phosphate-buffered 2.5% glutaraldehyde and 1% osmic acid, microdissection and incubation in phosphate-buffered 0.1 M cupric sulfate followed by 0.1 M potassium ferrocyanide. Localization of reaction product was studied by light and electron microscopy. By light microscopy, no reaction product was observed prior to 9 days of age. At 13 days, a few nodes and paranodes exhibited reaction product. This increased in frequency and intensity up to 30 days when almost all nodes or paranodes exhibited reaction product. Ultrastructurally, diffuse reaction product was first observed at 3 days of age in the axoplasm of the node, in the paranodal extracellular space of the terminal loops, in the Schwann cell proper and in the terminal loops of Schwann cell cytoplasm. When myelinated axons fulfilled the criteria for mature nodes, reaction product was no longer observed in the Schwann cell cytoplasm, while the intensity of reaction product in the nodal axoplasm and paranodal extracellular space of the terminal loops increased. Reaction product in the latter site appeared to be interrupted by the transverse bands. These results suggest that cation binding accompanies nodal maturity and that the Schwann cell may play a role in production or storage of the cation binding substance during myelinogenesis and development.

  2. Inhibition of Non-ATG Translational Events in Cells via Covalent Small Molecules Targeting RNA.

    PubMed

    Yang, Wang-Yong; Wilson, Henry D; Velagapudi, Sai Pradeep; Disney, Matthew D

    2015-04-29

    One major class of disease-causing RNAs is expanded repeating transcripts. These RNAs cause diseases via multiple mechanisms, including: (i) gain-of-function, in which repeating RNAs bind and sequester proteins involved in RNA biogenesis and (ii) repeat associated non-ATG (RAN) translation, in which repeating transcripts are translated into toxic proteins without use of a canonical, AUG, start codon. Herein, we develop and study chemical probes that bind and react with an expanded r(CGG) repeat (r(CGG)(exp)) present in a 5' untranslated region that causes fragile X-associated tremor/ataxia syndrome (FXTAS). Reactive compounds bind to r(CGG)(exp) in cellulo as shown with Chem-CLIP-Map, an approach to map small molecule binding sites within RNAs in cells. Compounds also potently improve FXTAS-associated pre-mRNA splicing and RAN translational defects, while not affecting translation of the downstream open reading frame. In contrast, oligonucleotides affect both RAN and canonical translation when they bind to r(CGG)(exp), which is mechanistically traced to a decrease in polysome loading. Thus, designer small molecules that react with RNA targets can be used to profile the RNAs to which they bind in cells, including identification of binding sites, and can modulate several aspects of RNA-mediated disease pathology in a manner that may be more beneficial than oligonucleotides.

  3. Fibroblast growth factor regulates insulin-like growth factor-binding protein production by vascular smooth muscle cells.

    PubMed

    Ververis, J; Ku, L; Delafontaine, P

    1994-02-01

    Insulin-like growth factor I is an important mitogen for vascular smooth muscle cells, and its effects are regulated by several binding proteins. Western ligand blotting of conditioned medium from rat aortic smooth muscle cells detected a 24 kDa binding protein and a 28 kDa glycosylated variant of this protein, consistent with insulin-like growth factor binding protein-4 by size. Low amounts of a glycosylated 38 to 42 kDa doublet (consistent with binding protein-3) and a 31 kDa non-glycosylated protein also were present. Basic fibroblast growth factor markedly increased secretion of the 24 kDa binding protein and its 28 kDa glycosylated variant. This effect was dose- and time-dependent and was inhibited by co-incubation with cycloheximide. Crosslinking of [125I]-insulin-like growth factor I to cell monolayers revealed no surface-associated binding proteins, either basally or after agonist treatment. Induction of binding protein production by fibroblast growth factor at sites of vascular injury may be important in vascular proliferative responses in vivo.

  4. Comparison of Genome-Wide Binding of MyoD in Normal Human Myogenic Cells and Rhabdomyosarcomas Identifies Regional and Local Suppression of Promyogenic Transcription Factors

    PubMed Central

    MacQuarrie, Kyle L.; Yao, Zizhen; Fong, Abraham P.; Diede, Scott J.; Rudzinski, Erin R.; Hawkins, Douglas S.

    2013-01-01

    Rhabdomyosarcoma is a pediatric tumor of skeletal muscle that expresses the myogenic basic helix-loop-helix protein MyoD but fails to undergo terminal differentiation. Prior work has determined that DNA binding by MyoD occurs in the tumor cells, but myogenic targets fail to activate. Using MyoD chromatin immunoprecipitation coupled to high-throughput sequencing and gene expression analysis in both primary human muscle cells and RD rhabdomyosarcoma cells, we demonstrate that MyoD binds in a similar genome-wide pattern in both tumor and normal cells but binds poorly at a subset of myogenic genes that fail to activate in the tumor cells. Binding differences are found both across genomic regions and locally at specific sites that are associated with binding motifs for RUNX1, MEF2C, JDP2, and NFIC. These factors are expressed at lower levels in RD cells than muscle cells and rescue myogenesis when expressed in RD cells. MEF2C is located in a genomic region that exhibits poor MyoD binding in RD cells, whereas JDP2 exhibits local DNA hypermethylation in its promoter in both RD cells and primary tumor samples. These results demonstrate that regional and local silencing of differentiation factors contributes to the differentiation defect in rhabdomyosarcomas. PMID:23230269

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sprague, E.R.; Wang, C.; Baker, D.

    Herpes simplex virus type-1 expresses a heterodimeric Fc receptor, gE-gI, on the surfaces of virions and infected cells that binds the Fc region of host immunoglobulin G and is implicated in the cell-to-cell spread of virus. gE-gI binds immunoglobulin G at the basic pH of the cell surface and releases it at the acidic pH of lysosomes, consistent with a role in facilitating the degradation of antiviral antibodies. Here we identify the C-terminal domain of the gE ectodomain (CgE) as the minimal Fc-binding domain and present a 1.78-{angstrom} CgE structure. A 5-{angstrom} gE-gI/Fc crystal structure, which was independently verified bymore » a theoretical prediction method, reveals that CgE binds Fc at the C{sub H}2-C{sub H}3 interface, the binding site for several mammalian and bacterial Fc-binding proteins. The structure identifies interface histidines that may confer pH-dependent binding and regions of CgE implicated in cell-to-cell spread of virus. The ternary organization of the gE-gI/Fc complex is compatible with antibody bipolar bridging, which can interfere with the antiviral immune response.« less

  6. X-Ray Structure of the Human Calreticulin Globular Domain Reveals a Peptide-Binding Area and Suggests a Multi-Molecular Mechanism

    PubMed Central

    Chouquet, Anne; Païdassi, Helena; Ling, Wai Li; Frachet, Philippe; Houen, Gunnar; Arlaud, Gérard J.; Gaboriaud, Christine

    2011-01-01

    In the endoplasmic reticulum, calreticulin acts as a chaperone and a Ca2+-signalling protein. At the cell surface, it mediates numerous important biological effects. The crystal structure of the human calreticulin globular domain was solved at 1.55 Å resolution. Interactions of the flexible N-terminal extension with the edge of the lectin site are consistently observed, revealing a hitherto unidentified peptide-binding site. A calreticulin molecular zipper, observed in all crystal lattices, could further extend this site by creating a binding cavity lined by hydrophobic residues. These data thus provide a first structural insight into the lectin-independent binding properties of calreticulin and suggest new working hypotheses, including that of a multi-molecular mechanism. PMID:21423620

  7. Formononetin, a phyto-oestrogen, and its metabolites up-regulate interleukin-4 production in activated T cells via increased AP-1 DNA binding activity

    PubMed Central

    Park, Jin; Kim, Seung H; Cho, Daeho; Kim, Tae S

    2005-01-01

    Phyto-oestrogens are polyphenolic non-steroidal plant compounds with oestrogen-like biological activity. Phyto-oestrogens have many biological effects including oestrogen agonist/antagonist properties. However, the effect of phyto-oestrogens on allergic responses remains unclear. In this study we investigated whether formononetin, a phyto-oestrogen, and its metabolites, daidzein and equol, affect production of interleukin-4 (IL-4), a pro-inflammatory cytokine closely associated with allergic immune response, in primary CD4+ T cells and EL4 T lymphoma cells. Formononetin, daidzein and equol significantly enhanced IL-4 production from both CD4+ T cells and EL4 cells in a dose-dependent manner. Formononetin, daidzein and equol also enhanced IL-4 gene promoter activity in EL4 cells transiently transfected with IL-4 gene promoter constructs, but this effect was impaired in EL4 cells transfected with an IL-4 promoter construct deleted of P4 site carrying nuclear factor of activated T cells (NF-AT) and activator protein-1 (AP-1) binding sites. In addition, formononetin, daidzein and equol increased AP-1 DNA binding activities while did not affect NF-AT DNA binding activities. The enhancing effects on IL-4 production and AP-1 DNA binding activities were abrogated by specific inhibitors for phosphatidylinositol-3-kinase (PI3K), protein kinase C (PKC) and p38 mitogen-activated protein kinase (MAPK), indicating that formononetin, daidzein and equol might enhance IL-4 production by increased activation of AP-1 through the PI3-K/PKC/p38 MAPK signalling pathway. These results suggest that phyto-oestrogens and some of their metabolites may increase allergic responses via the enhancement of IL-4 production in T cells. PMID:16108819

  8. Complementation analysis of mutants of nitric oxide synthase reveals that the active site requires two hemes.

    PubMed Central

    Xie, Q W; Leung, M; Fuortes, M; Sassa, S; Nathan, C

    1996-01-01

    For catalytic activity, nitric oxide synthases (NOSs) must be dimeric. Previous work revealed that the requirements for stable dimerization included binding of tetrahydrobiopterin (BH4), arginine, and heme. Here we asked what function is served by dimerization. We assessed the ability of individually inactive mutants of mouse inducible NOS (iNOS; NOS2), each deficient in binding a particular cofactor or cosubstrate, to complement each other by generating NO upon cotransfection into human epithelial cells. The ability of the mutants to homodimerize was gauged by gel filtration and/or PAGE under partially denaturing conditions, both followed by immunoblot. Their ability to heterodimerize was assessed by coimmunoprecipitation. Heterodimers that contained only one COOH-terminal hemimer and only one BH4-binding site could both form and function, even though the NADPH-, FAD-, and FMN-binding domains (in the COOH-terminal hemimer) and the BH4-binding sites (in the NH2-terminal hemimer) were contributed by opposite chains. Heterodimers that contained only one heme-binding site (Cys-194) could also form, either in cis or in trans to the nucleotide-binding domains. However, for NO production, both chains had to bind heme. Thus, NO production by iNOS requires dimerization because the active site requires two hemes. Images Fig. 2 Fig. 3 Fig. 4 Fig. 7 PMID:8643499

  9. Platelet-derived growth factor receptor mediates activation of ras through different signaling pathways in different cell types.

    PubMed Central

    Satoh, T; Fantl, W J; Escobedo, J A; Williams, L T; Kaziro, Y

    1993-01-01

    A series of pieces of evidence have shown that Ras protein acts as a transducer of the platelet-derived growth factor (PDGF) receptor-mediated signaling pathway: (i) formation of Ras.GTP is detected immediately on PDGF stimulation, and (ii) a dominant inhibitory mutant Ras, as well as a neutralizing anti-Ras antibody, can interfere with PDGF-induced responses. On the other hand, several signal transducing molecules including phosphatidylinositol 3-kinase (PI3-K), GTPase-activating protein (GAP), and phospholipase C gamma (PLC gamma) bind directly to the PDGF receptor and become tyrosine phosphorylated. Recently, it was shown that specific phosphorylated tyrosines of the PDGF receptor are responsible for interaction between the receptor and each signaling molecule. However, the roles of these signaling molecules have not been elucidated, and it remains unclear which molecules are implicated in the Ras pathway. In this study, we measured Ras activation in cell lines expressing mutant PDGF receptors that are deficient in coupling with specific molecules. In fibroblast CHO cells, a mutant receptor (Y708F/Y719F [PI3-K-binding sites]) was unable to stimulate Ras, whereas another mutant (Y739F [the GAP-binding site]) could do so, suggesting an indispensable role of PI3-K or a protein that binds to the same sites as PI3-K for PDGF-stimulated Ras activation. By contrast, both of the above mutants were capable of stimulating Ras protein in a pro-B-cell line, BaF3. Furthermore, a mutant receptor (Y977F/Y989F [PLC gamma-binding sites]) could fully activate Ras, and the direct activation of protein kinase C and calcium mobilization had almost no effect on the GDP/GTP state of Ras in this cell line. These results suggest that, in the pro-B-cell transfectants, each of the above pathways (PI3-K, GAP, and PLC gamma) can be eliminated without a loss of Ras activation. It remains unclear whether another unknown essential pathway which regulates Ras protein exists within BaF3 cells. Therefore, it is likely that several different PDGF receptor-mediated signaling pathways function upstream of Ras, and the extent of the contribution of each pathway for the regulation of Ras may differ among different cell types. Images PMID:8388543

  10. Mapping of the Lassa virus LAMP1 binding site reveals unique determinants not shared by other old world arenaviruses.

    PubMed

    Israeli, Hadar; Cohen-Dvashi, Hadas; Shulman, Anastasiya; Shimon, Amir; Diskin, Ron

    2017-04-01

    Cell entry of many enveloped viruses occurs by engagement with cellular receptors, followed by internalization into endocytic compartments and pH-induced membrane fusion. A previously unnoticed step of receptor switching was found to be critical during cell entry of two devastating human pathogens: Ebola and Lassa viruses. Our recent studies revealed the functional role of receptor switching to LAMP1 for triggering membrane fusion by Lassa virus and showed the involvement of conserved histidines in this switching, suggesting that other viruses from this family may also switch to LAMP1. However, when we investigated viruses that are genetically close to Lassa virus, we discovered that they cannot bind LAMP1. A crystal structure of the receptor-binding module from Morogoro virus revealed structural differences that allowed mapping of the LAMP1 binding site to a unique set of Lassa residues not shared by other viruses in its family, illustrating a key difference in the cell-entry mechanism of Lassa virus that may contribute to its pathogenicity.

  11. Site of anticonvulsant action on sodium channels: autoradiographic and electrophysiological studies in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Worley, P.F.; Baraban, J.M.

    1987-05-01

    The anticonvulsants phenytoin and carbamazepine interact allosterically with the batrachotoxin binding site of sodium channels. In the present study, we demonstrate an autoradiographic technique to localize the batrachotoxin binding site on sodium channels in rat brain using (/sup 3/H)batrachotoxinin-A 20-alpha-benzoate (BTX-B). Binding of (/sup 3/H)BTX-B to brain sections is dependent on potentiating allosteric interactions with scorpion venom and is displaced by BTX-B (Kd approximately 200 nM), aconitine, veratridine, and phenytoin with the same rank order of potencies as described in brain synaptosomes. The maximum number of (/sup 3/H)BTX-B binding sites in forebrain sections also agrees with biochemical determinations. Autoradiographic localizationsmore » indicate that (/sup 3/H)BTX-B binding sites are not restricted to cell bodies and axons but are present in synaptic zones throughout the brain. For example, a particularly dense concentration of these sites in the substantia nigra is associated with afferent terminals of the striatonigral projection. By contrast, myelinated structures possess much lower densities of binding sites. In addition, we present electrophysiological evidence that synaptic transmission, as opposed to axonal conduction, is preferentially sensitive to the action of aconitine and veratridine. Finally, the synaptic block produced by these sodium channel activators is inhibited by phenytoin and carbamazepine at therapeutic anticonvulsant concentrations.« less

  12. Diphtheria toxin can simultaneously bind to its receptor and adenylyl-(3',5')-uridine 3'-monophosphate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barbieri, J.T.; Collins, C.M.; Collier, R.J.

    1986-10-21

    Diphtheria toxin (DT) that was bound to receptors on BS-C-1 cells was able to bind approximately 1 molar equiv of adenylyl-(3',5')-uridine 3'-monophosphate (ApUp). In contrast, receptor-bound CRM197, a mutant form of toxin with greatly diminished affinity for dinucleotides, did not bind ApUp. Affinity of the dinucleotide for receptor-bound toxin differed from that for free toxin by less than an order of magnitude. These results indicate that the receptor site and the ApUp site on the toxin do not significantly overlap. BS-C-1 cells were incubated with or without /sup 125/I-DT or CRM 197. They were then incubated with (/sup 32/P)ApUp, andmore » assayed.« less

  13. The increased flexibility of CDR loops generated in antibodies by Congo red complexation favors antigen binding.

    PubMed

    Krol, Marcin; Roterman, Irena; Drozd, Anna; Konieczny, Leszek; Piekarska, Barbara; Rybarska, Janina; Spolnik, Paweł; Stopa, Barbara

    2006-02-01

    The dye Congo red and related self-assembling compounds were found to stabilize immune complexes by binding to antibodies currently engaged in complexation to antigen. In our simulations, it was shown that the site that becomes accessible for binding the supramolecular dye ligand is located in the V domain, and is normally occupied by the N-terminal polypeptide chain fragment. The binding of the ligand disrupts the beta-structure in the domain, increasing the plasticity of the antigen-binding site. The higher fluctuation of CDR-bearing loops enhances antigen binding, and allows even low-affinity antibodies to be engaged in immune complexes. Experimental observations of the enhancement effect were supported by theoretical studies using L lambda chain (4BJL-PDB identification) and the L chain from the complex of IgM-rheumatoid factor bound to the CH3 domain of the Fc fragment (1ADQ-PDB identification) as the initial structures for theoretical studies of dye-induced changes. Commercial IgM-type rheumatoid factor (human) and sheep red blood cells with coupled IgG (human) were used for experimental tests aimed to reveal the dye-enhancement effect in this system. The specificity of antigen-antibody interaction enhanced by dye binding was studied using rabbit anti-sheep red cell antibodies to agglutinate red cells of different species. Red blood cells of hoofed mammals (horse, goat) showed weak enhancement of agglutination in the presence of Congo red. Neither agglutination nor enhancement were observed in the case of human red cells. The dye-enhancement capability in the SRBC-antiSRBC system was lost after pepsin-digestion of antibodies producing (Fab)2 fragments still agglutinating red cells. Monoclonal (myeloma) IgG, L lambda chain and ovoalbumin failed to agglutinate red cells, as expected, and showed no enhancement effect. This indicates that the enhancement effect is specific.

  14. How allosteric control of Staphylococcus aureus penicillin binding protein 2a enables methicillin resistance and physiological function

    PubMed Central

    Otero, Lisandro H.; Rojas-Altuve, Alzoray; Llarrull, Leticia I.; Carrasco-López, Cesar; Kumarasiri, Malika; Lastochkin, Elena; Fishovitz, Jennifer; Dawley, Matthew; Hesek, Dusan; Lee, Mijoon; Johnson, Jarrod W.; Fisher, Jed F.; Chang, Mayland; Mobashery, Shahriar; Hermoso, Juan A.

    2013-01-01

    The expression of penicillin binding protein 2a (PBP2a) is the basis for the broad clinical resistance to the β-lactam antibiotics by methicillin-resistant Staphylococcus aureus (MRSA). The high-molecular mass penicillin binding proteins of bacteria catalyze in separate domains the transglycosylase and transpeptidase activities required for the biosynthesis of the peptidoglycan polymer that comprises the bacterial cell wall. In bacteria susceptible to β-lactam antibiotics, the transpeptidase activity of their penicillin binding proteins (PBPs) is lost as a result of irreversible acylation of an active site serine by the β-lactam antibiotics. In contrast, the PBP2a of MRSA is resistant to β-lactam acylation and successfully catalyzes the dd-transpeptidation reaction necessary to complete the cell wall. The inability to contain MRSA infection with β-lactam antibiotics is a continuing public health concern. We report herein the identification of an allosteric binding domain—a remarkable 60 Å distant from the dd-transpeptidase active site—discovered by crystallographic analysis of a soluble construct of PBP2a. When this allosteric site is occupied, a multiresidue conformational change culminates in the opening of the active site to permit substrate entry. This same crystallographic analysis also reveals the identity of three allosteric ligands: muramic acid (a saccharide component of the peptidoglycan), the cell wall peptidoglycan, and ceftaroline, a recently approved anti-MRSA β-lactam antibiotic. The ability of an anti-MRSA β-lactam antibiotic to stimulate allosteric opening of the active site, thus predisposing PBP2a to inactivation by a second β-lactam molecule, opens an unprecedented realm for β-lactam antibiotic structure-based design. PMID:24085846

  15. Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses

    PubMed Central

    Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa

    2018-01-01

    Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196

  16. Discovery and Optimization of Novel 5-Indolyl-7-arylimidazo[1,2-a]pyridine-8-carbonitrile Derivatives as Potent Antitubulin Agents Targeting Colchicine-binding Site

    NASA Astrophysics Data System (ADS)

    Zhai, Xin; Wang, Xiaoqiang; Wang, Jiao; Liu, Jin; Zuo, Daiying; Jiang, Nan; Zeng, Tianfang; Yang, Xiuxiu; Jing, Tongfei; Gong, Ping

    2017-02-01

    Aiming at development of potent antitubulin agents targeting colchicine-binding site, a series of novel 5-indolyl-7-arylimidazo[1,2-a]pyridine-8-carbonitrilederivatives (5a-5v and 7a-7h) were designed based on bioisosterism and hybridization strategies. All these compounds were concisely synthesized via a three-step process and examined against five human cancer cell lines (HT-29, A549, MKN-45, MDA-MB-231 and SMMC-7721) along with a normal human cell (L02) in vitro. A structure-activity relationships (SARs) study was carried out and optimization towards this series of compounds in cellular assay resulted in the discovery of 5k, which displayed similar or better antitumor potency against the tested cancer cells with IC50 value ranging from 0.02 to 1.22 μM superior to CA-4 and Crolibulin. Significantly, a cell cycle study disclosed the ability of 5k to arrest cell cycle at the G2/M phase, and immunofluorescence assay as well as a colchicine competition assay revealed that tubulin polymerization was disturbed by 5k by binding to the colchicine site. Moreover, the molecular modeling mode showed the posture of 5k and Crolibulin was similar in the colchcine-binding pocket of tubulin as identified with the SARs and pharmacological results. Together, all these results rationalized 5k might serve as a promising lead for a novel class of antitubulin agents for cancer treatments.

  17. Identification of an allosteric binding site for RORγt inhibition

    PubMed Central

    Scheepstra, Marcel; Leysen, Seppe; van Almen, Geert C.; Miller, J. Richard; Piesvaux, Jennifer; Kutilek, Victoria; van Eenennaam, Hans; Zhang, Hongjun; Barr, Kenneth; Nagpal, Sunil; Soisson, Stephen M.; Kornienko, Maria; Wiley, Kristen; Elsen, Nathaniel; Sharma, Sujata; Correll, Craig C.; Trotter, B. Wesley; van der Stelt, Mario; Oubrie, Arthur; Ottmann, Christian; Parthasarathy, Gopal; Brunsveld, Luc

    2015-01-01

    RORγt is critical for the differentiation and proliferation of Th17 cells associated with several chronic autoimmune diseases. We report the discovery of a novel allosteric binding site on the nuclear receptor RORγt. Co-crystallization of the ligand binding domain (LBD) of RORγt with a series of small-molecule antagonists demonstrates occupancy of a previously unreported allosteric binding pocket. Binding at this non-canonical site induces an unprecedented conformational reorientation of helix 12 in the RORγt LBD, which blocks cofactor binding. The functional consequence of this allosteric ligand-mediated conformation is inhibition of function as evidenced by both biochemical and cellular studies. RORγt function is thus antagonized in a manner molecularly distinct from that of previously described orthosteric RORγt ligands. This brings forward an approach to target RORγt for the treatment of Th17-mediated autoimmune diseases. The elucidation of an unprecedented modality of pharmacological antagonism establishes a mechanism for modulation of nuclear receptors. PMID:26640126

  18. Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase.

    PubMed

    Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R

    1985-01-29

    Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.

  19. Nuclear factor Y regulates ancient budgerigar hepadnavirus core promoter activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shen, Zhongliang; Liu, Yanfeng; Luo, Mengjun

    Endogenous viral elements (EVE) in animal genomes are the fossil records of ancient viruses and provide invaluable information on the origin and evolution of extant viruses. Extant hepadnaviruses include avihepadnaviruses of birds and orthohepadnaviruses of mammals. The core promoter (Cp) of hepadnaviruses is vital for viral gene expression and replication. We previously identified in the budgerigar genome two EVEs that contain the full-length genome of an ancient budgerigar hepadnavirus (eBHBV1 and eBHBV2). Here, we found eBHBV1 Cp and eBHBV2 Cp were active in several human and chicken cell lines. A region from nt −85 to −11 in eBHBV1 Cp was critical formore » the promoter activity. Bioinformatic analysis revealed a putative binding site of nuclear factor Y (NF-Y), a ubiquitous transcription factor, at nt −64 to −50 in eBHBV1 Cp. The NF-Y core binding site (ATTGG, nt −58 to −54) was essential for eBHBV1 Cp activity. The same results were obtained with eBHBV2 Cp and duck hepatitis B virus Cp. The subunit A of NF-Y (NF-YA) was recruited via the NF-Y core binding site to eBHBV1 Cp and upregulated the promoter activity. Finally, the NF-Y core binding site is conserved in the Cps of all the extant avihepadnaviruses but not of orthohepadnaviruses. Interestingly, a putative and functionally important NF-Y core binding site is located at nt −21 to −17 in the Cp of human hepatitis B virus. In conclusion, our findings have pinpointed an evolutionary conserved and functionally critical NF-Y binding element in the Cps of avihepadnaviruses. - Highlights: • Endogenous budgerigar hepadnavirus (eBHBV) core promoters (Cps) are active in cells. • NF-Y binding site exists in the Cps of eBHBVs and all the extant avihepadnaviruses. • NF-Y binding and mediated upregulation is critical for eBHBV Cp activity.« less

  20. The minimal promoter region of the dense-core vesicle protein IA-2: transcriptional regulation by CREB.

    PubMed

    Cai, Tao; Hirai, Hiroki; Xu, Huanyu; Notkins, Abner L

    2015-06-01

    IA-2 is a transmembrane protein found in the dense-core vesicles (DCV) of neuroendocrine cells and one of the major autoantigens in type 1 diabetes. DCV are involved in the secretion of hormones (e.g., insulin) and neurotransmitters. Stimulation of pancreatic β cells with glucose upregulates the expression of IA-2 and an increase in IA-2 results in an increase in the number of DCV. Little is known, however, about the promoter region of IA-2 or the transcriptional factors that regulate the expression of this gene. In the present study, we constructed eight deletion fragments from the upstream region of the IA-2 transcription start site and linked them to a luciferase reporter. By this approach, we have identified a short bp region (-216 to +115) that has strong promoter activity. We also identified a transcription factor, cAMP responsive element-binding protein (CREB), which binds to two CREB-related binding sites located in this region. The binding of CREB to these sites enhanced IA-2 transcription by more than fivefold. We confirmed these findings by site-directed mutagenesis, chromatin immunoprecipitation assays and RNAi inhibition. Based on these findings, we conclude that the PKA pathway is a critical, but not the exclusive signaling pathway involved in IA-2 gene expression.

  1. In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A

    PubMed Central

    Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

    2015-01-01

    A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5’-end including the 5’-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer. PMID:26221730

  2. In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

    PubMed

    Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

    2015-01-01

    A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

  3. Hb taradale [beta82(EF6)Lys-->Arg]: a novel mutation at a 2,3-diphosphoglycerate binding site.

    PubMed

    Brennan, Stephen O; Sheen, Campbell; Chan, Tim; George, Peter M

    2005-01-01

    Hb Taradale [beta82(EF6)Lys-->Arg] was initially detected as a split Hb A0 peak on Hb A1c, monitoring. Red cell parameters, hemoglobin (Hb) electrophoresis and stability tests were normal. Mass spectrometry (ms) clearly identified a variant beta chain with a mass increase of 28 Da and peptide mapping located the mutation site to peptide betaT-9. DNA sequencing confirmed the presence of a novel beta82(EF6)Lys-->Arg mutation. This conservative substitution at a 2,3-diphosphoglycerate (2,3-DPG) binding site did not, however, appear to affect the P50 for oxygen binding.

  4. Interplay between CedA, rpoB and double stranded DNA: A step towards understanding CedA mediated cell division in E. coli.

    PubMed

    Sharma, Pankaj; Tomar, Anil Kumar; Kundu, Bishwajit

    2018-02-01

    Cell division is compromised in DnaAcos mutant E. coli cells due to chromosome over-replication. In these cells, CedA acts as a regulatory protein and initiates cell division by a hitherto unknown mechanism. CedA, a double stranded DNA binding protein, interacts with various subunits of RNA polymerase complex, including rpoB. To reveal how this concert between CedA, rpoB and DNA brings about cell division in E. coli, we performed biophysical and in silico analysis and obtained mechanistic insights. Interaction between CedA and rpoB was shown by circular dichroism spectrometry and in silico docking experiments. Further, CedA and rpoB were allowed to interact individually to a selected DNA and their binding was monitored by fluorescence spectroscopy. The binding constants of these interactions as determined by BioLayer Interferometry clearly show that rpoB binds to DNA with higher affinity (K D2 =<1.0E-12M) as compared to CedA (K D2 =9.58E-09M). These findings were supported by docking analysis where 12 intermolecular H-bonds were formed in rpoB-DNA complex as compared to 4 in CedA-DNA complex. Based on our data we propose that in E. coli cells chromosome over-replication signals CedA to recruit rpoB to specific DNA site(s), which initiates transcription of cell division regulatory elements. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    PubMed

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  6. The Carboxy-Terminal Domain of Hsc70 Provides Binding Sites for a Distinct Set of Chaperone Cofactors

    PubMed Central

    Demand, Jens; Lüders, Jens; Höhfeld, Jörg

    1998-01-01

    The modulation of the chaperone activity of the heat shock cognate Hsc70 protein in mammalian cells involves cooperation with chaperone cofactors, such as Hsp40; BAG-1; the Hsc70-interacting protein, Hip; and the Hsc70-Hsp90-organizing protein, Hop. By employing the yeast two-hybrid system and in vitro interaction assays, we have provided insight into the structural basis that underlies Hsc70’s cooperation with different cofactors. The carboxy-terminal domain of Hsc70, previously shown to form a lid over the peptide binding pocket of the chaperone protein, mediates the interaction of Hsc70 with Hsp40 and Hop. Remarkably, the two cofactors bind to the carboxy terminus of Hsc70 in a noncompetitive manner, revealing the existence of distinct binding sites for Hsp40 and Hop within this domain. In contrast, Hip interacts exclusively with the amino-terminal ATPase domain of Hsc70. Hence, Hsc70 possesses separate nonoverlapping binding sites for Hsp40, Hip, and Hop. This appears to enable the chaperone protein to cooperate simultaneously with multiple cofactors. On the other hand, BAG-1 and Hip have recently been shown to compete in binding to the ATPase domain. Our data thus establish the existence of a network of cooperating and competing cofactors regulating the chaperone activity of Hsc70 in the mammalian cell. PMID:9528774

  7. Biological evaluation, docking and molecular dynamic simulation of some novel diaryl urea derivatives bearing quinoxalindione moiety

    PubMed Central

    Sadeghian-Rizi, Sedighe; Khodarahmi, Ghadamali Ali; Sakhteman, Amirhossein; Jahanian-Najafabadi, Ali; Rostami, Mahboubeh; Mirzaei, Mahmoud; Hassanzadeh, Farshid

    2017-01-01

    In this study a series of diarylurea derivatives containing quinoxalindione group were biologically evaluated for their cytotoxic activities using MTT assay against MCF-7 and HepG2 cell lines. Antibacterial activities of these compounds were also evaluated by Microplate Alamar Blue Assay (MABA) against three Gram-negative (Escherichia coli, Pseudomonas aeruginosa and Salmonella typhi), three Gram-positive (Staphylococcus aureus, Bacillus subtilis and Listeria monocitogenes) and one yeast-like fungus (Candida albicans) strain. Furthermore, molecular docking was carried out to study the binding pattern of the compounds to the active site of B-RAF kinase (PDB code: 1UWH). Molecular dynamics simulation was performed on the best ligand (16e) to investigate the ligand binding dynamics in the physiological environment. Cytotoxic evaluation revealed the most prominent cytotoxicity for 6 compounds with IC50 values of 10-18 μM against two mentioned cell lines. None of the synthesized compounds showed significant antimicrobial activity. The obtained results of the molecular docking study showed that all compounds fitted in the binding site of enzyme with binding energy range of -11.22 to -12.69 kcal/mol vs sorafenib binding energy -11.74 kcal/mol as the lead compound. Molecular dynamic simulation indicated that the binding of ligand (16e) was stable in the active site of B-RAF during the simulation. PMID:29204178

  8. Analysis of an artificial zinc finger epigenetic modulator: widespread binding but limited regulation

    PubMed Central

    Grimmer, Matthew R.; Stolzenburg, Sabine; Ford, Ethan; Lister, Ryan; Blancafort, Pilar; Farnham, Peggy J.

    2014-01-01

    Artificial transcription factors (ATFs) and genomic nucleases based on a DNA binding platform consisting of multiple zinc finger domains are currently being developed for clinical applications. However, no genome-wide investigations into their binding specificity have been performed. We have created six-finger ATFs to target two different 18 nt regions of the human SOX2 promoter; each ATF is constructed such that it contains or lacks a super KRAB domain (SKD) that interacts with a complex containing repressive histone methyltransferases. ChIP-seq analysis of the effector-free ATFs in MCF7 breast cancer cells identified thousands of binding sites, mostly in promoter regions; the addition of an SKD domain increased the number of binding sites ∼5-fold, with a majority of the new sites located outside of promoters. De novo motif analyses suggest that the lack of binding specificity is due to subsets of the finger domains being used for genomic interactions. Although the ATFs display widespread binding, few genes showed expression differences; genes repressed by the ATF-SKD have stronger binding sites and are more enriched for a 12 nt motif. Interestingly, epigenetic analyses indicate that the transcriptional repression caused by the ATF-SKD is not due to changes in active histone modifications. PMID:25122745

  9. Long non-coding RNA H19 suppresses retinoblastoma progression via counteracting miR-17-92 cluster.

    PubMed

    Zhang, Aihui; Shang, Weiwei; Nie, Qiaoli; Li, Ting; Li, Suhui

    2018-04-01

    Long non-coding RNAs (lncRNAs) are frequently dysregulated and play important roles in many cancers. lncRNA H19 is one of the earliest discovered lncRNAs which has diverse roles in different cancers. However, the expression, roles, and action mechanisms of H19 in retinoblastoma are still largely unknown. In this study, we found that H19 is downregulated in retinoblastoma tissues and cell lines. Gain-of-function and loss-of-function assays showed that H19 inhibits retinoblastoma cell proliferation, induces retinoblastoma cell cycle arrest and cell apoptosis. Mechanistically, we identified seven miR-17-92 cluster binding sites on H19, and found that H19 directly bound to miR-17-92 cluster via these seven binding sites. Through binding to miR-17-92 cluster, H19 relieves the suppressing roles of miR-17-92 cluster on p21. Furthermore, H19 represses STAT3 activation induced by miR-17-92 cluster. Hence, our results revealed that H19 upregulates p21 expression, inhibits STAT3 phosphorylation, and downregulates the expression of STAT3 target genes BCL2, BCL2L1, and BIRC5. In addition, functional assays demonstrated that the mutation of miR-17-92 cluster binding sites on H19 abolished the proliferation inhibiting, cell cycle arrest and cell apoptosis inducing roles of H19 in retinoblastoma. In conclusion, our data suggested that H19 inhibits retinoblastoma progression via counteracting the roles of miR-17-92 cluster, and implied that enhancing the action of H19 may be a promising therapeutic strategy for retinoblastoma. © 2017 Wiley Periodicals, Inc.

  10. Modulation of Cell Proliferation and Differentiation through Substrate-dependent Changes in Fibronectin Conformation

    PubMed Central

    García, Andrés J.; Vega, María D.; Boettiger, David

    1999-01-01

    Integrin-mediated cell adhesion to extracellular matrices provides signals essential for cell cycle progression and differentiation. We demonstrate that substrate-dependent changes in the conformation of adsorbed fibronectin (Fn) modulated integrin binding and controlled switching between proliferation and differentiation. Adsorption of Fn onto bacterial polystyrene (B), tissue culture polystyrene (T), and collagen (C) resulted in differences in Fn conformation as indicated by antibody binding. Using a biochemical method to quantify bound integrins in cultured cells, we found that differences in Fn conformation altered the quantity of bound α5 and β1 integrin subunits but not αv or β3. C2C12 myoblasts grown on these Fn-coated substrates proliferated to different levels (B > T > C). Immunostaining for muscle-specific myosin revealed minimal differentiation on B, significant levels on T, and extensive differentiation on C. Differentiation required binding to the RGD cell binding site in Fn and was blocked by antibodies specific for this site. Switching between proliferation and differentiation was controlled by the levels of α5β1 integrin bound to Fn, and differentiation was inhibited by anti-α5, but not anti-αv, antibodies, suggesting distinct integrin-mediated signaling pathways. Control of cell proliferation and differentiation through conformational changes in extracellular matrix proteins represents a versatile mechanism to elicit specific cellular responses for biological and biotechnological applications. PMID:10069818

  11. Novobiocin and additional inhibitors of the Hsp90 C-terminal nucleotide-binding pocket.

    PubMed

    Donnelly, Alison; Blagg, Brian S J

    2008-01-01

    The 90 kDa heat shock proteins (Hsp90), which are integrally involved in cell signaling, proliferation, and survival, are ubiquitously expressed in cells. Many proteins in tumor cells are dependent upon the Hsp90 protein folding machinery for their stability, refolding, and maturation. Inhibition of Hsp90 uniquely targets client proteins associated with all six hallmarks of cancer. Thus, Hsp90 has emerged as a promising target for the treatment of cancer. Hsp90 exists as a homodimer, which contains three domains. The N-terminal domain contains an ATP-binding site that binds the natural products geldanamycin and radicicol. The middle domain is highly charged and has high affinity for co-chaperones and client proteins. Initial studies by Csermely and co-workers suggested a second ATP-binding site in the C-terminus of Hsp90. This C-terminal nucleotide binding pocket has been shown to not only bind ATP, but cisplatin, novobiocin, epilgallocatechin-3-gallate (EGCG) and taxol. The coumarin antibiotics novobiocin, clorobiocin, and coumermycin A1 were isolated from several streptomyces strains and exhibit potent activity against Gram-positive bacteria. These compounds bind type II topoisomerases, including DNA gyrase, and inhibit the enzyme-catalyzed hydrolysis of ATP. As a result, novobiocin analogues have garnered the attention of numerous researchers as an attractive agent for the treatment of bacterial infection. Novobiocin was reported to bind weakly to the newly discovered Hsp90 C-terminal ATP binding site ( approximately 700 M in SkBr3 cells) and induce degradation of Hsp90 client proteins. Structural modification of this compound has led to an increase of 1000-fold in activity in anti-proliferative assays. Recent studies of structure-activity relationship (SAR) by Renoir and co-workers highlighted the crucial role of the C-4 and/or C-7 positions of the coumarin and removal of the noviose moiety, which appeared to be essential for degradation of Hsp90 client proteins. Unlike the N-terminal ATP binding site, there is no reported co-crystal structure of Hsp90 C-terminus bound to any inhibitor. The Hsp90 C-terminal domain, however, is known to contain a conserved pentapeptide sequence (MEEVD) which is recognized by co-chaperones. Cisplatin is a platinum-containing chemotherapeutic used to treat various types of cancers, including testicular, ovarian, bladder, and small cell lung cancer. Most notably, cisplatin coordinates to DNA bases, resulting in cross-linked DNA, which prohibits rapidly dividing cells from duplicating DNA for mitosis. Itoh and co-workers reported that cisplatin decreases the chaperone activity of Hsp90. This group applied bovine brain cytosol to a cisplatin affinity column, eluted with cisplatin and detected Hsp90 in the eluent. Subsequent experiments indicated that cisplatin exhibits high affinity for Hsp90. Moreover Csermely and co-workers determined that the cisplatin binding site is located proximal to the C-terminal ATP binding site. EGCG is one of the active ingredients found in green tea. EGCG is known to inhibit the activity of many Hsp90-dependent client proteins, including telomerase, several kinases, and the aryl hydrocarbon receptor (AhR). Recently Gasiewicz and co-workers reported that EGCG manifests its antagonistic activity against AhR through binding Hsp90. Similar to novobiocin, EGCG was shown to bind the C-terminus of Hsp90. Unlike previously identified N-terminal Hsp90 inhibitors, EGCG does not appear to prevent Hsp90 from forming multiprotein complexes. Studies are currently underway to determine whether EGCG competes with novobiocin or cisplatin binding. Taxol, a well-known drug for the treatment of cancer, is responsible for the stabilization of microtubules and the inhibition of mitosis. Previous studies have shown that taxol induces the activation of kinases and transcription factors, and mimics the effect of bacterial lipopolysaccharide (LPS), an attribute unrelated to its tubulin-binding properties. Rosen and co-workers prepared a biotinylated taxol derivative and performed affinity chromatography experiments with lysates from both mouse brain and macrophage cell lines. These studies led to identification of two chaperones, Hsp70 and Hsp90, by mass spectrometry. In contrast to typical Hsp90-binding drugs, taxol exhibits a stimulatory response. Recently it was reported that the geldanamycin derivative 17-AAG behaves synergistically with taxol-induced apoptosis. This review describes the different C-terminal inhibitors of Hsp90, with specific emphasis on structure-activity relationship studies of novobiocin and their effects on anti-proliferative activity.

  12. Novobiocin and Additional Inhibitors of the Hsp90 C-Terminal Nucleotide-binding Pocket

    PubMed Central

    Donnelly, Alison; Blagg, Brian S. J.

    2009-01-01

    The 90 kDa heal shock proteins (Hsp90), which are integrally involved in cell signaling, proliferation, and survival, are ubiquitously expressed in cells. Many proteins in tumor cells are dependent upon the Hsp90 protein folding machinery for their stability, refolding, and maturation. Inhibition of Hsp90 uniquely targets client proteins associated with all six hallmarks of cancer. Thus, Hsp90 has emerged as a promising target for the treatment of cancer. Hsp90 exists as a homodimer, which contains three domains. The N-terminal domain contains an ATP-binding site that binds the natural products geldanamycin and radicicol. The middle domain is highly charged and has high affinity for co-chaperones and client proteins. Initial studies by Csermely and co-workers suggested a second ATP-binding site in the C-terminus of Hsp90. This C-terminal nucleotide binding pocket has been shown to not only bind ATP, but cisplatin, novobiocin, epilgallocatechin-3-gallate (EGCG) and taxol. The coumarin antibiotics novobiocin, clorobiocin, and coumermycin A1 were isolated from several streptomyces strains and exhibit potent activity against Gram-positive bacteria. These compounds bind type II topoisomerases, including DNA gyrase, and inhibit the enzyme-catalyzed hydrolysis of ATP. As a result, novobiocin analogues have garnered the attention of numerous researchers as an attractive agent for the treatment of bacterial infection. Novobiocin was reported to bind weakly to the newly discovered Hsp90 C-terminal ATP binding site (~700 M in SkBr3 cells) and induce degradation of Hsp90 client proteins. Structural modification of this compound has led to an increase of 1000-fold in activity in anti-proliferative assays. Recent studies of structure-activity relationship (SAR) by Renoir and co-workers highlighted the crucial role of the C-4 and/or C-7 positions of the coumarin and removal of the noviose moiety, which appeared to be essential for degradation of Hsp90 client proteins. Unlike the N-terminal ATP binding site, there is no reported co-crystal structure of Hsp90 C-terminus bound to any inhibitor. The Hsp90 C-terminal domain, however, is known to contain a conserved pentapeptide sequence (MEEVD) which is recognized by co-chaperones. Cisplatin is a platinum-containing chemotherapeutic used to treat various types of cancers, including testicular, ovarian, bladder, and small cell lung cancer. Most notably, cisplatin coordinates to DNA bases, resulting in cross-linked DNA, which prohibits rapidly dividing cells from duplicating DNA for mitosis. Itoh and co-workers reported that cisplatin decreases the chaperone activity of Hsp90. This group applied bovine brain cytosol to a cisplatin affinity column, eluted with cisplatin and detected Hsp90 in the eluent. Subsequent experiments indicated that cisplatin exhibits high affinity for Hsp90. Moreover Csermely and co-workers determined that the cisplatin binding site is located proximal to the C-terminal ATP binding site. EGCG is one of the active ingredients found in green tea EGCG is known to inhibit the activity of many Hsp90-dependent client proteins, including telomerase, several kinases, and the aryl hydrocarbon receptor (AhR). Recently Gasiewicz and co-workers reported that EGCG manifests its antagonistic activity against AhR through binding Hsp90. Similar to novobiocin, EGCG was shown to bind the C-terminus of Hsp90. Unlike previously identified N-terminal Hsp90 inhibitors, EGCG does not appear to prevent Hsp90 from forming multiprotein complexes. Studies are currently underway to determine whether EGCG competes with novobiocin or cisplatin binding. Taxol, a well-known drug for the treatment of cancer, is responsible for the stabilization of microtubules and the inhibition of mitosis. Previous studies have shown that taxol induces the activation of kinases and transcription factors, and mimies the effect of bacterial lipopolysaccharide (LPS), an attribute unrelated to its tubulin-binding properties. Rosen and co-workers prepared a biotinylated taxol derivative and performed affinity chromatography experiments with lysates from both mouse brain and macrophage cell lines. These studies led to identification of two chaperones. Hsp70 and Hsp90, by mass spectrometry. In contrast to typical Hsp90-binding drugs, taxol exhibits a stimulatory response. Recently it was reported that the geldanamycin derivative 17-AAG behaves synergistically with taxol-induced apoptosis. This review describes the different C-terminal inhibitors of Hsp90, with specific emphasis on structure-activity relationship studies of novobiocin and their effects on anti-proliferative activity. PMID:18991631

  13. The PBX1 lupus susceptibility gene regulates CD44 expression

    PubMed Central

    Niu, Yuxin; Sengupta, Mayami; Titov, Anton A.; Choi, Seung-Chul; Morel, Laurence

    2017-01-01

    PBX1-d is novel splice isoform of pre-B-cell leukemia homeobox 1 (PBX1) that lacks its DNA-binding and Hox-binding domains, and functions as a dominant negative. We have shown that PBX1-d expression in CD4+ T cells is associated with systemic lupus erythematosus (SLE) in a mouse model as well as in human subjects. More specifically, PBX1-d expression leads to the production of autoreactive activated CD4+ T cells, a reduced frequency and function of Foxp3+ regulatory T (Treg) cells and an expansion of follicular helper T (Tfh) cells. Very little is known about the function of PBX1 in T cells, except that it directly regulates the expression of miRNAs associated with Treg and Tfh homeostasis. In the present study, we show that PBX1 directly regulated the expression of CD44, a marker of T cell activation. Two PBX1 binding sites in the promoter directly regulated CD44 expression, with PBX1-d driving a higher expression than the normal isoform PBX1-b. In addition, mutations in each of the two binding sites had different effects of PBX1-b and PBX1-d. Finally, we showed that an enhanced recruitment of co-factor MEIS by PBX1-d over PBX1-b, while there was no difference for co-factor PREP1 recruitment. Therefore, this study demonstrates that the lupus-associated PBX1-d isoform directly transactivates CD44, a marker of CD44 activation and memory, and that it has different DNA binding and co-factor recruitment relative to the normal isoform. Taken together, these results confirm that PBX1 directly regulates genes related to T cell activation and show that the lupus-associated isoform PBX1-d has unique molecular functions. PMID:28257976

  14. Insulin receptor in mouse neuroblastoma cell line N18TG2: binding properties and visualization with colloidal gold.

    PubMed

    Sartori, C; Stefanini, S; Bernardo, A; Augusti-Tocco, G

    1992-08-01

    Insulin function in the nervous system is still poorly understood. Possible roles as a neuromodulator and as a growth factor have been proposed (Baskin et al., 1987, Ann. Rev. Physiol. 49, 335-347). Stable cell lines may provide an appropriate experimental system for the analysis of insulin action on the various cellular components of the central nervous system. We report here a study to investigate the presence and the properties of insulin specific binding sites in the murine neuroblastoma line, N18TG2, together with insulin action on cell growth and metabolism. Also, receptor internalization has been studied. Binding experiments, carried out in standard conditions at 20 degrees C, enabled us to demonstrate that these cells bind insulin in a specific manner, thus confirming previous findings on other cell lines. Saturation curves showed the presence of two binding sites with Kd 0.3 and 9.7 nM. Competition experiments with porcine and bovine insulin showed an IC50 of 1 and 10 nM, respectively. Competition did not occur in the presence of the unrelated hormones ACTH and FSH. Dissociation experiments indicated the existence of an internalization process of the ligand-receptor complex; this was confirmed by an ultrastructural study using gold conjugated insulin. As far as the insulin action in N18TG2 cells is concerned, physiological concentrations stimulate cell proliferation, whereas no stimulation of glucose uptake was observed, indicating that insulin action in these cells is not mediated by general metabolic effects. On the basis of these data, N18TG2 line appears to be a very suitable model for further studies of the neuronal type insulin receptors, and possibly insulin specific action on the nervous system.

  15. Cortactin as a Target for FAK in the Regulation of Focal Adhesion Dynamics

    PubMed Central

    Ghassemian, Majid; Schlaepfer, David D.

    2012-01-01

    Background Efficient cell movement requires the dynamic regulation of focal adhesion (FA) formation and turnover. FAs are integrin-associated sites of cell attachment and establish linkages to the cellular actin cytoskeleton. Cells without focal adhesion kinase (FAK), an integrin-activated tyrosine kinase, exhibit defects in FA turnover and cell motility. Cortactin is an actin binding adaptor protein that can influence FA dynamics. FAK and cortactin interact, but the cellular role of this complex remains unclear. Principal Findings Using FAK-null fibroblasts stably reconstituted with green fluorescent protein (GFP) tagged FAK constructs, we find that FAK activity and FAK C-terminal proline-rich region 2 (PRR2) and PRR3 are required for FA turnover and cell motility. Cortactin binds directly to FAK PRR2 and PRR3 sites via its SH3 domain and cortactin expression is important in promoting FA turnover and GFP-FAK release from FAs. FAK-cortactin binding is negatively-regulated by FAK activity and associated with cortactin tyrosine phosphorylation. FAK directly phosphorylates cortactin at Y421 and Y466 and over-expression of cortactin Y421, Y466, and Y482 mutated to phenylalanine (3YF) prevented FAK-enhanced FA turnover and cell motility. However, phospho-mimetic cortactin mutated to glutamic acid (3YE) did not affect FA dynamics and did not rescue FA turnover defects in cells with inhibited FAK activity or with PRR2-mutated FAK that does not bind cortactin. Conclusions Our results support a model whereby FAK-mediated FA remodeling may occur through the formation of a FAK-cortactin signaling complex. This involves a cycle of cortactin binding to FAK, cortactin tyrosine phosphorylation, and subsequent cortactin-FAK dissociation accompanied by FA turnover and cell movement. PMID:22952866

  16. Increased actin polymerization reduces the inhibition of serum response factor activity by Yin Yang 1.

    PubMed Central

    Ellis, Peter D; Martin, Karen M; Rickman, Colin; Metcalfe, James C; Kemp, Paul R

    2002-01-01

    Recent evidence has implicated CC(A/T(richG))GG (CArG) boxes, binding sites for serum response factor (SRF), in the regulation of expression of a number of genes in response to changes in the actin cytoskeleton. In many cases, the activity of SRF at CArG boxes is modulated by transcription factors binding to overlapping (e.g. Yin Yang 1, YY1) or adjacent (e.g. ets) binding sites. However, the mechanisms by which SRF activity is regulated by the cytoskeleton have not been determined. To investigate these mechanisms, we screened for cells that did or did not increase the activity of a fragment of the promoter for a smooth-muscle (SM)-specific gene SM22alpha, in response to changes in actin cytoskeletal polymerization induced by LIM kinase. These experiments showed that vascular SM cells (VSMCs) and C2C12 cells increased the activity of promoters containing at least one of the SM22alpha CArG boxes (CArG near) in response to LIM kinase, whereas P19 cells did not. Bandshift assays using a probe to CArG near showed that P19 cells lacked detectable YY1 DNA binding to the CArG box in contrast with the other two cell types. Expression of YY1 in P19 cells inhibited SM22alpha promoter activity and conferred responsiveness to LIM kinase. Mutation of the CArG box to inhibit YY1 or SRF binding indicated that both factors were required for the LIM kinase response in VSMCs and C2C12 cells. The data indicate that changes in the actin cytoskeletal organization modify SRF activity at CArG boxes by modulating YY1-dependent inhibition. PMID:12023898

  17. Expression, subcellular localization, and regulation of sigma receptor in retinal muller cells.

    PubMed

    Jiang, Guoliang; Mysona, Barbara; Dun, Ying; Gnana-Prakasam, Jaya P; Pabla, Navjotsin; Li, Weiguo; Dong, Zheng; Ganapathy, Vadivel; Smith, Sylvia B

    2006-12-01

    Sigma receptors (sigmaRs) are nonopioid, nonphencyclidine binding sites with robust neuroprotective properties. Type 1 sigmaR1 (sigmaR1) is expressed in brain oligodendrocytes, but its expression and binding capacity have not been analyzed in retinal glial cells. This study examined the expression, subcellular localization, binding activity, and regulation of sigmaR1 in retinal Müller cells. Primary mouse Müller cells (MCs) were analyzed by RT-PCR, immunoblotting, and immunocytochemistry for the expression of sigmaR1, and data were compared with those of the rat Müller cell line (rMC-1) and the rat ganglion cell line (RGC-5). Confocal microscopy was used to determine the subcellular sigmaR1 location in primary mouse MCs. Membranes prepared from these cells were used for binding assays with [3H]-pentazocine (PTZ). The kinetics of binding, the ability of various sigmaR1 ligands to compete with sigmaR1 binding, and the effects of donated nitric oxide (NO) and reactive oxygen species (ROS) on binding were examined. sigmaR1 is expressed in primary mouse MCs and is localized to the nuclear and endoplasmic reticulum membranes. Binding assays showed that in primary mouse MCs, rMC-1, and RGC-5, the binding of PTZ was saturable. [3H]-PTZ bound with high affinity in RGC-5 and rMC-1 cells, and the binding was similarly robust in primary mouse MCs. Competition studies showed marked inhibition of [3H]-PTZ binding in the presence of sigmaR1-specific ligands. Incubation of cells with NO and ROS donors markedly increased sigmaR1 binding activity. MCs express sigmaR1 and demonstrate robust sigmaR1 binding activity, which is inhibited by sigmaR1 ligands and is stimulated during oxidative stress. The potential of Müller cells to bind sigmaR1 ligands may prove beneficial in retinal degenerative diseases such as diabetic retinopathy.

  18. Paxillin associates with poly(A)-binding protein 1 at the dense endoplasmic reticulum and the leading edge of migrating cells.

    PubMed

    Woods, Alison J; Roberts, Marnie S; Choudhary, Jyoti; Barry, Simon T; Mazaki, Yuichi; Sabe, Hisataka; Morley, Simon J; Critchley, David R; Norman, Jim C

    2002-02-22

    Using mass spectrometry we have identified proteins which co-immunoprecipitate with paxillin, an adaptor protein implicated in the integrin-mediated signaling pathways of cell motility. A major component of paxillin immunoprecipitates was poly(A)-binding protein 1, a 70-kDa mRNA-binding protein. Poly(A)-binding protein 1 associated with both the alpha and beta isoforms of paxillin, and this was unaffected by RNase treatment consistent with a protein-protein interaction. The NH(2)-terminal region of paxillin (residues 54-313) associated directly with poly(A)-binding protein 1 in cell lysates, and with His-poly(A)-binding protein 1 immobilized in microtiter wells. Binding was specific, saturable and of high affinity (K(d) of approximately 10 nm). Cell fractionation studies showed that at steady state, the bulk of paxillin and poly(A)-binding protein 1 was present in the "dense" polyribosome-associated endoplasmic reticulum. However, inhibition of nuclear export with leptomycin B caused paxillin and poly(A)-binding protein 1 to accumulate in the nucleus, indicating that they shuttle between the nuclear and cytoplasmic compartments. When cells migrate, poly(A)-binding protein 1 colocalized with paxillin-beta at the tips of lamellipodia. Our results suggest a new mechanism whereby a paxillin x poly(A)-binding protein 1 complex facilitates transport of mRNA from the nucleus to sites of protein synthesis at the endoplasmic reticulum and the leading lamella during cell migration.

  19. High resolution mapping of the binding site on human IgG1 for Fc gamma RI, Fc gamma RII, Fc gamma RIII, and FcRn and design of IgG1 variants with improved binding to the Fc gamma R.

    PubMed

    Shields, R L; Namenuk, A K; Hong, K; Meng, Y G; Rae, J; Briggs, J; Xie, D; Lai, J; Stadlen, A; Li, B; Fox, J A; Presta, L G

    2001-03-02

    Immunoglobulin G (IgG) Fc receptors play a critical role in linking IgG antibody-mediated immune responses with cellular effector functions. A high resolution map of the binding site on human IgG1 for human Fc gamma RI, Fc gamma RIIA, Fc gamma RIIB, Fc gamma RIIIA, and FcRn receptors has been determined. A common set of IgG1 residues is involved in binding to all Fc gamma R; Fc gamma RII and Fc gamma RIII also utilize residues outside this common set. In addition to residues which, when altered, abrogated binding to one or more of the receptors, several residues were found that improved binding only to specific receptors or simultaneously improved binding to one type of receptor and reduced binding to another type. Select IgG1 variants with improved binding to Fc gamma RIIIA exhibited up to 100% enhancement in antibody-dependent cell cytotoxicity using human effector cells; these variants included changes at residues not found at the binding interface in the IgG/Fc gamma RIIIA co-crystal structure (Sondermann, P., Huber, R., Oosthuizen, V., and Jacob, U. (2000) Nature 406, 267-273). These engineered antibodies may have important implications for improving antibody therapeutic efficacy.

  20. DNA wrapping and distortion by an oligomeric homeodomain protein.

    PubMed

    Williams, Hannah; Jayaraman, Padma-Sheela; Gaston, Kevin

    2008-10-31

    Many transcription factors alter DNA or chromatin structure. Changes in chromatin structure are often brought about by the recruitment of chromatin-binding proteins, chromatin-modifying proteins, or other transcription co-activator or co-repressor proteins. However, some transcription factors form oligomeric assemblies that may themselves induce changes in DNA conformation and chromatin structure. The proline-rich homeodomain (PRH/Hex) protein is a transcription factor that regulates cell differentiation and cell proliferation, and has multiple roles in embryonic development. Earlier, we showed that PRH can repress transcription by multiple mechanisms, including the recruitment of co-repressor proteins belonging to the TLE family of chromatin-binding proteins. Our in vivo crosslinking studies have shown that PRH forms oligomeric complexes in cells and a variety of biophysical techniques suggest that the protein forms octamers. However, as yet we have little knowledge of the role played by PRH oligomerisation in the regulation of promoter activity or of the architecture of promoters that are regulated directly by PRH in cells. Here, we compare the binding of PRH and the isolated PRH homeodomain to DNA fragments with single and multiple PRH sites, using gel retardation assays and DNase I and chemical footprinting. We show that the PRH oligomer binds to multiple sites within the human Goosecoid promoter with high affinity and that the binding of PRH brings about DNA distortion. We suggest that PRH octamers wrap DNA in order to bring about transcriptional repression.

  1. Reprogramming cell fate with a genome-scale library of artificial transcription factors.

    PubMed

    Eguchi, Asuka; Wleklinski, Matthew J; Spurgat, Mackenzie C; Heiderscheit, Evan A; Kropornicka, Anna S; Vu, Catherine K; Bhimsaria, Devesh; Swanson, Scott A; Stewart, Ron; Ramanathan, Parameswaran; Kamp, Timothy J; Slukvin, Igor; Thomson, James A; Dutton, James R; Ansari, Aseem Z

    2016-12-20

    Artificial transcription factors (ATFs) are precision-tailored molecules designed to bind DNA and regulate transcription in a preprogrammed manner. Libraries of ATFs enable the high-throughput screening of gene networks that trigger cell fate decisions or phenotypic changes. We developed a genome-scale library of ATFs that display an engineered interaction domain (ID) to enable cooperative assembly and synergistic gene expression at targeted sites. We used this ATF library to screen for key regulators of the pluripotency network and discovered three combinations of ATFs capable of inducing pluripotency without exogenous expression of Oct4 (POU domain, class 5, TF 1). Cognate site identification, global transcriptional profiling, and identification of ATF binding sites reveal that the ATFs do not directly target Oct4; instead, they target distinct nodes that converge to stimulate the endogenous pluripotency network. This forward genetic approach enables cell type conversions without a priori knowledge of potential key regulators and reveals unanticipated gene network dynamics that drive cell fate choices.

  2. Reprogramming cell fate with a genome-scale library of artificial transcription factors

    PubMed Central

    Eguchi, Asuka; Wleklinski, Matthew J.; Spurgat, Mackenzie C.; Heiderscheit, Evan A.; Kropornicka, Anna S.; Vu, Catherine K.; Bhimsaria, Devesh; Swanson, Scott A.; Stewart, Ron; Ramanathan, Parameswaran; Kamp, Timothy J.; Slukvin, Igor; Thomson, James A.; Dutton, James R.; Ansari, Aseem Z.

    2016-01-01

    Artificial transcription factors (ATFs) are precision-tailored molecules designed to bind DNA and regulate transcription in a preprogrammed manner. Libraries of ATFs enable the high-throughput screening of gene networks that trigger cell fate decisions or phenotypic changes. We developed a genome-scale library of ATFs that display an engineered interaction domain (ID) to enable cooperative assembly and synergistic gene expression at targeted sites. We used this ATF library to screen for key regulators of the pluripotency network and discovered three combinations of ATFs capable of inducing pluripotency without exogenous expression of Oct4 (POU domain, class 5, TF 1). Cognate site identification, global transcriptional profiling, and identification of ATF binding sites reveal that the ATFs do not directly target Oct4; instead, they target distinct nodes that converge to stimulate the endogenous pluripotency network. This forward genetic approach enables cell type conversions without a priori knowledge of potential key regulators and reveals unanticipated gene network dynamics that drive cell fate choices. PMID:27930301

  3. ABCB1 regulation through LRPPRC is influenced by the methylation status of the GC -100 box in its promoter

    PubMed Central

    Corrêa, Stephany; Binato, Renata; Du Rocher, Bárbara; Ferreira, Gerson; Cappelletti, Paola; Soares-Lima, Sheila; Pinto, Luis Felipe; Mencalha, André; Abdelhay, Eliana

    2014-01-01

    One of the potential mechanisms of imatinib mesylate (IM) resistance in chronic myeloid leukemia (CML) is increased level of P-glycoprotein (Pgp). Pgp is an efflux pump capable of activating the multidrug resistance (MDR) phenotype. The gene encoding Pgp (ABCB1) has several binding sites in its promoter region, along with CpG islands and GC boxes, involved in its epigenetic control. In previous work, we performed a proteomic study to identify proteins involved in IM cross-resistance in acute leukemia. Among these proteins, we identified LRPPRC as a potential regulator of ABCB1 transcription via an invMED1 binding site in ABCB1. Interestingly, this invMED1 binding site overlaps with the GC -100 box. In this work, we investigated the potential role of LRPPRC in the regulation of ABCB1 transcriptional activity in CML resistance. In addition, we evaluated the potential connection between this regulation and the methylation status of the ABCB1 promoter in its GC -100 box. Our results show that LRPPRC binds prominently to the ABCB1 promoter in Lucena cells, an IM-resistant cell line. Luciferase assays showed that ABCB1 transcription is positively regulated by LRPPRC upon its knockdown. Pyrosequencing analysis showed that the ABCB1 promoter is differentially methylated at its GC -100 box in K562 cells compared with Lucena cells, and in CML patients with different response to IM. Chromatin immunoprecipitation and Pgp expression after DNA demethylation treatment showed that LRPPRC binding is affected by the methylation status of ABCB1 GC -100 box. Taken together, our findings indicate that LRPPRC is a transcription factor related to ABCB1 expression and highlight the importance of epigenetic regulation in CML resistance. PMID:25089713

  4. ABCB1 regulation through LRPPRC is influenced by the methylation status of the GC -100 box in its promoter.

    PubMed

    Corrêa, Stephany; Binato, Renata; Du Rocher, Bárbara; Ferreira, Gerson; Cappelletti, Paola; Soares-Lima, Sheila; Pinto, Luis Felipe; Mencalha, André; Abdelhay, Eliana

    2014-08-01

    One of the potential mechanisms of imatinib mesylate (IM) resistance in chronic myeloid leukemia (CML) is increased level of P-glycoprotein (Pgp). Pgp is an efflux pump capable of activating the multidrug resistance (MDR) phenotype. The gene encoding Pgp (ABCB1) has several binding sites in its promoter region, along with CpG islands and GC boxes, involved in its epigenetic control. In previous work, we performed a proteomic study to identify proteins involved in IM cross-resistance in acute leukemia. Among these proteins, we identified LRPPRC as a potential regulator of ABCB1 transcription via an invMED1 binding site in ABCB1. Interestingly, this invMED1 binding site overlaps with the GC -100 box. In this work, we investigated the potential role of LRPPRC in the regulation of ABCB1 transcriptional activity in CML resistance. In addition, we evaluated the potential connection between this regulation and the methylation status of the ABCB1 promoter in its GC -100 box. Our results show that LRPPRC binds prominently to the ABCB1 promoter in Lucena cells, an IM-resistant cell line. Luciferase assays showed that ABCB1 transcription is positively regulated by LRPPRC upon its knockdown. Pyrosequencing analysis showed that the ABCB1 promoter is differentially methylated at its GC -100 box in K562 cells compared with Lucena cells, and in CML patients with different response to IM. Chromatin immunoprecipitation and Pgp expression after DNA demethylation treatment showed that LRPPRC binding is affected by the methylation status of ABCB1 GC -100 box. Taken together, our findings indicate that LRPPRC is a transcription factor related to ABCB1 expression and highlight the importance of epigenetic regulation in CML resistance.

  5. The retrovirus HTLV-1 inserts an ectopic CTCF-binding site into the human genome.

    PubMed

    Satou, Yorifumi; Miyazato, Paola; Ishihara, Ko; Yaguchi, Hiroko; Melamed, Anat; Miura, Michi; Fukuda, Asami; Nosaka, Kisato; Watanabe, Takehisa; Rowan, Aileen G; Nakao, Mitsuyoshi; Bangham, Charles R M

    2016-03-15

    Human T-lymphotropic virus type 1 (HTLV-1) is a retrovirus that causes malignant and inflammatory diseases in ∼10% of infected people. A typical host has between 10(4) and 10(5) clones of HTLV-1-infected T lymphocytes, each clone distinguished by the genomic integration site of the single-copy HTLV-1 provirus. The HTLV-1 bZIP (HBZ) factor gene is constitutively expressed from the minus strand of the provirus, whereas plus-strand expression, required for viral propagation to uninfected cells, is suppressed or intermittent in vivo, allowing escape from host immune surveillance. It remains unknown what regulates this pattern of proviral transcription and latency. Here, we show that CTCF, a key regulator of chromatin structure and function, binds to the provirus at a sharp border in epigenetic modifications in the pX region of the HTLV-1 provirus in T cells naturally infected with HTLV-1. CTCF is a zinc-finger protein that binds to an insulator region in genomic DNA and plays a fundamental role in controlling higher order chromatin structure and gene expression in vertebrate cells. We show that CTCF bound to HTLV-1 acts as an enhancer blocker, regulates HTLV-1 mRNA splicing, and forms long-distance interactions with flanking host chromatin. CTCF-binding sites (CTCF-BSs) have been propagated throughout the genome by transposons in certain primate lineages, but CTCF binding has not previously been described in present-day exogenous retroviruses. The presence of an ectopic CTCF-BS introduced by the retrovirus in tens of thousands of genomic locations has the potential to cause widespread abnormalities in host cell chromatin structure and gene expression.

  6. Igs expressed by chronic lymphocytic leukemia B cells show limited binding-site structure variability.

    PubMed

    Marcatili, Paolo; Ghiotto, Fabio; Tenca, Claudya; Chailyan, Anna; Mazzarello, Andrea N; Yan, Xiao-Jie; Colombo, Monica; Albesiano, Emilia; Bagnara, Davide; Cutrona, Giovanna; Morabito, Fortunato; Bruno, Silvia; Ferrarini, Manlio; Chiorazzi, Nicholas; Tramontano, Anna; Fais, Franco

    2013-06-01

    Ag selection has been suggested to play a role in chronic lymphocytic leukemia (CLL) pathogenesis, but no large-scale analysis has been performed so far on the structure of the Ag-binding sites (ABSs) of leukemic cell Igs. We sequenced both H and L chain V(D)J rearrangements from 366 CLL patients and modeled their three-dimensional structures. The resulting ABS structures were clustered into a small number of discrete sets, each containing ABSs with similar shapes and physicochemical properties. This structural classification correlates well with other known prognostic factors such as Ig mutation status and recurrent (stereotyped) receptors, but it shows a better prognostic value, at least in the case of one structural cluster for which clinical data were available. These findings suggest, for the first time, to our knowledge, on the basis of a structural analysis of the Ab-binding sites, that selection by a finite quota of antigenic structures operates on most CLL cases, whether mutated or unmutated.

  7. A Monofunctional Platinum Complex Coordinated to a Rhodium Metalloinsertor Selectively Binds Mismatched DNA in the Minor Groove

    PubMed Central

    Weidmann, Alyson G.; Barton, Jacqueline K.

    2015-01-01

    We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh—O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA non-classically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors. PMID:26397309

  8. Structural and Mechanistic Insight into the Listeria monocytogenes Two-enzyme Lipoteichoic Acid Synthesis System*

    PubMed Central

    Campeotto, Ivan; Percy, Matthew G.; MacDonald, James T.; Förster, Andreas; Freemont, Paul S.; Gründling, Angelika

    2014-01-01

    Lipoteichoic acid (LTA) is an important cell wall component required for proper cell growth in many Gram-positive bacteria. In Listeria monocytogenes, two enzymes are required for the synthesis of this polyglycerolphosphate polymer. The LTA primase LtaPLm initiates LTA synthesis by transferring the first glycerolphosphate (GroP) subunit onto the glycolipid anchor and the LTA synthase LtaSLm extends the polymer by the repeated addition of GroP subunits to the tip of the growing chain. Here, we present the crystal structures of the enzymatic domains of LtaPLm and LtaSLm. Although the enzymes share the same fold, substantial differences in the cavity of the catalytic site and surface charge distribution contribute to enzyme specialization. The eLtaSLm structure was also determined in complex with GroP revealing a second GroP binding site. Mutational analysis confirmed an essential function for this binding site and allowed us to propose a model for the binding of the growing chain. PMID:25128528

  9. A monofunctional platinum complex coordinated to a rhodium metalloinsertor selectively binds mismatched DNA in the minor groove.

    PubMed

    Weidmann, Alyson G; Barton, Jacqueline K

    2015-10-05

    We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh-O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA nonclassically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and it triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors.

  10. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  11. Initial targets and cellular responses to PDT

    NASA Astrophysics Data System (ADS)

    Rodriguez, Myriam E.; Azizuddin, Kashif; Chiu, Song-mao; Delos Santos, Grace; Joseph, Sheeba; Xue, Liang-yan; Oleinick, Nancy L.

    2007-02-01

    Pc 4, a photosensitizer first synthesized at Case Western Reserve University and now in clinical trial at University Hospitals of Cleveland, has been shown to bind preferentially and with high affinity to mitochondrial and endoplasmic reticulum membranes. Upon photoirradiation of Pc 4-loaded cells, membrane components are photodamaged. In most cancer cells, apoptosis is triggered by the initial photodamage; however, in cells deficient in one of the critical intermediates of apoptosis, this process does not occur, although the cells remain as sensitive to the lethal effects of Pc 4-PDT as the apoptosis-competent cells, when cell death is determined by colony formation. Here we report that an alternative death process, autophagy, is induced in all cells tested and becomes the dominant pathway for elimination of lethally damaged cells when apoptosis is compromised. The anti-apoptotic protein Bcl-2, when overexpressed, protects only apoptosis-competent cells against loss of clonogenicity, while the autophagy inhibitor 3-methyladenine provides a markedly greater protection to apoptosis-deficient cells. The results suggest that the primary determinant of cell death is not the final pathway for elimination of the cells but the initial photodamage to critical membrane targets. In attempts to identify those targets, we have studied the role of different membrane phospholipids in the localization of Pc 4. Cardiolipin (CL) is a phospholipid found exclusively in the mitochondrial inner membrane and at the contact sites between the inner and outer membranes. Previous fluorescence resonance energy transfer studies revealed colocalization of Pc 4 and CL, which points to CL as a possible binding site and target for Pc 4. Unilamellar liposomes with different lipid compositions were used as membrane models to test the affinity of Pc 4. As revealed by the binding constants, Pc 4 does not display preferential binding to CL in these systems. Moreover, binding affinities appear to be independent of lipid composition. Localization of Pc 4 in mitochondrial membranes is likely determined by proteins or other factors not replicated in the liposomes. Studies in cells with modified CL content could report modified binding affinities.

  12. USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

    PubMed

    Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

    1991-09-11

    The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

  13. Biosorption of heavy metal ions on Rhodobacter sphaeroides and Alcaligenes eutrophus H16

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seki, Hideshi; Suzuki, Akira; Mitsueda, Shinichiro

    1998-01-15

    A fundamental study of the application of bacteria to the recovery of toxic heavy metals from aqueous environments was carried out. The biosorption characteristics of cadmium and lead ions were determined with purple nonsulfur bacteria, Rhodobacter sphaeroides and hydrogen bacteria, Alcaligenes eutrophus H16 that were inactivated by steam sterilization. A simplified version of the metal binding model proposed by Plette et al. was used for the description of meal binding data. The results showed that the biosorption of bivalent metal ions to whole cell bodies of the bacteria was due to monodentate binding to two different types of acidic sites:more » carboxilic and phosphatic-type sites. The number of metal binding sites of A. eutrophus was 2.4-fold larger than that of R. sphaeroides.« less

  14. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-03-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

  15. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed Central

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-01-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

  16. p65 fragments, homologous to the C2 region of protein kinase C, bind to the intracellular receptors for protein kinase C.

    PubMed

    Mochly-Rosen, D; Miller, K G; Scheller, R H; Khaner, H; Lopez, J; Smith, B L

    1992-09-08

    Receptors for activated protein kinase C (RACKs) have been isolated from the particulate cell fraction of heart and brain. We previously demonstrated that binding of protein kinase C (PKC) to RACKs requires PKC activators and is via a site on PKC that is distinct from the substrate binding site. Here, we examine the possibility that the C2 region in the regulatory domain of PKC is involved in binding of PKC to RACKs. The synaptic vesicle-specific p65 protein contains two regions homologous to the C2 region of PKC. We found that three p65 fragments, containing either one or two of these PKC C2 homologous regions, bound to highly purified RACKs. Binding of the p65 fragments and PKC to RACKs was mutually exclusive; preincubation of RACKs with the p65 fragments inhibited PKC binding, and preincubation of RACKs with PKC inhibited binding of the p65 fragments. Preincubation of the p65 fragments with a peptide resembling the PKC binding site on RACKs also inhibited p65 binding to RACKs, suggesting that PKC and p65 bind to the same or nearby regions on RACKs. Since the only homologous region between PKC and the p65 fragments is the C2 region, these results suggest that the C2 region on PKC contains at least part of the RACK binding site.

  17. Structural basis for collagen recognition by the immune receptor OSCAR.

    PubMed

    Zhou, Long; Hinerman, Jennifer M; Blaszczyk, Michal; Miller, Jeanette L C; Conrady, Deborah G; Barrow, Alexander D; Chirgadze, Dimitri Y; Bihan, Dominique; Farndale, Richard W; Herr, Andrew B

    2016-02-04

    The osteoclast-associated receptor (OSCAR) is a collagen-binding immune receptor with important roles in dendritic cell maturation and activation of inflammatory monocytes as well as in osteoclastogenesis. The crystal structure of the OSCAR ectodomain is presented, both free and in complex with a consensus triple-helical peptide (THP). The structures revealed a collagen-binding site in each immunoglobulin-like domain (D1 and D2). The THP binds near a predicted collagen-binding groove in D1, but a more extensive interaction with D2 is facilitated by the unusually wide D1-D2 interdomain angle in OSCAR. Direct binding assays, combined with site-directed mutagenesis, confirm that the primary collagen-binding site in OSCAR resides in D2, in marked contrast to the related collagen receptors, glycoprotein VI (GPVI) and leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1). Monomeric OSCAR D1D2 binds to the consensus THP with a KD of 28 µM measured in solution, but shows a higher affinity (KD 1.5 μM) when binding to a solid-phase THP, most likely due to an avidity effect. These data suggest a 2-stage model for the interaction of OSCAR with a collagen fibril, with transient, low-affinity interactions initiated by the membrane-distal D1, followed by firm adhesion to the primary binding site in D2. © 2016 by The American Society of Hematology.

  18. Transport direction determines the kinetics of substrate transport by the glutamate transporter EAAC1

    PubMed Central

    Zhang, Zhou; Tao, Zhen; Gameiro, Armanda; Barcelona, Stephanie; Braams, Simona; Rauen, Thomas; Grewer, Christof

    2007-01-01

    Glutamate transport by the excitatory amino acid carrier EAAC1 is known to be reversible. Thus, glutamate can either be taken up into cells, or it can be released from cells through reverse transport, depending on the electrochemical gradient of the co- and countertransported ions. However, it is unknown how fast and by which reverse transport mechanism glutamate can be released from cells. Here, we determined the steady- and pre-steady-state kinetics of reverse glutamate transport with submillisecond time resolution. First, our results suggest that glutamate and Na+ dissociate from their cytoplasmic binding sites sequentially, with glutamate dissociating first, followed by the three cotransported Na+ ions. Second, the kinetics of glutamate transport depend strongly on transport direction, with reverse transport being faster but less voltage-dependent than forward transport. Third, electrogenicity is distributed over several reverse transport steps, including intracellular Na+ binding, reverse translocation, and reverse relocation of the K+-bound EAAC1. We propose a kinetic model, which is based on a “first-in-first-out” mechanism, suggesting that glutamate association, with its extracellular binding site as well as dissociation from its intracellular binding site, precedes association and dissociation of at least one Na+ ion. Our model can be used to predict rates of glutamate release from neurons under physiological and pathophysiological conditions. PMID:17991780

  19. Identification and pharmacological characterization of native, functional human urotensin-II receptors in rhabdomyosarcoma cell lines

    PubMed Central

    Douglas, Stephen A; Naselsky, Diane; Ao, Zhaohui; Disa, Jyoti; Herold, Christopher L; Lynch, Frank; Aiyar, Nambi V

    2004-01-01

    In an effort to identify endogenous, native mammalian urotensin-II (U-II) receptors (UT), a diverse range of human, primate and rodent cell lines (49 in total) were screened for the presence of detectable [125I]hU-II binding sites. UT mRNA (Northern blot, PCR) and protein (immunocytochemistry) were evident in human skeletal muscle tissue and cells. [125I]hU-II bound to a homogenous population of high-affinity, saturable (Kd 67.0±11.8 pM, Bmax 9687±843 sites cell−1) receptors in the skeletal muscle (rhabdomyosarcoma) cell line SJRH30. Radiolabel was characteristically slow to dissociate (⩽15% dissociation 90 min). A lower density of high-affinity U-II binding sites was also evident in the rhabdomyosarcoma cell line TE671 (1667±165 sites cell−1, Kd 74±8 pM). Consistent with the profile recorded in human recombinant UT-HEK293 cells, [125I]hU-II binding to SJRH30 cells was selectively displaced by both mammalian and fish U-II isopeptides (Kis 0.5±0.1–1.2±0.3 nM) and related analogues (hU-II[4-11]>[Cys5,10]Acm hU-II; Kis 0.4±0.1 and 864±193 nM, respectively). U-II receptor activation was functionally coupled to phospholipase C-mediated [Ca2+]i mobilization (EC50 6.9±2.2 nM) in SJRH30 cells. The present study is the first to identify the presence of ‘endogenous' U-II receptors in SJRH30 and TE671 cells. SJRH30 cells, in particular, might prove to be of utility for (a) investigating the pharmacological properties of hU-II and related small molecule antagonists at native human UT and (b) delineating the role of this neuropeptide in the (patho)physiological regulation of mammalian neuromuscular function. PMID:15210573

  20. The fine-tuning of TRAF2–GSTP1-1 interaction: effect of ligand binding and in situ detection of the complex

    PubMed Central

    De Luca, A; Mei, G; Rosato, N; Nicolai, E; Federici, L; Palumbo, C; Pastore, A; Serra, M; Caccuri, A M

    2014-01-01

    We provide the first biochemical evidence of a direct interaction between the glutathione transferase P1-1 (GSTP1-1) and the TRAF domain of TNF receptor-associated factor 2 (TRAF2), and describe how ligand binding modulates such an equilibrium. The dissociation constant of the heterocomplex is Kd=0.3 μM; however the binding affinity strongly decreases when the active site of GSTP1-1 is occupied by the substrate GSH (Kd≥2.6 μM) or is inactivated by oxidation (Kd=1.7 μM). This indicates that GSTP1-1's TRAF2-binding region involves the GSH-binding site. The GSTP1-1 inhibitor NBDHEX further decreases the complex's binding affinity, as compared with when GSH is the only ligand; this suggests that the hydrophobic portion of the GSTP1-1 active site also contributes to the interaction. We therefore hypothesize that TRAF2 binding inactivates GSTP1-1; however, analysis of the data, using a model taking into account the dimeric nature of GSTP1-1, suggests that GSTP1-1 engages only one subunit in the complex, whereas the second subunit maintains the catalytic activity or binds to other proteins. We also analyzed GSTP1-1's association with TRAF2 at the cellular level. The TRAF2–GSTP1-1 complex was constitutively present in U-2OS cells, but strongly decreased in S, G2 and M phases. Thus the interaction appears regulated in a cell cycle-dependent manner. The variations in the levels of individual proteins seem too limited to explain the complex's drastic decline observed in cells progressing from the G0/G1 to the S–G2–M phases. Moreover, GSH's intracellular content was so high that it always saturated GSTP1-1. Interestingly, the addition of NBDHEX maintains the TRAF2–GSTP1-1 complex at low levels, thus causing a prolonged cell cycle arrest in the G2/M phase. Overall, these findings suggest that a reversible sequestration of TRAF2 into the complex may be crucial for cell cycle progression and that multiple factors are involved in the fine-tuning of this interaction. PMID:24457959

  1. Biological Evaluation in Vitro and in Silico of Azetidin-2-one Derivatives as Potential Anticancer Agents.

    PubMed

    Olazaran, Fabián E; Rivera, Gildardo; Pérez-Vázquez, Alondra M; Morales-Reyes, Cynthia M; Segura-Cabrera, Aldo; Balderas-Rentería, Isaías

    2017-01-12

    Potential anticancer activity of 16 azetidin-2-one derivatives was evaluated showing that compound 6 [ N -( p -methoxy-phenyl)-2-( p -methyl-phenyl)-3-phenoxy-azetidin-2-one] presented cytotoxic activity in SiHa cells and B16F10 cells. The caspase-3 assay in B16F10 cells displayed that azetidin-2-one derivatives induce apoptosis. Microarray and molecular analysis showed that compound 6 was involved on specific gene overexpression of cytoskeleton regulation and apoptosis due to the inhibition of some cell cycle genes. From the 16 derivatives, compound 6 showed the highest selectivity to neoplastic cells, it was an inducer of apoptosis, and according to an in silico analysis of chemical interactions with colchicine binding site of human α/β-tubulin, the mechanism of action could be a molecular interaction involving the amino acids outlining such binding site.

  2. Biological Evaluation in Vitro and in Silico of Azetidin-2-one Derivatives as Potential Anticancer Agents

    PubMed Central

    2016-01-01

    Potential anticancer activity of 16 azetidin-2-one derivatives was evaluated showing that compound 6 [N-(p-methoxy-phenyl)-2-(p-methyl-phenyl)-3-phenoxy-azetidin-2-one] presented cytotoxic activity in SiHa cells and B16F10 cells. The caspase-3 assay in B16F10 cells displayed that azetidin-2-one derivatives induce apoptosis. Microarray and molecular analysis showed that compound 6 was involved on specific gene overexpression of cytoskeleton regulation and apoptosis due to the inhibition of some cell cycle genes. From the 16 derivatives, compound 6 showed the highest selectivity to neoplastic cells, it was an inducer of apoptosis, and according to an in silico analysis of chemical interactions with colchicine binding site of human α/β-tubulin, the mechanism of action could be a molecular interaction involving the amino acids outlining such binding site. PMID:28105271

  3. Computational repositioning of ethno medicine elucidated gB-gH-gL complex as novel anti herpes drug target

    PubMed Central

    2013-01-01

    Background Herpes viruses are important human pathogens that can cause mild to severe lifelong infections with high morbidity. They remain latent in the host cells and can cause recurrent infections that might prove fatal. These viruses are known to infect the host cells by causing the fusion of viral and host cell membrane proteins. Fusion is achieved with the help of conserved fusion machinery components, glycoproteins gB, heterodimer gH-gL complex along with other non-conserved components. Whereas, another important glycoprotein gD without which viral entry to the cell is not possible, acts as a co-activator for the gB-gH-gL complex formation. Thus, this complex formation interface is the most promising drug target for the development of novel anti-herpes drug candidates. In the present study, we propose a model for binding of gH-gL to gB glycoprotein leading from pre to post conformational changes during gB-gH-gL complex formation and reported the key residues involved in this binding activity along with possible binding site locations. To validate the drug targetability of our proposed binding site, we have repositioned some of the most promising in vitro, in vivo validated anti-herpes molecules onto the proposed binding site of gH-gL complex in a computational approach. Methods Hex 6.3 standalone software was used for protein-protein docking studies. Arguslab 4.0.1 and Accelrys® Discovery Studio 3.1 Visualizer softwares were used for semi-flexible docking studies and visualizing the interactions respectively. Protein receptors and ethno compounds were retrieved from Protein Data Bank (PDB) and Pubchem databases respectively. Lipinski’s Filter, Osiris Property Explorer and Lazar online servers were used to check the pharmaceutical fidelity of the drug candidates. Results Through protein-protein docking studies, it was identified that the amino acid residues VAL342, GLU347, SER349, TYR355, SER388, ASN395, HIS398 and ALA387 of gH-gL complex play an active role in its binding activity with gB. Semi flexible docking analysis of the most promising in vitro, in vivo validated anti-herpes molecules targeting the above mentioned key residues of gH-gL complex showed that all the analyzed ethno medicinal compounds have successfully docked into the proposed binding site of gH-gL glycoprotein with binding energy range between -10.4 to -6.4 K.cal./mol. Conclusions Successful repositioning of the analyzed compounds onto the proposed binding site confirms the drug targetability of gH-gL complex. Based on the free binding energy and pharmacological properties, we propose (3-chloro phenyl) methyl-3,4,5 trihydroxybenzoate as worth a small ethno medicinal lead molecule for further development as potent anti-herpes drug candidate targeting gB-gH-gL complex formation interface. PMID:23587166

  4. Cytotoxic effect of achatinin(H) (lectin) from Achatina fulica against a human mammary carcinoma cell line (MCF7).

    PubMed

    Dharmu, Indra; Ramamurty, N; Kannan, Ramalingam; Babu, Mary

    2007-01-01

    The hemolymph-derived achatinin(H) (lectin) from Achatina fulica showed a marked cytotoxic effect on MCF7, a human mammary carcinoma cell line. IC(50) values as measured by the 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide assay for achatinin(H) ranged from 6 to 10 microg/ml in the MCF7 cells. MCF7 cells showed significant morphological changes leading to cell death. The above cell death was observed after 48 h of treatment with 8 microg/ml when compared to untreated cells. Alterations in the tumor marker enzymes, as well as in antioxidant enzymes, were observed after achatinin(H) treatment. The specificity and purity of the achatinin(H) was confirmed by the Western blot assay. Achatinin(H) binding to MCF7 cells was detected by anti-achatinin(H), and visualization of the achatinin(H) binding sites on confluent MCF7 cells was confirmed by flourescein isothiocyanate conjugated secondary antibody. MCF7-treated cells fluoresced, indicating the presence of achatinin(H) binding sites. Fluorescence-activated cell sorting analysis of the cell cycle showed a significant increase in S-phase in MCF7 cells after 48 h of achatinin(H) treatment. The cells were arrested in G(2)/M phase of the cell cycle after 48 h with significant changes in cell viability. Cellular damage was confirmed by agarose gel electrophoresis with the characteristic appearance of a DNA streak in treated MCF7 cells indicating the ongoing apoptosis.

  5. Miglustat (NB-DNJ) works as a chaperone for mutated acid beta-glucosidase in cells transfected with several Gaucher disease mutations.

    PubMed

    Alfonso, Pilar; Pampín, Sandra; Estrada, Jorge; Rodríguez-Rey, José Carlos; Giraldo, Pilar; Sancho, Javier; Pocoví, Miguel

    2005-01-01

    Gaucher disease (GD) is a disorder of glycosphinglipid metabolism caused by deficiency of lysosomal acid beta-glucosidase (GC), resulting in progressive deposition of glucosylceramide in macrophages. The glucose analogue, N-butyl-deoxynojirimycin (NB-DNJ, Miglustat), is an inhibitor of the ceramide-specific glucosyltransferase (CSG) which catalyzes the first step of glycosphingolipids biosynthesis and is currently approved for the oral treatment of type 1 GD. Using site-directed mutagenesis, we constructed plasmids containing wild-type and several mutations in glucocerebrosidase (GBA) gene. The plasmids were transfected into COS-7 cells and stable transfected cell lines were obtained by geneticin (G418) selection. Cells were cultured during 6 days with medium with or without 10 microM NB-DNJ. The addition of NB-DNJ to COS-7 cell medium leads to 1.3-, 2.1-, 2.3-, 3.6-, and 9.9-fold increase in the activity of S364R, wild-type, N370S, V15M, and M123T GC, respectively. However, no significant changes were observed in the activity of the L444P, L336P, and S465del mutated proteins, but a small decrease in the rare P266L variant was observed. These results suggest that NB-DNJ, in addition to the inhibitory effect on CSG, also works as a "chemical chaperone", increasing the activity of acid beta-glucosidase of wild-type and several GC mutated proteins, including the most frequent N370S mutation. The specific location of the Miglustat binding site in GC is unknown. Potential binding sites in the enzyme have been searched for using computational molecular docking. The searching strategy identified three potential GC binding sites for Miglustat, one being the substrate-binding site of the enzyme, which was the best-ranked site by AutoDock program. Therefore, it is possible that Miglustat exerts its chaperoning activity on acid beta-glucosidase by acting as an inhibitor bound at the active site. This increase on the activity of the acid beta-glucosidase would imply that Miglustat is not only a substrate reducer but also an inhibitor of the GC degradation, with very promising clinical implications for the treatment of GD patients.

  6. Data on master regulators and transcription factor binding sites found by upstream analysis of multi-omics data on methotrexate resistance of colon cancer.

    PubMed

    Kel, AlexanderE

    2017-02-01

    Computational analysis of master regulators through the search for transcription factor binding sites followed by analysis of signal transduction networks of a cell is a new approach of causal analysis of multi-omics data. This paper contains results on analysis of multi-omics data that include transcriptomics, proteomics and epigenomics data of methotrexate (MTX) resistant colon cancer cell line. The data were used for analysis of mechanisms of resistance and for prediction of potential drug targets and promising compounds for reverting the MTX resistance of these cancer cells. We present all results of the analysis including the lists of identified transcription factors and their binding sites in genome and the list of predicted master regulators - potential drug targets. This data was generated in the study recently published in the article "Multi-omics "Upstream Analysis" of regulatory genomic regions helps identifying targets against methotrexate resistance of colon cancer" (Kel et al., 2016) [4]. These data are of interest for researchers from the field of multi-omics data analysis and for biologists who are interested in identification of novel drug targets against NTX resistance.

  7. NF-{kappa}B p65 represses {beta}-catenin-activated transcription of cyclin D1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hwang, Injoo; Choi, Yong Seok; Jeon, Mi-Ya

    2010-12-03

    Research highlights: {yields} Cyclin D1 transcription is directly activated by {beta}-catenin; however, {beta}-catenin-induced cyclin D1 transcription is reduced by NF-{kappa}B p65. {yields} Protein-protein interaction between NF-{kappa}B p65 and {beta}-catenin might be responsible for p65-mediated repression of cyclin D1. {yields} One of five putative binding sites, located further upstream of other sites, is the major {beta}-catenin binding site in the cyclin D1 promoter. {yields} NF-{kappa}B binding site in cyclin D1 is occupied not only by p65 but also by {beta}-catenin, which is dynamically regulated by the signal. -- Abstract: Signaling crosstalk between the {beta}-catenin and NF-{kappa}B pathways represents a functional network.more » To test whether the crosstalk also occurs on their common target genes, the cyclin D1 promoter was used as a model because it contains binding sites for both proteins. {beta}-catenin activated transcription from the cyclin D1 promoter, while co-expression of NF-{kappa}B p65 reduced {beta}-catenin-induced transcription. Chromatin immunoprecipitation revealed lithium chloride-induced binding of {beta}-catenin on one of the T-cell activating factor binding sites. More interestingly, {beta}-catenin binding was greatly reduced by NF-{kappa}B p65, possibly by the protein-protein interaction between the two proteins. Such a dynamic and complex binding of {beta}-catenin and NF-{kappa}B on promoters might contribute to the regulated expression of their target genes.« less

  8. Dual control by Cdk1 phosphorylation of the budding yeast APC/C ubiquitin ligase activator Cdh1.

    PubMed

    Höckner, Sebastian; Neumann-Arnold, Lea; Seufert, Wolfgang

    2016-07-15

    The antagonism between cyclin-dependent kinases (Cdks) and the ubiquitin ligase APC/C-Cdh1 is central to eukaryotic cell cycle control. APC/C-Cdh1 targets cyclin B and other regulatory proteins for degradation, whereas Cdks disable APC/C-Cdh1 through phosphorylation of the Cdh1 activator protein at multiple sites. Budding yeast Cdh1 carries nine Cdk phosphorylation sites in its N-terminal regulatory domain, most or all of which contribute to inhibition. However, the precise role of individual sites has remained unclear. Here, we report that the Cdk phosphorylation sites of yeast Cdh1 are organized into autonomous subgroups and act through separate mechanisms. Cdk sites 1-3 had no direct effect on the APC/C binding of Cdh1 but inactivated a bipartite nuclear localization sequence (NLS) and thereby controlled the partitioning of Cdh1 between cytoplasm and nucleus. In contrast, Cdk sites 4-9 did not influence the cell cycle-regulated localization of Cdh1 but prevented its binding to the APC/C. Cdk sites 4-9 reside near two recently identified APC/C interaction motifs in a pattern conserved with the human Cdh1 orthologue. Thus a Cdk-inhibited NLS goes along with Cdk-inhibited APC/C binding sites in yeast Cdh1 to relay the negative control by Cdk1 phosphorylation of the ubiquitin ligase APC/C-Cdh1. © 2016 Höckner et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  9. The c-myb proto-oncogene and microRNA-15a comprise an active autoregulatory feedback loop in human hematopoietic cells

    PubMed Central

    Zhao, Huiwu; Kalota, Anna; Jin, Shenghao

    2009-01-01

    The c-myb proto-oncogene encodes an obligate hematopoietic cell transcription factor important for lineage commitment, proliferation, and differentiation. Given its critical functions, c-Myb regulatory factors are of great interest but remain incompletely defined. Herein we show that c-Myb expression is subject to posttranscriptional regulation by microRNA (miRNA)–15a. Using a luciferase reporter assay, we found that miR-15a directly binds the 3′-UTR of c-myb mRNA. By transfecting K562 myeloid leukemia cells with a miR-15a mimic, functionality of binding was shown. The mimic decreased c-Myb expression, and blocked the cells in the G1 phase of cell cycle. Exogenous expression of c-myb mRNA lacking the 3′-UTR partially rescued the miR-15a induced cell-cycle block. Of interest, the miR-15a promoter contained several potential c-Myb protein binding sites. Occupancy of one canonical c-Myb binding site was demonstrated by chromatin immunoprecipitation analysis and shown to be required for miR-15a expression in K562 cells. Finally, in studies using normal human CD34+ cells, we showed that c-Myb and miR-15a expression were inversely correlated in cells undergoing erythroid differentiation, and that overexpression of miR-15a blocked both erythroid and myeloid colony formation in vitro. In aggregate, these findings suggest the presence of a c-Myb–miR-15a autoregulatory feedback loop of potential importance in human hematopoiesis. PMID:18818396

  10. Exploring molecular insights into the interaction mechanism of cholesterol derivatives with the Mce4A: A combined spectroscopic and molecular dynamic simulation studies.

    PubMed

    Khan, Shagufta; Khan, Faez Iqbal; Mohammad, Taj; Khan, Parvez; Hasan, Gulam Mustafa; Lobb, Kevin A; Islam, Asimul; Ahmad, Faizan; Imtaiyaz Hassan, Md

    2018-05-01

    Mammalian cell entry protein (Mce4A) is a member of MCE-family, and is being considered as a potential drug target of Mycobacterium tuberculosis infection because it is required for invasion and latent survival of pathogen by utilizing host's cholesterol. In the present study, we performed molecular docking followed by 100 ns MD simulation studies to understand the mechanism of interaction of Mce4A to the cholesterol derivatives and probucol. The selected ligands, cholesterol, 25-hydroxycholesterol, 5-cholesten-3β-ol-7-one and probucol bind to the predicted active site cavity of Mce4A, and complexes remain stable during entire simulation of 100 ns. In silico studies were further validated by fluorescence-binding studies to calculate actual binding affinity and number of binding site(s). The non-toxicity of all ligands was confirmed on human monocytic cell (THP1) by MTT assay. This work provides a deeper insight into the mechanism of interaction of Mce4A to cholesterol derivatives, which may be further exploited to design potential and specific inhibitors to ameliorate the Mycobacterium pathogenesis. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. How Force Might Activate Talin's Vinculin Binding Sites: SMD Reveals a Structural Mechanism

    PubMed Central

    Hytönen, Vesa P; Vogel, Viola

    2008-01-01

    Upon cell adhesion, talin physically couples the cytoskeleton via integrins to the extracellular matrix, and subsequent vinculin recruitment is enhanced by locally applied tensile force. Since the vinculin binding (VB) sites are buried in the talin rod under equilibrium conditions, the structural mechanism of how vinculin binding to talin is force-activated remains unknown. Taken together with experimental data, a biphasic vinculin binding model, as derived from steered molecular dynamics, provides high resolution structural insights how tensile mechanical force applied to the talin rod fragment (residues 486–889 constituting helices H1–H12) might activate the VB sites. Fragmentation of the rod into three helix subbundles is prerequisite to the sequential exposure of VB helices to water. Finally, unfolding of a VB helix into a completely stretched polypeptide might inhibit further binding of vinculin. The first events in fracturing the H1–H12 rods of talin1 and talin2 in subbundles are similar. The proposed force-activated α-helix swapping mechanism by which vinculin binding sites in talin rods are exposed works distinctly different from that of other force-activated bonds, including catch bonds. PMID:18282082

  12. BloodChIP: a database of comparative genome-wide transcription factor binding profiles in human blood cells.

    PubMed

    Chacon, Diego; Beck, Dominik; Perera, Dilmi; Wong, Jason W H; Pimanda, John E

    2014-01-01

    The BloodChIP database (http://www.med.unsw.edu.au/CRCWeb.nsf/page/BloodChIP) supports exploration and visualization of combinatorial transcription factor (TF) binding at a particular locus in human CD34-positive and other normal and leukaemic cells or retrieval of target gene sets for user-defined combinations of TFs across one or more cell types. Increasing numbers of genome-wide TF binding profiles are being added to public repositories, and this trend is likely to continue. For the power of these data sets to be fully harnessed by experimental scientists, there is a need for these data to be placed in context and easily accessible for downstream applications. To this end, we have built a user-friendly database that has at its core the genome-wide binding profiles of seven key haematopoietic TFs in human stem/progenitor cells. These binding profiles are compared with binding profiles in normal differentiated and leukaemic cells. We have integrated these TF binding profiles with chromatin marks and expression data in normal and leukaemic cell fractions. All queries can be exported into external sites to construct TF-gene and protein-protein networks and to evaluate the association of genes with cellular processes and tissue expression.

  13. Identification and characterization of Hoxa9 binding sites in hematopoietic cells

    PubMed Central

    Huang, Yongsheng; Sitwala, Kajal; Bronstein, Joel; Sanders, Daniel; Dandekar, Monisha; Collins, Cailin; Robertson, Gordon; MacDonald, James; Cezard, Timothee; Bilenky, Misha; Thiessen, Nina; Zhao, Yongjun; Zeng, Thomas; Hirst, Martin; Hero, Alfred; Jones, Steven

    2012-01-01

    The clustered homeobox proteins play crucial roles in development, hematopoiesis, and leukemia, yet the targets they regulate and their mechanisms of action are poorly understood. Here, we identified the binding sites for Hoxa9 and the Hox cofactor Meis1 on a genome-wide level and profiled their associated epigenetic modifications and transcriptional targets. Hoxa9 and the Hox cofactor Meis1 cobind at hundreds of highly evolutionarily conserved sites, most of which are distant from transcription start sites. These sites show high levels of histone H3K4 monomethylation and CBP/P300 binding characteristic of enhancers. Furthermore, a subset of these sites shows enhancer activity in transient transfection assays. Many Hoxa9 and Meis1 binding sites are also bound by PU.1 and other lineage-restricted transcription factors previously implicated in establishment of myeloid enhancers. Conditional Hoxa9 activation is associated with CBP/P300 recruitment, histone acetylation, and transcriptional activation of a network of proto-oncogenes, including Erg, Flt3, Lmo2, Myb, and Sox4. Collectively, this work suggests that Hoxa9 regulates transcription by interacting with enhancers of genes important for hematopoiesis and leukemia. PMID:22072553

  14. Modified 5-fluorouracil: Uridine phosphorylase inhibitor

    NASA Astrophysics Data System (ADS)

    Lashkov, A. A.; Shchekotikhin, A. A.; Shtil, A. A.; Sotnichenko, S. E.; Mikhailov, A. M.

    2016-09-01

    5-Fluorouracil (5-FU) is a medication widely used in chemotherapy to treat various types of cancer. Being a substrate for the reverse reaction catalyzed by uridine phosphorylase (UPase), 5-FU serves as a promising prototype molecule (molecular scaffold) for the design of a selective UPase inhibitor that enhances the antitumor activity of 5-FU and exhibits intrinsic cytostatic effects on cancer cells. The chemical formula of the new compound, which binds to the uracil-binding site and, in the presence of a phosphate anion, to the phosphate-binding site of UPase, is proposed and investigated by molecular simulation methods.

  15. Ankyrin-binding proteins related to nervous system cell adhesion molecules: candidates to provide transmembrane and intercellular connections in adult brain.

    PubMed

    Davis, J Q; McLaughlin, T; Bennett, V

    1993-04-01

    A major class of ankyrin-binding glycoproteins have been identified in adult rat brain of 186, 155, and 140 kD that are alternatively spliced products of the same pre-mRNA. Characterization of cDNAs demonstrated that ankyrin-binding glycoproteins (ABGPs) share 72% amino acid sequence identity with chicken neurofascin, a membrane-spanning neural cell adhesion molecule in the Ig super-family expressed in embryonic brain. ABGP polypeptides have the following features consistent with a role as ankyrin-binding proteins in vitro and in vivo: (a) ABGPs and ankyrin associate as pure proteins in a 1:1 molar stoichiometry; (b) the ankyrin-binding site is located in the COOH-terminal 21 kD of ABGP186 which contains the predicted cytoplasmic domain; (c) ABGP186 is expressed at approximately the same levels as ankyrin (15 pmoles/milligram of membrane protein); and (d) ABGP polypeptides are co-expressed with the adult form of ankyrinB late in postnatal development and are colocalized with ankyrinB by immunofluorescence. Similarity in amino acid sequence and conservation of sites of alternative splicing indicate that genes encoding ABGPs and neurofascin share a common ancestor. However, the major differences in developmental expression reported for neurofascin in embryos versus the late postnatal expression of ABGPs suggest that ABGPs and neurofascin represent products of gene duplication events that have subsequently evolved in parallel with distinct roles. The predicted cytoplasmic domains of rat ABGPs and chicken neurofascin are nearly identical to each other and closely related to a group of nervous system cell adhesion molecules with variable extracellular domains, which includes L1, Nr-CAM, and Ng-CAM of vertebrates, and neuroglian of Drosophila. The ankyrin-binding site of rat ABGPs is localized to the C-terminal 200 residues which encompass the cytoplasmic domain, suggesting the hypothesis that ability to associate with ankyrin may be a shared feature of neurofascin and related nervous system cell adhesion molecules.

  16. Oxysterol-binding protein-related protein (ORP) 9 is a PDK-2 substrate and regulates Akt phosphorylation.

    PubMed

    Lessmann, Eva; Ngo, Mike; Leitges, Michael; Minguet, Susana; Ridgway, Neale D; Huber, Michael

    2007-02-01

    The oxysterol-binding protein and oxysterol-binding protein-related protein family has been implicated in lipid transport and metabolism, vesicle trafficking and cell signaling. While investigating the phosphorylation of Akt/protein kinase B in stimulated bone marrow-derived mast cells, we observed that a monoclonal antibody directed against phospho-S473 Akt cross-reacted with oxysterol-binding protein-related protein 9 (ORP9). Further analysis revealed that mast cells exclusively express ORP9S, an N-terminal truncated version of full-length ORP9L. A PDK-2 consensus phosphorylation site in ORP9L and OPR9S at S287 (VPEFS(287)Y) was confirmed by site-directed mutagenesis. In contrast to Akt, increased phosphorylation of ORP9S S287 in stimulated mast cells was independent of phosphatidylinositol 3-kinase but sensitive to inhibition of conventional PKC isotypes. PKC-beta dependence was confirmed by lack of ORP9S phosphorylation at S287 in PKC-beta-deficient, but not PKC-alpha-deficient, mast cells. Moreover, co-immunoprecipitation of PKC-beta and ORP9S, and in vitro phosphorylation of ORP9S in this complex, argued for direct phosphorylation of ORP9S by PKC-beta, introducing ORP9S as a novel PKC-beta substrate. Akt was also detected in a PKC-beta/ORP9S immune complex and phosphorylation of Akt on S473 was delayed in PKC-deficient mast cells. In HEK293 cells, RNAi experiments showed that depletion of ORP9L increased Akt S473 phosphorylation 3-fold without affecting T308 phosphorylation in the activation loop. Furthermore, mammalian target of rapamycin was implicated in ORP9L phosphorylation in HEK293 cells. These studies identify ORP9 as a PDK-2 substrate and negative regulator of Akt phosphorylation at the PDK-2 site.

  17. Fungal lectin MpL enables entry of protein drugs into cancer cells and their subcellular targeting.

    PubMed

    Å Urga, Simon; Nanut, Milica Perišić; Kos, Janko; Sabotič, Jerica

    2017-04-18

    Lectins have been recognized as promising carrier molecules for targeted drug delivery. They specifically bind carbohydrate moieties on cell membranes and trigger cell internalization. Fungal lectin MpL (Macrolepiota procera lectin) does not provoke cancer cell cytotoxicity but is able to bind aminopeptidase N (CD13) and integrin α3β1, two glycoproteins that are overexpressed on the membrane of tumor cells. Upon binding, MpL is endocytosed in a clathrin-dependent manner and accumulates initially in the Golgi apparatus and, finally, in the lysosomes. For effective binding and internalization a functional binding site on the α-repeat is needed. To test the potential of MpL as a carrier for delivering protein drugs to cancer cells we constructed fusion proteins consisting of MpL and the cysteine peptidase inhibitors cystatin C and clitocypin. The fused proteins followed the same endocytic route as the unlinked MpL. Peptidase inhibitor-MpL fusions impaired both the intracellular degradation of extracellular matrix and the invasiveness of cancer cells. MpL is thus shown in vitro to be a lectin that can enable protein drugs to enter cancer cells, enhance their internalization and sort them to lysosomes and the Golgi apparatus.

  18. Structures of the tRNA export factor in the nuclear and cytosolic states.

    PubMed

    Cook, Atlanta G; Fukuhara, Noemi; Jinek, Martin; Conti, Elena

    2009-09-03

    Transfer RNAs are among the most ubiquitous molecules in cells, central to decoding information from messenger RNAs on translating ribosomes. In eukaryotic cells, tRNAs are actively transported from their site of synthesis in the nucleus to their site of function in the cytosol. This is mediated by a dedicated nucleo-cytoplasmic transport factor of the karyopherin-beta family (Xpot, also known as Los1 in Saccharomyces cerevisiae). Here we report the 3.2 A resolution structure of Schizosaccharomyces pombe Xpot in complex with tRNA and RanGTP, and the 3.1 A structure of unbound Xpot, revealing both nuclear and cytosolic snapshots of this transport factor. Xpot undergoes a large conformational change on binding cargo, wrapping around the tRNA and, in particular, binding to the tRNA 5' and 3' ends. The binding mode explains how Xpot can recognize all mature tRNAs in the cell and yet distinguish them from those that have not been properly processed, thus coupling tRNA export to quality control.

  19. Rational Design of Potent Antagonists to the Human Growth Hormone Receptor

    NASA Astrophysics Data System (ADS)

    Fuh, Germaine; Cunningham, Brian C.; Fukunaga, Rikiro; Nagata, Shigekazu; Goeddel, David V.; Wells, James A.

    1992-06-01

    A hybrid receptor was constructed that contained the extracellular binding domain of the human growth hormone (hGH) receptor linked to the transmembrane and intracellular domains of the murine granulocyte colony-stimulating factor receptor. Addition of hGH to a myeloid leukemia cell line (FDC-P1) that expressed the hybrid receptor caused proliferation of these cells. The mechanism for signal transduction of the hybrid receptor required dimerization because monoclonal antibodies to the hGH receptor were agonists whereas their monovalent fragments were not. Receptor dimerization occurs sequentially-a receptor binds to site 1 on hGH, and then a second receptor molecule binds to site 2 on hGH. On the basis of this sequential mechanism, which may occur in many other cytokine receptors, inactive hGH analogs were designed that were potent antagonists to hGH-induced cell proliferation. Such antagonists could be useful for treating clinical conditions of hGH excess, such as acromegaly.

  20. Identification of an hexapeptide that binds to a surface pocket in cyclin A and inhibits the catalytic activity of the complex cyclin-dependent kinase 2-cyclin A.

    PubMed

    Canela, Núria; Orzáez, Mar; Fucho, Raquel; Mateo, Francesca; Gutierrez, Ricardo; Pineda-Lucena, Antonio; Bachs, Oriol; Pérez-Payá, Enrique

    2006-11-24

    The protein-protein complexes formed between different cyclins and cyclin-dependent kinases (CDKs) are central to cell cycle regulation. These complexes represent interesting points of chemical intervention for the development of antineoplastic molecules. Here we describe the identification of an all d-amino acid hexapeptide, termed NBI1, that inhibits the kinase activity of the cyclin-dependent kinase 2 (cdk2)-cyclin A complex through selective binding to cyclin A. The mechanism of inhibition is non-competitive for ATP and non-competitive for protein substrates. In contrast to the existing CDKs peptide inhibitors, the hexapeptide NBI1 interferes with the formation of the cdk2-cyclin A complex. Furthermore, a cell-permeable derivative of NBI1 induces apoptosis and inhibits proliferation of tumor cell lines. Thus, the NBI1-binding site on cyclin A may represent a new target site for the selective inhibition of activity cdk2-cyclin A complex.

  1. Cofilin is a pH sensor for actin free barbed end formation: role of phosphoinositide binding.

    PubMed

    Frantz, Christian; Barreiro, Gabriela; Dominguez, Laura; Chen, Xiaoming; Eddy, Robert; Condeelis, John; Kelly, Mark J S; Jacobson, Matthew P; Barber, Diane L

    2008-12-01

    Newly generated actin free barbed ends at the front of motile cells provide sites for actin filament assembly driving membrane protrusion. Growth factors induce a rapid biphasic increase in actin free barbed ends, and we found both phases absent in fibroblasts lacking H(+) efflux by the Na-H exchanger NHE1. The first phase is restored by expression of mutant cofilin-H133A but not unphosphorylated cofilin-S3A. Constant pH molecular dynamics simulations and nuclear magnetic resonance (NMR) reveal pH-sensitive structural changes in the cofilin C-terminal filamentous actin binding site dependent on His133. However, cofilin-H133A retains pH-sensitive changes in NMR spectra and severing activity in vitro, which suggests that it has a more complex behavior in cells. Cofilin activity is inhibited by phosphoinositide binding, and we found that phosphoinositide binding is pH-dependent for wild-type cofilin, with decreased binding at a higher pH. In contrast, phosphoinositide binding by cofilin-H133A is attenuated and pH insensitive. These data suggest a molecular mechanism whereby cofilin acts as a pH sensor to mediate a pH-dependent actin filament dynamics.

  2. The Apc5 Subunit of the Anaphase-Promoting Complex/Cyclosome Interacts with Poly(A) Binding Protein and Represses Internal Ribosome Entry Site-Mediated Translation

    PubMed Central

    Koloteva-Levine, Nadejda; Pinchasi, Dalia; Pereman, Idan; Zur, Amit; Brandeis, Michael; Elroy-Stein, Orna

    2004-01-01

    The anaphase-promoting complex/cyclosome (APC/C) is a multisubunit ubiquitin ligase that mediates the proteolysis of cell cycle proteins in mitosis and G1. We used a yeast three-hybrid screen to identify proteins that interact with the internal ribosome entry site (IRES) of platelet-derived growth factor 2 mRNA. Surprisingly, this screen identified Apc5, although it does not harbor a classical RNA binding domain. We found that Apc5 binds the poly(A) binding protein (PABP), which directly binds the IRES element. PABP was found to enhance IRES-mediated translation, whereas Apc5 overexpression counteracted this effect. In addition to its association with the APC/C complex, Apc5 binds much heavier complexes and cosediments with the ribosomal fraction. In contrast to Apc3, which is associated only with the APC/C and remains intact during differentiation, Apc5 is degraded upon megakaryocytic differentiation in correlation with IRES activation. Expression of Apc5 in differentiated cells abolished IRES activation. This is the first report implying an additional role for an APC/C subunit, apart from its being part of the APC/C complex. PMID:15082755

  3. Mechanism of pathogen recognition by human dectin-2.

    PubMed

    Feinberg, Hadar; Jégouzo, Sabine A F; Rex, Maximus J; Drickamer, Kurt; Weis, William I; Taylor, Maureen E

    2017-08-11

    Dectin-2, a C-type lectin on macrophages and other cells of the innate immune system, functions in response to pathogens, particularly fungi. The carbohydrate-recognition domain (CRD) in dectin-2 is linked to a transmembrane sequence that interacts with the common Fc receptor γ subunit to initiate immune signaling. The molecular mechanism by which dectin-2 selectively binds to pathogens has been investigated by characterizing the CRD expressed in a bacterial system. Competition binding studies indicated that the CRD binds to monosaccharides with modest affinity and that affinity was greatly enhanced for mannose-linked α1-2 or α1-4 to a second mannose residue. Glycan array analysis confirmed selective binding of the CRD to glycans that contain Manα1-2Man epitopes. Crystals of the CRD in complex with a mammalian-type high-mannose Man 9 GlcNAc 2 oligosaccharide exhibited interaction with Manα1-2Man on two different termini of the glycan, with the reducing-end mannose residue ligated to Ca 2+ in a primary binding site and the nonreducing terminal mannose residue occupying an adjacent secondary site. Comparison of the binding sites in DC-SIGN and langerin, two other pathogen-binding receptors of the innate immune system, revealed why these two binding sites accommodate only terminal Manα1-2Man structures, whereas dectin-2 can bind Manα1-2Man in internal positions in mannans and other polysaccharides. The specificity and geometry of the dectin-2-binding site provide the molecular mechanism for binding of dectin-2 to fungal mannans and also to bacterial lipopolysaccharides, capsular polysaccharides, and lipoarabinomannans that contain the Manα1-2Man disaccharide unit. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. iCLIP Predicts the Dual Splicing Effects of TIA-RNA Interactions

    PubMed Central

    Briese, Michael; Zarnack, Kathi; Luscombe, Nicholas M.; Rot, Gregor; Zupan, Blaž; Curk, Tomaž; Ule, Jernej

    2010-01-01

    The regulation of alternative splicing involves interactions between RNA-binding proteins and pre-mRNA positions close to the splice sites. T-cell intracellular antigen 1 (TIA1) and TIA1-like 1 (TIAL1) locally enhance exon inclusion by recruiting U1 snRNP to 5′ splice sites. However, effects of TIA proteins on splicing of distal exons have not yet been explored. We used UV-crosslinking and immunoprecipitation (iCLIP) to find that TIA1 and TIAL1 bind at the same positions on human RNAs. Binding downstream of 5′ splice sites was used to predict the effects of TIA proteins in enhancing inclusion of proximal exons and silencing inclusion of distal exons. The predictions were validated in an unbiased manner using splice-junction microarrays, RT-PCR, and minigene constructs, which showed that TIA proteins maintain splicing fidelity and regulate alternative splicing by binding exclusively downstream of 5′ splice sites. Surprisingly, TIA binding at 5′ splice sites silenced distal cassette and variable-length exons without binding in proximity to the regulated alternative 3′ splice sites. Using transcriptome-wide high-resolution mapping of TIA-RNA interactions we evaluated the distal splicing effects of TIA proteins. These data are consistent with a model where TIA proteins shorten the time available for definition of an alternative exon by enhancing recognition of the preceding 5′ splice site. Thus, our findings indicate that changes in splicing kinetics could mediate the distal regulation of alternative splicing. PMID:21048981

  5. Nicotinamide Cofactors Suppress Active-Site Labeling of Aldehyde Dehydrogenases.

    PubMed

    Stiti, Naim; Chandrasekar, Balakumaran; Strubl, Laura; Mohammed, Shabaz; Bartels, Dorothea; van der Hoorn, Renier A L

    2016-06-17

    Active site labeling by (re)activity-based probes is a powerful chemical proteomic tool to globally map active sites in native proteomes without using substrates. Active site labeling is usually taken as a readout for the active state of the enzyme because labeling reflects the availability and reactivity of active sites, which are hallmarks for enzyme activities. Here, we show that this relationship holds tightly, but we also reveal an important exception to this rule. Labeling of Arabidopsis ALDH3H1 with a chloroacetamide probe occurs at the catalytic Cys, and labeling is suppressed upon nitrosylation and oxidation, and upon treatment with other Cys modifiers. These experiments display a consistent and strong correlation between active site labeling and enzymatic activity. Surprisingly, however, labeling is suppressed by the cofactor NAD(+), and this property is shared with other members of the ALDH superfamily and also detected for unrelated GAPDH enzymes with an unrelated hydantoin-based probe in crude extracts of plant cell cultures. Suppression requires cofactor binding to its binding pocket. Labeling is also suppressed by ALDH modulators that bind at the substrate entrance tunnel, confirming that labeling occurs through the substrate-binding cavity. Our data indicate that cofactor binding adjusts the catalytic Cys into a conformation that reduces the reactivity toward chloroacetamide probes.

  6. A Chrysin Derivative Suppresses Skin Cancer Growth by Inhibiting Cyclin-dependent Kinases*

    PubMed Central

    Liu, Haidan; Liu, Kangdong; Huang, Zunnan; Park, Chan-Mi; Thimmegowda, N. R.; Jang, Jae-Hyuk; Ryoo, In-Ja; He, Long; Kim, Sun-Ok; Oi, Naomi; Lee, Ki Won; Soung, Nak-Kyun; Bode, Ann M.; Yang, Yifeng; Zhou, Xinmin; Erikson, Raymond L.; Ahn, Jong-Seog; Hwang, Joonsung; Kim, Kyoon Eon; Dong, Zigang; Kim, Bo-Yeon

    2013-01-01

    Chrysin (5,7-dihydroxyflavone), a natural flavonoid widely distributed in plants, reportedly has chemopreventive properties against various cancers. However, the anticancer activity of chrysin observed in in vivo studies has been disappointing. Here, we report that a chrysin derivative, referred to as compound 69407, more strongly inhibited EGF-induced neoplastic transformation of JB6 P+ cells compared with chrysin. It attenuated cell cycle progression of EGF-stimulated cells at the G1 phase and inhibited the G1/S transition. It caused loss of retinoblastoma phosphorylation at both Ser-795 and Ser-807/811, the preferred sites phosphorylated by Cdk4/6 and Cdk2, respectively. It also suppressed anchorage-dependent and -independent growth of A431 human epidermoid carcinoma cells. Compound 69407 reduced tumor growth in the A431 mouse xenograft model and retinoblastoma phosphorylation at Ser-795 and Ser-807/811. Immunoprecipitation kinase assay results showed that compound 69407 attenuated endogenous Cdk4 and Cdk2 kinase activities in EGF-stimulated JB6 P+ cells. Pulldown and in vitro kinase assay results indicated that compound 69407 directly binds with Cdk2 and Cdk4 in an ATP-independent manner and inhibited their kinase activities. A binding model between compound 69407 and a crystal structure of Cdk2 predicted that compound 69407 was located inside the Cdk2 allosteric binding site. The binding was further verified by a point mutation binding assay. Overall results indicated that compound 69407 is an ATP-noncompetitive cyclin-dependent kinase inhibitor with anti-tumor effects, which acts by binding inside the Cdk2 allosteric pocket. This study provides new insights for creating a general pharmacophore model to design and develop novel ATP-noncompetitive agents with chemopreventive or chemotherapeutic potency. PMID:23888052

  7. Binding of extracellular matrix proteins to Aspergillus fumigatus conidia.

    PubMed Central

    Gil, M L; Peñalver, M C; Lopez-Ribot, J L; O'Connor, J E; Martinez, J P

    1996-01-01

    As detected by confocal immunofluorescence microscopy, binding of fibronectin and laminin appeared to be associated with the protrusions present on the outer cell wall layer of resting Aspergillus fumigatus conidia. Flow cytometry confirmed that binding of laminin to conidia was dose dependent and saturable. Laminin binding was virtually eliminated in trypsin-treated organisms, thus suggesting the protein nature of the binding site. Conidia were also able to specifically adhere to laminin immobilized on microtiter plates. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting (immunoblotting) with laminin and antilaminin antibody of whole conidial homogenates allowed identification, among the complex array of protein and glycoprotein species, of one polypeptide with an apparent molecular mass of 37 kDa which specifically interacts with laminin. The fact that binding of conidia to soluble or immobilized laminin or fibronectin was inhibited by fibronectin or laminin, respectively, suggests the existence of common binding sites for both ligands on the surface of conidia. Intact conidia were also able to adhere to type I and IV collagen immobilized on microtiter plates; adhesion was found to be dose dependent and saturable. Adhesion to immobilized type I and IV collagen was markedly inhibited by laminin and weakly inhibited by fibronectin. Coincubation of conidia with Arg-Gly-Asp (RGD) peptides caused a dose-dependent decrease in binding of cells to immobilized or soluble fibronectin, yet interaction of cells with soluble or immobilized laminin and type I and IV collagen remained unaffected. Interactions described here could be important in mediating attachment of the fungus to host tissues, thus playing a role in the establishment of the disease. PMID:8945572

  8. Protozoa lectins and their role in host-pathogen interactions.

    PubMed

    Singh, Ram Sarup; Walia, Amandeep Kaur; Kanwar, Jagat Rakesh

    2016-01-01

    Lectins are proteins/glycoproteins of non-immune origin that agglutinate red blood cells, lymphocytes, fibroblasts, etc., and bind reversibly to carbohydrates present on the apposing cells. They have at least two carbohydrate binding sites and their binding can be inhibited by one or more carbohydrates. Owing to carbohydrate binding specificity of lectins, they mediate cell-cell interactions and play role in protozoan adhesion and host cell cytotoxicity, thus are central to the pathogenic property of the parasite. Several parasitic protozoa possess lectins which mediate parasite adherence to host cells based on their carbohydrate specificities. These interactions could be exploited for development of novel therapeutics, targeting the adherence and thus helpful in eradicating wide spread of protozoan diseases. The current review highlights the present state knowledge with regard to protozoal lectins with an emphasis on their haemagglutination activity, carbohydrate specificity, characteristics and also their role in pathogenesis notably as adhesion molecules, thereby aiding the pathogen in disease establishment. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Osmolality-dependent relocation of penicillin-binding protein PBP2 to the division site in Caulobacter crescentus.

    PubMed

    Hocking, Jason; Priyadarshini, Richa; Takacs, Constantin N; Costa, Teresa; Dye, Natalie A; Shapiro, Lucy; Vollmer, Waldemar; Jacobs-Wagner, Christine

    2012-06-01

    The synthesis of the peptidoglycan cell wall is carefully regulated in time and space. In nature, this essential process occurs in cells that live in fluctuating environments. Here we show that the spatial distributions of specific cell wall proteins in Caulobacter crescentus are sensitive to small external osmotic upshifts. The penicillin-binding protein PBP2, which is commonly branded as an essential cell elongation-specific transpeptidase, switches its localization from a dispersed, patchy pattern to an accumulation at the FtsZ ring location in response to osmotic upshifts as low as 40 mosmol/kg. This osmolality-dependent relocation to the division apparatus is initiated within less than a minute, while restoration to the patchy localization pattern is dependent on cell growth and takes 1 to 2 generations. Cell wall morphogenetic protein RodA and penicillin-binding protein PBP1a also change their spatial distribution by accumulating at the division site in response to external osmotic upshifts. Consistent with its ecological distribution, C. crescentus displays a narrow range of osmotolerance, with an upper limit of 225 mosmol/kg in minimal medium. Collectively, our findings reveal an unsuspected level of environmental regulation of cell wall protein behavior that is likely linked to an ecological adaptation.

  10. Retinoic acid prevents immunogenicity of milk lipocalin Bos d 5 through binding to its immunodominant T-cell epitope.

    PubMed

    Hufnagl, Karin; Ghosh, Debajyoti; Wagner, Stefanie; Fiocchi, Alessandro; Dahdah, Lamia; Bianchini, Rodolfo; Braun, Nina; Steinborn, Ralf; Hofer, Martin; Blaschitz, Marion; Roth, Georg A; Hofstetter, Gerlinde; Roth-Walter, Franziska; Pacios, Luis F; Jensen-Jarolim, Erika

    2018-01-25

    The major cow's milk allergen Bos d 5 belongs to the lipocalin protein family, with an intramolecular pocket for hydrophobic ligands. We investigated whether Bos d 5 when loaded with the active vitamin A metabolite retinoic acid (RA), would elicit differential immune responses compared to the unloaded state. By in silico docking an affinity energy of -7.8 kcal/mol was calculated for RA into Bos d 5. Loading of RA to Bos d 5 could be achieved in vitro, as demonstrated by ANS displacement assay, but had no effect on serum IgE binding in tolerant or challenge-positive milk allergic children. Bioinformatic analysis revealed that RA binds to the immunodominant T-cell epitope region of Bos d 5. In accordance, Bos d 5 significantly suppressed the CD3+ CD4+ cell numbers, proliferative response and IL-10, IL-13 and IFN-γ secretion from stimulated human PBMCs only when complexed with RA. This phenomenon was neither associated with apoptosis of T-cells nor with the activation of Foxp3+ T-cells, but correlated likely with enhanced stability to lysosomal digestion due to a predicted overlap of Cathepsin S cleavage sites with the RA binding site. Taken together, proper loading of Bos d 5 with RA may suppress its immunogenicity and prevent its allergenicity.

  11. Limits of transforming competence of SV40 nuclear and cytoplasmic large T mutants with altered Rb binding sequences.

    PubMed

    Tedesco, D; Fischer-Fantuzzi, L; Vesco, C

    1993-03-01

    Multiple amino acid substitutions were introduced into the SV40 large T region that harbors the retinoblastoma protein (Rb) binding site and the nuclear transport signal, changing either one or both of these determinants. Mutant activities were examined in a set of assays allowing different levels of transforming potential to be distinguished; phenotypic changes in established and pre-crisis rat embryo fibroblasts (REFs) were detected under isogenic cell conditions, and comparisons made with other established rodent cells. The limit of the transforming ability of mutants with important substitutions in the Rb binding site fell between two transformation levels of the same established rat cells. Such cells could be induced to form dense foci but not agar colonies (their parental pre-crises REFs, as expected, were untransformed either way). Nonetheless, agar colony induction was possible in other cell lines, such as mouse NIH3T3 and (for one of the mutants) rat F2408. All these mutants efficiently immortalized pre-crisis REFs. The transforming ability of cytoplasmic mutants appeared to depend on the integrity of the Rb-binding sequence to approximately the same extent as that of the wild-type large T, although evidence of in vivo Rb-cytoplasmic large T complexes was not found. The presence or absence of small t was critical when the transforming task of mutants was near the limit of their abilities.

  12. Complex high affinity interactions occur between MHCI and superantigens

    NASA Technical Reports Server (NTRS)

    Chapes, S. K.; Herpich, A. R.; Spooner, B. S. (Principal Investigator)

    1998-01-01

    Staphylococcal enterotoxins A and C1 (SEA or SEC1) bound to major histocompatibility-I (MHCI) molecules with high affinity (binding constants ranging from 1.1 microM to 79 nM). SEA and SEC1 directly bound MHCI molecules that had been captured by monoclonal antibodies specific for H-2Kk, H-2Dk, or both. In addition, MHCI-specific antibodies inhibited the binding of SEC1 to LM929 cells and SEA competitively inhibited SEC1 binding; indicating that the superantigens bound to MHCI on the cell surface. The affinity and number of superantigen binding sites differed depending on whether MHCI was expressed in the membrane of LM929 cells or whether it was captured. These data support the hypothesis that MHCI molecules can serve as superantigen receptors.

  13. SMC condensation centers in Bacillus subtilis are dynamic structures.

    PubMed

    Kleine Borgmann, Luise A K; Hummel, Hanna; Ulbrich, Maximilian H; Graumann, Peter L

    2013-05-01

    SMC and MukB complexes consist of a central SMC dimer and two essential binding partners, ScpA and ScpB (MukE and MukF), and are crucial for correct chromosome compaction and segregation. The complexes form two bipolar assemblies on the chromosome, one in each cell half. Using fluorescence recovery after photobleaching (FRAP), we provide evidence that the SMC complex has high exchange rates. This depends to a considerable degree on de novo protein synthesis, revealing that the bacterial SMC complex has high on and off rates for binding to the chromosome. A mutation in SMC that affects ATPase activity and results in exaggerated DNA binding in vitro causes a strong segregation defect in vivo and affects the localization of the entire SMC complex, which localizes to many more sites in the cell than under normal conditions. These data indicate that ATP turnover is important for the function of Bacillus subtilis SMC. In contrast, the centromere protein Spo0J and DNA gyrase showed much less exchange between distinct binding sites on the chromosome than that seen with SMC. Binding of Spo0J to the origin regions was rather static and remained partially conserved until the next cell cycle. Our experiments reveal that the SMC complex has a high, condensin-like turnover rate and that an alteration of the ATPase cycle affects SMC function in vivo, while several nucleoid-associated proteins feature limited or slow exchange between different sites on the nucleoid, which may be the basis for epigenetic-like phenomena observed in bacteria.

  14. Mass spectrometry for identification of proteins that specifically bind to a distal enhancer of the Oct4 gene

    NASA Astrophysics Data System (ADS)

    Bakhmet, E. I.; Nazarov, I. B.; Artamonova, T. O.; Khodorkovsky, M. A.; Tomilin, A. N.

    2017-11-01

    Transcription factor Oct4 is a marker of pluripotent stem cells and has a significant role in their self-renewal. Oct4 gene is controlled by three cis-regulatory elements - proximal promoter, proximal enhancer and distal enhancer. All of these elements are targets for binding of regulatory proteins. Distal enhancer is in our research focus because of its activity in early stages of embryonic development. There are two main sequences called site 2A and site 2B that are presented in distal enhancer. For this moment proteins which bind to a site 2A (CCCCTCCCCCC) remain unknown. Using combination of in vitro method electrophoretic mobility shift assay (EMSA) and mass spectromery we identified several candidates that can regulate Oct4 gene expression through site 2A.

  15. DIRECT BINDING OF GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE TO TELOMERIC DNA PROTECTS TELOMERES AGAINST CHEMOTHERAPY-INDUCED RAPID DEGRADATION

    PubMed Central

    Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher

    2009-01-01

    GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890

  16. Cloning of Novel Isoforms of the Human Gli2 Oncogene and Their Activities To Enhance Tax-Dependent Transcription of the Human T-Cell Leukemia Virus Type 1 Genome

    PubMed Central

    Tanimura, Akira; Dan, Shingo; Yoshida, Mitsuaki

    1998-01-01

    The expression of human T-cell leukemia virus type 1 (HTLV-1) is activated by interaction of a viral transactivator protein, Tax, and cellular transcription factor, CREB (cyclic AMP response element binding protein), which bind to a 21-bp enhancer in the long terminal repeats (LTR). THP (Tax-helping protein) was previously determined to enhance the transactivation by Tax protein. Here we report novel forms of the human homolog of a member of the Gli oncogene family, Gli2 (also termed Gli2/THP), an extended form of a zinc finger protein, THP, which was described previously. Four possible isoforms (hGli2 α, β, γ, and δ) are formed by combinations of two independent alternative splicings, and all the isoforms could bind to a DNA motif, TRE2S, in the LTR. The longer isoforms, α and β, were abundantly expressed in various cell lines including HTLV-1-infected T-cell lines. Fusion proteins of the hGli2 isoforms with the DNA-binding domain of Gal4 activated transcription when the reporter contained a Gal4-binding site and one copy of the 21-bp sequence, to which CREB binds. This activation was observed only in the presence of Tax. The 21-bp sequence in the reporter was also essential for the activation. These results suggest that simultaneous binding of hGli2 and CREB to the respective sites in the reporter seems to be critical for Tax protein to activate transcription. Consequently, it is probable that the LTR can be regulated by two independent signals through hGli2 and CREB, since the LTR contains the 21-bp and TRE2S sequences in the vicinity. PMID:9557682

  17. Cell–specific Variation in E-selectin Ligand Expression Among Human Peripheral Blood Mononuclear Cells: Implications for Immunosurveillance and Pathobiology

    PubMed Central

    Silva, Mariana; Fung, Ronald Kam Fai; Donnelly, Conor Brian; Videira, Paula Alexandra; Sackstein, Robert

    2017-01-01

    Both host defense and immunopathology are shaped by the ordered recruitment of circulating leukocytes to affected sites, a process initiated by binding of blood-borne cells to E-selectin displayed at target endothelial beds. Accordingly, knowledge of the expression and function of leukocyte E-selectin ligands is key to understanding the tempo and specificity of immunoreactivity. Here, we performed E-selectin adherence assays under hemodynamic flow conditions coupled with flow cytometry and western blot analysis to elucidate the function and structural biology of glycoprotein E-selectin ligands expressed on human peripheral blood mononuclear cells (PBMCs). Circulating monocytes uniformly express high levels of the canonical E-selectin binding determinant sLeX and display markedly greater adhesive interactions with E-selectin than do circulating lymphocytes, which exhibit variable E-selectin binding among CD4+ and CD8+ T-cells but no binding by B-cells. Monocytes prominently present sLeX decorations on an array of protein scaffolds including PSGL-1, CD43, and CD44 (rendering the E-selectin ligands CLA, CD43E, and HCELL, respectively), and B-cells altogether lack E-selectin ligands. Quantitative PCR gene expression studies of glycosyltransferases that regulate display of sLeX reveal high transcript levels among circulating monocytes and low levels among circulating B-cells, and, commensurately, cell surface α(1,3)-fucosylation reveals that acceptor sialyllactosaminyl glycans convertible into sLeX are abundantly expressed on human monocytes yet are relatively deficient on B-cells. Collectively, these findings unveil distinct cell-specific patterns of E-selectin ligand expression among human PBMCs, indicating that circulating monocytes are specialized to engage E-selectin and providing key insights into the molecular effectors mediating recruitment of these cells at inflammatory sites. PMID:28330896

  18. Identification of a novel cell binding site of periostin involved in tumour growth.

    PubMed

    Orecchia, Paola; Conte, Romana; Balza, Enrica; Castellani, Patrizia; Borsi, Laura; Zardi, Luciano; Mingari, Maria Cristina; Carnemolla, Barbara

    2011-09-01

    Periostin (PN), a member of the fasciclin family of proteins, is a TGF-β-induced extracellular matrix protein involved in cell survival, angiogenesis, invasion and metastasis. It is considered a potent angiogenic factor and a marker of tumour progression in many types of human cancer. Many different kinds of cells bind to PN by means of the integrins αvβ3 and αvβ5, but the periostin epitope recognised by these integrins is not formally demonstrated. The aim of our study was to identify which domain of PN could be involved in cell adhesion and its potential role in tumour growth. We generated the monoclonal antibody OC-20 (mAb OC-20) by hybridoma technology. Different PN recombinant fragments were used to characterise the periostin epitope recognised by the mAb OC-20 and to localise a new cell binding site of the protein. A murine model of human melanoma was used in the preclinical in vivo experiments. We formally demonstrate that the periostin epitope recognised by OC-20 is a new binding site for the integrins αvβ3 and αvβ5, localised in the second FAS1 domain (FAS1-2) of the protein. Moreover the in vivo use of this antibody significantly inhibits tumour growth and angiogenesis. Our results show that the FAS1-2 domain of PN plays a role in tumour progression. Moreover this novel antibody may likewise prove to be very useful in clarifying the role of PN in angiogenesis and may contribute to the design of novel anti-angiogenesis drugs. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Novel 3-Substituted 7-Phenylpyrrolo[3,2-f]quinolin-9(6H)-ones as Single Entities with Multitarget Antiproliferative Activity.

    PubMed

    Carta, Davide; Bortolozzi, Roberta; Hamel, Ernest; Basso, Giuseppe; Moro, Stefano; Viola, Giampietro; Ferlin, Maria Grazia

    2015-10-22

    A series of chemically modified 7-phenylpyrrolo[3,2-f]quinolinones was synthesized and evaluated as anticancer agents. Among them, the most cytotoxic (subnanomolar GI50 values) amidic derivative 5f was shown to act as an inhibitor of tubulin polymerization (IC50, 0.99 μM) by binding to the colchicine site with high affinity. Moreover, 5f induced cell cycle arrest in the G2/M phase of the cell cycle in a concentration dependent manner, followed by caspase-dependent apoptotic cell death. Compound 5f also showed lower toxicity in nontumoral cells, suggesting selectivity toward cancer cells. Additional experiments revealed that 5f inhibited the enzymatic activity of multiple kinases, including AURKA, FLT3, GSK3A, MAP3K, MEK, RSK2, RSK4, PLK4, ULK1, and JAK1. Computational studies showed that 5f can be properly accommodated in the colchicine binding site of tubulin as well as in the ATP binding clefts of all examined kinases. Our data indicate that the excellent antiproliferative profile of 5f may be derived from its interactions with multiple cellular targets.

  20. Sugar-binding sites of the HA1 subcomponent of Clostridium botulinum type C progenitor toxin.

    PubMed

    Nakamura, Toshio; Tonozuka, Takashi; Ide, Azusa; Yuzawa, Takayuki; Oguma, Keiji; Nishikawa, Atsushi

    2008-02-22

    Clostridium botulinum type C 16S progenitor toxin contains a hemagglutinin (HA) subcomponent, designated HA1, which appears to play an important role in the effective internalization of the toxin in gastrointestinal epithelial cells and in creating a broad specificity for the oligosaccharide structure that corresponds to various targets. In this study, using the recombinant protein fused to glutathione S-transferase, we investigated the binding specificity of the HA1 subcomponent to sugars and estimated the binding sites of HA1 based on X-ray crystallography and soaking experiments using various sugars. N-Acetylneuraminic acid, N-acetylgalactosamine, and galactose effectively inhibited the binding that occurs between glutathione S-transferase-HA1 and mucins, whereas N-acetylglucosamine and glucose did not inhibit it. The crystal structures of HA1 complex with N-acetylneuraminic acid, N-acetylgalactosamine, and galactose were also determined. There are two sugar-binding sites, sites I and II. Site I corresponds to the electron densities noted for all sugars and is located at the C-terminal beta-trefoil domain, while site II corresponds to the electron densities noted only for galactose. An aromatic amino acid residue, Trp176, at site I has a stacking interaction with the hexose ring of the sugars. On the other hand, there is no aromatic residue at site II; thus, the interaction with galactose seems to be poor. The double mutant W176A at site I and D271F at site II has no avidity for N-acetylneuraminic acid but has avidity for galactose. In this report, the binding specificity of botulinum C16S toxin HA1 to various sugars is demonstrated based on its structural features.

  1. Functional characterization of transcription factor binding sites for HNF1-alpha, HNF3-beta (FOXA2), HNF4-alpha, Sp1 and Sp3 in the human prothrombin gene enhancer.

    PubMed

    Ceelie, H; Spaargaren-Van Riel, C C; De Jong, M; Bertina, R M; Vos, H L

    2003-08-01

    Prothrombin is a key component in blood coagulation. Overexpression of prothrombin leads to an increased risk of venous thrombosis. Therefore, the study of the transcriptional regulation of the prothrombin gene may help to identify mechanisms of overexpression. The aim of our study was to localize the regions within the prothrombin enhancer responsible for its activity, to identify the proteins binding to these regions, and to establish their functional importance. We constructed a set of prothrombin promoter 5' deletion constructs containing the firefly luciferase reporter gene, which were transiently transfected in HepG2, HuH7 and HeLa cells. Putative transcription factor (TF) binding sites were evaluated by electrophoretic mobility shift assays. The functional importance of each TF binding site was evaluated by site directed mutagenesis and transient transfection of the mutant constructs. We confirmed the major contribution of the enhancer region to the transcriptional activity of the prothrombin promoter. Analysis of this region revealed putative binding sites for hepatocyte nuclear factor HNF4, HNF3-beta and specificity protein(Sp)1. We identified six different TFs binding to three evolutionary conserved sites in the enhancer: HNF4-alpha (site 1), HNF1-alpha, HNF3-beta and an as yet unidentified TF (site 2) and the ubiquitously expressed TFs Sp1 and Sp3 (site 3). Mutagenesis studies showed that loss of binding of HNF3-beta resulted in a considerable decrease of enhancer activity, whereas loss of HNF4-alpha or Sp1/Sp3 resulted in milder reductions. The prothrombin enhancer plays a major role in regulation of prothrombin expression. Six different TFs are able to bind to this region. At least three of these TFs, HNF4-alpha, HNF3-beta and Sp1/Sp3, are important in regulation of prothrombin expression.

  2. Identification of key binding site residues of MCT1 for AR-C155858 reveals the molecular basis of its isoform selectivity.

    PubMed

    Nancolas, Bethany; Sessions, Richard B; Halestrap, Andrew P

    2015-02-15

    The proton-linked monocarboxylate transporters (MCTs) are required for lactic acid transport into and out of all mammalian cells. Thus, they play an essential role in tumour cells that are usually highly glycolytic and are promising targets for anti-cancer drugs. AR-C155858 is a potent MCT1 inhibitor (Ki ~2 nM) that also inhibits MCT2 when associated with basigin but not MCT4. Previous work [Ovens, M.J. et al. (2010) Biochem. J. 425, 523-530] revealed that AR-C155858 binding to MCT1 occurs from the intracellular side and involves transmembrane helices (TMs) 7-10. In the present paper, we generate a molecular model of MCT4 based on our previous models of MCT1 and identify residues in the intracellular substrate-binding cavity that differ significantly between MCT4 and MCT1/MCT2 and so might account for differences in inhibitor binding. We tested their involvement using site-directed mutagenesis (SDM) of MCT1 to change residues individually or in combination with their MCT4 equivalent and determined inhibitor sensitivity following expression in Xenopus oocytes. Phe360 and Ser364 were identified as important for AR-C155858 binding with the F360Y/S364G mutant exhibiting >100-fold reduction in inhibitor sensitivity. To refine the binding site further, we used molecular dynamics (MD) simulations and additional SDM. This approach implicated six more residues whose involvement was confirmed by both transport studies and [3H]-AR-C155858 binding to oocyte membranes. Taken together, our data imply that Asn147, Arg306 and Ser364 are important for directing AR-C155858 to its final binding site which involves interaction of the inhibitor with Lys38, Asp302 and Phe360 (residues that also play key roles in the translocation cycle) and also Leu274 and Ser278.

  3. Identification of key binding site residues of MCT1 for AR-C155858 reveals the molecular basis of its isoform selectivity

    PubMed Central

    Nancolas, Bethany; Sessions, Richard B.; Halestrap, Andrew P.

    2014-01-01

    The proton-linked monocarboxylate transporters (MCTs) are required for lactic acid transport into and out of all mammalian cells. Thus, they play an essential role in tumour cells that are usually highly glycolytic and are promising targets for anti-cancer drugs. AR-C155858 is a potent MCT1 inhibitor (Ki ~2 nM) that also inhibits MCT2 when associated with basigin but not MCT4. Previous work [Ovens, M.J. et al. (2010) Biochem. J. 425, 523–530] revealed that AR-C155858 binding to MCT1 occurs from the intracellular side and involves transmembrane helices (TMs) 7–10. In the present paper, we generate a molecular model of MCT4 based on our previous models of MCT1 and identify residues in the intracellular substrate-binding cavity that differ significantly between MCT4 and MCT1/MCT2 and so might account for differences in inhibitor binding. We tested their involvement using site-directed mutagenesis (SDM) of MCT1 to change residues individually or in combination with their MCT4 equivalent and determined inhibitor sensitivity following expression in Xenopus oocytes. Phe360 and Ser364 were identified as important for AR-C155858 binding with the F360Y/S364G mutant exhibiting >100-fold reduction in inhibitor sensitivity. To refine the binding site further, we used molecular dynamics (MD) simulations and additional SDM. This approach implicated six more residues whose involvement was confirmed by both transport studies and [3H]-AR-C155858 binding to oocyte membranes. Taken together, our data imply that Asn147, Arg306 and Ser364 are important for directing AR-C155858 to its final binding site which involves interaction of the inhibitor with Lys38, Asp302 and Phe360 (residues that also play key roles in the translocation cycle) and also Leu274 and Ser278. PMID:25437897

  4. Structural basis for the antibody neutralization of Herpes simplex virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Cheng-Chung; Lin, Li-Ling; Academia Sinica, Taipei 115, Taiwan

    2013-10-01

    The gD–E317-Fab complex crystal revealed the conformational epitope of human mAb E317 on HSV gD, providing a molecular basis for understanding the viral neutralization mechanism. Glycoprotein D (gD) of Herpes simplex virus (HSV) binds to a host cell surface receptor, which is required to trigger membrane fusion for virion entry into the host cell. gD has become a validated anti-HSV target for therapeutic antibody development. The highly inhibitory human monoclonal antibody E317 (mAb E317) was previously raised against HSV gD for viral neutralization. To understand the structural basis of antibody neutralization, crystals of the gD ectodomain bound to the E317more » Fab domain were obtained. The structure of the complex reveals that E317 interacts with gD mainly through the heavy chain, which covers a large area for epitope recognition on gD, with a flexible N-terminal and C-terminal conformation. The epitope core structure maps to the external surface of gD, corresponding to the binding sites of two receptors, herpesvirus entry mediator (HVEM) and nectin-1, which mediate HSV infection. E317 directly recognizes the gD–nectin-1 interface and occludes the HVEM contact site of gD to block its binding to either receptor. The binding of E317 to gD also prohibits the formation of the N-terminal hairpin of gD for HVEM recognition. The major E317-binding site on gD overlaps with either the nectin-1-binding residues or the neutralizing antigenic sites identified thus far (Tyr38, Asp215, Arg222 and Phe223). The epitopes of gD for E317 binding are highly conserved between two types of human herpesvirus (HSV-1 and HSV-2). This study enables the virus-neutralizing epitopes to be correlated with the receptor-binding regions. The results further strengthen the previously demonstrated therapeutic and diagnostic potential of the E317 antibody.« less

  5. Design of an allosterically modulated doxycycline and doxorubicin drug-binding protein.

    PubMed

    Schmidt, Karin; Gardill, Bernd R; Kern, Alina; Kirchweger, Peter; Börsch, Michael; Muller, Yves A

    2018-05-14

    The allosteric interplay between distant functional sites present in a single protein provides for one of the most important regulatory mechanisms in biological systems. While the design of ligand-binding sites into proteins remains challenging, this holds even truer for the coupling of a newly engineered binding site to an allosteric mechanism that regulates the ligand affinity. Here it is shown how computational design algorithms enabled the introduction of doxycycline- and doxorubicin-binding sites into the serine proteinase inhibitor (serpin) family member α1-antichymotrypsin. Further engineering allowed exploitation of the proteinase-triggered serpin-typical S-to-R transition to modulate the ligand affinities. These design variants follow strategies observed in naturally occurring plasma globulins that allow for the targeted delivery of hormones in the blood. By analogy, we propose that the variants described in the present study could be further developed to allow for the delivery of the antibiotic doxycycline and the anticancer compound doxorubicin to tissues/locations that express specific proteinases, such as bacterial infection sites or tumor cells secreting matrix metalloproteinases.

  6. [Propranolol beta-blocker decrease in the concentration of high-affinity binding sites for calcium ions by sarcolemma membranes of the rat heart].

    PubMed

    Seleznev, Iu M; Martynov, A V; Smirnov, V N

    1982-05-01

    In vivo administration of propranolol considerably inhibits the isoproterenol-stimulated increase in 45Ca accumulation by the myocardium and completely eliminates the potentiation of isoproterenol effect by hydrocortisone. A significant lowering of the concentration of high affinity binding sites for calcium in the sarcolemmal membranes can be produced by propranolol in vitro. Under these conditions, the glucocorticoids do not change the sarcolemmal Ca2+-binding parameters or modulate the propranolol effect. Therefore, for the manifestation of glucocorticoid action to be brought about, the integrity of the cells is apparently required, while propranolol seems to change calcium binding by direct interaction with the sarcolemmal membranes. It is suggested that in vivo propranolol inhibition of catecholamine effect on calcium ion accumulation by the myocardium depends on the interaction with the beta-receptors and direct modulation of the concentration of high affinity binding sites for calcium ions on the surface of the sarcolemma.

  7. Insulator function and topological domain border strength scale with architectural protein occupancy

    PubMed Central

    2014-01-01

    Background Chromosome conformation capture studies suggest that eukaryotic genomes are organized into structures called topologically associating domains. The borders of these domains are highly enriched for architectural proteins with characterized roles in insulator function. However, a majority of architectural protein binding sites localize within topological domains, suggesting sites associated with domain borders represent a functionally different subclass of these regulatory elements. How topologically associating domains are established and what differentiates border-associated from non-border architectural protein binding sites remain unanswered questions. Results By mapping the genome-wide target sites for several Drosophila architectural proteins, including previously uncharacterized profiles for TFIIIC and SMC-containing condensin complexes, we uncover an extensive pattern of colocalization in which architectural proteins establish dense clusters at the borders of topological domains. Reporter-based enhancer-blocking insulator activity as well as endogenous domain border strength scale with the occupancy level of architectural protein binding sites, suggesting co-binding by architectural proteins underlies the functional potential of these loci. Analyses in mouse and human stem cells suggest that clustering of architectural proteins is a general feature of genome organization, and conserved architectural protein binding sites may underlie the tissue-invariant nature of topologically associating domains observed in mammals. Conclusions We identify a spectrum of architectural protein occupancy that scales with the topological structure of chromosomes and the regulatory potential of these elements. Whereas high occupancy architectural protein binding sites associate with robust partitioning of topologically associating domains and robust insulator function, low occupancy sites appear reserved for gene-specific regulation within topological domains. PMID:24981874

  8. Mutations increasing exposure of a receptor binding site epitope in the soluble and oligomeric forms of the caprine arthritis-encephalitis lentivirus envelope glycoprotein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoetzel, Isidro; Cheevers, William P.

    2005-09-01

    The caprine arthritis-encephalitis (CAEV) and ovine maedi-visna (MVV) viruses are resistant to antibody neutralization, a feature shared with all other lentiviruses. Whether the CAEV gp135 receptor binding site(s) (RBS) in the functional surface envelope glycoprotein (Env) is protected from antibody binding, allowing the virus to resist neutralization, is not known. Two CAEV gp135 regions were identified by extrapolating a gp135 structural model that could affect binding of antibodies to the RBS: the V1 region and a short sequence analogous in position to the human immunodeficiency virus type 1 gp120 loop B postulated to be located between two major domains ofmore » CAEV gp135. Mutation of isoleucine-166 to alanine in the putative loop B of gp135 increased the affinity of soluble gp135 for the CAEV receptor(s) and goat monoclonal antibody (Mab) F7-299 which recognizes an epitope overlapping the gp135 RBS. The I166A mutation also stabilized or exposed the F7-299 epitope in anionic detergent buffers, indicating that the I166A mutation induces conformational changes and stabilizes the RBS of soluble gp135 and enhances Mab F7-299 binding. In contrast, the affinity of a V1 deletion mutant of gp135 for the receptor and Mab F7-299 and its structural stability did not differ from that of the wild-type gp135. However, both the I166A mutation and the V1 deletion of gp135 increased cell-to-cell fusion activity and binding of Mab F7-299 to the oligomeric Env. Therefore, the CAEV gp135 RBS is protected from antibody binding by mechanisms both dependent and independent of Env oligomerization which are disrupted by the V1 deletion and the I166A mutation, respectively. In addition, we found a correlation between side-chain {beta}-branching at amino acid position 166 and binding of Mab F7-299 to oligomeric Env and cell-to-cell fusion, suggesting local secondary structure constraints in the region around isoleucine-166 as one determinant of gp135 RBS exposure and antibody binding.« less

  9. Na+/substrate Coupling in the Multidrug Antiporter NorM Probed with a Spin-labeled Substrate

    PubMed Central

    Steed, P. Ryan; Stein, Richard A.; Mishra, Smriti; Goodman, Michael C.; Mchaourab, Hassane S.

    2013-01-01

    NorM of the multidrug and toxic compound extrusion (MATE) family of transporters couples the efflux of a broad range of hydrophobic molecules to an inward Na+ gradient across the cell membrane. Several crystal structures of MATE transporters revealed distinct substrate binding sites leading to differing models of the mechanism of ion-coupled substrate extrusion. In the experiments reported here, we observed that a spin-labeled derivative of daunorubicin, Ruboxyl, is transported by NorM from Vibrio cholerae. It is therefore ideal to characterize mechanistically relevant binding interactions with NorM and to directly address the coupling of ion and drug binding. Fluorescence and EPR experiments revealed that Ruboxyl binds to NorM with micromolar affinity and becomes immobilized upon binding, even in the presence of Na+. Using double electron-electron resonance (DEER) spectroscopy, we determined that Ruboxyl binds to a single site on the periplasmic side of the protein. The presence of Na+ did not translocate the substrate to a second site as previously proposed. These experiments surprisingly show that Na+ does not affect the affinity or location of the substrate binding site on detergent-solubilized NorM, thus suggesting that additional factors beyond simple mutual exclusivity of binding, such as the presence of a Na+ gradient across the native membrane, govern Na+/drug coupling during antiport. PMID:23902581

  10. Detection of biotin in individual sea urchin oocytes using a bioluminescence binding assay.

    PubMed

    Feltus, A; Grosvenor, A L; Conover, R C; Anderson, K W; Daunert, S

    2001-04-01

    The ability to detect biomolecules in single cells is important in order to fully understand the processes by which many biochemical events occur. To that end, we have developed a bioluminescence binding assay capable of measuring the intracellular biotin content of individual cells. The assay depends on competition between an aequorin-biotin conjugate (AEQ-biotin) and free biotin within the oocytes for binding sites on the protein avidin. The assay is performed by microinjecting each component into the oocytes and following the resulting bioluminescence within the oocyte upon triggering of aequorin. Results obtained using sea urchin oocytes show that the assay performed within the cells behaves in a manner consistent with assay theory. Using the assay, the individual biotin content of the oocytes is an average of approximately 20 amol. To our knowledge, this is the first reported multicomponent binding assay to be performed inside an intact single cell.

  11. Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

    PubMed

    Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

    2000-12-01

    The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

  12. Analysis of tandem E-box motifs within human Complement receptor 2 (CR2/CD21) promoter reveals cell specific roles for RP58, E2A, USF and localized chromatin accessibility.

    PubMed

    Cruickshank, Mark N; Dods, James; Taylor, Rhonda L; Karimi, Mahdad; Fenwick, Emily J; Quail, Elizabeth A; Rea, Alexander J; Holers, V Michael; Abraham, Lawrence J; Ulgiati, Daniela

    2015-07-01

    Complement receptor 2 (CR2/CD21) plays an important role in the generation of normal B cell immune responses. As transcription appears to be the prime mechanism via which surface CR2/CD21 expression is controlled, understanding transcriptional regulation of this gene will have broader implications to B cell biology. Here we report opposing, cell-context specific control of CR2/CD21 promoter activity by tandem E-box elements, spaced 22 bp apart and within 70 bp of the transcription initiation site. We have identified E2A and USF transcription factors as binding to the distal and proximal E-box sites respectively in CR2-positive B-cells, at a site that is hypersensitive to restriction enzyme digestion compared to non-expressing K562 cells. However, additional unidentified proteins have also been found to bind these functionally important elements. By utilizing a proteomics approach we have identified a repressor protein, RP58, binding the distal E-box motif. Co-transfection experiments using RP58 overexpression constructs demonstrated a specific 10-fold repression of CR2/CD21 transcriptional activity mediated through the distal E-box repressor element. Taken together, our results indicate that repression of the CR2/CD21 promoter can occur through one of the E-box motifs via recruitment of RP58 and other factors to bring about a silenced chromatin context within CR2/CD21 non-expressing cells. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Sequences required for induction of neurotensin receptor gene expression during neuronal differentiation of N1E-115 neuroblastoma cells.

    PubMed

    Tavares, D; Tully, K; Dobner, P R

    1999-10-15

    The promoter region of the mouse high affinity neurotensin receptor (Ntr-1) gene was characterized, and sequences required for expression in neuroblastoma cell lines that express high affinity NT-binding sites were characterized. Me(2)SO-induced neuronal differentiation of N1E-115 neuroblastoma cells increased both the expression of the endogenous Ntr-1 gene and reporter genes driven by NTR-1 promoter sequences by 3-4-fold. Deletion analysis revealed that an 83-base pair promoter region containing the transcriptional start site is required for Me(2)SO activation. Detailed mutational analysis of this region revealed that a CACCC box and the central region of a large GC-rich palindrome are the crucial cis-regulatory elements required for Me(2)SO induction. The CACCC box is bound by at least one factor that is induced upon Me(2)SO treatment of N1E-115 cells. The Me(2)SO effect was found to be both selective and cell type-restricted. Basal expression in the neuroblastoma cell lines required a distinct set of sequences, including an Sp1-like sequence, and a sequence resembling an NGFI-A-binding site; however, a more distal 5' sequence was found to repress basal activity in N1E-115 cells. These results provide evidence that Ntr-1 gene regulation involves both positive and negative regulatory elements located in the 5'-flanking region and that Ntr-1 gene activation involves the coordinate activation or induction of several factors, including a CACCC box binding complex.

  14. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  15. The mechanistic basis for noncompetitive ibogaine inhibition of serotonin and dopamine transporters.

    PubMed

    Bulling, Simon; Schicker, Klaus; Zhang, Yuan-Wei; Steinkellner, Thomas; Stockner, Thomas; Gruber, Christian W; Boehm, Stefan; Freissmuth, Michael; Rudnick, Gary; Sitte, Harald H; Sandtner, Walter

    2012-05-25

    Ibogaine, a hallucinogenic alkaloid proposed as a treatment for opiate withdrawal, has been shown to inhibit serotonin transporter (SERT) noncompetitively, in contrast to all other known inhibitors, which are competitive with substrate. Ibogaine binding to SERT increases accessibility in the permeation pathway connecting the substrate-binding site with the cytoplasm. Because of the structural similarity between ibogaine and serotonin, it had been suggested that ibogaine binds to the substrate site of SERT. The results presented here show that ibogaine binds to a distinct site, accessible from the cell exterior, to inhibit both serotonin transport and serotonin-induced ionic currents. Ibogaine noncompetitively inhibited transport by both SERT and the homologous dopamine transporter (DAT). Ibogaine blocked substrate-induced currents also in DAT and increased accessibility of the DAT cytoplasmic permeation pathway. When present on the cell exterior, ibogaine inhibited SERT substrate-induced currents, but not when it was introduced into the cytoplasm through the patch electrode. Similar to noncompetitive transport inhibition, the current block was not reversed by increasing substrate concentration. The kinetics of inhibitor binding and dissociation, as determined by their effect on SERT currents, indicated that ibogaine does not inhibit by forming a long-lived complex with SERT, but rather binds directly to the transporter in an inward-open conformation. A kinetic model for transport describing the noncompetitive action of ibogaine and the competitive action of cocaine accounts well for the results of the present study.

  16. The Mechanistic Basis for Noncompetitive Ibogaine Inhibition of Serotonin and Dopamine Transporters*

    PubMed Central

    Bulling, Simon; Schicker, Klaus; Zhang, Yuan-Wei; Steinkellner, Thomas; Stockner, Thomas; Gruber, Christian W.; Boehm, Stefan; Freissmuth, Michael; Rudnick, Gary; Sitte, Harald H.; Sandtner, Walter

    2012-01-01

    Ibogaine, a hallucinogenic alkaloid proposed as a treatment for opiate withdrawal, has been shown to inhibit serotonin transporter (SERT) noncompetitively, in contrast to all other known inhibitors, which are competitive with substrate. Ibogaine binding to SERT increases accessibility in the permeation pathway connecting the substrate-binding site with the cytoplasm. Because of the structural similarity between ibogaine and serotonin, it had been suggested that ibogaine binds to the substrate site of SERT. The results presented here show that ibogaine binds to a distinct site, accessible from the cell exterior, to inhibit both serotonin transport and serotonin-induced ionic currents. Ibogaine noncompetitively inhibited transport by both SERT and the homologous dopamine transporter (DAT). Ibogaine blocked substrate-induced currents also in DAT and increased accessibility of the DAT cytoplasmic permeation pathway. When present on the cell exterior, ibogaine inhibited SERT substrate-induced currents, but not when it was introduced into the cytoplasm through the patch electrode. Similar to noncompetitive transport inhibition, the current block was not reversed by increasing substrate concentration. The kinetics of inhibitor binding and dissociation, as determined by their effect on SERT currents, indicated that ibogaine does not inhibit by forming a long-lived complex with SERT, but rather binds directly to the transporter in an inward-open conformation. A kinetic model for transport describing the noncompetitive action of ibogaine and the competitive action of cocaine accounts well for the results of the present study. PMID:22451652

  17. A 10-aa-long sequence in SLP-76 upstream of the Gads binding site is essential for T cell development and function.

    PubMed

    Kumar, Lalit; Feske, Stefan; Rao, Anjana; Geha, Raif S

    2005-12-27

    The adapter SLP-76 is essential for T cell development and function. SLP-76 binds to the src homology 3 domain of Lck in vitro. This interaction depends on amino acids 185-194 of SLP-76. To examine the role of the Lck-binding region of SLP-76 in T cell development and function, SLP-76(-/-) mice were reconstituted with an SLP-76 mutant that lacks amino acids 185-194. Double and single positive thymocytes from reconstituted mice were severely reduced in numbers and exhibited impaired positive selection and increased apoptosis. Peripheral T cells were also reduced in numbers, exhibited impaired phospholipase C-gamma1 and Erk phosphorylation, and failed to flux calcium, secrete IL-2, and proliferate in response to T cell antigen receptor ligation. Delayed cutaneous hypersensitivity responses and Ab responses to T cell-dependent antigen were severely impaired. These results indicate that the Lck binding region of SLP-76 is essential for T cell antigen receptor signaling and normal T cell development and function.

  18. Characterization of the high affinity binding of epsilon toxin from Clostridium perfringens to the renal system.

    PubMed

    Dorca-Arévalo, Jonatan; Martín-Satué, Mireia; Blasi, Juan

    2012-05-25

    Epsilon toxin (ε-toxin), produced by Clostridium perfringens types B and D, causes fatal enterotoxaemia in livestock. In the renal system, the toxin binds to target cells before oligomerization, pore formation and cell death. Still, there is little information about the cellular and molecular mechanism involved in the initial steps of the cytotoxic action of ε-toxin, including the specific binding to the target sensitive cells. In the present report, the binding step of ε-toxin to the MDCK cell line is characterized by means of an ELISA-based binding assay with recombinant ε-toxin-green fluorescence protein (ε-toxin-GFP) and ε-prototoxin-GFP. In addition, different treatments with Pronase E, detergents, N-glycosidase F and beta-elimination on MDCK cells and renal cryosections have been performed to further characterize the ε-toxin binding. The ELISA assays revealed a single binding site with a similar dissociation constant (K(d)) for ε-toxin-GFP and ε-prototoxin-GFP, but a three-fold increase in B(max) levels in the case of ε-toxin-GFP. Double staining on kidney cryoslices with lectins and ε-prototoxin-GFP revealed specific binding to distal and collecting tubule cells. In addition, experiments on kidney and bladder cryoslices demonstrated the specific binding to distal tubule of a range of mammalian renal systems. Pronase E and beta-elimination treatments on kidney cryoslices and MDCK cells revealed that the binding of ε-toxin in renal system is mediated by a O-glycoprotein. Detergent treatments revealed that the integrity of the plasma membrane is required for the binding of ε-toxin to its receptor. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. The fibronectin synergy site re-enforces cell adhesion and mediates a crosstalk between integrin classes

    PubMed Central

    Benito-Jardón, Maria; Klapproth, Sarah; Gimeno-LLuch, Irene; Petzold, Tobias; Bharadwaj, Mitasha; Müller, Daniel J; Zuchtriegel, Gabriele; Reichel, Christoph A; Costell, Mercedes

    2017-01-01

    Fibronectin (FN), a major extracellular matrix component, enables integrin-mediated cell adhesion via binding of α5β1, αIIbβ3 and αv-class integrins to an RGD-motif. An additional linkage for α5 and αIIb is the synergy site located in close proximity to the RGD motif. We report that mice with a dysfunctional FN-synergy motif (Fn1syn/syn) suffer from surprisingly mild platelet adhesion and bleeding defects due to delayed thrombus formation after vessel injury. Additional loss of β3 integrins dramatically aggravates the bleedings and severely compromises smooth muscle cell coverage of the vasculature leading to embryonic lethality. Cell-based studies revealed that the synergy site is dispensable for the initial contact of α5β1 with the RGD, but essential to re-enforce the binding of α5β1/αIIbβ3 to FN. Our findings demonstrate a critical role for the FN synergy site when external forces exceed a certain threshold or when αvβ3 integrin levels decrease below a critical level. DOI: http://dx.doi.org/10.7554/eLife.22264.001 PMID:28092265

  20. Actin-binding and cell proliferation activities of angiomotin family members are regulated by Hippo pathway-mediated phosphorylation.

    PubMed

    Chan, Siew Wee; Lim, Chun Jye; Guo, Fusheng; Tan, Ivan; Leung, Thomas; Hong, Wanjin

    2013-12-27

    Whether the Hippo pathway has downstream targets other than YAP and TAZ is unknown. In this report, we have identified angiomotin (Amot) family members as novel substrates of Hippo core kinases. The N-terminal regions of Amot proteins contain a conserved HXRXXS consensus site for LATS1/2-mediated phosphorylation. Phospho-specific antibodies showed that Hippo core kinases could mediate phosphorylation of endogenous as well as exogenous Amot family members. Knockdown of LATS1 and LATS2 endogenously reduced the phosphorylation of Amots detected by the phospho-specific antibodies. Mutation of the serine to alanine within this HXRXXS site in Amot and AmotL2 established that this site was essential for Hippo core kinase-mediated phosphorylation. Wild-type and non-phosphorylated Amot (Amot-S175A) were targeted to actin filaments, whereas phospho-mimic Amot (Amot-S175D) failed to be localized with actin. Overexpression of LATS2 caused dissociation of Amot from actin but not Amot-S175A. Mapping of the actin-binding site of Amot showed that serine 175 of Amot was important for the actin-binding activity. Amot-S175A promoted, whereas Amot and Amot-S175D inhibited, cell proliferation. These results collectively suggest that the Hippo pathway negatively regulates the actin-binding activity of Amot family members through direct phosphorylation.

Top