Sample records for cell gene mutation

  1. Lung-MAP: Talazoparib in Treating Patients With HRRD Positive Recurrent Stage IV Squamous Cell Lung Cancer

    ClinicalTrials.gov

    2018-05-31

    ATM Gene Mutation; ATR Gene Mutation; BARD1 Gene Mutation; BRCA1 Gene Mutation; BRCA2 Gene Mutation; BRIP1 Gene Mutation; CHEK1 Gene Mutation; CHEK2 Gene Mutation; FANCA Gene Mutation; FANCC Gene Mutation; FANCD2 Gene Mutation; FANCF Gene Mutation; FANCM Gene Mutation; NBN Gene Mutation; PALB2 Gene Mutation; RAD51 Gene Mutation; RAD51B Gene Mutation; RAD54L Gene Mutation; Recurrent Squamous Cell Lung Carcinoma; RPA1 Gene Mutation; Stage IV Squamous Cell Lung Carcinoma AJCC v7

  2. Busulfan, Fludarabine, Donor Stem Cell Transplant, and Cyclophosphamide in Treating Patients With Multiple Myeloma or Myelofibrosis

    ClinicalTrials.gov

    2018-01-31

    Anemia; ASXL1 Gene Mutation; EZH2 Gene Mutation; IDH1 Gene Mutation; IDH2 Gene Mutation; Plasma Cell Myeloma; Primary Myelofibrosis; Recurrent Plasma Cell Myeloma; Secondary Myelofibrosis; Thrombocytopenia

  3. Recombinant EphB4-HSA Fusion Protein and Pembrolizumab, MK-3475

    ClinicalTrials.gov

    2018-03-30

    ALK Gene Mutation; BRAF Gene Mutation; EGFR Gene Mutation; Head and Neck Squamous Cell Carcinoma; Metastatic Head and Neck Carcinoma; Recurrent Head and Neck Carcinoma; Recurrent Non-Small Cell Lung Carcinoma; ROS1 Gene Mutation; Stage III Non-Small Cell Lung Cancer; Stage IIIA Non-Small Cell Lung Cancer; Stage IIIB Non-Small Cell Lung Cancer; Stage IV Non-Small Cell Lung Cancer

  4. Lung-MAP: AZD4547 as Second-Line Therapy in Treating FGFR Positive Patients With Recurrent Stage IV Squamous Cell Lung Cancer

    ClinicalTrials.gov

    2017-12-13

    FGFR1 Gene Amplification; FGFR1 Gene Mutation; FGFR2 Gene Amplification; FGFR2 Gene Mutation; FGFR3 Gene Amplification; FGFR3 Gene Mutation; Recurrent Squamous Cell Lung Carcinoma; Stage IV Squamous Cell Lung Carcinoma AJCC v7

  5. Mutational analysis of genes coding for cell surface proteins in colorectal cancer cell lines reveal novel altered pathways, druggable mutations and mutated epitopes for targeted therapy

    PubMed Central

    Correa, Bruna R.; Bettoni, Fabiana; Koyama, Fernanda C.; Navarro, Fabio C.P.; Perez, Rodrigo O.; Mariadason, John; Sieber, Oliver M.; Strausberg, Robert L.; Simpson, Andrew J.G.; Jardim, Denis L.F.; Reis, Luiz Fernando L.; Parmigiani, Raphael B.; Galante, Pedro A.F.; Camargo, Anamaria A.

    2014-01-01

    We carried out a mutational analysis of 3,594 genes coding for cell surface proteins (Surfaceome) in 23 colorectal cancer cell lines, searching for new altered pathways, druggable mutations and mutated epitopes for targeted therapy in colorectal cancer. A total of 3,944 somatic non-synonymous substitutions and 595 InDels, occurring in 2,061 (57%) Surfaceome genes were catalogued. We identified 48 genes not previously described as mutated in colorectal tumors in the TCGA database, including genes that are mutated and expressed in >10% of the cell lines (SEMA4C, FGFRL1, PKD1, FAM38A, WDR81, TMEM136, SLC36A1, SLC26A6, IGFLR1). Analysis of these genes uncovered important roles for FGF and SEMA4 signaling in colorectal cancer with possible therapeutic implications. We also found that cell lines express on average 11 druggable mutations, including frequent mutations (>20%) in the receptor tyrosine kinases AXL and EPHA2, which have not been previously considered as potential targets for colorectal cancer. Finally, we identified 82 cell surface mutated epitopes, however expression of only 30% of these epitopes was detected in our cell lines. Notwithstanding, 92% of these epitopes were expressed in cell lines with the mutator phenotype, opening new venues for the use of “general” immune checkpoint drugs in this subset of patients. PMID:25193853

  6. LATS2 tumour specific mutations and down-regulation of the gene in non-small cell carcinoma.

    PubMed

    Strazisar, Mojca; Mlakar, Vid; Glavac, Damjan

    2009-06-01

    LATS2 is a new member of the LATS tumour suppressor family. The human LATS2 gene is located at chromosome 13q11-12, a hot spot (67%) for loss of heterozygosity (LOH) in non-small cell lung cancer (NSCLC). We screened 129 non-small cell lung cancer samples and 13 lung cancer cell lines, initially for mutations in the LATS2 gene and subsequently for mutations in P53 and K-RAS genes. Either polymorphisms or mutations were identified in over 50 percent of analysed tumours. A novel missense mutation, S1073R, and a large deletion of 8 amino acids in the PAPA-repeat region were detected in 9 and 2 NSCLC tumours, respectively. Those mutations were not identified in the 13 lung cancer cell lines. Mutations were tumour specific and were absent from adjacent normal tissue and healthy controls. Down-regulation of the LATS2 gene was observed in most NSCLC tumours but was not related to any mutation or polymorphism. Tumours with a LATS2 mutation often also harbour a P53 but not K-RAS gene mutation and were mostly in an advanced stage of development, with regional lymph node involvement.

  7. Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

    PubMed Central

    Cheng, J; Haas, M

    1990-01-01

    Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

  8. Detection of EGFR Gene Mutation by Mutation-oriented LAMP Method.

    PubMed

    Matsumoto, Naoyuki; Kumasaka, Akira; Ando, Tomohiro; Komiyama, Kazuo

    2018-04-01

    Epidermal growth factor receptor (EGFR) is a target of molecular therapeutics for non-small cell lung cancer. EGFR gene mutations at codons 746-753 promote constitutive EGFR activation and result in worst prognosis. However, these mutations augment the therapeutic effect of EGFR-tyrosine kinase inhibitor. Therefore, the detection of EGFR gene mutations is important for determining treatment planning. The aim of the study was to establish a method to detect EGFR gene mutations at codons 746-753. EGFR gene mutation at codons 746-753 in six cancer cell lines were investigated. A loop-mediated isothermal amplification (LAMP)-based procedure was developed, that employed peptide nucleic acid to suppress amplification of the wild-type allele. This mutation-oriented LAMP can amplify the DNA fragment of the EGFR gene with codons 746-753 mutations within 30 min. Moreover, boiled cells can work as template resources. Mutation oriented-LAMP assay for EGFR gene mutation is sensitive on extracted DNA. This procedure would be capable of detecting EGFR gene mutation in sputum, pleural effusion, broncho-alveolar lavage fluid or trans-bronchial lung biopsy by chair side. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  9. B cell Variable genes have evolved their codon usage to focus the targeted patterns of somatic mutation on the complementarity determining regions

    PubMed Central

    Saini, Jasmine; Hershberg, Uri

    2015-01-01

    The exceptional ability of B cells to diversify through somatic mutation and improve affinity of the repertoire towards the antigens is the cornerstone of adaptive immunity. Somatic mutation is not evenly distributed and exhibits certain micro-sequence specificities. We show here that the combination of somatic mutation targeting and the codon usage in human B cell receptor (BCR) Variable (V) genes create expected patterns of mutation and post mutation changes that are focused on their complementarity determining regions (CDR). T cell V genes are also skewed in targeting mutations but to a lesser extent and are lacking the codon usage bias observed in BCRs. This suggests that the observed skew in T cell receptors is due to their amino acid usage, which is similar to that of BCRs. The mutation targeting and the codon bias allow B cell CDRs to diversify by specifically accumulating nonconservative changes. We counted the distribution of mutations to CDR in 4 different human datasets. In all four cases we found that the number of actual mutations in the CDR correlated significantly with the V gene mutation biases to the CDR predicted by our models. Finally, it appears that the mutation bias in V genes indeed relates to their long-term survival in actual human repertoires. We observed that resting repertoires of B cells overexpressed V genes that were especially biased towards focused mutation and change in the CDR. This bias in V gene usage was somewhat relaxed at the height of the immune response to a vaccine, presumably because of the need for a wider diversity in a primary response. However, older patients did not retain this flexibility and were biased towards using only highly skewed V genes at all stages of their response. PMID:25660968

  10. B cell variable genes have evolved their codon usage to focus the targeted patterns of somatic mutation on the complementarity determining regions.

    PubMed

    Saini, Jasmine; Hershberg, Uri

    2015-05-01

    The exceptional ability of B cells to diversify through somatic mutation and improve affinity of the repertoire toward the antigens is the cornerstone of adaptive immunity. Somatic mutation is not evenly distributed and exhibits certain micro-sequence specificities. We show here that the combination of somatic mutation targeting and the codon usage in human B cell receptor (BCR) Variable (V) genes create expected patterns of mutation and post mutation changes that are focused on their complementarity determining regions (CDR). T cell V genes are also skewed in targeting mutations but to a lesser extent and are lacking the codon usage bias observed in BCRs. This suggests that the observed skew in T cell receptors is due to their amino acid usage, which is similar to that of BCRs. The mutation targeting and the codon bias allow B cell CDRs to diversify by specifically accumulating nonconservative changes. We counted the distribution of mutations to CDR in 4 different human datasets. In all four cases we found that the number of actual mutations in the CDR correlated significantly with the V gene mutation biases to the CDR predicted by our models. Finally, it appears that the mutation bias in V genes indeed relates to their long-term survival in actual human repertoires. We observed that resting repertoires of B cells overexpressed V genes that were especially biased toward focused mutation and change in the CDR. This bias in V gene usage was somewhat relaxed at the height of the immune response to a vaccine, presumably because of the need for a wider diversity in a primary response. However, older patients did not retain this flexibility and were biased toward using only highly skewed V genes at all stages of their response. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. A universal method for the mutational analysis of K-ras and p53 gene in non-small-cell lung cancer using formalin-fixed paraffin-embedded tissue.

    PubMed

    Sarkar, F H; Valdivieso, M; Borders, J; Yao, K L; Raval, M M; Madan, S K; Sreepathi, P; Shimoyama, R; Steiger, Z; Visscher, D W

    1995-12-01

    The p53 tumor suppressor gene has been found to be altered in almost all human solid tumors, whereas K-ras gene mutations have been observed in a limited number of human cancers (adenocarcinoma of colon, pancreas, and lung). Studies of mutational inactivation for both genes in the same patient's sample on non-small-cell lung cancer have been limited. In an effort to perform such an analysis, we developed and compared methods (for the mutational detection of p53 and K-ras gene) that represent a modified and universal protocol, in terms of DNA extraction, polymerase chain reaction (PCR) amplification, and nonradioisotopic PCR-single-strand conformation polymorphism (PCR-SSCP) analysis, which is readily applicable to either formalin-fixed, paraffin-embedded tissues or frozen tumor specimens. We applied this method to the evaluation of p53 (exons 5-8) and K-ras (codon 12 and 13) gene mutations in 55 cases of non-small-cell lung cancer. The mutational status in the p53 gene was evaluated by radioisotopic PCR-SSCP and compared with PCR-SSCP utilizing our standardized nonradioisotopic detection system using a single 6-microns tissue section. The mutational patterns observed by PCR-SSCP were subsequently confirmed by PCR-DNA sequencing. The mutational status in the K-ras gene was similarly evaluated by PCR-SSCP, and the specific mutation was confirmed by Southern slot-blot hybridization using 32P-labeled sequence-specific oligonucleotide probes for codons 12 and 13. Mutational changes in K-ras (codon 12) were found in 10 of 55 (18%) of non-small-cell lung cancers. Whereas adenocarcinoma showed K-ras mutation in 33% of the cases at codon 12, only one mutation was found at codon 13. As expected, squamous cell carcinoma samples (25 cases) did not show K-ras mutations. Mutations at exons 5-8 of the p53 gene were documented in 19 of 55 (34.5%) cases. Ten of the 19 mutations were single nucleotide point mutations, leading to amino acid substitution. Six showed insertional mutation, and three showed deletion mutations. Only three samples showed mutations of both K-ras and p53 genes. We conclude that although K-ras and p53 gene mutations are frequent in non-small-cell lung cancer, mutations of both genes in the same patient's samples are not common. We also conclude that this universal nonradioisotopic method is superior to other similar methods and is readily applicable to the rapid screening of large numbers of formalin-fixed, paraffin-embedded or frozen samples for the mutational analysis of multiple genes.

  12. Characterization of stem cells and cancer cells on the basis of gene expression profile stability, plasticity, and robustness: dynamical systems theory of gene expressions under cell-cell interaction explains mutational robustness of differentiated cells and suggests how cancer cells emerge.

    PubMed

    Kaneko, Kunihiko

    2011-06-01

    Here I present and discuss a model that, among other things, appears able to describe the dynamics of cancer cell origin from the perspective of stable and unstable gene expression profiles. In identifying such aberrant gene expression profiles as lying outside the normal stable states attracted through development and normal cell differentiation, the hypothesis explains why cancer cells accumulate mutations, to which they are not robust, and why these mutations create a new stable state far from the normal gene expression profile space. Such cells are in strong contrast with normal cell types that appeared as an attractor state in the gene expression dynamical system under cell-cell interaction and achieved robustness to noise through evolution, which in turn also conferred robustness to mutation. In complex gene regulation networks, other aberrant cellular states lacking such high robustness are expected to remain, which would correspond to cancer cells. Copyright © 2011 WILEY Periodicals, Inc.

  13. Small Cell Lung Cancer Exhibits Frequent Inactivating Mutations in the Histone Methyltransferase KMT2D/MLL2: CALGB 151111 (Alliance)

    PubMed Central

    Augert, Arnaud; Zhang, Qing; Bates, Breanna; Cui, Min; Wang, Xiaofei; Wildey, Gary; Dowlati, Afshin; MacPherson, David

    2017-01-01

    Introduction SCLC is a lethal neuroendocrine tumor type that is highly prone to metastasis. There is an urgency to understand the mutated genes that promote SCLC, as there are no approved targeted therapies yet available. SCLC is rarely resected, limiting the number of samples available for genomic analyses of somatic mutations. Methods To identify potential driver mutations in human SCLC we sequenced the whole exomes of 18 primary SCLCs and seven cell lines along with matched normal controls. We extended these data by resequencing a panel of genes across 40 primary SCLCs and 48 cell lines. Results We report frequent mutations in the lysine methyltransferase 2D gene (KMT2D) (also known as MLL2), a key regulator of transcriptional enhancer function. KMT2D exhibited truncating nonsense/frameshift/splice site mutations in 8% of SCLC tumors and 17% of SCLC cell lines. We found that KMT2D mutation in human SCLC cell lines was associated with reduced lysine methyltransferase 2D protein levels and reduced monomethylation of histone H3 lysine 4, a mark associated with transcriptional enhancers. We also found mutations in other genes associated with transcriptional enhancer control, including CREB binding protein gene (CREBBP), E1A binding protein p300 gene (EP300), and chromodomain helicase DNA binding protein 7 gene (CHD7), and we report mutations in additional chromatin remodeling genes such as polybromo 1 gene (PBRM1). Conclusions These data indicate that KMT2D is one of the major mutated genes in SCLC, and they point to perturbation of transcriptional enhancer control as potentially contributing to SCLC. PMID:28007623

  14. Mutation of MSH3 in endometrial cancer and evidence for its functional role in heteroduplex repair.

    PubMed

    Risinger, J I; Umar, A; Boyd, J; Berchuck, A; Kunkel, T A; Barrett, J C

    1996-09-01

    Many human tumours have length alterations in repetitive sequence elements. Although this microsatellite instability has been attributed to mutations in four DNA mismatch repair genes in hereditary nonpolyposis colorectal cancer (HNPCC) kindreds, many sporadic tumours exhibit instability but no detectable mutations in these genes. It is therefore of interest to identify other genes that contribute to this instability. In yeast, mutations in several genes, including RTH and MSH3, cause microsatellite instability. Thus, we screened 16 endometrial carcinomas with microsatellite instability for alterations in FEN1 (the human homolog of RTH) and in MSH3 (refs 12-14). Although we found no FEN1 mutations, a frameshift mutation in MSH3 was observed in an endometrial carcinoma and in an endometrial carcinoma cell line. Extracts of the cell line were deficient in repair of DNA substrates containing mismatches or extra nucleotides. Introducing chromosome 5, encoding the MSH3 gene, into the mutant cell line increased the stability of some but not all microsatellites. Extracts of these cells repaired certain substrates containing extra nucleotides, but were deficient in repair of those containing mismatches or other extra nucleotides. A subsequent search revealed a second gene mutation in HHUA cells, a missense mutation in the MSH6 gene. Together the data suggest that the MSH3 gene encodes a product that functions in repair of some but not all pre-mutational intermediates, its mutation in tumours can result in genomic instability and, as in yeast, MSH3 and MSH6 are partially redundant for mismatch repair.

  15. Characterization of various types of mast cells derived from model mice of familial gastrointestinal stromal tumors with KIT-Asp818Tyr mutation

    PubMed Central

    Kajimoto, Noriko; Nakai, Norihiro; Ohkouchi, Mizuka; Hashikura, Yuka; Liu-Kimura, Ning-Ning; Isozaki, Koji; Hirota, Seiichi

    2015-01-01

    Sporadic mast cell neoplasms and gastrointestinal stromal tumors (GISTs) often have various types of somatic gain-of-function mutations of the c-kit gene which encodes a receptor tyrosine kinase, KIT. Several types of germline gain-of-function mutations of the c-kit gene have been detected in families with multiple GISTs. All three types of model mice for the familial GISTs with germline c-kit gene mutations at exon 11, 13 or 17 show development of GIST, while they are different from each other in skin mast cell number. Skin mast cell number in the model mice with exon 17 mutation was unchanged compared to the corresponding wild-type mice. In the present study, we characterized various types of mast cells derived from the model mice with exon 17 mutation (KIT-Asp818Tyr) corresponding to human familial GIST case with human KIT-Asp820Tyr to clarify the role of the c-kit gene mutation in mast cells. Bone marrow-derived cultured mast cells (BMMCs) derived from wild-type mice, heterozygotes and homozygotes were used for the experiments. Immortalized BMMCs, designated as IMC-G4 cells, derived from BMMCs of a homozygote during long-term culture were also used. Ultrastructure, histamine contents, proliferation profiles and phosphorylation of various signaling molecules in those cells were examined. In IMC-G4 cells, presence of additional mutation(s) of the c-kit gene and effect of KIT inhibitors on both KIT autophosphorylation and cell proliferation were also analyzed. We demonstrated that KIT-Asp818Tyr did not affect ultrastructure and proliferation profiles but did histamine contents in BMMCs. IMC-G4 cells had an additional novel c-kit gene mutation of KIT-Tyr421Cys which is considered to induce neoplastic transformation of mouse mast cells and the mutation appeared to be resistant to a KIT inhibitor of imatinib but sensitive to another KIT inhibitor of nilotinib. IMC-G4 cells might be a useful mast cell line to investigate mast cell biology. PMID:26722383

  16. Irradiated Donor Cells Following Stem Cell Transplant in Controlling Cancer in Patients With Hematologic Malignancies

    ClinicalTrials.gov

    2018-05-16

    Acute Lymphoblastic Leukemia; Acute Myeloid Leukemia in Remission; Hematopoietic Cell Transplantation Recipient; JAK2 Gene Mutation; Loss of Chromosome 17p; Mantle Cell Lymphoma; Minimal Residual Disease; Myelodysplastic Syndrome; Non-Hodgkin Lymphoma; Plasma Cell Myeloma; RAS Family Gene Mutation; Recurrent Diffuse Large B-Cell Lymphoma; Recurrent Hematologic Malignancy; Recurrent Mature T- and NK-Cell Non-Hodgkin Lymphoma; Refractory Diffuse Large B-Cell Lymphoma; Refractory Mature T-Cell and NK-Cell Non-Hodgkin Lymphoma; Therapy-Related Acute Myeloid Leukemia; Therapy-Related Myelodysplastic Syndrome; TP53 Gene Mutation

  17. In Vivo Rat T-Lymphocyte Pig-a Assay: Detection and Expansion of Cells Deficient in the GPI-Anchored CD48 Surface Marker for Analysis of Mutation in the Endogenous Pig-a Gene.

    PubMed

    Dobrovolsky, Vasily N; Revollo, Javier; Petibone, Dayton M; Heflich, Robert H

    2017-01-01

    The Pig-a assay is being developed as an in vivo gene mutation assay for regulatory safety assessments. The assay is based on detecting mutation in the endogenous Pig-a gene of treated rats by using flow cytometry to measure changes in cell surface markers of peripheral blood cells. Here we present a methodology for demonstrating that phenotypically mutant rat T-cells identified by flow cytometry contain mutations in the Pig-a gene, an important step for validating the assay. In our approach, the mutant phenotype T-cells are sorted into individual wells of 96-well plates and expanded into clones. Subsequent sequencing of genomic DNA from the expanded clones confirms that the Pig-a assay detects exactly what it claims to detect-cells with mutations in the endogenous Pig-a gene. In addition, determining the spectra of Pig-a mutations provides information for better understanding the mutational mechanism of compounds of interest. Our methodology of combining phenotypic antibody labeling, magnetic enrichment, sorting, and single-cell clonal expansion can be used in genotoxicity/mutagenicity studies and in other general immunotoxicology research requiring identification, isolation, and expansion of extremely rare subpopulations of T-cells.

  18. Mutation site and context dependent effects of ESR1 mutation in genome-edited breast cancer cell models.

    PubMed

    Bahreini, Amir; Li, Zheqi; Wang, Peilu; Levine, Kevin M; Tasdemir, Nilgun; Cao, Lan; Weir, Hazel M; Puhalla, Shannon L; Davidson, Nancy E; Stern, Andrew M; Chu, David; Park, Ben Ho; Lee, Adrian V; Oesterreich, Steffi

    2017-05-23

    Mutations in the estrogen receptor alpha (ERα) 1 gene (ESR1) are frequently detected in ER+ metastatic breast cancer, and there is increasing evidence that these mutations confer endocrine resistance in breast cancer patients with advanced disease. However, their functional role is not well-understood, at least in part due to a lack of ESR1 mutant models. Here, we describe the generation and characterization of genome-edited T47D and MCF7 breast cancer cell lines with the two most common ESR1 mutations, Y537S and D538G. Genome editing was performed using CRISPR and adeno-associated virus (AAV) technologies to knock-in ESR1 mutations into T47D and MCF7 cell lines, respectively. Various techniques were utilized to assess the activity of mutant ER, including transactivation, growth and chromatin-immunoprecipitation (ChIP) assays. The level of endocrine resistance was tested in mutant cells using a number of selective estrogen receptor modulators (SERMs) and degraders (SERDs). RNA sequencing (RNA-seq) was employed to study gene targets of mutant ER. Cells with ESR1 mutations displayed ligand-independent ER activity, and were resistant to several SERMs and SERDs, with cell line and mutation-specific differences with respect to magnitude of effect. The SERD AZ9496 showed increased efficacy compared to other drugs tested. Wild-type and mutant cell co-cultures demonstrated a unique evolution of mutant cells under estrogen deprivation and tamoxifen treatment. Transcriptome analysis confirmed ligand-independent regulation of ERα target genes by mutant ERα, but also identified novel target genes, some of which are involved in metastasis-associated phenotypes. Despite significant overlap in the ligand-independent genes between Y537S and D538G, the number of mutant ERα-target genes shared between the two cell lines was limited, suggesting context-dependent activity of the mutant receptor. Some genes and phenotypes were unique to one mutation within a given cell line, suggesting a mutation-specific effect. Taken together, ESR1 mutations in genome-edited breast cancer cell lines confer ligand-independent growth and endocrine resistance. These biologically relevant models can be used for further mechanistic and translational studies, including context-specific and mutation site-specific analysis of the ESR1 mutations.

  19. GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.

    PubMed

    Livide, Gabriella; Patriarchi, Tommaso; Amenduni, Mariangela; Amabile, Sonia; Yasui, Dag; Calcagno, Eleonora; Lo Rizzo, Caterina; De Falco, Giulia; Ulivieri, Cristina; Ariani, Francesca; Mari, Francesca; Mencarelli, Maria Antonietta; Hell, Johannes Wilhelm; Renieri, Alessandra; Meloni, Ilaria

    2015-02-01

    Rett syndrome is a monogenic disease due to de novo mutations in either MECP2 or CDKL5 genes. In spite of their involvement in the same disease, a functional interaction between the two genes has not been proven. MeCP2 is a transcriptional regulator; CDKL5 encodes for a kinase protein that might be involved in the regulation of gene expression. Therefore, we hypothesized that mutations affecting the two genes may lead to similar phenotypes by dysregulating the expression of common genes. To test this hypothesis we used induced pluripotent stem (iPS) cells derived from fibroblasts of one Rett patient with a MECP2 mutation (p.Arg306Cys) and two patients with mutations in CDKL5 (p.Gln347Ter and p.Thr288Ile). Expression profiling was performed in CDKL5-mutated cells and genes of interest were confirmed by real-time RT-PCR in both CDKL5- and MECP2-mutated cells. The only major change in gene expression common to MECP2- and CDKL5-mutated cells was for GRID1, encoding for glutamate D1 receptor (GluD1), a member of the δ-family of ionotropic glutamate receptors. GluD1 does not form AMPA or NMDA glutamate receptors. It acts like an adhesion molecule by linking the postsynaptic and presynaptic compartments, preferentially inducing the inhibitory presynaptic differentiation of cortical neurons. Our results demonstrate that GRID1 expression is downregulated in both MECP2- and CDKL5-mutated iPS cells and upregulated in neuronal precursors and mature neurons. These data provide novel insights into disease pathophysiology and identify possible new targets for therapeutic treatment of Rett syndrome.

  20. GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells

    PubMed Central

    Livide, Gabriella; Patriarchi, Tommaso; Amenduni, Mariangela; Amabile, Sonia; Yasui, Dag; Calcagno, Eleonora; Lo Rizzo, Caterina; De Falco, Giulia; Ulivieri, Cristina; Ariani, Francesca; Mari, Francesca; Mencarelli, Maria Antonietta; Hell, Johannes Wilhelm; Renieri, Alessandra; Meloni, Ilaria

    2015-01-01

    Rett syndrome is a monogenic disease due to de novo mutations in either MECP2 or CDKL5 genes. In spite of their involvement in the same disease, a functional interaction between the two genes has not been proven. MeCP2 is a transcriptional regulator; CDKL5 encodes for a kinase protein that might be involved in the regulation of gene expression. Therefore, we hypothesized that mutations affecting the two genes may lead to similar phenotypes by dysregulating the expression of common genes. To test this hypothesis we used induced pluripotent stem (iPS) cells derived from fibroblasts of one Rett patient with a MECP2 mutation (p.Arg306Cys) and two patients with mutations in CDKL5 (p.Gln347Ter and p.Thr288Ile). Expression profiling was performed in CDKL5-mutated cells and genes of interest were confirmed by real-time RT-PCR in both CDKL5- and MECP2-mutated cells. The only major change in gene expression common to MECP2- and CDKL5-mutated cells was for GRID1, encoding for glutamate D1 receptor (GluD1), a member of the δ-family of ionotropic glutamate receptors. GluD1 does not form AMPA or NMDA glutamate receptors. It acts like an adhesion molecule by linking the postsynaptic and presynaptic compartments, preferentially inducing the inhibitory presynaptic differentiation of cortical neurons. Our results demonstrate that GRID1 expression is downregulated in both MECP2- and CDKL5-mutated iPS cells and upregulated in neuronal precursors and mature neurons. These data provide novel insights into disease pathophysiology and identify possible new targets for therapeutic treatment of Rett syndrome. PMID:24916645

  1. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

    PubMed

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

    2011-11-24

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

  2. Identification of three subgroups of B cell chronic lymphocytic leukemia based upon mutations of BCL-6 and IgV genes.

    PubMed

    Capello, D; Fais, F; Vivenza, D; Migliaretti, G; Chiorazzi, N; Gaidano, G; Ferrarini, M

    2000-05-01

    Although B cell chronic lymphocytic leukemia (B-CLL) has been traditionally viewed as a tumor of virgin B cells, this notion has been recently questioned by data suggesting that a fraction of B-CLL derives from antigen experienced B cells. In order to further clarify the histogenetic derivation of this lymphoproliferation, we have analyzed the DNA sequences of the 5' non-coding region of BCL-6 proto-oncogene in 28 cases of B-CLL. Mutations of BCL-6 proto-oncogene, a zinc finger transcription factor implicated in lymphoma development, represent a histogenetic marker of B cell transit through the germinal center (GC) and occur frequently in B cell malignancies derived from GC or post-GC B cells. For comparison, the same tumor panel was analyzed for somatic mutations of the rearranged immunoglobulin variable (IgV) genes, which are known to be acquired at the time of B cell transit through the GC. Sequence analyses of BCL-6 and IgV genes allowed the definition of three groups of B-CLL. Group I B-CLL displayed mutations of both BCL-6 and IgV genes (10/28; 36%). Group II B-CLL displayed mutated IgV genes, but a germline BCL-6 gene (5/28; 18%). Finally, group III B-CLL included the remaining cases (13/28; 46%) that were characterized by the absence of somatic mutations of both BCL-6 and IgV genes. Overall, the distribution of BCL-6 and IgV mutations in B-CLL reinforce the notion that this leukemia is histogenetically heterogeneous and that a substantial subgroup of these lymphoproliferations derives from post-germinal center B cells.

  3. Primary cutaneous B-cell lymphoma is associated with somatically hypermutated immunoglobulin variable genes and frequent use of VH1-69 and VH4-59 segments.

    PubMed

    Perez, M; Pacchiarotti, A; Frontani, M; Pescarmona, E; Caprini, E; Lombardo, G A; Russo, G; Faraggiana, T

    2010-03-01

    Accurate assessment of the somatic mutational status of clonal immunoglobulin variable region (IgV) genes is relevant in elucidating tumour cell origin in B-cell lymphoma; virgin B cells bear unmutated IgV genes, while germinal centre and postfollicular B cells carry mutated IgV genes. Furthermore, biases in the IgV repertoire and distribution pattern of somatic mutations indicate a possible antigen role in the pathogenesis of B-cell malignancies. This work investigates the cellular origin and antigenic selection in primary cutaneous B-cell lymphoma (PCBCL). We analysed the nucleotide sequence of clonal IgV heavy-chain gene (IgVH) rearrangements in 51 cases of PCBCL (25 follicle centre, 19 marginal zone and seven diffuse large B-cell lymphoma, leg-type) and compared IgVH sequences with their closest germline segment in the GenBank database. Molecular data were then correlated with histopathological features. We showed that all but one of the 51 IgVH sequences analysed exhibited extensive somatic hypermutations. The detected mutation rate ranged from 1.6% to 21%, with a median rate of 9.8% and was independent of PCBCL histotype. Calculation of antigen-selection pressure showed that 39% of the mutated IgVH genes displayed a number of replacement mutations and silent mutations in a pattern consistent with antigenic selection. Furthermore, two segments, VH1-69 (12%) and VH4-59 (14%), were preferentially used in our case series. Data indicate that neoplastic B cells of PBCBL have experienced germinal centre reaction and also suggest that the involvement of IgVH genes is not entirely random in PCBCL and that common antigen epitopes could be pathologically relevant in cutaneous lymphomagenesis.

  4. Construction and Characterization of Human Mammary Epithelial Cell Lines Containing Mutations in the p53 or BRCA1 Genes

    DTIC Science & Technology

    1999-01-01

    development of breast cancers. To study the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway, we have...the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway. The consequences of transduction of these...proposed three approaches for constructing p53-deficient cells; i.e., by mutating the p53 gene directly, by abrogating the protein’s normal cellular

  5. CRISPR/Cas9-mediated ASXL1 mutations in U937 cells disrupt myeloid differentiation

    PubMed Central

    Wu, Zhi-Jie; Zhao, Xin; Banaszak, Lauren G.; Gutierrez-Rodrigues, Fernanda; Keyvanfar, Keyvan; Gao, Shou-Guo; Raffo, Diego Quinones; Kajigaya, Sachiko; Young, Neal S.

    2018-01-01

    Additional sex combs-like 1 (ASXL1) is a well-known tumor suppressor gene and epigenetic modifier. ASXL1 mutations are frequent in myeloid malignances; these mutations are risk factors for the development of myelodysplasia and also appear as small clones during normal aging. ASXL1 appears to act as an epigenetic regulator of cell survival and myeloid differentiation; however, the molecular mechanisms underlying the malignant transformation of cells with ASXL1 mutations are not well defined. Using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein-9 nuclease (Cas9) genome editing, heterozygous and homozygous ASXL1 mutations were introduced into human U937 leukemic cells. Comparable cell growth and cell cycle progression were observed between wild-type (WT) and ASXL1-mutated U937 cells. Drug-induced cytotoxicity, as measured by growth inhibition and apoptosis in the presence of the cell-cycle active agent 5-fluorouracil, was variable among the mutated clones but was not significantly different from WT cells. In addition, ASXL1-mutated cells exhibited defects in monocyte/macrophage differentiation. Transcriptome analysis revealed that ASXL1 mutations altered differentiation of U937 cells by disturbing genes involved in myeloid differentiation, including cytochrome B-245 β chain and C-type lectin domain family 5, member A. Dysregulation of numerous gene sets associated with cell death and survival were also observed in ASXL1-mutated cells. These data provide evidence regarding the underlying molecular mechanisms induced by mutated ASXL1 in leukemogenesis. PMID:29532865

  6. Mutation of Breast Cancer Cell Genomic DNA by APOBEC3B

    DTIC Science & Technology

    2012-09-01

    down Yes, A3B expression increases the steady-state level of genomic uracil Fig. 2a-2c 2) Can A3B mutate a target gene to escape drug...somatic mutation in human cancer genomes. Nature 446, 153-158 (2007). 10 2 Jones, S. et al. Frequent mutations of chromatin remodeling gene ARID1A in...processes molding the genomes of 21 breast cancers. Cell 149, 979-993 (2012). 9 Stephens, P. J. et al. The landscape of cancer genes and mutational

  7. BGJ398 in Treating Patients With FGFR Positive Recurrent Head and Neck Cancer

    ClinicalTrials.gov

    2018-06-05

    FGFR Gene Amplification; FGFR1 Gene Amplification; FGFR2 Gene Amplification; FGFR2 Gene Mutation; FGFR3 Gene Mutation; Head and Neck Squamous Cell Carcinoma; Human Papillomavirus Infection; Recurrent Head and Neck Carcinoma; Recurrent Nasopharynx Carcinoma; Recurrent Oropharyngeal Squamous Cell Carcinoma

  8. Ancient genes establish stress-induced mutation as a hallmark of cancer.

    PubMed

    Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

    2017-01-01

    Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to stress that evolved among prokaryotes was co-opted to maintain diversity in the germline and immune system, while the original phenotype is restored in cancer. Reversion to a stress-induced mutational response is a hallmark of cancer that allows for effectively searching "protected" genome space where genes causally implicated in cancer are located and underlies the high adaptive potential and concomitant therapeutic resistance that is characteristic of cancer.

  9. Ancient genes establish stress-induced mutation as a hallmark of cancer

    PubMed Central

    Orr, Adam J.; Miočević, Milica; Lineweaver, Charles H.; Davies, Paul

    2017-01-01

    Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to stress that evolved among prokaryotes was co-opted to maintain diversity in the germline and immune system, while the original phenotype is restored in cancer. Reversion to a stress-induced mutational response is a hallmark of cancer that allows for effectively searching “protected” genome space where genes causally implicated in cancer are located and underlies the high adaptive potential and concomitant therapeutic resistance that is characteristic of cancer. PMID:28441401

  10. Olaparib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With Defects in DNA Damage Repair Genes (A Pediatric MATCH Treatment Trial)

    ClinicalTrials.gov

    2018-06-25

    Advanced Malignant Solid Neoplasm; Ann Arbor Stage III Childhood Non-Hodgkin Lymphoma; Ann Arbor Stage IV Childhood Non-Hodgkin Lymphoma; Deleterious ATM Gene Mutation; Deleterious BRCA1 Gene Mutation; Deleterious BRCA2 Gene Mutation; Deleterious RAD51C Gene Mutation; Deleterious RAD51D Gene Mutation; Histiocytosis; Low Grade Glioma; Malignant Glioma; Recurrent Childhood Central Nervous System Neoplasm; Recurrent Childhood Ependymoma; Recurrent Childhood Malignant Germ Cell Tumor; Recurrent Childhood Non-Hodgkin Lymphoma; Recurrent Childhood Rhabdomyosarcoma; Recurrent Childhood Soft Tissue Sarcoma; Recurrent Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Recurrent Glioma; Recurrent Hepatoblastoma; Recurrent Langerhans Cell Histiocytosis; Recurrent Malignant Solid Neoplasm; Recurrent Medulloblastoma; Recurrent Neuroblastoma; Recurrent Osteosarcoma; Refractory Central Nervous System Neoplasm; Refractory Langerhans Cell Histiocytosis; Refractory Malignant Solid Neoplasm; Refractory Neuroblastoma; Refractory Non-Hodgkin Lymphoma; Rhabdoid Tumor; Wilms Tumor

  11. TP53 mutation-correlated genes predict the risk of tumor relapse and identify MPS1 as a potential therapeutic kinase in TP53-mutated breast cancers.

    PubMed

    Győrffy, Balázs; Bottai, Giulia; Lehmann-Che, Jacqueline; Kéri, György; Orfi, László; Iwamoto, Takayuki; Desmedt, Christine; Bianchini, Giampaolo; Turner, Nicholas C; de Thè, Hugues; André, Fabrice; Sotiriou, Christos; Hortobagyi, Gabriel N; Di Leo, Angelo; Pusztai, Lajos; Santarpia, Libero

    2014-05-01

    Breast cancers (BC) carry a complex set of gene mutations that can influence their gene expression and clinical behavior. We aimed to identify genes driven by the TP53 mutation status and assess their clinical relevance in estrogen receptor (ER)-positive and ER-negative BC, and their potential as targets for patients with TP53 mutated tumors. Separate ROC analyses of each gene expression according to TP53 mutation status were performed. The prognostic value of genes with the highest AUC were assessed in a large dataset of untreated, and neoadjuvant chemotherapy treated patients. The mitotic checkpoint gene MPS1 was the most significant gene correlated with TP53 status, and the most significant prognostic marker in all ER-positive BC datasets. MPS1 retained its prognostic value independently from the type of treatment administered. The biological functions of MPS1 were investigated in different BC cell lines. We also assessed the effects of a potent small molecule inhibitor of MPS1, SP600125, alone and in combination with chemotherapy. Consistent with the gene expression profiling and siRNA assays, the inhibition of MPS1 by SP600125 led to a reduction in cell viability and a significant increase in cell death, selectively in TP53-mutated BC cells. Furthermore, the chemical inhibition of MPS1 sensitized BC cells to conventional chemotherapy, particularly taxanes. Our results collectively demonstrate that TP53-correlated kinase MPS1, is a potential therapeutic target in BC patients with TP53 mutated tumors, and that SP600125 warrant further development in future clinical trials. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  12. PIK3CA gene mutations in Northwest Chinese esophageal squamous cell carcinoma

    PubMed Central

    Liu, Shi-Yuan; Chen, Wei; Chughtai, Ehtesham Annait; Qiao, Zhe; Jiang, Jian-Tao; Li, Shao-Min; Zhang, Wei; Zhang, Jin

    2017-01-01

    AIM To evaluate PIK3CA gene mutational status in Northwest Chinese esophageal squamous cell carcinoma (ESCC) patients, and examine the associations of PIK3CA gene mutations with clinicopathological characteristics and clinical outcome. METHODS A total of 210 patients with ESCC who underwent curative resection were enrolled in this study. Pyrosequencing was applied to investigate mutations in exons 9 and 20 of PIK3CA gene in 210 Northwest Chinese ESCCs. The associations of PIK3CA gene mutations with clinicopathological characteristics and clinical outcome were examined. RESULTS PIK3CA gene mutations in exon 9 were detected in 48 cases (22.9%) of a non-biased database of 210 curatively resected Northwest Chinese ESCCs. PIK3CA gene mutations were not associated with sex, tobacco use, alcohol use, tumor location, stage, or local recurrence. When compared with wild-type PIK3CA gene cases, patients with PIK3CA gene mutations in exons 9 experienced significantly better disease-free survival and overall survival rates. CONCLUSION The results of this study suggest that PIK3CA gene mutations could act as a prognostic biomarker in Northwest Chinese ESCC patients. PMID:28465643

  13. B cells in chronically hepatitis C virus-infected individuals lack a virus-induced mutation signature in the TP53, CTNNB1, and BCL6 genes.

    PubMed

    Tucci, Felicia Anna; Broering, Ruth; Johansson, Patricia; Schlaak, Joerg F; Küppers, Ralf

    2013-03-01

    Hepatitis C virus (HCV) is considered to have a causative role in B-cell lymphoproliferative diseases, including B-cell lymphomas, in chronic virus carriers. Previous data from in vitro HCV-infected B-cell lines and peripheral blood mononuclear cells from HCV-positive individuals suggested that HCV might have a direct mutagenic effect on B cells, inducing mutations in the tumor suppressor gene TP53 and the proto-oncogenes BCL6 and CTNNB1 (β-catenin). To clarify whether HCV indeed has a mutagenic effect on B cells in vivo, we analyzed naive and memory B cells from the peripheral blood of four chronic HCV carriers and intrahepatic B cells from the livers of two HCV-positive patients for mutations in the three reported target genes. However, no mutations were found in the TP53 and CTNNB1 genes. For BCL6, which is a physiological target of the somatic hypermutation process in germinal-center B cells, the mutation levels identified were not higher than those reported in the respective B-cell subsets in healthy individuals. Hence, we conclude that in chronic HCV carriers, the virus does not generally induce mutations in the cancer-related genes TP53, CTNNB1, and BCL6 in B cells. Based on these findings, new targets have to be investigated as potential mediators of HCV-associated B-cell lymphomagenesis.

  14. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia

    PubMed Central

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.

    2011-01-01

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML. PMID:21989985

  15. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    PubMed

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  16. The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development.

    PubMed

    Ortega-Molina, Ana; Boss, Isaac W; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A; Gascoyne, Randy D; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M; Wendel, Hans-Guido

    2015-10-01

    The gene encoding the lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma and diffuse large B cell lymphoma; however, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center involution and impedes B cell differentiation and class switch recombination. Integrative genomic analyses indicate that KMT2D affects methylation of lysine 4 on histone H3 (H3K4) and expression of a set of genes, including those in the CD40, JAK-STAT, Toll-like receptor and B cell receptor signaling pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3 and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell-activating pathways.

  17. CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

    PubMed

    He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

    2016-01-01

    The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

  18. Frequent mutation of histone-modifying genes in non-Hodgkin lymphoma | Office of Cancer Genomics

    Cancer.gov

    In a recent Nature article, Morin et al. uncovered a novel role for chromatin modification in driving the progression of two non-Hodgkin lymphomas (NHLs), follicular lymphoma and diffuse large B-cell lymphoma. Through DNA and RNA sequencing of 117 tumor samples and 10 assorted cell lines, the authors identified and validated 109 genes with multiple mutations in these B-cell NHLs. Of the 109 genes, several genes not previously linked to lymphoma demonstrated positive selection for mutation including two genes involved in histone modification, MLL2 and MEF2B.

  19. Age-related mutations associated with clonal hematopoietic expansion and malignancies.

    PubMed

    Xie, Mingchao; Lu, Charles; Wang, Jiayin; McLellan, Michael D; Johnson, Kimberly J; Wendl, Michael C; McMichael, Joshua F; Schmidt, Heather K; Yellapantula, Venkata; Miller, Christopher A; Ozenberger, Bradley A; Welch, John S; Link, Daniel C; Walter, Matthew J; Mardis, Elaine R; Dipersio, John F; Chen, Feng; Wilson, Richard K; Ley, Timothy J; Ding, Li

    2014-12-01

    Several genetic alterations characteristic of leukemia and lymphoma have been detected in the blood of individuals without apparent hematological malignancies. The Cancer Genome Atlas (TCGA) provides a unique resource for comprehensive discovery of mutations and genes in blood that may contribute to the clonal expansion of hematopoietic stem/progenitor cells. Here, we analyzed blood-derived sequence data from 2,728 individuals from TCGA and discovered 77 blood-specific mutations in cancer-associated genes, the majority being associated with advanced age. Remarkably, 83% of these mutations were from 19 leukemia and/or lymphoma-associated genes, and nine were recurrently mutated (DNMT3A, TET2, JAK2, ASXL1, TP53, GNAS, PPM1D, BCORL1 and SF3B1). We identified 14 additional mutations in a very small fraction of blood cells, possibly representing the earliest stages of clonal expansion in hematopoietic stem cells. Comparison of these findings to mutations in hematological malignancies identified several recurrently mutated genes that may be disease initiators. Our analyses show that the blood cells of more than 2% of individuals (5-6% of people older than 70 years) contain mutations that may represent premalignant events that cause clonal hematopoietic expansion.

  20. Mutations in a gene encoding the. cap alpha. subunit of a Saccharomyces cerevisiae G protein indicate a role in mating pheromone signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jahng, K.Y.; Ferguson, J.; Reed, S.I.

    1988-06-01

    Mutations which allowed conjugation by Saccharomyces cerevisiae cells lacking a mating pheromone receptor gene were selected. One of the genes defined by such mutations was isolated from a yeast genomic library by complementation of a temperature-sensitive mutation and is identically to the gene GPA1 (also known as SCG1), recently shown to be highly homologous to gene encoding the ..cap alpha.. subunits of mammalian G proteins. Physiological analysis of temperature-sensitive gpal mutations suggests that the encoded G protein is involved in signaling in response to mating pheromones. Mutational disruption of G-protein activity causes cell-cycle arrest in G/sub 1/, deposition of mating-specificmore » cell surface aggultinins, and induction of pheromone-specific mRNa, all of which are responses to pheromone in wild-type cells. In addition, mutants can conjugate without the benefit of mating pheromone or pheromone receptor. A model is presented where the activated G protein has a negative impact on a constitutive signal which normally keeps the pheromone response repressed.« less

  1. Confirmation of Pig-a mutation in flow cytometry-identified CD48-deficient T-lymphocytes from F344 rats.

    PubMed

    Revollo, Javier; Pearce, Mason G; Petibone, Dayton M; Mittelstaedt, Roberta A; Dobrovolsky, Vasily N

    2015-05-01

    The Pig-a assay is used for monitoring somatic cell mutation in laboratory animals and humans. The assay detects haematopoietic cells deficient in glycosylphosphatidylinositol (GPI)-anchored protein surface markers using flow cytometry. However, given that synthesis of the protein markers (and the expression of their genes) is independent of the expression of the X-linked Pig-a gene and the function of its enzyme product, the deficiency of markers at the surface of the cells may be caused by a number of events (e.g. by mutation or epigenetic silencing in the marker gene itself or in any of about two dozen autosomal genes involved in the synthesis of GPI). Here we provide direct evidence that the deficiency of the GPI-anchored surface marker CD48 in rat T-cells is accompanied by mutation in the endogenous X-linked Pig-a gene. We treated male F344 rats with N-ethyl-N-nitrosourea (ENU), and established colonies from flow cytometry-identified and sorted CD48-deficient spleen T-lymphocytes. Molecular analysis confirmed that the expanded sorted cells have mutations in the Pig-a gene. The spectrum of Pig-a mutation in our model was consistent with the spectrum of ENU-induced mutation determined in other in vivo models, mostly base-pair substitutions at A:T with the mutated T on the non-transcribed strand of Pig-a genomic DNA. We also used next generation sequencing to derive a similar mutational spectrum from a pool of 64 clones developed from flow-sorted CD48-deficient lymphocytes. Our findings confirm that Pig-a assays detect what they are designed to detect-gene mutation in the Pig-a gene. © The Author 2015. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Generation of gene-targeted mice using embryonic stem cells derived from a transgenic mouse model of Alzheimer's disease.

    PubMed

    Yamamoto, Satoshi; Ooshima, Yuki; Nakata, Mitsugu; Yano, Takashi; Matsuoka, Kunio; Watanabe, Sayuri; Maeda, Ryouta; Takahashi, Hideki; Takeyama, Michiyasu; Matsumoto, Yoshio; Hashimoto, Tadatoshi

    2013-06-01

    Gene-targeting technology using mouse embryonic stem (ES) cells has become the "gold standard" for analyzing gene functions and producing disease models. Recently, genetically modified mice with multiple mutations have increasingly been produced to study the interaction between proteins and polygenic diseases. However, introduction of an additional mutation into mice already harboring several mutations by conventional natural crossbreeding is an extremely time- and labor-intensive process. Moreover, to do so in mice with a complex genetic background, several years may be required if the genetic background is to be retained. Establishing ES cells from multiple-mutant mice, or disease-model mice with a complex genetic background, would offer a possible solution. Here, we report the establishment and characterization of novel ES cell lines from a mouse model of Alzheimer's disease (3xTg-AD mouse, Oddo et al. in Neuron 39:409-421, 2003) harboring 3 mutated genes (APPswe, TauP301L, and PS1M146V) and a complex genetic background. Thirty blastocysts were cultured and 15 stable ES cell lines (male: 11; female: 4) obtained. By injecting these ES cells into diploid or tetraploid blastocysts, we generated germline-competent chimeras. Subsequently, we confirmed that F1 mice derived from these animals showed similar biochemical and behavioral characteristics to the original 3xTg-AD mice. Furthermore, we introduced a gene-targeting vector into the ES cells and successfully obtained gene-targeted ES cells, which were then used to generate knockout mice for the targeted gene. These results suggest that the present methodology is effective for introducing an additional mutation into mice already harboring multiple mutated genes and/or a complex genetic background.

  3. ZAP-70 compared with immunoglobulin heavy-chain gene mutation status as a predictor of disease progression in chronic lymphocytic leukemia.

    PubMed

    Rassenti, Laura Z; Huynh, Lang; Toy, Tracy L; Chen, Liguang; Keating, Michael J; Gribben, John G; Neuberg, Donna S; Flinn, Ian W; Rai, Kanti R; Byrd, John C; Kay, Neil E; Greaves, Andrew; Weiss, Arthur; Kipps, Thomas J

    2004-08-26

    The course of chronic lymphocytic leukemia (CLL) is variable. In aggressive disease, the CLL cells usually express an unmutated immunoglobulin heavy-chain variable-region gene (IgV(H)) and the 70-kD zeta-associated protein (ZAP-70), whereas in indolent disease, the CLL cells usually express mutated IgV(H) but lack expression of ZAP-70. We evaluated the CLL B cells from 307 patients with CLL for ZAP-70 and mutations in the rearranged IgV(H) gene. We then investigated the association between the results and the time from diagnosis to initial therapy. We found that ZAP-70 was expressed above a defined threshold level in 117 of the 164 patients with an unmutated IgV(H) gene (71 percent), but in only 24 of the 143 patients with a mutated IgV(H) gene (17 percent, P<0.001). Among the patients with ZAP-70-positive CLL cells, the median time from diagnosis to initial therapy in those who had an unmutated IgV(H) gene (2.8 years) was not significantly different from the median time in those who had a mutated IgV(H) gene (4.2 years, P=0.07). However, the median time from diagnosis to initial treatment in each of these groups was significantly shorter than the time in patients with ZAP-70-negative CLL cells who had either mutated or unmutated IgV(H) genes (P<0.001). The median time from diagnosis to initial therapy among patients who did not have ZAP-70 was 11.0 years in those with a mutated IgV(H) gene and 7.1 years in those with an unmutated IgV(H) gene (P<0.001). Although the presence of an unmutated IgV(H) gene is strongly associated with the expression of ZAP-70, ZAP-70 is a stronger predictor of the need for treatment in B-cell CLL. Copyright 2004 Massachusetts Medical Society

  4. Targeted sequencing identifies associations between IL7R-JAK mutations and epigenetic modulators in T-cell acute lymphoblastic leukemia

    PubMed Central

    Vicente, Carmen; Schwab, Claire; Broux, Michaël; Geerdens, Ellen; Degryse, Sandrine; Demeyer, Sofie; Lahortiga, Idoya; Elliott, Alannah; Chilton, Lucy; La Starza, Roberta; Mecucci, Cristina; Vandenberghe, Peter; Goulden, Nicholas; Vora, Ajay; Moorman, Anthony V.; Soulier, Jean; Harrison, Christine J.; Clappier, Emmanuelle; Cools, Jan

    2015-01-01

    T-cell acute lymphoblastic leukemia is caused by the accumulation of multiple oncogenic lesions, including chromosomal rearrangements and mutations. To determine the frequency and co-occurrence of mutations in T-cell acute lymphoblastic leukemia, we performed targeted re-sequencing of 115 genes across 155 diagnostic samples (44 adult and 111 childhood cases). NOTCH1 and CDKN2A/B were mutated/deleted in more than half of the cases, while an additional 37 genes were mutated/deleted in 4% to 20% of cases. We found that IL7R-JAK pathway genes were mutated in 27.7% of cases, with JAK3 mutations being the most frequent event in this group. Copy number variations were also detected, including deletions of CREBBP or CTCF and duplication of MYB. FLT3 mutations were rare, but a novel extracellular mutation in FLT3 was detected and confirmed to be transforming. Furthermore, we identified complex patterns of pairwise associations, including a significant association between mutations in IL7R-JAK genes and epigenetic regulators (WT1, PRC2, PHF6). Our analyses showed that IL7R-JAK genetic lesions did not confer adverse prognosis in T-cell acute lymphoblastic leukemia cases enrolled in the UK ALL2003 trial. Overall, these results identify interconnections between the T-cell acute lymphoblastic leukemia genome and disease biology, and suggest a potential clinical application for JAK inhibitors in a significant proportion of patients with T-cell acute lymphoblastic leukemia. PMID:26206799

  5. Effect of the Molecular Nature of Mutation on the Efficiency of Intrachromosomal Gene Conversion in Mouse Cells

    PubMed Central

    Letsou, Anthea; Liskay, R. Michael

    1987-01-01

    With the intent of further exploring the nature of gene conversion in mammalian cells, we systematically addressed the effects of the molecular nature of mutation on the efficiency of intrachromosomal gene conversion in cultured mouse cells. Comparison of conversion rates revealed that all mutations studied were suitable substrates for gene conversion; however, we observed that the rates at which different mutations converted to wild-type could differ by two orders of magnitude. Differences in conversion rates were correlated with the molecular nature of the mutations. In general, rates of conversion decreased with increasing size of the molecular lesions. In comparisons of conversion rates for single base pair insertions and deletions we detected a genotype-directed path for conversion, by which an insertion was converted to wild-type three to four times more efficiently than was a deletion which maps to the same site. The data are discussed in relation to current theories of gene conversion, and are consistent with the idea that gene conversion in mammalian cells can result from repair of heteroduplex DNA (hDNA) intermediates. PMID:2828159

  6. The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development

    PubMed Central

    Ortega-Molina, Ana; Boss, Isaac W.; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W.; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A.; Gascoyne, Randy D.; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M.; Wendel, Hans-Guido

    2015-01-01

    The lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma (FL) and diffuse large B cell lymphoma (DLBCL). However, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center (GC) involution, impedes B cell differentiation and class switch recombination (CSR). Integrative genomic analyses indicate that KMT2D affects H3K4 methylation and expression of a specific set of genes including those in the CD40, JAK-STAT, Toll-like receptor, and B cell receptor pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3, and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell activating pathways. PMID:26366710

  7. Mutations in PRPF31 Inhibit Pre-mRNA Splicing of Rhodopsin Gene and Cause Apoptosis of Retinal Cells

    PubMed Central

    Yuan, Liya; Kawada, Mariko; Havlioglu, Necat; Tang, Hao; Wu, Jane Y.

    2007-01-01

    Mutations in human PRPF31 gene have been identified in patients with autosomal dominant retinitis pigmentosa (adRP). To begin to understand mechanisms by which defects in this general splicing factor cause retinal degeneration, we examined the relationship between PRPF31 and pre-mRNA splicing of photoreceptor-specific genes. We used a specific anti-PRPF31 antibody to immunoprecipitate splicing complexes from retinal cells and identified the transcript of rhodopsin gene (RHO) among RNA species associated with PRPF31-containing complexes. Mutant PRPF31 proteins significantly inhibited pre-mRNA splicing of intron 3 in RHO gene. In primary retinal cell cultures, expression of the mutant PRPF31 proteins reduced rhodopsin expression and caused apoptosis of rhodopsin-positive retinal cells. This primary retinal culture assay provides an in vitro model to study photoreceptor cell death caused by PRPF31 mutations. Our results demonstrate that mutations in PRPF31 gene affect RHO pre-mRNA splicing and reveal a link between PRPF31 and RHO, two major adRP genes. PMID:15659613

  8. Genetics Home Reference: Proteus syndrome

    MedlinePlus

    ... genetic mutation is known as mosaicism . The AKT1 gene helps regulate cell growth and division (proliferation) and cell death. A mutation in this gene disrupts a cell's ability to regulate its own growth, allowing it to grow and divide abnormally. Increased ...

  9. Multiple mutant clones in blood rarely coexist

    NASA Astrophysics Data System (ADS)

    Dingli, David; Pacheco, Jorge M.; Traulsen, Arne

    2008-02-01

    Leukemias arise due to mutations in the genome of hematopoietic (blood) cells. Hematopoiesis has a multicompartment architecture, with cells exhibiting different rates of replication and differentiation. At the root of this process, one finds a small number of stem cells, and hence the description of the mutation-selection dynamics of blood cells calls for a stochastic approach. We use stochastic dynamics to investigate to which extent acquired hematopoietic disorders are associated with mutations of single or multiple genes within developing blood cells. Our analysis considers the appearance of mutations both in the stem cell compartment as well as in more committed compartments. We conclude that in the absence of genomic instability, acquired hematopoietic disorders due to mutations in multiple genes are most likely very rare events, as multiple mutations typically require much longer development times compared to those associated with a single mutation.

  10. Mutation spectrum of MSH3-deficient HHUA/chr.2 cells reflects in vivo activity of the MSH3 gene product in mismatch repair.

    PubMed

    Tauchi, H; Komatsu, K; Ishizaki, K; Yatagai, F; Kato, T

    2000-02-14

    The endometrial tumor cell line HHUA carries mutations in two mismatch repair (MMR) genes MSH3 and MSH6. We have established an MSH3-deficient HHUA/chr.2 cell line by introducing human chromosome 2, which carries wild-type MSH6 and MSH2 genes, to HHUA cells. Introduction of chromosome 2 to HHUA cells partially restored G:G MMR activity to the cell extract and reduced the frequency of mutation at the hypoxanthine-guanine phosphoribosyltransferase (hprt*) locus to about 3% that of the parental HHUA cells, which is five-fold the frequency in MMR-proficient cells, indicating that the residual mutator activity in HHUA/chr.2 is due to an MSH3-deficiency in these cells. The spectrum of mutations occurring at the HPRT locus of HHUA/chr.2 was determined with 71 spontaneous 6TG(r) clones. Base substitutions and +/-1 bp frameshifts were the major mutational events constituting, respectively, 54% and 42% of the total mutations, and more than 70% of them occurred at A:T sites. A possible explanation for the apparent bias of mutations to A:T sites in HHUA/chr.2 is haploinsufficiency of the MSH6 gene on the transferred chromosome 2. Comparison of the mutation spectra of HHUA/chr.2 with that of the MSH6-deficient HCT-15 cell line [S. Ohzeki, A. Tachibana, K. Tatsumi, T. Kato, Carcinogenesis 18 (1997) 1127-1133.] suggests that in vivo the MutSalpha (MSH2:MSH6) efficiently repairs both mismatch and unpaired extrahelical bases, whereas MutSbeta (MSH2:MSH3) efficiently repairs extrahelical bases and repairs mismatch bases to a limited extent.

  11. ASXL1 mutation correction by CRISPR/Cas9 restores gene function in leukemia cells and increases survival in mouse xenografts

    PubMed Central

    Valletta, Simona; Dolatshad, Hamid; Bartenstein, Matthias; Yip, Bon Ham; Bello, Erica; Gordon, Shanisha; Yu, Yiting; Shaw, Jacqueline; Roy, Swagata; Scifo, Laura; Schuh, Anna; Pellagatti, Andrea; Fulga, Tudor A.; Verma, Amit; Boultwood, Jacqueline

    2015-01-01

    Recurrent somatic mutations of the epigenetic modifier and tumor suppressor ASXL1 are common in myeloid malignancies, including chronic myeloid leukemia (CML), and are associated with poor clinical outcome. CRISPR/Cas9 has recently emerged as a powerful and versatile genome editing tool for genome engineering in various species. We have used the CRISPR/Cas9 system to correct the ASXL1 homozygous nonsense mutation present in the CML cell line KBM5, which lacks ASXL1 protein expression. CRISPR/Cas9-mediated ASXL1 homozygous correction resulted in protein re-expression with restored normal function, including down-regulation of Polycomb repressive complex 2 target genes. Significantly reduced cell growth and increased myeloid differentiation were observed in ASXL1 mutation-corrected cells, providing new insights into the role of ASXL1 in human myeloid cell differentiation. Mice xenografted with mutation-corrected KBM5 cells showed significantly longer survival than uncorrected xenografts. These results show that the sole correction of a driver mutation in leukemia cells increases survival in vivo in mice. This study provides proof-of-concept for driver gene mutation correction via CRISPR/Cas9 technology in human leukemia cells and presents a strategy to illuminate the impact of oncogenic mutations on cellular function and survival. PMID:26623729

  12. ASXL1 mutation correction by CRISPR/Cas9 restores gene function in leukemia cells and increases survival in mouse xenografts.

    PubMed

    Valletta, Simona; Dolatshad, Hamid; Bartenstein, Matthias; Yip, Bon Ham; Bello, Erica; Gordon, Shanisha; Yu, Yiting; Shaw, Jacqueline; Roy, Swagata; Scifo, Laura; Schuh, Anna; Pellagatti, Andrea; Fulga, Tudor A; Verma, Amit; Boultwood, Jacqueline

    2015-12-29

    Recurrent somatic mutations of the epigenetic modifier and tumor suppressor ASXL1 are common in myeloid malignancies, including chronic myeloid leukemia (CML), and are associated with poor clinical outcome. CRISPR/Cas9 has recently emerged as a powerful and versatile genome editing tool for genome engineering in various species. We have used the CRISPR/Cas9 system to correct the ASXL1 homozygous nonsense mutation present in the CML cell line KBM5, which lacks ASXL1 protein expression. CRISPR/Cas9-mediated ASXL1 homozygous correction resulted in protein re-expression with restored normal function, including down-regulation of Polycomb repressive complex 2 target genes. Significantly reduced cell growth and increased myeloid differentiation were observed in ASXL1 mutation-corrected cells, providing new insights into the role of ASXL1 in human myeloid cell differentiation. Mice xenografted with mutation-corrected KBM5 cells showed significantly longer survival than uncorrected xenografts. These results show that the sole correction of a driver mutation in leukemia cells increases survival in vivo in mice. This study provides proof-of-concept for driver gene mutation correction via CRISPR/Cas9 technology in human leukemia cells and presents a strategy to illuminate the impact of oncogenic mutations on cellular function and survival.

  13. AIP mutations impair AhR signaling in pituitary adenoma patients fibroblasts and in GH3 cells.

    PubMed

    Lecoq, Anne-Lise; Viengchareun, Say; Hage, Mirella; Bouligand, Jérôme; Young, Jacques; Boutron, Audrey; Zizzari, Philippe; Lombès, Marc; Chanson, Philippe; Kamenický, Peter

    2016-05-01

    Germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene predispose humans to pituitary adenomas through unknown molecular mechanisms. The best-known interacting partner of AIP is the aryl hydrocarbon receptor (AhR), a transcription factor that mediates the effects of xenobiotics implicated in carcinogenesis. As 75% of AIP mutations disrupt the physical and/or functional interaction with AhR, we postulated that the tumorigenic potential of AIP mutations might result from altered AhR signaling. We evaluated the impact of AIP mutations on the AhR signaling pathway, first in fibroblasts from AIP-mutated patients with pituitary adenomas, by comparison with fibroblasts from healthy subjects, then in transfected pituitary GH3 cells. The AIP protein level in mutated fibroblasts was about half of that in cells from healthy subjects, but AhR expression was unaffected. Gene expression analyses showed significant modifications in the expression of the AhR target genes CYP1B1 and AHRR in AIP-mutated fibroblasts, both before and after stimulation with the endogenous AhR ligand kynurenine. Kynurenine increased Cyp1b1 expression to a greater extent in GH3 cells overexpressing wild type compared with cells expressing mutant AIP Knockdown of endogenous Aip in these cells attenuated Cyp1b1 induction by the AhR ligand. Both mutant AIP expression and knockdown of endogenous Aip affected the kynurenine-dependent GH secretion of GH3 cells. This study of human fibroblasts bearing endogenous heterozygous AIP mutations and transfected pituitary GH3 cells shows that AIP mutations affect the AIP protein level and alter AhR transcriptional activity in a gene- and tissue-dependent manner. © 2016 Society for Endocrinology.

  14. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

    PubMed

    Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

    2015-04-23

    With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

  15. MOLECULAR ANALYSIS OF MUTATIONS INDUCED BY MUTAGENS IN THE TK GENE OF MOUSE LYMPHOMA CELLS

    EPA Science Inventory

    MOLECULAR ANALYSIS OF MUTATIONS INDUCED BY BROMATE AND N- ETHYL-N-NITROSOUREA IN THE TK GENE OF MOUSE L YMPHOMA CELLS

    The mouse lymphoma assay is widely used to identify chemical mutagens The Tk +1- gene located on an autosome in mouse lymphoma cells may recover a wide ra...

  16. Genome-Wide Mutation Avalanches Induced in Diploid Yeast Cells by a Base Analog or an APOBEC Deaminase

    PubMed Central

    Lada, Artem G.; Stepchenkova, Elena I.; Waisertreiger, Irina S. R.; Noskov, Vladimir N.; Dhar, Alok; Eudy, James D.; Boissy, Robert J.; Hirano, Masayuki; Rogozin, Igor B.; Pavlov, Youri I.

    2013-01-01

    Genetic information should be accurately transmitted from cell to cell; conversely, the adaptation in evolution and disease is fueled by mutations. In the case of cancer development, multiple genetic changes happen in somatic diploid cells. Most classic studies of the molecular mechanisms of mutagenesis have been performed in haploids. We demonstrate that the parameters of the mutation process are different in diploid cell populations. The genomes of drug-resistant mutants induced in yeast diploids by base analog 6-hydroxylaminopurine (HAP) or AID/APOBEC cytosine deaminase PmCDA1 from lamprey carried a stunning load of thousands of unselected mutations. Haploid mutants contained almost an order of magnitude fewer mutations. To explain this, we propose that the distribution of induced mutation rates in the cell population is uneven. The mutants in diploids with coincidental mutations in the two copies of the reporter gene arise from a fraction of cells that are transiently hypersensitive to the mutagenic action of a given mutagen. The progeny of such cells were never recovered in haploids due to the lethality caused by the inactivation of single-copy essential genes in cells with too many induced mutations. In diploid cells, the progeny of hypersensitive cells survived, but their genomes were saturated by heterozygous mutations. The reason for the hypermutability of cells could be transient faults of the mutation prevention pathways, like sanitization of nucleotide pools for HAP or an elevated expression of the PmCDA1 gene or the temporary inability of the destruction of the deaminase. The hypothesis on spikes of mutability may explain the sudden acquisition of multiple mutational changes during evolution and carcinogenesis. PMID:24039593

  17. PMS2 gene mutation results in DNA mismatch repair system failure in a case of adult granulosa cell tumor.

    PubMed

    Wang, Wen-Chung; Lee, Ya-Ting; Lai, Yen-Chein

    2017-03-27

    Granulosa cell tumors are rare ovarian malignancies. Their characteristics include unpredictable indolent growth with malignant potential and late recurrence. Approximately 95% are of adult type. Recent molecular studies have characterized the FOXL2 402C > G mutation in adult granulosa cell tumor. Our previous case report showed that unique FOXL2 402C > G mutation and defective DNA mismatch repair system are associated with the development of adult granulosa cell tumor. In this study, the DNA sequences of four genes, MSH2, MLH1, MSH6, and PMS2, in the DNA mismatch repair system were determined via direct sequencing to elucidate the exact mechanism for the development of this granulosa cell tumor. The results showed that two missense germline mutations, T485K and N775L, inactivate the PMS2 gene. The results of this case study indicated that although FOXL2 402C > G mutation determines the development of granulosa cell tumor, PMS2 mutation may be the initial driver of carcinogenesis. Immunohistochemistry-based tumor testing for mismatch repair gene expression may be necessary for granulosa cell tumors to determine their malignant potential or if they are part of Lynch syndrome.

  18. Identification of somatic mutations in non-small cell lung carcinomas using whole-exome sequencing

    PubMed Central

    Liu, Pengyuan; Morrison, Carl; Wang, Liang; Xiong, Donghai; Vedell, Peter; Cui, Peng; Hua, Xing; Ding, Feng; Lu, Yan; James, Michael; Ebben, John D.; Xu, Haiming; Adjei, Alex A.; Head, Karen; Andrae, Jaime W.; Tschannen, Michael R.; Jacob, Howard; Pan, Jing; Zhang, Qi; Van den Bergh, Francoise; Xiao, Haijie; Lo, Ken C.; Patel, Jigar; Richmond, Todd; Watt, Mary-Anne; Albert, Thomas; Selzer, Rebecca; Anderson, Marshall; Wang, Jiang; Wang, Yian; Starnes, Sandra; Yang, Ping; You, Ming

    2012-01-01

    Lung cancer is the leading cause of cancer-related death, with non-small cell lung cancer (NSCLC) being the predominant form of the disease. Most lung cancer is caused by the accumulation of genomic alterations due to tobacco exposure. To uncover its mutational landscape, we performed whole-exome sequencing in 31 NSCLCs and their matched normal tissue samples. We identified both common and unique mutation spectra and pathway activation in lung adenocarcinomas and squamous cell carcinomas, two major histologies in NSCLC. In addition to identifying previously known lung cancer genes (TP53, KRAS, EGFR, CDKN2A and RB1), the analysis revealed many genes not previously implicated in this malignancy. Notably, a novel gene CSMD3 was identified as the second most frequently mutated gene (next to TP53) in lung cancer. We further demonstrated that loss of CSMD3 results in increased proliferation of airway epithelial cells. The study provides unprecedented insights into mutational processes, cellular pathways and gene networks associated with lung cancer. Of potential immediate clinical relevance, several highly mutated genes identified in our study are promising druggable targets in cancer therapy including ALK, CTNNA3, DCC, MLL3, PCDHIIX, PIK3C2B, PIK3CG and ROCK2. PMID:22510280

  19. Seamless correction of the sickle cell disease mutation of the HBB gene in human induced pluripotent stem cells using TALENs.

    PubMed

    Sun, Ning; Zhao, Huimin

    2014-05-01

    Sickle cell disease (SCD) is the most common human genetic disease which is caused by a single mutation of human β-globin (HBB) gene. The lack of long-term treatment makes the development of reliable cell and gene therapies highly desirable. Disease-specific patient-derived human induced pluripotent stem cells (hiPSCs) have great potential for developing novel cell and gene therapies. With the disease-causing mutations corrected in situ, patient-derived hiPSCs can restore normal cell functions and serve as a renewable autologous cell source for the treatment of genetic disorders. Here we successfully utilized transcription activator-like effector nucleases (TALENs), a recently emerged novel genome editing tool, to correct the SCD mutation in patient-derived hiPSCs. The TALENs we have engineered are highly specific and generate minimal off-target effects. In combination with piggyBac transposon, TALEN-mediated gene targeting leaves no residual ectopic sequences at the site of correction and the corrected hiPSCs retain full pluripotency and a normal karyotype. Our study demonstrates an important first step of using TALENs for the treatment of genetic diseases such as SCD, which represents a significant advance toward hiPSC-based cell and gene therapies. © 2013 Wiley Periodicals, Inc.

  20. Effect of KCNJ5 Mutations on Gene Expression in Aldosterone-Producing Adenomas and Adrenocortical Cells

    PubMed Central

    Monticone, Silvia; Hattangady, Namita G.; Nishimoto, Koshiro; Mantero, Franco; Rubin, Beatrice; Cicala, Maria Verena; Pezzani, Raffaele; Auchus, Richard J.; Ghayee, Hans K.; Shibata, Hirotaka; Kurihara, Isao; Williams, Tracy A.; Giri, Judith G.; Bollag, Roni J.; Edwards, Michael A.; Isales, Carlos M.

    2012-01-01

    Context: Primary aldosteronism is a heterogeneous disease that includes both sporadic and familial forms. A point mutation in the KCNJ5 gene is responsible for familial hyperaldosteronism type III. Somatic mutations in KCNJ5 also occur in sporadic aldosterone producing adenomas (APA). Objective: The objective of the study was to define the effect of the KCNJ5 mutations on gene expression and aldosterone production using APA tissue and human adrenocortical cells. Methods: A microarray analysis was used to compare the transcriptome profiles of female-derived APA samples with and without KCNJ5 mutations and HAC15 adrenal cells overexpressing either mutated or wild-type KCNJ5. Real-time PCR validated a set of differentially expressed genes. Immunohistochemical staining localized the KCNJ5 expression in normal adrenals and APA. Results: We report a 38% (18 of 47) prevalence of KCNJ5 mutations in APA. KCNJ5 immunostaining was highest in the zona glomerulosa of NA and heterogeneous in APA tissue, and KCNJ5 mRNA was 4-fold higher in APA compared with normal adrenals (P < 0.05). APA with and without KCNJ5 mutations displayed slightly different gene expression patterns, notably the aldosterone synthase gene (CYP11B2) was more highly expressed in APA with KCNJ5 mutations. Overexpression of KCNJ5 mutations in HAC15 increased aldosterone production and altered expression of 36 genes by greater than 2.5-fold (P < 0.05). Real-time PCR confirmed increases in CYP11B2 and its transcriptional regulator, NR4A2. Conclusions: KCNJ5 mutations are prevalent in APA, and our data suggest that these mutations increase expression of CYP11B2 and NR4A2, thus increasing aldosterone production. PMID:22628608

  1. Mutational Analysis of Extranodal NK/T-Cell Lymphoma Using Targeted Sequencing with a Comprehensive Cancer Panel.

    PubMed

    Choi, Seungkyu; Go, Jai Hyang; Kim, Eun Kyung; Lee, Hojung; Lee, Won Mi; Cho, Chun-Sung; Han, Kyudong

    2016-09-01

    Extranodal natural killer (NK)/T-cell lymphoma, nasal type (NKTCL), is a malignant disorder of cytotoxic lymphocytes of NK or T cells. It is an aggressive neoplasm with a very poor prognosis. Although extranodal NKTCL reportedly has a strong association with Epstein-Barr virus, the molecular pathogenesis of NKTCL has been unexplored. The recent technological advancements in next-generation sequencing (NGS) have made DNA sequencing cost- and time-effective, with more reliable results. Using the Ion Proton Comprehensive Cancer Panel, we sequenced 409 cancer-related genes to identify somatic mutations in five NKTCL tissue samples. The sequencing analysis detected 25 mutations in 21 genes. Among them, KMT2D , a histone modification-related gene, was the most frequently mutated gene (four of the five cases). This result was consistent with recent NGS studies that have suggested KMT2D as a novel driver gene in NKTCL. Mutations were also found in ARID1A , a chromatin remodeling gene, and TP53 , which also recurred in recent NGS studies. We also found mutations in 18 novel candidate genes, with molecular functions that were potentially implicated in cancer development. We suggest that these genes may result in multiple oncogenic events and may be used as potential bio-markers of NKTCL in the future.

  2. A mathematical model of breast cancer development, local treatment and recurrence.

    PubMed

    Enderling, Heiko; Chaplain, Mark A J; Anderson, Alexander R A; Vaidya, Jayant S

    2007-05-21

    Cancer development is a stepwise process through which normal somatic cells acquire mutations which enable them to escape their normal function in the tissue and become self-sufficient in survival. The number of mutations depends on the patient's age, genetic susceptibility and on the exposure of the patient to carcinogens throughout their life. It is believed that in every malignancy 4-6 crucial similar mutations have to occur on cancer-related genes. These genes are classified as oncogenes and tumour suppressor genes (TSGs) which gain or lose their function respectively, after they have received one mutative hit or both of their alleles have been knocked out. With the acquisition of each of the necessary mutations the transformed cell gains a selective advantage over normal cells, and the mutation will spread throughout the tissue via clonal expansion. We present a simplified model of this mutation and expansion process, in which we assume that the loss of two TSGs is sufficient to give rise to a cancer. Our mathematical model of the stepwise development of breast cancer verifies the idea that the normal mutation rate in genes is only sufficient to give rise to a tumour within a clinically observable time if a high number of breast stem cells and TSGs exist or genetic instability is involved as a driving force of the mutation pathway. Furthermore, our model shows that if a mutation occurred in stem cells pre-puberty, and formed a field of cells with this mutation through clonal formation of the breast, it is most likely that a tumour will arise from within this area. We then apply different treatment strategies, namely surgery and adjuvant external beam radiotherapy and targeted intraoperative radiotherapy (TARGIT) and use the model to identify different sources of local recurrence and analyse their prevention.

  3. Transcriptional alterations in skin fibroblasts from Parkinson's disease patients with parkin mutations.

    PubMed

    González-Casacuberta, Ingrid; Morén, Constanza; Juárez-Flores, Diana-Luz; Esteve-Codina, Anna; Sierra, Cristina; Catalán-García, Marc; Guitart-Mampel, Mariona; Tobías, Ester; Milisenda, José César; Pont-Sunyer, Claustre; Martí, María José; Cardellach, Francesc; Tolosa, Eduard; Artuch, Rafael; Ezquerra, Mario; Fernández-Santiago, Rubén; Garrabou, Glòria

    2018-05-01

    Mutations in the parkin gene (PRKN) are the most common cause of autosomal-recessive juvenile Parkinson's disease (PD). PRKN encodes an E3 ubiquitin ligase that is involved in multiple regulatory functions including proteasomal-mediated protein turnover, mitochondrial function, mitophagy, and cell survival. However, the precise molecular events mediated by PRKN mutations in PRKN-associated PD (PRKN-PD) remain unknown. To elucidate the cellular impact of parkin mutations, we performed an RNA sequencing study in skin fibroblasts from PRKN-PD patients carrying different PRKN mutations (n = 4) and genetically unrelated healthy subjects (n = 4). We identified 343 differentially expressed genes in PRKN-PD fibroblasts. Gene ontology and canonical pathway analysis revealed enrichment of differentially expressed genes in processes such as cell adhesion, cell growth, and amino acid and folate metabolism among others. Our findings indicate that PRKN mutations are associated with large global gene expression changes as observed in fibroblasts from PRKN-PD patients and support the view of PD as a systemic disease affecting also non-neural peripheral tissues such as the skin. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. [Analysis of EML4-ALK gene fusion mutation in patients 
with non-small cell lung cancer].

    PubMed

    Wang, Xuzhou; Chen, Weisheng; Yu, Yinghao

    2015-02-01

    Non-small cell lung cancer (NSCLC) is the main type of lung cancer, and the related locus mutation detection research has become a hot direction of molecular targeted therapy, studying on gene mutation status of echinodem microtubule associated protein like 4-Anaplastic lymphoma kinase (EML4-ALK) and epidermal growth factor receptor (EGFR), detecting the sensitivity of EML4-ALK gene fusion and gene mutation of EGFR. EML4-ALK gene fusion in 85 cases of paraffin embedded tumor tissue and adjacent lung tissue was detected with the application of immunohistochemistry (IHC), Scorpions amplification refractory mutation system (Scorpions ARMS) fluorescence quantitative PCR and fluorescence in situ hybridization (FISH) technology, and EGFR gene in 18, 19, 20 and 21 exon mutation status was detected with the application of ARMS method. In 115 cases of NSCLC, IHC showed 32 cases with ALK (D5F3) expression, the expression rate was 27.8%; ARMS showed 27 cases with EML4-ALK fusion gene mutation, the mutation detection rate was 23.5%; 53 cases were detected with EGFR mutation, the mutation rate was 46%. While FISH showed 23 cases with EML4-ALK fusion gene mutation, the detection rate was 20%, slightly lower than the ARMS detection results, suggesting that ARMS more sensitive. The application of IHC, ARMS fluorescence quantitative PCR and FISH technology can make a rapid and accurate evaluation of EML4-ALK gene fusion.

  5. Erdafitinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With FGFR Mutations (A Pediatric MATCH Treatment Trial)

    ClinicalTrials.gov

    2018-06-25

    Advanced Malignant Solid Neoplasm; Ann Arbor Stage III Childhood Non-Hodgkin Lymphoma; Ann Arbor Stage IV Childhood Non-Hodgkin Lymphoma; FGFR1 Gene Mutation; FGFR2 Gene Mutation; FGFR3 Gene Mutation; FGFR4 Gene Mutation; Histiocytosis; Low Grade Glioma; Malignant Glioma; Recurrent Central Nervous System Neoplasm; Recurrent Childhood Ependymoma; Recurrent Childhood Malignant Germ Cell Tumor; Recurrent Childhood Medulloblastoma; Recurrent Childhood Non-Hodgkin Lymphoma; Recurrent Childhood Rhabdomyosarcoma; Recurrent Childhood Soft Tissue Sarcoma; Recurrent Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Recurrent Hepatoblastoma; Recurrent Langerhans Cell Histiocytosis; Recurrent Malignant Solid Neoplasm; Recurrent Neuroblastoma; Recurrent Osteosarcoma; Refractory Central Nervous System Neoplasm; Refractory Langerhans Cell Histiocytosis; Refractory Malignant Solid Neoplasm; Refractory Neuroblastoma; Refractory Non-Hodgkin Lymphoma; Rhabdoid Tumor; Stage III Soft Tissue Sarcoma AJCC v7; Stage IV Soft Tissue Sarcoma AJCC v7; Wilms Tumor

  6. [Mutations of EGFR gene and EML4-ALK fusion gene in superficial lymph node of non-small cell lung cancer].

    PubMed

    Wei, Lili; Li, Xingzhou; Yu, Zhonghe

    2015-07-14

    To explore the mutation status of epidermal growth factor receptor (EGFR) fusion gene and microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion gene in superficial lymph nodes of non-small cell lung cancer (NSCLC). The technique of fluorescent quantitative polymerase chain reaction (FQ-PCR) was employed for detecting the mutation rate of EGFR gene and EML4-ALK fusion gene for 40 cases of superficial lymph node tissue of NSCLC inpatients at General Military Hospital of Beijing PLA Command from February 2013 to November 2014. And then the correlations were analyzed between EMIA-ALK fusion gene and EGFR gene with clinical features and the clinical efficacies of targeted therapy. The mutation rate of EGFR gene was 35% (14/40) and 50% (10/20) in non-smokers and 46.7% (14/30) in adenocarcinoma patients. The mutation distribution was as follows: exon 18 (n = 1), exon 19 (n =8) and exon 21 (n =5). The mutation rate of EML4-ALK fusion gene was 2. 5% (1/40). EGFR gene mutation was predominantly present in non-smokers (P < 0. 05) and adenocarcinoma (P <0. 01) while no significant difference existed between gender, age or stage (P >0. 05). Those on a targeted therapy had a disease control rate of 93. 3%. Both EGFR gene and EMI4-ALK fusion gene may be detected in superficial lymph nodes of NSCLC patients. The mutation rate of EGFR gene is high in adenocarcinoma and non-smokers while EML4-ALK fusion gene has a low mutation rate.

  7. Exclusive mutation in epidermal growth factor receptor gene, HER-2, and KRAS, and synchronous methylation of nonsmall cell lung cancer.

    PubMed

    Suzuki, Makoto; Shigematsu, Hisayuki; Iizasa, Toshihiko; Hiroshima, Kenzo; Nakatani, Yukio; Minna, John D; Gazdar, Adi F; Fujisawa, Takehiko

    2006-05-15

    Both genetic and epigenetic changes in nonsmall cell lung cancer (NSCLC) are known to be a common event. Mutations in the epidermal growth factor receptor gene (EGFR), HER-2, and KRAS and the methylation profile of 9 genes for NSCLC were analyzed and correlated with clinical and histologic data. Thirty-nine EGFR, 4 HER-2, and 6 KRAS mutations were found in 150 NSCLC cases, with the methylation percentages of the genes ranging from 13% to 54%. Most mutations were present in adenocarcinomas, but mutations of the 3 genes were never found to be present in individual tumors. The frequency of methylation for all the genes was correlated with the Methylation Index, a reflection of the overall methylation pattern (all genes, P< or = .01), supporting the presence of the CpG island methylator phenotype (CIMP) in NSCLC. On the basis of the methylation profile, CRBP1 and CDH13 methylation were good indicators of CIMP in NSCLC, and were correlated with a poorer prognosis in adenocarcinomas. Mutations in EGFR, HER-2, and KRAS were found to be present exclusively, whereas methylation tended to be present synchronously. A comparison of mutation and methylation demonstrated that the EGFR mutation had an inverse correlation with methylation of SPARC (secreted protein acidic and rich in cysteine), an extracellular Ca2+-binding matricellular glycoprotein associated with the regulation of cell adhesion and growth, and the p16INK4A gene. The findings of the current study suggest that adenocarcinoma cases with CIMP have a poorer prognosis than adenocarcinoma cases without CIMP, and the EGFR mutation was shown to have an inverse correlation with methylation of SPARC and the p16INK4A gene in NSCLC. Copyright 2006 American Cancer Society

  8. Ineffectiveness of the presence of H-ras/p53 combination of mutations in squamous cell carcinoma cells to induce a conversion of a nontumorigenic to a tumorigenic phenotype.

    PubMed

    Lee, H; Li, D; Prior, T; Casto, B C; Weghorst, C M; Shuler, C F; Milo, G E

    1997-10-01

    Human tumor cells have properties in vitro or in surrogate hosts that are distinct from those of normal cells, such as immortality, anchorage independence, and tumor formation in nude mice. However, different cells from individual tumors may exhibit some, but not all of these features. In previous years, human tumor cell lines derived from different tumor and tissue types have been studied to determine those molecular changes that are associated with the in vitro properties listed above and with tumorigenicity in nude mice. In the present study, seven cell lines derived from human tumors were characterized for p53 and ras mutations that may occur in SCC tumor phenotypes and for tumor formation in nude mice. This investigation was designed to examine whether co-occurrence of mutated ras and p53 lead to a malignant stage in the progression process. None of the seven cell lines contained mutations in the recognized "hot spots" of the p53 tumor suppressor gene, but four had a nonsense/splice mutation in codon 126 and a mutation in codon 12 of the H-ras gene. The remaining three cell lines had p53 mutations in intron 5, in codon 193, and a missense mutation in codon 126, respectively. Four of seven cell lines were nontumorigenic; two of these cell lines contained a nonsense p53-126 mutation and mutated ras; one had a missense mutation at codon 126 but no mutated ras; the the fourth had only a p53 mutation at codon 193. Two of the nontumorigenic cell lines were converted to tumorigenicity after treatment with methyl methanesulfonate or N-methyl-N'-nitro-N-nitrosoguanidine with no apparent additional mutations in either gene. Our analysis revealed that there was a high frequency of genetic diversity and mutations in both p53 and H-ras. There was also a lack of a causal relationship in the presence of mutations in p53 and the cells' ability to exhibit a malignant potential in nude mice.

  9. LNDriver: identifying driver genes by integrating mutation and expression data based on gene-gene interaction network.

    PubMed

    Wei, Pi-Jing; Zhang, Di; Xia, Junfeng; Zheng, Chun-Hou

    2016-12-23

    Cancer is a complex disease which is characterized by the accumulation of genetic alterations during the patient's lifetime. With the development of the next-generation sequencing technology, multiple omics data, such as cancer genomic, epigenomic and transcriptomic data etc., can be measured from each individual. Correspondingly, one of the key challenges is to pinpoint functional driver mutations or pathways, which contributes to tumorigenesis, from millions of functional neutral passenger mutations. In this paper, in order to identify driver genes effectively, we applied a generalized additive model to mutation profiles to filter genes with long length and constructed a new gene-gene interaction network. Then we integrated the mutation data and expression data into the gene-gene interaction network. Lastly, greedy algorithm was used to prioritize candidate driver genes from the integrated data. We named the proposed method Length-Net-Driver (LNDriver). Experiments on three TCGA datasets, i.e., head and neck squamous cell carcinoma, kidney renal clear cell carcinoma and thyroid carcinoma, demonstrated that the proposed method was effective. Also, it can identify not only frequently mutated drivers, but also rare candidate driver genes.

  10. Abnormal RNA splicing and genomic instability after induction of DNMT3A mutations by CRISPR/Cas9 gene editing.

    PubMed

    Banaszak, Lauren G; Giudice, Valentina; Zhao, Xin; Wu, Zhijie; Gao, Shouguo; Hosokawa, Kohei; Keyvanfar, Keyvan; Townsley, Danielle M; Gutierrez-Rodrigues, Fernanda; Fernandez Ibanez, Maria Del Pilar; Kajigaya, Sachiko; Young, Neal S

    2018-03-01

    DNA methyltransferase 3A (DNMT3A) mediates de novo DNA methylation. Mutations in DNMT3A are associated with hematological malignancies, most frequently acute myeloid leukemia. DNMT3A mutations are hypothesized to establish a pre-leukemic state, rendering cells vulnerable to secondary oncogenic mutations and malignant transformation. However, the mechanisms by which DNMT3A mutations contribute to leukemogenesis are not well-defined. Here, we successfully created four DNMT3A-mutated K562 cell lines with frameshift mutations resulting in truncated DNMT3A proteins. DNMT3A-mutated cell lines exhibited significantly impaired growth and increased apoptotic activity compared to wild-type (WT) cells. Consistent with previous studies, DNMT3A-mutated cells displayed impaired differentiation capacity. RNA-seq was used to compare transcriptomes of DNMT3A-mutated and WT cells; DNMT3A ablation resulted in downregulation of genes involved in spliceosome function, causing dysfunction of RNA splicing. Unexpectedly, we observed DNMT3A-mutated cells to exhibit marked genomic instability and an impaired DNA damage response compared to WT. CRISPR/Cas9-mediated DNMT3A-mutated K562 cells may be used to model effects of DNMT3A mutations in human cells. Our findings implicate aberrant splicing and induction of genomic instability as potential mechanisms by which DNMT3A mutations might predispose to malignancy. Published by Elsevier Inc.

  11. Age-related cancer mutations associated with clonal hematopoietic expansion

    PubMed Central

    Xie, Mingchao; Lu, Charles; Wang, Jiayin; McLellan, Michael D.; Johnson, Kimberly J.; Wendl, Michael C.; McMichael, Joshua F.; Schmidt, Heather K.; Yellapantula, Venkata; Miller, Christopher A.; Ozenberger, Bradley A.; Welch, John S.; Link, Daniel C.; Walter, Matthew J.; Mardis, Elaine R.; Dipersio, John F.; Chen, Feng; Wilson, Richard K.; Ley, Timothy J.; Ding, Li

    2015-01-01

    Several genetic alterations characteristic of leukemia and lymphoma have been detected in the blood of individuals without apparent hematological malignancies. We analyzed blood-derived sequence data from 2,728 individuals within The Cancer Genome Atlas, and discovered 77 blood-specific mutations in cancer-associated genes, the majority being associated with advanced age. Remarkably, 83% of these mutations were from 19 leukemia/lymphoma-associated genes, and nine were recurrently mutated (DNMT3A, TET2, JAK2, ASXL1, TP53, GNAS, PPM1D, BCORL1 and SF3B1). We identified 14 additional mutations in a very small fraction of blood cells, possibly representing the earliest stages of clonal expansion in hematopoietic stem cells. Comparison of these findings to mutations in hematological malignancies identified several recurrently mutated genes that may be disease initiators. Our analyses show that the blood cells of more than 2% of individuals (5–6% of people older than 70 years) contain mutations that may represent premalignant, initiating events that cause clonal hematopoietic expansion. PMID:25326804

  12. Validation in mesenchymal progenitor cells of a mutation-independent ex vivo approach to gene therapy for osteogenesis imperfecta.

    PubMed

    Millington-Ward, Sophia; Allers, Carolina; Tuohy, Gearóid; Conget, Paulette; Allen, Danny; McMahon, Helena P; Kenna, Paul F; Humphries, Peter; Farrar, G Jane

    2002-09-15

    Over 100 dominant-negative mutations within the COL1A1 gene have been identified in osteogenesis imperfecta (OI). In terms of human therapeutics, targeting each of these mutations independently is unlikely to be feasible. Here we show that the hammerhead ribozyme Rzpol1a1, targeting a common polymorphism within transcripts from the COL1A1 gene, downregulates COL1A1 transcript in human mesenchymal progenitor cells at a ribozyme to transcript ratio of only 1:1. Downregulation was confirmed at the protein level. Transducing stem cells with Rzpol1A1 ex vivo followed by autologous transplantation could provide a gene therapy for a large proportion of OI patients with gain-of-function mutations using a single therapeutic.

  13. The transcriptional control machinery as well as the cell wall integrity and its regulation are involved in the detoxification of the organic solvent dimethyl sulfoxide in Saccharomyces cerevisiae.

    PubMed

    Zhang, Lilin; Liu, Ningning; Ma, Xiao; Jiang, Linghuo

    2013-03-01

    In the present study, we have identified 339 dimethyl sulfoxide (DMSO)-sensitive and nine DMSO-tolerant gene mutations in Saccharomyces cerevisiae through a functional genomics approach. Twelve of these identified DMSO-sensitive mutations are of genes involved in the general control of gene expression mediated by the SWR1 complex and the RNA polymerase II mediator complex, whereas 71 of them are of genes involved in the protein trafficking and vacuolar sorting processes. In addition, twelve of these DMSO-sensitive mutations are of genes involved in the cell wall integrity (CWI) and its regulation. DMSO-tolerant mutations are of genes mainly involved in the metabolism and the gene expression control. Therefore, the transcriptional control machinery, the CWI and its regulation as well as the protein trafficking and sorting process play critical roles in the DMSO detoxification in yeast cells. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peltomaeki, Paeivi, E-mail: Paivi.Peltomaki@Helsinki.Fi

    Cancer is traditionally viewed as a disease of abnormal cell proliferation controlled by a series of mutations. Mutations typically affect oncogenes or tumor suppressor genes thereby conferring growth advantage. Genomic instability facilitates mutation accumulation. Recent findings demonstrate that activation of oncogenes and inactivation of tumor suppressor genes, as well as genomic instability, can be achieved by epigenetic mechanisms as well. Unlike genetic mutations, epimutations do not change the base sequence of DNA and are potentially reversible. Similar to genetic mutations, epimutations are associated with specific patterns of gene expression that are heritable through cell divisions. Knudson's hypothesis postulates that inactivationmore » of tumor suppressor genes requires two hits, with the first hit occurring either in somatic cells (sporadic cancer) or in the germline (hereditary cancer) and the second one always being somatic. Studies on hereditary and sporadic forms of colorectal carcinoma have made it evident that, apart from genetic mutations, epimutations may serve as either hit or both. Furthermore, recent next-generation sequencing studies show that epigenetic genes, such as those encoding histone modifying enzymes and subunits for chromatin remodeling systems, are themselves frequent targets of somatic mutations in cancer and can act like tumor suppressor genes or oncogenes. This review discusses genetic vs. epigenetic origin of cancer, including cancer susceptibility, in light of recent discoveries. Situations in which mutations and epimutations occur to serve analogous purposes are highlighted.« less

  15. The in vivo Pig-a gene mutation assay, a potential tool for regulatory safety assessment.

    PubMed

    Dobrovolsky, Vasily N; Miura, Daishiro; Heflich, Robert H; Dertinger, Stephen D

    2010-01-01

    The Pig-a (phosphatidylinositol glycan, Class A) gene codes for a catalytic subunit of the N-acetylglucosamine transferase complex involved in an early step of glycosylphosphatidyl inositol (GPI) cell surface anchor synthesis. Pig-a is the only gene involved in GPI anchor synthesis that is on the X-chromosome, and research into the origins of an acquired genetic disease involving GPI anchor deficiency (paroxysmal nocturnal hemoglobinuria) indicates that cells lacking GPI anchors, or GPI-anchored cell surface proteins, almost always have mutations in the Pig-a gene. These properties of the Pig-a gene and the GPI anchor system have been exploited in a series of assays for measuring in vivo gene mutation in blood cells from humans, rats, mice, and monkeys. In rats, flow cytometric measurement of Pig-a mutation in red blood cells requires microliter volumes of blood and data can be generated in hours. Spontaneous mutant frequencies are relatively low (<5 × 10(-6)) and rats treated with multiple doses of the potent mutagen, N-ethyl-N-nitrosourea, display Pig-a mutant frequencies that are close to the sum of the frequencies produced by the individual exposures. A general observation is that induced mutant frequencies are manifested earlier in reticulocytes (about 2 weeks after treatment) than in total red blood cells (about 2 months after exposure). Based on data from a limited number of test agents, the assay shows promise for regulatory applications, including integration of gene mutation measurement into repeat-dose toxicology studies.

  16. Gene Mutation Profiles in Primary Diffuse Large B Cell Lymphoma of Central Nervous System: Next Generation Sequencing Analyses

    PubMed Central

    Todorovic Balint, Milena; Jelicic, Jelena; Mihaljevic, Biljana; Kostic, Jelena; Stanic, Bojana; Balint, Bela; Pejanovic, Nadja; Lucic, Bojana; Tosic, Natasa; Marjanovic, Irena; Stojiljkovic, Maja; Karan-Djurasevic, Teodora; Perisic, Ognjen; Rakocevic, Goran; Popovic, Milos; Raicevic, Sava; Bila, Jelena; Antic, Darko; Andjelic, Bosko; Pavlovic, Sonja

    2016-01-01

    The existence of a potential primary central nervous system lymphoma-specific genomic signature that differs from the systemic form of diffuse large B cell lymphoma (DLBCL) has been suggested, but is still controversial. We investigated 19 patients with primary DLBCL of central nervous system (DLBCL CNS) using the TruSeq Amplicon Cancer Panel (TSACP) for 48 cancer-related genes. Next generation sequencing (NGS) analyses have revealed that over 80% of potentially protein-changing mutations were located in eight genes (CTNNB1, PIK3CA, PTEN, ATM, KRAS, PTPN11, TP53 and JAK3), pointing to the potential role of these genes in lymphomagenesis. TP53 was the only gene harboring mutations in all 19 patients. In addition, the presence of mutated TP53 and ATM genes correlated with a higher total number of mutations in other analyzed genes. Furthermore, the presence of mutated ATM correlated with poorer event-free survival (EFS) (p = 0.036). The presence of the mutated SMO gene correlated with earlier disease relapse (p = 0.023), inferior event-free survival (p = 0.011) and overall survival (OS) (p = 0.017), while mutations in the PTEN gene were associated with inferior OS (p = 0.048). Our findings suggest that the TP53 and ATM genes could be involved in the molecular pathophysiology of primary DLBCL CNS, whereas mutations in the PTEN and SMO genes could affect survival regardless of the initial treatment approach. PMID:27164089

  17. SEQUENCE ANALYSIS OF MUTATIONS INDUCED BY N-ETHYL-N-NITROSOUREA IN THE TK AND HPRT GENES OF MOUSE LYMPHOMA CELLS.

    EPA Science Inventory

    The mouse lymphoma assay is widely used to identify chemicals that are capable of inducing mutational damages. The Tk+/- gene located on an autosome in mouse lymphoma cells may recover a wider range of mutational events than the X-linked Hprt locus. However, chemical-induced muta...

  18. New target genes in endometrial tumors show a role for the estrogen-receptor pathway in microsatellite-unstable cancers.

    PubMed

    Ferreira, Ana M; Tuominen, Iina; Sousa, Sónia; Gerbens, Frans; van Dijk-Bos, Krista; Osinga, Jan; Kooi, Krista A; Sanjabi, Bahram; Esendam, Chris; Oliveira, Carla; Terpstra, Peter; Hardonk, Menno; van der Sluis, Tineke; Zazula, Monika; Stachura, Jerzy; van der Zee, Ate G; Hollema, Harry; Sijmons, Rolf H; Aaltonen, Lauri A; Seruca, Raquel; Hofstra, Robert M W; Westers, Helga

    2014-12-01

    Microsatellite instability (MSI) in tumors results in an accumulation of mutations in (target) genes. Previous studies suggest that the profile of target genes differs according to tumor type. This paper describes the first genome-wide search for target genes for mismatch repair-deficient endometrial cancers. Genes expressed in normal endometrium containing coding repeats were analyzed for mutations in tumors. We identified 44 possible genes of which seven are highly mutated (>15%). Some candidates were also found mutated in colorectal and gastric tumors. The most frequently mutated gene, NRIP1 encoding nuclear receptor-interacting protein 1, was silenced in an endometrial tumor cell line and expression microarray experiments were performed. Silencing of NRIP1 was associated with differences in the expression of several genes in the estrogen-receptor network. Furthermore, an enrichment of genes related to cell cycle (regulation) and replication was observed. We present a new profile of target genes, some of them tissue specific, whereas others seem to play a more general role in MSI tumors. The high-mutation frequency combined with the expression data suggest, for the first time, an involvement of NRIP1 in endometrial cancer development. © 2014 WILEY PERIODICALS, INC.

  19. Whole-exome sequencing of primary plasma cell leukemia discloses heterogeneous mutational patterns.

    PubMed

    Cifola, Ingrid; Lionetti, Marta; Pinatel, Eva; Todoerti, Katia; Mangano, Eleonora; Pietrelli, Alessandro; Fabris, Sonia; Mosca, Laura; Simeon, Vittorio; Petrucci, Maria Teresa; Morabito, Fortunato; Offidani, Massimo; Di Raimondo, Francesco; Falcone, Antonietta; Caravita, Tommaso; Battaglia, Cristina; De Bellis, Gianluca; Palumbo, Antonio; Musto, Pellegrino; Neri, Antonino

    2015-07-10

    Primary plasma cell leukemia (pPCL) is a rare and aggressive form of plasma cell dyscrasia and may represent a valid model for high-risk multiple myeloma (MM). To provide novel information concerning the mutational profile of this disease, we performed the whole-exome sequencing of a prospective series of 12 pPCL cases included in a Phase II multicenter clinical trial and previously characterized at clinical and molecular levels. We identified 1, 928 coding somatic non-silent variants on 1, 643 genes, with a mean of 166 variants per sample, and only few variants and genes recurrent in two or more samples. An excess of C > T transitions and the presence of two main mutational signatures (related to APOBEC over-activity and aging) occurring in different translocation groups were observed. We identified 14 candidate cancer driver genes, mainly involved in cell-matrix adhesion, cell cycle, genome stability, RNA metabolism and protein folding. Furthermore, integration of mutation data with copy number alteration profiles evidenced biallelically disrupted genes with potential tumor suppressor functions. Globally, cadherin/Wnt signaling, extracellular matrix and cell cycle checkpoint resulted the most affected functional pathways. Sequencing results were finally combined with gene expression data to better elucidate the biological relevance of mutated genes. This study represents the first whole-exome sequencing screen of pPCL and evidenced a remarkable genetic heterogeneity of mutational patterns. This may provide a contribution to the comprehension of the pathogenetic mechanisms associated with this aggressive form of PC dyscrasia and potentially with high-risk MM.

  20. Correction of the sickle cell disease mutation in human hematopoietic stem/progenitor cells.

    PubMed

    Hoban, Megan D; Cost, Gregory J; Mendel, Matthew C; Romero, Zulema; Kaufman, Michael L; Joglekar, Alok V; Ho, Michelle; Lumaquin, Dianne; Gray, David; Lill, Georgia R; Cooper, Aaron R; Urbinati, Fabrizia; Senadheera, Shantha; Zhu, Allen; Liu, Pei-Qi; Paschon, David E; Zhang, Lei; Rebar, Edward J; Wilber, Andrew; Wang, Xiaoyan; Gregory, Philip D; Holmes, Michael C; Reik, Andreas; Hollis, Roger P; Kohn, Donald B

    2015-04-23

    Sickle cell disease (SCD) is characterized by a single point mutation in the seventh codon of the β-globin gene. Site-specific correction of the sickle mutation in hematopoietic stem cells would allow for permanent production of normal red blood cells. Using zinc-finger nucleases (ZFNs) designed to flank the sickle mutation, we demonstrate efficient targeted cleavage at the β-globin locus with minimal off-target modification. By co-delivering a homologous donor template (either an integrase-defective lentiviral vector or a DNA oligonucleotide), high levels of gene modification were achieved in CD34(+) hematopoietic stem and progenitor cells. Modified cells maintained their ability to engraft NOD/SCID/IL2rγ(null) mice and to produce cells from multiple lineages, although with a reduction in the modification levels relative to the in vitro samples. Importantly, ZFN-driven gene correction in CD34(+) cells from the bone marrow of patients with SCD resulted in the production of wild-type hemoglobin tetramers. © 2015 by The American Society of Hematology.

  1. IgVH gene analysis suggests that peritoneal B cells do not contribute to the gut immune system in man.

    PubMed

    Boursier, Laurent; Farstad, Inger Nina; Mellembakken, Jan Roar; Brandtzaeg, Per; Spencer, Jo

    2002-09-01

    The contribution of peritoneal B cells to the intestinal lamina propria plasma cell population is well documented in mice, but unknown in humans. We have analyzed immunoglobulin (Ig) genes of human peritoneal B cells, because such genes show distinctive characteristics in mucosal B cells, particularly highly mutated variable regions. Here, we report the characteristics of variable region genes used by IgM, IgA and IgG in peritoneal cells. We focused on the properties of IgV(H)4-34 to allow comparisons of like-with-like between different isotypes and cells from different immune compartments. We observed that the IgM genes were mostly unmutated, and that the mutated subset had less mutations than would be expected in a mucosal B cell population. Likewise, the IgV(H)4-34 genes used by IgA and IgG from peritoneal B cells had significantly lower numbers of mutations than observed in the mucosal counterparts. Other trends observed, while not reaching statistical significance, followed the trend of peripheral B cells. The peritoneal B cell population had more IgA1 than IgA2 sequences, and there was no dominance of J(H)4 in the IgA from peritoneum or spleen, in contrast to the mucosal sequences. Overall, this study suggested that human peritoneal B cell are either peripheral or mixed in origin; they are unlikely to represent an inductive compartment for the mucosal B cell system.

  2. The Effect of Coexistence of a Pair of Mutated Oncogenes on the Survival Rate of Invasive Breast Carcinoma Patients

    NASA Astrophysics Data System (ADS)

    Nair, D. R.

    2017-12-01

    The purpose of this project was to determine the effect of two mutated oncogenes on the survival rate from invasive breast carcinoma when in comparison to the mutation of a single oncogene on the survival rate. An oncogene is defined as a gene, that when mutated, can lead to cancer. The two oncogenes used in this project were human epidermal growth factor receptor 2 (HER2) and c-myc (MYC). HER2 and MYC are both oncogenes that contribute to the formation of cancer. HER2 proteins are receptors on breast cells, and when the HER2 gene is mutated, there is an overexpression of HER2 protein on the breast cell. This makes the breast cells proliferate uncontrollably. MYC is a gene that codes for a transcription factor that plays a role in cell cycle progression. The overexpression of MYC also leads to the proliferation of cells. I hypothesized that if there is a mutation in both the MYC and HER2 genes, then the survival rate of invasive breast carcinoma patients will be lower compared to patients with the mutations of only MYC or HER2. To test this hypothesis, we conducted individual gene searches in CBioPortal for HER2 in the datasets from the studies titled TCGA Nature 2012, TCGA Cell 2015, and TCGA Provisional. We conducted individual gene searches in CBioPortal for MYC in the same datasets. The survival rate data was then exported and analyzed for patients with mutations of either HER2 or MYC and with mutations of both genes. To determine the cases that had both HER2 and MYC mutations, we found the overlapping cases in both HER2 and MYC groups for all three datasets. We calculated the median of the survival data for cases where either HER2 or MYC was mutated and cases where both MYC and HER2 were mutated. From the first dataset, the median of MYC data was 95.53, HER2 data was 95.83, and both HER2 and MYC data was 91.24. In the second dataset, the median of MYC data was 92.17 , HER2 data was 93.5, and both HER2 and MYC data was 87.95 . In the third dataset, the median of MYC data was 92.18, HER2 data was 94.22, and both HER2 and MYC data was 89.45. The median survival rates all showed that cases with mutations in both genes had a lower survival rate than those with single mutations. My hypothesis was supported. Some sources of error are the fewer number of cases in the TCGA Nature 2012 dataset, making this data statistically insignificant.

  3. A mutation in the insulin receptor gene that impairs transport of the receptor to the plasma membrane and causes insulin-resistant diabetes.

    PubMed Central

    Accili, D; Frapier, C; Mosthaf, L; McKeon, C; Elbein, S C; Permutt, M A; Ramos, E; Lander, E; Ullrich, A; Taylor, S I

    1989-01-01

    Insulin binds to a receptor on the cell surface, thereby triggering a biological response within the target cell. Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. We have studied a family in which two sisters have a genetic form of insulin-resistant diabetes mellitus. The technique of homozygosity mapping has been used to demonstrate that the mutation causing diabetes in this consanguineous family is genetically linked to the insulin receptor gene. The two insulin-resistant sisters are homozygous for a mutation encoding substitution of valine for phenylalanine at position 382 in the alpha-subunit of the insulin receptor. Transfection of mutant insulin receptor cDNA into NIH3T3 cells demonstrated that the Val382 mutation impaired post-translational processing and retarded transport of the insulin receptor to the plasma membrane. Thus, the mutation causes insulin resistance by decreasing the number of insulin receptors on the surface of the patients' cells. Images PMID:2573522

  4. Functional mutation analysis of EGFR family genes and corresponding lymph node metastases in head and neck squamous cell carcinoma.

    PubMed

    Hama, Takanori; Yuza, Yuki; Suda, Toshihito; Saito, Yoshimichi; Norizoe, Chihiro; Kato, Takakuni; Moriyama, Hiroshi; Urashima, Mitsuyoshi

    2012-01-01

    Tumors with certain mutations in the epidermal growth factor receptor (EGFR) family genes dramatically respond to EGFR inhibitors. Therefore, these mutations are important factors that influence disease progression and patient survival. We previously studied the mutation status of EGFR in patients with head and neck squamous cell carcinoma (HNSCC). However, the mutation status of lymph node metastases and the frequency of mutations in EGFR family genes have not been extensively studied. In this study, we sequenced the catalytic domains of the three other members of the EGFR family, HER2, HER3, and HER4 in 92 clinical samples of HNSCC. We identified a HER2 mutation (K716E) in one sample but no mutations were found in HER3 or HER4. Next to investigate the relationship between EGFR mutations and tumor metastasis, we compared the DNA sequences of the EGFR gene between the primary tumor and the lymph node metastasis in 31 clinical samples. Only one of the patients with an EGFR mutation in the primary HNSCC carried the same mutation (L858R) in the lymph node metastasis. Finally, we explored the tumorigenic potential of the EGFR mutations that we had previously identified and their sensitivity to two different EGFR tyrosine kinase inhibitors (CL-387785, OSI-420). Ba/F3 cells transformed with mutant EGFR genes were sensitive to treatment with lower concentrations of CL-387785 than of OSI-420. These results contribute to our understanding of the genetic basis of drug sensitivity and will help design drugs that specifically target different subtypes of HNSCC.

  5. Novel candidate genes may be possible predisposing factors revealed by whole exome sequencing in familial esophageal squamous cell carcinoma.

    PubMed

    Forouzanfar, Narjes; Baranova, Ancha; Milanizadeh, Saman; Heravi-Moussavi, Alireza; Jebelli, Amir; Abbaszadegan, Mohammad Reza

    2017-05-01

    Esophageal squamous cell carcinoma is one of the deadliest of all the cancers. Its metastatic properties portend poor prognosis and high rate of recurrence. A more advanced method to identify new molecular biomarkers predicting disease prognosis can be whole exome sequencing. Here, we report the most effective genetic variants of the Notch signaling pathway in esophageal squamous cell carcinoma susceptibility by whole exome sequencing. We analyzed nine probands in unrelated familial esophageal squamous cell carcinoma pedigrees to identify candidate genes. Genomic DNA was extracted and whole exome sequencing performed to generate information about genetic variants in the coding regions. Bioinformatics software applications were utilized to exploit statistical algorithms to demonstrate protein structure and variants conservation. Polymorphic regions were excluded by false-positive investigations. Gene-gene interactions were analyzed for Notch signaling pathway candidates. We identified novel and damaging variants of the Notch signaling pathway through extensive pathway-oriented filtering and functional predictions, which led to the study of 27 candidate novel mutations in all nine patients. Detection of the trinucleotide repeat containing 6B gene mutation (a slice site alteration) in five of the nine probands, but not in any of the healthy samples, suggested that it may be a susceptibility factor for familial esophageal squamous cell carcinoma. Noticeably, 8 of 27 novel candidate gene mutations (e.g. epidermal growth factor, signal transducer and activator of transcription 3, MET) act in a cascade leading to cell survival and proliferation. Our results suggest that the trinucleotide repeat containing 6B mutation may be a candidate predisposing gene in esophageal squamous cell carcinoma. In addition, some of the Notch signaling pathway genetic mutations may act as key contributors to esophageal squamous cell carcinoma.

  6. Mutational and structural analysis of diffuse large B-cell lymphoma using whole genome sequencing | Office of Cancer Genomics

    Cancer.gov

    Abstract: Diffuse large B-cell lymphoma (DLBCL) is a genetically heterogeneous cancer comprising at least two molecular subtypes that differ in gene expression and distribution of mutations. Recently, application of genome/exome sequencing and RNA-seq to DLBCL has revealed numerous genes that are recurrent targets of somatic point mutation in this disease.

  7. Combining Single Strand Oligodeoxynucleotides and CRISPR/Cas9 to Correct Gene Mutations in β-Thalassemia-induced Pluripotent Stem Cells.

    PubMed

    Niu, Xiaohua; He, Wenyin; Song, Bing; Ou, Zhanhui; Fan, Di; Chen, Yuchang; Fan, Yong; Sun, Xiaofang

    2016-08-05

    β-Thalassemia (β-Thal) is one of the most common genetic diseases in the world. The generation of patient-specific β-Thal-induced pluripotent stem cells (iPSCs), correction of the disease-causing mutations in those cells, and then differentiation into hematopoietic stem cells offers a new therapeutic strategy for this disease. Here, we designed a CRISPR/Cas9 to specifically target the Homo sapiens hemoglobin β (HBB) gene CD41/42(-CTTT) mutation. We demonstrated that the combination of single strand oligodeoxynucleotides with CRISPR/Cas9 was capable of correcting the HBB gene CD41/42 mutation in β-Thal iPSCs. After applying a correction-specific PCR assay to purify the corrected clones followed by sequencing to confirm mutation correction, we verified that the purified clones retained full pluripotency and exhibited normal karyotyping. Additionally, whole-exome sequencing showed that the mutation load to the exomes was minimal after CRISPR/Cas9 targeting. Furthermore, the corrected iPSCs were selected for erythroblast differentiation and restored the expression of HBB protein compared with the parental iPSCs. This method provides an efficient and safe strategy to correct the HBB gene mutation in β-Thal iPSCs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Whole exome sequencing reveals recurrent mutations in BRCA2 and FAT genes in acinar cell carcinomas of the pancreas.

    PubMed

    Furukawa, Toru; Sakamoto, Hitomi; Takeuchi, Shoko; Ameri, Mitra; Kuboki, Yuko; Yamamoto, Toshiyuki; Hatori, Takashi; Yamamoto, Masakazu; Sugiyama, Masanori; Ohike, Nobuyuki; Yamaguchi, Hiroshi; Shimizu, Michio; Shibata, Noriyuki; Shimizu, Kyoko; Shiratori, Keiko

    2015-03-06

    Acinar cell carcinoma of the pancreas is a rare tumor with a poor prognosis. Compared to pancreatic ductal adenocarcinoma, its molecular features are poorly known. We studied a total of 11 acinar cell carcinomas, including 3 by exome and 4 by target sequencing. Exome sequencing revealed 65 nonsynonymous mutations and 22 indels with a mutation rate of 3.4 mutations/Mb per tumor, on average. By accounting for not only somatic but also germline mutations with loss of the wild-type allele, we identified recurrent mutations of BRCA2 and FAT genes. BRCA2 showed somatic or germline premature termination mutations, with loss of the wild-type allele in 3 of 7 tumors. FAT1, FAT3, and FAT4 showed somatic or germline missense mutations in 4 of 7 tumors. The germline FAT mutations were with loss of the wild-type allele. Loss of BRCA2 expression was observed in 5 of 11 tumors. One patient with a BRCA2-mutated tumor experienced complete remission of liver metastasis following cisplatinum chemotherapy. In conclusion, acinar cell carcinomas show a distinct mutation pattern and often harbor somatic or germline mutations of BRCA2 and FAT genes. This result may warrant assessment of BRCA2 abrogation in patients with the carcinoma to determine their sensitivity to chemotherapy.

  9. Detection of EML4-ALK fusion gene and features associated with EGFR mutations in Chinese patients with non-small-cell lung cancer.

    PubMed

    Wen, Miaomiao; Wang, Xuejiao; Sun, Ying; Xia, Jinghua; Fan, Liangbo; Xing, Hao; Zhang, Zhipei; Li, Xiaofei

    2016-01-01

    Echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK) and epidermal growth factor receptor (EGFR) define specific molecular subsets of lung cancer with distinct clinical features. We aimed at revealing the clinical features of EML4-ALK fusion gene and EGFR mutation in non-small-cell lung cancer (NSCLC). We enrolled 694 Chinese patients with NSCLC for analysis. EML4-ALK fusion gene was analyzed by real-time polymerase chain reaction, and EGFR mutations were analyzed by amplified refractory mutation system. Among the 694 patients, 60 (8.65%) patients had EML4-ALK fusions. In continuity correction χ (2) test analysis, EML4-ALK fusion gene was correlated with sex, age, smoking status, and histology, but no significant association was observed between EML4-ALK fusion gene and clinical stage. A total of 147 (21.18%) patients had EGFR mutations. In concordance with previous reports, EGFR mutation was correlated with age, smoking status, histology, and clinical stage, whereas patient age was not significantly associated with EGFR mutation. Meanwhile, to our surprise, six (0.86%) patients had coexisting EML4-ALK fusions and EGFR mutations. EML4-ALK fusion gene defines a new molecular subset in patients with NSCLC. Six patients who harbored both EML4-ALK fusion genes and EGFR mutations were identified in our study. The EGFR mutations and the EML4-ALK fusion genes are coexistent.

  10. Detection of EML4-ALK fusion gene and features associated with EGFR mutations in Chinese patients with non-small-cell lung cancer

    PubMed Central

    Wen, Miaomiao; Wang, Xuejiao; Sun, Ying; Xia, Jinghua; Fan, Liangbo; Xing, Hao; Zhang, Zhipei; Li, Xiaofei

    2016-01-01

    Purpose Echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (EML4-ALK) and epidermal growth factor receptor (EGFR) define specific molecular subsets of lung cancer with distinct clinical features. We aimed at revealing the clinical features of EML4-ALK fusion gene and EGFR mutation in non-small-cell lung cancer (NSCLC). Methods We enrolled 694 Chinese patients with NSCLC for analysis. EML4-ALK fusion gene was analyzed by real-time polymerase chain reaction, and EGFR mutations were analyzed by amplified refractory mutation system. Results Among the 694 patients, 60 (8.65%) patients had EML4-ALK fusions. In continuity correction χ2 test analysis, EML4-ALK fusion gene was correlated with sex, age, smoking status, and histology, but no significant association was observed between EML4-ALK fusion gene and clinical stage. A total of 147 (21.18%) patients had EGFR mutations. In concordance with previous reports, EGFR mutation was correlated with age, smoking status, histology, and clinical stage, whereas patient age was not significantly associated with EGFR mutation. Meanwhile, to our surprise, six (0.86%) patients had coexisting EML4-ALK fusions and EGFR mutations. Conclusion EML4-ALK fusion gene defines a new molecular subset in patients with NSCLC. Six patients who harbored both EML4-ALK fusion genes and EGFR mutations were identified in our study. The EGFR mutations and the EML4-ALK fusion genes are coexistent. PMID:27103824

  11. Novel Insight into Mutational Landscape of Head and Neck Squamous Cell Carcinoma

    PubMed Central

    Gaykalova, Daria A.; Mambo, Elizabeth; Choudhary, Ashish; Houghton, Jeffery; Buddavarapu, Kalyan; Sanford, Tiffany; Darden, Will; Adai, Alex; Hadd, Andrew; Latham, Gary; Danilova, Ludmila V.; Bishop, Justin; Li, Ryan J.; Westra, William H.; Hennessey, Patrick; Koch, Wayne M.; Ochs, Michael F.; Califano, Joseph A.; Sun, Wenyue

    2014-01-01

    Development of head and neck squamous cell carcinoma (HNSCC) is characterized by accumulation of mutations in several oncogenes and tumor suppressor genes. We have formerly described the mutation pattern of HNSCC and described NOTCH signaling pathway alterations. Given the complexity of the HNSCC, here we extend the previous study to understand the overall HNSCC mutation context and to discover additional genetic alterations. We performed high depth targeted exon sequencing of 51 highly actionable cancer-related genes with a high frequency of mutation across many cancer types, including head and neck. DNA from primary tumor tissues and matched normal tissues was analyzed for 37 HNSCC patients. We identified 26 non-synonymous or stop-gained mutations targeting 11 of 51 selected genes. These genes were mutated in 17 out of 37 (46%) studied HNSCC patients. Smokers harbored 3.2-fold more mutations than non-smokers. Importantly, TP53 was mutated in 30%, NOTCH1 in 8% and FGFR3 in 5% of HNSCC. HPV negative patients harbored 4-fold more TP53 mutations than HPV positive patients. These data confirm prior reports of the HNSCC mutational profile. Additionally, we detected mutations in two new genes, CEBPA and FES, which have not been previously reported in HNSCC. These data extend the spectrum of HNSCC mutations and define novel mutation targets in HNSCC carcinogenesis, especially for smokers and HNSCC without HPV infection. PMID:24667986

  12. A Genetic Screen for Mutations Affecting Cell Division in the Arabidopsis thaliana Embryo Identifies Seven Loci Required for Cytokinesis

    DOE PAGES

    Gillmor, C. Stewart; Roeder, Adrienne H. K.; Sieber, Patrick; ...

    2016-01-08

    Cytokinesis in plants involves the formation of unique cellular structures such as the phragmoplast and the cell plate, both of which are required to divide the cell after nuclear division. In order to isolate genes that are involved in de novo cell wall formation, we performed a large-scale, microscope-based screen for Arabidopsis mutants that severely impair cytokinesis in the embryo. We recovered 35 mutations that form abnormally enlarged cells with multiple, often polyploid nuclei and incomplete cell walls. These mutants represent seven genes, four of which have previously been implicated in phragmoplast or cell plate function. Mutations in two locimore » show strongly reduced transmission through the haploid gametophytic generation. Molecular cloning of both corresponding genes reveals that one is represented by hypomorphic alleles of the kinesin-5 gene RADIALLY SWOLLEN 7 (homologous to tobacco kinesin-related protein TKRP125), and that the other gene corresponds to the Arabidopsis FUSED ortholog TWO-IN-ONE (originally identified based on its function in pollen development). No mutations that completely abolish the formation of cross walls in diploid cells were found. Lastly, our results support the idea that cytokinesis in the diploid and haploid generations involve similar mechanisms.« less

  13. A Genetic Screen for Mutations Affecting Cell Division in the Arabidopsis thaliana Embryo Identifies Seven Loci Required for Cytokinesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gillmor, C. Stewart; Roeder, Adrienne H. K.; Sieber, Patrick

    Cytokinesis in plants involves the formation of unique cellular structures such as the phragmoplast and the cell plate, both of which are required to divide the cell after nuclear division. In order to isolate genes that are involved in de novo cell wall formation, we performed a large-scale, microscope-based screen for Arabidopsis mutants that severely impair cytokinesis in the embryo. We recovered 35 mutations that form abnormally enlarged cells with multiple, often polyploid nuclei and incomplete cell walls. These mutants represent seven genes, four of which have previously been implicated in phragmoplast or cell plate function. Mutations in two locimore » show strongly reduced transmission through the haploid gametophytic generation. Molecular cloning of both corresponding genes reveals that one is represented by hypomorphic alleles of the kinesin-5 gene RADIALLY SWOLLEN 7 (homologous to tobacco kinesin-related protein TKRP125), and that the other gene corresponds to the Arabidopsis FUSED ortholog TWO-IN-ONE (originally identified based on its function in pollen development). No mutations that completely abolish the formation of cross walls in diploid cells were found. Lastly, our results support the idea that cytokinesis in the diploid and haploid generations involve similar mechanisms.« less

  14. Deleterious CHEK2 1100delC and L303X mutants identified among 38 human breast cancer cell lines.

    PubMed

    Wasielewski, Marijke; Hanifi-Moghaddam, Pejman; Hollestelle, Antoinette; Merajver, Sofia D; van den Ouweland, Ans; Klijn, Jan G M; Ethier, Stephen P; Schutte, Mieke

    2009-01-01

    The CHEK2 protein plays a major role in the regulation of DNA damage response pathways. Mutations in the CHEK2 gene, in particular 1100delC, have been associated with increased cancer risks, but the precise function of CHEK2 mutations in carcinogenesis is not known. Human cancer cell lines with CHEK2 mutations are therefore of main interest. Here, we have sequenced 38 breast cancer cell lines for mutations in the CHEK2 gene and identified two cell lines with deleterious CHEK2 mutations. Cell line UACC812 has a nonsense truncating mutation in the CHEK2 kinase domain (L303X) and cell line SUM102PT has the well-known oncogenic CHEK2 1100delC founder mutation. Immunohistochemical analysis revealed that the two CHEK2 mutant cell lines expressed neither CHEK2 nor P-Thr(68) CHEK2 proteins, implying abrogation of normal CHEK2 DNA repair functions. Cell lines UACC812 and SUM102PT thus are the first human CHEK2 null cell lines reported and should therefore be a major help in further unraveling the function of CHEK2 mutations in carcinogenesis.

  15. TET2 mutations in B cells of patients affected by angioimmunoblastic T-cell lymphoma.

    PubMed

    Schwartz, Friederike H; Cai, Qian; Fellmann, Eva; Hartmann, Sylvia; Mäyränpää, Mikko I; Karjalainen-Lindsberg, Marja-Liisa; Sundström, Christer; Scholtysik, René; Hansmann, Martin-Leo; Küppers, Ralf

    2017-06-01

    Angioimmunoblastic T-cell lymphomas (AITLs) frequently carry mutations in the TET2 and IDH2 genes. TET2 mutations represent early genetic lesions as they had already been detected in haematopoietic precursor cells of AITL patients. We show by analysis of whole-tissue sections and microdissected PD1 + cells that the frequency of TET2-mutated AITL is presumably even higher than reported (12/13 cases in our collection; 92%). In two-thirds of informative AITLs (6/9), a fraction of B cells was also TET2-mutated. Investigation of four AITLs by TET2 and IGHV gene sequencing of single microdissected B cells showed that between 10% and 60% of polyclonal B cells in AITL lymph nodes harboured the identical TET2 mutations of the respective T-cell lymphoma clone. Thus, TET2-mutated haematopoietic precursor cells in AITL patients not only give rise to the T-cell lymphoma but also generate a large population of mutated mature B cells. Future studies will show whether this is a reason why AITL patients frequently also develop B-cell lymphomas. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  16. Cellular context-dependent consequences of Apc mutations on gene regulation and cellular behavior.

    PubMed

    Hashimoto, Kyoichi; Yamada, Yosuke; Semi, Katsunori; Yagi, Masaki; Tanaka, Akito; Itakura, Fumiaki; Aoki, Hitomi; Kunisada, Takahiro; Woltjen, Knut; Haga, Hironori; Sakai, Yoshiharu; Yamamoto, Takuya; Yamada, Yasuhiro

    2017-01-24

    The spectrum of genetic mutations differs among cancers in different organs, implying a cellular context-dependent effect for genetic aberrations. However, the extent to which the cellular context affects the consequences of oncogenic mutations remains to be fully elucidated. We reprogrammed colon tumor cells in an Apc Min/+ (adenomatous polyposis coli) mouse model, in which the loss of the Apc gene plays a critical role in tumor development and subsequently, established reprogrammed tumor cells (RTCs) that exhibit pluripotent stem cell (PSC)-like signatures of gene expression. We show that the majority of the genes in RTCs that were affected by Apc mutations did not overlap with the genes affected in the intestine. RTCs lacked pluripotency but exhibited an increased expression of Cdx2 and a differentiation propensity that was biased toward the trophectoderm cell lineage. Genetic rescue of the mutated Apc allele conferred pluripotency on RTCs and enabled their differentiation into various cell types in vivo. The redisruption of Apc in RTC-derived differentiated cells resulted in neoplastic growth that was exclusive to the intestine, but the majority of the intestinal lesions remained as pretumoral microadenomas. These results highlight the significant influence of cellular context on gene regulation, cellular plasticity, and cellular behavior in response to the loss of the Apc function. Our results also imply that the transition from microadenomas to macroscopic tumors is reprogrammable, which underscores the importance of epigenetic regulation on tumor promotion.

  17. Cellular context-dependent consequences of Apc mutations on gene regulation and cellular behavior

    PubMed Central

    Hashimoto, Kyoichi; Yamada, Yosuke; Semi, Katsunori; Yagi, Masaki; Tanaka, Akito; Itakura, Fumiaki; Aoki, Hitomi; Kunisada, Takahiro; Woltjen, Knut; Haga, Hironori; Sakai, Yoshiharu; Yamamoto, Takuya; Yamada, Yasuhiro

    2017-01-01

    The spectrum of genetic mutations differs among cancers in different organs, implying a cellular context-dependent effect for genetic aberrations. However, the extent to which the cellular context affects the consequences of oncogenic mutations remains to be fully elucidated. We reprogrammed colon tumor cells in an ApcMin/+ (adenomatous polyposis coli) mouse model, in which the loss of the Apc gene plays a critical role in tumor development and subsequently, established reprogrammed tumor cells (RTCs) that exhibit pluripotent stem cell (PSC)-like signatures of gene expression. We show that the majority of the genes in RTCs that were affected by Apc mutations did not overlap with the genes affected in the intestine. RTCs lacked pluripotency but exhibited an increased expression of Cdx2 and a differentiation propensity that was biased toward the trophectoderm cell lineage. Genetic rescue of the mutated Apc allele conferred pluripotency on RTCs and enabled their differentiation into various cell types in vivo. The redisruption of Apc in RTC-derived differentiated cells resulted in neoplastic growth that was exclusive to the intestine, but the majority of the intestinal lesions remained as pretumoral microadenomas. These results highlight the significant influence of cellular context on gene regulation, cellular plasticity, and cellular behavior in response to the loss of the Apc function. Our results also imply that the transition from microadenomas to macroscopic tumors is reprogrammable, which underscores the importance of epigenetic regulation on tumor promotion. PMID:28057861

  18. NET1 and HFI1 genes of yeast mediate both chromosome maintenance and mitochondrial rho(-) mutagenesis.

    PubMed

    Koltovaya, N A; Guerasimova, A S; Tchekhouta, I A; Devin, A B

    2003-08-01

    An increase in the mitochondrial rho(-) mutagenesis is a well-known response of yeast cells to mutations in numerous nuclear genes as well as to various kinds of stress. Despite extensive studies for several decades, the biological significance of this response is still not fully understood. The genetic approach to solving this enigma includes a study of genes that are required for the high incidence of spontaneous rho(-) mutants. We have obtained mutations of a few nuclear genes of that sort and found that mutations in certain genes, including CDC28, the central cell-cycle regulation gene, result in a decrease in spontaneous rho(-) mutability and simultaneously affect the maintenance of the yeast chromosomes and plasmids. Two more genes resembling CDC28 in this respect are identified in the present work as a result of the characterization of four new mutants. These two genes are NET1 and HFI1 which mediate important regulatory protein-protein interactions in the yeast cell. The effects of four mutations, including net1-srm and hfi1-srm, on the maintenance of the yeast mitochondrial genome, chromosomes and plasmids, as well as on the cell's sensitivity to ionizing radiation, are also described. The data presented suggest that the pleiotropic srm mutations determining coordinate changes in the fidelity of mitotic transmission of chromosomes, plasmids and mtDNA molecules identify genes that most probably operate high up in the hierarchy of the general genetic regulation of yeast. Copyright 2003 John Wiley & Sons, Ltd.

  19. Novel mutations in the RB1 gene from Chinese families with a history of retinoblastoma.

    PubMed

    Zhang, Leilei; Jia, Renbing; Zhao, Junyang; Fan, Jiayan; Zhou, YiXiong; Han, Bing; Song, Xin; Wu, Li; Zhang, He; Song, Huaidong; Ge, Shengfang; Fan, Xianqun

    2015-04-01

    Retinoblastoma is an aggressive eye cancer that develops during infancy and is divided into two clinical types, sporadic and heritable. RB1 has been identified as the only pathological gene responsible for heritable retinoblastoma. Here, we identified 11 RB1 germline mutations in the Han pedigrees of 17 bilateral retinoblastoma patients from China. Four mutations were nonsense mutations, five were splice site mutations, and two resulted in a frame shift due to an insertion or a deletion. Three of the mutations had not been previously reported, and the p.Q344L mutation occurred in two generations of retinoblastoma patients. We investigated phenotypic-genotypic relationships for the novel mutations and showed that these mutations affected the expression, location, and function of the retinoblastoma protein. Abnormal protein localization was observed after transfection of the mutant genes. In addition, changes in the cell cycle distribution and apoptosis rates were observed when the Saos-2 cell line was transfected with plasmids encoding the mutant RB1 genes. Our findings expand the spectrum of known RB1 mutations and will benefit the investigation of RB1 mutation hotspots. Genetic counseling can be offered to families with heritable RB1 mutations.

  20. Mutations in BHD and TP53 genes, but not in HNF1β gene, in a large series of sporadic chromophobe renal cell carcinoma

    PubMed Central

    Gad, S; Lefèvre, S H; Khoo, S K; Giraud, S; Vieillefond, A; Vasiliu, V; Ferlicot, S; Molinié, V; Denoux, Y; Thiounn, N; Chrétien, Y; Méjean, A; Zerbib, M; Benoît, G; Hervé, J M; Allègre, G; Bressac-de Paillerets, B; Teh, B T; Richard, S

    2006-01-01

    BHD, TP53, and HNF1β on chromosome 17 were studied in 92 cases of renal cell carcinoma (46 chromophobe, 19 clear cell, 18 oncocytoma, and nine papillary). Six, thirteen, and zero cases had, respectively BHD, TP53, and HNF1β mutations, (84% mutations involved chromophobe), suggesting a role for BHD and TP53 in chromophobe subtype. PMID:17133269

  1. Restricted ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bredberg, A.; Kraemer, K.H.; Seidman, M.M.

    1986-11-01

    A shuttle vector plasmid, pZ189, carrying a bacterial suppressor tRNA marker gene, was treated with ultraviolet radiation and propagated in cultured skin cells from a patient with the skin-cancer-prone, DNA repair-deficient disease xeroderma pigmentosum and in repair-proficient cells. After replication in the human cells, progeny plasmids were purified. Plasmid survival and mutations inactivating the marker gene were scored by transforming an indicator strain of Escherichia coli carrying a suppressible amber mutation in the beta-galactosidase gene. Plasmid survival in the xeroderma pigmentosum cells was less than that of pZ189 harvested from repair-proficient human cells. The point-mutation frequency in the 150-base-pair tRNAmore » marker gene increased up to 100-fold with ultraviolet dose. Sequence analysis of 150 mutant plasmids revealed that mutations were infrequent at potential thymine-thymine dimer sites. Ninety-three percent of the mutant plasmids from the xeroderma pigmentosum cells showed G X C----A X T transitions, compared to 73% in the normal cells (P less than 0.002). There were significantly fewer transversions (P less than 0.002) (especially G X C----T X A) and multiple base substitutions (P less than 0.00001) than when pZ189 was passaged in repair-proficient cells. The subset of mutational changes that are common to ultraviolet-treated plasmids propagated in both repair-proficient and xeroderma pigmentosum skin cells may be associated with the development of ultraviolet-induced skin cancer in humans.« less

  2. Gene therapy restores vision in rd1 mice after removal of a confounding mutation in Gpr179.

    PubMed

    Nishiguchi, Koji M; Carvalho, Livia S; Rizzi, Matteo; Powell, Kate; Holthaus, Sophia-Martha kleine; Azam, Selina A; Duran, Yanai; Ribeiro, Joana; Luhmann, Ulrich F O; Bainbridge, James W B; Smith, Alexander J; Ali, Robin R

    2015-01-23

    The rd1 mouse with a mutation in the Pde6b gene was the first strain of mice identified with a retinal degeneration. However, AAV-mediated gene supplementation of rd1 mice only results in structural preservation of photoreceptors, and restoration of the photoreceptor-mediated a-wave, but not in restoration of the bipolar cell-mediated b-wave. Here we show that a mutation in Gpr179 prevents the full restoration of vision in rd1 mice. Backcrossing rd1 with C57BL6 mice reveals the complete lack of b-wave in a subset of mice, consistent with an autosomal recessive Mendelian inheritance pattern. We identify a mutation in the Gpr179 gene, which encodes for a G-protein coupled receptor localized to the dendrites of ON-bipolar cells. Gene replacement in rd1 mice that are devoid of the mutation in Gpr179 successfully restores the function of both photoreceptors and bipolar cells, which is maintained for up to 13 months. Our discovery may explain the failure of previous gene therapy attempts in rd1 mice, and we propose that Grp179 mutation status should be taken into account in future studies involving rd1 mice.

  3. Seven mutations in the human insulin gene linked to permanent neonatal/infancy-onset diabetes mellitus

    PubMed Central

    Colombo, Carlo; Porzio, Ottavia; Liu, Ming; Massa, Ornella; Vasta, Mario; Salardi, Silvana; Beccaria, Luciano; Monciotti, Carla; Toni, Sonia; Pedersen, Oluf; Hansen, Torben; Federici, Luca; Pesavento, Roberta; Cadario, Francesco; Federici, Giorgio; Ghirri, Paolo; Arvan, Peter; Iafusco, Dario; Barbetti, Fabrizio

    2008-01-01

    Permanent neonatal diabetes mellitus (PNDM) is a rare disorder usually presenting within 6 months of birth. Although several genes have been linked to this disorder, in almost half the cases documented in Italy, the genetic cause remains unknown. Because the Akita mouse bearing a mutation in the Ins2 gene exhibits PNDM associated with pancreatic β cell apoptosis, we sequenced the human insulin gene in PNDM subjects with unidentified mutations. We discovered 7 heterozygous mutations in 10 unrelated probands. In 8 of these patients, insulin secretion was detectable at diabetes onset, but rapidly declined over time. When these mutant proinsulins were expressed in HEK293 cells, we observed defects in insulin protein folding and secretion. In these experiments, expression of the mutant proinsulins was also associated with increased Grp78 protein expression and XBP1 mRNA splicing, 2 markers of endoplasmic reticulum stress, and with increased apoptosis. Similarly transfected INS-1E insulinoma cells had diminished viability compared with those expressing WT proinsulin. In conclusion, we find that mutations in the insulin gene that promote proinsulin misfolding may cause PNDM. PMID:18451997

  4. NK cells are intrinsically functional in pigs with Severe Combined Immunodeficiency (SCID) caused by spontaneous mutations in the Artemis gene

    USDA-ARS?s Scientific Manuscript database

    We have identified Severe Combined Immunodeficiency (SCID) in a line of Yorkshire pigs at Iowa State University. These SCID pigs lack B-cells and T-cells, but possess Natural Killer (NK) cells. This SCID phenotype is caused by recessive mutations in the Artemis gene. Interestingly, two human tumor c...

  5. Determining the Origin of Human Germinal Center B Cell-Derived Malignancies.

    PubMed

    Seifert, Marc; Küppers, Ralf

    2017-01-01

    Most human B cell lymphomas originate from germinal center (GC) B cells. This is partly caused by the high proliferative activity of GC B cells and the remodeling processes acting at the immunoglobulin (Ig) loci of these cells, i.e., somatic hypermutation and class-switching. Mistargeting of these processes can cause chromosomal translocations, and the hypermutation machinery may also target non-Ig genes. As somatic hypermutation is exclusively active in GC B cells, the presence of somatic mutations in rearranged IgV genes is a standard criterium for a GC or post-GC B cell origin of lymphomas. Beyond this, ongoing somatic hypermutation during lymphoma clone expansion indicates that the lymphoma has an active GC B cell differentiation program. The proto-oncogene BCL6 is specifically expressed in GC B cells and also acquires somatic mutations as a physiological by-product of the somatic hypermutation process, albeit at a lower level than IgV genes. Thus, detection of BCL6 mutations is a further genetic trait of a GC experience of a B cell lymphoma. Typically, B cell lymphomas retain key features of their specific cells of origin, including a differentiation stage-specific gene expression pattern. This is at least partly due to genetic lesions, which "freeze" the lymphoma cells at the differentiation stage at which the transformation occurred. Therefore, identification of the normal B cell subset with the most similar gene expression pattern to a particular type of B cell lymphoma has been instrumental to deduce the precise cell of origin of lymphomas.We present here protocols to analyze human B cell lymphomas for a potential origin from GC B cells by determining the presence of mutations in rearranged IgV genes and the BCL6 gene, and by comparing the gene expression pattern of lymphoma cells with those of normal B cell subsets by genechip or RNA-sequencing analysis.

  6. Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

    PubMed

    Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

    2011-07-01

    Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

  7. A novel start codon mutation of the MERTK gene in a patient with retinitis pigmentosa

    PubMed Central

    Jinda, Worapoj; Poungvarin, Naravat; Taylor, Todd D.; Suzuki, Yutaka; Thongnoppakhun, Wanna; Limwongse, Chanin; Lertrit, Patcharee; Suriyaphol, Prapat

    2016-01-01

    Purpose Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous group of inherited retinal degenerations characterized by progressive loss of photoreceptor cells and RPE functions. More than 70 causative genes are known to be responsible for RP. This study aimed to identify the causative gene in a patient from a consanguineous family with childhood-onset severe retinal dystrophy. Methods To identify the defective gene, whole exome sequencing was performed. Candidate causative variants were selected and validated using Sanger sequencing. Segregation analysis of the causative gene was performed in additional family members. To verify that the mutation has an effect on protein synthesis, an expression vector containing the first ten amino acids of the mutant protein fused with the DsRed2 fluorescent protein was constructed and transfected into HEK293T cells. Expression of the fusion protein in the transfected cells was measured using fluorescence microscopy. Results By filtering against public variant databases, a novel homozygous missense mutation (c.3G>A) localized in the start codon of the MERTK gene was detected as a potentially pathogenic mutation for autosomal recessive RP. The c.3G>A mutation cosegregated with the disease phenotype in the family. No expression of the first ten amino acids of the MerTK mutant fused with the DsRed2 fluorescent protein was detected in HEK293T cells, indicating that the mutation affects the translation initiation site of the gene that may lead to loss of function of the MerTK signaling pathway. Conclusions We report a novel missense mutation (c.3G>A, p.0?) in the MERTK gene that causes severe vision impairment in a patient. Taken together with previous reports, our results expand the spectrum of MERTK mutations and extend our understanding of the role of the MerTK protein in the pathogenesis of retinitis pigmentosa. PMID:27122965

  8. CLL Cells Respond to B-Cell Receptor Stimulation with a MicroRNA/mRNA Signature Associated with MYC Activation and Cell Cycle Progression

    PubMed Central

    Pede, Valerie; Rombout, Ans; Vermeire, Jolien; Naessens, Evelien; Mestdagh, Pieter; Robberecht, Nore; Vanderstraeten, Hanne; Van Roy, Nadine; Vandesompele, Jo; Speleman, Frank; Philippé, Jan; Verhasselt, Bruno

    2013-01-01

    Chronic lymphocytic leukemia (CLL) is a disease with variable clinical outcome. Several prognostic factors such as the immunoglobulin heavy chain variable genes (IGHV) mutation status are linked to the B-cell receptor (BCR) complex, supporting a role for triggering the BCR in vivo in the pathogenesis. The miRNA profile upon stimulation and correlation with IGHV mutation status is however unknown. To evaluate the transcriptional response of peripheral blood CLL cells upon BCR stimulation in vitro, miRNA and mRNA expression was measured using hybridization arrays and qPCR. We found both IGHV mutated and unmutated CLL cells to respond with increased expression of MYC and other genes associated with BCR activation, and a phenotype of cell cycle progression. Genome-wide expression studies showed hsa-miR-132-3p/hsa-miR-212 miRNA cluster induction associated with a set of downregulated genes, enriched for genes modulated by BCR activation and amplified by Myc. We conclude that BCR triggering of CLL cells induces a transcriptional response of genes associated with BCR activation, enhanced cell cycle entry and progression and suggest that part of the transcriptional profiles linked to IGHV mutation status observed in isolated peripheral blood are not cell intrinsic but rather secondary to in vivo BCR stimulation. PMID:23560086

  9. A Novel c.125 T>G (p.Val42Gly) Mutation in The Human INS Gene Leads to Neonatal Diabetes Mellitus via a Decrease in Insulin Synthesis.

    PubMed

    Sun, Fei; Du, Wenhua; Ma, Junhua; Gu, Mingjun; Wang, Jingnan; Zhu, Hongling; Song, Huaidong; Gao, Guanqi

    2018-06-11

    Neonatal diabetes mellitus is likely caused by monogenic mutations, several of which have been identified. INS mutations have a broad spectrum of clinical presentations, ranging from severe neonatal onset to mild adult onset, which suggests that the products of different mutant INS alleles behave differently and utilize distinct mechanisms to induce diabetes. In this study, a neonatal diabetes mellitus patient's INS gene was sequenced, and functional experiments were conducted. The neonatal diabetes mellitus patient's genomic DNA was extracted, and the patient's KCNJ11, ABCC8, and INS genes were sequenced. A novel mutation was identified in INS, and the open reading frame of this human mutant INS gene was inserted into the pMSCV-PIG plasmid. The constructed pMSCV-PIG plasmid was combined with VSV-g and Gag-pol and transfected into 293T cells to package the lentivirus. To stably overexpress the mutant gene, INS-1 cells were infected with the virus. The levels of insulin in the cell culture medium and cytoplasm were determined by ELISA and immunocytochemistry, respectively. A heterozygous mutation, c.125T>G (p. Val42Gly), was identified in a neonatal diabetes mellitus patient's INS gene. The human mutant INS open reading frame was overexpressed in INS-1 cells, and the mutant insulin was undetectable in the cell culture medium and cytoplasm. The novel heterozygous activating mutation c.125 T>G (p.Val42Gly) impairs the synthesis of insulin by pancreatic beta cells, resulting in diabetes. © Georg Thieme Verlag KG Stuttgart · New York.

  10. Infrequent detectable somatic mutations of the RET and glial cell line-derived neurotrophic factor (GDNF) genes in human pituitary adenomas.

    PubMed

    Yoshimoto, K; Tanaka, C; Moritani, M; Shimizu, E; Yamaoka, T; Yamada, S; Sano, T; Itakura, M

    1999-02-01

    RET is a receptor tyrosine kinase expressed in neuroendocrine cells and tumors. RET is activated by a ligand complex comprising glial cell line-derived neurotrophic factor (GDNF) and GDNF receptor-alpha (GDNFR-alpha). Activating mutations of the RET proto-oncogene were found in multiple endocrine neoplasia (MEN) 2 and in sporadic medullary thyroid carcinoma and pheochromocytoma of neuroendocrine origin. Mutations of the RET proto-oncogene and the glial cell line-derived neurotrophic factor (GDNF) gene were examined in human pituitary tumors. No mutations of the RET proto-oncogene including the cysteine-rich region or codon 768 and 918 in the tyrosine kinase domain were detected in 172 human pituitary adenomas either by polymerase chain reaction (PCR)-single strand conformation polymorphism (SSCP) or by PCR-restriction fragment length polymorphism (RFLP). Further, somatic mutations of the GDNF gene in 33 human pituitary adenomas were not detected by PCR-SSCP. One polymorphism of the GDNF gene at codon 145 of TGC or TGT was observed in a prolactinoma. The RET proto-oncogene message was detected in a normal human pituitary gland or 4 of 4 human pituitary adenomas with reverse transcription (RT)-PCR, and in rodent pituitary tumor cell lines with Western blotting. The expression of GDNF gene was detected in 1 of 4 human somatotroph adenomas, 1 of 2 corticotroph adenomas, and 2 of 6 rodent pituitary tumor cell lines with RT-PCR. Based on these, it is concluded that somatic mutations of the RET proto-oncogene or the GDNF gene do not appear to play a major role in the pituitary tumorigenesis in examined tumors.

  11. Mendelian and non-mendelian mutations affecting surface antigen expression in Paramecium tetraurelia.

    PubMed Central

    Epstein, L M; Forney, J D

    1984-01-01

    A screening procedure was devised for the isolation of X-ray-induced mutations affecting the expression of the A immobilization antigen (i-antigen) in Paramecium tetraurelia. Two of the mutations isolated by this procedure proved to be in modifier genes. The two genes are unlinked to each other and unlinked to the structural A i-antigen gene. These are the first modifier genes identified in a Paramecium sp. that affect surface antigen expression. Another mutation was found to be a deletion of sequences just downstream from the A i-antigen gene. In cells carrying this mutation, the A i-antigen gene lies in close proximity to the end of a macronuclear chromosome. The expression of the A i-antigen is not affected in these cells, demonstrating that downstream sequences are not important for the regulation and expression of the A i-antigen gene. A stable cell line was also recovered which shows non-Mendelian inheritance of a macronuclear deletion of the A i-antigen gene. This mutant does not contain the gene in its macronucleus, but contains a complete copy of the gene in its micronucleus. In the cytoplasm of wild-type animals, the micronuclear gene is included in the developing macronucleus; in the cytoplasm of the mutant, the incorporation of the A i-antigen gene into the macronucleus is inhibited. This is the first evidence that a mechanism is available in ciliates to control the expression of a gene by regulating its incorporation into developing macronuclei. Images PMID:6092921

  12. Par-4, a Gene Required for Cytoplasmic Localization and Determination of Specific Cell Types in Caenorhabditis Elegans Embryogenesis

    PubMed Central

    Morton, D. G.; Roos, J. M.; Kemphues, K. J.

    1992-01-01

    Specification of some cell fates in the early Caenorhabditis elegans embryo is mediated by cytoplasmic localization under control of the maternal genome. Using nine newly isolated mutations, and two existing mutations, we have analyzed the role of the maternally expressed gene par-4 in cytoplasmic localization. We recovered seven new par-4 alleles in screens for maternal effect lethal mutations that result in failure to differentiate intestinal cells. Two additional par-4 mutations were identified in noncomplementation screens using strains with a high frequency of transposon mobility. All 11 mutations cause defects early in development of embryos produced by homozygous mutant mothers. Analysis with a deficiency in the region indicates that it33 is a strong loss-of-function mutation. par-4(it33) terminal stage embryos contain many cells, but show no morphogenesis, and are lacking intestinal cells. Temperature shifts with the it57ts allele suggest that the critical period for both intestinal differentiation and embryo viability begins during oogenesis, about 1.5 hr before fertilization, and ends before the four-cell stage. We propose that the primary function of the par-4 gene is to act as part of a maternally encoded system for cytoplasmic localization in the first cell cycle, with par-4 playing a particularly important role in the determination of intestine. Analysis of a par-4;par-2 double mutant suggests that par-4 and par-2 gene products interact in this system. PMID:1582558

  13. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    PubMed

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  14. Mutations within the HBc gene of the hepatitis B virus: a study on Iranian patients.

    PubMed

    Zare-Bidaki, Mohammad; Ayoobi, Fatemeh; Hassanshahi, Gholamhossein; Arababadi, Mohammad Kazemi; Mirzaei, Tayebeh; Darehdori, Ahmad Shebanizade; Kennedy, Derek

    2014-01-01

    Hepatitis B virus (HBV) is a serious risk factor for several severe liver diseases such as cirrhosis and hepatocellular carcinoma. HBV, like other viruses, uses several mechanisms to escape from specific immune responses including the use of mutations in the genome which lead to epitope variations. There are several immune responses, including T helper cells, cytotoxic T lymphocytes, and B cells, against the core antigen of HBV (HBcAg) that can lead to HBV eradication. Therefore, mutations within the HBc gene can lead to escape from immune responses by HBV and, hence, understanding the prevalence of HBc mutations among a specific population can be helpful for future treatment and vaccination. This review addresses the recent information regarding the prevalence of mutations within the HBc gene among Iranian HBV infected patients. The data presented here was collected gene sequences reported from Iran to the NCBI nucleotide Gen Bank. Results showed that the prevalence of HBc gene mutations is frequent in Iranian HBV infected patients. Based on our searches it seems that escape from immune responses is a plausible reason for the high prevalence of HBc gene mutations among Iranian HBV infected patients.

  15. Somatic alterations of the serine/threonine kinase LKB1 gene in squamous cell (SCC) and large cell (LCC) lung carcinoma.

    PubMed

    Strazisar, Mojca; Mlakar, Vid; Rott, Tomaz; Glavac, Damjan

    2009-05-01

    Somatic LKB1 serine/threonine kinase alterations are rare in sporadic cancers, with the exception lung adenocarcinoma, but no mutations in squamous cell or large cell primary carcinoma were discovered. We screened the LKB1 gene in 129 primary nonsmall cell lung carcinomas, adjacent healthy lung tissue, and control blood samples. Forty-five percent of nonsmall cell lung tumors harbored either intron or exon alterations. We identified R86G, F354L, Y272Y and three polymorphisms: 290+36G/T, 386+156G/T, and 862+145C/T (novel). R86G (novel) and F354L mutations were found in six squamous cell carcinomas and three large cell cancer carcinomas, but not in the adjacent healthy tissue or controls samples. The F354L mutation was found in advanced squamous cell carcinomas with elevated COX-2 expression, rare P53, and no K-RAS mutation. Results indicate that the LKB1 gene is changed in a certain proportion of nonsmall cell lung tumors, predominately in advanced squamous lung carcinoma. Inactivation of the gene takes place via the C-terminal domain and could be related to mechanisms influencing tumor initiation, differentiation, and metastasis.

  16. A case report of novel mutation in PRF1 gene, which causes familial autosomal recessive hemophagocytic lymphohistiocytosis.

    PubMed

    Bordbar, Mohammad Reza; Modarresi, Farzaneh; Farazi Fard, Mohammad Ali; Dastsooz, Hassan; Shakib Azad, Nader; Faghihi, Mohammad Ali

    2017-05-03

    Hemophagocytic Lymphohistiocytosis (HLH) is a life-threatening immunodeficiency and multi-organ disease that affects people of all ages and ethnic groups. Common symptoms and signs of this disease are high fever, hepatosplenomegaly, and cytopenias. Familial form of HLH disease, which is an autosomal recessive hematological disorder is due to disease-causing mutations in several genes essential for NK and T-cell granule-mediated cytotoxic function. For an effective cytotoxic response from cytotoxic T lymphocyte or NK cell encountering an infected cell or tumor cell, different processes are required, including trafficking, docking, priming, membrane fusion, and entry of cytotoxic granules into the target cell leading to apoptosis. Therefore, genes involved in these steps play important roles in the pathogenesis of HLH disease which include PRF1, UNC13D (MUNC13-4), STX11, and STXBP2 (MUNC18-2). Here, we report a novel missense mutation in an 8-year-old boy suffered from hepatosplenomegaly, hepatitis, epilepsy and pancytopenia. The patient was born to a first-cousin parents with no previous documented disease in his parents. To identify mutated gene in the proband, Whole Exome Sequencing (WES) utilizing next generation sequencing was used on an Illumina HiSeq 2000 platform on DNA sample from the patient. Results showed a novel deleterious homozygous missense mutation in PRF1 gene (NM_001083116: exon3: c. 1120 T > G, p.W374G) in the patient and then using Sanger sequencing it was confirmed in the proband and his parents. Since his parents were heterozygous for the identified mutation, autosomal recessive pattern of inheritance was confirmed in the family. Our study identified a rare new pathogenic missense mutation in PRF1 gene in patient with HLH disease and it is the first report of mutation in PRF1 in Iranian patients with this disease.

  17. Mutagenic effect of accelerated heavy ions on bacterial cells

    NASA Astrophysics Data System (ADS)

    Boreyko, A. V.; Krasavin, E. A.

    2011-11-01

    The heavy ion accelerators of the Joint Institute for Nuclear Research were used to study the regularities and mechanisms of formation of different types of mutations in prokaryote cells. The induction of direct (lac-, ton B-, col B) mutations for Esherichia coli cells and reverse his- → His+ mutations of Salmonella typhimurium, Bacillus subtilis cells under the action of radiation in a wide range of linear energy transfer (LET) was studied. The regularities of formation of gene and structural (tonB trp-) mutations for Esherichia coli bacteria under the action of accelerated heavy ions were studied. It was demonstrated that the rate of gene mutations as a function of the dose under the action of Γ rays and accelerated heavy ions is described by linear-quadratic functions. For structural mutations, linear "dose-effect" dependences are typical. The quadratic character of mutagenesis dose curves is determined by the "interaction" of two independent "hitting" events in the course of SOS repair of genetic structures. The conclusion made was that gene mutations under the action of accelerated heavy ions are induced by δ electron regions of charged particle tracks. The methods of SOS chromotest, SOS lux test, and λ prophage induction were used to study the regularities of SOS response of cells under the action of radiations in a wide LET range. The following proposition was substantiated: the molecular basis for formation of gene mutations are cluster single-strand DNA breaks, and that for structural mutations, double-strand DNA breaks. It was found out that the LET dependence of the relative biological efficiency of accelerated ions is described by curves with a local maximum. It was demonstrated that the biological efficiency of ionizing radiations with different physical characteristics on cells with different genotype, estimated by the lethal action, induction of gene and deletion mutations, precision excision of transposons, is determined by the specific features of energy transfer of the radiations that affect the character of induced DNA damage, and the efficiency inducible and constitutive cell repair systems. The growth of relative biological efficiency of heavy charged particles is determined by the growth of the damage yield of the DNA participating in the formation of radiation-induced effects, and higher efficiency of inducible repair systems. It was established that the LET value ( L max) for which the maximum (according to the applied irradiation criteria) coefficients of relative biological efficiency are observed varies depending on the character of the registered radiation induced effect. It was demonstrated that for gene mutations and induction of precision excision of mobile elements the values of L max are realized in a LET range of ≈20 keV/μm. For lethal effects of irradiation and induction of deletion mutations the value of L max is ≈ 100 and 50 keV/μm, respectively. The differences in the L max for the studied radiation gene effectis are determined by the different type of DNA damage participating in the mutation process. A molecular model of the formation of gene mutations in Escherichia coli cells under the action of ionizing radiation was proposed. Basic DNA radiation damage and main repair ways were considered in the framework of this model. The basis is the idea of the decisive role of mutagenic, error-prone, branch of SOS repair in fixing premutation DNA damage into point mutations. It was demonstrated that the central mechanism in this process is the formation of an inducible multi-enzymatic complex including the DNA polymerase V (Umu C), RecA-protease, SSB proteins, subunits of DNA polymerase III, performing erroneous DNA synthesis on the damaged matrix. A mathematical model of induction of gene mutations under ultraviolet cell irradiation was developed based on the molecular model.

  18. p53 mutation, but not in vitro predictor genes of therapeutic efficacy of cisplatin, is clinically relevant in comparing partial and complete responder cases of maxillary squamous cell carcinoma.

    PubMed

    Kudo, Itsuhiro; Esumi, Mariko; Kida, Akihiro; Ikeda, Minoru

    2010-10-01

    To predict the efficacy of cisplatin and radiation therapy for maxillary squamous cell carcinoma, we examined the mRNA expression of 14 cisplatin-resistant genes and p53 mutation in specimens biopsied from patients prior to initiation of therapy. Five of 10 patients had mutations in the p53 gene, of whom four had residual tumors pathologically following chemoradiotherapy (p=0.0476). Of 14 genes examined, the mRNA expression of ATP7B was significantly lower in cases that were resistant to chemoradiotherapy. Six genes including multidrug resistance protein 1 (MDR-1), multidrug resistance associated protein 1 (MRP-1), Cu++ transporting, beta polypeptide (ATP7B), xeroderma pigmentosum, complementation group A (XPA), excision repair cross-complementing rodent repair deficiency, complementation group 1 (ERCC-1) and B-cell CLL/lymphoma 2 (BCL2) were down-regulated in cases of recurrent cancers. These results show that the evaluation of p53 mutation provides the most useful predictor of therapeutic effects. In responder cases, the drug-resistant genes that were determined in cell lines by culture do not necessarily translate into clinical relevance.

  19. Mutational Analysis of Cell Types in Tuberous Sclerosis Complex (TSC)

    DTIC Science & Technology

    2007-01-01

    disorder resulting from mutations in the TSC1 or TSC2 genes that is associated with epilepsy, cognitive disability, and autism . TSC1/TSC2 gene mutations...cognitive disability, and autism . TSC1/TSC2 gene mutations lead to developmental alterations in brain structure known as tubers in over 80% of TSC...TSC (Sparagana and Roach, 2000). Comorbid neuropsychological disorders such as autism , mental retardation (MR), pervasive developmental disorder

  20. Oncogenic PIK3CA gene mutations and HER2/neu gene amplifications determine the sensitivity of uterine serous carcinoma cell lines to GDC-0980, a selective inhibitor of Class I PI3 kinase and mTOR kinase (TORC1/2).

    PubMed

    English, Diana P; Bellone, Stefania; Cocco, Emiliano; Bortolomai, Ileana; Pecorelli, Sergio; Lopez, Salvatore; Silasi, Dan-Arin; Schwartz, Peter E; Rutherford, Thomas; Santin, Alessandro D

    2013-11-01

    To evaluate PIK3CA mutational status and c-erbB2 gene amplification in a series of primary uterine serous carcinomas (USC) cell lines. To assess the efficacy of GDC-0980, a potent inhibitor of Class I PI3 kinase and mTOR kinase (TORC1/2), against primary USC harboring HER2/neu gene amplification and/or PIK3CA mutations. Twenty-two primary USC cell lines were evaluated for c-erbB2 oncogene amplification by fluorescence in situ hybridization (FISH) assays and for PIK3CA gene mutations by direct DNA sequencing of exons 9 and 20. In vitro sensitivity to GDC-0980 was evaluated by flow-cytometry-based viability and proliferation assays. Downstream cellular responses to GDC-0980 were assessed by measuring phosphorylation of the 4-EBP1 protein by flow-cytometry. Five of 22 (22.7%) USC cell lines contained oncogenic PIK3CA mutations although 9 (40.9%) harbored c-erbB2 gene amplification by FISH. GDC-0980 caused a strong differential growth inhibition in FISH+ USC when compared with FISH- (GDC-0980 IC50 mean ± SEM = 0.29 ± 0.05 μM in FISH+ vs 1.09 ± 0.20 μM in FISH- tumors, P = .02). FISH+ USC harboring PIK3CA mutations were significantly more sensitive to GDC-0980 exposure when compared with USC cell lines harboring wild-type PIK3CA (P = .03). GDC-0980 growth-inhibition was associated with a significant and dose-dependent decline in phosphorylated 4-EBP1 levels. Oncogenic PIK3CA mutations and c-erbB2 gene amplification may represent biomarkers to identify patients harboring USC who may benefit most from the use of GDC-0980. Copyright © 2013 Mosby, Inc. All rights reserved.

  1. Mutation of a chitinase-like gene causes ectopic deposition of lignin, aberrant cell shapes, and overproduction of ethylene.

    PubMed

    Zhong, Ruiqin; Kays, Stanley J; Schroeder, Betty P; Ye, Zheng-Hua

    2002-01-01

    Chitinase-like proteins have long been proposed to play roles in normal plant growth and development, but no mutations in chitinase-like genes have been obtained previously to support this hypothesis. In this study, we have shown that the gene responsible for the elp1 mutation in Arabidopsis encodes a chitinase-like protein (AtCTL1). Mutation of this chitinase-like gene caused ectopic deposition of lignin and aberrant shapes of cells with incomplete cell walls in the pith of inflorescence stems. The AtCTL1 gene was expressed in all organs during normal plant growth and development, but it was not induced by wounding, salicylic acid, pectin fragments, or ethylene. Consistent with its ubiquitous expression pattern, mutation of the AtCTL1 gene affected many aspects of plant growth and development, including exaggerated hook curvature, reduced length and increased diameter of hypocotyls in dark-grown seedlings, and reduced root length and increased number of root hairs in light-grown seedlings. The mutant phenotypes could be rescued partially by ethylene inhibitors, and ethylene production in the mutant was significantly greater than in the wild type. Together, these results suggest that AtCTL1, a chitinase-like gene, is essential for normal plant growth and development in Arabidopsis.

  2. Comparative Oncogenomics for Peripheral Nerve Sheath Cancer Gene Discovery

    DTIC Science & Technology

    2015-06-01

    neurofibromas and MPNSTs, establish gene signatures defining distinct tumor subtypes and functionally test the role of selected driver mutations ...allografted tumor cells, and a variety of in vitro functional assays. We will validate the relevance of these mutated mouse genes in human neurofibromas...and MPNSTs by determining whether these same genes are mutated in human tumors. 15. SUBJECT TERMS Nothing listed 16. SECURITY CLASSIFICATION OF: 17

  3. Functioning and nonfunctioning thyroid adenomas involve different molecular pathogenetic mechanisms.

    PubMed

    Tonacchera, M; Vitti, P; Agretti, P; Ceccarini, G; Perri, A; Cavaliere, R; Mazzi, B; Naccarato, A G; Viacava, P; Miccoli, P; Pinchera, A; Chiovato, L

    1999-11-01

    The molecular biology of follicular cell growth in thyroid nodules is still poorly understood. Because gain-of-function (activating) mutations of the thyroid-stimulating hormone receptor (TShR) and/or Gs alpha genes may confer TSh-independent growth advantage to neoplastic thyroid cells, we searched for somatic mutations of these genes in a series of hyperfunctioning and nonfunctioning follicular thyroid adenomas specifically selected for their homogeneous gross anatomy (single nodule in an otherwise normal thyroid gland). TShR gene mutations were identified by direct sequencing of exons 9 and 10 of the TShR gene in genomic DNA obtained from surgical specimens. Codons 201 and 227 of the Gs alpha gene were also analyzed. At histology, all hyperfunctioning nodules and 13 of 15 nonfunctioning nodules were diagnosed as follicular adenomas. Two nonfunctioning thyroid nodules, although showing a prevalent microfollicular pattern of growth, had histological features indicating malignant transformation (a minimally invasive follicular carcinoma and a focal papillary carcinoma). Activating mutations of the TShR gene were found in 12 of 15 hyperfunctioning follicular thyroid adenomas. In one hyperfunctioning adenoma, which was negative for TShR mutations, a mutation in codon 227 of the Gs alpha gene was identified. At variance with hyperfunctioning thyroid adenomas, no mutation of the TShR or Gs alpha genes was detected in nonfunctioning thyroid nodules. In conclusion, our findings clearly define a different molecular pathogenetic mechanism in hyperfunctioning and nonfunctioning follicular thyroid adenomas. Activation of the cAMP cascade, which leads to proliferation but maintains differentiation of follicular thyroid cells, typically occurs in hyperfunctioning thyroid adenomas. Oncogenes other than the TShR and Gs alpha genes are probably involved in nonfunctioning follicular adenomas.

  4. Cytology smears as diagnostic material for EGFR gene testing in non-small cell lung cancer.

    PubMed

    Powrózek, Tomasz; Krawczyk, Paweł; Pankowski, Juliusz; Reszka, Katarzyna; Jakubiak, Magdalena; Obrochta, Anna; Wojas-Krawczyk, Kamila; Buczkowski, Jarosław; Milanowski, Janusz

    2015-11-14

    Cytology smears can be effectively used for EGFR mutation testing in the qualification of NSCLC patients for EGFR tyrosine kinase inhibitor therapy. However, tissue specimens are preferred for EGFR mutation analysis. The aim of this study was to estimate the effectiveness of the real-time PCR method for EGFR testing in histology and cytology materials obtained simultaneously from NSCLC patients. Fourteen adenocarcinoma patients with EGFR-mutation-positive primary tumor tissues were included in the study. Corresponding cytological smears of metastatic lymph nodes obtained by EBUS-TBNA were examined. EGFR Mutation Analysis Kit (EntroGen, USA) and real-time PCR (m2000rt system, Abbott, USA) were used for EGFR mutation analysis in both types of material. In primary tumor tissues, 12 deletions in exon 19 and 2 substitutions in exon 21 (L858R mutation) of the EGFR gene were found. Except for 1 deletion in exon 19, the same EGFR gene mutations were detected in all corresponding cytology samples. The percentage of tumor cells, DNA concentration, percentage of mutated DNA as well as ΔCt values were similar in cytology slides and histology material. In both types of materials, no significant correlations were found between the percentage of tumor cells and the percentage of mutated DNA nor between the DNA concentration and the percentage of mutated DNA. We demonstrated the high effectiveness of a sensitive real-time PCR method in EGFR gene mutation detection in cytology smears.

  5. Identifying activating mutations in the EGFR gene: prognostic and therapeutic implications in non-small cell lung cancer.

    PubMed

    Lopes, Gabriel Lima; Vattimo, Edoardo Filippo de Queiroz; Castro Junior, Gilberto de

    2015-01-01

    Lung cancer is the leading cause of cancer-related deaths worldwide. Promising new therapies have recently emerged from the development of molecular targeted drugs; particularly promising are those blocking the signal transduction machinery of cancer cells. One of the most widely studied cell signaling pathways is that of EGFR, which leads to uncontrolled cell proliferation, increased cell angiogenesis, and greater cell invasiveness. Activating mutations in the EGFR gene (deletions in exon 19 and mutation L858R in exon 21), first described in 2004, have been detected in approximately 10% of all non-squamous non-small cell lung cancer (NSCLC) patients in Western countries and are the most important predictors of a response to EGFR tyrosine-kinase inhibitors (EGFR-TKIs). Studies of the EGFR-TKIs gefitinib, erlotinib, and afatinib, in comparison with platinum-based regimens, as first-line treatments in chemotherapy-naïve patients have shown that the EGFR-TKIs produce gains in progression-free survival and overall response rates, although only in patients whose tumors harbor activating mutations in the EGFR gene. Clinical trials have also shown EGFR-TKIs to be effective as second- and third-line therapies in advanced NSCLC. Here, we review the main aspects of EGFR pathway activation in NSCLC, underscore the importance of correctly identifying activating mutations in the EGFR gene, and discuss the main outcomes of EGFR-TKI treatment in NSCLC.

  6. Genetic heterogeneity of diffuse large B-cell lymphoma.

    PubMed

    Zhang, Jenny; Grubor, Vladimir; Love, Cassandra L; Banerjee, Anjishnu; Richards, Kristy L; Mieczkowski, Piotr A; Dunphy, Cherie; Choi, William; Au, Wing Yan; Srivastava, Gopesh; Lugar, Patricia L; Rizzieri, David A; Lagoo, Anand S; Bernal-Mizrachi, Leon; Mann, Karen P; Flowers, Christopher; Naresh, Kikkeri; Evens, Andrew; Gordon, Leo I; Czader, Magdalena; Gill, Javed I; Hsi, Eric D; Liu, Qingquan; Fan, Alice; Walsh, Katherine; Jima, Dereje; Smith, Lisa L; Johnson, Amy J; Byrd, John C; Luftig, Micah A; Ni, Ting; Zhu, Jun; Chadburn, Amy; Levy, Shawn; Dunson, David; Dave, Sandeep S

    2013-01-22

    Diffuse large B-cell lymphoma (DLBCL) is the most common form of lymphoma in adults. The disease exhibits a striking heterogeneity in gene expression profiles and clinical outcomes, but its genetic causes remain to be fully defined. Through whole genome and exome sequencing, we characterized the genetic diversity of DLBCL. In all, we sequenced 73 DLBCL primary tumors (34 with matched normal DNA). Separately, we sequenced the exomes of 21 DLBCL cell lines. We identified 322 DLBCL cancer genes that were recurrently mutated in primary DLBCLs. We identified recurrent mutations implicating a number of known and not previously identified genes and pathways in DLBCL including those related to chromatin modification (ARID1A and MEF2B), NF-κB (CARD11 and TNFAIP3), PI3 kinase (PIK3CD, PIK3R1, and MTOR), B-cell lineage (IRF8, POU2F2, and GNA13), and WNT signaling (WIF1). We also experimentally validated a mutation in PIK3CD, a gene not previously implicated in lymphomas. The patterns of mutation demonstrated a classic long tail distribution with substantial variation of mutated genes from patient to patient and also between published studies. Thus, our study reveals the tremendous genetic heterogeneity that underlies lymphomas and highlights the need for personalized medicine approaches to treating these patients.

  7. Role of Human DNA Polymerase and Its Accessory Proteins in Breast Cancer

    DTIC Science & Technology

    2002-04-01

    the POLD1 gene in breast cancer tissues using a Non-Isotopic RNase Cleavage Assay (NIRCA) and DNA sequencing techniques. Four novel mutations , P327L...M.Y.W.T. Mutational Analysis of the Exo Motif of POLD1 gene in human Breast Cancer cells (in preparation) 9. Jaime, C., Mazloum N., and Lee, M.Y.W. T...Cold Spring Harbor 1999 8. Xu, H., and Lee, M.Y.W.T. Analyzes of POLD1 gene mutation and study of its transcriptional regulation in Breast Cancer Cells

  8. Enhanced Eradication of Lymphoma by Tumor-Specific Cytotoxic T Cells Secreting an Engineered Tumor-Specific Immunotoxin

    DTIC Science & Technology

    2008-06-01

    verified the insertion of the genes in our expression plasmids and in our lentivirus vectors. Transduction/selection of the 293T with mutated E2F... mutation created in this gene is located in the PEA targeted region of EF-2, it prevents the interaction of these 2 proteins and thus the cell death...We have cloned this mutated elongation factor in an expression vector and in a lentivirus plasmid also encoding a marker gene . The mEF-2-lentivirus

  9. The ALCHEMIST Lung Cancer Trials

    Cancer.gov

    A collection of material about the ALCHEMIST lung cancer trials that will examine tumor tissue from patients with certain types of early-stage, completely resected non-small cell lung cancer for gene mutations in the EGFR and ALK genes, and assign patients with these gene mutations to treatment trials testing post-surgical use of drugs targeted against these mutations.

  10. Molecular characterization of oral squamous cell carcinoma using targeted next-generation sequencing.

    PubMed

    Er, Tze-Kiong; Wang, Yen-Yun; Chen, Chih-Chieh; Herreros-Villanueva, Marta; Liu, Ta-Chih; Yuan, Shyng-Shiou F

    2015-10-01

    Many genetic factors play an important role in the development of oral squamous cell carcinoma. The aim of this study was to assess the mutational profile in oral squamous cell carcinoma using formalin-fixed, paraffin-embedded tumors from a Taiwanese population by performing targeted sequencing of 26 cancer-associated genes that are frequently mutated in solid tumors. Next-generation sequencing was performed in 50 formalin-fixed, paraffin-embedded tumor specimens obtained from patients with oral squamous cell carcinoma. Genetic alterations in the 26 cancer-associated genes were detected using a deep sequencing (>1000X) approach. TP53, PIK3CA, MET, APC, CDH1, and FBXW7 were most frequently mutated genes. Most remarkably, TP53 mutations and PIK3CA mutations, which accounted for 68% and 18% of tumors, respectively, were more prevalent in a Taiwanese population. Other genes including MET (4%), APC (4%), CDH1 (2%), and FBXW7 (2%) were identified in our population. In summary, our study shows the feasibility of performing targeted sequencing using formalin-fixed, paraffin-embedded samples. Additionally, this study also reports the mutational landscape of oral squamous cell carcinoma in the Taiwanese population. We believe that this study will shed new light on fundamental aspects in understanding the molecular pathogenesis of oral squamous cell carcinoma and may aid in the development of new targeted therapies. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. INS-gene mutations: from genetics and beta cell biology to clinical disease.

    PubMed

    Liu, Ming; Sun, Jinhong; Cui, Jinqiu; Chen, Wei; Guo, Huan; Barbetti, Fabrizio; Arvan, Peter

    2015-04-01

    A growing list of insulin gene mutations causing a new form of monogenic diabetes has drawn increasing attention over the past seven years. The mutations have been identified in the untranslated regions of the insulin gene as well as the coding sequence of preproinsulin including within the signal peptide, insulin B-chain, C-peptide, insulin A-chain, and the proteolytic cleavage sites both for signal peptidase and the prohormone convertases. These mutations affect a variety of different steps of insulin biosynthesis in pancreatic beta cells. Importantly, although many of these mutations cause proinsulin misfolding with early onset autosomal dominant diabetes, some of the mutant alleles appear to engage different cellular and molecular mechanisms that underlie beta cell failure and diabetes. In this article, we review the most recent advances in the field and discuss challenges as well as potential strategies to prevent/delay the development and progression of autosomal dominant diabetes caused by INS-gene mutations. It is worth noting that although diabetes caused by INS gene mutations is rare, increasing evidence suggests that defects in the pathway of insulin biosynthesis may also be involved in the progression of more common types of diabetes. Collectively, the (pre)proinsulin mutants provide insightful molecular models to better understand the pathogenesis of all forms of diabetes in which preproinsulin processing defects, proinsulin misfolding, and ER stress are involved. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. INS-gene mutations: From genetics and beta cell biology to clinical disease

    PubMed Central

    Liu, Ming; Sun, Jinhong; Cui, Jinqiu; Chen, Wei; Guo, Huan; Barbetti, Fabrizio; Arvan, Peter

    2015-01-01

    A growing list of insulin gene mutations causing a new form of monogenic diabetes has drawn increasing attention over the past seven years. The mutations have been identified in the untranslated regions of the insulin gene as well as the coding sequence of preproinsulin including within the signal peptide, insulin B-chain, C-peptide, insulin A-chain, and the proteolytic cleavage sites both for signal peptidase and the prohormone convertases. These mutations affect a variety of different steps of insulin biosynthesis in pancreatic beta cells. Importantly, although many of these mutations cause proinsulin misfolding with early onset autosomal dominant diabetes, some of the mutant alleles appear to engage different cellular and molecular mechanisms that underlie beta cell failure and diabetes. In this article, we review the most recent advances in the field and discuss challenges as well as potential strategies to prevent/delay the development and progression of autosomal dominant diabetes caused by INS-gene mutations. It is worth noting that although diabetes caused by INS gene mutations is rare, increasing evidence suggests that defects in the pathway of insulin biosynthesis may also be involved in the progression of more common types of diabetes. Collectively, the (pre)proinsulin mutants provide insightful molecular models to better understand the pathogenesis of all forms of diabetes in which preproinsulin processing defects, proinsulin misfolding, and ER stress are involved. PMID:25542748

  13. Genetics Home Reference: polycythemia vera

    MedlinePlus

    ... mutations occur in the DNA of a hematopoietic stem cell . These stem cells are located in the bone marrow and ... controlling the production of blood cells from hematopoietic stem cells. JAK2 gene mutations result in the production ...

  14. [The PIG-A gene as a new biomarker of mutagenesis: proof of concept and technical specifications].

    PubMed

    Castel, Pierre; Carcopino, Xavier; Robert, Stéphane; Bonetto, Rémi; Cowen, Didier; Orsiere, Thierry

    2017-04-01

    Gene mutations are not directly detected by current genotoxicity assays and most of them need a cell culture step. The whole blood PIG-A assay consists in the detection of the mutation frequency within the PIG-A sentinel gene by identification of glycosyl-phosphatidyl-inositol (GPI-) deficient cells. PIG-A mutated/GPI-deficient cells can be detected by flow cytometry as they no longer express surface fluorescence for GPI-linked markers. The last researches have focused on cell enrichment techniques leading to increased throughput and sensitivity. The results of this new and promising biomarker of mutagenesis, performed in humans or rodents, are now available within 2 hours after blood collection. © 2017 médecine/sciences – Inserm.

  15. [A preliminary study on p53 gene in lung cancer tissues of workers exposed to silica and welding fumes].

    PubMed

    Liu, B; Zhou, P; Miao, Q

    1997-05-01

    Mutations of suppressor gene p53 was studied in 36 cases of silica related lung cancer and 6 cases of welding fume related lung cancer with immunohistochemical and PCR-SSCP methods. Cancer tissues were embedded in paraffin and stored for 13.4 years in average. Results revealed that there was abnormal mobility shift of electrophoresis in 18 cases with 20 point mutations of 42 specimens tested, accounted for 42.9%, and 50% (10/20) of the mutations were clustered in exon 8. This finding differed from mutational spectrum of gene in non-occupational lung cancer, in which mutation frequency of exon 8 ranged from 17.5% to 23.5%. Gene mutation frequency in varied pathological categories of pneumoconiosis related lung cancer also differed from that in common lung cancer. In the latter, the highest one was in small cell lung cancer (70%) and the lowest in adenocarcinoma (33%), but in the former, the highest in adenocarcinoma (53.9%) and the lowest in small cell lung cancer (30.8%). Immunohistochemical observations also showed a very high prevalence of p53 gene mutation expression (46.9%). Sequencing, which was determined in two cases of this study, revealed that two point mutations all occurred in non-hotspot codon 144 of p53 gene. Difference in gene mutation spectrum suggests that there exist specific carcinogens and carcinogenesis in silica and welding fume related lung cancer.

  16. Genetics Home Reference: trichohepatoenteric syndrome

    MedlinePlus

    ... Genetic Changes Trichohepatoenteric syndrome can be caused by mutations in the TTC37 or SKIV2L gene. These genes ... and abnormal mRNA is important for cell growth. Mutations in the TTC37 or SKIV2L gene likely eliminate ...

  17. Somatic mosaicism containing double mutations in PTCH1 revealed by generation of induced pluripotent stem cells from nevoid basal cell carcinoma syndrome.

    PubMed

    Ikemoto, Yu; Takayama, Yoshinaga; Fujii, Katsunori; Masuda, Mokuri; Kato, Chise; Hatsuse, Hiromi; Fujitani, Kazuko; Nagao, Kazuaki; Kameyama, Kohzoh; Ikehara, Hajime; Toyoda, Masashi; Umezawa, Akihiro; Miyashita, Toshiyuki

    2017-08-01

    Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder characterised by developmental defects and tumorigenesis, such as medulloblastomas and basal cell carcinomas, caused by mutations of the patched-1 ( PTCH1 ) gene. In this article, we seek to demonstrate a mosaicism containing double mutations in PTCH1 in an individual with NBCCS. A de novo germline mutation of PTCH1 (c.272delG) was detected in a 31-year-old woman with NBCCS. Gene analysis of two out of four induced pluripotent stem cell (iPSC) clones established from the patient unexpectedly revealed an additional mutation, c.274delT. Deep sequencing confirmed a low-prevalence somatic mutation (5.5%-15.6% depending on the tissue) identical to the one found in iPSC clones. This is the first case of mosaicism unequivocally demonstrated in NBCCS. Furthermore, the mosaicism is unique in that the patient carries one normal and two mutant alleles. Because these mutations are located in close proximity, reversion error is likely to be involved in this event rather than a spontaneous mutation. In addition, this study indicates that gene analysis of iPSC clones can contribute to the detection of mosaicism containing a minor population carrying a second mutation. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  18. Tissue-Specific Effects of Reduced β-catenin Expression on Adenomatous Polyposis Coli Mutation-Instigated Tumorigenesis in Mouse Colon and Ovarian Epithelium

    PubMed Central

    Feng, Ying; Sakamoto, Naoya; Wu, Rong; Liu, Jie-yu; Wiese, Alexandra; Green, Maranne E.; Green, Megan; Akyol, Aytekin; Roy, Badal C.; Zhai, Yali; Cho, Kathleen R.; Fearon, Eric R.

    2015-01-01

    Adenomatous polyposis coli (APC) inactivating mutations are present in most human colorectal cancers and some other cancers. The APC protein regulates the β-catenin protein pool that functions as a co-activator of T cell factor (TCF)-regulated transcription in Wnt pathway signaling. We studied effects of reduced dosage of the Ctnnb1 gene encoding β-catenin in Apc-mutation-induced colon and ovarian mouse tumorigenesis and cell culture models. Concurrent somatic inactivation of one Ctnnb1 allele, dramatically inhibited Apc mutation-induced colon polyposis and greatly extended Apc-mutant mouse survival. Ctnnb1 hemizygous dose markedly inhibited increases in β-catenin levels in the cytoplasm and nucleus following Apc inactivation in colon epithelium, with attenuated expression of key β-catenin/TCF-regulated target genes, including those encoding the EphB2/B3 receptors, the stem cell marker Lgr5, and Myc, leading to maintenance of crypt compartmentalization and restriction of stem and proliferating cells to the crypt base. A critical threshold for β-catenin levels in TCF-regulated transcription was uncovered for Apc mutation-induced effects in colon epithelium, along with evidence of a feed-forward role for β-catenin in Ctnnb1 gene expression and CTNNB1 transcription. The active β-catenin protein pool was highly sensitive to CTNNB1 transcript levels in colon cancer cells. In mouse ovarian endometrioid adenocarcinomas (OEAs) arising from Apc- and Pten-inactivation, while Ctnnb1 hemizygous dose affected β-catenin levels and some β-catenin/TCF target genes, Myc induction was retained and OEAs arose in a fashion akin to that seen with intact Ctnnb1 gene dose. Our findings indicate Ctnnb1 gene dose exerts tissue-specific differences in Apc mutation-instigated tumorigenesis. Differential expression of selected β-catenin/TCF-regulated genes, such as Myc, likely underlies context-dependent effects of Ctnnb1 gene dosage in tumorigenesis. PMID:26528816

  19. Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells.

    PubMed

    Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang

    2016-01-01

    Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future.

  20. Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells

    PubMed Central

    Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang

    2016-01-01

    Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future. PMID:27362942

  1. [B lymphocyte clonal evolution of human reactive lymph nodes revealed by lineage tree analysis].

    PubMed

    Tabibian-Keissar, Hilla; Schiby, Ginette; Azogui-Rosenthal, Noemie; Hazanov, Helena; Rakovsky, Aviya Shapira; Michaeli, Miri; Rosenblatt, Kinneret; Mehr, Ramit; Barshack, Iris

    2013-06-01

    Hypermutation and selection processes, characterizing T-dependent B cell responses taking place in germinal centers of lymph nodes, lead to B cell receptor affinity maturation. Those immune responses lead to the development of memory B cells and plasma cells that secrete high amounts of antibody molecules. The dynamics of B cell clonal evolution during affinity maturation has significant importance in infectious and autoimmune diseases, malignancies and aging. Immunoglobulin (Ig) gene mutational Lineage tree construction by comparing variable regions of Ig-gene sequences to the Ig germline gene is an interesting approach for studying B cell cLonal evolution. Lineage tree shapes and Ig gene mutations can be evaluated not only qualitatively and intuitively, but also quantitatively, and thus reveal important information related to hypermutation and selection. In this paper we describe the experimental protocols that we used for PCR amplification of Igvariable region genes from human formalin fixed paraffin embedded reactive lymph node tissues and the subsequent bioinformatical analyses of sequencing data using Ig mutational lineage trees. B cell populations of three out of four reactive Lymph node tissues were composed of several clones. Most of the Ig gene mutational lineage trees were small and narrow. Significant differences were not detected by quantification of Lineage trees. B lymphocyte clones that were detected in human reactive lymph node tissues represent major responding clones in normal polyclonal immune response. This result is in line with the polyclonal profile of B Lymphocyte populations that reside in reactive lymph node tissues.

  2. Generation of an allelic series of knock-in mice using recombinase-mediated cassette exchange (RMCE).

    PubMed

    Roebroek, Anton J M; Van Gool, Bart

    2014-01-01

    Molecular genetic strategies applying embryonic stem cell (ES cell) technologies to study the function of a gene in mice or to generate a mouse model for a human disease are continuously under development. Next to (conditional) inactivation of genes the application and importance of approaches to generate knock-in mutations are increasing. In this chapter the principle and application of recombinase-mediated cassette exchange (RMCE) are discussed as being a new emerging knock-in strategy, which enables easy generation of a series of different knock-in mutations within one gene. An RMCE protocol, which was used to generate a series of different knock-in mutations in the Lrp1 gene of ES cells, is described in detail as an example of how RMCE can be used to generate highly efficiently an allelic series of differently modified ES cell clones from a parental modified ES cell clone. Subsequently the differently modified ES cell clones can be used to generate an allelic series of mutant knock-in mice.

  3. Direct detection of a BRAF mutation in total RNA from melanoma cells using cantilever arrays

    NASA Astrophysics Data System (ADS)

    Huber, F.; Lang, H. P.; Backmann, N.; Rimoldi, D.; Gerber, Ch.

    2013-02-01

    Malignant melanoma, the deadliest form of skin cancer, is characterized by a predominant mutation in the BRAF gene. Drugs that target tumours carrying this mutation have recently entered the clinic. Accordingly, patients are routinely screened for mutations in this gene to determine whether they can benefit from this type of treatment. The current gold standard for mutation screening uses real-time polymerase chain reaction and sequencing methods. Here we show that an assay based on microcantilever arrays can detect the mutation nanomechanically without amplification in total RNA samples isolated from melanoma cells. The assay is based on a BRAF-specific oligonucleotide probe. We detected mutant BRAF at a concentration of 500 pM in a 50-fold excess of the wild-type sequence. The method was able to distinguish melanoma cells carrying the mutation from wild-type cells using as little as 20 ng µl-1 of RNA material, without prior PCR amplification and use of labels.

  4. Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.

    PubMed

    He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu

    2015-02-10

    Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.

  5. An exonic missense mutation c.28G>A is associated with weak B blood group by affecting RNA splicing of the ABO gene.

    PubMed

    Cai, Xiaohong; Qian, Chengrui; Wu, Wenman; Lei, Hang; Ding, Qiulan; Zou, Wei; Xiang, Dong; Wang, Xuefeng

    2017-09-01

    The amino acid substitutions caused by ABO gene mutations are usually predicted to impact glycosyltransferase's function or its biosynthesis. Here we report an ABO exonic missense mutation that affects B-antigen expression by decreasing the mRNA level of the ABO gene rather than the amino acid change. Serologic studies including plasma total GTB transfer capacity were performed. The exon sequences of the ABO gene were analyzed by Sanger sequencing. B 310 cDNA with c.28G>A (p.G10R) mutation was expressed in HeLa cells and total GTB transfer capacity in cell supernatant was measured. Flow cytometry was performed on these HeLa cells after transfection, and agglutination of Hela-B weak cells was also examined. The mRNA of the ABO gene was analyzed by direct sequencing and real-time reverse transcriptase-polymerase chain reaction. A minigene construct was prepared to evaluate the potential of splicing. While plasma total GTB transfer capacity was undetectable in this B 3 -like individual, the relative percentage of antigen-expressing cells and mean fluorescence index of the B weak red blood cells (RBCs) were 19 and 14% of normal B RBCs, respectively. There was no significant difference of total GTB transfer capacity in cell supernatant and B-antigen expression on cell surfaces between HeLa cells transfected with B 310 cDNA and B cDNA. The mRNA expression level of B 310 in peripheral whole blood was significantly reduced. The amount of splicing is significantly lower in c.28G>A construct compared to that in wild-type construct after transfection in K562 cells. ABO c.28G>A mutation may cause B 3 -like subgroup by affecting RNA splicing of the ABO gene. © 2017 AABB.

  6. Creation of Mice Bearing a Partial Duplication of HPRT Gene Marked with a GFP Gene and Detection of Revertant Cells In Situ as GFP-Positive Somatic Cells.

    PubMed

    Noda, Asao; Suemori, Hirofumi; Hirai, Yuko; Hamasaki, Kanya; Kodama, Yoshiaki; Mitani, Hiroshi; Landes, Reid D; Nakamura, Nori

    2015-01-01

    It is becoming clear that apparently normal somatic cells accumulate mutations. Such accumulations or propagations of mutant cells are thought to be related to certain diseases such as cancer. To better understand the nature of somatic mutations, we developed a mouse model that enables in vivo detection of rare genetically altered cells via GFP positive cells. The mouse model carries a partial duplication of 3' portion of X-chromosomal HPRT gene and a GFP gene at the end of the last exon. In addition, although HPRT gene expression was thought ubiquitous, the expression level was found insufficient in vivo to make the revertant cells detectable by GFP positivity. To overcome the problem, we replaced the natural HPRT-gene promoter with a CAG promoter. In such animals, termed HPRT-dup-GFP mouse, losing one duplicated segment by crossover between the two sister chromatids or within a single molecule of DNA reactivates gene function, producing hybrid HPRT-GFP proteins which, in turn, cause the revertant cells to be detected as GFP-positive cells in various tissues. Frequencies of green mutant cells were measured using fixed and frozen sections (liver and pancreas), fixed whole mount (small intestine), or by means of flow cytometry (unfixed splenocytes). The results showed that the frequencies varied extensively among individuals as well as among tissues. X-ray exposure (3 Gy) increased the frequency moderately (~2 times) in the liver and small intestine. Further, in two animals out of 278 examined, some solid tissues showed too many GFP-positive cells to score (termed extreme jackpot mutation). Present results illustrated a complex nature of somatic mutations occurring in vivo. While the HPRT-dup-GFP mouse may have a potential for detecting tissue-specific environmental mutagens, large inter-individual variations of mutant cell frequency cause the results unstable and hence have to be reduced. This future challenge will likely involve lowering the background mutation frequency, thus reducing inter-individual variation.

  7. Application of advanced cytometric and molecular technologies to minimal residual disease monitoring

    NASA Astrophysics Data System (ADS)

    Leary, James F.; He, Feng; Reece, Lisa M.

    2000-04-01

    Minimal residual disease monitoring presents a number of theoretical and practical challenges. Recently it has been possible to meet some of these challenges by combining a number of new advanced biotechnologies. To monitor the number of residual tumor cells requires complex cocktails of molecular probes that collectively provide sensitivities of detection on the order of one residual tumor cell per million total cells. Ultra-high-speed, multi parameter flow cytometry is capable of analyzing cells at rates in excess of 100,000 cells/sec. Residual tumor selection marker cocktails can be optimized by use of receiver operating characteristic analysis. New data minimizing techniques when combined with multi variate statistical or neural network classifications of tumor cells can more accurately predict residual tumor cell frequencies. The combination of these techniques can, under at least some circumstances, detect frequencies of tumor cells as low as one cell in a million with an accuracy of over 98 percent correct classification. Detection of mutations in tumor suppressor genes requires insolation of these rare tumor cells and single-cell DNA sequencing. Rare residual tumor cells can be isolated at single cell level by high-resolution single-cell cell sorting. Molecular characterization of tumor suppressor gene mutations can be accomplished using a combination of single- cell polymerase chain reaction amplification of specific gene sequences followed by TA cloning techniques and DNA sequencing. Mutations as small as a single base pair in a tumor suppressor gene of a single sorted tumor cell have been detected using these methods. Using new amplification procedures and DNA micro arrays it should be possible to extend the capabilities shown in this paper to screening of multiple DNA mutations in tumor suppressor and other genes on small numbers of sorted metastatic tumor cells.

  8. Photodamage: all signs lead to actinic keratosis and early squamous cell carcinoma.

    PubMed

    Wei, Jerry; Kok, Lai Fong; Byrne, Scott N; Halliday, Gary M

    2015-01-01

    Ultraviolet (UV) radiation is likely to drive the initiation and progression of skin cancer from actinic keratosis to squamous cell carcinoma. Signs of photodamage occur at multiple steps. UV radiation damages many cellular constituents, including lipids, proteins and DNA, all of which are likely to contribute to UV-induced skin cancer. Two biological events culminating from photodamage are mutations in the genes critical to the control of cell division, differentiation and invasion and immunosuppression. DNA photodamage, if unrepaired prior to cell division, can result in the incorporation of an incorrect nucleotide into newly synthesised DNA. Mutations in critical genes contribute to carcinogenesis. Photodamage to proteins such as those involved in DNA repair or proteins or lipids involved in cellular signalling can interfere with this repair process and contribute to mutagenesis. Mutations in key genes, including TP53, BRM, PTCH1, and HRAS, contribute to skin carcinogenesis. UV also damages immunity. Photodamage to DNA and signalling lipids as well as other molecular changes are detrimental to the key cells that regulate immunity. Photodamaged dendritic cells and altered responses by mast cells lead to the activation of T and B regulatory cells that suppress immunity to the protein products of UV-mutated genes. This stops the immune response from its protective function of destroying mutated cells, enabling the transformed cells to progress to skin cancer. UV appears to play a pivotal role at each of these steps, and therefore, signs of photodamage point to the development of skin cancer. © 2015 S. Karger AG, Basel.

  9. Generation of human iPSCs from an essential thrombocythemia patient carrying a V501L mutation in the MPL gene.

    PubMed

    Liu, Senquan; Ye, Zhaohui; Gao, Yongxing; He, Chaoxia; Williams, Donna W; Moliterno, Alison; Spivak, Jerry; Huang, He; Cheng, Linzhao

    2017-01-01

    Activating point mutations in the MPL gene encoding the thrombopoietin receptor are found in 3%-10% of essential thrombocythemia (ET) and myelofibrosis patients. Here, we report the derivation of induced pluripotent stem cells (iPSCs) from an ET patient with a heterozygous MPL V501L mutation. Peripheral blood CD34 + progenitor cells were reprogrammed by transient plasmid expression of OCT4, SOX2, KLF4, c-MYC plus BCL2L1 (BCL-xL) genes. The derived line M494 carries a MPL V501L mutation, displays typical iPSC morphology and characteristics, are pluripotent and karyotypically normal. Upon differentiation, the iPSCs are able to differentiate into cells derived from three germ layers. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  10. Somatic mutations in cancer: Stochastic versus predictable.

    PubMed

    Gold, Barry

    2017-02-01

    The origins of human cancers remain unclear except for a limited number of potent environmental mutagens, such as tobacco and UV light, and in rare cases, familial germ line mutations that affect tumor suppressor genes or oncogenes. A significant component of cancer etiology has been deemed stochastic and correlated with the number of stem cells in a tissue, the number of times the stem cells divide and a low incidence of random DNA polymerase errors that occur during each cell division. While somatic mutations occur during each round of DNA replication, mutations in cancer driver genes are not stochastic. Out of a total of 2843 codons, 1031 can be changed to stop codons by a single base substitution in the tumor suppressor APC gene, which is mutated in 76% of colorectal cancers (CRC). However, the nonsense mutations, which comprise 65% of all the APC driver mutations in CRC, are not random: 43% occur at Arg CGA codons, although they represent <3% of the codons. In TP53, CGA codons comprise <3% of the total 393 codons but they account for 72% and 39% of the mutations in CRC and ovarian cancer OVC, respectively. This mutation pattern is consistent with the kinetically slow, but not stochastic, hydrolytic deamination of 5-methylcytosine residues at specific methylated CpG sites to afford T·G mismatches that lead to C→T transitions and stop codons at CGA. Analysis of nonsense mutations in CRC, OVC and a number of other cancers indicates the need to expand the predictable risk factors for cancer to include, in addition to random polymerase errors, the methylation status of gene body CGA codons in tumor suppressor genes. Copyright © 2017. Published by Elsevier B.V.

  11. Tumor Hypoxia and Genetic Alterations in Sporadic Cancers

    PubMed Central

    Koi, Minoru; Boland, C.R.

    2011-01-01

    The cancer genome contains many gene alterations. How cancer cells acquire these alterations is a matter for discussion. One hypothesis is that cancer cells obtain mutations in genome stability genes at an early stage of tumor development, which results in genetic instability and generates a gene pool that enhances cellular proliferation and survival. Another hypothesis puts its emphasis on the natural selection of gene mutations for fitness. Recent data for systematic cancer genome sequencing shows that mutations in stability genes are rare in human sporadic cancers. Instead, many “passenger” mutations that do not drive the carcinogenesis process have been found in the cancer genome. Both the hypotheses mentioned above fall short in explaining recent data. Recently, many studies demonstrate the role of the tumor microenvironment, especially hypoxia and reoxygenation, in genetic instability. In this review, literature will be presented which supports a third hypothesis, i.e. that hypoxia/re-oxygenation induces genetic instability. PMID:21272156

  12. Deep targeted sequencing in pediatric acute lymphoblastic leukemia unveils distinct mutational patterns between genetic subtypes and novel relapse-associated genes.

    PubMed

    Lindqvist, C Mårten; Lundmark, Anders; Nordlund, Jessica; Freyhult, Eva; Ekman, Diana; Carlsson Almlöf, Jonas; Raine, Amanda; Övernäs, Elin; Abrahamsson, Jonas; Frost, Britt-Marie; Grandér, Dan; Heyman, Mats; Palle, Josefine; Forestier, Erik; Lönnerholm, Gudmar; Berglund, Eva C; Syvänen, Ann-Christine

    2016-09-27

    To characterize the mutational patterns of acute lymphoblastic leukemia (ALL) we performed deep next generation sequencing of 872 cancer genes in 172 diagnostic and 24 relapse samples from 172 pediatric ALL patients. We found an overall greater mutational burden and more driver mutations in T-cell ALL (T-ALL) patients compared to B-cell precursor ALL (BCP-ALL) patients. In addition, the majority of the mutations in T-ALL had occurred in the original leukemic clone, while most of the mutations in BCP-ALL were subclonal. BCP-ALL patients carrying any of the recurrent translocations ETV6-RUNX1, BCR-ABL or TCF3-PBX1 harbored few mutations in driver genes compared to other BCP-ALL patients. Specifically in BCP-ALL, we identified ATRX as a novel putative driver gene and uncovered an association between somatic mutations in the Notch signaling pathway at ALL diagnosis and increased risk of relapse. Furthermore, we identified EP300, ARID1A and SH2B3 as relapse-associated genes. The genes highlighted in our study were frequently involved in epigenetic regulation, associated with germline susceptibility to ALL, and present in minor subclones at diagnosis that became dominant at relapse. We observed a high degree of clonal heterogeneity and evolution between diagnosis and relapse in both BCP-ALL and T-ALL, which could have implications for the treatment efficiency.

  13. Charcot-Marie-Tooth Disease

    MedlinePlus

    ... with one X and one Y chromosome are male. In rare cases the gene mutation causing CMT ... involved in Schwann cell communication with the axon. Males who inherit one mutated gene from their mothers ...

  14. The Association Between Molecular Markers in Colorectal Sessile Serrated Polyps and Colorectal Cancer Risk

    DTIC Science & Technology

    2017-08-01

    mouse and human colon epithelium; Aim 2.) Perform genome editing using CRISPR /Cas9 on immortalized human colon epithelial cells to introduce CRC...relevant gene mutations; Aim 3.) Use CRISPR /Cas9 genome editing in colon organoid cultures to introduce CRC relevant gene mutations into primary colon cells

  15. Differential effect of mutational impairment of penicillin-binding proteins 1A and 1B on Escherichia coli strains harboring thermosensitive mutations in the cell division genes ftsA, ftsQ, ftsZ, and pbpB.

    PubMed Central

    García del Portillo, F; de Pedro, M A

    1990-01-01

    To study the functional differences between penicillin-binding proteins (PBPs) 1A and 1B, as well as their recently postulated involvement in the septation process (F. García del Portillo, M. A. de Pedro, D. Joseleau-Petit, and R. D'Ari, J. Bacteriol. 171:4217-4221, 1989), a series of isogenic strains with mutations in the genes coding for PBP 1A (ponA) or PBP 1B (ponB) or in the cell division-specific genes ftsA, ftsQ, pbpB, and ftsZ was constructed and used as the start point to produce double mutants combining the ponA or ponB characters with mutations in cell division genes. PBP 1A seemed to be unable to preserve cell integrity by itself, requiring the additional activities of PBP 2, PBP 3, and FtsQ. PBP 1B was apparently endowed with a more versatile biosynthetic potential that permitted a substantial enlargement of PBP 1A-deficient cells when PBP 2 or 3 was inhibited or when FtsQ was inactive. beta-Lactams binding to PBP 2 (mecillinam) or 3 (furazlocillin) caused rapid lysis in a ponB background. The lytic effect of furazlocillin to ponB cell division double mutants was suppressed at the restrictive temperature irrespective of the identity of the mutated cell division gene. These results indicate that PBPs 1A and 1B play distinct roles in cell wall synthesis and support the idea of a relevant involvement of PBP 1B in peptidoglycan synthesis at the time of septation. Images PMID:2211517

  16. The role of HPV RNA transcription, immune response-related gene expression and disruptive TP53 mutations in diagnostic and prognostic profiling of head and neck cancer.

    PubMed

    Wichmann, Gunnar; Rosolowski, Maciej; Krohn, Knut; Kreuz, Markus; Boehm, Andreas; Reiche, Anett; Scharrer, Ulrike; Halama, Dirk; Bertolini, Julia; Bauer, Ulrike; Holzinger, Dana; Pawlita, Michael; Hess, Jochen; Engel, Christoph; Hasenclever, Dirk; Scholz, Markus; Ahnert, Peter; Kirsten, Holger; Hemprich, Alexander; Wittekind, Christian; Herbarth, Olf; Horn, Friedemann; Dietz, Andreas; Loeffler, Markus

    2015-12-15

    Stratification of head and neck squamous cell carcinomas (HNSCC) based on HPV16 DNA and RNA status, gene expression patterns, and mutated candidate genes may facilitate patient treatment decision. We characterize head and neck squamous cell carcinomas (HNSCC) with different HPV16 DNA and RNA (E6*I) status from 290 consecutively recruited patients by gene expression profiling and targeted sequencing of 50 genes. We show that tumors with transcriptionally inactive HPV16 (DNA+ RNA-) are similar to HPV-negative (DNA-) tumors regarding gene expression and frequency of TP53 mutations (47%, 8/17 and 43%, 72/167, respectively). We also find that an immune response-related gene expression cluster is associated with lymph node metastasis, independent of HPV16 status and that disruptive TP53 mutations are associated with lymph node metastasis in HPV16 DNA- tumors. We validate each of these associations in another large data set. Four gene expression clusters which we identify differ moderately but significantly in overall survival. Our findings underscore the importance of measuring the HPV16 RNA (E6*I) and TP53-mutation status for patient stratification and identify associations of an immune response-related gene expression cluster and TP53 mutations with lymph node metastasis in HNSCC. © 2015 UICC.

  17. Relevance of phenotypic noise to adaptation and evolution.

    PubMed

    Kaneko, K; Furusawa, C

    2008-09-01

    Biological processes are inherently noisy, as highlighted in recent measurements of stochasticity in gene expression. Here, the authors show that such phenotypic noise is essential to the adaptation of organisms to a variety of environments and also to the evolution of robustness against mutations. First, the authors show that for any growing cell showing stochastic gene expression, the adaptive cellular state is inevitably selected by noise, without the use of a specific signal transduction network. In general, changes in any protein concentration in a cell are products of its synthesis minus dilution and degradation, both of which are proportional to the rate of cell growth. In an adaptive state, both the synthesis and dilution terms of proteins are large, and so the adaptive state is less affected by stochasticity in gene expression, whereas for a non-adaptive state, both terms are smaller, and so cells are easily knocked out of their original state by noise. This leads to a novel, generic mechanism for the selection of adaptive states. The authors have confirmed this selection by model simulations. Secondly, the authors consider the evolution of gene networks to acquire robustness of the phenotype against noise and mutation. Through simulations using a simple stochastic gene expression network that undergoes mutation and selection, the authors show that a threshold level of noise in gene expression is required for the network to acquire both types of robustness. The results reveal how the noise that cells encounter during growth and development shapes any network's robustness, not only to noise but also to mutations. The authors also establish a relationship between developmental and mutational robustness.

  18. Olaparib or Cediranib Maleate and Olaparib Compared With Standard Platinum-Based Chemotherapy in Treating Patients With Recurrent Platinum-Sensitive Ovarian, Fallopian Tube, or Primary Peritoneal Cancer

    ClinicalTrials.gov

    2018-06-11

    BRCA Rearrangement; Deleterious BRCA1 Gene Mutation; Deleterious BRCA2 Gene Mutation; Fallopian Tube Clear Cell Adenocarcinoma; Fallopian Tube Transitional Cell Carcinoma; Ovarian Clear Cell Adenocarcinoma; Ovarian Endometrioid Tumor; Ovarian Seromucinous Carcinoma; Ovarian Serous Tumor; Ovarian Transitional Cell Carcinoma; Recurrent Fallopian Tube Carcinoma; Recurrent Ovarian Carcinoma; Recurrent Primary Peritoneal Carcinoma; Undifferentiated Fallopian Tube Carcinoma; Undifferentiated Ovarian Carcinoma

  19. Hot spot mutations in Finnish non-small cell lung cancers.

    PubMed

    Mäki-Nevala, Satu; Sarhadi, Virinder Kaur; Rönty, Mikko; Kettunen, Eeva; Husgafvel-Pursiainen, Kirsti; Wolff, Henrik; Knuuttila, Aija; Knuutila, Sakari

    2016-09-01

    Non-small cell lung cancer (NSCLC) is a common cancer with a poor prognosis. The aim of this study was to screen Finnish NSCLC tumor samples for common cancer-related mutations by targeted next generation sequencing and to determine their concurrences and associations with clinical features. Sequencing libraries were prepared from DNA isolated from formalin-fixed, paraffin-embedded tumor material of 425 patients using the AmpliSeq Colon and Lung panel covering mutational hot spot regions of 22 cancer genes. Sequencing was performed with the Ion Torrent Personal Genome Machine (PGM). Data analysis of the hot spot mutations revealed mutations in 77% of the patients, with 7% having 3 or more mutations reported in the Catalogue of Somatic Mutations in Cancer (COSMIC) database. Two of the most frequently mutated genes were TP53 (46%) and KRAS (25%). KRAS codon 12 mutations were the most recurrently occurring mutations. EGFR mutations were significantly associated with adenocarcinoma, female gender and never/light-smoking history; CTNNB1 mutations with light ex-smokers, PIK3CA and TP53 mutations with squamous cell carcinoma, and KRAS with adenocarcinoma. TP53 mutations were most prevalent in current smokers and ERBB2, ERBB4, PIK3CA, NRAS, NOTCH1, FBWX7, PTEN and STK11 mutations occurred exclusively in a group of ever-smokers, however the association was not statistically significant. No mutation was found that associated with asbestos exposure. Finnish NSCLC patients have a similar mutation profile as other Western patients, however with a higher frequency of BRAF mutations but a lower frequency of STK11 and ERBB2 mutations. Moreover, TP53 mutations occurred frequently with other gene mutations, most commonly with KRAS, MET, EGFR and PIK3CA mutations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  20. Nicotine and oxidative stress induced exomic variations are concordant and overrepresented in cancer-associated genes

    PubMed Central

    Bavarva, Jasmin H.; Tae, Hongseok; McIver, Lauren; Garner, Harold R.

    2014-01-01

    Although the connection between cancer and cigarette smoke is well established, nicotine is not characterized as a carcinogen. Here, we used exome sequencing to identify nicotine and oxidative stress-induced somatic mutations in normal human epithelial cells and its correlation with cancer. We identified over 6,400 SNVs, indels and microsatellites in each of the stress exposed cells relative to the control, of which, 2,159 were consistently observed at all nicotine doses. These included 429 nsSNVs including 158 novel and 79 cancer-associated. Over 80% of consistently nicotine induced variants overlap with variations detected in oxidative stressed cells, indicating that nicotine induced genomic alterations could be mediated through oxidative stress. Nicotine induced mutations were distributed across 1,585 genes, of which 49% were associated with cancer. MUC family genes were among the top mutated genes. Analysis of 591 lung carcinoma tumor exomes from The Cancer Genome Atlas (TCGA) revealed that 20% of non-small-cell lung cancer tumors in smokers have mutations in at least one of the MUC4, MUC6 or MUC12 genes in contrast to only 6% in non-smokers. These results indicate that nicotine induces genomic variations, promotes instability potentially mediated by oxidative stress, implicating nicotine in carcinogenesis, and establishes MUC genes as potential targets. PMID:24947164

  1. Potential large animal models for gene therapy of human genetic diseases of immune and blood cell systems.

    PubMed

    Bauer, Thomas R; Adler, Rima L; Hickstein, Dennis D

    2009-01-01

    Genetic mutations involving the cellular components of the hematopoietic system--red blood cells, white blood cells, and platelets--manifest clinically as anemia, infection, and bleeding. Although gene targeting has recapitulated many of these diseases in mice, these murine homologues are limited as translational models by their small size and brief life span as well as the fact that mutations induced by gene targeting do not always faithfully reflect the clinical manifestations of such mutations in humans. Many of these limitations can be overcome by identifying large animals with genetic diseases of the hematopoietic system corresponding to their human disease counterparts. In this article, we describe human diseases of the cellular components of the hematopoietic system that have counterparts in large animal species, in most cases carrying mutations in the same gene (CD18 in leukocyte adhesion deficiency) or genes in interacting proteins (DNA cross-link repair 1C protein and protein kinase, DNA-activated catalytic polypeptide in radiation-sensitive severe combined immunodeficiency). Furthermore, we describe the potential of these animal models to serve as disease-specific preclinical models for testing the efficacy and safety of clinical interventions such as hematopoietic stem cell transplantation or gene therapy before their use in humans with the corresponding disease.

  2. The Genomic Evolution of Prostate Cancer

    DTIC Science & Technology

    2014-10-01

    Mutation characteristics. (a) Number of high-confidence somatic mutations across all foci. Non- silent , non- silent mutations; Unique, number of unique...genes harboring a non- silent mutation; Reported, gene reported to be mutated in references 9–12 and 14. (b) Spectrum of unique high confidence somatic...epigenetic and micr- oRNA-mediated inactivation of LRP1B, a modulator of the extracellular environment of thyroid cancer cells. Oncogene 2011; 30

  3. Identifying activating mutations in the EGFR gene: prognostic and therapeutic implications in non-small cell lung cancer *

    PubMed Central

    Lopes, Gabriel Lima; Vattimo, Edoardo Filippo de Queiroz; de Castro, Gilberto

    2015-01-01

    Abstract Lung cancer is the leading cause of cancer-related deaths worldwide. Promising new therapies have recently emerged from the development of molecular targeted drugs; particularly promising are those blocking the signal transduction machinery of cancer cells. One of the most widely studied cell signaling pathways is that of EGFR, which leads to uncontrolled cell proliferation, increased cell angiogenesis, and greater cell invasiveness. Activating mutations in the EGFR gene (deletions in exon 19 and mutation L858R in exon 21), first described in 2004, have been detected in approximately 10% of all non-squamous non-small cell lung cancer (NSCLC) patients in Western countries and are the most important predictors of a response to EGFR tyrosine-kinase inhibitors (EGFR-TKIs). Studies of the EGFR-TKIs gefitinib, erlotinib, and afatinib, in comparison with platinum-based regimens, as first-line treatments in chemotherapy-naïve patients have shown that the EGFR-TKIs produce gains in progression-free survival and overall response rates, although only in patients whose tumors harbor activating mutations in the EGFR gene. Clinical trials have also shown EGFR-TKIs to be effective as second- and third-line therapies in advanced NSCLC. Here, we review the main aspects of EGFR pathway activation in NSCLC, underscore the importance of correctly identifying activating mutations in the EGFR gene, and discuss the main outcomes of EGFR-TKI treatment in NSCLC. PMID:26398757

  4. Mutational analysis of PI3K/AKT and RAS/RAF pathway activation in malignant salivary gland tumours with a new mutation of PIK3CA.

    PubMed

    Shalmon, B; Drendel, M; Wolf, M; Hirshberg, A; Cohen, Y

    2016-06-01

    The phosphoinositide 3-kinase (PIK3)/v-akt murine thymoma (AKT) oncogene pathway and the RAS/RAF pathway are involved in regulating the signalling of multiple biological processes, including apoptosis, metabolism, cell proliferation, and cell growth. Mutations in the genes within these pathways are frequently found in several tumours. The aim of this study was to investigate the frequency of mutations in the PIK3CA, BRAF, and KRAS genes in cases of malignant salivary gland tumours. Mutational analysis of the PIK3CA, KRAS, and BRAF genes was performed by direct sequencing of material from 21 patients with malignant salivary gland tumours who underwent surgery between 1992 and 2001. No mutations were found in the KRAS exon 2, BRAF exon 15, or PIK3CA exon 9 genes. However, an unpublished mutation of the PIK3CA gene in exon 20 (W1051 stop mutation) was found in one case of adenocarcinoma NOS. The impact of this mutation on the biological behaviour of the tumour has yet to be explored, however the patient with adenocarcinoma NOS harbouring this mutation has survived for over 20 years following surgery despite a high stage at presentation. Further studies with more homogeneous patient cohorts are needed to address whether this mutation reflects a different clinical presentation and may benefit from targeted treatment strategies. Copyright © 2015 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  5. Sapanisertib in Treating Patients With Locally Advanced or Metastatic Bladder Cancer With TSC1 and/or TSC2 Mutations

    ClinicalTrials.gov

    2018-05-02

    Metastatic Transitional Cell Carcinoma; Metastatic Urothelial Carcinoma; Recurrent Bladder Carcinoma; Stage III Bladder Urothelial Carcinoma AJCC v6 and v7; Stage IV Bladder Urothelial Carcinoma AJCC v7; TSC1 Gene Mutation; TSC2 Gene Mutation

  6. Recurrent mutation of the ID3 gene in Burkitt lymphoma identified by integrated genome, exome and transcriptome sequencing.

    PubMed

    Richter, Julia; Schlesner, Matthias; Hoffmann, Steve; Kreuz, Markus; Leich, Ellen; Burkhardt, Birgit; Rosolowski, Maciej; Ammerpohl, Ole; Wagener, Rabea; Bernhart, Stephan H; Lenze, Dido; Szczepanowski, Monika; Paulsen, Maren; Lipinski, Simone; Russell, Robert B; Adam-Klages, Sabine; Apic, Gordana; Claviez, Alexander; Hasenclever, Dirk; Hovestadt, Volker; Hornig, Nadine; Korbel, Jan O; Kube, Dieter; Langenberger, David; Lawerenz, Chris; Lisfeld, Jasmin; Meyer, Katharina; Picelli, Simone; Pischimarov, Jordan; Radlwimmer, Bernhard; Rausch, Tobias; Rohde, Marius; Schilhabel, Markus; Scholtysik, René; Spang, Rainer; Trautmann, Heiko; Zenz, Thorsten; Borkhardt, Arndt; Drexler, Hans G; Möller, Peter; MacLeod, Roderick A F; Pott, Christiane; Schreiber, Stefan; Trümper, Lorenz; Loeffler, Markus; Stadler, Peter F; Lichter, Peter; Eils, Roland; Küppers, Ralf; Hummel, Michael; Klapper, Wolfram; Rosenstiel, Philip; Rosenwald, Andreas; Brors, Benedikt; Siebert, Reiner

    2012-12-01

    Burkitt lymphoma is a mature aggressive B-cell lymphoma derived from germinal center B cells. Its cytogenetic hallmark is the Burkitt translocation t(8;14)(q24;q32) and its variants, which juxtapose the MYC oncogene with one of the three immunoglobulin loci. Consequently, MYC is deregulated, resulting in massive perturbation of gene expression. Nevertheless, MYC deregulation alone seems not to be sufficient to drive Burkitt lymphomagenesis. By whole-genome, whole-exome and transcriptome sequencing of four prototypical Burkitt lymphomas with immunoglobulin gene (IG)-MYC translocation, we identified seven recurrently mutated genes. One of these genes, ID3, mapped to a region of focal homozygous loss in Burkitt lymphoma. In an extended cohort, 36 of 53 molecularly defined Burkitt lymphomas (68%) carried potentially damaging mutations of ID3. These were strongly enriched at somatic hypermutation motifs. Only 6 of 47 other B-cell lymphomas with the IG-MYC translocation (13%) carried ID3 mutations. These findings suggest that cooperation between ID3 inactivation and IG-MYC translocation is a hallmark of Burkitt lymphomagenesis.

  7. Enhancement of hypermutation frequency in the chicken B cell line DT40 for efficient diversification of the antibody repertoire

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Magari, Masaki; Kanehiro, Yuichi; Todo, Kagefumi

    Chicken B cell line DT40 continuously accumulates mutations in the immunoglobulin variable region (IgV) gene by gene conversion and point mutation, both of which are mediated by activation-induced cytidine deaminase (AID), thereby producing an antibody (Ab) library that is useful for screening monoclonal Abs (mAbs) in vitro. We previously generated an engineered DT40 line named DT40-SW, whose AID expression can be reversibly switched on or off, and developed an in vitro Ab generation system using DT40-SW cells. To efficiently create an Ab library with sufficient diversity, higher hypermutation frequency is advantageous. To this end, we generated a novel cell linemore » DT40-SW{Delta}C, which conditionally expresses a C-terminus-truncated AID mutant lacking the nuclear export signal. The transcription level of the mutant AID gene in DT40-SW{Delta}C cells was similar to that of the wild-type gene in DT40-SW cells. However, the protein level of the truncated AID mutant was less than that of the wild type. The mutant protein was enriched in the nuclei of DT40-SW{Delta}C cells, although the protein might be highly susceptible to degradation. In DT40-SW{Delta}C cells, both gene conversion and point mutation occurred in the IgV gene with over threefold higher frequency than in DT40-SW cells, suggesting that a lower level of the mutant AID protein was sufficient to increase mutation frequency. Thus, DT40-SW{Delta}C cells may be useful for constructing Ab libraries for efficient screening of mAbs in vitro.« less

  8. Papillary renal cell carcinoma: a clinicopathological and whole-genome exon sequencing study

    PubMed Central

    Liu, Kunpeng; Ren, Yuan; Pang, Lijuan; Qi, Yan; Jia, Wei; Tao, Lin; Hu, Zhengyan; Zhao, Jin; Zhang, Haijun; Li, Li; Yue, Haifeng; Han, Juan; Liang, Weihua; Hu, Jianming; Zou, Hong; Yuan, Xianglin; Li, Feng

    2015-01-01

    Papillary renal cell carcinoma (PRCC) represents the second most common histological subtype of RCC, and comprises 2 subtypes. Prognosis for type 1 PRCC is relatively good, whereas type 2 PRCC is associated with poor clinical outcomes. The aim of the present study was to evaluate the clinicopathological and mutations characteristics of PRCC. Hence, we reported on 13 cases of PRCC analyzed using whole-exome sequencing. Histologically, type 2 PRCC showed a higher nuclear grade and lymphovascular invasion rate versus type 1 PRCC (P < 0.05). Immunostaining revealed type 1 PRCC had higher CK7 and lower Top IIα expression rates (P < 0.05). Whole-exome sequencing data analysis revealed that the mutational statuses of 373 genes (287 missense, 69 silent, 6 nonsense, and 11 synonymous mutations) differed significantly between PRCC and normal renal tissues (P < 0.05). Functional enrichment analysis was used to classify the 287 missense-mutated genes into 11 biological process clusters (comprised of 61 biological processes) and 5 pathways, involved in cell adhesion, microtubule-based movement, the cell cycle, polysaccharide biosynthesis, muscle cell development and differentiation, cell death, and negative regulation. Associated pathways included the ATP-binding cassette transporter, extracellular matrix-receptor interaction, lysosome, complement and coagulation cascades, and glyoxylate and dicarboxylate metabolism pathways. The missense mutation status of 19 genes differed significantly between the groups (P < 0.05), and alterations in the EEF1D, RFNG, GPR142, and RAB37 genes were located in different chromosomal regions in type 1 and 2 PRCC. These mutations may contribute to future studies on pathogenic mechanisms and targeted therapy of PRCC. PMID:26339402

  9. Decreased mutation frequencies among immunoglobulin G variable region genes during viremic HIV-1 infection.

    PubMed

    Bowers, Elisabeth; Scamurra, Ronald W; Asrani, Anil; Beniguel, Lydie; MaWhinney, Samantha; Keays, Kathryne M; Thurn, Joseph R; Janoff, Edward N

    2014-01-01

    HIV-1 infection is complicated by high rates of opportunistic infections against which specific antibodies contribute to immune defense. Antibody function depends on somatic hypermutation (SHM) of variable regions of immunoglobulin heavy chain genes (VH-D-J). We characterized the frequency of SHM in expressed IgG mRNA immunoglobulin transcripts from control and HIV-1-infected patients. We compared utilization of genes in the most prominent VH family (VH3) and mutation frequencies and patterns of cDNA from VH3-IgG genes from 10 seronegative control subjects and 21 patients with HIV-1 infection (6 without and 15 patients with detectable plasma viremia). Unique IgG VH3 family cDNA sequences (n = 1,565) were PCR amplified, cloned, and sequenced from blood. Sequences were analyzed using online (Vbase) and in-house immunoglobulin alignment resources. Mutation frequencies in the antigen-binding hypervariable complementarity determining regions (CDR1/2) of IgG class-switched B cells were lower among viremic HIV-1-infected patients vs. controls for nucleotides (CDR1/2: 10±5% vs. 13.5±6%, p = 0.03) and amino acids (CDR: 20%±10 vs. 25%±12, p = 0.02) and in structural framework regions. Mutation patterns were similar among groups. The most common VH3 gene, VH3-23, was utilized less frequently among viremic HIV-1-infected patients (p = 0.03), and overall, mutation frequencies were decreased in nearly all VH3 genes compared with controls. B cells from HIV-1-infected patients show decreased mutation frequencies, especially in antigen-binding VH3 CDR genes, and selective defects in gene utilization. Similar mutation patterns suggest defects in the quantity, but not quality, of mutator activity. Lower levels of SHM in IgG class-switched B cells from HIV-1-infected patients may contribute to the increased risk of opportunistic infections and impaired humoral responses to preventative vaccines.

  10. PIK3CA gene alterations in bladder cancer are frequent and associate with reduced recurrence in non-muscle invasive tumors.

    PubMed

    Dueñas, Marta; Martínez-Fernández, Mónica; García-Escudero, Ramón; Villacampa, Felipe; Marqués, Miriam; Saiz-Ladera, Cristina; Duarte, José; Martínez, Victor; Gómez, M José; Martín, M Luisa; Fernández, Manoli; Castellano, Daniel; Real, Francisco X; Rodriguez-Peralto, Jose L; De La Rosa, Federico; Paramio, Jesús M

    2015-07-01

    Bladder cancer (BC) is the fifth most common cancer in the world, being the non-muscle invasive tumors (NMIBC) the most frequent. NMIBC shows a very high frequency of recurrence and, in certain cases, tumor progression. The phosphatidylinositol 3-kinase (PI3K) pathway, which controls cell growth, tumorigenesis, cell invasion and drug response, is frequently activated in numerous human cancers, including BC, in part through alterations of PIK3CA gene. However, the significance of PIK3CA gene alterations with respect to clinicopathological characteristics, and in particular tumor recurrence and progression, remains elusive. Here, we analyzed the presence of mutations in FGFR3 and PIK3CA genes and copy number alterations of PIK3CA gene in bladder tumor and their correspondent paired normal samples from 87 patients. We observed an extremely high frequency of PIK3CA gene alterations (mutations, copy gains, or both) in tumor samples, affecting primarily T1 and T2 tumors. A significant number of normal tissues also showed mutations and copy gains, being coincident with those found in the corresponding tumor sample. In low-grade tumors PIK3CA mutations associated with FGFR3 mutations. Alterations in PIK3CA gene resulted in increased Akt activity in tumors. Interestingly, the presence of PIK3CA gene alterations, and in particular gene mutations, is significantly associated with reduced recurrence of NMIBC patients. Importantly, the presence of FGFR3 mutations may influence the clinical outcome of patients bearing alterations in PIK3CA gene, and increased recurrence was associated to FGFR3 mutated, PIK3CA wt tumors. These findings may have high relevance in terms of using PI3K-targeted therapies for BC treatment. © 2013 Wiley Periodicals, Inc.

  11. CD79B and MYD88 Mutations in Splenic Marginal Zone Lymphoma

    PubMed Central

    Trøen, Gunhild; Warsame, Abdirashid; Delabie, Jan

    2013-01-01

    The mutation status of genes involved in the NF-κB signaling pathway in splenic marginal zone lymphoma was examined. DNA sequence analysis of four genes was performed: CD79A, CD79B, CARD11, and MYD88 that are activated through BCR signaling or Toll-like and interleukin signaling. A single point mutation was detected in the CD79B gene (Y196H) in one of ten SMZL cases. Additionally, one point mutation was identified in the MYD88 gene (L265P) in another SMZL case. No mutations were revealed in CD79A or CARD11 genes in these SMZL cases. Neither were mutations detected in these four genes studied in 13 control MZL samples. Interestingly, the two cases with mutations of CD79B and MYD88 showed increased numbers of immunoblasts spread among the smaller and typical marginal zone lymphoma cells. Although SMZL shows few mutations of NF-κB signaling genes, our results indicate that the presence of these mutations is associated with a higher histological grade. PMID:23378931

  12. Mutations of NOTCH3 in childhood pulmonary arterial hypertension

    PubMed Central

    Chida, Ayako; Shintani, Masaki; Matsushita, Yoshihisa; Sato, Hiroki; Eitoku, Takahiro; Nakayama, Tomotaka; Furutani, Yoshiyuki; Hayama, Emiko; Kawamura, Yoichi; Inai, Kei; Ohtsuki, Shinichi; Saji, Tsutomu; Nonoyama, Shigeaki; Nakanishi, Toshio

    2014-01-01

    Mutations of BMPR2 and other TGF-β superfamily genes have been reported in pulmonary arterial hypertension (PAH). However, 60–90% of idiopathic PAH cases have no mutations in these genes. Recently, the expression of NOTCH3 was shown to be increased in the pulmonary artery smooth muscle cells of PAH patients. We sought to investigate NOTCH3 and its target genes in PAH patients and clarify the role of NOTCH3 signaling. We screened for mutations in NOTCH3, HES1, and HES5 in 41 PAH patients who had no mutations in BMPR2, ALK1, endoglin, SMAD1/4/8, BMPR1B, or Caveolin-1. Two novel missense mutations (c.2519 G>A p.G840E, c.2698 A>C p.T900P) in NOTCH3 were identified in two PAH patients. We performed functional analysis using stable cell lines expressing either wild-type or mutant NOTCH3. The protein-folding chaperone GRP78/BiP was colocalized with wild-type NOTCH3 in the endoplasmic reticulum, whereas the majority of GRP78/BiP was translocated into the nuclei of cells expressing mutant NOTCH3. Cell proliferation and viability were higher for cells expressing mutant NOTCH3 than for those expressing wild-type NOTCH3. We identified novel NOTCH3 mutations in PAH patients and revealed that these mutations were involved in cell proliferation and viability. NOTCH3 mutants induced an impairment in NOTCH3-HES5 signaling. The results may contribute to the elucidation of PAH pathogenesis. PMID:24936512

  13. Aspirin-induced chemoprevention and response kinetics are enhanced by PIK3CA mutations in colorectal cancer cells

    PubMed Central

    Zumwalt, Timothy J; Wodarz, Dominik; Komarova, Natalia L; Toden, Shusuke; Turner, Jacob; Cardenas, Jacob; Burn, John; Chan, Andrew T; Boland, C Richard; Goel, Ajay

    2017-01-01

    This study was designed to determine how aspirin influences the growth kinetics and characteristics of cultured colorectal cancer (CRC) cells that harbor a variety of different mutational backgrounds, including PIK3CA and KRAS activating mutations and the presence or absence of microsatellite instability. CRC cell lines (HCT116, HCT116+Chr3/5, RKO, SW480, HCT15, CACO2, HT29, and SW48) were treated with pharmacologically relevant doses of aspirin (0.5–10 mM) and evaluated for proliferation and cell cycle distribution. These parameters were fitted to a mathematical model to quantify the effects and understand the mechanism(s) by which aspirin modifies growth in CRC cells. We also evaluated the effects of aspirin on key G0/G1 cell cycle genes that are regulated by PI3K-Akt pathway. Aspirin decelerated growth rates and disrupted cell cycle dynamics more profoundly in faster growing CRC cell lines, which tended to be PIK3CA-mutants. Additionally, microarray analysis of 151 CRC cell lines identified important cell cycle regulatory genes downstream targets of PIK3, which were dysregulated by aspirin treatment cycle genes (PCNA and RB1, p<0.01). Our study demonstrated what clinical trials have only speculated, that PIK3CA-mutant CRCs are more sensitive to aspirin. Aspirin inhibited cell growth in all CRC cell lines regardless of mutational background, but the effects were exacerbated in cells with PIK3CA mutations. Mathematical modeling combined with bench science revealed that cells with PIK3CA mutations experience significant G0/G1 arrest and explains why patients with PIK3CA-mutant CRCs may benefit from aspirin use after diagnosis. PMID:28154202

  14. Infrequent widespread microsatellite instability in hepatocellular carcinomas.

    PubMed

    Yamamoto, H; Itoh, F; Fukushima, H; Kaneto, H; Sasaki, S; Ohmura, T; Satoh, T; Karino, Y; Endo, T; Toyota, J; Imai, K

    2000-03-01

    Widespread or high-frequency microsatellite instability (MSI) due to the defective DNA mismatch repair (MMR) occurs in the majority of hereditary non-polyposis colorectal cancer and a subset of sporadic malignant tumors. The incidence of MSI and underlying DNA MMR defects have been well characterized in gastrointestinal carcinogenesis, but not in hepatocarcinogenesis. To address the issue, we analyzed 55 Japanese hepatocellular carcinomas using several indicators of DNA MMR defects, such as microsatellite analysis, loss of heterozygosity (LOH) and mutation analysis of MMR genes, methylation of hMLH1 promoter, and frameshift mutations of mononucleotide repeat sequences within possible target genes. Mutation of beta2-microglobulin gene, which is presumably involved in MSI-positive tumor cell escape from immune surveillance was also examined. Some of these analyses were also carried out in 9 human liver cancer cell lines. None of the 3 quasi-monomorphic mononucleotide markers sensitive for MSI, BAT26, BAT25, and BAT34C4 presented shortened unstable alleles in any of the carcinoma, cirrhosis, chronic hepatitis tissues, or cell lines. LOH at MMR genes was infrequent (4.4 approximately 7.1%), and no mutations were detected. Neither hMLH1 hypermethylation nor frameshift mutation in the target genes was detected. No mutations were found in beta2-microglobulin. Widespread MSI due to the defective DNA MMR appears to play little if any part in Japanese hepatocarcinogenesis.

  15. Impact of the underlying mutation and the route of vector administration on immune responses to factor IX in gene therapy for hemophilia B.

    PubMed

    Cao, Ou; Hoffman, Brad E; Moghimi, Babak; Nayak, Sushrusha; Cooper, Mario; Zhou, Shangzhen; Ertl, Hildegund C J; High, Katherine A; Herzog, Roland W

    2009-10-01

    Immune responses to factor IX (F.IX), a major concern in gene therapy for hemophilia, were analyzed for adeno-associated viral (AAV-2) gene transfer to skeletal muscle and liver as a function of the F9 underlying mutation. Vectors identical to those recently used in clinical trials were administered to four lines of hemophilia B mice on a defined genetic background [C3H/HeJ with deletion of endogenous F9 and transgenic for a range of nonfunctional human F.IX (hF.IX) variants]. The strength of the immune response to AAV-encoded F.IX inversely correlated with the degree of conservation of endogenous coding information and levels of endogenous antigen. Null mutation animals developed T- and B-cell responses in both protocols. However, inhibitor titers were considerably higher upon muscle gene transfer (or protein therapy). Transduced muscles of Null mice had strong infiltrates with CD8+ cells, which were much more limited in the liver and not seen for the other mutations. Sustained expression was achieved with liver transduction in mice with crm(-) nonsense and missense mutations, although they still formed antibodies upon muscle gene transfer. Therefore, endogenous expression prevented T-cell responses more effectively than antibody formation, and immune responses varied substantially depending on the protocol and the underlying mutation.

  16. Rare Complex Mutational Profile in an ALK Inhibitor-resistant Non-small Cell Lung Cancer.

    PubMed

    Azzato, Elizabeth M; Deshpande, Charuhas; Aikawa, Vania; Aggarwal, Charu; Alley, Evan; Jacobs, Benjamin; Morrissette, Jennifer; Daber, Robert

    2015-05-01

    Testing for somatic alterations, including anaplastic lymphoma receptor tyrosine kinase gene (ALK) rearrangements and epidermal growth factor receptor gene (EGFR) mutations, is standard practice in the diagnostic evaluation and therapeutic management of non-small cell lung cancer (NSCLC), where the results of such tests can predict response to targeted-therapy. ALK rearrangements, EGFR mutations and mutations in the Kirsten rat sarcoma viral oncogene homolog (KRAS) are considered mutually exclusive in NSCLC. Herein we identified a KRAS Q22K mutation and frameshift mutations in the genes encoding serine/threonine kinase 11 (STK11) and ataxia telangiectasia mutated serine/threonine kinase (ATM) by next-generation sequencing in a patient with ALK rearrangement-positive oligo-metastatic NSCLC, whose disease progressed while on two ALK-targeted therapies. Such a complex diagnostic genetic profile has not been reported in ALK fusion-positive NSCLC. This case highlights the utility of comprehensive molecular testing in the diagnosis of NSCLC. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  17. Somatic mutation profiles of clear cell endometrial tumors revealed by whole exome and targeted gene sequencing.

    PubMed

    Le Gallo, Matthieu; Rudd, Meghan L; Urick, Mary Ellen; Hansen, Nancy F; Zhang, Suiyuan; Lozy, Fred; Sgroi, Dennis C; Vidal Bel, August; Matias-Guiu, Xavier; Broaddus, Russell R; Lu, Karen H; Levine, Douglas A; Mutch, David G; Goodfellow, Paul J; Salvesen, Helga B; Mullikin, James C; Bell, Daphne W

    2017-09-01

    The molecular pathogenesis of clear cell endometrial cancer (CCEC), a tumor type with a relatively unfavorable prognosis, is not well defined. We searched exome-wide for novel somatically mutated genes in CCEC and assessed the mutational spectrum of known and candidate driver genes in a large cohort of cases. We conducted whole exome sequencing of paired tumor-normal DNAs from 16 cases of CCEC (12 CCECs and the CCEC components of 4 mixed histology tumors). Twenty-two genes-of-interest were Sanger-sequenced from another 47 cases of CCEC. Microsatellite instability (MSI) and microsatellite stability (MSS) were determined by genotyping 5 mononucleotide repeats. Two tumor exomes had relatively high mutational loads and MSI. The other 14 tumor exomes were MSS and had 236 validated nonsynonymous or splice junction somatic mutations among 222 protein-encoding genes. Among the 63 cases of CCEC in this study, we identified frequent somatic mutations in TP53 (39.7%), PIK3CA (23.8%), PIK3R1 (15.9%), ARID1A (15.9%), PPP2R1A (15.9%), SPOP (14.3%), and TAF1 (9.5%), as well as MSI (11.3%). Five of 8 mutations in TAF1, a gene with no known role in CCEC, localized to the putative histone acetyltransferase domain and included 2 recurrently mutated residues. Based on patterns of MSI and mutations in 7 genes, CCEC subsets molecularly resembled serous endometrial cancer (SEC) or endometrioid endometrial cancer (EEC). Our findings demonstrate molecular similarities between CCEC and SEC and EEC and implicate TAF1 as a novel candidate CCEC driver gene. Cancer 2017;123:3261-8. © 2017 American Cancer Society. © 2017 American Cancer Society.

  18. Step Inside NIH's Sickle Cell Branch

    MedlinePlus

    ... attack it. This is gene transfer, which requires gene editing. Sickle cell disease is caused by a single ... can reverse that mutation in the DNA using gene editing, we could change that one mutant gene back ...

  19. Analysis of IgV gene mutations in B cell chronic lymphocytic leukaemia according to antigen-driven selection identifies subgroups with different prognosis and usage of the canonical somatic hypermutation machinery.

    PubMed

    Degan, Massimo; Bomben, Riccardo; Bo, Michele Dal; Zucchetto, Antonella; Nanni, Paola; Rupolo, Maurizio; Steffan, Agostino; Attadia, Vincenza; Ballerini, Pier Ferruccio; Damiani, Daniela; Pucillo, Carlo; Poeta, Giovanni Del; Colombatti, Alfonso; Gattei, Valter

    2004-07-01

    Cases of B-cell chronic lymphocytic leukaemia (B-CLL) with mutated (M) IgV(H) genes have a better prognosis than unmutated (UM) cases. We analysed the IgV(H) mutational status of B-CLL according to the features of a canonical somatic hypermutation (SHM) process, correlating this data with survival. In a series of 141 B-CLLs, 124 cases were examined for IgV(H) gene per cent mutations and skewing of replacement/silent mutations in the framework/complementarity-determining regions as evidence of antigen-driven selection; this identified three B-CLL subsets: significantly mutated (sM), with evidence of antigen-driven selection, not significantly mutated (nsM) and UM, without such evidence and IgV(H) gene per cent mutations above or below the 2% cut-off. sM B-CLL patients had longer survival within the good prognosis subgroup that had more than 2% mutations of IgV(H) genes. sM, nsM and UM B-CLL were also characterized for the biased usage of IgV(H) families, intraclonal IgV(H) gene diversification, preference of mutations to target-specific nucleotides or hotspots, and for the expression of enzymes involved in SHM (translesion DNA polymerase zeta and eta and activation-induced cytidine deaminase). These findings indicate the activation of a canonical SHM process in nsM and sM B-CLLs and underscore the role of the antigen in defining the specific clinical and biological features of B-CLL.

  20. [The significance of pedigree genetic screening and rapid immunological parameters in the diagnosis of primary hemophagocytic lymphohistiocytosis].

    PubMed

    Zhang, J; Wang, Y N; Wang, J S; Wu, L; Wei, N; Fu, L; Gao, Z; Chen, J H; Pei, R J; Wang, Z

    2016-07-01

    To investigate the significance of pedigree genetic screening and rapid immunological parameters in the diagnosis of primary hemophagocytic lymphohistiocytosis (HLH). Four cases of primary HLH patients with PRF1, UNC13D and SH2D1A gene mutations were conducted pedigree investigation, including family genetic screening and detections of immunological parameters (NK cell activity, CD107a degranulation and expression of HLH related defective protein), to evaluate the significance of these different indicators in the diagnosis of primary HLH and explore their correlations. The DNA mutations of the four families included missense mutation c.T172C (p.S58P) and non- frameshift deletions c.1083_1094del (p.361_365del), missense mutation c.C1349T (p.T450M) and frameshift mutation c.1090_1091delCT (p.T364fsX93) in PRF1 gene, missense mutation c.G2588A (p.G863D) in UNC13D gene and hemizygous mutation c.32T>G (p.I11S) in SH2D1A gene. The patients and their family members presented decreased NK cell activities. Individuals who carried mutations of PRF1 gene and SH2D1A gene showed low expression of perforin (PRF1) and signaling lymphocytic activation molecule associated protein (SAP). And the patient with UNC13D gene mutation and his family member with identical mutation showed significant reducing cytotoxic degranulation function (expression of CD107a). Pedigree genetic screening and rapid detection of immunological parameters might play an important role in the diagnosis of primary HLH, and both of them had good consistency. As an efficient detection means, the rapid immunological detection indicators would provide reliable basis for the early diagnosis of the primary HLH.

  1. Amplified Genes in Breast Cancer: Molecular Targets for Investigation and Therapy

    DTIC Science & Technology

    1999-09-01

    checkpoints (Hartwell and Kastan, 1994). Mutations in genes involved in these transactions occur commonly during cancer progression and can greatly ele...induction of micronuclei as a measure of genotoxicity. A report of the U.S. Environmental Protection Agency Gene - Tox Program. Mutat . Res. 123:61-118...evidence for mutations at different loci in the HGPRT gene . J. Cell. Physiol. 85:307-320. 6 Capecchi, M.R., Hughes, S.H. and Wahl, G.M. (1975) Yeast

  2. Genetic Alterations of the Retinoblastoma-Related Gene RB2/p130 Identify Different Pathogenetic Mechanisms in and among Burkitt’s Lymphoma Subtypes

    PubMed Central

    Cinti, Caterina; Leoncini, Lorenzo; Nyongo, Aggrey; Ferrari, Filomena; Lazzi, Stefano; Bellan, Cristiana; Vatti, Rosella; Zamparelli, Alessandra; Cevenini, Gabriele; osi, Gian Marco T; Claudio, Pier Paolo; Maraldi, Nadir M.; Tosi, Piero; Giordano, Antonio

    2000-01-01

    Alterations of cell cycle-associated genes probably contribute to the pathogenesis of Burkitt’s Lymphoma (BL), in addition to c-myc translocation. Mutations disrupting the nuclear localization signal of the retinoblastoma-related gene RB2/p130 have been documented recently in BL cell lines and primary tumors. Given the importance of the RB2/p130 gene in controlling cell growth, mutations of this gene may result in uncontrolled cell proliferation. We tested the expression and genomic organization of the RB2/p130 gene in relation to the proliferative features of a series of BL samples collected from the endemic and sporadic regions, regardless of whether the samples were acquired immune deficiency syndrome (AIDS)-related. The expression of the Rb2/p130, p107, and cell proliferation-related proteins (cyclin A and B) was determined by immunohistochemistry. The structures of exons 19 through 22 of the RB2/p130 gene, encoding for the B domain and C terminus, were analyzed by polymerase chain reaction (PCR) analysis and single-strand conformation polymorphism (SSCP) technique. The direct PCR products were sequenced to identify the actual mutations. Our results suggest that BL is composed of a mixture of molecular types with distinct genetic and phenotypic patterns, probably resulting from different pathogenetic mechanisms. In endemic BL, the RB2/p130 gene is mutated in most of the cases, and the protein is restricted to the cytoplasm. In AIDS-related BL, high levels of nuclear expression of the wild-type pRb2/p130, p107, and cell proliferation-related proteins were detected. This finding is in line with the molecular mechanisms observed in virus-linked oncogenesis. Sporadic BLs were mainly characterized by the low nuclear values of the wild-type pRb2/p130 and, conversely, the high values of p107. The increased cell proliferation due to different alterations of cell growth control by Rb-related proteins may be the first step in lymphomagenesis, during which additional genetic changes, including missense mutations of c-myc, may subsequently occur. PMID:10702389

  3. Correction of mutant Fanconi anemia gene by homologous recombination in human hematopoietic cells using adeno-associated virus vector.

    PubMed

    Paiboonsukwong, Kittiphong; Ohbayashi, Fumi; Shiiba, Haruka; Aizawa, Emi; Yamashita, Takayuki; Mitani, Kohnosuke

    2009-11-01

    Adeno-associated virus (AAV) vectors have been shown to correct a variety of mutations in human cells by homologous recombination (HR) at high rates, which can overcome insertional mutagenesis and transgene silencing, two of the major hurdles in conventional gene addition therapy of inherited diseases. We examined an ability of AAV vectors to repair a mutation in human hematopoietic cells by HR. We infected a human B-lymphoblastoid cell line (BCL) derived from a normal subject with an AAV, which disrupts the hypoxanthine phosphoribosyl transferase1 (HPRT1) locus, to measure the frequency of AAV-mediated HR in BCL cells. We subsequently constructed an AAV vector encoding the normal sequences from the Fanconi anemia group A (FANCA) locus to correct a mutation in the gene in BCL derived from a FANCA patient. Under optimal conditions, approximately 50% of BCL cells were transduced with an AAV serotype 2 (AAV-2) vector. In FANCA BCL cells, up to 0.016% of infected cells were gene-corrected by HR. AAV-mediated restoration of normal genotypic and phenotypic characteristics in FANCA-mutant cells was confirmed at the DNA, protein and functional levels. The results obtained in the present study indicate that AAV vectors may be applicable for gene correction therapy of inherited hematopoietic disorders.

  4. A homozygous p53 R282W mutant human embryonic stem cell line generated using TALEN-mediated precise gene editing.

    PubMed

    Zhou, Ruoji; Xu, An; Wang, Donghui; Zhu, Dandan; Mata, Helen; Huo, Zijun; Tu, Jian; Liu, Mo; Mohamed, Alaa M T; Jewell, Brittany E; Gingold, Julian; Xia, Weiya; Rao, Pulivarthi H; Hung, Mien-Chie; Zhao, Ruiying; Lee, Dung-Fang

    2018-03-01

    The tumor suppressor gene TP53 is the most frequently mutated gene in human cancers. Many hot-spot mutations of TP53 confer novel functions not found in wild-type p53 and contribute to tumor development and progression. We report on the generation of a H1 human embryonic stem cell line carrying a homozygous TP53 R282W mutation using TALEN-mediated genome editing. The generated cell line demonstrates normal karyotype, maintains a pluripotent state, and is capable of generating a teratoma in vivo containing tissues from all three germ layers. Copyright © 2018 The Author(s). Published by Elsevier B.V. All rights reserved.

  5. A mutation screening of oncogenes, tumor suppressor gene TP53 and nuclear encoded mitochondrial complex I genes in oncocytic thyroid tumors.

    PubMed

    Evangelisti, Cecilia; de Biase, Dario; Kurelac, Ivana; Ceccarelli, Claudio; Prokisch, Holger; Meitinger, Thomas; Caria, Paola; Vanni, Roberta; Romeo, Giovanni; Tallini, Giovanni; Gasparre, Giuseppe; Bonora, Elena

    2015-03-21

    Thyroid neoplasias with oncocytic features represent a specific phenotype in non-medullary thyroid cancer, reflecting the unique biological phenomenon of mitochondrial hyperplasia in the cytoplasm. Oncocytic thyroid cells are characterized by a prominent eosinophilia (or oxyphilia) caused by mitochondrial abundance. Although disruptive mutations in the mitochondrial DNA (mtDNA) are the most significant hallmark of such tumors, oncocytomas may be envisioned as heterogeneous neoplasms, characterized by multiple nuclear and mitochondrial gene lesions. We investigated the nuclear mutational profile of oncocytic tumors to pinpoint the mutations that may trigger the early oncogenic hit. Total DNA was extracted from paraffin-embedded tissues from 45 biopsies of oncocytic tumors. High-resolution melting was used for mutation screening of mitochondrial complex I subunits genes. Specific nuclear rearrangements were investigated by RT-PCR (RET/PTC) or on isolated nuclei by interphase FISH (PAX8/PPARγ). Recurrent point mutations were analyzed by direct sequencing. In our oncocytic tumor samples, we identified rare TP53 mutations. The series of analyzed cases did not include poorly- or undifferentiated thyroid carcinomas, and none of the TP53 mutated cases had significant mitotic activity or high-grade features. Thus, the presence of disruptive TP53 mutations was completely unexpected. In addition, novel mutations in nuclear-encoded complex I genes were identified. These findings suggest that nuclear genetic lesions altering the bioenergetics competence of thyroid cells may give rise to an aberrant mitochondria-centered compensatory mechanism and ultimately to the oncocytic phenotype.

  6. In situ genetic correction of the sickle cell anemia mutation in human induced pluripotent stem cells using engineered zinc finger nucleases.

    PubMed

    Sebastiano, Vittorio; Maeder, Morgan L; Angstman, James F; Haddad, Bahareh; Khayter, Cyd; Yeo, Dana T; Goodwin, Mathew J; Hawkins, John S; Ramirez, Cherie L; Batista, Luis F Z; Artandi, Steven E; Wernig, Marius; Joung, J Keith

    2011-11-01

    The combination of induced pluripotent stem cell (iPSC) technology and targeted gene modification by homologous recombination (HR) represents a promising new approach to generate genetically corrected, patient-derived cells that could be used for autologous transplantation therapies. This strategy has several potential advantages over conventional gene therapy including eliminating the need for immunosuppression, avoiding the risk of insertional mutagenesis by therapeutic vectors, and maintaining expression of the corrected gene by endogenous control elements rather than a constitutive promoter. However, gene targeting in human pluripotent cells has remained challenging and inefficient. Recently, engineered zinc finger nucleases (ZFNs) have been shown to substantially increase HR frequencies in human iPSCs, raising the prospect of using this technology to correct disease causing mutations. Here, we describe the generation of iPSC lines from sickle cell anemia patients and in situ correction of the disease causing mutation using three ZFN pairs made by the publicly available oligomerized pool engineering method (OPEN). Gene-corrected cells retained full pluripotency and a normal karyotype following removal of reprogramming factor and drug-resistance genes. By testing various conditions, we also demonstrated that HR events in human iPSCs can occur as far as 82 bps from a ZFN-induced break. Our approach delineates a roadmap for using ZFNs made by an open-source method to achieve efficient, transgene-free correction of monogenic disease mutations in patient-derived iPSCs. Our results provide an important proof of principle that ZFNs can be used to produce gene-corrected human iPSCs that could be used for therapeutic applications. Copyright © 2011 AlphaMed Press.

  7. Early onset of colorectal cancer in a 13-year-old girl with Lynch syndrome.

    PubMed

    Ahn, Do Hee; Rho, Jung Hee; Tchah, Hann; Jeon, In-Sang

    2016-01-01

    Lynch syndrome is the most common inherited colon cancer syndrome. Patients with Lynch syndrome develop a range of cancers including colorectal cancer (CRC) and carry a mutation on one of the mismatched repair (MMR) genes. Although CRC usually occurs after the fourth decade in patients with Lynch syndrome harboring a heterozygous MMR gene mutation, it can occur in children with Lynch syndrome who have a compound heterozygous or homozygous MMR gene mutation. We report a case of CRC in a 13-year-old patient with Lynch syndrome and congenital heart disease. This patient had a heterozygous mutation in MLH1 (an MMR gene), but no compound MMR gene defects, and a K-RAS somatic mutation in the cancer cells.

  8. Myelin protein zero gene mutated in Charcot-Marie-Tooth type 1B patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Su, Ying; Li, Lanying; Lepercq, J.

    1993-11-15

    The autosomal dominant of Charcot-Marie-Tooth disease (CMT), whose gene is type 1B (CMT1B), has slow nerve conduction with demyelinated Schwann cells. In this study the abundant peripheral myelin protein zero (MPZ) gene, MPZ, was mapped 130 kb centromeric to the Fc receptor immunoglobulin gene cluster in band 1q22, and a major MPZ point mutation was found to cosegregate with CMT1B in one large CMT1B family. The MPZ point mutation in 18 of 18 related CMT1B pedigree 1 patients converts a positively charged lysine in codon 96 to a negatively charged glutamate. The same MPZ locus cosegregates with the CMT1B diseasemore » gene in a second CMT1B family [total multipoint logarithm of odds (lod) = 11.4 at [theta] = 0.00] with a splice junction mutation. Both mutations occur in MPZ protein regions otherwise conserved identically in human, rat, and cow since these species diverged 100 million years ago. MPZ protein, expressed exclusively in myelinated peripheral nerve Schwann cells, constitutes >50% of myelin protein. These mutations are anticipated to disrupt homophilic MPZ binding and result in CMT1B peripheral nerve demyelination.« less

  9. Genetics Home Reference: triosephosphate isomerase deficiency

    MedlinePlus

    ... more common in particular ethnic groups? Genetic Changes Mutations in the TPI1 gene cause triosephosphate isomerase deficiency . ... down to produce energy for cells. TPI1 gene mutations lead to the production of unstable enzymes or ...

  10. Identification and Characterization of Genes That Interact with Lin-12 in Caenorhabditis Elegans

    PubMed Central

    Tax, F. E.; Thomas, J. H.; Ferguson, E. L.; Horvitz, H. R.

    1997-01-01

    We identified and characterized 14 extragenic mutations that suppressed the dominant egg-laying defect of certain lin-12 gain-of-function mutations. These suppressors defined seven genes: sup-17, lag-2, sel-4, sel-5, sel-6, sel-7 and sel-8. Mutations in six of the genes are recessive suppressors, whereas the two mutations that define the seventh gene, lag-2, are semi-dominant suppressors. These suppressor mutations were able to suppress other lin-12 gain-of-function mutations. The suppressor mutations arose at a very low frequency per gene, 10-50 times below the typical loss-of-function mutation frequency. The suppressor mutations in sup-17 and lag-2 were shown to be rare non-null alleles, and we present evidence that null mutations in these two genes cause lethality. Temperature-shift studies for two suppressor genes, sup-17 and lag-2, suggest that both genes act at approximately the same time as lin-12 in specifying a cell fate. Suppressor alleles of six of these genes enhanced a temperature-sensitive loss-of-function allele of glp-1, a gene related to lin-12 in structure and function. Our analysis of these suppressors suggests that the majority of these genes are part of a shared lin-12/glp-1 signal transduction pathway, or act to regulate the expression or stability of lin-12 and glp-1. PMID:9409830

  11. Analysis of Transcription Factors Key for Mouse Pancreatic Development Establishes NKX2-2 and MNX1 Mutations as Causes of Neonatal Diabetes in Man

    PubMed Central

    Flanagan, Sarah E.; De Franco, Elisa; Lango Allen, Hana; Zerah, Michele; Abdul-Rasoul, Majedah M.; Edge, Julie A.; Stewart, Helen; Alamiri, Elham; Hussain, Khalid; Wallis, Sam; de Vries, Liat; Rubio-Cabezas, Oscar; Houghton, Jayne A.L.; Edghill, Emma L.; Patch, Ann-Marie; Ellard, Sian; Hattersley, Andrew T.

    2014-01-01

    Summary Understanding transcriptional regulation of pancreatic development is required to advance current efforts in developing beta cell replacement therapies for patients with diabetes. Current knowledge of key transcriptional regulators has predominantly come from mouse studies, with rare, naturally occurring mutations establishing their relevance in man. This study used a combination of homozygosity analysis and Sanger sequencing in 37 consanguineous patients with permanent neonatal diabetes to search for homozygous mutations in 29 transcription factor genes important for murine pancreatic development. We identified homozygous mutations in 7 different genes in 11 unrelated patients and show that NKX2-2 and MNX1 are etiological genes for neonatal diabetes, thus confirming their key role in development of the human pancreas. The similar phenotype of the patients with recessive mutations and mice with inactivation of a transcription factor gene support there being common steps critical for pancreatic development and validate the use of rodent models for beta cell development. PMID:24411943

  12. Heteroplasmic mutation in the anticodon-stem of mitochondrial tRNA(Val) causing MNGIE-like gastrointestinal dysmotility and cachexia.

    PubMed

    Horváth, Rita; Bender, Andreas; Abicht, Angela; Holinski-Feder, Elke; Czermin, Birgit; Trips, Tobias; Schneiderat, Peter; Lochmüller, Hanns; Klopstock, Thomas

    2009-05-01

    While mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is typically associated with mutations in the nuclear gene encoding for thymidine phosphorylase (ECGF1, TYMP), a similar clinical phenotype was described in patients carrying mutations in the nuclear-encoded polymerase gamma (POLG1) as well as a few mitochondrial tRNA genes. Here we report a novel mutation in the mitochondrial tRNA(Val) (MTTV) gene in a girl presenting with clinical symptoms of MNGIE-like gastrointestinal dysmotility and cachexia. Clinical, histological, biochemical and single cell investigations were performed. The heteroplasmic m.1630A>G mutation was detected in the mitochondrial tRNA(Val) (MTTV) gene in the patient's muscle, blood leukocytes and myoblasts, as well as in blood DNA of the unaffected mother. We provide clinical, biochemical, histological, and molecular genetic evidence on the single cell level for the pathogenicity of this mutation. Our finding adds to the genetic heterogeneity of MNGIE-like gastrointestinal symptoms and highlights the importance of a thorough genetic workup in case of suspected mitochondrial disease.

  13. Plasma homocysteine and vitamin B12 serum levels, red blood cell folate concentrations, C677T methylenetetrahydrofolate reductase gene mutation and risk of recurrent miscarriage: a case-control study in Spain.

    PubMed

    Creus, Montserrat; Deulofeu, Ramon; Peñarrubia, Joana; Carmona, Francisco; Balasch, Juan

    2013-03-01

    Hyperhomocysteinemia and methylenetetrahydrofolate reductase (MTHFR) gene mutation have been postulated as a possible cause of recurrent miscarriage (RM). There is a wide variation in the prevalence of MTHFR polymorphisms and homocysteine (Hcy) plasma levels among populations around the world. The present study was undertaken to investigate the possible association between hyperhomocysteinemia and its causative genetic or acquired factors and RM in Catalonia, a Mediterranean region in Spain. Sixty consecutive patients with ≥ 3 unexplained RM and 30 healthy control women having at least one child but no previous miscarriage were included. Plasma Hcy levels, MTHFR gene mutation, red blood cell (RBC) folate and vitamin B12 serum levels were measured in all subjects. No significant differences were observed neither in plasma Hcy levels, RBC folate and vitamin B12 serum levels nor in the prevalence of homozygous and heterozygous MTHFR gene mutation between the two groups studied. In the present study RM is not associated with hyperhomocysteinemia, and/or the MTHFR gene mutation.

  14. Spectrum of benzo[a]pyrene-induced mutations in the Pig-a gene of L5178YTk+/- cells identified with next generation sequencing.

    PubMed

    Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N

    2017-12-01

    We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.

  15. The transcriptome of the human mast cell leukemia cells HMC-1.2: an approach to identify specific changes in the gene expression profile in KitD816V systemic mastocytosis.

    PubMed

    Haenisch, B; Herms, S; Molderings, G J

    2013-05-01

    To circumvent the costly isolation procedure associated with tissue mast cells, human mast cell lines such as HMC-1 are employed in mastocytosis research, but their relation to mutated mast cells in systemic mastocytosis has not been investigated systematically. In the present study, we determined the transcriptome of HMC-1.2 cells and compared the expression data with those reported in the literature for normal human resting lung and tonsillar mast cells as well as leukocytes from peripheral blood and mononuclear cells from bone marrow aspirates of patients with D816 V-positive systemic mastocytosis. Our results suggest that HMC-1.2 cells are an appropriate model for the investigation of this variant of systemic mast cell activation disease. The data confirm previous suggestions that the pathologically increased activity of mast cells in patients with D816 V-positive systemic mastocytosis can be deduced from the detection of mutation-related changes in the gene expression profile in leukocytes from peripheral blood and in mononuclear cells from bone marrow aspirates. Thus, mutation-related changes of the expression profile can serve as surrogates (besides clustering of mast cells, expression of CD25, and increased release of tryptase) for the presence of the mutation D816 V in tyrosine kinase Kit in patients with systemic mastocytosis according to the WHO criteria. Whether this also holds true for systemic mast cell activation disease caused by other mutations in Kit or other mast cell activity-related genes is a subject for future studies.

  16. Multiple levels of redundant processes inhibit Caenorhabditis elegans vulval cell fates.

    PubMed

    Andersen, Erik C; Saffer, Adam M; Horvitz, H Robert

    2008-08-01

    Many mutations cause obvious abnormalities only when combined with other mutations. Such synthetic interactions can be the result of redundant gene functions. In Caenorhabditis elegans, the synthetic multivulva (synMuv) genes have been grouped into multiple classes that redundantly inhibit vulval cell fates. Animals with one or more mutations of the same class undergo wild-type vulval development, whereas animals with mutations of any two classes have a multivulva phenotype. By varying temperature and genetic background, we determined that mutations in most synMuv genes within a single synMuv class enhance each other. However, in a few cases no enhancement was observed. For example, mutations that affect an Mi2 homolog and a histone methyltransferase are of the same class and do not show enhancement. We suggest that such sets of genes function together in vivo and in at least some cases encode proteins that interact physically. The approach of genetic enhancement can be applied more broadly to identify potential protein complexes as well as redundant processes or pathways. Many synMuv genes are evolutionarily conserved, and the genetic relationships we have identified might define the functions not only of synMuv genes in C. elegans but also of their homologs in other organisms.

  17. Multiple Levels of Redundant Processes Inhibit Caenorhabditis elegans Vulval Cell Fates

    PubMed Central

    Andersen, Erik C.; Saffer, Adam M.; Horvitz, H. Robert

    2008-01-01

    Many mutations cause obvious abnormalities only when combined with other mutations. Such synthetic interactions can be the result of redundant gene functions. In Caenorhabditis elegans, the synthetic multivulva (synMuv) genes have been grouped into multiple classes that redundantly inhibit vulval cell fates. Animals with one or more mutations of the same class undergo wild-type vulval development, whereas animals with mutations of any two classes have a multivulva phenotype. By varying temperature and genetic background, we determined that mutations in most synMuv genes within a single synMuv class enhance each other. However, in a few cases no enhancement was observed. For example, mutations that affect an Mi2 homolog and a histone methyltransferase are of the same class and do not show enhancement. We suggest that such sets of genes function together in vivo and in at least some cases encode proteins that interact physically. The approach of genetic enhancement can be applied more broadly to identify potential protein complexes as well as redundant processes or pathways. Many synMuv genes are evolutionarily conserved, and the genetic relationships we have identified might define the functions not only of synMuv genes in C. elegans but also of their homologs in other organisms. PMID:18689876

  18. [Development of a mouse cell line containing stably integrated copies of pMCLacI/Neo plasmid: a model for studying mutations in vitro].

    PubMed

    Lu, Y; Li, H; Fu, J

    2000-04-01

    To establish a suitable model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells. The NIH3T3 cells were transfected with the linearized pMCLacI/Neo DNAs by liposome-mediated transfection, and grew in the presence of G418. One drug resistant cell clone was selected to proliferate and to be analyzed with Southern blot and RT-PCR analyses on its genomic DNAs. (1) Multiple copies of pMCLacI/Neo plasmid DNA were intactly integrated in the genomic DNAs of the cell clone. (2) One of lac I target genes in the integrated plasmid could be transcribed in the NIH3T3 cells while the other could not. (3) The pMCLacI/Neo plasmid DNA could be efficiently rescued from the genomic DNAs of the cell clone with the average rescue efficiency of 410 cfu/microg DNA. The NIH3T3 cell line containing copies of a stably integrated pMCLacI/Neo has been established. The two lacI target genes in the cell line could imitate the functional states of expressed and non-expressed genes in mammalian cells respectively. The cell line will be a useful model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells.

  19. A somatic T15091C mutation in the Cytb gene of mouse mitochondrial DNA dominantly induces respiration defects.

    PubMed

    Hayashi, Chisato; Takibuchi, Gaku; Shimizu, Akinori; Mito, Takayuki; Ishikawa, Kaori; Nakada, Kazuto; Hayashi, Jun-Ichi

    2015-08-07

    Our previous studies provided evidence that mammalian mitochondrial DNA (mtDNA) mutations that cause mitochondrial respiration defects behave in a recessive manner, because the induction of respiration defects could be prevented with the help of a small proportion (10%-20%) of mtDNA without the mutations. However, subsequent studies found the induction of respiration defects by the accelerated accumulation of a small proportion of mtDNA with various somatic mutations, indicating the presence of mtDNA mutations that behave in a dominant manner. Here, to provide the evidence for the presence of dominant mutations in mtDNA, we used mouse lung carcinoma P29 cells and examined whether some mtDNA molecules possess somatic mutations that dominantly induce respiration defects. Cloning and sequence analysis of 40-48 mtDNA molecules from P29 cells was carried out to screen for somatic mutations in protein-coding genes, because mutations in these genes could dominantly regulate respiration defects by formation of abnormal polypeptides. We found 108 missense mutations existing in one or more of 40-48 mtDNA molecules. Of these missense mutations, a T15091C mutation in the Cytb gene was expected to be pathogenic due to the presence of its orthologous mutation in mtDNA from a patient with cardiomyopathy. After isolation of many subclones from parental P29 cells, we obtained subclones with various proportions of T15091C mtDNA, and showed that the respiration defects were induced in a subclone with only 49% T15091C mtDNA. Because the induction of respiration defects could not be prevented with the help of the remaining 51% mtDNA without the T15091C mutation, the results indicate that the T15091C mutation in mtDNA dominantly induced the respiration defects. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. BCOR regulates myeloid cell proliferation and differentiation

    PubMed Central

    Cao, Qi; Gearhart, Micah D.; Gery, Sigal; Shojaee, Seyedmehdi; Yang, Henry; Sun, Haibo; Lin, De-chen; Bai, Jing-wen; Mead, Monica; Zhao, Zhiqiang; Chen, Qi; Chien, Wen-wen; Alkan, Serhan; Alpermann, Tamara; Haferlach, Torsten; Müschen, Markus; Bardwell, Vivian J.; Koeffler, H. Phillip

    2016-01-01

    BCOR is a component of a variant Polycomb group repressive complex 1 (PRC1). Recently, we and others reported recurrent somatic BCOR loss-of-function mutations in myelodysplastic syndrome and acute myelogenous leukaemia (AML). However, the role of BCOR in normal hematopoiesis is largely unknown. Here, we explored the function of BCOR in myeloid cells using myeloid murine models with Bcor conditional loss-of-function or overexpression alleles. Bcor mutant bone marrow cells showed significantly higher proliferation and differentiation rates with upregulated expression of Hox genes. Mutation of Bcor reduced protein levels of RING1B, an H2A ubiquitin ligase subunit of PRC1 family complexes and reduced H2AK119ub upstream of upregulated HoxA genes. Global RNA expression profiling in murine cells and AML patient samples with BCOR loss-of-function mutation suggested that loss of BCOR expression is associated with enhanced cell proliferation and myeloid differentiation. Our results strongly suggest that BCOR plays an indispensable role in hematopoiesis by inhibiting myeloid cell proliferation and differentiation and offer a mechanistic explanation for how BCOR regulates gene expression such as Hox genes. PMID:26847029

  1. A targeted mutational landscape of angioimmunoblastic T-cell lymphoma

    PubMed Central

    Odejide, Oreofe; Weigert, Oliver; Lane, Andrew A.; Toscano, Dan; Lunning, Matthew A.; Kopp, Nadja; Kim, Sunhee; van Bodegom, Diederik; Bolla, Sudha; Schatz, Jonathan H.; Teruya-Feldstein, Julie; Hochberg, Ephraim; Louissaint, Abner; Dorfman, David; Stevenson, Kristen; Rodig, Scott J.; Piccaluga, Pier Paolo; Jacobsen, Eric; Pileri, Stefano A.; Harris, Nancy L.; Ferrero, Simone; Inghirami, Giorgio; Horwitz, Steven M.

    2014-01-01

    The genetics of angioimmunoblastic T-cell lymphoma (AITL) are very poorly understood. We defined the mutational landscape of AITL across 219 genes in 85 cases from the United States and Europe. We identified ≥2 mutations in 34 genes, nearly all of which were not previously implicated in AITL. These included loss-of-function mutations in TP53 (n = 4), ETV6 (n = 3), CCND3 (n = 2), and EP300 (n = 5), as well as gain-of-function mutations in JAK2 (n = 2) and STAT3 (n = 4). TET2 was mutated in 65 (76%) AITLs, including 43 that harbored 2 or 3 TET2 mutations. DNMT3A mutations occurred in 28 (33%) AITLs; 100% of these also harbored TET2 mutations (P < .0001). Seventeen AITLs harbored IDH2 R172 substitutions, including 15 with TET2 mutations. In summary, AITL is characterized by high frequencies of overlapping mutations in epigenetic modifiers and targetable mutations in a subset of cases. PMID:24345752

  2. Next-generation sequencing of translocation renal cell carcinoma reveals novel RNA splicing partners and frequent mutations of chromatin-remodeling genes.

    PubMed

    Malouf, Gabriel G; Su, Xiaoping; Yao, Hui; Gao, Jianjun; Xiong, Liangwen; He, Qiuming; Compérat, Eva; Couturier, Jérôme; Molinié, Vincent; Escudier, Bernard; Camparo, Philippe; Doss, Denaha J; Thompson, Erika J; Khayat, David; Wood, Christopher G; Yu, Willie; Teh, Bin T; Weinstein, John; Tannir, Nizar M

    2014-08-01

    MITF/TFE translocation renal cell carcinoma (TRCC) is a rare subtype of kidney cancer. Its incidence and the genome-wide characterization of its genetic origin have not been fully elucidated. We performed RNA and exome sequencing on an exploratory set of TRCC (n = 7), and validated our findings using The Cancer Genome Atlas (TCGA) clear-cell RCC (ccRCC) dataset (n = 460). Using the TCGA dataset, we identified seven TRCC (1.5%) cases and determined their genomic profile. We discovered three novel partners of MITF/TFE (LUC7L3, KHSRP, and KHDRBS2) that are involved in RNA splicing. TRCC displayed a unique gene expression signature as compared with other RCC types, and showed activation of MITF, the transforming growth factor β1 and the PI3K complex targets. Genes differentially spliced between TRCC and other RCC types were enriched for MITF and ID2 targets. Exome sequencing of TRCC revealed a distinct mutational spectrum as compared with ccRCC, with frequent mutations in chromatin-remodeling genes (six of eight cases, three of which were from the TCGA). In two cases, we identified mutations in INO80D, an ATP-dependent chromatin-remodeling gene, previously shown to control the amplitude of the S phase. Knockdown of INO80D decreased cell proliferation in a novel cell line bearing LUC7L3-TFE3 translocation. This genome-wide study defines the incidence of TRCC within a ccRCC-directed project and expands the genomic spectrum of TRCC by identifying novel MITF/TFE partners involved in RNA splicing and frequent mutations in chromatin-remodeling genes. ©2014 American Association for Cancer Research.

  3. Premature chain termination is a unifying mechanism for COL1A1 null alleles in osteogenesis imperfecta type I cell strains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Willing, M.C.; Deschenes, S.P.; Roberts, E.J.

    Nonsense and frameshift mutations, which predict premature termination of translation, often cause a dramatic reduction in the amount of transcript from the mutant allele (nonsense-mediated mRNA decay). In some genes, these mutations also influence RNA splicing and induce skipping of the exon that contains the nonsense codon. To begin to dissect how premature termination alters the metabolism of RNA from the COL1A1 gene, we studied nonsense and frameshift mutations distributed over exons 11-49 of the gene. These mutations were originally identified in 10 unrelated families with osteogenesis imperfecta (OI) type I. We observed marked reduction in steady-state amounts of mRNAmore » from the mutant allele in both total cellular and nuclear RNA extracts of cells from affected individuals, suggesting that nonsense-mediated decay of COL1A1 RNA is a nuclear phenomenon. Position of the mutation within the gene did not influence this observation. None of the mutations induced skipping of either the exon containing the mutation or, for the frameshifts, the downstream exons with the new termination sites. Our data suggest that nonsense and frameshift mutations throughout most of the COL1A1 gene result in a null allele, which is associated with the predictable mild clinical phenotype, OI type I. 42 refs., 6 figs., 1 tab.« less

  4. The landscape of cancer genes and mutational processes in breast cancer

    PubMed Central

    Stephens, Philip J.; Tarpey, Patrick S.; Davies, Helen; Loo, Peter Van; Greenman, Chris; Wedge, David C.; Nik-Zainal, Serena; Martin, Sancha; Varela, Ignacio; Bignell, Graham R.; Yates, Lucy R.; Papaemmanuil, Elli; Beare, David; Butler, Adam; Cheverton, Angela; Gamble, John; Hinton, Jonathan; Jia, Mingming; Jayakumar, Alagu; Jones, David; Latimer, Calli; Lau, King Wai; McLaren, Stuart; McBride, David J.; Menzies, Andrew; Mudie, Laura; Raine, Keiran; Rad, Roland; Chapman, Michael Spencer; Teague, Jon; Easton, Douglas; Langerød, Anita; OSBREAC; Lee, Ming Ta Michael; Shen, Chen-Yang; Tee, Benita Tan Kiat; Huimin, Bernice Wong; Broeks, Annegien; Vargas, Ana Cristina; Turashvili, Gulisa; Martens, John; Fatima, Aquila; Miron, Penelope; Chin, Suet-Feung; Thomas, Gilles; Boyault, Sandrine; Mariani, Odette; Lakhani, Sunil R.; van de Vijver, Marc; van ’t Veer, Laura; Foekens, John; Desmedt, Christine; Sotiriou, Christos; Tutt, Andrew; Caldas, Carlos; Reis-Filho, Jorge S.; Aparicio, Samuel A. J. R.; Salomon, Anne Vincent; Børresen-Dale, Anne-Lise; Richardson, Andrea L.; Campbell, Peter J.; Futreal, P. Andrew; Stratton, Michael R.

    2012-01-01

    All cancers carry somatic mutations in their genomes. A subset, known as driver mutations, confer clonal selective advantage on cancer cells and are causally implicated in oncogenesis1, and the remainder are passenger mutations. The driver mutations and mutational processes operative in breast cancer have not yet been comprehensively explored. Here we examine the genomes of 100 tumours for somatic copy number changes and mutations in the coding exons of protein-coding genes. The number of somatic mutations varied markedly between individual tumours. We found strong correlations between mutation number, age at which cancer was diagnosed and cancer histological grade, and observed multiple mutational signatures, including one present in about ten per cent of tumours characterized by numerous mutations of cytosine at TpC dinucleotides. Driver mutations were identified in several new cancer genes including AKT2, ARID1B, CASP8, CDKN1B, MAP3K1, MAP3K13, NCOR1, SMARCD1 and TBX3. Among the 100 tumours, we found driver mutations in at least 40 cancer genes and 73 different combinations of mutated cancer genes. The results highlight the substantial genetic diversity underlying this common disease. PMID:22722201

  5. Correction of Hirschsprung-Associated Mutations in Human Induced Pluripotent Stem Cells Via Clustered Regularly Interspaced Short Palindromic Repeats/Cas9, Restores Neural Crest Cell Function.

    PubMed

    Lai, Frank Pui-Ling; Lau, Sin-Ting; Wong, John Kwong-Leong; Gui, Hongsheng; Wang, Reeson Xu; Zhou, Tingwen; Lai, Wing Hon; Tse, Hung-Fat; Tam, Paul Kwong-Hang; Garcia-Barcelo, Maria-Mercedes; Ngan, Elly Sau-Wai

    2017-07-01

    Hirschsprung disease is caused by failure of enteric neural crest cells (ENCCs) to fully colonize the bowel, leading to bowel obstruction and megacolon. Heterozygous mutations in the coding region of the RET gene cause a severe form of Hirschsprung disease (total colonic aganglionosis). However, 80% of HSCR patients have short-segment Hirschsprung disease (S-HSCR), which has not been associated with genetic factors. We sought to identify mutations associated with S-HSCR, and used the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 gene editing system to determine how mutations affect ENCC function. We created induced pluripotent stem cell (iPSC) lines from 1 patient with total colonic aganglionosis (with the G731del mutation in RET) and from 2 patients with S-HSCR (without a RET mutation), as well as RET +/- and RET -/- iPSCs. IMR90-iPSC cells were used as the control cell line. Migration and differentiation capacities of iPSC-derived ENCCs were analyzed in differentiation and migration assays. We searched for mutation(s) associated with S-HSCR by combining genetic and transcriptome data from patient blood- and iPSC-derived ENCCs, respectively. Mutations in the iPSCs were corrected using the CRISPR/Cas9 system. ENCCs derived from all iPSC lines, but not control iPSCs, had defects in migration and neuronal lineage differentiation. RET mutations were associated with differentiation and migration defects of ENCCs in vitro. Genetic and transcriptome analyses associated a mutation in the vinculin gene (VCL M209L) with S-HSCR. CRISPR/Cas9 correction of the RET G731del and VCL M209L mutations in iPSCs restored the differentiation and migration capacities of ENCCs. We identified mutations in VCL associated with S-HSCR. Correction of this mutation in iPSC using CRISPR/Cas9 editing, as well as the RET G731del mutation that causes Hirschsprung disease with total colonic aganglionosis, restored ENCC function. Our study demonstrates how human iPSCs can be used to identify disease-associated mutations and determine how they affect cell functions and contribute to pathogenesis. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  6. A reversion of an IL2RG mutation in combined immunodeficiency providing competitive advantage to the majority of CD8+ T cells

    PubMed Central

    Kuijpers, Taco W.; van Leeuwen, Ester M.M.; Barendregt, Barbara H.; Klarenbeek, Paul; aan de Kerk, Daan J.; Baars, Paul A.; Jansen, Machiel H.; de Vries, Niek; van Lier, René A.W.; van der Burg, Mirjam

    2013-01-01

    Mutations in the common gamma chain (γc, CD132, encoded by the IL2RG gene) can lead to B+T−NK− X-linked severe combined immunodeficiency, as a consequence of unresponsiveness to γc-cytokines such as interleukins-2, -7 and -15. Hypomorphic mutations in CD132 may cause combined immunodeficiencies with a variety of clinical presentations. We analyzed peripheral blood mononuclear cells of a 6-year-old boy with normal lymphocyte counts, who suffered from recurrent pneumonia and disseminated mollusca contagiosa. Since proliferative responses of T cells and NK cells to γc -cytokines were severely impaired, we performed IL2RG gene analysis, showing a heterozygous mutation in the presence of a single X-chromosome. Interestingly, an IL2RG reversion to normal predominated in both naïve and antigen-primed CD8+ T cells and increased over time. Only the revertant CD8+ T cells showed normal expression of CD132 and the various CD8+ T cell populations had a different T-cell receptor repertoire. Finally, a fraction of γδ+ T cells and differentiated CD4+CD27− effector-memory T cells carried the reversion, whereas NK or B cells were repeatedly negative. In conclusion, in a patient with a novel IL2RG mutation, gene-reverted CD8+ T cells accumulated over time. Our data indicate that selective outgrowth of particular T-cell subsets may occur following reversion at the level of committed T progenitor cells. PMID:23403317

  7. A reversion of an IL2RG mutation in combined immunodeficiency providing competitive advantage to the majority of CD8+ T cells.

    PubMed

    Kuijpers, Taco W; van Leeuwen, Ester M M; Barendregt, Barbara H; Klarenbeek, Paul; aan de Kerk, Daan J; Baars, Paul A; Jansen, Machiel H; de Vries, Niek; van Lier, René A W; van der Burg, Mirjam

    2013-07-01

    Mutations in the common gamma chain (γc, CD132, encoded by the IL2RG gene) can lead to B(+)T(-)NK(-) X-linked severe combined immunodeficiency, as a consequence of unresponsiveness to γc-cytokines such as interleukins-2, -7 and -15. Hypomorphic mutations in CD132 may cause combined immunodeficiencies with a variety of clinical presentations. We analyzed peripheral blood mononuclear cells of a 6-year-old boy with normal lymphocyte counts, who suffered from recurrent pneumonia and disseminated mollusca contagiosa. Since proliferative responses of T cells and NK cells to γc -cytokines were severely impaired, we performed IL2RG gene analysis, showing a heterozygous mutation in the presence of a single X-chromosome. Interestingly, an IL2RG reversion to normal predominated in both naïve and antigen-primed CD8(+) T cells and increased over time. Only the revertant CD8(+) T cells showed normal expression of CD132 and the various CD8(+) T cell populations had a different T-cell receptor repertoire. Finally, a fraction of γδ(+) T cells and differentiated CD4(+)CD27(-) effector-memory T cells carried the reversion, whereas NK or B cells were repeatedly negative. In conclusion, in a patient with a novel IL2RG mutation, gene-reverted CD8(+) T cells accumulated over time. Our data indicate that selective outgrowth of particular T-cell subsets may occur following reversion at the level of committed T progenitor cells.

  8. How Alterations in the Cdt1 Expression Lead to Gene Amplification in Breast Cancer

    DTIC Science & Technology

    2011-07-01

    absence of extrinsic DNA damage. We measured the TLS activity by measuring the mutation frequency in a supF gene (in a shuttle vector) subjected to UV...induced DNA damage before its introduction into the cells. Error-prone TLS activity will mutate the supF gene , which is scored by a blue-white colony...Figure 4A). Sequencing of the mutant supF genes , revealed a mutation spectrum consistent with error prone TLS (Supplemental Table 1). Significantly

  9. New mutations and an updated database for the patched-1 (PTCH1) gene.

    PubMed

    Reinders, Marie G; van Hout, Antonius F; Cosgun, Betûl; Paulussen, Aimée D; Leter, Edward M; Steijlen, Peter M; Mosterd, Klara; van Geel, Michel; Gille, Johan J

    2018-05-01

    Basal cell nevus syndrome (BCNS) is an autosomal dominant disorder characterized by multiple basal cell carcinomas (BCCs), maxillary keratocysts, and cerebral calcifications. BCNS most commonly is caused by a germline mutation in the patched-1 (PTCH1) gene. PTCH1 mutations are also described in patients with holoprosencephaly. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). We included 117 new PTCH1 variations, in addition to 331 previously published unique PTCH1 mutations. These new mutations were found in 141 patients who had a positive PTCH1 mutation analysis in either the VU University Medical Centre (VUMC) or Maastricht University Medical Centre (MUMC) between 1995 and 2015. The database contains 331 previously published unique PTCH1 mutations and 117 new PTCH1 variations. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). The database provides an open collection for both clinicians and researchers and is accessible online at http://www.lovd.nl/PTCH1. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  10. Genetics Home Reference: spinal muscular atrophy

    MedlinePlus

    ... atrophy types I, II, III, and IV. SMN1 gene mutations lead to a shortage of the SMN protein. ... to be broken down (degraded) within cells. UBA1 gene mutations lead to reduced or absent levels of functional ...

  11. Impact of spliceosome mutations on RNA splicing in myelodysplasia: dysregulated genes/pathways and clinical associations.

    PubMed

    Pellagatti, Andrea; Armstrong, Richard N; Steeples, Violetta; Sharma, Eshita; Repapi, Emmanouela; Singh, Shalini; Sanchi, Andrea; Radujkovic, Aleksandar; Horn, Patrick; Dolatshad, Hamid; Roy, Swagata; Broxholme, John; Lockstone, Helen; Taylor, Stephen; Giagounidis, Aristoteles; Vyas, Paresh; Schuh, Anna; Hamblin, Angela; Papaemmanuil, Elli; Killick, Sally; Malcovati, Luca; Hennrich, Marco L; Gavin, Anne-Claude; Ho, Anthony D; Luft, Thomas; Hellström-Lindberg, Eva; Cazzola, Mario; Smith, Christopher W J; Smith, Stephen; Boultwood, Jacqueline

    2018-06-21

    SF3B1, SRSF2 and U2AF1 are the most frequently mutated splicing factor genes in the myelodysplastic syndromes (MDS). We have performed a comprehensive and systematic analysis to determine the impact of these commonly mutated splicing factors on pre-mRNA splicing in the bone marrow stem/progenitor cells and in the erythroid and myeloid precursors in splicing factor mutant MDS. Using RNA-seq, we determined the aberrantly spliced genes and dysregulated pathways in CD34 + cells of 84 MDS patients. Splicing factor mutations result in different alterations in splicing and largely affect different genes, but these converge in common dysregulated pathways and cellular processes, focused on RNA splicing, protein synthesis and mitochondrial dysfunction, suggesting common mechanisms of action in MDS. Many of these dysregulated pathways and cellular processes can be linked to the known disease pathophysiology associated with splicing factor mutations in MDS, whilst several others have not been previously associated with MDS, such as sirtuin signaling. We identified aberrantly spliced events associated with clinical variables, and isoforms which independently predict survival in MDS and implicate dysregulation of focal adhesion and extracellular exosomes as drivers of poor survival. Aberrantly spliced genes and dysregulated pathways were identified in the MDS-affected lineages in splicing factor mutant MDS. Functional studies demonstrated that knockdown of the mitosis regulators SEPT2 and AKAP8, aberrantly spliced target genes of SF3B1 and SRSF2 mutations respectively, led to impaired erythroid cell growth and differentiation. This study illuminates the impact of the common spliceosome mutations on the MDS phenotype and provides novel insights into disease pathophysiology. Copyright © 2018 American Society of Hematology.

  12. Personalized Stem Cell Therapy to Correct Corneal Defects Due to a Unique Homozygous-Heterozygous Mosaicism of Ectrodactyly-Ectodermal Dysplasia-Clefting Syndrome.

    PubMed

    Barbaro, Vanessa; Nasti, Annamaria Assunta; Raffa, Paolo; Migliorati, Angelo; Nespeca, Patrizia; Ferrari, Stefano; Palumbo, Elisa; Bertolin, Marina; Breda, Claudia; Miceli, Francesco; Russo, Antonella; Caenazzo, Luciana; Ponzin, Diego; Palù, Giorgio; Parolin, Cristina; Di Iorio, Enzo

    2016-08-01

    : Ectrodactyly-ectodermal dysplasia-clefting (EEC) syndrome is a rare autosomal dominant disease caused by mutations in the p63 gene. To date, approximately 40 different p63 mutations have been identified, all heterozygous. No definitive treatments are available to counteract and resolve the progressive corneal degeneration due to a premature aging of limbal epithelial stem cells. Here, we describe a unique case of a young female patient, aged 18 years, with EEC and corneal dysfunction, who was, surprisingly, homozygous for a novel and de novo R311K missense mutation in the p63 gene. A detailed analysis of the degree of somatic mosaicism in leukocytes from peripheral blood and oral mucosal epithelial stem cells (OMESCs) from biopsies of buccal mucosa showed that approximately 80% were homozygous mutant cells and 20% were heterozygous. Cytogenetic and molecular analyses excluded genomic alterations, thus suggesting a de novo mutation followed by an allelic gene conversion of the wild-type allele by de novo mutant allele as a possible mechanism to explain the homozygous condition. R311K-p63 OMESCs were expanded in vitro and heterozygous holoclones selected following clonal analysis. These R311K-p63 OMESCs were able to generate well-organized and stratified epithelia in vitro, resembling the features of healthy tissues. This study supports the rationale for the development of cultured autologous oral mucosal epithelial stem cell sheets obtained by selected heterozygous R311K-p63 stem cells, as an effective and personalized therapy for reconstructing the ocular surface of this unique case of EEC syndrome, thus bypassing gene therapy approaches. This case demonstrates that in a somatic mosaicism context, a novel homozygous mutation in the p63 gene can arise as a consequence of an allelic gene conversion event, subsequent to a de novo mutation. The heterozygous mutant R311K-p63 stem cells can be isolated by means of clonal analysis and given their good regenerative capacity, they may be used to successfully correct the corneal defects present in this unique case of ectrodactyly-ectodermal dysplasia-clefting syndrome. ©AlphaMed Press.

  13. Cediranib Maleate and Olaparib or Standard Chemotherapy in Treating Patients With Recurrent Platinum-Resistant or -Refractory Ovarian, Fallopian Tube, or Primary Peritoneal Cancer

    ClinicalTrials.gov

    2018-06-15

    Deleterious BRCA1 Gene Mutation; Deleterious BRCA2 Gene Mutation; Fallopian Tube Clear Cell Adenocarcinoma; Fallopian Tube Endometrioid Adenocarcinoma; Fallopian Tube Serous Adenocarcinoma; Fallopian Tube Transitional Cell Carcinoma; Ovarian Clear Cell Adenocarcinoma; Ovarian Endometrioid Adenocarcinoma; Ovarian Seromucinous Carcinoma; Ovarian Serous Adenocarcinoma; Ovarian Transitional Cell Carcinoma; Primary Peritoneal Serous Adenocarcinoma; Recurrent Fallopian Tube Carcinoma; Recurrent Ovarian Carcinoma; Recurrent Primary Peritoneal Carcinoma; Undifferentiated Fallopian Tube Carcinoma; Undifferentiated Ovarian Carcinoma

  14. Identification of a Novel GJA8 (Cx50) Point Mutation Causes Human Dominant Congenital Cataracts

    NASA Astrophysics Data System (ADS)

    Ge, Xiang-Lian; Zhang, Yilan; Wu, Yaming; Lv, Jineng; Zhang, Wei; Jin, Zi-Bing; Qu, Jia; Gu, Feng

    2014-02-01

    Hereditary cataracts are clinically and genetically heterogeneous lens diseases that cause a significant proportion of visual impairment and blindness in children. Human cataracts have been linked with mutations in two genes, GJA3 and GJA8, respectively. To identify the causative mutation in a family with hereditary cataracts, family members were screened for mutations by PCR for both genes. Sequencing the coding regions of GJA8, coding for connexin 50, revealed a C > A transversion at nucleotide 264, which caused p.P88T mutation. To dissect the molecular consequences of this mutation, plasmids carrying wild-type and mutant mouse ORFs of Gja8 were generated and ectopically expressed in HEK293 cells and human lens epithelial cells, respectively. The recombinant proteins were assessed by confocal microscopy and Western blotting. The results demonstrate that the molecular consequences of the p.P88T mutation in GJA8 include changes in connexin 50 protein localization patterns, accumulation of mutant protein, and increased cell growth.

  15. Recessive mutations in the INS gene result in neonatal diabetes through reduced insulin biosynthesis

    PubMed Central

    Garin, Intza; Edghill, Emma L.; Akerman, Ildem; Rubio-Cabezas, Oscar; Rica, Itxaso; Locke, Jonathan M.; Maestro, Miguel Angel; Alshaikh, Adnan; Bundak, Ruveyde; del Castillo, Gabriel; Deeb, Asma; Deiss, Dorothee; Fernandez, Juan M.; Godbole, Koumudi; Hussain, Khalid; O’Connell, Michele; Klupa, Thomasz; Kolouskova, Stanislava; Mohsin, Fauzia; Perlman, Kusiel; Sumnik, Zdenek; Rial, Jose M.; Ugarte, Estibaliz; Vasanthi, Thiruvengadam; Johnstone, Karen; Flanagan, Sarah E.; Martínez, Rosa; Castaño, Carlos; Patch, Ann-Marie; Fernández-Rebollo, Eduardo; Raile, Klemens; Morgan, Noel; Harries, Lorna W.; Castaño, Luis; Ellard, Sian; Ferrer, Jorge; de Nanclares, Guiomar Perez; Hattersley, Andrew T.

    2010-01-01

    Heterozygous coding mutations in the INS gene that encodes preproinsulin were recently shown to be an important cause of permanent neonatal diabetes. These dominantly acting mutations prevent normal folding of proinsulin, which leads to beta-cell death through endoplasmic reticulum stress and apoptosis. We now report 10 different recessive INS mutations in 15 probands with neonatal diabetes. Functional studies showed that recessive mutations resulted in diabetes because of decreased insulin biosynthesis through distinct mechanisms, including gene deletion, lack of the translation initiation signal, and altered mRNA stability because of the disruption of a polyadenylation signal. A subset of recessive mutations caused abnormal INS transcription, including the deletion of the C1 and E1 cis regulatory elements, or three different single base-pair substitutions in a CC dinucleotide sequence located between E1 and A1 elements. In keeping with an earlier and more severe beta-cell defect, patients with recessive INS mutations had a lower birth weight (−3.2 SD score vs. −2.0 SD score) and were diagnosed earlier (median 1 week vs. 10 weeks) compared to those with dominant INS mutations. Mutations in the insulin gene can therefore result in neonatal diabetes as a result of two contrasting pathogenic mechanisms. Moreover, the recessively inherited mutations provide a genetic demonstration of the essential role of multiple sequence elements that regulate the biosynthesis of insulin in man. PMID:20133622

  16. Precision Medicine: Genetic Repair of Retinitis Pigmentosa in Patient-Derived Stem Cells.

    PubMed

    Bassuk, Alexander G; Zheng, Andrew; Li, Yao; Tsang, Stephen H; Mahajan, Vinit B

    2016-01-27

    Induced pluripotent stem cells (iPSCs) generated from patient fibroblasts could potentially be used as a source of autologous cells for transplantation in retinal disease. Patient-derived iPSCs, however, would still harbor disease-causing mutations. To generate healthy patient-derived cells, mutations might be repaired with new gene-editing technology based on the bacterial system of clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9, thereby yielding grafts that require no patient immunosuppression. We tested whether CRISPR/Cas9 could be used in patient-specific iPSCs to precisely repair an RPGR point mutation that causes X-linked retinitis pigmentosa (XLRP). Fibroblasts cultured from a skin-punch biopsy of an XLRP patient were transduced to produce iPSCs carrying the patient's c.3070G > T mutation. The iPSCs were transduced with CRISPR guide RNAs, Cas9 endonuclease, and a donor homology template. Despite the gene's repetitive and GC-rich sequences, 13% of RPGR gene copies showed mutation correction and conversion to the wild-type allele. This is the first report using CRISPR to correct a pathogenic mutation in iPSCs derived from a patient with photoreceptor degeneration. This important proof-of-concept finding supports the development of personalized iPSC-based transplantation therapies for retinal disease.

  17. Multiple point mutations in a shuttle vector propagated in human cells: evidence for an error-prone DNA polymerase activity.

    PubMed

    Seidman, M M; Bredberg, A; Seetharam, S; Kraemer, K H

    1987-07-01

    Mutagenesis was studied at the DNA-sequence level in human fibroblast and lymphoid cells by use of a shuttle vector plasmid, pZ189, containing a suppressor tRNA marker gene. In a series of experiments, 62 plasmids were recovered that had two to six base substitutions in the 160-base-pair marker gene. Approximately 20-30% of the mutant plasmids that were recovered after passing ultraviolet-treated pZ189 through a repair-proficient human fibroblast line contained these multiple mutations. In contrast, passage of ultraviolet-treated pZ189 through an excision-repair-deficient (xeroderma pigmentosum) line yielded only 2% multiple base substitution mutants. Introducing a single-strand nick in otherwise unmodified pZ189 adjacent to the marker, followed by passage through the xeroderma pigmentosum cells, resulted in about 66% multiple base substitution mutants. The multiple mutations were found in a 160-base-pair region containing the marker gene but were rarely found in an adjacent 170-base-pair region. Passing ultraviolet-treated or nicked pZ189 through a repair-proficient human B-cell line also yielded multiple base substitution mutations in 20-33% of the mutant plasmids. An explanation for these multiple mutations is that they were generated by an error-prone polymerase while filling gaps. These mutations share many of the properties displayed by mutations in the immunoglobulin hypervariable regions.

  18. Antigen S1, encoded by the MIC1 gene, is characterized as an epitope of human CD59, enabling measurement of mutagen-induced intragenic deletions in the AL cell system

    NASA Technical Reports Server (NTRS)

    Wilson, A. B.; Seilly, D.; Willers, C.; Vannais, D. B.; McGraw, M.; Waldren, C. A.; Hei, T. K.; Davies, A.; Chatterjee, A. (Principal Investigator)

    1999-01-01

    S1 cell membrane antigen is encoded by the MIC1 gene on human chromosome 11. This antigen has been widely used as a marker for studies in gene mapping or in analysis of mutagen-induced gene deletions/mutations, which utilized the human-hamster hybrid cell-line, AL-J1, carrying human chromosome 11. Evidence is presented here which identifies S1 as an epitope of CD59, a cell membrane complement inhibiting protein. E7.1 monoclonal antibody, specific for the S1 determinant, was found to react strongly with membrane CD59 in Western blotting, and to bind to purified, urinary form of CD59 in ELISAs. Cell membrane expression of S1 on various cell lines always correlated with that of CD59 when examined by immunofluorescent staining. In addition, E7.1 antibody inhibited the complement regulatory function of CD59. Identification of S1 protein as CD59 has increased the scope of the AL cell system by enabling analysis of intragenic mutations, and multiplex PCR analysis of mutated cells is described, showing variable loss of CD59 exons.

  19. Landscape of somatic mutations and clonal evolution in mantle cell lymphoma.

    PubMed

    Beà, Sílvia; Valdés-Mas, Rafael; Navarro, Alba; Salaverria, Itziar; Martín-Garcia, David; Jares, Pedro; Giné, Eva; Pinyol, Magda; Royo, Cristina; Nadeu, Ferran; Conde, Laura; Juan, Manel; Clot, Guillem; Vizán, Pedro; Di Croce, Luciano; Puente, Diana A; López-Guerra, Mónica; Moros, Alexandra; Roue, Gael; Aymerich, Marta; Villamor, Neus; Colomo, Lluís; Martínez, Antonio; Valera, Alexandra; Martín-Subero, José I; Amador, Virginia; Hernández, Luis; Rozman, Maria; Enjuanes, Anna; Forcada, Pilar; Muntañola, Ana; Hartmann, Elena M; Calasanz, María J; Rosenwald, Andreas; Ott, German; Hernández-Rivas, Jesús M; Klapper, Wolfram; Siebert, Reiner; Wiestner, Adrian; Wilson, Wyndham H; Colomer, Dolors; López-Guillermo, Armando; López-Otín, Carlos; Puente, Xose S; Campo, Elías

    2013-11-05

    Mantle cell lymphoma (MCL) is an aggressive tumor, but a subset of patients may follow an indolent clinical course. To understand the mechanisms underlying this biological heterogeneity, we performed whole-genome and/or whole-exome sequencing on 29 MCL cases and their respective matched normal DNA, as well as 6 MCL cell lines. Recurrently mutated genes were investigated by targeted sequencing in an independent cohort of 172 MCL patients. We identified 25 significantly mutated genes, including known drivers such as ataxia-telangectasia mutated (ATM), cyclin D1 (CCND1), and the tumor suppressor TP53; mutated genes encoding the anti-apoptotic protein BIRC3 and Toll-like receptor 2 (TLR2); and the chromatin modifiers WHSC1, MLL2, and MEF2B. We also found NOTCH2 mutations as an alternative phenomenon to NOTCH1 mutations in aggressive tumors with a dismal prognosis. Analysis of two simultaneous or subsequent MCL samples by whole-genome/whole-exome (n = 8) or targeted (n = 19) sequencing revealed subclonal heterogeneity at diagnosis in samples from different topographic sites and modulation of the initial mutational profile at the progression of the disease. Some mutations were predominantly clonal or subclonal, indicating an early or late event in tumor evolution, respectively. Our study identifies molecular mechanisms contributing to MCL pathogenesis and offers potential targets for therapeutic intervention.

  20. Comparison of small biopsy specimens and surgical specimens for the detection of EGFR mutations and EML4-ALK in non-small-cell lung cancer

    PubMed Central

    Xiao, DeSheng; Lu, Can; Zhu, Wei; He, QiuYan; Li, Yong; Fu, ChunYan; Zhou, JianHua; Liu, Shuang; Tao, YongGuang

    2016-01-01

    Epidermal growth factor receptor (EGFR) mutations and anaplastic lymphoma kinase (ALK) fusion genes represent novel oncogenes that are associated with non–small-cell lung cancers (NSCLC). The feasibility of detecting EGFR mutations and ALK fusion genes in small biopsy specimens or surgical specimens was determined. Of the 721 NSCLC patients, a total of 305 cases were positive for EGFR mutations (42.3%). The rate of EGFR mutations in women was significantly higher than that in men. Histologically, the EGFR mutation rate in adenocarcinomas was significantly higher than that in squamous cell carcinomas. No difference in the EGFR mutation rate was observed between surgical specimens (42.1%) and small biopsy specimens (42.4%), which indicated that the EGFR mutation ratios in surgical specimens and small biopsy specimens were not different. In 385 NSCLC patients, 26 cases were positive for EML4-ALK (6.8%). However, 11.7% of the surgical specimens were EML4-ALK-positive, whereas the positive proportion in the small biopsy specimens was only 4.7%, which indicated that EML4-ALK-positive rate in the surgical specimens was significantly higher than that in the small biopsy specimens. Detection of EGFR gene mutations was feasible in small biopsy specimens, and screening for EML4-ALK expression in small biopsy specimens can be used to guide clinical treatments. PMID:27322143

  1. Comparison of small biopsy specimens and surgical specimens for the detection of EGFR mutations and EML4-ALK in non-small-cell lung cancer.

    PubMed

    Xiao, DeSheng; Lu, Can; Zhu, Wei; He, QiuYan; Li, Yong; Fu, ChunYan; Zhou, JianHua; Liu, Shuang; Tao, YongGuang

    2016-09-13

    Epidermal growth factor receptor (EGFR) mutations and anaplastic lymphoma kinase (ALK) fusion genes represent novel oncogenes that are associated with non-small-cell lung cancers (NSCLC). The feasibility of detecting EGFR mutations and ALK fusion genes in small biopsy specimens or surgical specimens was determined. Of the 721 NSCLC patients, a total of 305 cases were positive for EGFR mutations (42.3%). The rate of EGFR mutations in women was significantly higher than that in men. Histologically, the EGFR mutation rate in adenocarcinomas was significantly higher than that in squamous cell carcinomas. No difference in the EGFR mutation rate was observed between surgical specimens (42.1%) and small biopsy specimens (42.4%), which indicated that the EGFR mutation ratios in surgical specimens and small biopsy specimens were not different. In 385 NSCLC patients, 26 cases were positive for EML4-ALK (6.8%). However, 11.7% of the surgical specimens were EML4-ALK-positive, whereas the positive proportion in the small biopsy specimens was only 4.7%, which indicated that EML4-ALK-positive rate in the surgical specimens was significantly higher than that in the small biopsy specimens. Detection of EGFR gene mutations was feasible in small biopsy specimens, and screening for EML4-ALK expression in small biopsy specimens can be used to guide clinical treatments.

  2. Targeted deletion of MKK4 in cancer cells: a detrimental phenotype manifests as decreased experimental metastasis and suggests a counterweight to the evolution of tumor-suppressor loss.

    PubMed

    Cunningham, Steven C; Gallmeier, Eike; Hucl, Tomas; Dezentje, David A; Calhoun, Eric S; Falco, Geppino; Abdelmohsen, Kotb; Gorospe, Myriam; Kern, Scott E

    2006-06-01

    Tumor-suppressors have commanded attention due to the selection for their inactivating mutations in human tumors. However, relatively little is understood about the inverse, namely, that tumors do not select for a large proportion of seemingly favorable mutations in tumor-suppressor genes. This could be explained by a detrimental phenotype accruing in a cell type-specific manner to most cells experiencing a biallelic loss. For example, MKK4, a tumor suppressor gene distinguished by a remarkably consistent mutational rate across diverse tumor types and an unusually high rate of loss of heterozygosity, has the surprisingly low rate of genetic inactivation of only approximately 5%. To explore this incongruity, we engineered a somatic gene knockout of MKK4 in human cancer cells. Although the null cells resembled the wild-type cells regarding in vitro viability and proliferation in plastic dishes, there was a marked difference in a more relevant in vivo model of experimental metastasis and tumorigenesis. MKK4(-/-) clones injected i.v. produced fewer lung metastases than syngeneic MKK4-competent cells (P = 0.0034). These findings show how cell type-specific detrimental phenotypes can offer a paradoxical and yet key counterweight to the selective advantage attained by cells as they experiment with genetic null states during tumorigenesis, the resultant balance then determining the observed biallelic mutation rate for a given tumor-suppressor gene.

  3. COMPREHENSIVE MOLECULAR CHARACTERIZATION OF CLEAR CELL RENAL CELL CARCINOMA

    PubMed Central

    2013-01-01

    Genetic changes underlying clear cell renal cell carcinoma (ccRCC) include alterations in genes controlling cellular oxygen sensing (e.g. VHL) and the maintenance of chromatin states (e.g. PBRM1). We surveyed more than 400 tumors using different genomic platforms and identified 19 significantly mutated genes. The PI3K/Akt pathway was recurrently mutated, suggesting this pathway as a potential therapeutic target. Widespread DNA hypomethylation was associated with mutation of the H3K36 methyltransferase SETD2, and integrative analysis suggested that mutations involving the SWI/SNF chromatin remodeling complex (PBRM1, ARID1A, SMARCA4) could have far-reaching effects on other pathways. Aggressive cancers demonstrated evidence of a metabolic shift, involving down-regulation of genes involved in the TCA cycle, decreased AMPK and PTEN protein levels, up-regulation of the pentose phosphate pathway and the glutamine transporter genes, increased acetyl-CoA carboxylase protein, and altered promoter methylation of miR-21 and GRB10. Remodeling cellular metabolism thus constitutes a recurrent pattern in ccRCC that correlates with tumor stage and severity and offers new views on the opportunities for disease treatment. PMID:23792563

  4. Novel POC1A mutation in primordial dwarfism reveals new insights for centriole biogenesis.

    PubMed

    Koparir, Asuman; Karatas, Omer F; Yuceturk, Betul; Yuksel, Bayram; Bayrak, Ali O; Gerdan, Omer F; Sagiroglu, Mahmut S; Gezdirici, Alper; Kirimtay, Koray; Selcuk, Ece; Karabay, Arzu; Creighton, Chad J; Yuksel, Adnan; Ozen, Mustafa

    2015-10-01

    POC1A encodes a WD repeat protein localizing to centrioles and spindle poles and is associated with short stature, onychodysplasia, facial dysmorphism and hypotrichosis (SOFT) syndrome. These main features are related to the defect in cell proliferation of chondrocytes in growth plate. In the current study, we aimed at identifying the molecular basis of two patients with primordial dwarfism (PD) in a single family through utilization of whole-exome sequencing. A novel homozygous p.T120A missense mutation was detected in POC1A in both patients, a known causative gene of SOFT syndrome, and confirmed using Sanger sequencing. To test the pathogenicity of the detected mutation, primary fibroblast cultures obtained from the patients and a control individual were used. For evaluating the global gene expression profile of cells carrying p.T120A mutation in POC1A, we performed the gene expression array and compared their expression profiles to those of control fibroblast cells. The gene expression array analysis showed that 4800 transcript probes were significantly deregulated in cells with p.T120A mutation in comparison to the control. GO term association results showed that deregulated genes are mostly involved in the extracellular matrix and cytoskeleton. Furthermore, the p.T120A missense mutation in POC1A caused the formation of abnormal mitotic spindle structure, including supernumerary centrosomes, and changes in POC1A were accompanied by alterations in another centrosome-associated WD repeat protein p80-katanin. As a result, we identified a novel mutation in POC1A of patients with PD and showed that this mutation causes the formation of multiple numbers of centrioles and multipolar spindles with abnormal chromosome arrangement. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Toki, Hideaki; Minowa, Osamu; Inoue, Maki

    Dominant mutations in the Serca2 gene, which encodes sarco(endo)plasmic reticulum calcium-ATPase, predispose mice to gastrointestinal epithelial carcinoma [1–4] and humans to Darier disease (DD) [14–17]. In this study, we generated mice harboring N-ethyl-N-nitrosourea (ENU)-induced allelic mutations in Serca2: three missense mutations and one nonsense mutation. Mice harboring these Serca2 mutations developed tumors that were categorized as either early onset squamous cell tumors (SCT), with development similar to null-type knockout mice [2,4] (aggressive form; M682, M814), or late onset tumors (mild form; M1049, M1162). Molecular analysis showed no aberration in Serca2 mRNA or protein expression levels in normal esophageal cells ofmore » any of the four mutant heterozygotes. There was no loss of heterozygosity at the Serca2 locus in the squamous cell carcinomas in any of the four lines. The effect of each mutation on Ca{sup 2+}-ATPase activity was predicted using atomic-structure models and accumulated mutated protein studies, suggesting that putative complete loss of Serca2 enzymatic activity may lead to early tumor onset, whereas mutations in which Serca2 retains residual enzymatic activity result in late onset. We propose that impaired Serca2 gene product activity has a long-term effect on squamous cell carcinogenesis from onset to the final carcinoma stage through an as-yet unrecognized but common regulatory pathway. -- Highlights: •Novel mutations in murine Serca2 caused early onset or late onset of tumorigenesis. •They also caused higher or lower incidence of Darier Disease phenotype. •3D structure model suggested the former mutations led to severer defect on ATPase. •Driver gene mutations via long-range effect on Ca2+ distributions are suggested.« less

  6. Comprehensive identification of mutations responsible for heterogeneous vancomycin-intermediate Staphylococcus aureus (hVISA)-to-VISA conversion in laboratory-generated VISA strains derived from hVISA clinical strain Mu3.

    PubMed

    Matsuo, Miki; Cui, Longzhu; Kim, Jeeyoung; Hiramatsu, Keiichi

    2013-12-01

    Heterogeneous vancomycin-intermediate Staphylococcus aureus (hVISA) spontaneously produces VISA cells within its cell population at a frequency of 10(-6) or greater. We established a total of 45 VISA mutant strains independently obtained from hVISA Mu3 and its related strains by one-step vancomycin selection. We then performed high-throughput whole-genome sequencing of the 45 strains and their parent strains to identify the genes involved in the hVISA-to-VISA phenotypic conversion. A comparative genome study showed that all the VISA strains tested carried a unique set of mutations. All of the 45 VISA strains carried 1 to 4 mutations possibly affecting the expression of a total of 48 genes. Among them, 32 VISA strains carried only one gene affected by a single mutation. As many as 20 genes in more than eight functional categories were affected in the 32 VISA strains, which explained the extremely high rates of the hVISA-to-VISA phenotypic conversion. Five genes, rpoB, rpoC, walK, pbp4, and pp2c, were previously reported as being involved in vancomycin resistance. Fifteen remaining genes were newly identified as associated with vancomycin resistance in this study. The gene most frequently affected (6 out of 32 strains) was cmk, which encodes cytidylate kinase, followed closely by rpoB (5 out of 32), encoding the β subunit of RNA polymerase. A mutation prevalence study also revealed a sizable number of cmk mutants among clinical VISA strains (7 out of 38 [18%]). Reduced cytidylate kinase activity in cmk mutant strains is proposed to contribute to the hVISA-to-VISA phenotype conversion by thickening the cell wall and reducing the cell growth rate.

  7. Elucidate the Mechanism of Telomere Maintenance in STAG2 Mutated Tumor Cells

    DTIC Science & Technology

    2017-12-01

    recent analysis identified the cohesin subunit STAG2 as one of twelve genes mutated in four or more tumor types including melanoma, pancreatic...conferences, seminars, study groups , and individual study. Include participation in conferences, workshops, and seminars not listed under major...only 12 genes found to be significantly mutated in four or more cancer types (18). Approximately 85% of STAG2 mutations are truncating and often result

  8. Glucose-6-Phosphate Dehydrogenase: Update and Analysis of New Mutations around the World

    PubMed Central

    Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Serrano-Posada, Hugo; Ortega-Cuellar, Daniel; González-Valdez, Abigail; Castillo-Rodríguez, Rosa Angélica; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) is a key regulatory enzyme in the pentose phosphate pathway which produces nicotinamide adenine dinucleotide phosphate (NADPH) to maintain an adequate reducing environment in the cells and is especially important in red blood cells (RBC). Given its central role in the regulation of redox state, it is understandable that mutations in the gene encoding G6PD can cause deficiency of the protein activity leading to clinical manifestations such as neonatal jaundice and acute hemolytic anemia. Recently, an extensive review has been published about variants in the g6pd gene; recognizing 186 mutations. In this work, we review the state of the art in G6PD deficiency, describing 217 mutations in the g6pd gene; we also compile information about 31 new mutations, 16 that were not recognized and 15 more that have recently been reported. In order to get a better picture of the effects of new described mutations in g6pd gene, we locate the point mutations in the solved three-dimensional structure of the human G6PD protein. We found that class I mutations have the most deleterious effects on the structure and stability of the protein. PMID:27941691

  9. VCP gene analyses in Japanese patients with sporadic amyotrophic lateral sclerosis identify a new mutation.

    PubMed

    Hirano, Makito; Nakamura, Yusaku; Saigoh, Kazumasa; Sakamoto, Hikaru; Ueno, Shuichi; Isono, Chiharu; Mitsui, Yoshiyuki; Kusunoki, Susumu

    2015-03-01

    Accumulating evidence has proven that mutations in the VCP gene encoding valosin-containing protein (VCP) cause inclusion body myopathy with Paget disease of the bone and frontotemporal dementia. This gene was later found to be causative for amyotrophic lateral sclerosis (ALS), a fatal neurodegenerative disease, occurring typically in elderly persons. We thus sequenced the VCP gene in 75 Japanese patients with sporadic ALS negative for mutations in other genes causative for ALS and found a novel mutation, p.Arg487His, in 1 patient. The newly identified mutant as well as known mutants rendered neuronal cells susceptible to oxidative stress. The presence of the mutation in the Japanese population extends the geographic region for involvement of the VCP gene in sporadic ALS to East Asia. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Mutation of FAS, XIAP, and UNC13D genes in a patient with a complex lymphoproliferative phenotype.

    PubMed

    Boggio, Elena; Aricò, Maurizio; Melensi, Matteo; Dianzani, Irma; Ramenghi, Ugo; Dianzani, Umberto; Chiocchetti, Annalisa

    2013-10-01

    This article presents a case report for a child presenting with mixed clinical features of autoimmune lymphoproliferative syndrome (ALPS), familial hemophagocytic lymphohistiocytosis (FHL), and X-linked lymphoproliferative (XLP) disease. From 6 months, he exhibited splenomegaly and lymphoadenopathy and from 4 years, he showed recurrent severe autoimmune hemocytopenia and sepsislike bouts of fever, from which he eventually died at the age of 12. Intriguingly, the patient carried mutations in FAS, XIAP, and UNC13D genes, which are involved in ALPS, XLP disease, and FHL, respectively. These mutations were inherited from the mother, who had rheumatoid arthritis but no signs of ALPS. A role for other modifying genes was suggested by the finding that the healthy father exhibited defective Fas function, without mutation of the FAS gene, and had transmitted to the patient an osteopontin (OPN) gene variant previously associated with ALPS. Therefore, several genes might influence the disease outcome in this family. In vitro analyses revealed that the FAS and the XIAP mutations decreased expression of the corresponding proteins, and the UNC13D mutation decreased granule secretion and Munc interaction with Rab-27a. These findings suggest that overlap may exist between ALPS, FHL, and XLP disease, in accordance with the notion that FHL and XLP disease are due to defective natural killer (NK)/NK T-cell function, which involves Fas. Therefore, we propose that NK cell defects should be evaluated in patients with ALPS-like characteristics, and hematopoietic stem cell transplantation should be considered in individuals with severe refractory cytopenia and FHL-like manifestations.

  11. Severe hypertriglyceridemia due to two novel loss-of-function lipoprotein lipase gene mutations (C310R/E396V) in a Chinese family associated with recurrent acute pancreatitis.

    PubMed

    Lun, Yu; Sun, Xiaofang; Wang, Ping; Chi, Jingwei; Hou, Xu; Wang, Yangang

    2017-07-18

    Lipoprotein lipase (LPL) is widely expressed in skeletal muscles, cardiac muscles as well as adipose tissue and involved in the catabolism of triglyceride. Herein we have systematically characterized two novel loss-of-function mutations in LPL from a Chinese family in which afflicted members were manifested by severe hypertriglyceridemia and recurrent pancreatitis. DNA sequencing revealed that the proband was a heterozygote carrying a novel c.T928C (p.C310R) mutation in exon 6 of the LPL gene. Another member of the family was detected to be a compound heterozygote who along with the c.T928C mutation also carried a novel missense mutation c.A1187T (p.E396V) in exon 8 of the LPL gene. Furthermore, COS-1 cells were transfected with lentiviruses containing the mutant LPL genes. While C310R markedly reduced the overall LPL protein level, COS-1 cells carrying E396V or double mutations contained similar overall LPL protein levels to the wild-type. The specific activity of the LPL mutants remained at comparable magnitude to the wild-type. However, few LPL were detected in the culture medium for the mutants, suggesting that both mutations caused aberrant triglyceride catabolism. More specifically, E396V and double mutations dampened the transport of LPL to the cell surface, while for the C310R mutation, reducing LPL protein level might be involved. By characterizing these two novel LPL mutations, this study has expanded our understanding on the pathogenesis of familial hypertriglyceridemia (FHTG).

  12. Target sequencing and CRISPR/Cas editing reveal simultaneous loss of UTX and UTY in urothelial bladder cancer.

    PubMed

    Ahn, Jinwoo; Kim, Kwang Hyun; Park, Sanghui; Ahn, Young-Ho; Kim, Ha Young; Yoon, Hana; Lee, Ji Hyun; Bang, Duhee; Lee, Dong Hyeon

    2016-09-27

    UTX is a histone demethylase gene located on the X chromosome and is a frequently mutated gene in urothelial bladder cancer (UBC). UTY is a paralog of UTX located on the Y chromosome. We performed target capture sequencing on 128 genes in 40 non-metastatic UBC patients. UTX was the most frequently mutated gene (30%, 12/40). Of the genetic alterations identified, 75% were truncating mutations. UTY copy number loss was detected in 8 male patients (22.8%, 8/35). Of the 9 male patients with UTX mutations, 6 also had copy number loss (66.7%). To evaluate the functional roles of UTX and UTY in tumor progression, we designed UTX and UTY single knockout and UTX-UTY double knockout experiments using a CRISPR/Cas9 lentiviral system, and compared the proliferative capacities of two UBC cell lines in vitro. Single UTX or UTY knockout increased cell proliferation as compared to UTX-UTY wild-type cells. UTX-UTY double knockout cells exhibited greater proliferation than single knockout cells. These findings suggest both UTX and UTY function as dose-dependent suppressors of UBC development. While UTX escapes X chromosome inactivation in females, UTY may function as a male homologue of UTX, which could compensate for dosage imbalances.

  13. Vacuolar Protein Sorting Genes in Parkinson's Disease: A Re-appraisal of Mutations Detection Rate and Neurobiology of Disease.

    PubMed

    Gambardella, Stefano; Biagioni, Francesca; Ferese, Rosangela; Busceti, Carla L; Frati, Alessandro; Novelli, Giuseppe; Ruggieri, Stefano; Fornai, Francesco

    2016-01-01

    Mammalian retromers play a critical role in protein trans-membrane sorting from endosome to the trans-Golgi network (TGN). Recently, retromer alterations have been related to the onset of Parkinson's Disease (PD) since the variant p.Asp620Asn in VPS35 (Vacuolar Protein Sorting 35) was identified as a cause of late onset PD. This variant causes a primary defect in endosomal trafficking and retromers formation. Other mutations in VPS genes have been reported in both sporadic and familial PD. These mutations are less defined. Understanding the specific prevalence of all VPS gene mutations is key to understand the relevance of retromers impairment in the onset of PD. A number of PD-related mutations despite affecting different biochemical systems (autophagy, mitophagy, proteasome, endosomes, protein folding), all converge in producing an impairment in cell clearance. This may explain how genetic predispositions to PD may derive from slightly deleterious VPS mutations when combined with environmental agents overwhelming the clearance of the cell. This manuscript reviews genetic data produced in the last 5 years to re-define the actual prevalence of VPS gene mutations in the onset of PD. The prevalence of p.Asp620Asn mutation in VPS35 is 0.286 of familial PD. This increases up to 0.548 when considering mutations affecting all VPS genes. This configures mutations in VPS genes as the second most frequent autosomal dominant PD genotype. This high prevalence, joined with increased awareness of the role played by retromers in the neurobiology of PD, suggests environmentally-induced VPS alterations as crucial in the genesis of PD.

  14. Exome sequencing identifies MAX mutations as a cause of hereditary pheochromocytoma.

    PubMed

    Comino-Méndez, Iñaki; Gracia-Aznárez, Francisco J; Schiavi, Francesca; Landa, Iñigo; Leandro-García, Luis J; Letón, Rocío; Honrado, Emiliano; Ramos-Medina, Rocío; Caronia, Daniela; Pita, Guillermo; Gómez-Graña, Alvaro; de Cubas, Aguirre A; Inglada-Pérez, Lucía; Maliszewska, Agnieszka; Taschin, Elisa; Bobisse, Sara; Pica, Giuseppe; Loli, Paola; Hernández-Lavado, Rafael; Díaz, José A; Gómez-Morales, Mercedes; González-Neira, Anna; Roncador, Giovanna; Rodríguez-Antona, Cristina; Benítez, Javier; Mannelli, Massimo; Opocher, Giuseppe; Robledo, Mercedes; Cascón, Alberto

    2011-06-19

    Hereditary pheochromocytoma (PCC) is often caused by germline mutations in one of nine susceptibility genes described to date, but there are familial cases without mutations in these known genes. We sequenced the exomes of three unrelated individuals with hereditary PCC (cases) and identified mutations in MAX, the MYC associated factor X gene. Absence of MAX protein in the tumors and loss of heterozygosity caused by uniparental disomy supported the involvement of MAX alterations in the disease. A follow-up study of a selected series of 59 cases with PCC identified five additional MAX mutations and suggested an association with malignant outcome and preferential paternal transmission of MAX mutations. The involvement of the MYC-MAX-MXD1 network in the development and progression of neural crest cell tumors is further supported by the lack of functional MAX in rat PCC (PC12) cells and by the amplification of MYCN in neuroblastoma and suggests that loss of MAX function is correlated with metastatic potential.

  15. What do somatic hypermutation and class switch recombination teach us about chronic lymphocytic leukaemia pathogenesis?

    PubMed

    Oppezzo, P; Dighiero, G

    2005-01-01

    B-CLL cells express CD5 and IgM/IgD and thus have a mantle zone-like phenotype of naive cells, which, in normal conditions express unmutated Ig genes. However, recent studies have shown that 50%-70% of CLL harbour somatic mutations of VH genes, as if they had matured in a lymphoid follicle. Interestingly, the presence or absence of somatic hypermutation (SHM) process is associated with the use of particular VH genes. Particular alleles of the VH1-69 gene and the VH4-39 gene are preferentially expressed in an unmutated form, while VH4-34 or the majority of VH3 family genes frequently contain somatic mutations. The fact that some genes like VH1-69 and VH3-07 recombine this VH segment to particular JH segments and the restricted use of CDR3 sequences by CLLs expressing the VH4-39 gene suggest that the observed differences in BCR structure in B-CLL could result from selection by distinct antigenic epitopes. It is currently unclear whether this putative antigen-driven process could occur prior to leukaemic transformation and/or that the precursors were transformed into leukaemic cells at distinct maturational stages. The mutational profile of Ig genes has been shown to be associated with disease prognosis. These results could favour the idea that CLL could correspond to two different diseases that look alike in morphologic and phenotypic terms. In CLL with mutated Ig genes, the proliferating B cell may have transited through germinal centres, the physiologic site of hypermutation, whereas in CLL with unmutated Ig genes the malignant B cell may derive from a pre-germinal centre naïve B cell. Despite these clinical and molecular differences, recent studies on gene expression profiling of B-CLL cells showed that CLL is characterized by a common gene expression signature that is irrespective of Ig mutational status and differs from other lymphoid cancers and normal lymphoid subpopulations, suggesting that CLL cases share a common mechanism of transformation and/or cell of origin. Activation induced cytidine deaminase (AID) plays a key role in SHM and class switch recombination (CSR). However, the mechanisms accounting for AID action and control of its expression remain unclear. In a recent work we have shown that in contrast to normal circulating B-cells, AID transcripts are expressed constitutively in CLL patients undergoing active CSR, but interestingly this expression occurs predominately in unmutated CLL B-cells. These data favour the view that AID protein may act differentially on CSR and SHM pathways, but the role-played by AID in both processes remains to be elucidated. Recent work indicates that AID is expressed in a small fraction of tumoral cells, which could suggest that this small fraction of cells may correspond to B-CLL cells that would have recently experienced an AID-inducing stimulus occurring in a specific microenvironment.

  16. Capturing the biological impact of CDKN2A and MC1R genes as an early predisposing event in melanoma and non melanoma skin cancer

    PubMed Central

    Puig-Butille, Joan Anton; Escámez, María José; Garcia-Garcia, Francisco; Tell-Marti, Gemma; Fabra, Àngels; Martínez-Santamaría, Lucía; Badenas, Celia; Aguilera, Paula; Pevida, Marta; Dopazo, Joaquín; del Río, Marcela; Puig, Susana

    2014-01-01

    Germline mutations in CDKN2A and/or red hair color variants in MC1R genes are associated with an increased susceptibility to develop cutaneous melanoma or non melanoma skin cancer. We studied the impact of the CDKN2A germinal mutation p.G101W and MC1R variants on gene expression and transcription profiles associated with skin cancer. To this end we set-up primary skin cell co-cultures from siblings of melanoma prone-families that were later analyzed using the expression array approach. As a result, we found that 1535 transcripts were deregulated in CDKN2A mutated cells, with over-expression of immunity-related genes (HLA-DPB1, CLEC2B, IFI44, IFI44L, IFI27, IFIT1, IFIT2, SP110 and IFNK) and down-regulation of genes playing a role in the Notch signaling pathway. 3570 transcripts were deregulated in MC1R variant carriers. In particular, genes related to oxidative stress and DNA damage pathways were up-regulated as well as genes associated with neurodegenerative diseases such as Parkinson’s, Alzheimer and Huntington. Finally, we observed that the expression signatures indentified in phenotypically normal cells carrying CDKN2A mutations or MC1R variants are maintained in skin cancer tumors (melanoma and squamous cell carcinoma). These results indicate that transcriptome deregulation represents an early event critical for skin cancer development. PMID:24742402

  17. Novel NEK8 Mutations Cause Severe Syndromic Renal Cystic Dysplasia through YAP Dysregulation

    PubMed Central

    Grampa, Valentina; Odye, Gweltas; Thomas, Sophie; Elkhartoufi, Nadia; Filhol, Emilie; Niel, Olivier; Silbermann, Flora; Lebreton, Corinne; Collardeau-Frachon, Sophie; Rouvet, Isabelle; Alessandri, Jean-Luc; Devisme, Louise; Dieux-Coeslier, Anne; Cordier, Marie-Pierre; Capri, Yline; Khung-Savatovsky, Suonavy; Sigaudy, Sabine; Salomon, Rémi; Antignac, Corinne; Gubler, Marie-Claire; Benmerah, Alexandre; Terzi, Fabiola; Attié-Bitach, Tania; Jeanpierre, Cécile; Saunier, Sophie

    2016-01-01

    Ciliopathies are a group of genetic multi-systemic disorders related to dysfunction of the primary cilium, a sensory organelle present at the cell surface that regulates key signaling pathways during development and tissue homeostasis. In order to identify novel genes whose mutations would cause severe developmental ciliopathies, >500 patients/fetuses were analyzed by a targeted high throughput sequencing approach allowing exome sequencing of >1200 ciliary genes. NEK8/NPHP9 mutations were identified in five cases with severe overlapping phenotypes including renal cystic dysplasia/hypodysplasia, situs inversus, cardiopathy with hypertrophic septum and bile duct paucity. These cases highlight a genotype-phenotype correlation, with missense and nonsense mutations associated with hypodysplasia and enlarged cystic organs, respectively. Functional analyses of NEK8 mutations in patient fibroblasts and mIMCD3 cells showed that these mutations differentially affect ciliogenesis, proliferation/apoptosis/DNA damage response, as well as epithelial morphogenesis. Notably, missense mutations exacerbated some of the defects due to NEK8 loss of function, highlighting their likely gain-of-function effect. We also showed that NEK8 missense and loss-of-function mutations differentially affect the regulation of the main Hippo signaling effector, YAP, as well as the expression of its target genes in patient fibroblasts and renal cells. YAP imbalance was also observed in enlarged spheroids of Nek8-invalidated renal epithelial cells grown in 3D culture, as well as in cystic kidneys of Jck mice. Moreover, co-injection of nek8 MO with WT or mutated NEK8-GFP RNA in zebrafish embryos led to shortened dorsally curved body axis, similar to embryos injected with human YAP RNA. Finally, treatment with Verteporfin, an inhibitor of YAP transcriptional activity, partially rescued the 3D spheroid defects of Nek8-invalidated cells and the abnormalities of NEK8-overexpressing zebrafish embryos. Altogether, our study demonstrates that NEK8 human mutations cause major organ developmental defects due to altered ciliogenesis and cell differentiation/proliferation through deregulation of the Hippo pathway. PMID:26967905

  18. Genetics Home Reference: isolated hyperCKemia

    MedlinePlus

    ... signaling and maintenance of the cell structure. CAV3 gene mutations result in a shortage of caveolin-3 protein ... this condition. In addition to isolated hyperCKemia , CAV3 gene mutations can cause other caveolinopathies including CAV3 -related distal ...

  19. Somatic Mutation Patterns in Hemizygous Genomic Regions Unveil Purifying Selection during Tumor Evolution

    PubMed Central

    Basu, Swaraj; Larsson, Erik

    2016-01-01

    Identification of cancer driver genes using somatic mutation patterns indicative of positive selection has become a major goal in cancer genomics. However, cancer cells additionally depend on a large number of genes involved in basic cellular processes. While such genes should in theory be subject to strong purifying (negative) selection against damaging somatic mutations, these patterns have been elusive and purifying selection remains inadequately explored in cancer. Here, we hypothesized that purifying selection should be evident in hemizygous genomic regions, where damaging mutations cannot be compensated for by healthy alleles. Using a 7,781-sample pan-cancer dataset, we first confirmed this in POLR2A, an essential gene where hemizygous deletions are known to confer elevated sensitivity to pharmacological suppression. We next used this principle to identify several genes and pathways that show patterns indicative of purifying selection to avoid deleterious mutations. These include the POLR2A interacting protein INTS10 as well as genes involved in mRNA splicing, nonsense-mediated mRNA decay and other RNA processing pathways. Many of these genes belong to large protein complexes, and strong overlaps were observed with recent functional screens for gene essentiality in human cells. Our analysis supports that purifying selection acts to preserve the remaining function of many hemizygously deleted essential genes in tumors, indicating vulnerabilities that might be exploited by future therapeutic strategies. PMID:28027311

  20. RAG-mediated recombination is the predominant driver of oncogenic rearrangement in ETV6-RUNX1 acute lymphoblastic leukemia

    PubMed Central

    Papaemmanuil, Elli; Rapado, Inmaculada; Li, Yilong; Potter, Nicola E; Wedge, David C; Tubio, Jose; Alexandrov, Ludmil B; Van Loo, Peter; Cooke, Susanna L; Marshall, John; Martincorena, Inigo; Hinton, Jonathan; Gundem, Gunes; van Delft, Frederik W; Nik-Zainal, Serena; Jones, David R; Ramakrishna, Manasa; Titley, Ian; Stebbings, Lucy; Leroy, Catherine; Menzies, Andrew; Gamble, John; Robinson, Ben; Mudie, Laura; Raine, Keiran; O’Meara, Sarah; Teague, Jon W; Butler, Adam P; Cazzaniga, Giovanni; Biondi, Andrea; Zuna, Jan; Kempski, Helena; Muschen, Markus; Ford, Anthony M; Stratton, Michael R; Greaves, Mel; Campbell, Peter J

    2014-01-01

    The ETV6-RUNX1 fusion gene, found in 25% of childhood acute lymphoblastic leukemia (ALL), is acquired in utero but requires additional somatic mutations for overt leukemia. We used exome and low-coverage whole-genome sequencing to characterize secondary events associated with leukemic transformation. RAG-mediated deletions emerge as the dominant mutational process, characterized by recombination signal sequence motifs near the breakpoints; incorporation of non-templated sequence at the junction; ~30-fold enrichment at promoters and enhancers of genes actively transcribed in B-cell development and an unexpectedly high ratio of recurrent to non-recurrent structural variants. Single cell tracking shows that this mechanism is active throughout leukemic evolution with evidence of localized clustering and re-iterated deletions. Integration of point mutation and rearrangement data identifies ATF7IP and MGA as two new tumor suppressor genes in ALL. Thus, a remarkably parsimonious mutational process transforms ETV6-RUNX1 lymphoblasts, targeting the promoters, enhancers and first exons of genes that normally regulate B-cell differentiation. PMID:24413735

  1. The genomic landscape of mantle cell lymphoma is related to the epigenetically determined chromatin state of normal B cells

    PubMed Central

    Zhang, Jenny; Jima, Dereje; Moffitt, Andrea B.; Liu, Qingquan; Czader, Magdalena; Hsi, Eric D.; Fedoriw, Yuri; Dunphy, Cherie H.; Richards, Kristy L.; Gill, Javed I.; Sun, Zhen; Love, Cassandra; Scotland, Paula; Lock, Eric; Levy, Shawn; Hsu, David S.; Dunson, David; Dave, Sandeep S.

    2014-01-01

    In this study, we define the genetic landscape of mantle cell lymphoma (MCL) through exome sequencing of 56 cases of MCL. We identified recurrent mutations in ATM, CCND1, MLL2, and TP53. We further identified a number of novel genes recurrently mutated in patients with MCL including RB1, WHSC1, POT1, and SMARCA4. We noted that MCLs have a distinct mutational profile compared with lymphomas from other B-cell stages. The ENCODE project has defined the chromatin structure of many cell types. However, a similar characterization of primary human mature B cells has been lacking. We defined, for the first time, the chromatin structure of primary human naïve, germinal center, and memory B cells through chromatin immunoprecipitation and sequencing for H3K4me1, H3K4me3, H3Ac, H3K36me3, H3K27me3, and PolII. We found that somatic mutations that occur more frequently in either MCLs or Burkitt lymphomas were associated with open chromatin in their respective B cells of origin, naïve B cells, and germinal center B cells. Our work thus elucidates the landscape of gene-coding mutations in MCL and the critical interplay between epigenetic alterations associated with B-cell differentiation and the acquisition of somatic mutations in cancer. PMID:24682267

  2. Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma.

    PubMed

    Coco, Simona; De Mariano, Marilena; Valdora, Francesca; Servidei, Tiziana; Ridola, Vita; Andolfo, Immacolata; Oberthuer, André; Tonini, Gian Paolo; Longo, Luca

    2012-10-01

    The anaplastic lymphoma kinase (ALK) gene has been found either rearranged or mutated in several neoplasms such as anaplastic large-cell lymphoma, non-small-cell lung cancer, neuroblastoma and anaplastic thyroid cancer. Medulloblastoma (MB) is an embryonic pediatric cancer arising from nervous system, a tissue in which ALK is expressed during embryonic development. We performed an ALK mutation screening in 52 MBs and we found a novel heterozygous germline deletion of a single base in exon 23 (3605delG) in a case with marked anaplasia. This G deletion results in a frameshift mutation producing a premature stop codon in exon 25 of ALK tyrosine kinase domain. We also screened three human MB cell lines without finding any mutation of ALK gene. Quantitative expression analysis of 16 out of 52 samples showed overexpression of ALK mRNA in three MBs. In the present study, we report the first mutation of ALK found in MB. Moreover, a deletion of ALK gene producing a stop codon has not been detected in human tumors up to now. Further investigations are now required to elucidate whether the truncated form of ALK may have a role in signal transduction.

  3. Efficient Knock-in of a Point Mutation in Porcine Fibroblasts Using the CRISPR/Cas9-GMNN Fusion Gene.

    PubMed

    Gerlach, Max; Kraft, Theresia; Brenner, Bernhard; Petersen, Björn; Niemann, Heiner; Montag, Judith

    2018-06-13

    During CRISPR/Cas9 mediated genome editing, site-specific double strand breaks are introduced and repaired either unspecific by non-homologous end joining (NHEJ) or sequence dependent by homology directed repair (HDR). Whereas NHEJ-based generation of gene knock-out is widely performed, the HDR-based knock-in of specific mutations remains a bottleneck. Especially in primary cell lines that are essential for the generation of cell culture and animal models of inherited human diseases, knock-in efficacy is insufficient and needs significant improvement. Here, we tested two different approaches to increase the knock-in frequency of a specific point mutation into the MYH7 -gene in porcine fetal fibroblasts. We added a small molecule inhibitor of NHEJ, SCR7 (5,6-bis((E)-benzylideneamino)-2-mercaptopyrimidin-4-ol), during genome editing and screened cell cultures for the point mutation. However, this approach did not yield increased knock-in rates. In an alternative approach, we fused humanized Cas9 (hCas9) to the N-terminal peptide of the Geminin gene ( GMNN ). The fusion protein is degraded in NHEJ-dominated cell cycle phases, which should increase HDR-rates. Using hCas9- GMNN and point mutation-specific real time PCR screening, we found a two-fold increase in genome edited cell cultures. This increase of HDR by hCas9- GMNN provides a promising way to enrich specific knock-in in porcine fibroblast cultures for somatic cloning approaches.

  4. [Correlation of clinicopathologic features and driver gene mutation in non-small cell lung cancer].

    PubMed

    Chen, L F; Chen, X Y; Yu, X B

    2016-04-08

    To study the relationship between mutations of well-known driver genes and clinicopathologic characteristics of non-small cell lung cancers (NSCLC). Scorpions amplification refractory mutation system (scorpions ARMS) fluorescence quantitative PCR was performed to investigate 205 driver gene mutation status in NSCLC in correlation with clinicopathological characteristics of the patients. Driver gene mutations were detected in 146 of 205 (71.2%) patients with NSCLC, including 81.7%(138/169) adenocarcinomas, in which mutations of nine genes were found: EGFR (63.3%, 107/169), KRAS (5.9%, 10/169), PIK3CA (4.1%, 7/169), ALK (4.1%, 7/169), ROS1 (3.0%, 5/169), RET (3.6%, 6/169), HER2 (1.8%, 3/169), NRAS (0.6%, 1/169) and BRAF (0.6%, 1/169). The frequencies of driver gene mutations were higher in adenocarcinomas, female patients and non-smokers (P<0.01, P=0.003, P<0.01, respectively). Driver gene mutation status showed no correlation with either the age or the clinical stage (P=0.281, P=0.490, respectively). However, EGFR mutations tended to occur in adenocarcinoma, female, non-smokers, and patients of ≥62 years of age (P<0.01, P<0.01, P=0.002, P=0.012, respectively). The frequency of EGFR mutation was positively correlated with the tumor histology of lepidic, acinar, papillary and micropapillary predominant growth patterns. There was no relationship between EGFR mutation and the clinical stage (P=0.237). The frequency of KRAS mutation was higher in solid predominant and invasive mucinous adenocarcinomas (P=0.015); that of PIK3CA mutation was higher in patients of ≥62 years of age, invasive mucinous adenocarcinoma and fetal adenocarcinoma (P=0.015, P=0.006, respectively). ALK, ROS1 or RET mutation positive NSCLC tended to occur in nonsmokers and have solid predominant tumors and invasive mucinous adenocarcinoma (P=0.012, P=0.017 respectively). The frequency of EML4-ALK mutation was higher in the early stage patients with solid predominant tumors and invasive mucinous adenocarcinomas (P=0.025, P=0.014, respectively); that of ROS1 rearrangement was higher in invasive mucinous adenocarcinomas (P=0.049). NRAS, BRAF and HER2 gene mutations were infrequent and their clinical significance remained to be elucidated. The relationship between mutations of well-known driver genes and clinicopathological characteristics in patients with NSCLC has diversity, the rate of mutations is higher in non-smoking female patients with adenocarcinoma.

  5. Exome-wide Sequencing Shows Low Mutation Rates and Identifies Novel Mutated Genes in Seminomas.

    PubMed

    Cutcutache, Ioana; Suzuki, Yuka; Tan, Iain Beehuat; Ramgopal, Subhashini; Zhang, Shenli; Ramnarayanan, Kalpana; Gan, Anna; Lee, Heng Hong; Tay, Su Ting; Ooi, Aikseng; Ong, Choon Kiat; Bolthouse, Jonathan T; Lane, Brian R; Anema, John G; Kahnoski, Richard J; Tan, Patrick; Teh, Bin Tean; Rozen, Steven G

    2015-07-01

    Testicular germ cell tumors are the most common cancer diagnosed in young men, and seminomas are the most common type of these cancers. There have been no exome-wide examinations of genes mutated in seminomas or of overall rates of nonsilent somatic mutations in these tumors. The objective was to analyze somatic mutations in seminomas to determine which genes are affected and to determine rates of nonsilent mutations. Eight seminomas and matched normal samples were surgically obtained from eight patients. DNA was extracted from tissue samples and exome sequenced on massively parallel Illumina DNA sequencers. Single-nucleotide polymorphism chip-based copy number analysis was also performed to assess copy number alterations. The DNA sequencing read data were analyzed to detect somatic mutations including single-nucleotide substitutions and short insertions and deletions. The detected mutations were validated by independent sequencing and further checked for subclonality. The rate of nonsynonymous somatic mutations averaged 0.31 mutations/Mb. We detected nonsilent somatic mutations in 96 genes that were not previously known to be mutated in seminomas, of which some may be driver mutations. Many of the mutations appear to have been present in subclonal populations. In addition, two genes, KIT and KRAS, were affected in two tumors each with mutations that were previously observed in other cancers and are presumably oncogenic. Our study, the first report on exome sequencing of seminomas, detected somatic mutations in 96 new genes, several of which may be targetable drivers. Furthermore, our results show that seminoma mutation rates are five times higher than previously thought, but are nevertheless low compared to other common cancers. Similar low rates are seen in other cancers that also have excellent rates of remission achieved with chemotherapy. We examined the DNA sequences of seminomas, the most common type of testicular germ cell cancer. Our study identified 96 new genes in which mutations occurred during seminoma development, some of which might contribute to cancer development or progression. The study also showed that the rates of DNA mutations during seminoma development are higher than previously thought, but still lower than for other common solid-organ cancers. Such low rates are also observed among other cancers that, like seminomas, show excellent rates of disease remission after chemotherapy. Copyright © 2015 European Association of Urology. Published by Elsevier B.V. All rights reserved.

  6. Germline stem cell competition, mutation hot spots, genetic disorders and older dads

    PubMed Central

    Arnheim, Norman; Calabrese, Peter

    2016-01-01

    Some de novo human mutations arise at frequencies far exceeding the genome average mutation rate. Examples are the common mutations at one or a few sites in the genes causing achondroplasia, Noonan syndrome, multiple endocrine neoplasia 2B and Apert syndrome. These mutations are recurrent, provide a gain of function, are paternally derived and are more likely transmitted as the father ages. Recent experiments tested whether the high mutation frequencies are due to an elevated mutation rate per cell division, as expected, or an advantage of the mutant spermatogonial stem cells over wild-type stem cells. The evidence, which includes the surprising discovery of testis mutation clusters, rejects the former model but not the latter. We propose how the mutations might alter spermatogonial stem cell function and discuss how germline selection contributes to the paternal age effect, the human mutational load and adaptive evolution. PMID:27070266

  7. nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.

    PubMed

    Chen, Sijie; Zhang, Hefei; Wang, Fenghua; Zhang, Wei; Peng, Gang

    2016-09-15

    Sex determinations are diverse in vertebrates. Although many sex-determining genes and pathways are conserved, the mechanistic roles of these genes and pathways in the genetic sex determination are not well understood. DAX1 (encoded by the NR0B1 gene) is a vertebrate specific orphan nuclear receptor that regulates gonadal development and sexual determination. In human, duplication of the NR0B1 gene leads to male-to-female sex reversal. In mice, Nr0b1 shows both pro-testis and anti-testis functions. We generated inheritable nr0b1 mutation in the zebrafish and found the nr0b1 mutation caused homozygous mutants to develop as fertile males due to female-to-male sex reversal. The nr0b1 mutation did not increase Caspase-3 labeling nor tp53 expression in the developing gonads. Introduction of a tp53 mutation into the nr0b1 mutant did not rescue the sex-reversal phenotype. Further examination revealed reduction in cell proliferation and abnormal somatic cell differentiation in the nr0b1 mutant gonads at the undifferentiated and bi-potential ovary stages. Together, our results suggest nr0b1 regulates somatic cell differentiation and cell proliferation to ensure normal sex development in the zebrafish. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Efficient exon skipping of SGCG mutations mediated by phosphorodiamidate morpholino oligomers.

    PubMed

    Wyatt, Eugene J; Demonbreun, Alexis R; Kim, Ellis Y; Puckelwartz, Megan J; Vo, Andy H; Dellefave-Castillo, Lisa M; Gao, Quan Q; Vainzof, Mariz; Pavanello, Rita C M; Zatz, Mayana; McNally, Elizabeth M

    2018-05-03

    Exon skipping uses chemically modified antisense oligonucleotides to modulate RNA splicing. Therapeutically, exon skipping can bypass mutations and restore reading frame disruption by generating internally truncated, functional proteins to rescue the loss of native gene expression. Limb-girdle muscular dystrophy type 2C is caused by autosomal recessive mutations in the SGCG gene, which encodes the dystrophin-associated protein γ-sarcoglycan. The most common SGCG mutations disrupt the transcript reading frame abrogating γ-sarcoglycan protein expression. In order to treat most SGCG gene mutations, it is necessary to skip 4 exons in order to restore the SGCG transcript reading frame, creating an internally truncated protein referred to as Mini-Gamma. Using direct reprogramming of human cells with MyoD, myogenic cells were tested with 2 antisense oligonucleotide chemistries, 2'-O-methyl phosphorothioate oligonucleotides and vivo-phosphorodiamidate morpholino oligomers, to induce exon skipping. Treatment with vivo-phosphorodiamidate morpholino oligomers demonstrated efficient skipping of the targeted exons and corrected the mutant reading frame, resulting in the expression of a functional Mini-Gamma protein. Antisense-induced exon skipping of SGCG occurred in normal cells and those with multiple distinct SGCG mutations, including the most common 521ΔT mutation. These findings demonstrate a multiexon-skipping strategy applicable to the majority of limb-girdle muscular dystrophy 2C patients.

  9. PAX5 mutations occur frequently in adult B-cell progenitor acute lymphoblastic leukemia and PAX5 haploinsufficiency is associated with BCR-ABL1 and TCF3-PBX1 fusion genes: a GRAALL study.

    PubMed

    Familiades, J; Bousquet, M; Lafage-Pochitaloff, M; Béné, M-C; Beldjord, K; De Vos, J; Dastugue, N; Coyaud, E; Struski, S; Quelen, C; Prade-Houdellier, N; Dobbelstein, S; Cayuela, J-M; Soulier, J; Grardel, N; Preudhomme, C; Cavé, H; Blanchet, O; Lhéritier, V; Delannoy, A; Chalandon, Y; Ifrah, N; Pigneux, A; Brousset, P; Macintyre, E A; Huguet, F; Dombret, H; Broccardo, C; Delabesse, E

    2009-11-01

    Adult and child B-cell progenitor acute lymphoblastic leukemia (BCP-ALL) differ in terms of incidence and prognosis. These disparities are mainly due to the molecular abnormalities associated with these two clinical entities. A genome-wide analysis using oligo SNP arrays recently demonstrated that PAX5 (paired-box domain 5) is the main target of somatic mutations in childhood BCP-ALL being altered in 38.9% of the cases. We report here the most extensive analysis of alterations of PAX5 coding sequence in 117 adult BCP-ALL patients in the unique clinical protocol GRAALL-2003/GRAAPH-2003. Our study demonstrates that PAX5 is mutated in 34% of adult BCP-ALL, mutations being partial or complete deletion, partial or complete amplification, point mutation or fusion gene. PAX5 alterations are heterogeneous consisting in complete loss in 17%, focal deletions in 10%, point mutations in 7% and translocations in 1% of the cases. PAX5 complete loss and PAX5 point mutations differ. PAX5 complete loss seems to be a secondary event and is significantly associated with BCR-ABL1 or TCF3-PBX1 fusion genes and a lower white blood cell count.

  10. Clonal hematopoiesis, with and without candidate driver mutations, is common in the elderly

    PubMed Central

    Zink, Florian; Stacey, Simon N.; Norddahl, Gudmundur L.; Frigge, Michael L.; Magnusson, Olafur T.; Jonsdottir, Ingileif; Thorgeirsson, Thorgeir E.; Sigurdsson, Asgeir; Gudjonsson, Sigurjon A.; Gudmundsson, Julius; Jonasson, Jon G.; Tryggvadottir, Laufey; Jonsson, Thorvaldur; Helgason, Agnar; Gylfason, Arnaldur; Sulem, Patrick; Rafnar, Thorunn; Thorsteinsdottir, Unnur; Gudbjartsson, Daniel F.; Masson, Gisli; Kong, Augustine

    2017-01-01

    Clonal hematopoiesis (CH) arises when a substantial proportion of mature blood cells is derived from a single dominant hematopoietic stem cell lineage. Somatic mutations in candidate driver (CD) genes are thought to be responsible for at least some cases of CH. Using whole-genome sequencing of 11 262 Icelanders, we found 1403 cases of CH by using barcodes of mosaic somatic mutations in peripheral blood, whether or not they have a mutation in a CD gene. We find that CH is very common in the elderly, trending toward inevitability. We show that somatic mutations in TET2, DNMT3A, ASXL1, and PPM1D are associated with CH at high significance. However, known CD mutations were evident in only a fraction of CH cases. Nevertheless, the highly prevalent CH we detect associates with increased mortality rates, risk for hematological malignancy, smoking behavior, telomere length, Y-chromosome loss, and other phenotypic characteristics. Modeling suggests some CH cases could arise in the absence of CD mutations as a result of neutral drift acting on a small population of active hematopoietic stem cells. Finally, we find a germline deletion in intron 3 of the telomerase reverse transcriptase (TERT) gene that predisposes to CH (rs34002450; P = 7.4 × 10−12; odds ratio, 1.37). PMID:28483762

  11. HER2 activating mutations are targets for colorectal cancer treatment

    PubMed Central

    Kavuri, Shyam M.; Jain, Naveen; Galimi, Francesco; Cottino, Francesca; Leto, Simonetta M.; Migliardi, Giorgia; Searleman, Adam C.; Shen, Wei; Monsey, John; Trusolino, Livio; Jacobs, Samuel A.; Bertotti, Andrea; Bose, Ron

    2015-01-01

    The Cancer Genome Atlas project identified HER2 somatic mutations and gene amplification in 7% of colorectal cancer patients. Introduction of the HER2 mutations, S310F, L755S, V777L, V842I, and L866M, into colon epithelial cells increased signaling pathways and anchorage-independent cell growth, indicating that they are activating mutations. Introduction of these HER2 activating mutations into colorectal cancer cell lines produced resistance to cetuximab and panitumumab by sustaining MAPK phosphorylation. HER2 mutations are potently inhibited by low nanomolar doses of the irreversible tyrosine kinase inhibitors, neratinib and afatinib. HER2 gene sequencing of 48 cetuximab resistant, quadruple (KRAS, NRAS, BRAF, and PIK3CA) WT colorectal cancer patient-derived xenografts (PDX’s) identified 4 PDX’s with HER2 mutations. HER2 targeted therapies were tested on two PDX’s. Treatment with a single HER2 targeted drug (trastuzumab, neratinib, or lapatinib) delayed tumor growth, but dual HER2 targeted therapy with trastuzumab plus tyrosine kinase inhibitors produced regression of these HER2 mutated PDX’s. PMID:26243863

  12. EPHA2 MUTATIONS CONTRIBUTE TO CONGENITAL CATARACT THROUGH DIVERSE MECHANISMS.

    PubMed

    Dave, Alpana; Martin, Sarah; Kumar, Raman; Craig, Jamie E; Burdon, Kathryn P; Sharma, Shiwani

    2016-01-01

    Congenital cataract is a leading cause of childhood blindness. Mutations in the EPHA2 gene are one of the causes of inherited congenital cataract. The EPHA2 gene encodes a membrane-bound tyrosine kinase receptor and is highly expressed in epithelial cells, including in the ocular lens. Signaling through the EPHA2 receptor plays a pivotal role in epithelial cell homeostasis. The aim of this study was to determine the effect of congenital cataract causing mutations in the EPHA2 gene on the encoded protein in epithelial cells. The effect of five disease-causing mutations, p.P584L (c.1751C>T), p.T940I (c.2819C>T), p.D942fsXC71 (c.2826-9G>A), p.A959T (c.2875G>A), and p.V972GfsX39 (c.2915_2916delTG), on localization of the protein was examined in two in vitro epithelial cell culture systems: Madin-Darby Canine Kidney (MDCK) and human colorectal adenocarcinoma (Caco-2) epithelial cells. Myc-tagged mutant constructs were generated by polymerase chain reaction (PCR)-based mutagenesis. The Myc-tagged wild-type construct was used as a control. The Myc-tagged wild-type and mutant proteins were ectopically expressed and detected by immunofluorescence labeling. Two of the mutations, p.T940I and p.D942fsXC71, located within the cytoplasmic sterile-α-motif (SAM) domain of EPHA2, led to mis-localization of the protein to the perinuclear space and co-localization with the cis-golgi apparatus, indicating sub-organellar/cellular retention of the mutant proteins. The mutant proteins carrying the remaining three mutations, similar to the wild-type EPHA2, localized to the cell membrane. Mis-localization of two of the mutant proteins in epithelial cells suggests that some disease-causing mutations in EPHA2 likely affect lens epithelial cell homeostasis and contribute to cataract. This study suggests that mutations in EPHA2 contribute to congenital cataract through diverse mechanisms.

  13. Characterizing mutagenesis in the hprt gene of rat alveolar epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Driscoll, K.E.; Deyo, L.C.; Howard, B.W.

    1995-12-31

    A clonal selection assay was developed for mutation in the hypoxanthine-guanine phosphoribosyl transferase (hprt) gene of rat alveolar epithelial cells. Studies were conducted to establish methods for isolation and long-term culture of rat alveolar epithelial cells. When isolated by pronase digestion purified on a Nycodenz gradient and cultured in media containing 7.5% fetal bovine serum (FBS), pituitary extract, EGF, insulin, and IGF-1, rat alveolar epithelial cells could be maintained in culture for several weeks with cell doubling times of 2-4 days. The rat alveolar epithelial cell cultures were exposed in vitro to the mutagens ethylnitrosourea (ENU) and H{sub 2}O{sub 2},more » and mutation in the hprt gene was selected for by culture in the presence of the toxic purine analog, 6-thioguanine (6TG). In vitro exposure to ENU or H{sub 2}O produced a dose-dependent increase in hprt mutation frequency in the alveolar epithelial cells. To determine if the assay system could be used to evaluate mutagenesis in alveolar type II cells after in vivo mutagen or carcinogen exposure, cells were isolated from rats treated previously with ENU or {alpha}-quartz. A significant increase in hprt mutation frequency was detected in alveolar epithelial cells obtained from rats exposed to ENU or {alpha}-quartz; the latter observation is the first demonstration that crystalline silica exposure is mutagenic in vivo. In summary, these studies show that rat alveolar epithelial cells isolated by pronase digestion and Nycodenz separation techniques and cultured in a defined media can be used in a clonal selection assay for mutation in the hprt gene. This assay demonstrates that ENU and H{sub 2}O{sub 2} in vitro and ENU and {alpha}-quartz in vivo are mutagenic for rat alveolar epithelial cells. This model should be useful for investigating the genotoxic effects of chemical and physical agents on an important lung cell target for neoplastic transformation. 41 refs., 4 figs., 3 tabs.« less

  14. Remarkable difference of somatic mutation patterns between oncogenes and tumor suppressor genes.

    PubMed

    Liu, Haoxuan; Xing, Yuhang; Yang, Sihai; Tian, Dacheng

    2011-12-01

    Cancers arise owing to mutations that confer selective growth advantages on the cells in a subset of tumor suppressor and/or oncogenes. To understand oncogenesis and diagnose cancers, it is crucial to discriminate these two groups of genes by using the difference in their mutation patterns. Here, we investigated>120,000 mutation samples in 66 well-known tumor suppressor genes and oncogenes of the COSMIC database, and found a set of significant differences in mutation patterns (e.g., non-3n-indel, non-sense SNP and mutation hotspot) between them. By screening the best measurement, we developed indices to readily distinguish one from another and predict clearly the unknown oncogenesis genes as tumor suppressors (e.g., ASXL1, HNF1A and KDM6A) or oncogenes (e.g., FOXL2, MYD88 and TSHR). Based on our results, a third gene group can be classified, which has a mutational pattern between tumor suppressors and oncogenes. The concept of the third gene group could help to understand gene function in different cancers or individual patients and to know the exact function of genes in oncogenesis. In conclusion, our study provides further insights into cancer-related genes and identifies several potential therapeutic targets.

  15. Chromatin modifiers and the promise of epigenetic therapy in acute leukemia

    PubMed Central

    Greenblatt, Sarah M.; Nimer, Stephen D.

    2017-01-01

    Hematopoiesis is a tightly regulated process involving the control of gene expression that directs the transition from hematopoietic stem and progenitor cells to terminally differentiated blood cells. In leukemia, the processes directing self-renewal, differentiation, and progenitor cell expansion are disrupted, leading to the accumulation of immature, non-functioning malignant cells. Insights into these processes have come in stages, based upon technological advances in genetic analyses, bioinformatics, and biological sciences. The first cytogenetic studies of leukemic cells identified chromosomal translocations that generate oncogenic fusion proteins, and most commonly affect regulators of transcription. This was followed by the discovery of recurrent somatic mutations in genes encoding regulators of the signal transduction pathways that control cell proliferation and survival. Recently, studies of global changes in methylation and gene expression have led to the understanding that the output of transcriptional regulators and the proliferative signaling pathways, are ultimately influenced by chromatin structure. Candidate gene, whole genome, and whole exome sequencing studies have identified recurrent somatic mutations in genes encoding epigenetic modifiers in both acute myeloid leukemia (AML) and acute lymphoid leukemia (ALL). In contrast to the two hit model of leukemogenesis, emerging evidence suggests that these epigenetic modifiers represent a class of mutations that are critical to the development of leukemia and affect the regulation of various other oncogenic pathways. In this review, we discuss the range of recurrent, somatic mutations in epigenetic modifiers found in leukemia and how these modifiers relate to the classical leukemogenic pathways that lead to impaired cell differentiation and aberrant self-renewal and proliferation. PMID:24609046

  16. Histone modifier gene mutations in peripheral T-cell lymphoma not otherwise specified.

    PubMed

    Ji, Meng-Meng; Huang, Yao-Hui; Huang, Jin-Yan; Wang, Zhao-Fu; Fu, Di; Liu, Han; Liu, Feng; Leboeuf, Christophe; Wang, Li; Ye, Jing; Lu, Yi-Ming; Janin, Anne; Cheng, Shu; Zhao, Wei-Li

    2018-04-01

    Due to heterogeneous morphological and immunophenotypic features, approximately 50% of peripheral T-cell lymphomas are unclassifiable and categorized as peripheral T-cell lymphomas, not otherwise specified. These conditions have an aggressive course and poor clinical outcome. Identification of actionable biomarkers is urgently needed to develop better therapeutic strategies. Epigenetic alterations play a crucial role in tumor progression. Histone modifications, particularly methylation and acetylation, are generally involved in chromatin state regulation. Here we screened the core set of genes related to histone methylation ( KMT2D , SETD2 , KMT2A , KDM6A ) and acetylation ( EP300 , CREBBP ) and identified 59 somatic mutations in 45 of 125 (36.0%) patients with peripheral T-cell lymphomas, not otherwise specified. Histone modifier gene mutations were associated with inferior progression-free survival time of the patients, irrespective of chemotherapy regimens, but an increased response to the histone deacetylase inhibitor chidamide. In vitro , chidamide significantly inhibited the growth of EP300-mutated T-lymphoma cells and KMT2D-mutated T-lymphoma cells when combined with the hypomethylating agent decitabine. Mechanistically, decitabine acted synergistically with chidamide to enhance the interaction of KMT2D with transcription factor PU.1, regulated H3K4me-associated signaling pathways, and sensitized T-lymphoma cells to chidamide. In a xenograft KMT2D-mutated T-lymphoma model, dual treatment with chidamide and decitabine significantly retarded tumor growth and induced cell apoptosis through modulation of the KMT2D/H3K4me axis. Our work thus contributes to the understanding of aberrant histone modification in peripheral T-cell lymphomas, not otherwise specified and the stratification of a biological subset that can benefit from epigenetic treatment. Copyright© 2018 Ferrata Storti Foundation.

  17. APC alterations are frequently involved in the pathogenesis of acinar cell carcinoma of the pancreas, mainly through gene loss and promoter hypermethylation.

    PubMed

    Furlan, Daniela; Sahnane, Nora; Bernasconi, Barbara; Frattini, Milo; Tibiletti, Maria Grazia; Molinari, Francesca; Marando, Alessandro; Zhang, Lizhi; Vanoli, Alessandro; Casnedi, Selenia; Adsay, Volkan; Notohara, Kenji; Albarello, Luca; Asioli, Sofia; Sessa, Fausto; Capella, Carlo; La Rosa, Stefano

    2014-05-01

    Genetic and epigenetic alterations involved in the pathogenesis of pancreatic acinar cell carcinomas (ACCs) are poorly characterized, including the frequency and role of gene-specific hypermethylation, chromosome aberrations, and copy number alterations (CNAs). A subset of ACCs is known to show alterations in the APC/β-catenin pathway which includes mutations of APC gene. However, it is not known whether, in addition to mutation, loss of APC gene function can occur through alternative genetic and epigenetic mechanisms such as gene loss or promoter methylation. We investigated the global methylation profile of 34 tumor suppressor genes, CNAs of 52 chromosomal regions, and APC gene alterations (mutation, methylation, and loss) together with APC mRNA level in 45 ACCs and related peritumoral pancreatic tissues using methylation-specific multiplex ligation probe amplification (MS-MLPA), fluorescence in situ hybridization (FISH), mutation analysis, and reverse transcription-droplet digital PCR. ACCs did not show an extensive global gene hypermethylation profile. RASSF1 and APC were the only two genes frequently methylated. APC mutations were found in only 7 % of cases, while APC loss and methylation were more frequently observed (48 and 56 % of ACCs, respectively). APC mRNA low levels were found in 58 % of cases and correlated with CNAs. In conclusion, ACCs do not show extensive global gene hypermethylation. APC alterations are frequently involved in the pathogenesis of ACCs mainly through gene loss and promoter hypermethylation, along with reduction of APC mRNA levels.

  18. Problems in mechanistic theoretical models for cell transformation by ionizing radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chatterjee, A.; Holley, W.R.

    1991-10-01

    A mechanistic model based on yields of double strand breaks has been developed to determine the dose response curves for cell transformation frequencies. At its present stage the model is applicable to immortal cell lines and to various qualities (X-rays, Neon and Iron) of ionizing radiation. Presently, we have considered four types of processes which can lead to activation phenomena: (1) point mutation events on a regulatory segment of selected oncogenes, (2) inactivation of suppressor genes, through point mutation, (3) deletion of a suppressor gene by a single track, and (4) deletion of a suppressor gene by two tracks.

  19. Chemical inducible promoter used to obtain transgenic plants with a silent marker and organisms and cells and methods of using same for screening for mutations

    DOEpatents

    Zuo, Jianru [New York, NY; Chua, Nam-Hai [Scarsdale, NY

    2007-06-12

    Disclosed is a chemically inducible promoter for transforming plants or plant cells with genes which are regulatable by adding the plants or cells to a medium containing an inducer or by removing them from such medium. The promoter is inducible by a glucocorticoid, estrogen or inducer not endogenous to plants. Such promoters may be used with any plant genes that can promote shoot regeneration and development to induce shoot formation in the presence of a glucocorticoid, estrogen or inducer. The promoter may be used with antibiotic or herbicide resistance genes or other genes which are regulatable by the presence or absence of a given inducer. Also presented are organisms or cells comprising a gene wherein the natural promoter of the gene is disrupted and the gene is placed under the control of a transgenic inducible promoter. These organisms and cells and their progeny are useful for screening for conditional gain of function and loss of function mutations.

  20. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  1. The PSO4 gene is responsible for an error-prone recombinational DNA repair pathway in Saccharomyces cerevisiae.

    PubMed

    de Andrade, H H; Marques, E K; Schenberg, A C; Henriques, J A

    1989-06-01

    The induction of mitotic gene conversion and crossing-over in Saccharomyces cerevisiae diploid cells homozygous for the pso4-1 mutation was examined in comparison to the corresponding wild-type strain. The pso4-1 mutant strain was found to be completely blocked in mitotic recombination induced by photoaddition of mono- and bifunctional psoralen derivatives as well as by mono- (HN1) and bifunctional (HN2) nitrogen mustards or 254 nm UV radiation in both stationary and exponential phases of growth. Concerning the lethal effect, diploids homozygous for the pso4-1 mutation are more sensitive to all agents tested in any growth phase. However, this effect is more pronounced in the G2 phase of the cell cycle. These results imply that the ploidy effect and the resistance of budding cells are under the control of the PSO4 gene. On the other hand, the pso4-1 mutant is mutationally defective for all agents used. Therefore, the pso4-1 mutant has a generalized block in both recombination and mutation ability. This indicates that the PSO4 gene is involved in an error-prone repair pathway which relies on a recombinational mechanism, strongly suggesting an analogy between the pso4-1 mutation and the RecA or LexA mutation of Escherichia coli.

  2. Genetics Home Reference: Niemann-Pick disease

    MedlinePlus

    ... is responsible for the conversion of a fat (lipid) called sphingomyelin into another type of lipid called ceramide. Mutations in SMPD1 lead to a ... these genes are involved in the movement of lipids within cells. Mutations in these genes lead to ...

  3. Loss-of-function thrombospondin-1 mutations in familial pulmonary hypertension

    PubMed Central

    Stearman, Robert S.; Bull, Todd M.; Calabrese, David W.; Tripp-Addison, Megan L.; Wick, Marilee J.; Broeckel, Ulrich; Robbins, Ivan M.; Wheeler, Lisa A.; Cogan, Joy D.; Loyd, James E.

    2012-01-01

    Most patients with familial pulmonary arterial hypertension (FPAH) carry mutations in the bone morphogenic protein receptor 2 gene (BMPR2). Yet carriers have only a 20% risk of disease, suggesting that other factors influence penetrance. Thrombospondin-1 (TSP1) regulates activation of TGF-β and inhibits endothelial and smooth muscle cell proliferation, pathways coincidentally altered in pulmonary arterial hypertension (PAH). To determine whether a subset of FPAH patients also have mutations in the TSP1 gene (THBS1) we resequenced the type I repeats of THBS1 encoding the TGF-β regulation and cell growth inhibition domains in 60 FPAH probands, 70 nonfamilial PAH subjects, and in large control groups. We identified THBS1 mutations in three families: a novel missense mutation in two (Asp362Asn), and an intronic mutation in a third (IVS8+255 G/A). Neither mutation was detected in population controls. Mutant 362Asn TSP1 had less than half of the ability of wild-type TSP1 to activate TGF-β. Mutant 362Asn TSP1 also lost the ability to inhibit growth of pulmonary arterial smooth muscle cells and was over threefold less effective at inhibiting endothelial cell growth. The IVS8+255 G/A mutation decreased and/or eliminated local binding of the transcription factors SP1 and MAZ but did not affect RNA splicing. These novel mutations implicate THBS1 as a modifier gene in FPAH. These THBS1 mutations have implications in the genetic evaluation of FPAH patients. However, since FPAH is rare, these data are most relevant as evidence for the importance of TSP1 in pulmonary vascular homeostasis. Further examination of THBS1 in the pathogenesis of PAH is warranted. PMID:22198906

  4. Oligonucleotide-directed mutagenesis screen to identify pathogenic Lynch syndrome-associated MSH2 DNA mismatch repair gene variants

    PubMed Central

    Houlleberghs, Hellen; Dekker, Marleen; Lantermans, Hildo; Kleinendorst, Roos; Dubbink, Hendrikus Jan; Hofstra, Robert M. W.; Verhoef, Senno; te Riele, Hein

    2016-01-01

    Single-stranded DNA oligonucleotides can achieve targeted base-pair substitution with modest efficiency but high precision. We show that “oligo targeting” can be used effectively to study missense mutations in DNA mismatch repair (MMR) genes. Inherited inactivating mutations in DNA MMR genes are causative for the cancer predisposition Lynch syndrome (LS). Although overtly deleterious mutations in MMR genes can clearly be ascribed as the cause of LS, the functional implications of missense mutations are often unclear. We developed a genetic screen to determine the pathogenicity of these variants of uncertain significance (VUS), focusing on mutator S homolog 2 (MSH2). VUS were introduced into the endogenous Msh2 gene of mouse embryonic stem cells by oligo targeting. Subsequent selection for MMR-deficient cells using the guanine analog 6-thioguanine allowed the detection of MMR-abrogating VUS. The screen was able to distinguish weak and strong pathogenic variants from polymorphisms and was used to investigate 59 Msh2 VUS. Nineteen of the 59 VUS were identified as pathogenic. Functional assays revealed that 14 of the 19 detected variants fully abrogated MMR activity and that five of the detected variants attenuated MMR activity. Implementation of the screen in clinical practice allows proper counseling of mutation carriers and treatment of their tumors. PMID:26951660

  5. The Influence of Polyploidy on the Evolution of Yeast Grown in a Sub-Optimal Carbon Source

    PubMed Central

    Scott, Amber L.; Richmond, Phillip A.; Dowell, Robin D.; Selmecki, Anna M.

    2017-01-01

    Abstract Polyploidization events have occurred during the evolution of many fungi, plant, and animal species and are thought to contribute to speciation and tumorigenesis, however little is known about how ploidy level contributes to adaptation at the molecular level. Here we integrate whole genome sequencing, RNA expression analysis, and relative fitness of ∼100 evolved clones at three ploidy levels. Independent haploid, diploid, and tetraploid populations were grown in a low carbon environment for 250 generations. We demonstrate that the key adaptive mutation in the evolved clones is predicted by a gene expression signature of just five genes. All of the adaptive mutations identified encompass a narrow set of genes, however the tetraploid clones gain a broader spectrum of adaptive mutations than haploid or diploid clones. While many of the adaptive mutations occur in genes that encode proteins with known roles in glucose sensing and transport, we discover mutations in genes with no canonical role in carbon utilization (IPT1 and MOT3), as well as identify novel dominant mutations in glucose signal transducers thought to only accumulate recessive mutations in carbon limited environments (MTH1 and RGT1). We conclude that polyploid cells explore more genotypic and phenotypic space than lower ploidy cells. Our study provides strong evidence for the beneficial role of polyploidization events that occur during the evolution of many species and during tumorigenesis. PMID:28957510

  6. Characterization of immune cells and perforin mutations in familiar venous thromboembolism.

    PubMed

    Duan, Qianglin; Lv, Wei; Yang, Minjun; Yang, Fan; Zhu, Yongqiang; Kang, Hui; Song, Haoming; Wang, Shengyue; Dong, Hui; Wang, Lemin

    2015-01-01

    This study was to carry out exome sequencing in a Han Chinese family with venous thromboembolism. Three venous thromboembolism (VTE) patients and five members from a Han Chinese family were evaluated by exome sequencing. Among the 3 VTE patients, mutations of 2 genes including PRF1 and HTR2A were identified and predicted to be functionally damaged to their encoded proteins. In addition, the PRF1 mutation and the HTR2A mutation identified in our study were absent in 100 non-related controls, indicating that venous thromboembolism has a genetic component. The R357W mutation is located in the membrane attack complex/perforin domain of PRF1 protein, which exists in both the perforin. The steps of killing foreign or pathological antigen cells by NK cells, CD8 (+)T cells and the membrane attack complex include membrane perforation and release of the granzyme, either of which is abnormal can lead to immune dysfunction. The mutations of immune related genes in familial VTE might provide new understanding of the pathogenesis of familial venous thromboembolism.

  7. Correlation of Merkel cell polyomavirus positivity with PDGFRα mutations and survivin expression in Merkel cell carcinoma.

    PubMed

    Batinica, M; Akgül, B; Silling, S; Mauch, C; Zigrino, P

    2015-07-01

    Merkel cell carcinoma (MCC) is a neuroendocrine cancer of the skin postulated to originate through Merkel cell polyomavirus (MCPyV) oncogenesis and/or by mutations in molecules implicated in the regulation of cell growth and survival. Despite the fact that MCPvV is detected more broadly within the population, only a part of the infected people also develop MCC. It is thus conceivable that together, virus and for example mutations, are necessary for disease development. However, apart from a correlation between MCPyV positivity or mutations and MCC development, less is known about the association of these factors with progressive disease. To analyze MCPyV positivity, load and integration in MCC as well as presence of mutations in PDGFRα and TP53 genes and correlate these with clinical features and disease progression to identify features with prognostic value for clinical progression. This is a study on a MCC population group of 64 patients. MCPyV positivity, load and integration in parallel to mutations in the PDGFRα and TP53 were analyzed on genomic DNA from MCC specimens. In addition, expression of PDGFRα, survivin and p53 proteins was analyzed by immunodetection in tissues specimens. All these parameters were analyzed as function of patient's disease progression status. 83% of MCCs were positive for the MCPyV and among these 36% also displayed virus-T integration. Viral load ranged from 0.006 to 943 viral DNA copies/β-globin gene and was highest in patients with progressive disease. We detected more than one mutation within the PDGFRα gene and identified two new SNPs in 36% of MCC patients, whereas no mutations were found in TP53 gene. Survivin was expressed in 78% of specimens. We could not correlate either mutations in PDGFR or expression of PDGFR, p53 and surviving either to the disease progression or to the MCPyV positivity. In conclusion, our data indicate that the viral positivity when associated with high viral load, correlates with poor disease outcome. Frequent mutations in the PDGFRα gene and high survivin expression were found in MCC independent of the viral positivity. These data suggest that these three factors independently contribute to Merkel cell carcinoma development and that only the viral load can be used as indicator of disease progression in virus positive patients. Copyright © 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  8. Control of Cell Morphology: Signalling by the Receptor Notch.

    DTIC Science & Technology

    1996-10-01

    missense mutations or small deletions at the extreme C-terminus of NOTCH, and lie within the minimal region that includes the C-terminal binding site for...20 Figure 4. Genetic interaction of null and hypomorphic alleles of Notch with abl mutations ...wide variety of cell types during Drosophila embryogenesis [1, 2]. Mutations in the Notch gene lead to severe defects in cell identity in the nervous

  9. A complex of serine protease genes expressed preferentially in cytotoxic T-lymphocytes is closely linked to the T-cell receptor alpha- and delta-chain genes on mouse chromosome 14.

    PubMed

    Crosby, J L; Bleackley, R C; Nadeau, J H

    1990-02-01

    A complex of genes encoding serine proteases that are preferentially expressed in cytotoxic T-cells was shown to be closely linked to the T-cell receptor alpha- and delta-chain genes on mouse chromosome 14. A striking difference in recombination frequencies among linkage crosses was reported. Two genes, Np-1 and Tcra, which fail to recombine in crosses involving conventional strains of mice, were shown to recombine readily in interspecific crosses involving Mus spretus. This difference in recombination frequency suggests chromosomal rearrangements that suppress recombination in conventional crosses, recombination hot spots in interspecific crosses, or selection against recombinant haplotypes during development of recombinant inbred strains. Finally, a mutation called disorganization, which is located near the serine protease complex, is of considerable interest because it causes an extraordinarily wide variety of congenital defects. Because of the involvement of serine protease loci in several homeotic mutations in Drosophila, disorganization must be considered a candidate for a mutation in a serine protease-encoding gene.

  10. Clonal Architecture of Secondary Acute Myeloid Leukemia

    PubMed Central

    Walter, Matthew J.; Shen, Dong; Ding, Li; Shao, Jin; Koboldt, Daniel C.; Chen, Ken; Larson, David E.; McLellan, Michael D.; Dooling, David; Abbott, Rachel; Fulton, Robert; Magrini, Vincent; Schmidt, Heather; Kalicki-Veizer, Joelle; O’Laughlin, Michelle; Fan, Xian; Grillot, Marcus; Witowski, Sarah; Heath, Sharon; Frater, John L.; Eades, William; Tomasson, Michael; Westervelt, Peter; DiPersio, John F.; Link, Daniel C.; Mardis, Elaine R.; Ley, Timothy J.; Wilson, Richard K.; Graubert, Timothy A.

    2012-01-01

    BACKGROUND The myelodysplastic syndromes are a group of hematologic disorders that often evolve into secondary acute myeloid leukemia (AML). The genetic changes that underlie progression from the myelodysplastic syndromes to secondary AML are not well understood. METHODS We performed whole-genome sequencing of seven paired samples of skin and bone marrow in seven subjects with secondary AML to identify somatic mutations specific to secondary AML. We then genotyped a bone marrow sample obtained during the antecedent myelodysplastic-syndrome stage from each subject to determine the presence or absence of the specific somatic mutations. We identified recurrent mutations in coding genes and defined the clonal architecture of each pair of samples from the myelodysplastic-syndrome stage and the secondary-AML stage, using the allele burden of hundreds of mutations. RESULTS Approximately 85% of bone marrow cells were clonal in the myelodysplastic-syndrome and secondary-AML samples, regardless of the myeloblast count. The secondary-AML samples contained mutations in 11 recurrently mutated genes, including 4 genes that have not been previously implicated in the myelodysplastic syndromes or AML. In every case, progression to acute leukemia was defined by the persistence of an antecedent founding clone containing 182 to 660 somatic mutations and the outgrowth or emergence of at least one subclone, harboring dozens to hundreds of new mutations. All founding clones and subclones contained at least one mutation in a coding gene. CONCLUSIONS Nearly all the bone marrow cells in patients with myelodysplastic syndromes and secondary AML are clonally derived. Genetic evolution of secondary AML is a dynamic process shaped by multiple cycles of mutation acquisition and clonal selection. Recurrent gene mutations are found in both founding clones and daughter subclones. (Funded by the National Institutes of Health and others.) PMID:22417201

  11. KRAS driven expression signature has prognostic power superior to mutation status in non-small cell lung cancer.

    PubMed

    Nagy, Ádám; Pongor, Lőrinc Sándor; Szabó, András; Santarpia, Mariacarmela; Győrffy, Balázs

    2017-02-15

    KRAS is the most frequently mutated oncogene in non-small cell lung cancer (NSCLC). However, the prognostic role of KRAS mutation status in NSCLC still remains controversial. We hypothesize that the expression changes of genes affected by KRAS mutation status will have the most prominent effect and could be used as a prognostic signature in lung cancer. We divided NSCLC patients with mutation and RNA-seq data into KRAS mutated and wild type groups. Mann-Whitney test was used to identify genes showing altered expression between these cohorts. Mean expression of the top five genes was designated as a "transcriptomic fingerprint" of the mutation. We evaluated the effect of this signature on clinical outcome in 2,437 NSCLC patients using univariate and multivariate Cox regression analysis. Mutation of KRAS was most common in adenocarcinoma. Mutation status and KRAS expression were not correlated to prognosis. The transcriptomic fingerprint of KRAS include FOXRED2, KRAS, TOP1, PEX3 and ABL2. The KRAS signature had a high prognostic power. Similar results were achieved when using the second and third set of strongest genes. Moreover, all cutoff values delivered significant prognostic power (p < 0.01). The KRAS signature also remained significant (p < 0.01) in a multivariate analysis including age, gender, smoking history and tumor stage. We generated a "surrogate signature" of KRAS mutation status in NSCLC patients by computationally linking genotype and gene expression. We show that secondary effects of a mutation can have a higher prognostic relevance than the primary genetic alteration itself. © 2016 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  12. Novel causative mutations in patients with Nance-Horan syndrome and altered localization of the mutant NHS-A protein isoform

    PubMed Central

    Burdon, Kathryn P.; Dave, Alpana; Jamieson, Robyn V.; Yaron, Yuval; Billson, Frank; Van Maldergem, Lionel; Lorenz, Birgit; Gécz, Jozef; Craig, Jamie E.

    2008-01-01

    Purpose Nance-Horan syndrome is typically characterized by severe bilateral congenital cataracts and dental abnormalities. Truncating mutations in the Nance-Horan syndrome (NHS) gene cause this X-linked genetic disorder. NHS encodes two isoforms, NHS-A and NHS-1A. The ocular lens expresses NHS-A, the epithelial and neuronal cell specific isoform. The NHS-A protein localizes in the lens epithelium at the cellular periphery. The data to date suggest a role for this isoform at cell-cell junctions in epithelial cells. This study aimed to identify the causative mutations in new patients diagnosed with Nance-Horan syndrome and to investigate the effect of mutations on subcellular localization of the NHS-A protein. Methods All coding exons of NHS were screened for mutations by polymerase chain reaction (PCR) and sequencing. PCR-based mutagenesis was performed to introduce three independent mutations in the NHS-A cDNA. Expression and localization of the mutant proteins was determined in mammalian epithelial cells. Results Truncating mutations were found in 6 out of 10 unrelated patients from four countries. Each of four patients carried a novel mutation (R248X, P264fs, K1198fs, and I1302fs), and each of the two other patients carried two previously reported mutations (R373X and R879X). No mutation was found in the gene in four patients. Two disease-causing mutations (R134fs and R901X) and an artificial mutation (T1357fs) resulted in premature truncation of the NHS-A protein. All three mutant proteins failed to localize to the cellular periphery in epithelial cells and instead were found in the cytoplasm. Conclusions This study brings the total number of mutations identified in NHS to 18. The mislocalization of the mutant NHS-A protein, revealed by mutation analysis, is expected to adversely affect cell-cell junctions in epithelial cells such as the lens epithelium, which may explain cataractogenesis in Nance-Horan syndrome patients. Mutation analysis also shed light on the significance of NHS-A regions for its localization and, hence, its function at epithelial cell junctions. PMID:18949062

  13. Novel causative mutations in patients with Nance-Horan syndrome and altered localization of the mutant NHS-A protein isoform.

    PubMed

    Sharma, Shiwani; Burdon, Kathryn P; Dave, Alpana; Jamieson, Robyn V; Yaron, Yuval; Billson, Frank; Van Maldergem, Lionel; Lorenz, Birgit; Gécz, Jozef; Craig, Jamie E

    2008-01-01

    Nance-Horan syndrome is typically characterized by severe bilateral congenital cataracts and dental abnormalities. Truncating mutations in the Nance-Horan syndrome (NHS) gene cause this X-linked genetic disorder. NHS encodes two isoforms, NHS-A and NHS-1A. The ocular lens expresses NHS-A, the epithelial and neuronal cell specific isoform. The NHS-A protein localizes in the lens epithelium at the cellular periphery. The data to date suggest a role for this isoform at cell-cell junctions in epithelial cells. This study aimed to identify the causative mutations in new patients diagnosed with Nance-Horan syndrome and to investigate the effect of mutations on subcellular localization of the NHS-A protein. All coding exons of NHS were screened for mutations by polymerase chain reaction (PCR) and sequencing. PCR-based mutagenesis was performed to introduce three independent mutations in the NHS-A cDNA. Expression and localization of the mutant proteins was determined in mammalian epithelial cells. Truncating mutations were found in 6 out of 10 unrelated patients from four countries. Each of four patients carried a novel mutation (R248X, P264fs, K1198fs, and I1302fs), and each of the two other patients carried two previously reported mutations (R373X and R879X). No mutation was found in the gene in four patients. Two disease-causing mutations (R134fs and R901X) and an artificial mutation (T1357fs) resulted in premature truncation of the NHS-A protein. All three mutant proteins failed to localize to the cellular periphery in epithelial cells and instead were found in the cytoplasm. This study brings the total number of mutations identified in NHS to 18. The mislocalization of the mutant NHS-A protein, revealed by mutation analysis, is expected to adversely affect cell-cell junctions in epithelial cells such as the lens epithelium, which may explain cataractogenesis in Nance-Horan syndrome patients. Mutation analysis also shed light on the significance of NHS-A regions for its localization and, hence, its function at epithelial cell junctions.

  14. Megacystis Microcolon Intestinal Hypoperistalsis Syndrome in Which a Different De Novo Actg2 Gene Mutation was Detected: A Case Report.

    PubMed

    Korğalı, Elif Ünver; Yavuz, Amine; Şimşek, Cemile Ece Çağlar; Güney, Cengiz; Kurtulgan, Hande Küçük; Başer, Burak; Atalar, Mehmet Haydar; Özer, Hatice; Eğilmez, Hatice Reyhan

    2018-04-01

    Megacystis microcolon intestinal hypoperistalsis syndrome (MMIHS) is characterized by bladder distension without urinary tract obstruction, decreased or absent intestinal peristalsis and microcolon. Although the definitive cause remains unknown, changes in the ACTG2 gene are thought to be responsible for the intestinal and bladder hypoperistalsis. This female newborn with MMIHS had a c.532C>A /p.Arg178Ser heterozygous de novo mutation detected in the ACTG2 gene. Normal immature ganglion cells, normal calretinin punctate positivity, maintence of smooth muscle actin immunoreactivity, and decreased numbers of interstitial cells of Cajal(ICCs) were detected. This previously unreported c.532C>A /p.Arg178Ser heterozygous de novo mutation in the ACTG2 gene may lead to a severe form of MMIHS.

  15. Mannosyltransferase is required for cell wall biosynthesis, morphology and control of asexual development in Neurospora crassa.

    PubMed

    Bowman, Shaun M; Piwowar, Amy; Ciocca, Maria; Free, Stephen J

    2005-01-01

    Two Neurospora mutants with a phenotype that includes a tight colonial growth pattern, an inability to form conidia and an inability to form protoperithecia have been isolated and characterized. The relevant mutations were mapped to the same locus on the sequenced Neurospora genome. The mutations responsible for the mutant phenotype then were identified by examining likely candidate genes from the mutant genomes at the mapped locus with PCR amplification and a sequencing assay. The results demonstrate that a map and sequence strategy is a feasible way to identify mutant genes in Neurospora. The gene responsible for the phenotype is a putative alpha-1,2-mannosyltransferase gene. The mutant cell wall has an altered composition demonstrating that the gene functions in cell wall biosynthesis. The results demonstrate that the mnt-1 gene is required for normal cell wall biosynthesis, morphology and for the regulation of asexual development.

  16. Transgenic rescue demonstrates involvement of the Ian5 gene in T cell development in the rat.

    PubMed

    Michalkiewicz, Mieczyslaw; Michalkiewicz, Teresa; Ettinger, Ruth A; Rutledge, Elizabeth A; Fuller, Jessica M; Moralejo, Daniel H; Van Yserloo, Brian; MacMurray, Armand J; Kwitek, Anne E; Jacob, Howard J; Lander, Eric S; Lernmark, Ake

    2004-10-04

    A single point mutation in a novel immune-associated nucleotide gene 5 (Ian5) coincides with severe T cell lymphopenia in BB rats. We used a transgenic rescue approach in lymphopenic BB-derived congenic F344.lyp/lyp rats to determine whether this mutation is responsible for lymphopenia and to establish the functional importance of this novel gene. A 150-kb P1 artificial chromosome (PAC) transgene harboring a wild-type allele of the rat Ian5 gene restored Ian5 transcript and protein levels, completely rescuing the T cell lymphopenia in the F344.lyp/lyp rats. This successful complementation provides direct functional evidence that the Ian5 gene product is essential for maintaining normal T cell levels. It also demonstrates that transgenic rescue in the rat is a practical and definitive method for revealing the function of a novel gene.

  17. APOBEC-mediated mutagenesis in urothelial carcinoma is associated with improved survival, mutations in DNA damage response genes, and immune response

    PubMed Central

    Glaser, Alexander P.; Fantini, Damiano; Wang, Yiduo; Yu, Yanni; Rimar, Kalen J.; Podojil, Joseph R.; Miller, Stephen D.; Meeks, Joshua J.

    2018-01-01

    APOBEC enzymes are responsible for a mutation signature (TCW>T/G) implicated in a wide variety of tumors. We explore the APOBEC mutational signature in bladder cancer and the relationship with specific mutations, molecular subtype, gene expression, and survival using sequencing data from The Cancer Genome Atlas (n = 395), Beijing Genomics Institute (n = 99), and Cancer Cell Line Encyclopedia. Tumors were split into “APOBEC-high” and “APOBEC-low” based on APOBEC enrichment. Patients with APOBEC-high tumors have better overall survival compared to those with APOBEC-low tumors (38.2 vs. 18.5 months, p = 0.005). APOBEC-high tumors are more likely to have mutations in DNA damage response genes (TP53, ATR, BRCA2) and chromatin regulatory genes (ARID1A, MLL, MLL3), while APOBEC-low tumors are more likely to have mutations in FGFR3 and KRAS. APOBEC3A and APOBEC3B expression correlates with mutation burden, regardless of bladder tumor molecular subtype. APOBEC mutagenesis is associated with increased expression of immune signatures, including interferon signaling, and expression of APOBEC3B is increased after stimulation of APOBEC-high bladder cancer cell lines with IFNγ. In summary, APOBEC-high tumors are more likely to have mutations in DNA damage response and chromatin regulatory genes, potentially providing more substrate for APOBEC enzymes, leading to a hypermutational phenotype and the subsequent enhanced immune response. PMID:29435122

  18. Not all SCID pigs are created equally: Two independent mutations in the Artemis gene cause Severe Combined Immunodeficiency (SCID) in pigs

    PubMed Central

    Waide, Emily H; Dekkers, Jack CM; Ross, Jason W; Rowland, Raymond RR; Wyatt, Carol R; Ewen, Catherine L; Evans, Alyssa B; Thekkoot, Dinesh M; Boddicker, Nicholas J; Serão, Nick VL; Ellinwood, N Matthew; Tuggle, Christopher K

    2017-01-01

    Mutations in over 30 genes are known to result in impairment of the adaptive immune system, causing a group of disorders collectively known as severe combined immunodeficiency (SCID). SCID disorders are split into groups based on their presence and/or functionality of B, T, and NK cells. Piglets from a line of Yorkshire pigs at Iowa State University were shown to be affected by T− B− NK+ SCID, representing the first example of naturally occurring SCID in pigs. Here, we present evidence for two spontaneous mutations as the molecular basis for this SCID phenotype. Flow cytometry analysis of thymocytes showed an increased frequency of immature T cells in SCID pigs. Fibroblasts from these pigs were more sensitive to ionizing radiation than non-SCID piglets, eliminating the RAG1 and RAG2 genes. Genetic and molecular analyses showed two mutations were present in the Artemis gene, which in homozygous or compound heterozygous state cause the immunodeficient phenotype. Rescue of SCID fibroblast radiosensitivity by human Artemis protein demonstrated that the identified Artemis mutations are the direct cause of this cellular phenotype. The work presented here reveals two mutations in the Artemis gene that cause T− B− NK+ SCID in pigs. The SCID pig can be an important biomedical model, but these mutations would be undesirable in commercial pig populations. The identified mutations and associated genetic tests can be used to address both of these issues. PMID:26320255

  19. Genetics and Prognostication in Splenic Marginal Zone Lymphoma: Revelations from Deep Sequencing

    PubMed Central

    Gibson, Jane; Wang, Jun; Walewska, Renata; Parker, Helen; Parker, Anton; Davis, Zadie; Gardiner, Anne; McIver-Brown, Neil; Kalpadakis, Christina; Xochelli, Aliki; Anagnostopoulos, Achilles; Fazi, Claudia; de Castro, David Gonzalez; Dearden, Claire; Pratt, Guy; Rosenquist, Richard; Ashton-Key, Margaret; Forconi, Francesco; Collins, Andrew; Ghia, Paolo; Matutes, Estella; Pangalis, Gerassimos; Stamatopoulos, Kostas; Oscier, David; Strefford, Jonathan C

    2015-01-01

    Purpose Mounting evidence supports the clinical significance of gene mutations and immunogenetic features in common mature B-cell malignancies. Experimental Design We undertook a detailed characterization of the genetic background of splenic marginal zone lymphoma (SMZL), using targeted re-sequencing and explored potential clinical implications in a multinational cohort of 175 SMZL patients. Results We identified recurrent mutations in TP53 (16%), KLF2 (12%), NOTCH2 (10%), TNFAIP3 (7%), MLL2 (11%), MYD88 (7%) and ARID1A (6%), all genes known to be targeted by somatic mutation in SMZL. KLF2 mutations were early, clonal events, enriched in patients with del(7q) and IGHV1-2*04 B-cell receptor immunoglobulins, and were associated with a short median time-to-first-treatment (0.12 vs. 1.11 yrs; P=0.01). In multivariate analysis mutations in NOTCH2 (HR 2.12, 95%CI 1.02-4.4, P=0.044) and 100% germline IGHV gene identity (HR 2.19, 95%CI 1.05-4.55, P=0.036) were independent markers of short time-to-first-treatment, while TP53 mutations were an independent marker of short overall survival (HR 2.36, 95% CI 1.08-5.2, P=0.03). Conclusion We identify key associations between gene mutations and clinical outcome, demonstrating for the first time that NOTCH2 and TP53 gene mutations are independent markers of reduced treatment-free and overall survival, respectively. PMID:25779943

  20. PT2385 for the Treatment of Von Hippel-Lindau Disease-Associated Clear Cell Renal Cell Carcinoma

    ClinicalTrials.gov

    2017-08-23

    VHL Gene Mutation; VHL; VHL Syndrome; VHL Gene Inactivation; Von Hippel; Von Hippel-Lindau Disease; Von Hippel's Disease; Von Hippel-Lindau Syndrome, Modifiers of; Clear Cell Renal Cell Carcinoma; Clear Cell RCC; ccRCC

  1. Analysis of full coding sequence of the TP53 gene in invasive vulvar cancers: Implications for therapy.

    PubMed

    Kashofer, Karl; Regauer, Sigrid

    2017-08-01

    This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.

  2. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor-suppressor genes.

    PubMed

    Chen, Kaifu; Chen, Zhong; Wu, Dayong; Zhang, Lili; Lin, Xueqiu; Su, Jianzhong; Rodriguez, Benjamin; Xi, Yuanxin; Xia, Zheng; Chen, Xi; Shi, Xiaobing; Wang, Qianben; Li, Wei

    2015-10-01

    Tumor suppressors are mostly defined by inactivating mutations in tumors, yet little is known about their epigenetic features in normal cells. Through integrative analysis of 1,134 genome-wide epigenetic profiles, mutations from >8,200 tumor-normal pairs and our experimental data from clinical samples, we discovered broad peaks for trimethylation of histone H3 at lysine 4 (H3K4me3; wider than 4 kb) as the first epigenetic signature for tumor suppressors in normal cells. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity, which together lead to exceptionally high gene expression, and is distinct from other broad epigenetic features, such as super-enhancers. Genes with broad H3K4me3 peaks conserved across normal cells may represent pan-cancer tumor suppressors, such as TP53 and PTEN, whereas genes with cell type-specific broad H3K4me3 peaks may represent cell identity genes and cell type-specific tumor suppressors. Furthermore, widespread shortening of broad H3K4me3 peaks in cancers is associated with repression of tumor suppressors. Thus, the broad H3K4me3 epigenetic signature provides mutation-independent information for the discovery and characterization of new tumor suppressors.

  3. Mutation for nonsyndromic mental retardation in the trans-2-enoyl-CoA reductase TER gene involved in fatty acid elongation impairs the enzyme activity and stability, leading to change in sphingolipid profile.

    PubMed

    Abe, Kensuke; Ohno, Yusuke; Sassa, Takayuki; Taguchi, Ryo; Çalışkan, Minal; Ober, Carole; Kihara, Akio

    2013-12-20

    Very long-chain fatty acids (VLCFAs, chain length >C20) exist in tissues throughout the body and are synthesized by repetition of the fatty acid (FA) elongation cycle composed of four successive enzymatic reactions. In mammals, the TER gene is the only gene encoding trans-2-enoyl-CoA reductase, which catalyzes the fourth reaction in the FA elongation cycle. The TER P182L mutation is the pathogenic mutation for nonsyndromic mental retardation. This mutation substitutes a leucine for a proline residue at amino acid 182 in the TER enzyme. Currently, the mechanism by which the TER P182L mutation causes nonsyndromic mental retardation is unknown. To understand the effect of this mutation on the TER enzyme and VLCFA synthesis, we have biochemically characterized the TER P182L mutant enzyme using yeast and mammalian cells transfected with the TER P182L mutant gene and analyzed the FA elongation cycle in the B-lymphoblastoid cell line with the homozygous TER P182L mutation (TER(P182L/P182L) B-lymphoblastoid cell line). We have found that TER P182L mutant enzyme exhibits reduced trans-2-enoyl-CoA reductase activity and protein stability, thereby impairing VLCFA synthesis and, in turn, altering the sphingolipid profile (i.e. decreased level of C24 sphingomyelin and C24 ceramide) in the TER(P182L/P182L) B-lymphoblastoid cell line. We have also found that in addition to the TER enzyme-catalyzed fourth reaction, the third reaction in the FA elongation cycle is affected by the TER P182L mutation. These findings provide new insight into the biochemical defects associated with this genetic mutation.

  4. Mutations of the X-linked genes encoding neuroligins NLGN3 and NLGN4 are associated with autism

    PubMed Central

    Jamain, Stéphane; Quach, Hélène; Betancur, Catalina; Råstam, Maria; Colineaux, Catherine; Gillberg, I Carina; Söderström, Henrik; Giros, Bruno; Leboyer, Marion; Gillberg, Christopher; Bourgeron, Thomas

    2003-01-01

    Many studies have supported a genetic aetiology for autism. Here we report mutations in two X-linked genes, neuroligins NLGN3 and NLGN4, in siblings with autism spectrum disorders. These mutations affect cell adhesion molecules localised at the synapse and suggest that a defect of synaptogenesis may predispose to autism. PMID:12669065

  5. Mutations of the X-linked genes encoding neuroligins NLGN3 and NLGN4 are associated with autism.

    PubMed

    Jamain, Stéphane; Quach, Hélène; Betancur, Catalina; Råstam, Maria; Colineaux, Catherine; Gillberg, I Carina; Soderstrom, Henrik; Giros, Bruno; Leboyer, Marion; Gillberg, Christopher; Bourgeron, Thomas

    2003-05-01

    Many studies have supported a genetic etiology for autism. Here we report mutations in two X-linked genes encoding neuroligins NLGN3 and NLGN4 in siblings with autism-spectrum disorders. These mutations affect cell-adhesion molecules localized at the synapse and suggest that a defect of synaptogenesis may predispose to autism.

  6. Functional link between DNA damage responses and transcriptional regulation by ATM in response to a histone deacetylase inhibitor TSA.

    PubMed

    Lee, Jong-Soo

    2007-09-01

    Mutations in the ATM (ataxia-telangiectasia mutated) gene, which encodes a 370 kd protein with a kinase catalytic domain, predisposes people to cancers, and these mutations are also linked to ataxia-telangiectasia (A-T). The histone acetylaion/deacetylation- dependent chromatin remodeling can activate the ATM kinase-mediated DNA damage signal pathway (in an accompanying work, Lee, 2007). This has led us to study whether this modification can impinge on the ATM-mediated DNA damage response via transcriptional modulation in order to understand the function of ATM in the regulation of gene transcription. To identify the genes whose expression is regulated by ATM in response to histone deaceylase (HDAC) inhibition, we performed an analysis of oligonucleotide microarrays with using the appropriate cell lines, isogenic A-T (ATM(-)) and control (ATM(+)) cells, following treatment with a HDAC inhibitor TSA. Treatment with TSA reprograms the differential gene expression profile in response to HDAC inhibition in ATM(-) cells and ATM(+) cells. We analyzed the genes that are regulated by TSA in the ATM-dependent manner, and we classified these genes into different functional categories, including those involved in cell cycle/DNA replication, DNA repair, apoptosis, growth/differentiation, cell- cell adhesion, signal transduction, metabolism and transcription. We found that while some genes are regulated by TSA without regard to ATM, the patterns of gene regulation are differentially regulated in an ATM-dependent manner. Taken together, these finding indicate that ATM can regulate the transcription of genes that play critical roles in the molecular response to DNA damage, and this response is modulated through an altered HDAC inhibition-mediated gene expression.

  7. Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I.

    PubMed

    Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Millán, José M; Kimberling, William J

    2012-01-01

    PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  8. Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I

    PubMed Central

    Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Kimberling, William J.

    2012-01-01

    Purpose PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Methods Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Results Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Conclusions Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment. PMID:22815625

  9. Somatic mutation detection in human biomonitoring.

    PubMed

    Olsen, L S; Nielsen, L R; Nexø, B A; Wassermann, K

    1996-06-01

    Somatic cell gene mutation arising in vivo may be considered to be a biomarker for genotoxicity. Assays detecting mutations of the haemoglobin and glycophorin A genes in red blood cells and of the hypoxanthine-guanine phosphoribosyltransferase and human leucocyte antigenes in T-lymphocytes are available in humans. This MiniReview describes these assays and their application to studies of individuals exposed to genotoxic agents. Moreover, with the implementation of techniques of molecular biology mutation spectra can now be defined in addition to the quantitation of in vivo mutant frequencies. We describe current screening methods for unknown mutations, including the denaturing gradient gel electrophoresis, single strand conformation polymorphism analysis, heteroduplex analysis, chemical modification techniques and enzymatic cleavage methods. The advantage of mutation detection as a biomarker is that it integrates exposure and sensitivity in one measurement. With the analysis of mutation spectra it may thus be possible to identify the causative genotoxic agent.

  10. A Japanese family with nonautoimmune hyperthyroidism caused by a novel heterozygous thyrotropin receptor gene mutation.

    PubMed

    Nakamura, Akie; Morikawa, Shuntaro; Aoyagi, Hayato; Ishizu, Katsura; Tajima, Toshihiro

    2014-06-01

    Hyperthyroidism caused by activating mutations of the thyrotropin receptor gene (TSHR) is rare in the pediatric population. We found a Japanese family with hyperthyroidism without autoantibody. DNA sequence analysis of TSHR was undertaken in this family. The functional consequences for the Gs-adenylyl cyclase and Gq/11-phospholipase C signaling pathways and cell surface expression of receptors were determined in vitro using transiently transfected human embryonic kidney 293 cells. We identified a heterozygous mutation (M453R) in exon 10 of TSHR. In this family, this mutation was found in all individuals who exhibited hyperthyroidism. The results showed that this mutation resulted in constitutive activation of the Gs-adenylyl cyclase system. However, this mutation also caused a reduction in the activation capacity of the Gq/11-phospholipase C pathway, compared with the wild type. We demonstrate that the M453R mutation is the cause of nonautoimmune hyperthyroidism.

  11. A novel papillation assay for the identification of genes affecting mutation rate in Pseudomonas putida and other pseudomonads.

    PubMed

    Tagel, Mari; Tavita, Kairi; Hõrak, Rita; Kivisaar, Maia; Ilves, Heili

    2016-08-01

    Formation of microcolonies (papillae) permits easy visual screening of mutational events occurring in single colonies of bacteria. In this study, we have established a novel papillation assay employable in a wide range of pseudomonads including Pseudomonas aeruginosa and Pseudomonas putida for monitoring mutation frequency in distinct colonies. With the aid of this assay, we conducted a genome-wide search for the factors affecting mutation frequency in P. putida. Screening ∼27,000 transposon mutants for increased mutation frequency allowed us to identify 34 repeatedly targeted genes. In addition to genes involved in DNA replication and repair, we identified genes participating in metabolism and transport of secondary metabolites, cell motility, and cell wall synthesis. The highest effect on mutant frequency was observed when truA (tRNA pseudouridine synthase), mpl (UDP-N-acetylmuramate-alanine ligase) or gacS (multi-sensor hybrid histidine kinase) were inactivated. Inactivation of truA elevated the mutant frequency only in growing cells, while the deficiency of gacS affected mainly stationary-phase mutagenesis. Thus, our results demonstrate the feasibility of the assay for isolating mutants with elevated mutagenesis in growing as well as stationary-phase bacteria. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Disruption of SF3B1 results in deregulated expression and splicing of key genes and pathways in myelodysplastic syndrome hematopoietic stem and progenitor cells.

    PubMed

    Dolatshad, H; Pellagatti, A; Fernandez-Mercado, M; Yip, B H; Malcovati, L; Attwood, M; Przychodzen, B; Sahgal, N; Kanapin, A A; Lockstone, H; Scifo, L; Vandenberghe, P; Papaemmanuil, E; Smith, C W J; Campbell, P J; Ogawa, S; Maciejewski, J P; Cazzola, M; Savage, K I; Boultwood, J

    2015-05-01

    The splicing factor SF3B1 is the most commonly mutated gene in the myelodysplastic syndrome (MDS), particularly in patients with refractory anemia with ring sideroblasts (RARS). We investigated the functional effects of SF3B1 disruption in myeloid cell lines: SF3B1 knockdown resulted in growth inhibition, cell cycle arrest and impaired erythroid differentiation and deregulation of many genes and pathways, including cell cycle regulation and RNA processing. MDS is a disorder of the hematopoietic stem cell and we thus studied the transcriptome of CD34(+) cells from MDS patients with SF3B1 mutations using RNA sequencing. Genes significantly differentially expressed at the transcript and/or exon level in SF3B1 mutant compared with wild-type cases include genes that are involved in MDS pathogenesis (ASXL1 and CBL), iron homeostasis and mitochondrial metabolism (ALAS2, ABCB7 and SLC25A37) and RNA splicing/processing (PRPF8 and HNRNPD). Many genes regulated by a DNA damage-induced BRCA1-BCLAF1-SF3B1 protein complex showed differential expression/splicing in SF3B1 mutant cases. This is the first study to determine the target genes of SF3B1 mutation in MDS CD34(+) cells. Our data indicate that SF3B1 has a critical role in MDS by affecting the expression and splicing of genes involved in specific cellular processes/pathways, many of which are relevant to the known RARS pathophysiology, suggesting a causal link.

  13. Clonal status of actionable driver events and the timing of mutational processes in cancer evolution

    PubMed Central

    McGranahan, Nicholas; Favero, Francesco; de Bruin, Elza C.; Birkbak, Nicolai Juul; Szallasi, Zoltan; Swanton, Charles

    2015-01-01

    Deciphering whether actionable driver mutations are found in all or a subset of tumor cells will likely be required to improve drug development and precision medicine strategies. We analyzed nine cancer types to determine the subclonal frequencies of driver events, to time mutational processes during cancer evolution, and to identify drivers of subclonal expansions. Although mutations in known driver genes typically occurred early in cancer evolution, we also identified later subclonal “actionable” mutations, including BRAF(V600E), IDH1(R132H), PIK3CA(E545K), EGFR(L858R), and KRAS(G12D), which may compromise the efficacy of targeted therapy approaches. More than 20% of IDH1 mutations in glioblastomas, and 15% of mutations in genes in the PI3K(phosphatidylinositol 3-kinase)–AKT–mTOR (mammalian target of rapamycin) signaling axis across all tumor types were subclonal. Mutations in the RAS–MEK (mitogen-activated protein kinase kinase) signaling axis were less likely to be subclonal than mutations in genes associated with PI3K-AKT-mTORsignaling. Analysis of late mutations revealed a link between APOBEC-mediated mutagenesis and the acquisition of subclonal driver mutations and uncovered putative cancer genes involved in subclonal expansions, including CTNNA2 and ATXN1. Our results provide a pan-cancer census of driver events within the context of intratumor heterogeneity and reveal patterns of tumor evolution across cancers. The frequent presence of subclonal driver mutations suggests the need to stratify targeted therapy response according to the proportion of tumor cells in which the driver is identified. PMID:25877892

  14. Analysis of transcription factors key for mouse pancreatic development establishes NKX2-2 and MNX1 mutations as causes of neonatal diabetes in man.

    PubMed

    Flanagan, Sarah E; De Franco, Elisa; Lango Allen, Hana; Zerah, Michele; Abdul-Rasoul, Majedah M; Edge, Julie A; Stewart, Helen; Alamiri, Elham; Hussain, Khalid; Wallis, Sam; de Vries, Liat; Rubio-Cabezas, Oscar; Houghton, Jayne A L; Edghill, Emma L; Patch, Ann-Marie; Ellard, Sian; Hattersley, Andrew T

    2014-01-07

    Understanding transcriptional regulation of pancreatic development is required to advance current efforts in developing beta cell replacement therapies for patients with diabetes. Current knowledge of key transcriptional regulators has predominantly come from mouse studies, with rare, naturally occurring mutations establishing their relevance in man. This study used a combination of homozygosity analysis and Sanger sequencing in 37 consanguineous patients with permanent neonatal diabetes to search for homozygous mutations in 29 transcription factor genes important for murine pancreatic development. We identified homozygous mutations in 7 different genes in 11 unrelated patients and show that NKX2-2 and MNX1 are etiological genes for neonatal diabetes, thus confirming their key role in development of the human pancreas. The similar phenotype of the patients with recessive mutations and mice with inactivation of a transcription factor gene support there being common steps critical for pancreatic development and validate the use of rodent models for beta cell development. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Activity-dependent neuroprotective protein (ADNP): a case study for highly conserved chordata-specific genes shaping the brain and mutated in cancer.

    PubMed

    Gozes, Illana; Yeheskel, Adva; Pasmanik-Chor, Metsada

    2015-01-01

    The recent finding of activity-dependent neuroprotective protein (ADNP) as a protein decreased in serum of patients with Alzheimer's disease (AD) compared to controls, alongside with the discovery of ADNP mutations in autism and coupled with the original description of cancer mutations, ignited an interest for a comparative analysis of ADNP with other AD/autism/cancer-associated genes. We strive toward a better understanding of the molecular structure of key players in psychiatric/neurodegenerative diseases including autism, schizophrenia, and AD. This article includes data mining and bioinformatics analysis on the ADNP gene and protein, in addition to other related genes, with emphasis on recent literature. ADNP is discovered here as unique to chordata with specific autism mutations different from cancer-associated mutation. Furthermore, ADNP exhibits similarities to other cancer/autism-associated genes. We suggest that key genes, which shape and maintain our brain and are prone to mutations, are by in large unique to chordata. Furthermore, these brain-controlling genes, like ADNP, are linked to cell growth and differentiation, and under different stress conditions may mutate or exhibit expression changes leading to cancer propagation. Better understanding of these genes could lead to better therapeutics.

  16. Ddx18 is essential for cell-cycle progression in zebrafish hematopoietic cells and is mutated in human AML

    PubMed Central

    Bolli, Niccolò; Rhodes, Jennifer; Abdel-Wahab, Omar I.; Levine, Ross; Hedvat, Cyrus V.; Stone, Richard; Khanna-Gupta, Arati; Sun, Hong; Kanki, John P.; Gazda, Hanna T.; Beggs, Alan H.; Cotter, Finbarr E.

    2011-01-01

    In a zebrafish mutagenesis screen to identify genes essential for myelopoiesis, we identified an insertional allele hi1727, which disrupts the gene encoding RNA helicase dead-box 18 (Ddx18). Homozygous Ddx18 mutant embryos exhibit a profound loss of myeloid and erythroid cells along with cardiovascular abnormalities and reduced size. These mutants also display prominent apoptosis and a G1 cell-cycle arrest. Loss of p53, but not Bcl-xl overexpression, rescues myeloid cells to normal levels, suggesting that the hematopoietic defect is because of p53-dependent G1 cell-cycle arrest. We then sequenced primary samples from 262 patients with myeloid malignancies because genes essential for myelopoiesis are often mutated in human leukemias. We identified 4 nonsynonymous sequence variants (NSVs) of DDX18 in acute myeloid leukemia (AML) patient samples. RNA encoding wild-type DDX18 and 3 NSVs rescued the hematopoietic defect, indicating normal DDX18 activity. RNA encoding one mutation, DDX18-E76del, was unable to rescue hematopoiesis, and resulted in reduced myeloid cell numbers in ddx18hi1727/+ embryos, indicating this NSV likely functions as a dominant-negative allele. These studies demonstrate the use of the zebrafish as a robust in vivo system for assessing the function of genes mutated in AML, which will become increasingly important as more sequence variants are identified by next-generation resequencing technologies. PMID:21653321

  17. Hodgkin's disease biology: recent advances.

    PubMed

    Jox, A; Wolf, J; Diehl, V

    1997-11-01

    The cellular origin of H-RS cells has been questioned for a long time. Recently, using single cell amplification of Ig genes evidence was obtained that H-RS cells clonally arise from B-cells. Sequence analysis of rearranged Ig genes demonstrated that H-RS cells develop within the germinal centre. H-RS cells in classical HD grow despite loss of function of their rearranged Ig genes. In contrast, the mutation pattern of rearranged Ig genes in L & H cells of lymphocyte-predominant HD frequently shows ongoing mutations indicating that these cell are still antigen selected. These molecular differences show that LP HD genetically differs from classical HD. H-RS cells escape from apoptosis within the germinal centre. However, the events leading to malignant transformation are still unknown. The association between EBV and HD has been repeatedly described, but the occurrence of EBV negative cases is hard to explain just by loss of EBV. The analysis of chromosomal aberrations in H-RS cells did not result in the description of a specific 'HD-gene'. Also the role of the T-lymphocytes surrounding the H-RS cells has remained an open question.

  18. CRISPR-mediated genotypic and phenotypic correction of a chronic granulomatous disease mutation in human iPS cells

    PubMed Central

    Flynn, Rowan; Grundmann, Alexander; Renz, Peter; Hänseler, Walther; James, William S.; Cowley, Sally A.; Moore, Michael D.

    2015-01-01

    Chronic granulomatous disease (CGD) is a rare genetic disease characterized by severe and persistent childhood infections. It is caused by the lack of an antipathogen oxidative burst, normally performed by phagocytic cells to contain and clear bacterial and fungal growth. Restoration of immune function can be achieved with heterologous bone marrow transplantation; however, autologous bone marrow transplantation would be a preferable option. Thus, a method is required to recapitulate the function of the diseased gene within the patient's own cells. Gene therapy approaches for CGD have employed randomly integrating viruses with concomitant issues of insertional mutagenesis, inaccurate gene dosage, and gene silencing. Here, we explore the potential of the recently described clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9 site-specific nuclease system to encourage repair of the endogenous gene by enhancing the levels of homologous recombination. Using induced pluripotent stem cells derived from a CGD patient containing a single intronic mutation in the CYBB gene, we show that footprintless gene editing is a viable option to correct disease mutations. Gene correction results in restoration of oxidative burst function in iPS-derived phagocytes by reintroduction of a previously skipped exon in the cytochrome b-245 heavy chain (CYBB) protein. This study provides proof-of-principle for a gene therapy approach to CGD treatment using CRISPR-Cas9. PMID:26101162

  19. Splicing factor gene mutations in the myelodysplastic syndromes: impact on disease phenotype and therapeutic applications.

    PubMed

    Pellagatti, Andrea; Boultwood, Jacqueline

    2017-01-01

    Splicing factor gene mutations are the most frequent mutations found in patients with the myeloid malignancy myelodysplastic syndrome (MDS), suggesting that spliceosomal dysfunction plays a major role in disease pathogenesis. The aberrantly spliced target genes and deregulated cellular pathways associated with the commonly mutated splicing factor genes in MDS (SF3B1, SRSF2 and U2AF1) are being identified, illuminating the molecular mechanisms underlying MDS. Emerging data from mouse modeling studies indicate that the presence of splicing factor gene mutations can lead to bone marrow hematopoietic stem/myeloid progenitor cell expansion, impaired hematopoiesis and dysplastic differentiation that are hallmarks of MDS. Importantly, recent evidence suggests that spliceosome inhibitors and splicing modulators may have therapeutic value in the treatment of splicing factor mutant myeloid malignancies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Brooke-Spiegler syndrome presenting multiple concurrent cutaneous and parotid gland neoplasms: cytologic findings on fine-needle sample and description of a novel mutation of the CYLD gene.

    PubMed

    Malzone, Maria Gabriella; Campanile, Anna Cipolletta; Losito, Nunzia Simona; Longo, Francesco; Perri, Francesco; Caponigro, Francesco; Schiavone, Concetta; Ionna, Franco; Maiello, Francesco; Martinuzzi, Claudia; Nasti, Sabina; Botti, Gerardo; Fulciniti, Franco

    2015-08-01

    Multiple dermal cylindromas and membranous basal cell adenoma of parotid gland in a 67-year-old woman with Brooke-Spiegler syndrome (BSS) were examined by fine-needle cytology. Histology, immunochemistry, and CYLD germline mutation testing were also performed. Cytomorphology and immunochemistry of the two lesions showed basaloid neoplasms, remarkably similar, composed by proliferating epithelial cells of basal type accompanied by a smaller proportion of myoepithelial cells. CYLD gene showed a novel germline splice acceptor site mutation (c.2042-1G>C) with skipping of the entire exon 15. The occurrence of analogous tumors, dermal cylindromas, and membranous basal cell adenoma of the parotid gland, in the same patient may result from the action of a single gene on ontogenetically similar stem cells. Therefore, patients with BSS should be offered a genetic counselling for an early and correct diagnosis. © 2015 Wiley Periodicals, Inc.

  1. Multiple independent second-site mutations in two siblings with somatic mosaicism for Wiskott-Aldrich syndrome.

    PubMed

    Boztug, K; Germeshausen, M; Avedillo Díez, I; Gulacsy, V; Diestelhorst, J; Ballmaier, M; Welte, K; Maródi, L; Chernyshova, Li; Klein, C

    2008-07-01

    Wiskott-Aldrich syndrome (WAS) is an X-linked primary immunodeficiency disorder associated with microthrombocytopenia, eczema, autoimmunity and predisposition to malignant lymphoma. Although rare, few cases of somatic mosaicism have been published in WAS patients to date. We here report on two Ukrainian siblings who were referred to us at the age of 3 and 4 years, respectively. Both patients suffered from severe WAS caused by a nonsense mutation in exon 1 of the WAS gene. In both siblings, flow cytometric analysis revealed the presence of Wiskott-Aldrich syndrome protein (WASp)-positive and WASp-negative cell populations among T and B lymphocytes as well as natural killer (NK) cells. In contrast to previously described cases of revertant mosaicism in WAS, molecular analyses in both children showed that the WASp-positive T cells, B cells, and NK cells carried multiple different second-site mutations, resulting in different missense mutations. To our knowledge, this is the first report describing somatic mosaicism in WAS patients caused by several independent second-site mutations in the WAS gene.

  2. The effects of ryanodine receptor (RYR1) mutation on natural killer cell cytotoxicity, plasma cytokines and stress hormones during acute intermittent exercise in pigs.

    PubMed

    Ciepielewski, Z M; Stojek, W; Borman, A; Myślińska, D; Pałczyńska, P; Kamyczek, M

    2016-04-01

    Stress susceptibility has been mapped to a single recessive gene, the ryanodine receptor 1 (RYR1) gene or halothane (Hal) gene. Homozygous (Hal(nn)), mutated pigs are sensitive to halothane and susceptible to Porcine Stress Syndrome (PSS). Previous studies have shown that stress-susceptible RYR1 gene mutated homozygotes in response to restraint stress showed an increase in natural killer cell cytotoxicity (NKCC) accompanied by more pronounced stress-related hormone and anti-inflammatory cytokine changes. In order to determine the relationship of a RYR1 gene mutation with NKCC, plasma cytokines and stress-related hormones following a different stress model - exercise - 36 male pigs (representing different genotypes according to RYR1 gene mutation: NN, homozygous dominant; Nn, heterozygous; nn, homozygous recessive) were submitted to an intermittent treadmill walking. During the entire experiment the greatest level of NKCC and the greatest concentrations of interleukin (IL-) 6, IL-10, IL-12, interferon (IFN-)γ and tumor necrosis factor-α and stress-related hormones (adrenaline, prolactin, beta-endorphin) were observed in nn pigs, and the greatest concentration of IL-1 and growth hormone in NN pigs. Immunostimulatory effects of intermittent exercise on NKCC in nn pigs were concomitant with increases in IL-2, IL-12 and IFN-γ, the potent NKCC activators. Our findings suggest that stress-susceptible pigs RYR1 gene mutated pigs develop a greater level of NKCC and cytokine production in response to exercise stress. These results suggest that the heterogeneity of immunological and neuroendocrine response to exercise stress in pigs could be influenced by RYR1 gene mutation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Role of key-regulator genes in melanoma susceptibility and pathogenesis among patients from South Italy.

    PubMed

    Casula, Milena; Muggiano, Antonio; Cossu, Antonio; Budroni, Mario; Caracò, Corrado; Ascierto, Paolo A; Pagani, Elena; Stanganelli, Ignazio; Canzanella, Sergio; Sini, Mariacristina; Palomba, Grazia; Palmieri, Giuseppe

    2009-10-03

    Several genetic alterations have been demonstrated to contribute to the development and progression of melanoma. In this study, we further investigated the impact of key-regulator genes in susceptibility and pathogenesis of such a disease. A large series (N = 846) of sporadic and familial cases originating from South Italy was screened for germline mutations in p16(CDKN2A), BRCA2, and MC1R genes by DHPLC analysis and automated DNA sequencing. Paired primary melanomas and lymph node metastases from same patients (N = 35) as well as melanoma cell lines (N = 18) were analyzed for somatic mutations in NRAS, BRAF, and p16(CDKN2A) genes. For melanoma susceptibility, investigations at germline level indicated that p16(CDKN2A) was exclusively mutated in 16/545 (2.9%) non-Sardinian patients, whereas BRCA2 germline mutations were observed in 4/91 (4.4%) patients from North Sardinia only. Two MC1R germline variants, Arg151Cys and Asp294His, were significantly associated with melanoma in Sardinia. Regarding genetic events involved in melanoma pathogenesis at somatic level, mutually-exclusive mutations of NRAS and BRAF genes were observed at quite same rate (about two thirds) in cultured and in vivo melanomas (either primary or metastatic lesions). Conversely, p16(CDKN2A) gene alterations were observed at increased rates moving from primary to metastatic melanomas and melanoma cell lines. Activation of the ERK gene product was demonstrated to be consistently induced by a combination of molecular alterations (NRAS/BRAF mutations and p16(CDKN2A) silencing). Our findings further clarified that: a) mutation prevalence in melanoma susceptibility genes may vary within each specific geographical area; b) multiple molecular events are accumulating during melanomagenesis.

  4. A Gene Module-Based eQTL Analysis Prioritizing Disease Genes and Pathways in Kidney Cancer.

    PubMed

    Yang, Mary Qu; Li, Dan; Yang, William; Zhang, Yifan; Liu, Jun; Tong, Weida

    2017-01-01

    Clear cell renal cell carcinoma (ccRCC) is the most common and most aggressive form of renal cell cancer (RCC). The incidence of RCC has increased steadily in recent years. The pathogenesis of renal cell cancer remains poorly understood. Many of the tumor suppressor genes, oncogenes, and dysregulated pathways in ccRCC need to be revealed for improvement of the overall clinical outlook of the disease. Here, we developed a systems biology approach to prioritize the somatic mutated genes that lead to dysregulation of pathways in ccRCC. The method integrated multi-layer information to infer causative mutations and disease genes. First, we identified differential gene modules in ccRCC by coupling transcriptome and protein-protein interactions. Each of these modules consisted of interacting genes that were involved in similar biological processes and their combined expression alterations were significantly associated with disease type. Then, subsequent gene module-based eQTL analysis revealed somatic mutated genes that had driven the expression alterations of differential gene modules. Our study yielded a list of candidate disease genes, including several known ccRCC causative genes such as BAP1 and PBRM1 , as well as novel genes such as NOD2, RRM1, CSRNP1, SLC4A2, TTLL1 and CNTN1. The differential gene modules and their driver genes revealed by our study provided a new perspective for understanding the molecular mechanisms underlying the disease. Moreover, we validated the results in independent ccRCC patient datasets. Our study provided a new method for prioritizing disease genes and pathways.

  5. Workshop on Self-Determination in Developing and Evolving Systems

    DTIC Science & Technology

    1994-02-18

    processes of duplication (e.g. gene duplication, cell duplication, structural enlargement), responses to selfish DNA (e.g. suppression of outlaw...direct their development, then the genes would need some form of environmental feedback. Are there any plausible mechanisms for such feedback? 3. What is...evolutionary innovation, what is the contribution of random mutations, directed mutation, gene conversion, symbiogenesis, fusion, jumping genes or other

  6. HER2 activating mutations are targets for colorectal cancer treatment.

    PubMed

    Kavuri, Shyam M; Jain, Naveen; Galimi, Francesco; Cottino, Francesca; Leto, Simonetta M; Migliardi, Giorgia; Searleman, Adam C; Shen, Wei; Monsey, John; Trusolino, Livio; Jacobs, Samuel A; Bertotti, Andrea; Bose, Ron

    2015-08-01

    The Cancer Genome Atlas project identified HER2 somatic mutations and gene amplification in 7% of patients with colorectal cancer. Introduction of the HER2 mutations S310F, L755S, V777L, V842I, and L866M into colon epithelial cells increased signaling pathways and anchorage-independent cell growth, indicating that they are activating mutations. Introduction of these HER2 activating mutations into colorectal cancer cell lines produced resistance to cetuximab and panitumumab by sustaining MAPK phosphorylation. HER2 mutants are potently inhibited by low nanomolar doses of the irreversible tyrosine kinase inhibitors neratinib and afatinib. HER2 gene sequencing of 48 cetuximab-resistant, quadruple (KRAS, NRAS, BRAF, and PIK3CA) wild-type (WT) colorectal cancer patient-derived xenografts (PDX) identified 4 PDXs with HER2 mutations. HER2-targeted therapies were tested on two PDXs. Treatment with a single HER2-targeted drug (trastuzumab, neratinib, or lapatinib) delayed tumor growth, but dual HER2-targeted therapy with trastuzumab plus tyrosine kinase inhibitors produced regression of these HER2-mutated PDXs. HER2 activating mutations cause EGFR antibody resistance in colorectal cell lines, and PDXs with HER2 mutations show durable tumor regression when treated with dual HER2-targeted therapy. These data provide a strong preclinical rationale for clinical trials targeting HER2 activating mutations in metastatic colorectal cancer. ©2015 American Association for Cancer Research.

  7. Bilateral granulosa cell tumors: a novel malignant manifestation of multiple endocrine neoplasia 1 syndrome found in a patient with a rare menin in-frame deletion

    PubMed Central

    Hall, Michael J; Innocent, Julie; Rybak, Christina; Veloski, Colleen; Scott, Walter J; Wu, Hong; Ridge, John A; Hoffman, John P; Borghaei, Hossein; Turaka, Aruna; Daly, Mary B

    2015-01-01

    Introduction Multiple endocrine neoplasia 1 (MEN1) is a cancer syndrome resulting from mutations of the MEN1 gene. The syndrome is characterized by neoplasia of the parathyroid and pituitary glands, and malignant tumors of the endocrine pancreas. Other manifestations include benign lipomas, angiofibromas, and carcinoid tumors commonly originating in the colon, thymus, and lung. This is the first report of MEN1 syndrome manifesting as bilateral granulosa cell ovarian tumors, and which is associated with a rare intronic mutation of the MEN1 gene. Case report A 41-year-old woman presented with abdominal pain, increasing abdominal girth, and dysmenorrhea. Ultrasound demonstrated enlarged ovaries and uterine fibroids. After an exploratory laparotomy, she subsequently underwent bilateral salpingo–oophorectomy with hysterectomy where the pathology revealed bilateral cystic granulosa cell tumors of the ovaries. Additional workup including computed tomography imaging discovered a thymic mass, which the pathology showed was malignant, along with a pancreatic mass suspicious for a neuroendocrine tumor. Hyperparathyroidism was also discovered and was found to be secondary to a parathyroid adenoma. Genetic testing revealed an exceedingly rare mutation in the MEN1 gene (c.654 + 1 G>A). Discussion Mutations of the menin gene leading to MEN1 syndrome are classically nonsense or missense mutations producing a dysfunctional protein product. Recently, researchers described a novel mutation of MEN1 (c.654 + 1 G>A) in a male proband meeting the criteria for clinical MEN1 syndrome. Functional analysis performed on the stable mutant protein showed selective disruption of the transforming growth factor beta signaling pathway, yet it maintained its wild-type ability to inhibit nuclear factor kappa B and to suppress JunD transcriptional activity. Conclusion To our knowledge, this is the first report of MEN1 syndrome associated with bilateral granulosa cell malignancy. We postulate that this presentation may be due to the novel menin gene mutation recently described. PMID:25733923

  8. Pathways Impacted by Genomic Alterations in Pulmonary Carcinoid Tumors.

    PubMed

    Asiedu, Michael K; Thomas, Charles F; Dong, Jie; Schulte, Sandra C; Khadka, Prasidda; Sun, Zhifu; Kosari, Farhad; Jen, Jin; Molina, Julian; Vasmatzis, George; Kuang, Ray; Aubry, Marie Christine; Yang, Ping; Wigle, Dennis A

    2018-04-01

    Purpose: Pulmonary carcinoid tumors account for up to 5% of all lung malignancies in adults, comprise 30% of all carcinoid malignancies, and are defined histologically as typical carcinoid (TC) and atypical carcinoid (AC) tumors. The role of specific genomic alterations in the pathogenesis of pulmonary carcinoid tumors remains poorly understood. We sought to identify genomic alterations and pathways that are deregulated in these tumors to find novel therapeutic targets for pulmonary carcinoid tumors. Experimental Design: We performed integrated genomic analysis of carcinoid tumors comprising whole genome and exome sequencing, mRNA expression profiling and SNP genotyping of specimens from normal lung, TC and AC, and small cell lung carcinoma (SCLC) to fully represent the lung neuroendocrine tumor spectrum. Results: Analysis of sequencing data found recurrent mutations in cancer genes including ATP1A2, CNNM1, MACF1, RAB38, NF1, RAD51C, TAF1L, EPHB2, POLR3B , and AGFG1 The mutated genes are involved in biological processes including cellular metabolism, cell division cycle, cell death, apoptosis, and immune regulation. The top most significantly mutated genes were TMEM41B, DEFB127, WDYHV1, and TBPL1 Pathway analysis of significantly mutated and cancer driver genes implicated MAPK/ERK and amyloid beta precursor protein (APP) pathways whereas analysis of CNV and gene expression data suggested deregulation of the NF-κB and MAPK/ERK pathways. The mutation signature was predominantly C>T and T>C transitions with a minor contribution of T>G transversions. Conclusions: This study identified mutated genes affecting cancer relevant pathways and biological processes that could provide opportunities for developing targeted therapies for pulmonary carcinoid tumors. Clin Cancer Res; 24(7); 1691-704. ©2018 AACR . ©2018 American Association for Cancer Research.

  9. KRAS-G12C mutation is associated with poor outcome in surgically resected lung adenocarcinoma.

    PubMed

    Nadal, Ernest; Chen, Guoan; Prensner, John R; Shiratsuchi, Hiroe; Sam, Christine; Zhao, Lili; Kalemkerian, Gregory P; Brenner, Dean; Lin, Jules; Reddy, Rishindra M; Chang, Andrew C; Capellà, Gabriel; Cardenal, Felipe; Beer, David G; Ramnath, Nithya

    2014-10-01

    The aim of this study was to examine the effects of KRAS mutant subtypes on the outcome of patients with resected lung adenocarcinoma (AC). Using clinical and sequencing data, we identified 179 patients with resected lung AC for whom KRAS mutational status was determined. A multivariate Cox model was used to identify factors associated with disease-free survival (DFS) and overall survival (OS). Publicly available mutation and gene-expression data from lung cancer cell lines and lung AC were used to assess whether distinct KRAS mutant variants have a different profile. Patients with KRAS mutation had a significantly shorter DFS compared with those with KRAS wild-type (p = 0.009). Patients with KRAS-G12C mutant tumors had significantly shorter DFS compared with other KRAS mutants and KRAS wild-type tumors (p < 0.001). In the multivariate Cox model, KRAS-G12C remained as an independent prognostic marker for DFS (Hazard ratio = 2.46, 95% confidence interval 1.51-4.00, p < 0.001) and for OS (Hazard ratio = 2.35, 95% confidence interval 1.35-4.10, p = 0.003). No genes were statistically significant when comparing the mutational or transcriptional profile of lung cancer cell lines and lung AC harboring KRAS-G12C with other KRAS mutant subtypes. Gene set enrichment analysis revealed that KRAS-G12C mutants overexpressed epithelial to mesenchymal transition genes and expressed lower levels of genes predicting KRAS dependency. KRAS-G12C mutation is associated with worse DFS and OS in resected lung AC. Gene-expression profiles in lung cancer cell lines and surgically resected lung AC revealed that KRAS-G12C mutants had an epithelial to mesenchymal transition and a KRAS-independent phenotype.

  10. Control of cellular morphogenesis by the Ip12/Bem2 GTPase-activating protein: possible role of protein phosphorylation

    PubMed Central

    1994-01-01

    The IPL2 gene is known to be required for normal polarized cell growth in the budding yeast Saccharomyces cerevisiae. We now show that IPL2 is identical to the previously identified BEM2 gene. bem2 mutants are defective in bud site selection at 26 degrees C and localized cell surface growth and organization of the actin cytoskeleton at 37 degrees C. BEM2 encodes a protein with a COOH-terminal domain homologous to sequences found in several GTPase-activating proteins, including human Bcr. The GTPase-activating protein-domain from the Bem2 protein (Bem2p) or human Bcr can functionally substitute for Bem2p. The Rho1 and Rho2 GTPases are the likely in vivo targets of Bem2p because bem2 mutant phenotypes can be partially suppressed by increasing the gene dosage of RHO1 or RHO2. CDC55 encodes the putative regulatory B subunit of protein phosphatase 2A, and mutations in BEM2 have previously been identified as suppressors of the cdc55-1 mutation. We show here that mutations in the previously identified GRR1 gene can suppress bem2 mutations. grr1 and cdc55 mutants are both elongated in shape and cold- sensitive for growth, and cells lacking both GRR1 and CDC55 exhibit a synthetic lethal phenotype. bem2 mutant phenotypes also can be suppressed by the SSD1-vl (also known as SRK1) mutation, which was shown previously to suppress mutations in the protein phosphatase- encoding SIT4 gene. Cells lacking both BEM2 and SIT4 exhibit a synthetic lethal phenotype even in the presence of the SSD1-v1 suppressor. These genetic interactions together suggest that protein phosphorylation and dephosphorylation play an important role in the BEM2-mediated process of polarized cell growth. PMID:7962097

  11. Control of cellular morphogenesis by the Ip12/Bem2 GTPase-activating protein: possible role of protein phosphorylation.

    PubMed

    Kim, Y J; Francisco, L; Chen, G C; Marcotte, E; Chan, C S

    1994-12-01

    The IPL2 gene is known to be required for normal polarized cell growth in the budding yeast Saccharomyces cerevisiae. We now show that IPL2 is identical to the previously identified BEM2 gene. bem2 mutants are defective in bud site selection at 26 degrees C and localized cell surface growth and organization of the actin cytoskeleton at 37 degrees C. BEM2 encodes a protein with a COOH-terminal domain homologous to sequences found in several GTPase-activating proteins, including human Bcr. The GTPase-activating protein-domain from the Bem2 protein (Bem2p) or human Bcr can functionally substitute for Bem2p. The Rho1 and Rho2 GTPases are the likely in vivo targets of Bem2p because bem2 mutant phenotypes can be partially suppressed by increasing the gene dosage of RHO1 or RHO2. CDC55 encodes the putative regulatory B subunit of protein phosphatase 2A, and mutations in BEM2 have previously been identified as suppressors of the cdc55-1 mutation. We show here that mutations in the previously identified GRR1 gene can suppress bem2 mutations. grr1 and cdc55 mutants are both elongated in shape and cold-sensitive for growth, and cells lacking both GRR1 and CDC55 exhibit a synthetic lethal phenotype. bem2 mutant phenotypes also can be suppressed by the SSD1-vl (also known as SRK1) mutation, which was shown previously to suppress mutations in the protein phosphatase-encoding SIT4 gene. Cells lacking both BEM2 and SIT4 exhibit a synthetic lethal phenotype even in the presence of the SSD1-v1 suppressor. These genetic interactions together suggest that protein phosphorylation and dephosphorylation play an important role in the BEM2-mediated process of polarized cell growth.

  12. Role of the mismatch repair gene, Msh6, in suppressing genome instability and radiation-induced mutations

    PubMed Central

    Barrera-Oro, Julio; Liu, Tzu-Yang; Gorden, Erin; Kucherlapati, Raju; Shao, Changshun; Tischfield, Jay A

    2008-01-01

    Mismatch repair (MMR) is critical for preserving genomic integrity. Failure of this system can accelerate somatic mutation and increase the risk of developing cancer. MSH6, in complex with MSH2, is the MMR protein that mediates DNA repair through the recognition of 1- and 2-bp mismatches. To evaluate the effects of MSH6 deficiency on genomic stability we compared the frequency of in vivo loss of heterozygosity (LOH) between MSH6-proficient and deficient, 129S2 x C57BL/6 F1 hybrid mice that were heterozygous for our reporter gene Aprt. We recovered mutant cells that had functionally lost APRT protein activity and categorized the spectrum of mutations responsible for the LOH events. We also measured the mutant frequency at the X-linked gene, Hprt, as a second reporter for point mutation. In Msh6−/−Aprt+/− mice, mutation frequency at Aprt was elevated in both T cells and fibroblasts by 2.5-fold and 5.7-fold, respectively, over Msh6+/+Aprt+/− littermate controls. While a modest increase in mitotic recombination (MR) was observed in MSH6-deficient fibroblasts compared to wild type controls, point mutation was the predominant mechanism leading to APRT deficiency in both cell types. Base substitution, consisting of multiple types of transitions, accounted for all of the point mutations identified within the Aprt coding region. We also assessed the role of MSH6 in preventing mutations caused by a common environmental mutagen, ionizing radiation (IR). In Msh6−/−Aprt+/− mice, 4 Gy of X-irradiation induced a significant increase in point mutations at both Aprt and Hprt in T cells, but not in fibroblasts. These findings indicate that MutSα reduces spontaneous and IR-induced mutation in a cell-type dependant manner. PMID:18538799

  13. Molecular Pathology of Anaplastic Thyroid Carcinomas: A Retrospective Study of 144 Cases.

    PubMed

    Bonhomme, Benjamin; Godbert, Yann; Perot, Gaelle; Al Ghuzlan, Abir; Bardet, Stéphane; Belleannée, Geneviève; Crinière, Lise; Do Cao, Christine; Fouilloux, Geneviève; Guyetant, Serge; Kelly, Antony; Leboulleux, Sophie; Buffet, Camille; Leteurtre, Emmanuelle; Michels, Jean-Jacques; Tissier, Frédérique; Toubert, Marie-Elisabeth; Wassef, Michel; Pinard, Clémence; Hostein, Isabelle; Soubeyran, Isabelle

    2017-05-01

    Anaplastic thyroid carcinoma (ATC) is a rare tumor, with poorly defined oncogenic molecular mechanisms and limited therapeutic options contributing to its poor prognosis. The aims of this retrospective study were to determine the frequency of anaplastic lymphoma kinase (ALK) translocations and to identify the mutational profile of ATC including TERT promoter mutations. One hundred and forty-four ATC cases were collected from 10 centers that are a part of the national French network for management of refractory thyroid tumors. Fluorescence in situ hybridization analysis for ALK rearrangement was performed on tissue microarrays. A panel of 50 genes using next-generation sequencing and TERT promoter mutations using Sanger sequencing were also screened. Fluorescence in situ hybridization was interpretable for 90 (62.5%) cases. One (1.1%) case was positive for an ALK rearrangement with a borderline threshold (15% positive cells). Next-generation sequencing results were interpretable for 94 (65.3%) cases, and Sanger sequencing (TERT) for 98 (68.1%) cases. A total of 210 mutations (intronic and exonic) were identified. TP53 alterations were the most frequent (54.4%). Forty-three percent harbored a mutation in the (H-K-N)RAS genes, 13.8% a mutation in the BRAF gene (essentially p.V600E), 17% a PI3K-AKT pathway mutation, 6.4% both RAS and PI3K pathway mutations, and 4.3% both TP53 and PTEN mutations. Nearly 10% of the cases showed no mutations of the RAS, PI3K-AKT pathways, or TP53, with mutations of ALK, ATM, APC, CDKN2A, ERBB2, RET, or SMAD4, including mutations not yet described in thyroid tumors. Genes encoding potentially druggable targets included: mutations in the ATM gene in four (4.3%) cases, in ERBB2 in one (1.1%) case, in MET in one (1.1%) case, and in ALK in one (1.1%) case. A TERT promoter alteration was found in 53 (54.0%) cases, including 43 C228T and 10 C250T mutations. Three out of our cases did not harbor mutations in the panel of genes with therapeutic interest. This study confirms that ALK rearrangements in ATC are rare and that the mutational landscape of ATC is heterogeneous, with many genes implicated in the follicular epithelial cell dedifferentiation process. This may explain the limited effectiveness of targeted therapeutic options tested so far.

  14. Mutations in XLF/NHEJ1/Cernunnos gene results in downregulation of telomerase genes expression and telomere shortening.

    PubMed

    Carrillo, Jaime; Calvete, Oriol; Pintado-Berninches, Laura; Manguan-García, Cristina; Sevilla Navarro, Julian; Arias-Salgado, Elena G; Sastre, Leandro; Guenechea, Guillermo; López Granados, Eduardo; de Villartay, Jean-Pierre; Revy, Patrick; Benitez, Javier; Perona, Rosario

    2017-05-15

    NHEJ1-patients develop severe progressive lymphocytopenia and premature aging of hematopoietic stem cells (HSCs) at a young age. Here we show a patient with a homozygous-NHEJ1 mutation identified by whole exome-sequencing that developed severe pancytopenia and bone marrow aplasia correlating with the presence of short telomeres. The mutation resulted in a truncated protein. In an attempt to identify the mechanism behind the short telomere phenotype found in the NHEJ1-patient we downregulated NHEJ1 expression in 293T and CD34+cells. This downregulation resulted in reduced telomerase activity and decreased expression of several telomerase/shelterin genes. Interestingly, cell lines derived from two other NHEJ1-deficient patients with different mutations also showed increased p21 expression, inhibition in expression of several telomerase complex genes and shortened telomeres. Decrease in expression of telomerase/shelterin genes did not occur when we inhibited expression of other NHEJ genes mutated in SCID patients: DNA-PK, Artemis or LigaseIV. Because premature aging of HSCs is observed only in NHEJ1 patients, we propose that is the result of senescence induced by decreased expression of telomerase/shelterin genes that lead to an inhibition of telomerase activity. Previous reports failed to find this connection because of the use of patient´s cells immortalized by TERT expression or recombined telomeres by ALT pathway. In summary, defective regulation of telomere biology together with defective V(D)J recombination can negatively impact on the evolution of the disease in these patients. Identification of telomere shortening is important since it may open new therapeutic interventions for these patients by treatments aimed to recover the expression of telomerase genes. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. A Gene Gravity Model for the Evolution of Cancer Genomes: A Study of 3,000 Cancer Genomes across 9 Cancer Types.

    PubMed

    Cheng, Feixiong; Liu, Chuang; Lin, Chen-Ching; Zhao, Junfei; Jia, Peilin; Li, Wen-Hsiung; Zhao, Zhongming

    2015-09-01

    Cancer development and progression result from somatic evolution by an accumulation of genomic alterations. The effects of those alterations on the fitness of somatic cells lead to evolutionary adaptations such as increased cell proliferation, angiogenesis, and altered anticancer drug responses. However, there are few general mathematical models to quantitatively examine how perturbations of a single gene shape subsequent evolution of the cancer genome. In this study, we proposed the gene gravity model to study the evolution of cancer genomes by incorporating the genome-wide transcription and somatic mutation profiles of ~3,000 tumors across 9 cancer types from The Cancer Genome Atlas into a broad gene network. We found that somatic mutations of a cancer driver gene may drive cancer genome evolution by inducing mutations in other genes. This functional consequence is often generated by the combined effect of genetic and epigenetic (e.g., chromatin regulation) alterations. By quantifying cancer genome evolution using the gene gravity model, we identified six putative cancer genes (AHNAK, COL11A1, DDX3X, FAT4, STAG2, and SYNE1). The tumor genomes harboring the nonsynonymous somatic mutations in these genes had a higher mutation density at the genome level compared to the wild-type groups. Furthermore, we provided statistical evidence that hypermutation of cancer driver genes on inactive X chromosomes is a general feature in female cancer genomes. In summary, this study sheds light on the functional consequences and evolutionary characteristics of somatic mutations during tumorigenesis by propelling adaptive cancer genome evolution, which would provide new perspectives for cancer research and therapeutics.

  16. A Gene Gravity Model for the Evolution of Cancer Genomes: A Study of 3,000 Cancer Genomes across 9 Cancer Types

    PubMed Central

    Lin, Chen-Ching; Zhao, Junfei; Jia, Peilin; Li, Wen-Hsiung; Zhao, Zhongming

    2015-01-01

    Cancer development and progression result from somatic evolution by an accumulation of genomic alterations. The effects of those alterations on the fitness of somatic cells lead to evolutionary adaptations such as increased cell proliferation, angiogenesis, and altered anticancer drug responses. However, there are few general mathematical models to quantitatively examine how perturbations of a single gene shape subsequent evolution of the cancer genome. In this study, we proposed the gene gravity model to study the evolution of cancer genomes by incorporating the genome-wide transcription and somatic mutation profiles of ~3,000 tumors across 9 cancer types from The Cancer Genome Atlas into a broad gene network. We found that somatic mutations of a cancer driver gene may drive cancer genome evolution by inducing mutations in other genes. This functional consequence is often generated by the combined effect of genetic and epigenetic (e.g., chromatin regulation) alterations. By quantifying cancer genome evolution using the gene gravity model, we identified six putative cancer genes (AHNAK, COL11A1, DDX3X, FAT4, STAG2, and SYNE1). The tumor genomes harboring the nonsynonymous somatic mutations in these genes had a higher mutation density at the genome level compared to the wild-type groups. Furthermore, we provided statistical evidence that hypermutation of cancer driver genes on inactive X chromosomes is a general feature in female cancer genomes. In summary, this study sheds light on the functional consequences and evolutionary characteristics of somatic mutations during tumorigenesis by propelling adaptive cancer genome evolution, which would provide new perspectives for cancer research and therapeutics. PMID:26352260

  17. Bone Marrow Transplantation in Mice as a Tool to Generate Genetically Modified Animals

    NASA Astrophysics Data System (ADS)

    Rőszer, Tamás; Pintye, Éva; Benkő, Ilona

    2008-12-01

    Transgenic mice can be used either as models of known inherited human diseases or can be applied to perform phenotypic tests of genes with unknown function. In some special applications of gene modification we have to create a tissue specific mutation of a given gene. In some cases however the gene modification can be lethal in the intrauterine life, therefore we should engraft the mutated cells in the postnatal life period. After total body irradiation transplantation of bone marrow cells can be a solution to introduce mutant hematopoietic stem cells into a mature animal. Bone marrow transplantation is a useful and novel tool to study the role of hematopoietic cells in the pathogenesis of inflammation, autoimmune syndromes and many metabolic alterations coupled recently to leukocyte functions.

  18. Poly ADP-ribose polymerase-1 as a potential therapeutic target in Merkel cell carcinoma.

    PubMed

    Ferrarotto, Renata; Cardnell, Robert; Su, Shirley; Diao, Lixia; Eterovic, A Karina; Prieto, Victor; Morrisson, William H; Wang, Jing; Kies, Merrill S; Glisson, Bonnie S; Byers, Lauren Averett; Bell, Diana

    2018-03-23

    Patients with metastatic Merkel cell carcinoma are treated similarly to small cell lung cancer (SCLC). Poly ADP-ribose polymerase-1 (PARP1) is overexpressed in SCLC and response to PARP inhibitors have been reported in patients with SCLC. Our study explores PARP as a therapeutic target in Merkel cell carcinoma. We evaluated PARP1 expression and Merkel cell polyomavirus (MCPyV) in 19 patients with Merkel cell carcinoma. Target exome-sequencing was performed in 14 samples. Sensitivity to olaparib was tested in 4 Merkel cell carcinoma cell lines. Most Merkel cell carcinomas (74%) express PARP1 at high levels. Mutations in DNA-damage repair genes were identified in 9 samples (64%), occurred exclusively in head neck primaries, and correlated with TP53/RB1 mutations. The TP53/RB1 mutations were more frequent in MCPyV-negative tumors. Sensitivity to olaparib was seen in the Merkel cell carcinoma line with highest PARP1 expression. Based on PARP1 overexpression, DNA-damage repair gene mutations, platinum sensitivity, and activity of olaparib in a Merkel cell carcinoma line, clinical trials with PARP inhibitors are warranted in Merkel cell carcinoma. © 2018 Wiley Periodicals, Inc.

  19. EFFECTS OF THE ANTIMUTAGENS VANILLIN AND CINNAMALDEHYDE ON SPONTANEOUS MUTATION IN E. COLI LACL STRAINS AND ON GLOBAL GENE EXPRESSION IN SALMONELLA TA104 AND HUMAN HEPG2 CELLS

    EPA Science Inventory

    Effects of the Antimutagens Vanillin and Cinnamaldehyde on Spontaneous Mutation in E. coli lacI Strains and on Global Gene Epression in Salmonella TAlO4 and Human HepG2 Cells

    In previous work we have shown that vanillin (VAN) and cinnamaldehyde (CIN) are dietary antimutag...

  20. Mutational Analysis of Cell Types in Tuberous Sclerosis Complex (TSC)

    DTIC Science & Technology

    2009-01-01

    from mutations in the TSC1 or TSC2 genes that is associated with epilepsy, cognitive disability, and autism . TSC1/TSC2 gene mutations lead to...gene inactivation and leads to activation of the mTOR cascade as evidenced by phosphorylation of ribosomal S6 protein (P-S6). We demonstrate that...phosphorylation of the ribosomal S6 protein (phospho-S6 or P-S6), a marker for enhanced mTOR signaling. We find P-S6 expression in cortex as well as

  1. Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer.

    PubMed

    van Haaften, Gijs; Dalgliesh, Gillian L; Davies, Helen; Chen, Lina; Bignell, Graham; Greenman, Chris; Edkins, Sarah; Hardy, Claire; O'Meara, Sarah; Teague, Jon; Butler, Adam; Hinton, Jonathan; Latimer, Calli; Andrews, Jenny; Barthorpe, Syd; Beare, Dave; Buck, Gemma; Campbell, Peter J; Cole, Jennifer; Forbes, Simon; Jia, Mingming; Jones, David; Kok, Chai Yin; Leroy, Catherine; Lin, Meng-Lay; McBride, David J; Maddison, Mark; Maquire, Simon; McLay, Kirsten; Menzies, Andrew; Mironenko, Tatiana; Mulderrig, Lee; Mudie, Laura; Pleasance, Erin; Shepherd, Rebecca; Smith, Raffaella; Stebbings, Lucy; Stephens, Philip; Tang, Gurpreet; Tarpey, Patrick S; Turner, Rachel; Turrell, Kelly; Varian, Jennifer; West, Sofie; Widaa, Sara; Wray, Paul; Collins, V Peter; Ichimura, Koichi; Law, Simon; Wong, John; Yuen, Siu Tsan; Leung, Suet Yi; Tonon, Giovanni; DePinho, Ronald A; Tai, Yu-Tzu; Anderson, Kenneth C; Kahnoski, Richard J; Massie, Aaron; Khoo, Sok Kean; Teh, Bin Tean; Stratton, Michael R; Futreal, P Andrew

    2009-05-01

    Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase gene UTX, pointing to histone H3 lysine methylation deregulation in multiple tumor types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene.

  2. Novel Gardos channel mutations linked to dehydrated hereditary stomatocytosis (xerocytosis).

    PubMed

    Andolfo, Immacolata; Russo, Roberta; Manna, Francesco; Shmukler, Boris E; Gambale, Antonella; Vitiello, Giuseppina; De Rosa, Gianluca; Brugnara, Carlo; Alper, Seth L; Snyder, L Michael; Iolascon, Achille

    2015-10-01

    Dehydrated hereditary stomatocytosis (DHSt) is an autosomal dominant congenital hemolytic anemia with moderate splenomegaly and often compensated hemolysis. Affected red cells are characterized by a nonspecific cation leak of the red cell membrane, reflected in elevated sodium content, decreased potassium content, elevated MCHC and MCV, and decreased osmotic fragility. The majority of symptomatic DHSt cases reported to date have been associated with gain-of-function mutations in the mechanosensitive cation channel gene, PIEZO1. A recent study has identified two families with DHSt associated with a single mutation in the KCNN4 gene encoding the Gardos channel (KCa3.1), the erythroid Ca(2+) -sensitive K(+) channel of intermediate conductance, also expressed in many other cell types. We present here, in the second report of DHSt associated with KCNN4 mutations, two previously undiagnosed DHSt families. Family NA exhibited the same de novo missense mutation as that recently described, suggesting a hot spot codon for DHSt mutations. Family WO carried a novel, inherited missense mutation in the ion transport domain of the channel. The patients' mild hemolytic anemia did not improve post-splenectomy, but splenectomy led to no serious thromboembolic events. We further characterized the expression of KCNN4 in the mutated patients and during erythroid differentiation of CD34+ cells and K562 cells. We also analyzed KCNN4 expression during mouse embryonic development. © 2015 Wiley Periodicals, Inc.

  3. Evidence for constitutional mutations in patients with multiple BCCs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bonifas, J.M.; Leyden, W.A.; Epstein, E.H. Jr.

    Basal cell nevus syndrome (BCNS) is an autosomal dominant disease, one of whose prominent phenotypic features is a large number of cutaneous basal cell carcinomas. The gene whose mutation underlies this disease has been mapped to chromosome 9q22.3-q31, and basal cell carcinomas frequently have allelic losses at this area. We have reported recently that the chromosome 9q22.3-q31 alleles lost in 57% (24/42) of basal cell carcinomas from BCNS patients were those alleles predicted by linkage to contain the wild type gene, as is expected for a tumor suppressor gene. We have extended this work to patients with multiple basal cellmore » carcinomas with no other phenotypic manifestations of BCNS. We found in two individuals that 88% (30 out of 34) had loss of heterozygosity (LOH) in this region. Surprisingly, in both patients the allele lost in tumors was not random; it was the same in 29/30 tumors (19 form one patient and 10 from the other). This suggests that constitutional mutations in the BCNS gene region may underlie skin carcinomas in patients without BCNS. The mutations may have been somatic, because neither of one patient`s two adult sons have BCCs even though they have inherited different copies of his 9q.« less

  4. Progressive glomerular and tubular damage in sickle cell trait and sickle cell anemia mouse models.

    PubMed

    Saraf, Santosh L; Sysol, Justin R; Susma, Alexandru; Setty, Suman; Zhang, Xu; Gudehithlu, Krishnamurthy P; Arruda, Jose A L; Singh, Ashok K; Machado, Roberto F; Gordeuk, Victor R

    2018-02-02

    Homozygosity for the hemoglobin (Hb) S mutation (HbSS, sickle cell anemia) results in hemoglobin polymerization under hypoxic conditions leading to vaso-occlusion and hemolysis. Sickle cell anemia affects 1:500 African Americans and is a strong risk factor for kidney disease, although the mechanisms are not well understood. Heterozygous inheritance (HbAS; sickle cell trait) affects 1:10 African Americans and is associated with an increased risk for kidney disease in some reports. Using transgenic sickle mice, we investigated the histopathologic, ultrastructural, and gene expression differences with the HbS mutation. Consistent with progressive glomerular damage, we observed progressively greater urine protein concentrations (P = 0.03), glomerular hypertrophy (P = 0.002), and glomerular cellularity (P = 0.01) in HbAA, HbAS, and HbSS mice, respectively. Ultrastructural studies demonstrated progressive podocyte foot process effacement, glomerular basement membrane thickening with reduplication, and tubular villous atrophy with the HbS mutation. Gene expression studies highlighted the differential expression of several genes involved in prostaglandin metabolism (AKR1C18), heme and iron metabolism (HbA-A2, HMOX1, SCL25A37), electrolyte balance (SLC4A1, AQP6), immunity (RSAD2, C3, UBE2O), fatty acid metabolism (FASN), hypoxia hall-mark genes (GCK, SDC3, VEGFA, ETS1, CP, BCL2), as well as genes implicated in other forms of kidney disease (PODXL, ELMO1, FRMD3, MYH9, APOA1). Pathway analysis highlighted increased gene enrichment in focal adhesion, extracellular matrix-receptor interaction, and axon guidance pathways. In summary, using transgenic sickle mice, we observed that inheritance of the HbS mutation is associated with glomerular and tubular damage and identified several candidate genes and pathways for future investigation in sickle cell trait and sickle cell anemia-related kidney disease. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Mutational profiles of Brenner tumors show distinctive features uncoupling urothelial carcinomas and ovarian carcinoma with transitional cell histology.

    PubMed

    Pfarr, Nicole; Darb-Esfahani, Silvia; Leichsenring, Jonas; Taube, Eliane; Boxberg, Melanie; Braicu, Ioana; Jesinghaus, Moritz; Penzel, Roland; Endris, Volker; Noske, Aurelia; Weichert, Wilko; Schirmacher, Peter; Denkert, Carsten; Stenzinger, Albrecht

    2017-10-01

    Brenner tumors (BT) are rare ovarian tumors encompassing benign, borderline, and malignant variants. While the histopathology of BTs and their clinical course is well described, little is known about the underlying genetic defects. We employed targeted next generation sequencing to analyze the mutational landscape in a cohort of 23 BT cases (17 benign, 2 borderline, and 4 malignant) and 3 ovarian carcinomas with transitional cell histology (TCC). Copy number variations (CNV) were validated by fluorescence in-situ hybridization (FISH) and quantitative PCR-based copy number assays. Additionally, we analyzed the TERT promotor region by conventional Sanger sequencing. We identified 25 different point mutations in 23 of the analyzed genes in BTs and 10 mutations in 8 genes in TCCs. About 57% percent of mutations occurred in genes involved in cell cycle control, DNA repair, and epigenetic regulation processes. All TCC cases harbored TP53 mutations whereas all BTs were negative and none of the mutations observed in BTs were present in TCCs. CNV analysis revealed recurrent MDM2 amplifications in 3 out of 4 of the malignant BT cases with one case harboring a concomitant amplification of CCND1. No mutations were observed in the TERT promoter region in BTs and TCCs, which is mutated in about 50%-75% of urothelial carcinoma and in 16% of ovarian clear-cell carcinomas. In conclusion, our study highlights distinct genetic features of BTs, and detection of the triplet phenotype MDM2 amplification/TP53 wt/TERT wt may aid diagnosis of malignant BT in difficult cases. Moreover, selected genetic lesions may be clinically exploitable in a metastatic setting. © 2017 Wiley Periodicals, Inc.

  6. Surgery Branch recruiting patients to study new treatment for cancers with RAS mutations | Center for Cancer Research

    Cancer.gov

    RAS is a family of proteins that send signals to genes involved in cell growth and is mutated in approximately a quarter of all human cancers. James Yang, M.D., of the Surgery Branch is leading a team of investigators who have generated a special T-cell receptor from mouse cells that can recognize a mutation of RAS that is found in many human cancer cells. The goal is to

  7. Dominant suppressor mutation bypasses the sphingolipid requirement for growth of Saccharomyces cells at low pH: role of the CWP2 gene.

    PubMed

    Skrzypek, M; Lester, R L; Spielmann, P; Zingg, N; Shelling, J; Dickson, R C

    2000-11-01

    Strains of Saccharomyces cerevisiae termed sphingolipid compensatory (SLC) do not grow at low pH when the cells lack sphingolipids. To begin to understand why sphingolipids are required for growth at low pH, we isolated derivatives of SLC strains, termed low pH resistant (LprR), carrying the LPR suppressor gene that allows growth at pH 4.1 when cells lack sphingolipids. Suppression is due to mutation of a single nuclear gene. The LPR suppressor gene functions, at least in part, by enhancing the ability of cells lacking sphingolipids to generate a net efflux of protons in suspension fluid with a pH range of 4.0-6.0. The LPR suppressor gene also enables cells lacking sphingolipids to maintain their intracellular pH near neutrality when the pH of the suspension fluid is low, unlike cells lacking the suppressor gene, which cannot maintain their intracellular pH in the face of a low external pH. These results demonstrate that some functions(s) of sphingolipids necessary for growth at low pH can be bypassed by a suppressor mutation. Attempts to clone the LPR suppressor gene were not successful, but they led to the isolation of the CWP2 gene, which encodes a major mannoprotein component of the outer cell wall. It was isolated because an increased copy number has the unusual property of increasing the frequency at which LprR strains arise. As we show here, part of the reason for this effect is that the CWP2 gene is essential for generating a net efflux of protons and for controlling intracellular pH in LprR strains that lack sphingolipids. These results suggest new cellular functions for the Cwp2 protein.

  8. [The absence of cyclin-dependent protein kinase Pho85 affects stability of mitochondrial DNA in yeast Saccharomyces cerevisiae].

    PubMed

    Fizikova, A Iu; Padkina, M V; Sambuk, E V

    2009-06-01

    The cyclin-dependent protein kinase Pho85 is involved in the regulation of phosphate metabolism in yeast Saccharomyces cerevisiae. Mutations in the PH085 gene lead to constitutive synthesis of Pho5 acidic phosphatase, a delay in cell growth on media containing nonfermentable carbon sources, and other pleiotropic effects. In this work, it was shown that the accumulation of respiratory incompetent cells occurs with high frequency in strains carrying pho85 mutations as early as during the first cell divisions, and the number of these cells at the early logarithmic growth phase of the culture promptly reaches virtually 100%. Cytological analysis revealed a high accumulation rate of [rho(0)] cells the background of gene pho85 that may be related to disturbances in the distribution of mitochondrial nucleoids rather than to changes in morphology of mitochondria and a delay in their transport into the bud. Genetic analysis revealed that the appearing secondary mutations pho4, pho81, pho84, and pho87 stabilize nucleoids and hamper the loss of mitochondrial DNA caused by pho85. These results provide evidence for the influence of intracellular phosphate concentration on the inheritance of mitochondrial nucleoids, but it is fully probable that the occurrence of mutation pho4 in the background of gene pho85 may change the expression level of other genes required for the stabilization of mitochondrial functions.

  9. Activation of the NRF2 pathway and its impact on the prognosis of anaplastic glioma patients

    PubMed Central

    Kanamori, Masayuki; Higa, Tsuyoshi; Sonoda, Yukihiko; Murakami, Shohei; Dodo, Mina; Kitamura, Hiroshi; Taguchi, Keiko; Shibata, Tatsuhiro; Watanabe, Mika; Suzuki, Hiroyoshi; Shibahara, Ichiyo; Saito, Ryuta; Yamashita, Yoji; Kumabe, Toshihiro; Yamamoto, Masayuki; Motohashi, Hozumi; Tominaga, Teiji

    2015-01-01

    Background Nuclear factor erythroid 2–related factor 2 (NRF2) plays pivotal roles in cytoprotection. We aimed at clarifying the contribution of the NRF2 pathway to malignant glioma pathology. Methods NRF2 target gene expression and its association with prognosis were examined in 95 anaplastic gliomas with or without isocitrate dehydrogenase (IDH) 1/2 gene mutations and 52 glioblastomas. To explore mechanisms for the altered activity of the NRF2 pathway, we examined somatic mutations and expressions of the NRF2 gene and those encoding NRF2 regulators, Kelch-like ECH-associated protein 1 (KEAP1) and p62/SQSTSM. To clarify the functional interaction between IDH1 mutations and the NRF2 pathway, we introduced a mutant IDH1 to T98 glioblastoma-derived cells and examined the NRF2 activity in these cells. Results NRF2 target genes were elevated in 13.7% and 32.7% of anaplastic gliomas and glioblastomas, respectively. Upregulation of NRF2 target genes correlated with poor prognosis in anaplastic gliomas but not in glioblastomas. Neither somatic mutations of NRF2/KEAP1 nor dysregulated expression of KEAP1/p62 explained the increased expression of NRF2 target genes. In most cases of anaplastic glioma with mutated IDH1/2, NRF2 and its target genes were downregulated. This was reproducible in IDH1 R132H–expressing T98 cells. In minor cases of IDH1/2-mutant anaplastic gliomas with increased expression of NRF2 target genes, the clinical outcomes were significantly poor. Conclusions The NRF2 activity is increased in a significant proportion of malignant gliomas in general but decreased in the majority of IDH1/2-mutant anaplastic gliomas. It is plausible that the NRF2 pathway plays an important role in tumor progression of anaplastic gliomas with IDH1/2 mutations. PMID:25304134

  10. miR-2909-mediated regulation of KLF4: a novel molecular mechanism for differentiating between B-cell and T-cell pediatric acute lymphoblastic leukemias

    PubMed Central

    2014-01-01

    Background microRNAs (miRNAs) play both oncogenic and oncostatic roles in leukemia. However, the molecular details underlying miRNA-mediated regulation of their target genes in pediatric B- and T-cell acute lymphoblastic leukemias (ALLs) remain unclear. The present study investigated the relationship between miR-2909 and Kruppel-like factor 4 (KLF4), and its functional relevance to cell cycle progression and immortalization in patients with pediatric ALL. Methods Elevated levels of miR-2909 targeted the tumor suppressor gene KLF4 in pediatric B-cell, but not pediatric T-cell ALL, as detected by pMIR-GFP reporter assay. Expression levels of genes including apoptosis-antagonizing transcription factor (AATF), MYC, B-cell lymphoma (BCL3), P21 CIP , CCND1 and SP1 in B- and T-cells from patients with pediatric ALL were compared with control levels using real-time quantitative reverse transcription polymerase chain reaction, western blotting, and reporter assays. Results We identified two novel mutations in KLF4 in pediatric T-ALL. A mutation in the 3′ untranslated region of the KLF4 gene resulted in loss of miR-2909-mediated regulation, while mutation in its first or third zinc-finger motif (Zf1/Zf3) rendered KLF4 transcriptionally inactive. This mutation was a frameshift mutation resulting in alteration of the Zf3 motif sequence in the mutant KLF4 protein in all pediatric T-ALL samples. Homology models, docking studies and promoter activity of its target gene P21 CIP confirmed the lack of function of the mutant KLF4 protein in pediatric T-ALL. Moreover, the inability of miR-2909 to regulate KLF4 and its downstream genes controlling cell cycle and apoptosis in T-cell but not in B-ALL was verified by antagomiR-2909 transfection. Comprehensive sequence analysis of KLF4 identified the predominance of isoform 1 (~55 kDa) in most patients with pediatric B-ALL, while those with pediatric T-ALL expressed isoform 2 (~51 kDa). Conclusions This study identified a novel miR-2909-KLF4 molecular axis able to differentiate between the pathogeneses of pediatric B- and T-cell ALLs, and which may represent a new diagnostic/prognostic marker. PMID:25037230

  11. [Programmed mouse genome modifications].

    PubMed

    Babinet, C

    1998-02-01

    The availability, in the mouse, of embryonic stem cells (ES cells) which have the ability to colonize the germ line of a developing embryo, has opened entirely new avenues to the genetic approach of embryonic development, physiology and pathology of this animal. Indeed, it is now possible, using homologous recombination in ES cells, to introduce mutations in any gene as long as it has been cloned. Thus, null as well as more subtle mutations can be created. Furthermore, scenarios are currently being derived which will allow one to generate conditional mutations. Taken together, these methods offer a tremendous tool to study gene function in vivo; they also open the way to creating murine models of human genetic diseases.

  12. [Control levels of Sin3 histone deacetylase for spontaneous and UV-induced mutagenesis in yeasts Saccharomyces cerevisiae].

    PubMed

    Lebovka, I Iu; Kozhina, T N; Fedorova, I V; Peshekhonov, V T; Evstiukhina, T A; Chernenkov, A Iu; Korolev, V G

    2014-01-01

    SIN3 gene product operates as a repressor for a huge amount of genes in Saccharomyces cerevisiae. Sin3 protein with a mass of about 175 kDa is a member of the RPD3 protein complex with an assessed mass of greater than 2 million Da. It was previously shownthat RPD3 gene mutations influence recombination and repair processes in S. cerevisiae yeasts. We studied the impacts of the sin3 mutation on UV-light sensitivity and UV-induced mutagenesis in budding yeast cells. The deletion ofthe SIN3 gene causes weak UV-sensitivity of mutant budding cells as compared to the wild-type strain. These results show that the sin3 mutation decreases both spontaneous and UV-induced levels of levels. This fact is hypothetically related to themalfunction of ribonucleotide reductase activity regulation, which leads to a decrease in the dNTP pool and the inaccurate error-prone damage bypass postreplication repair pathway, which in turn provokes a reduction in the incidence of mutations.

  13. Natural gene therapy in monozygotic twins with Fanconi anemia.

    PubMed

    Mankad, Anuj; Taniguchi, Toshiyasu; Cox, Barbara; Akkari, Yassmine; Rathbun, R Keaney; Lucas, Lora; Bagby, Grover; Olson, Susan; D'Andrea, Alan; Grompe, Markus

    2006-04-15

    Monozygotic twin sisters, with nonhematologic symptoms of Fanconi anemia (FA), were discovered to be somatic mosaics for mutations in the FANCA gene. Skin fibroblasts, but not lymphocytes or committed hematopoietic progenitors, were sensitive to DNA cross-linking agents. Molecular analysis revealed, in skin cells of both twins, a frameshift causing deletion in exon 27 (2555deltaT) and an exon 28 missense mutation (2670G>A/R880Q). The latter resulted in primarily cytoplasmic expression and reduced function of the mutant FANCA (R880Q) protein. Surprisingly, the same acquired exon 30 missense change (2927G>A/E966K) was detected in the hematopoietic cells of both sisters, but not in their fibroblasts, nor in either parent. This compensatory mutation existed in cis with the maternal exon 28 mutation, and it restored function and nuclear localization of the resulting protein. Both sisters have been free of hematologic symptoms for more than 2 decades, suggesting that this de novo mutation occurred prenatally in a single hematopoietic stem cell (HSC) in one twin and that descendants of this functionally corrected HSC, via intra-uterine circulation, repopulated the blood lineages of both sisters. This finding suggests that treating FA patients with gene therapy might require transduction of only a few hematopoietic stem cells.

  14. Correlation of EGFR or KRAS mutation status with 18F-FDG uptake on PET-CT scan in lung adenocarcinoma.

    PubMed

    Takamochi, Kazuya; Mogushi, Kaoru; Kawaji, Hideya; Imashimizu, Kota; Fukui, Mariko; Oh, Shiaki; Itoh, Masayoshi; Hayashizaki, Yoshihide; Ko, Weijey; Akeboshi, Masao; Suzuki, Kenji

    2017-01-01

    18F-fluoro-2-deoxy-glucose (18F-FDG) positron emission tomography (PET) is a functional imaging modality based on glucose metabolism. The correlation between EGFR or KRAS mutation status and the standardized uptake value (SUV) of 18F-FDG PET scanning has not been fully elucidated. Correlations between EGFR or KRAS mutation status and clinicopathological factors including SUVmax were statistically analyzed in 734 surgically resected lung adenocarcinoma patients. Molecular causal relationships between EGFR or KRAS mutation status and glucose metabolism were then elucidated in 62 lung adenocarcinomas using cap analysis of gene expression (CAGE), a method to determine and quantify the transcription initiation activities of mRNA across the genome. EGFR and KRAS mutations were detected in 334 (46%) and 83 (11%) of the 734 lung adenocarcinomas, respectively. The remaining 317 (43%) patients had wild-type tumors for both genes. EGFR mutations were more frequent in tumors with lower SUVmax. In contrast, no relationship was noted between KRAS mutation status and SUVmax. CAGE revealed that 4 genes associated with glucose metabolism (GPI, G6PD, PKM2, and GAPDH) and 5 associated with the cell cycle (ANLN, PTTG1, CIT, KPNA2, and CDC25A) were positively correlated with SUVmax, although expression levels were lower in EGFR-mutated than in wild-type tumors. No similar relationships were noted with KRAS mutations. EGFR-mutated adenocarcinomas are biologically indolent with potentially lower levels of glucose metabolism than wild-type tumors. Several genes associated with glucose metabolism and the cell cycle were specifically down-regulated in EGFR-mutated adenocarcinomas.

  15. Relationship between driver gene mutations, their relative protein expressions and survival in non-small cell lung carcinoma in Macao.

    PubMed

    Chan, Kin Iong; Vong, Hong Ting; Sin, Lai Fong; Yip, Yuk Ching; Zhong, Xue Yun; Wen, Jian Ming

    2018-04-01

    We report the status of most common gene mutations in non-small cell lung carcinoma (NSCLC) in Macao, and explore the relationship between each gene mutation and clinicopathologic features and survival. EGFR, KRAS and BRAF mutations were detected by PCR in 122 cases of NSCLC. ALK translocation and MET amplification were detected by fluorescence in situ hybridization (FISH). MET and thyroid transcription factor (TTF-1) were investigated by immunohistochemistry. Clinical data were collected for analyzing their correlation with the gene mutations. The mutation of EGFR, KRAS and BRAF was detected in 48 (39.3%), 13 (10.7%) and 3 (2.5%) of 122 cases of NSCLC, respectively. ALK translocation and MET amplification were detected in 7 (5.7%) and 3 cases (2.5%). The rate of EGFR mutation was significantly higher in female and non-smoker patients. In TTF-1 positive cases EGFR mutation was more frequent. Age of the patients over 62-year old was correlated with KRAS mutations. The concordance between ALK IHC and FISH was 58.3%. The MET protein in the cases with MET amplification was 100% positive. The survival was lower in the patients with positive MET protein than those with negative. MET protein was an independent prognostic factor for NSCLC. EGFR mutation occurred frequently in the female never smoke patients with NSCLC. KRAS mutation was more common in old patients. Negative MET protein expression could be used as a negative predictive marker of MET amplification. MET protein expression was an independent prognostic factor for NSCLC. © 2017 John Wiley & Sons Ltd.

  16. High Inter-Individual Diversity of Point Mutations, Insertions, and Deletions in Human Influenza Virus Nucleoprotein-Specific Memory B Cells

    PubMed Central

    Bussmann, Bianca M.; Horn, Susanne; Sieg, Michael; Jassoy, Christian

    2015-01-01

    The diversity of virus-specific antibodies and of B cells among different individuals is unknown. Using single-cell cloning of antibody genes, we generated recombinant human monoclonal antibodies from influenza nucleoprotein-specific memory B cells in four adult humans with and without preceding influenza vaccination. We examined the diversity of the antibody repertoires and found that NP-specific B cells used numerous immunoglobulin genes. The heavy chains (HCs) originated from 26 and the kappa light chains (LCs) from 19 different germ line genes. Matching HC and LC chains gave rise to 43 genetically distinct antibodies that bound influenza NP. The median lengths of the CDR3 of the HC, kappa and lambda LC were 14, 9 and 11 amino acids, respectively. We identified changes at 13.6% of the amino acid positions in the V gene of the antibody heavy chain, at 8.4 % in the kappa and at 10.6 % in the lambda V gene. We identified somatic insertions or deletions in 8.1% of the variable genes. We also found several small groups of clonal relatives that were highly diversified. Our findings demonstrate broadly diverse memory B cell repertoires for the influenza nucleoprotein. We found extensive variation within individuals with a high number of point mutations, insertions, and deletions, and extensive clonal diversification. Thus, structurally conserved proteins can elicit broadly diverse and highly mutated B-cell responses. PMID:26086076

  17. Microfluidic screening and whole-genome sequencing identifies mutations associated with improved protein secretion by yeast.

    PubMed

    Huang, Mingtao; Bai, Yunpeng; Sjostrom, Staffan L; Hallström, Björn M; Liu, Zihe; Petranovic, Dina; Uhlén, Mathias; Joensson, Haakan N; Andersson-Svahn, Helene; Nielsen, Jens

    2015-08-25

    There is an increasing demand for biotech-based production of recombinant proteins for use as pharmaceuticals in the food and feed industry and in industrial applications. Yeast Saccharomyces cerevisiae is among preferred cell factories for recombinant protein production, and there is increasing interest in improving its protein secretion capacity. Due to the complexity of the secretory machinery in eukaryotic cells, it is difficult to apply rational engineering for construction of improved strains. Here we used high-throughput microfluidics for the screening of yeast libraries, generated by UV mutagenesis. Several screening and sorting rounds resulted in the selection of eight yeast clones with significantly improved secretion of recombinant α-amylase. Efficient secretion was genetically stable in the selected clones. We performed whole-genome sequencing of the eight clones and identified 330 mutations in total. Gene ontology analysis of mutated genes revealed many biological processes, including some that have not been identified before in the context of protein secretion. Mutated genes identified in this study can be potentially used for reverse metabolic engineering, with the objective to construct efficient cell factories for protein secretion. The combined use of microfluidics screening and whole-genome sequencing to map the mutations associated with the improved phenotype can easily be adapted for other products and cell types to identify novel engineering targets, and this approach could broadly facilitate design of novel cell factories.

  18. Thiol peroxidase deficiency leads to increased mutational load and decreased fitness in Saccharomyces cerevisiae.

    PubMed

    Kaya, Alaattin; Lobanov, Alexei V; Gerashchenko, Maxim V; Koren, Amnon; Fomenko, Dmitri E; Koc, Ahmet; Gladyshev, Vadim N

    2014-11-01

    Thiol peroxidases are critical enzymes in the redox control of cellular processes that function by reducing low levels of hydroperoxides and regulating redox signaling. These proteins were also shown to regulate genome stability, but how their dysfunction affects the actual mutations in the genome is not known. Saccharomyces cerevisiae has eight thiol peroxidases of glutathione peroxidase and peroxiredoxin families, and the mutant lacking all these genes (∆8) is viable. In this study, we employed two independent ∆8 isolates to analyze the genome-wide mutation spectrum that results from deficiency in these enzymes. Deletion of these genes was accompanied by a dramatic increase in point mutations, many of which clustered in close proximity and scattered throughout the genome, suggesting strong mutational bias. We further subjected multiple lines of wild-type and ∆8 cells to long-term mutation accumulation, followed by genome sequencing and phenotypic characterization. ∆8 lines showed a significant increase in nonrecurrent point mutations and indels. The original ∆8 cells exhibited reduced growth rate and decreased life span, which were further reduced in all ∆8 mutation accumulation lines. Although the mutation spectrum of the two independent isolates was different, similar patterns of gene expression were observed, suggesting the direct contribution of thiol peroxidases to the observed phenotypes. Expression of a single thiol peroxidase could partially restore the growth phenotype of ∆8 cells. This study shows how deficiency in nonessential, yet critical and conserved oxidoreductase function, leads to increased mutational load and decreased fitness. Copyright © 2014 by the Genetics Society of America.

  19. Transcriptional specificity in various p53-mutant cells.

    PubMed

    Okaichi, Kumio; Izumi, Nanaka; Takamura, Yuma; Fukui, Shoichi; Kudo, Takashi

    2013-03-01

    Mutation of the tumor suppressor gene p53 is the most common genetic alteration observed in human tumors. However, the relationship between the mutation point of p53 and the transcriptional specificity is not so obvious. We prepared Saos-2 cells with various mutations of p53 that are found in human tumors, and examined the resulting transcriptional alterations in the cells. Loss of function and gain of function were observed in all p53 mutants. Hot-spot mutations of p53 are frequently found in tumor cells. We compared hot-spot mutations and other mutations of p53 and found that a more than 2-fold transcription of CADPS2, PIWIL4 and TRIM9 was induced by hot spot mutations, but not by other mutations. As PIWIL4 suppresses the p16(INK4A) and ARF pathway, restraining cell growth and genomic instability, induction of PIWIL4 expression may be one reason why hot-spot mutations are frequently found in tumor cells.

  20. Mutational Analysis of Cell Types in TSC

    DTIC Science & Technology

    2008-01-01

    disability, and autism . TSC1/TSC2 gene mutations lead to developmental alterations in brain structure known as tubers in over 80% of TSC patients. Loss of...that is associated with epilepsy, cognitive disability, and autism . TSC1/TSC2 gene mutations lead to developmental alterations in brain structure...2000). Comorbid neuropsychological disorders such as autism , mental retardation (MR), pervasive developmental disorder, attention deficit disorder (ADD

  1. Multiple organ gigantism caused by mutation in VmPPD gene in blackgram (Vigna mungo).

    PubMed

    Naito, Ken; Takahashi, Yu; Chaitieng, Bubpa; Hirano, Kumi; Kaga, Akito; Takagi, Kyoko; Ogiso-Tanaka, Eri; Thavarasook, Charaspon; Ishimoto, Masao; Tomooka, Norihiko

    2017-03-01

    Seed size is one of the most important traits in leguminous crops. We obtained a recessive mutant of blackgram that had greatly enlarged leaves, stems and seeds. The mutant produced 100% bigger leaves, 50% more biomass and 70% larger seeds though it produced 40% less number of seeds. We designated the mutant as multiple-organ-gigantism ( mog ) and found the mog phenotype was due to increase in cell numbers but not in cell size. We also found the mog mutant showed a rippled leaf ( rl ) phenotype, which was probably caused by a pleiotropic effect of the mutation. We performed a map-based cloning and successfully identified an 8 bp deletion in the coding sequence of VmPPD gene, an orthologue of Arabidopsis PEAPOD ( PPD ) that regulates arrest of cell divisions in meristematic cells . We found no other mutations in the neighboring genes between the mutant and the wild type. We also knocked down GmPPD genes and reproduced both the mog and rl phenotypes in soybean. Controlling PPD genes to produce the mog phenotype is highly valuable for breeding since larger seed size could directly increase the commercial values of grain legumes.

  2. Multiple organ gigantism caused by mutation in VmPPD gene in blackgram (Vigna mungo)

    PubMed Central

    Naito, Ken; Takahashi, Yu; Chaitieng, Bubpa; Hirano, Kumi; Kaga, Akito; Takagi, Kyoko; Ogiso-Tanaka, Eri; Thavarasook, Charaspon; Ishimoto, Masao; Tomooka, Norihiko

    2017-01-01

    Seed size is one of the most important traits in leguminous crops. We obtained a recessive mutant of blackgram that had greatly enlarged leaves, stems and seeds. The mutant produced 100% bigger leaves, 50% more biomass and 70% larger seeds though it produced 40% less number of seeds. We designated the mutant as multiple-organ-gigantism (mog) and found the mog phenotype was due to increase in cell numbers but not in cell size. We also found the mog mutant showed a rippled leaf (rl) phenotype, which was probably caused by a pleiotropic effect of the mutation. We performed a map-based cloning and successfully identified an 8 bp deletion in the coding sequence of VmPPD gene, an orthologue of Arabidopsis PEAPOD (PPD) that regulates arrest of cell divisions in meristematic cells. We found no other mutations in the neighboring genes between the mutant and the wild type. We also knocked down GmPPD genes and reproduced both the mog and rl phenotypes in soybean. Controlling PPD genes to produce the mog phenotype is highly valuable for breeding since larger seed size could directly increase the commercial values of grain legumes. PMID:28588392

  3. DPL-1 DP, LIN-35 Rb and EFL-1 E2F act with the MCD-1 zinc-finger protein to promote programmed cell death in Caenorhabditis elegans.

    PubMed

    Reddien, Peter W; Andersen, Erik C; Huang, Michael C; Horvitz, H Robert

    2007-04-01

    The genes egl-1, ced-9, ced-4, and ced-3 play major roles in programmed cell death in Caenorhabditis elegans. To identify genes that have more subtle activities, we sought mutations that confer strong cell-death defects in a genetically sensitized mutant background. Specifically, we screened for mutations that enhance the cell-death defects caused by a partial loss-of-function allele of the ced-3 caspase gene. We identified mutations in two genes not previously known to affect cell death, dpl-1 and mcd-1 (modifier of cell death). dpl-1 encodes the C. elegans homolog of DP, the human E2F-heterodimerization partner. By testing genes known to interact with dpl-1, we identified roles in cell death for four additional genes: efl-1 E2F, lin-35 Rb, lin-37 Mip40, and lin-52 dLin52. mcd-1 encodes a novel protein that contains one zinc finger and that is synthetically required with lin-35 Rb for animal viability. dpl-1 and mcd-1 act with efl-1 E2F and lin-35 Rb to promote programmed cell death and do so by regulating the killing process rather than by affecting the decision between survival and death. We propose that the DPL-1 DP, MCD-1 zinc finger, EFL-1 E2F, LIN-35 Rb, LIN-37 Mip40, and LIN-52 dLin52 proteins act together in transcriptional regulation to promote programmed cell death.

  4. Radiation sensitivities of 31 human oesophageal squamous cell carcinoma cell lines

    PubMed Central

    Ban, Sadayuki; Michikawa, Yuichi; Ishikawa, Ken-ichi; Sagara, Masashi; Watanabe, Koji; Shimada, Yutaka; Inazawa, Johji; Imai, Takashi

    2005-01-01

    The purpose of this study was to determine the radiosensitivities of 31 human oesophageal squamous cell carcinoma cell lines with a colony-formation assay. A large variation in radiosensitivity existed among 31 cell lines. Such a large variation may partly explain the poor result of radiotherapy for this cancer. One cell line (KYSE190) demonstrated an unusual radiosensitivity. Ataxia-telangiectasia-mutated (ATM) gene in these cells had five missense mutations, and ATM protein was truncated or degraded. Inability to phosphorylate Chk2 in the irradiated KYSE190 cells suggests that the ATM protein in these cells had lost its function. The dysfunctional ATM protein may be a main cause of unusual radiosensitivity of KYSE190 cells. Because the donor of these cells was not diagnosed with ataxia telangiectasia, mutations in ATM gene might have occurred during the initiation and progression of cancer. Radiosensitive cancer developed in non-hereditary diseased patients must be a good target for radiotherapy. PMID:16045545

  5. Resetting the epigenetic balance of Polycomb and COMPASS function at enhancers for cancer therapy.

    PubMed

    Wang, Lu; Zhao, Zibo; Ozark, Patrick A; Fantini, Damiano; Marshall, Stacy A; Rendleman, Emily J; Cozzolino, Kira A; Louis, Nundia; He, Xingyao; Morgan, Marc A; Takahashi, Yoh-Hei; Collings, Clayton K; Smith, Edwin R; Ntziachristos, Panagiotis; Savas, Jeffrey N; Zou, Lihua; Hashizume, Rintaro; Meeks, Joshua J; Shilatifard, Ali

    2018-06-01

    The lysine methyltransferase KMT2C (also known as MLL3), a subunit of the COMPASS complex, implements monomethylation of Lys4 on histone H3 (H3K4) at gene enhancers. KMT2C (hereafter referred to as MLL3) frequently incurs point mutations across a range of human tumor types, but precisely how these lesions alter MLL3 function and contribute to oncogenesis is unclear. Here we report a cancer mutational hotspot in MLL3 within the region encoding its plant homeodomain (PHD) repeats and demonstrate that this domain mediates association of MLL3 with the histone H2A deubiquitinase and tumor suppressor BAP1. Cancer-associated mutations in the sequence encoding the MLL3 PHD repeats disrupt the interaction between MLL3 and BAP1 and correlate with poor patient survival. Cancer cells that had PHD-associated MLL3 mutations or lacked BAP1 showed reduced recruitment of MLL3 and the H3K27 demethylase KDM6A (also known as UTX) to gene enhancers. As a result, inhibition of the H3K27 methyltransferase activity of the Polycomb repressive complex 2 (PRC2) in tumor cells harboring BAP1 or MLL3 mutations restored normal gene expression patterns and impaired cell proliferation in vivo. This study provides mechanistic insight into the oncogenic effects of PHD-associated mutations in MLL3 and suggests that restoration of a balanced state of Polycomb-COMPASS activity may have therapeutic efficacy in tumors that bear mutations in the genes encoding these epigenetic factors.

  6. Exon skipping and gene transfer restore dystrophin expression in human induced pluripotent stem cells-cardiomyocytes harboring DMD mutations.

    PubMed

    Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns; Denning, Chris

    2013-10-15

    With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47-50 or 48-50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart.

  7. Exon Skipping and Gene Transfer Restore Dystrophin Expression in Human Induced Pluripotent Stem Cells-Cardiomyocytes Harboring DMD Mutations

    PubMed Central

    Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H.; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns

    2013-01-01

    With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47–50 or 48–50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart. PMID:23829870

  8. Sigma nonopioid intracellular receptor 1 mutations cause frontotemporal lobar degeneration-motor neuron disease.

    PubMed

    Luty, Agnes A; Kwok, John B J; Dobson-Stone, Carol; Loy, Clement T; Coupland, Kirsten G; Karlström, Helena; Sobow, Tomasz; Tchorzewska, Joanna; Maruszak, Aleksandra; Barcikowska, Maria; Panegyres, Peter K; Zekanowski, Cezary; Brooks, William S; Williams, Kelly L; Blair, Ian P; Mather, Karen A; Sachdev, Perminder S; Halliday, Glenda M; Schofield, Peter R

    2010-11-01

    Frontotemporal lobar degeneration (FTLD) is the most common cause of early-onset dementia. Pathological ubiquitinated inclusion bodies observed in FTLD and motor neuron disease (MND) comprise trans-activating response element (TAR) DNA binding protein (TDP-43) and/or fused in sarcoma (FUS) protein. Our objective was to identify the causative gene in an FTLD-MND pedigree with no mutations in known dementia genes. A mutation screen of candidate genes, luciferase assays, and quantitative polymerase chain reaction (PCR) was performed to identify the biological role of the putative mutation. Neuropathological characterization of affected individuals and western blot studies of cell lines were performed to identify the pathological mechanism of the mutation. We identified a nonpolymorphic mutation (c.672*51G>T) in the 3'-untranslated region (UTR) of the Sigma nonopioid intracellular receptor 1 (SIGMAR1) gene in affected individuals from the FTLD-MND pedigree. The c.672*51G>T mutation increased gene expression by 1.4-fold, corresponding with a significant 1.5-fold to 2-fold change in the SIGMAR1 transcript or Sigma-1 protein in lymphocyte or brain tissue. Brains of SIGMAR1 mutation carriers displayed a unique pathology with cytoplasmic inclusions immunopositive for either TDP-43 or FUS but not Sigma-1. Overexpression of SIGMAR1 shunted TDP-43 and FUS from the nucleus to the cytoplasm by 2.3-fold and 5.2-fold, respectively. Treatment of cells with Sigma-1 ligands significantly altered translocation of TDP-43 by up to 2-fold. SIGMAR1 is a causative gene for familial FTLD-MND with a unique neuropathology that differs from other FTLD and MND cases. Our findings also suggest Sigma-1 drugs as potential treatments for the TDP-43/FUS proteinopathies.

  9. Transcriptomic analysis and mutational status of IDH1 in paired primary-recurrent intrahepatic cholangiocarcinoma.

    PubMed

    Peraldo-Neia, C; Ostano, P; Cavalloni, G; Pignochino, Y; Sangiolo, D; De Cecco, L; Marchesi, E; Ribero, D; Scarpa, A; De Rose, A M; Giuliani, A; Calise, F; Raggi, C; Invernizzi, P; Aglietta, M; Chiorino, G; Leone, F

    2018-06-05

    Effective target therapies for intrahepatic cholangiocarcinoma (ICC) have not been identified so far. One of the reasons may be the genetic evolution from primary (PR) to recurrent (REC) tumors. We aim to identify peculiar characteristics and to select potential targets specific for recurrent tumors. Eighteen ICC paired PR and REC tumors were collected from 5 Italian Centers. Eleven pairs were analyzed for gene expression profiling and 16 for mutational status of IDH1. For one pair, deep mutational analysis by Next Generation Sequencing was also carried out. An independent cohort of patients was used for validation. Two class-paired comparison yielded 315 differentially expressed genes between REC and PR tumors. Up-regulated genes in RECs are involved in RNA/DNA processing, cell cycle, epithelial to mesenchymal transition (EMT), resistance to apoptosis, and cytoskeleton remodeling. Down-regulated genes participate to epithelial cell differentiation, proteolysis, apoptotic, immune response, and inflammatory processes. A 24 gene signature is able to discriminate RECs from PRs in an independent cohort; FANCG is statistically associated with survival in the chol-TCGA dataset. IDH1 was mutated in the RECs of five patients; 4 of them displayed the mutation only in RECs. Deep sequencing performed in one patient confirmed the IDH1 mutation in REC. RECs are enriched for genes involved in EMT, resistance to apoptosis, and cytoskeleton remodeling. Key players of these pathways might be considered druggable targets in RECs. IDH1 is mutated in 30% of RECs, becoming both a marker of progression and a target for therapy.

  10. Analysis of p53 gene mutations in human gliomas by polymerase chain reaction-based single-strand conformation polymorphism and DNA sequencing.

    PubMed

    Sarkar, F H; Kupsky, W J; Li, Y W; Sreepathi, P

    1994-03-01

    Mutations in the p53 gene have been recognized in brain tumors, and clonal expansion of p53 mutant cells has been shown to be associated with glioma progression. However, studies on the p53 gene have been limited by the need for frozen tissues. We have developed a method utilizing polymerase chain reaction (PCR) for the direct analysis of p53 mutation by single-strand conformation polymorphism (SSCP) and by direct DNA sequencing of the p53 gene using a single 10-microns paraffin-embedded tissue section. We applied this method to screen for p53 gene mutations in exons 5-8 in human gliomas utilizing paraffin-embedded tissues. Twenty paraffin blocks containing tumor were selected from surgical specimens from 17 different adult patients. Tumors included six anaplastic astrocytomas (AAs), nine glioblastomas (GBs), and two mixed malignant gliomas (MMGs). The tissue section on the stained glass slide was used to guide microdissection of an unstained adjacent tissue section to ensure > 90% of the tumor cell population for p53 mutational analysis. Simultaneously, microdissection of the tissue was also carried out to obtain normal tissue from adjacent areas as a control. Mutations in the p53 gene were identified in 3 of 17 (18%) patients by PCR-SSCP analysis and subsequently confirmed by PCR-based DNA sequencing. Mutations in exon 5 resulting in amino acid substitution were found in one thalamic AA (codon 158, CGC > CTT: Arg > Leu) and one cerebral hemispheric GB (codon 151, CCG > CTG: Pro > Leu).(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Calreticulin mutation-specific immunostaining in myeloproliferative neoplasms: pathogenetic insight and diagnostic value

    PubMed Central

    Vannucchi, A M; Rotunno, G; Bartalucci, N; Raugei, G; Carrai, V; Balliu, M; Mannarelli, C; Pacilli, A; Calabresi, L; Fjerza, R; Pieri, L; Bosi, A; Manfredini, R; Guglielmelli, P

    2014-01-01

    Mutations in the gene calreticulin (CALR) occur in the majority of JAK2- and MPL-unmutated patients with essential thrombocythemia (ET) and primary myelofibrosis (PMF); identifying CALR mutations contributes to the diagnostic pathway of ET and PMF. CALR mutations are heterogeneous spanning over the exon 9, but all result in a novel common protein C terminus. We developed a polyclonal antibody against a 17-amino-acid peptide derived from mutated calreticulin that was used for immunostaining of bone marrow biopsies. We show that this antibody specifically recognized patients harboring different types of CALR mutation with no staining in healthy controls and JAK2- or MPL-mutated ET and PMF. The labeling was mostly localized in megakaryocytes, whereas myeloid and erythroid cells showed faint staining, suggesting a preferential expression of calreticulin in megakaryocytes. Megakaryocytic-restricted expression of calreticulin was also demonstrated using an antibody against wild-type calreticulin and by measuring the levels of calreticulin RNA by gene expression analysis. Immunostaining using an antibody specific for mutated calreticulin may become a rapid, simple and cost-effective method for identifying CALR-mutated patients complementing molecular analysis; furthermore, the labeling pattern supports the preferential expansion of megakaryocytic cell lineage as a result of CALR mutation in an immature hematopoietic stem cell. PMID:24618731

  12. Evidence that expression of a mutated p53 gene attenuates apoptotic cell death in human gastric intestinal-type carcinomas in vivo.

    PubMed

    Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H

    1997-05-01

    To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P < 0.05). Apoptotic cells were identified from routinely stained sections and by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P < 0.05). The proliferating cell nuclear antigen index, defined similarly to the TI, was 56.4 +/- 16.3% in category A, and it was significantly higher than that in category B (P < 0.05). The immunohistochemically detected expression of p21CIP1/WAP1 did not differ between the two categories, while Bax-positive tumor cells were more frequently detected in category A. These results indicate that (1) expression of a mutated p53 gene attenuates apoptotic cell death of gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.

  13. Analysis of the genes encoding neuroligins NLGN3 and NLGN4 in Bulgarian patients with autism.

    PubMed

    Avdjieva-Tzavella, D M; Todorov, T P; Todorova, A P; Kirov, A V; Hadjidekova, S P; Rukova, B B; Litvinenko, I O; Hristova-Naydenova, D N; Tincheva, R S; Toncheva, D I

    2012-01-01

    Many studies have supported a genetic aetiology for autism. Neuroligins are postsynaptically located cell-adhesion molecules. Mutations in two X-linked neuroligin genes, NLGN3 and NLGN4, have been implicated in pathogenesis of autism. In order to confirm these causative mutations in our autistic population and to determine their frequency we screened 20 individuals affected with autism. We identified one patient with a point mutation in NLGN4 gene that substituted a Met for Thr 787 - c.2360C > T, p.(Thr787Met) and three patients with identical polymorphisms in the same gene: c.933C > T, p.(Thr311Thr) in combination with c.[1777C > T+1779C > G, p.(Leu593Leu)]. All patients tested for NLGN3 mutations were negative. These results indicate that mutations in these genes are responsible for at most a small fraction of autism cases.

  14. The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation.

    PubMed

    Zhang, Hui; Zhang, Jinshan; Wei, Pengliang; Zhang, Botao; Gou, Feng; Feng, Zhengyan; Mao, Yanfei; Yang, Lan; Zhang, Heng; Xu, Nanfei; Zhu, Jian-Kang

    2014-08-01

    The CRISPR/Cas9 system has been demonstrated to efficiently induce targeted gene editing in a variety of organisms including plants. Recent work showed that CRISPR/Cas9-induced gene mutations in Arabidopsis were mostly somatic mutations in the early generation, although some mutations could be stably inherited in later generations. However, it remains unclear whether this system will work similarly in crops such as rice. In this study, we tested in two rice subspecies 11 target genes for their amenability to CRISPR/Cas9-induced editing and determined the patterns, specificity and heritability of the gene modifications. Analysis of the genotypes and frequency of edited genes in the first generation of transformed plants (T0) showed that the CRISPR/Cas9 system was highly efficient in rice, with target genes edited in nearly half of the transformed embryogenic cells before their first cell division. Homozygotes of edited target genes were readily found in T0 plants. The gene mutations were passed to the next generation (T1) following classic Mendelian law, without any detectable new mutation or reversion. Even with extensive searches including whole genome resequencing, we could not find any evidence of large-scale off-targeting in rice for any of the many targets tested in this study. By specifically sequencing the putative off-target sites of a large number of T0 plants, low-frequency mutations were found in only one off-target site where the sequence had 1-bp difference from the intended target. Overall, the data in this study point to the CRISPR/Cas9 system being a powerful tool in crop genome engineering. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  15. Mutations in iron-sulfur cluster proteins that improve xylose utilization

    DOEpatents

    Froehlich, Allan; Henningsen, Brooks; Covalla, Sean; Zelle, Rintze M.

    2018-03-20

    There is provided an engineered host cells comprising (a) one or more mutations in one or more endogenous genes encoding a protein associated with iron metabolism; and (b) at least one gene encoding a polypeptide having xylose isomerase activity, and methods of their use thereof.

  16. Modeling xeroderma pigmentosum associated neurological pathologies with patients-derived iPSCs.

    PubMed

    Fu, Lina; Xu, Xiuling; Ren, Ruotong; Wu, Jun; Zhang, Weiqi; Yang, Jiping; Ren, Xiaoqing; Wang, Si; Zhao, Yang; Sun, Liang; Yu, Yang; Wang, Zhaoxia; Yang, Ze; Yuan, Yun; Qiao, Jie; Izpisua Belmonte, Juan Carlos; Qu, Jing; Liu, Guang-Hui

    2016-03-01

    Xeroderma pigmentosum (XP) is a group of genetic disorders caused by mutations of XP-associated genes, resulting in impairment of DNA repair. XP patients frequently exhibit neurological degeneration, but the underlying mechanism is unknown, in part due to lack of proper disease models. Here, we generated patient-specific induced pluripotent stem cells (iPSCs) harboring mutations in five different XP genes including XPA, XPB, XPC, XPG, and XPV. These iPSCs were further differentiated to neural cells, and their susceptibility to DNA damage stress was investigated. Mutation of XPA in either neural stem cells (NSCs) or neurons resulted in severe DNA damage repair defects, and these neural cells with mutant XPA were hyper-sensitive to DNA damage-induced apoptosis. Thus, XP-mutant neural cells represent valuable tools to clarify the molecular mechanisms of neurological abnormalities in the XP patients.

  17. JAK2 mutation in a patient with CLL with coexistent myeloproliferative neoplasm (MPN).

    PubMed

    Kodali, Srinivas; Chen, Chi; Rathnasabapathy, Chenthilmurugan; Wang, Jen Chin

    2009-12-01

    JAK2 mutation has not been described in patients with chronic lymphocytic leukemia (CLL). We found JAK2 mutation in a patient with CLL and coexisting myeloproliferative neoplasm (MPN). In this patient, we demonstrated the presence of the JAK2 mutation in CD34(+) progenitor cells, myeloid lineage cells, megakaryocytes, B lymphocytes but not in T lymphocytes. This case represents the first case report of JAK2 mutation in CLL and may also suggest that, JAK2 mutation most likely represents a secondary event from primary gene mutations involving the primitive stem cells which give rise to MPN and CLL. Furthermore, in this case, we believe that we are the first to demonstrate that JAK2 mutation in myeloid and B lymphoid cells but not T lymphocytes in a case of coexisting CLL and MPN.

  18. Loss of ERLIN2 function leads to juvenile primary lateral sclerosis.

    PubMed

    Al-Saif, Amr; Bohlega, Saeed; Al-Mohanna, Futwan

    2012-10-01

    Primary lateral sclerosis (PLS) is a motor neuron disorder that exclusively affects upper motor neurons leading to their degeneration. Mutations in the ALS2 gene encoding the protein Alsin have been described previously in the juvenile form of the disease. In this study, we identify mutation of the ERLIN2 gene in juvenile PLS patients and describe an in vitro model for loss of ERLIN2 function. Single nucleotide polymorphism arrays were used for homozygosity mapping. DNA sequencing of candidate genes was used to detect the underlying mutation. Level of ERLIN2 mRNA was measured by quantitative real time polymerase chain reaction. Knocking down ERLIN2 in NSC34 cells was accomplished by short-hairpin RNA interference. We identified a splice junction mutation in the ERLIN2 gene-a component of the endoplasmic reticulum (ER) lipid rafts-that resulted in abnormal splicing of ERLIN2 transcript and nonsense-mediated decay of ERLIN2 mRNA. Knocking down ERLIN2 in NSC34 cells suppressed their growth in culture. Recently, we found that mutation of SIGMAR1, a component of ER lipid rafts, leads to juvenile amyotrophic lateral sclerosis. The identification of mutation in another component of the ER lipid rafts in juvenile PLS patients emphasizes their role in motor neuron function. Furthermore, the discovered effect of ERLIN2 loss on cell growth may advance understanding of the mechanism behind motor neuron degeneration in PLS. Copyright © 2012 American Neurological Association.

  19. CCDC65 Mutation Causes Primary Ciliary Dyskinesia with Normal Ultrastructure and Hyperkinetic Cilia

    PubMed Central

    Horani, Amjad; Brody, Steven L.; Ferkol, Thomas W.; Shoseyov, David; Wasserman, Mollie G.; Ta-shma, Asaf; Wilson, Kate S.; Bayly, Philip V.; Amirav, Israel; Cohen-Cymberknoh, Malena; Dutcher, Susan K.; Elpeleg, Orly; Kerem, Eitan

    2013-01-01

    Background Primary ciliary dyskinesia (PCD) is a genetic disorder characterized by impaired ciliary function, leading to chronic sinopulmonary disease. The genetic causes of PCD are still evolving, while the diagnosis is often dependent on finding a ciliary ultrastructural abnormality and immotile cilia. Here we report a novel gene associated with PCD but without ciliary ultrastructural abnormalities evident by transmission electron microscopy, but with dyskinetic cilia beating. Methods Genetic linkage analysis was performed in a family with a PCD subject. Gene expression was studied in Chlamydomonas reinhardtii and human airway epithelial cells, using RNA assays and immunostaining. The phenotypic effects of candidate gene mutations were determined in primary culture human tracheobronchial epithelial cells transduced with gene targeted shRNA sequences. Video-microscopy was used to evaluate cilia motion. Results A single novel mutation in CCDC65, which created a termination codon at position 293, was identified in a subject with typical clinical features of PCD. CCDC65, an orthologue of the Chlamydomonas nexin-dynein regulatory complex protein DRC2, was localized to the cilia of normal nasal epithelial cells but was absent in those from the proband. CCDC65 expression was up-regulated during ciliogenesis in cultured airway epithelial cells, as was DRC2 in C. reinhardtii following deflagellation. Nasal epithelial cells from the affected individual and CCDC65-specific shRNA transduced normal airway epithelial cells had stiff and dyskinetic cilia beating patterns compared to control cells. Moreover, Gas8, a nexin-dynein regulatory complex component previously identified to associate with CCDC65, was absent in airway cells from the PCD subject and CCDC65-silenced cells. Conclusion Mutation in CCDC65, a nexin-dynein regulatory complex member, resulted in a frameshift mutation and PCD. The affected individual had altered cilia beating patterns, and no detectable ultrastructural defects of the ciliary axoneme, emphasizing the role of the nexin-dynein regulatory complex and the limitations of certain methods for PCD diagnosis. PMID:23991085

  20. Surgery Branch recruiting patients to study new treatment for cancers with RAS mutations | Center for Cancer Research

    Cancer.gov

    RAS is a family of proteins that send signals to genes involved in cell growth and is mutated in approximately a quarter of all human cancers. James Yang, M.D., of the Surgery Branch is leading a team of investigators who have generated a special T-cell receptor from mouse cells that can recognize a mutation of RAS that is found in many human cancer cells. The goal is to determine if a new therapy is safe and can help shrink tumors that have the G12V RAS mutation. Read more...

  1. Loss of function JAK1 mutations occur at high frequency in cancers with microsatellite instability and are suggestive of immune evasion.

    PubMed

    Albacker, Lee A; Wu, Jeremy; Smith, Peter; Warmuth, Markus; Stephens, Philip J; Zhu, Ping; Yu, Lihua; Chmielecki, Juliann

    2017-01-01

    Immune evasion is a well-recognized hallmark of cancer and recent studies with immunotherapy agents have suggested that tumors with increased numbers of neoantigens elicit greater immune responses. We hypothesized that the immune system presents a common selective pressure on high mutation burden tumors and therefore immune evasion mutations would be enriched in high mutation burden tumors. The JAK family of kinases is required for the signaling of a host of immune modulators in tumor, stromal, and immune cells. Therefore, we analyzed alterations in this family for the hypothesized signature of an immune evasion mutation. Here, we searched a database of 61,704 unique solid tumors for alterations in the JAK family kinases (JAK1/2/3, TYK2). We used The Cancer Genome Atlas and Cancer Cell Line Encyclopedia data to confirm and extend our findings by analyzing gene expression patterns. Recurrent frameshift mutations in JAK1 were associated with high mutation burden and microsatellite instability. These mutations occurred in multiple tumor types including endometrial, colorectal, stomach, and prostate carcinomas. Analyzing gene expression signatures in endometrial and stomach adenocarcinomas revealed that tumors with a JAK1 frameshift exhibited reduced expression of interferon response signatures and multiple anti-tumor immune signatures. Importantly, endometrial cancer cell lines exhibited similar gene expression changes that were expected to be tumor cell intrinsic (e.g. interferon response) but not those expected to be tumor cell extrinsic (e.g. NK cells). From these data, we derive two primary conclusions: 1) JAK1 frameshifts are loss of function alterations that represent a potential pan-cancer adaptation to immune responses against tumors with microsatellite instability; 2) The mechanism by which JAK1 loss of function contributes to tumor immune evasion is likely associated with loss of the JAK1-mediated interferon response.

  2. [Gene Expression and Clinical Characteristics of Molecular Targeted Therapy 
in Non-small Cell Lung Cancer Patients in Shandong].

    PubMed

    Qiao, Xiuli; Ai, Dan; Liang, Honglu; Mu, Dianbin; Guo, Qisen

    2017-01-20

    Molecular targeted therapy has gradually become an important treatment for lung cancer, the aim of this research is to analyze the clinicopathologic features associated with the gene mutation status of epidermal growth factor receptor (EGFR), echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK), ROS proto-oncogene 1, receptor tyrosine kinase (ROS1) and Kirsten rat sarcoma viral oncogene (KRAS) in non-small cell lung cancer (NSCLC) patients and determine the most likely populations to benefit from molecular target therapy treatment. The mutation status of EGFR, EML4-ALK fusion gene, ROS1 and KARS gene were determined by Real-time PCR, the relationship between clinical pathologic features and concomitant gene were analyzed with χ2 test by SPSS software 19.0. A total of 514 specimens from Shandong tumor hospital were collected from NSCLC patients between January 2014 and May 2016. The total mutation rate of EGFR gene was 36.70%, major occurred in exon 19 (36.61%) and exon 21 (51.36%), respectively, and EGFR mutations usually occurred in female, non-smoking and adenocarcinoma patients (P<0.05). The total rearrangements rate of EML4-ALK fusion gene was 9.37%, EML4-ALK fusion gene usually occurred in younger age (≤60 yr) and non-smoking patients (P<0.05). Mutations were not related to gender and pathological type (P>0.05). ROS1 fusion gene was detected in 136 cases, the positive rate was 3.67%, all patients were 60 years old, and the difference was statistically significant (P<0.05). Only 23 samples were tested KARS gene mutations, two of them were positive and the positive rate was 8.70%. They all occurred in non-smoker and adenocarcinoma patients. No mutation was detected to coexist in EGFR, EML4-ALK and KARS gene mutation. EGFR, EML4-ALK, ROS1 and KRAS defines different molecular subset of NSCLC with distinct characteristic, which provides a new option for the clinical treatment of patients with NSCLC.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong

    Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None ofmore » the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies.« less

  4. Genes affecting sensitivity to serotonin in Caenorhabditis elegans.

    PubMed

    Schafer, W R; Sanchez, B M; Kenyon, C J

    1996-07-01

    Regulating the response of a postsynaptic cell to neurotransmitter is an important mechanism for controlling synaptic strength, a process critical to learning. We have begun to define and characterize genes that may control sensitivity to the neurotransmitter serotonin in the nematode Caenorhabditis elegans by identifying serotonin-hypersensitive mutants. We reported previously that mutations in the gene unc-2, which encodes a putative calcium channel subunit, result in hypersensitivity to serotonin. Here we report that mutants defective in the unc-36 gene, which encodes a homologue of a calcium channel auxiliary subunit, are also serotonin-hypersensitive. Moreover, the unc-36 gene appears to be required in the same cells as unc-2 for control of the same behaviors. Mutations in several other genes, including unc-8, unc-10, unc-20, unc-35, unc-75, unc-77, and snt-1 also result in hypersensitivity to serotonin. Several of these mutations have previously been shown to confer resistance to acetylcholinesterase inhibitors, suggesting that they may affect acetylcholine release. Moreover, we found that mutations that decrease acetylcholine synthesis cause defective egg-laying and serotonin hypersensitivity. Thus, acetylcholine appears to negatively regulate the response to serotonin and may participate in the process of serotonin desensitization.

  5. Genes Affecting Sensitivity to Serotonin in Caenorhabditis Elegans

    PubMed Central

    Schafer, W. R.; Sanchez, B. M.; Kenyon, C. J.

    1996-01-01

    Regulating the response of a postsynaptic cell to neurotransmitter is an important mechanism for controlling synaptic strength, a process critical to learning. We have begun to define and characterize genes that may control sensitivity to the neurotransmitter serotonin in the nematode Caenorhabditis elegans by identifying serotonin-hypersensitive mutants. We reported previously that mutations in the gene unc-2, which encodes a putative calcium channel subunit, result in hypersensitivity to serotonin. Here we report that mutants defective in the unc-36 gene, which encodes a homologue of a calcium channel auxiliary subunit, are also serotonin-hypersensitive. Moreover, the unc-36 gene appears to be required in the same cells as unc-2 for control of the same behaviors. Mutations in several other genes, including unc-8, unc-10, unc-20, unc-35, unc-75, unc-77, and snt-1 also result in hypersensitivity to serotonin. Several of these mutations have previously been shown to confer resistance to acetylcholinesterase inhibitors, suggesting that they may affect acetylcholine release. Moreover, we found that mutations that decrease acetylcholine synthesis cause defective egg-laying and serotonin hypersensitivity. Thus, acetylcholine appears to negatively regulate the response to serotonin and may participate in the process of serotonin desensitization. PMID:8807295

  6. A novel mutation of α-galactosidase A gene causes Fabry disease mimicking primary erythromelalgia in a Chinese family.

    PubMed

    Ge, Wei; Wei, Bin; Zhu, Hao; Miao, Zhigang; Zhang, Weimin; Leng, Cuihua; Li, Jizhen; Zhang, Dan; Sun, Miao; Xu, Xingshun

    2017-05-01

    Fabry disease is an X-linked genetic disorder caused by the mutations of α-galactosidase A (GLA, MIM 300644) gene presenting with various clinical symptoms including small-fiber peripheral neuropathy and limb burning pain. Here, we reported a Chinese pedigree with the initial diagnosis of primary erythromelalgia in an autosomal dominant (AD)-inherited pattern. Mutation analysis of SCN9A and GLA genes by direct sequencing and functional analysis of a novel mutation of GLA in cells were performed. Our data did not show any pathological mutations in SCN9A gene; however, a novel missense mutation c.139T>C (p.W47R) of GLA was identified in a male proband as well as two female carriers in this family. Enzyme assay of α-galactosidase A activity showed deficient enzyme activity in male patients and female carriers, further confirming the diagnosis of Fabry disease. Finally, a functional analysis indicated that the replacement of the 47th amino acid tryptophan (W47) with arginine (W47R) or glycine (W47G) led to reduced activity of α-galactosidase A in 293T cells. Therefore, these findings demonstrated that the novel mutation p.W47R of GLA is the cause of Fabry disease. Because Fabry disease and primary erythromelalgia share similar symptoms, it is a good strategy for clinical physicians to perform genetic mutation screenings on both SCN9A and GLA genes in those patients with limb burning pain but without a clear inheritant pattern.

  7. Mutation analysis of HIF prolyl hydroxylases (PHD/EGLN) in individuals with features of phaeochromocytoma and renal cell carcinoma susceptibility.

    PubMed

    Astuti, Dewi; Ricketts, Christopher J; Chowdhury, Rasheduzzaman; McDonough, Michael A; Gentle, Dean; Kirby, Gail; Schlisio, Susanne; Kenchappa, Rajappa S; Carter, Bruce D; Kaelin, William G; Ratcliffe, Peter J; Schofield, Christopher J; Latif, Farida; Maher, Eamonn R

    2011-02-01

    Germline mutations in the von Hippel-Lindau disease (VHL) and succinate dehydrogenase subunit B (SDHB) genes can cause inherited phaeochromocytoma and/or renal cell carcinoma (RCC). Dysregulation of the hypoxia-inducible factor (HIF) transcription factors has been linked to VHL and SDHB-related RCC; both HIF dysregulation and disordered function of a prolyl hydroxylase domain isoform 3 (PHD3/EGLN3)-related pathway of neuronal apoptosis have been linked to the development of phaeochromocytoma. The 2-oxoglutarate-dependent prolyl hydroxylase enzymes PHD1 (EGLN2), PHD2 (EGLN1) and PHD3 (EGLN3) have a key role in regulating the stability of HIF-α subunits (and hence expression of the HIF-α transcription factors). A germline PHD2 mutation has been reported in association with congenital erythrocytosis and recurrent extra-adrenal phaeochromocytoma. We undertook mutation analysis of PHD1, PHD2 and PHD3 in two cohorts of patients with features of inherited phaeochromocytoma (n=82) and inherited RCC (n=64) and no evidence of germline mutations in known susceptibility genes. No confirmed pathogenic mutations were detected suggesting that mutations in these genes are not a frequent cause of inherited phaeochromocytoma or RCC.

  8. Diploid yeast cells yield homozygous spontaneous mutations

    NASA Technical Reports Server (NTRS)

    Esposito, M. S.; Bruschi, C. V.; Brushi, C. V. (Principal Investigator)

    1993-01-01

    A leucine-requiring hybrid of Saccharomyces cerevisiae, homoallelic at the LEU1 locus (leu1-12/leu1-12) and heterozygous for three chromosome-VII genetic markers distal to the LEU1 locus, was employed to inquire: (1) whether spontaneous gene mutation and mitotic segregation of heterozygous markers occur in positive nonrandom association and (2) whether homozygous LEU1/LEU1 mutant diploids are generated. The results demonstrate that gene mutation of leu1-12 to LEU1 and mitotic segregation of heterozygous chromosome-VII markers occur in strong positive nonrandom association, suggesting that the stimulatory DNA lesion is both mutagenic and recombinogenic. In addition, genetic analysis of diploid Leu+ revertants revealed that approximately 3% of mutations of leu1-12 to LEU1 result in LEU1/LEU1 homozygotes. Red-white sectored Leu+ colonies exhibit genotypes that implicate post-replicational chromatid breakage and exchange near the site of leu1-12 reversion, chromosome loss, and subsequent restitution of diploidy, in the sequence of events leading to mutational homozygosis. By analogy, diploid cell populations can yield variants homozygous for novel recessive gene mutations at biologically significant rates. Mutational homozygosis may be relevant to both carcinogenesis and the evolution of asexual diploid organisms.

  9. A novel missense mutation in the ACTG1 gene in a family with congenital autosomal dominant deafness: A case report.

    PubMed

    Lee, Cha Gon; Jang, Jahyeon; Jin, Hyun-Seok

    2018-06-01

    The ACTG1 gene encodes the cytoskeletal protein γ-actin, which functions in non‑muscle cells and is abundant in the auditory hair cells of the cochlea. Autosomal dominant missense mutations in ACTG1 are associated with DFNA20/26, a disorder that is typically characterized by post‑lingual progressive hearing loss. To date, 17 missense mutations in ACTG1 have been reported in 20 families with DFNA20/26. The present study described a small family with autosomal dominant nonsyndromic hearing loss. A novel heterozygous missense mutation, c.94C>T (p.Pro32Ser), in ACTG1 was identified using the TruSight One sequencing panel. Notably, congenital hearing loss in our proband was identified by newborn hearing screening at birth. In silico predictions of protein structure and function indicate that the p.Pro32Ser mutation may result in conformational changes in γ‑actin. The present study expands the understanding of the phenotypic effects of heterozygous missense mutations in the ACTG1 gene. In specific, the present results emphasize that mutations in ACTG1 result in a diverse spectrum of onset ages, including congenital in addition to post‑lingual onset.

  10. Mutations in the LKB1 tumour suppressor are frequently detected in tumours from Caucasian but not Asian lung cancer patients

    PubMed Central

    Koivunen, J P; Kim, J; Lee, J; Rogers, A M; Park, J O; Zhao, X; Naoki, K; Okamoto, I; Nakagawa, K; Yeap, B Y; Meyerson, M; Wong, K-K; Richards, W G; Sugarbaker, D J; Johnson, B E; Jänne, P A

    2008-01-01

    Somatic mutations of LKB1 tumour suppressor gene have been detected in human cancers including non-small cell lung cancer (NSCLC). The relationship between LKB1 mutations and clinicopathological characteristics and other common oncogene mutations in NSCLC is inadequately described. In this study we evaluated tumour specimens from 310 patients with NSCLC including those with adenocarcinoma, adenosquamous carcinoma, and squamous cell carcinoma histologies. Tumours were obtained from patients of US (n=143) and Korean (n=167) origin and screened for LKB1, KRAS, BRAF, and EGFR mutations using RT—PCR-based SURVEYOR-WAVE method followed by Sanger sequencing. We detected mutations in the LKB1 gene in 34 tumours (11%). LKB1 mutation frequency was higher in NSCLC tumours of US origin (17%) compared with 5% in NSCLCs of Korean origin (P=0.001). They tended to occur more commonly in adenocarcinomas (13%) than in squamous cell carcinomas (5%) (P=0.066). LKB1 mutations associated with smoking history (P=0.007) and KRAS mutations (P=0.042) were almost mutually exclusive with EGFR mutations (P=0.002). The outcome of stages I and II NSCLC patients treated with surgery alone did not significantly differ based on LKB1 mutation status. Our study provides clinical and molecular characteristics of NSCLC, which harbour LKB1 mutations. PMID:18594528

  11. Mutations in the LKB1 tumour suppressor are frequently detected in tumours from Caucasian but not Asian lung cancer patients.

    PubMed

    Koivunen, J P; Kim, J; Lee, J; Rogers, A M; Park, J O; Zhao, X; Naoki, K; Okamoto, I; Nakagawa, K; Yeap, B Y; Meyerson, M; Wong, K-K; Richards, W G; Sugarbaker, D J; Johnson, B E; Jänne, P A

    2008-07-22

    Somatic mutations of LKB1 tumour suppressor gene have been detected in human cancers including non-small cell lung cancer (NSCLC). The relationship between LKB1 mutations and clinicopathological characteristics and other common oncogene mutations in NSCLC is inadequately described. In this study we evaluated tumour specimens from 310 patients with NSCLC including those with adenocarcinoma, adenosquamous carcinoma, and squamous cell carcinoma histologies. Tumours were obtained from patients of US (n=143) and Korean (n=167) origin and screened for LKB1, KRAS, BRAF, and EGFR mutations using RT-PCR-based SURVEYOR-WAVE method followed by Sanger sequencing. We detected mutations in the LKB1 gene in 34 tumours (11%). LKB1 mutation frequency was higher in NSCLC tumours of US origin (17%) compared with 5% in NSCLCs of Korean origin (P=0.001). They tended to occur more commonly in adenocarcinomas (13%) than in squamous cell carcinomas (5%) (P=0.066). LKB1 mutations associated with smoking history (P=0.007) and KRAS mutations (P=0.042) were almost mutually exclusive with EGFR mutations (P=0.002). The outcome of stages I and II NSCLC patients treated with surgery alone did not significantly differ based on LKB1 mutation status. Our study provides clinical and molecular characteristics of NSCLC, which harbour LKB1 mutations.

  12. Novel Mutations in PSENEN Gene in Two Chinese Acne Inversa Families Manifested as Familial Multiple Comedones and Dowling-Degos Disease

    PubMed Central

    Zhou, Cheng; Wen, Guang-Dong; Soe, Lwin Myint; Xu, Hong-Jun; Du, Juan; Zhang, Jian-Zhong

    2016-01-01

    Background: Acne inversa (AI), also called hidradenitis suppurativa, is a chronic, inflammatory, recurrent skin disease of the hair follicle. Familial AI shows autosomal-dominant inheritance caused by mutations in the γ-secretase genes. This study was aimed to identify the specific mutations in the γ-secretase genes in two Chinese families with AI. Methods: In this study, two Chinese families with AI were investigated. All the affected individuals in the two families mainly manifested with multiple comedones, pitted scars, and a few inflammatory nodules on their face, neck, trunk, axilla, buttocks, upper arms, and thighs. Reticulate pigmentation in the flexures areas resembled Dowling-Degos disease clinically and pathologically. In addition, one of the affected individuals developed anal canal squamous cell carcinoma. Molecular mutation analysis of γ-secretase genes including PSENEN, PSEN1, and NCSTN was performed by polymerase chain reaction and direct DNA sequencing. Results: Two novel mutations of PSENEN gene were identified, including a heterozygous missense mutation c.194T>G (p.L65R) and a splice site mutation c.167-2A>G. Conclusions: The identification of the two mutations could expand the spectrum of mutations in the γ-secretase genes underlying AI and provide valuable information for further study of genotype-phenotype correlations. PMID:27900998

  13. Relative deformability of red blood cells in sickle cell trait and sickle cell anemia by trapping and dragging

    NASA Astrophysics Data System (ADS)

    Solomon, Rance; Cooper, James; Welker, Gabriel; Aguilar, Elaura; Flanagan, Brooke; Pennycuff, Chelsey; Scott, David; Farone, Anthony; Farone, Mary; Erenso, Daniel; Mushi, Robert; del Pilar Aguinaga, Maria

    2013-06-01

    Genetic mutation of the β-globin gene or inheritance of this mutated gene changes the chemical composition of the oxygen-carrying hemoglobin molecule that could lead to either the heterozygote genotype, resulting in sickle cell trait (SCT), or the homozygote genotype, resulting in sickle cell anemia (SCA). These mutations could affect the reversible elastic deformations of the red blood cells (RBCs) which are vital for biological functions. We have investigated this effect by studying the differences in the deformability of RBCs from blood samples of an individual with SCT and an untreated patient with SCA along with hemoglobin quantitation of each blood sample. Infrared 1064 nm laser trap force along with drag shear force are used to induce deformation in the RBCs. Ultra2-High Performance Liquid Chromatography (UHPLC) is used for the hemoglobin quantitation.

  14. Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

    PubMed

    Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

    2008-01-01

    The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

  15. Gene editing rescue of a novel MPL mutant associated with congenital amegakaryocytic thrombocytopenia.

    PubMed

    Cleyrat, Cédric; Girard, Romain; Choi, Eun H; Jeziorski, Éric; Lavabre-Bertrand, Thierry; Hermouet, Sylvie; Carillo, Serge; Wilson, Bridget S

    2017-09-26

    Thrombopoietin (Tpo) and its receptor (Mpl) are the principal regulators of early and late thrombopoiesis and hematopoietic stem cell maintenance. Mutations in MPL can drastically impair its function and be a contributing factor in multiple hematologic malignancies, including congenital amegakaryocytic thrombocytopenia (CAMT). CAMT is characterized by severe thrombocytopenia at birth, which progresses to bone marrow failure and pancytopenia. Here we report unique familial cases of CAMT that presented with a previously unreported MPL mutation: T814C (W272R) in the background of the activating MPL G117T (K39N or Baltimore) mutation. Confocal microscopy, proliferation and surface biotinylation assays, co-immunoprecipitation, and western blotting analysis were used to elucidate the function and trafficking of Mpl mutants. Results showed that Mpl protein bearing the W272R mutation, alone or together with the K39N mutation, lacks detectable surface expression while being strongly colocalized with the endoplasmic reticulum (ER) marker calreticulin. Both WT and K39N-mutated Mpl were found to be signaling competent, but single or double mutants bearing W272R were unresponsive to Tpo. Function of the deficient Mpl receptor could be rescued by using 2 separate approaches: (1) GRASP55 overexpression, which partially restored Tpo-induced signaling of mutant Mpl by activating an autophagy-dependent secretory pathway and thus forcing ER-trapped immature receptors to traffic to the cell surface; and (2) CRISPR-Cas9 gene editing used to repair MPL T814C mutation in transfected cell lines and primary umbilical cord blood-derived CD34 + cells. We demonstrate proof of principle for rescue of mutant Mpl function by using gene editing of primary hematopoietic stem cells, which indicates direct therapeutic applications for CAMT patients.

  16. Gene editing rescue of a novel MPL mutant associated with congenital amegakaryocytic thrombocytopenia

    PubMed Central

    Girard, Romain; Choi, Eun H.; Jeziorski, Éric; Lavabre-Bertrand, Thierry; Hermouet, Sylvie; Carillo, Serge; Wilson, Bridget S.

    2017-01-01

    Thrombopoietin (Tpo) and its receptor (Mpl) are the principal regulators of early and late thrombopoiesis and hematopoietic stem cell maintenance. Mutations in MPL can drastically impair its function and be a contributing factor in multiple hematologic malignancies, including congenital amegakaryocytic thrombocytopenia (CAMT). CAMT is characterized by severe thrombocytopenia at birth, which progresses to bone marrow failure and pancytopenia. Here we report unique familial cases of CAMT that presented with a previously unreported MPL mutation: T814C (W272R) in the background of the activating MPL G117T (K39N or Baltimore) mutation. Confocal microscopy, proliferation and surface biotinylation assays, co-immunoprecipitation, and western blotting analysis were used to elucidate the function and trafficking of Mpl mutants. Results showed that Mpl protein bearing the W272R mutation, alone or together with the K39N mutation, lacks detectable surface expression while being strongly colocalized with the endoplasmic reticulum (ER) marker calreticulin. Both WT and K39N-mutated Mpl were found to be signaling competent, but single or double mutants bearing W272R were unresponsive to Tpo. Function of the deficient Mpl receptor could be rescued by using 2 separate approaches: (1) GRASP55 overexpression, which partially restored Tpo-induced signaling of mutant Mpl by activating an autophagy-dependent secretory pathway and thus forcing ER-trapped immature receptors to traffic to the cell surface; and (2) CRISPR-Cas9 gene editing used to repair MPL T814C mutation in transfected cell lines and primary umbilical cord blood–derived CD34+ cells. We demonstrate proof of principle for rescue of mutant Mpl function by using gene editing of primary hematopoietic stem cells, which indicates direct therapeutic applications for CAMT patients. PMID:29296828

  17. DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

    PubMed

    Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

    2006-02-01

    Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

  18. Clonal status of actionable driver events and the timing of mutational processes in cancer evolution.

    PubMed

    McGranahan, Nicholas; Favero, Francesco; de Bruin, Elza C; Birkbak, Nicolai Juul; Szallasi, Zoltan; Swanton, Charles

    2015-04-15

    Deciphering whether actionable driver mutations are found in all or a subset of tumor cells will likely be required to improve drug development and precision medicine strategies. We analyzed nine cancer types to determine the subclonal frequencies of driver events, to time mutational processes during cancer evolution, and to identify drivers of subclonal expansions. Although mutations in known driver genes typically occurred early in cancer evolution, we also identified later subclonal "actionable" mutations, including BRAF (V600E), IDH1 (R132H), PIK3CA (E545K), EGFR (L858R), and KRAS (G12D), which may compromise the efficacy of targeted therapy approaches. More than 20% of IDH1 mutations in glioblastomas, and 15% of mutations in genes in the PI3K (phosphatidylinositol 3-kinase)-AKT-mTOR (mammalian target of rapamycin) signaling axis across all tumor types were subclonal. Mutations in the RAS-MEK (mitogen-activated protein kinase kinase) signaling axis were less likely to be subclonal than mutations in genes associated with PI3K-AKT-mTOR signaling. Analysis of late mutations revealed a link between APOBEC-mediated mutagenesis and the acquisition of subclonal driver mutations and uncovered putative cancer genes involved in subclonal expansions, including CTNNA2 and ATXN1. Our results provide a pan-cancer census of driver events within the context of intratumor heterogeneity and reveal patterns of tumor evolution across cancers. The frequent presence of subclonal driver mutations suggests the need to stratify targeted therapy response according to the proportion of tumor cells in which the driver is identified. Copyright © 2015, American Association for the Advancement of Science.

  19. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed Central

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  20. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  1. Fanconi anemia: causes and consequences of genetic instability.

    PubMed

    Kalb, R; Neveling, K; Nanda, I; Schindler, D; Hoehn, H

    2006-01-01

    Fanconi anemia (FA) is a rare recessive disease that reflects the cellular and phenotypic consequences of genetic instability: growth retardation, congenital malformations, bone marrow failure, high risk of neoplasia, and premature aging. At the cellular level, manifestations of genetic instability include chromosomal breakage, cell cycle disturbance, and increased somatic mutation rates. FA cells are exquisitely sensitive towards oxygen and alkylating drugs such as mitomycin C or diepoxybutane, pointing to a function of FA genes in the defense against reactive oxygen species and other DNA damaging agents. FA is caused by biallelic mutations in at least 12 different genes which appear to function in the maintenance of genomic stability. Eight of the FA proteins form a nuclear core complex with a catalytic function involving ubiquitination of the central FANCD2 protein. The posttranslational modification of FANCD2 promotes its accumulation in nuclear foci, together with known DNA maintenance proteins such as BRCA1, BRCA2, and the RAD51 recombinase. Biallelic mutations in BRCA2 cause a severe FA-like phenotype, as do biallelic mutations in FANCD2. In fact, only leaky or hypomorphic mutations in this central group of FA genes appear to be compatible with life birth and survival. The newly discovered FANCJ (= BRIP1) and FANCM (= Hef ) genes correspond to known DNA-maintenance genes (helicase resp. helicase-associated endonuclease for fork-structured DNA). These genes provide the most convincing evidence to date of a direct involvement of FA genes in DNA repair functions associated with the resolution of DNA crosslinks and stalled replication forks. Even though genetic instability caused by mutational inactivation of the FANC genes has detrimental effects for the majority of FA patients, around 20% of patients appear to benefit from genetic instability since genetic instability also increases the chance of somatic reversion of their constitutional mutations. Intragenic crossover, gene conversion, back mutation and compensating mutations in cis have all been observed in revertant, and, consequently, mosaic FA-patients, leading to improved bone marrow function. There probably is no other experiment of nature in our species in which causes and consequences of genetic instability, including the role of reactive oxygen species, can be better documented and explored than in FA.

  2. The p.Leu167del Mutation in APOE Gene Causes Autosomal Dominant Hypercholesterolemia by Down-regulation of LDL Receptor Expression in Hepatocytes.

    PubMed

    Cenarro, Ana; Etxebarria, Aitor; de Castro-Orós, Isabel; Stef, Marianne; Bea, Ana M; Palacios, Lourdes; Mateo-Gallego, Rocío; Benito-Vicente, Asier; Ostolaza, Helena; Tejedor, Teresa; Martín, César; Civeira, Fernando

    2016-05-01

    The p.Leu167del mutation in the APOE gene has been associated with hyperlipidemia. Our objective was to determine the frequency of p.Leu167del mutation in APOE gene in subjects with autosomal dominant hypercholesterolemia (ADH) in whom LDLR, APOB, and PCSK9 mutations had been excluded and to identify the mechanisms by which this mutant apo E causes hypercholesterolemia. The APOE gene was analyzed in a case-control study. The study was conducted at a University Hospital Lipid Clinic. Two groups (ADH, 288 patients; control, 220 normolipidemic subjects) were included. We performed sequencing of APOE gene and proteomic and cellular experiments. To determine the frequency of the p.Leu167del mutation and the mechanism by which it causes hypercholesterolemia. In the ADH group, nine subjects (3.1%) were carriers of the APOE c.500_502delTCC, p.Leu167del mutation, cosegregating with hypercholesterolemia in studied families. Proteomic quantification of wild-type and mutant apo E in very low-density lipoprotein (VLDL) from carrier subjects revealed that apo E3 is almost a 5-fold increase compared to mutant apo E. Cultured cell studies revealed that VLDL from mutation carriers had a significantly higher uptake by HepG2 and THP-1 cells compared to VLDL from subjects with E3/E3 or E2/E2 genotypes. Transcriptional down-regulation of LDLR was also confirmed. p.Leu167del mutation in APOE gene is the cause of hypercholesterolemia in the 3.1% of our ADH subjects without LDLR, APOB, and PCSK9 mutations. The mechanism by which this mutation is associated to ADH is that VLDL carrying the mutant apo E produces LDLR down-regulation, thereby raising plasma low-density lipoprotein cholesterol levels.

  3. Intraclonal Cell Expansion and Selection Driven by B Cell Receptor in Chronic Lymphocytic Leukemia

    PubMed Central

    Colombo, Monica; Cutrona, Giovanna; Reverberi, Daniele; Fabris, Sonia; Neri, Antonino; Fabbi, Marina; Quintana, Giovanni; Quarta, Giovanni; Ghiotto, Fabio; Fais, Franco; Ferrarini, Manlio

    2011-01-01

    The mutational status of the immunoglobulin heavy-chain variable region (IGHV) genes utilized by chronic lymphocytic leukemia (CLL) clones defines two disease subgroups. Patients with unmutated IGHV have a more aggressive disease and a worse outcome than patients with cells having somatic IGHV gene mutations. Moreover, up to 30% of the unmutated CLL clones exhibit very similar or identical B cell receptors (BcR), often encoded by the same IG genes. These “stereotyped” BcRs have been classified into defined subsets. The presence of an IGHV gene somatic mutation and the utilization of a skewed gene repertoire compared with normal B cells together with the expression of stereotyped receptors by unmutated CLL clones may indicate stimulation/selection by antigenic epitopes. This antigenic stimulation may occur prior to or during neoplastic transformation, but it is unknown whether this stimulation/selection continues after leukemogenesis has ceased. In this study, we focused on seven CLL cases with stereotyped BcR Subset #8 found among a cohort of 700 patients; in six, the cells expressed IgG and utilized IGHV4-39 and IGKV1-39/IGKV1D-39 genes, as reported for Subset #8 BcR. One case exhibited special features, including expression of IgM or IgG by different subclones consequent to an isotype switch, allelic inclusion at the IGH locus in the IgM-expressing cells and a particular pattern of cytogenetic lesions. Collectively, the data indicate a process of antigenic stimulation/selection of the fully transformed CLL cells leading to the expansion of the Subset #8 IgG-bearing subclone. PMID:21541442

  4. Interallelic complementation of mutations in propionic acidemia by microinjection of mutant cDNAs into fibroblasts of affected patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Loyer, M.; Leclerc, D.; Gravel, R.A.

    1994-09-01

    Propionic acidemia is a rare autosomal recessive disorder resulting from defects of the {alpha} or {beta} subunit of biotin-dependent propionyl-CoA carboxylase (PCC). Mutations are assigned to defects of the PCCA ({alpha} subunit) or PCCB ({beta} subunit) gene through complementation studies after somatic fusion of patient cell lines. About two-thirds of patients with {beta} subunit defects (complementation group pccBC) show interallelic complementation in cell fusion experiments (subgroups pccB and pccC), monitored by the PCC-dependent metabolisms of {sup 14}C-propionate. Most patient cell lines are heteroallelic for two different mutations, leaving ambiguous the identity of the mutation participating in interallelic complementation. To identifymore » the complementing mutations, we have expressed {beta}-subunit cDNAs containing individual mutations by microinjection of the cDNAs in recipient cells from patients with {beta} subunit defects. Correction of the PCC defect was monitored by autoradiography of {sup 14}C-propionate incorporation. In some experiments, cDNAs were co-injected with a plasmid expressing the E. coli lacZ gene as a positive control for successful injection. Two mutations from the pccB subgroup showed complementation when injected into pccC cells; dupKICK140-143 and Pro228Leu. Similarly, two mutations from the pccC subgroup complemented after injection into pccB cells; {Delta}Ile408 and Arg410Trp. No mutation complemented with mutation of the pccBC group which are classified as non-complementing in cell fusion experiments. The results show that the complementing pccB mutations are found in the N-terminal half of the {beta} subunit, while the complementing pccC mutations cluxter at a site in the C-terminal half. The latter site is a candidate for the propionyl-CoA binding site based on sequence identity with a region of transcarboxylase from Propionibacterium shermanii.« less

  5. Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

    PubMed

    Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

    2018-03-01

    β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

  6. Comprehensive Identification of Mutations Responsible for Heterogeneous Vancomycin-Intermediate Staphylococcus aureus (hVISA)-to-VISA Conversion in Laboratory-Generated VISA Strains Derived from hVISA Clinical Strain Mu3

    PubMed Central

    Matsuo, Miki; Cui, Longzhu; Kim, Jeeyoung

    2013-01-01

    Heterogeneous vancomycin-intermediate Staphylococcus aureus (hVISA) spontaneously produces VISA cells within its cell population at a frequency of 10−6 or greater. We established a total of 45 VISA mutant strains independently obtained from hVISA Mu3 and its related strains by one-step vancomycin selection. We then performed high-throughput whole-genome sequencing of the 45 strains and their parent strains to identify the genes involved in the hVISA-to-VISA phenotypic conversion. A comparative genome study showed that all the VISA strains tested carried a unique set of mutations. All of the 45 VISA strains carried 1 to 4 mutations possibly affecting the expression of a total of 48 genes. Among them, 32 VISA strains carried only one gene affected by a single mutation. As many as 20 genes in more than eight functional categories were affected in the 32 VISA strains, which explained the extremely high rates of the hVISA-to-VISA phenotypic conversion. Five genes, rpoB, rpoC, walK, pbp4, and pp2c, were previously reported as being involved in vancomycin resistance. Fifteen remaining genes were newly identified as associated with vancomycin resistance in this study. The gene most frequently affected (6 out of 32 strains) was cmk, which encodes cytidylate kinase, followed closely by rpoB (5 out of 32), encoding the β subunit of RNA polymerase. A mutation prevalence study also revealed a sizable number of cmk mutants among clinical VISA strains (7 out of 38 [18%]). Reduced cytidylate kinase activity in cmk mutant strains is proposed to contribute to the hVISA-to-VISA phenotype conversion by thickening the cell wall and reducing the cell growth rate. PMID:24018261

  7. A New Way to Treat Brain Tumors: Targeting Proteins Coded by Microcephaly Genes?: Brain tumors and microcephaly arise from opposing derangements regulating progenitor growth. Drivers of microcephaly could be attractive brain tumor targets.

    PubMed

    Lang, Patrick Y; Gershon, Timothy R

    2018-05-01

    New targets for brain tumor therapies may be identified by mutations that cause hereditary microcephaly. Brain growth depends on the repeated proliferation of stem and progenitor cells. Microcephaly syndromes result from mutations that specifically impair the ability of brain progenitor or stem cells to proliferate, by inducing either premature differentiation or apoptosis. Brain tumors that derive from brain progenitor or stem cells may share many of the specific requirements of their cells of origin. These tumors may therefore be susceptible to disruptions of the protein products of genes that are mutated in microcephaly. The potential for the products of microcephaly genes to be therapeutic targets in brain tumors are highlighted hereby reviewing research on EG5, KIF14, ASPM, CDK6, and ATR. Treatments that disrupt these proteins may open new avenues for brain tumor therapy that have increased efficacy and decreased toxicity. © 2018 WILEY Periodicals, Inc.

  8. Exome and deep sequencing of clinically aggressive neuroblastoma reveal somatic mutations that affect key pathways involved in cancer progression

    PubMed Central

    Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D.; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario

    2016-01-01

    The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma. Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines. We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK. Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%. Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression. Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants. In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression. PMID:27009842

  9. Exome and deep sequencing of clinically aggressive neuroblastoma reveal somatic mutations that affect key pathways involved in cancer progression.

    PubMed

    Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario

    2016-04-19

    The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma.Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines.We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK.Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%.Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression.Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants.In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression.

  10. The lipodystrophic hotspot lamin A p.R482W mutation deregulates the mesodermal inducer T/Brachyury and early vascular differentiation gene networks.

    PubMed

    Briand, Nolwenn; Guénantin, Anne-Claire; Jeziorowska, Dorota; Shah, Akshay; Mantecon, Matthieu; Capel, Emilie; Garcia, Marie; Oldenburg, Anja; Paulsen, Jonas; Hulot, Jean-Sebastien; Vigouroux, Corinne; Collas, Philippe

    2018-04-15

    The p.R482W hotspot mutation in A-type nuclear lamins causes familial partial lipodystrophy of Dunnigan-type (FPLD2), a lipodystrophic syndrome complicated by early onset atherosclerosis. Molecular mechanisms underlying endothelial cell dysfunction conferred by the lamin A mutation remain elusive. However, lamin A regulates epigenetic developmental pathways and mutations could perturb these functions. Here, we demonstrate that lamin A R482W elicits endothelial differentiation defects in a developmental model of FPLD2. Genome modeling in fibroblasts from patients with FPLD2 caused by the lamin A R482W mutation reveals repositioning of the mesodermal regulator T/Brachyury locus towards the nuclear center relative to normal fibroblasts, suggesting enhanced activation propensity of the locus in a developmental model of FPLD2. Addressing this issue, we report phenotypic and transcriptional alterations in mesodermal and endothelial differentiation of induced pluripotent stem cells we generated from a patient with R482W-associated FPLD2. Correction of the LMNA mutation ameliorates R482W-associated phenotypes and gene expression. Transcriptomics links endothelial differentiation defects to decreased Polycomb-mediated repression of the T/Brachyury locus and over-activation of T target genes. Binding of the Polycomb repressor complex 2 to T/Brachyury is impaired by the mutated lamin A network, which is unable to properly associate with the locus. This leads to a deregulation of vascular gene expression over time. By connecting a lipodystrophic hotspot lamin A mutation to a disruption of early mesodermal gene expression and defective endothelial differentiation, we propose that the mutation rewires the fate of several lineages, resulting in multi-tissue pathogenic phenotypes.

  11. Differential RNA-seq analysis comparing APC-defective and APC-restored SW480 colorectal cancer cells.

    PubMed

    King, Lauren E; Love, Christopher G; Sieber, Oliver M; Faux, Maree C; Burgess, Antony W

    2016-03-01

    The adenomatous polyposis coli (APC) tumour suppressor gene is mutated in about 80% of colorectal cancers (CRC) Brannon et al. (2014) [1]. APC is a large multifunctional protein that regulates many biological functions including Wnt signalling (through the regulation of beta-catenin stability) Reya and Clevers (2005) [2], cell migration Kroboth et al. (2007), Sansom et al. (2004) [3], [4], mitosis Kaplan et al. (2001) [5], cell adhesion Faux et al. (2004), Carothers et al. (2001) [6], [7] and differentiation Sansom et al. (2004) [4]. Although the role of APC in CRC is often described as the deregulation of Wnt signalling, its other biological functions suggest that there are other factors at play that contribute to the onset of adenomas and the progression of CRC upon the truncation of APC. To identify genes and pathways that are dysregulated as a consequence of loss of function of APC, we compared the gene expression profiles of the APC mutated human CRC cell line SW480 following reintroduction of wild-type APC (SW480 + APC) or empty control vector (SW480 + vector control) Faux et al. (2004) . Here we describe the RNA-seq data derived for three biological replicates of parental SW480, SW480 + vector control and SW480 + APC cells, and present the bioinformatics pipeline used to test for differential gene expression and pathway enrichment analysis. A total of 1735 genes showed significant differential expression when APC was restored and were enriched for genes associated with cell polarity, Wnt signalling and the epithelial to mesenchymal transition. There was additional enrichment for genes involved in cell-cell adhesion, cell-matrix junctions, angiogenesis, axon morphogenesis and cell movement. The raw and analysed RNA-seq data have been deposited in the Gene Expression Omnibus (GEO) database under accession number GSE76307. This dataset is useful for further investigations of the impact of APC mutation on the properties of colorectal cancer cells.

  12. Genetics Home Reference: aldosterone-producing adenoma

    MedlinePlus

    ... genes. The most commonly mutated gene is KCNJ5 , accounting for an estimated 40 percent of the tumors, ... across cell membranes. These abnormalities overactivate a biochemical process that increases adrenal cell growth and division (proliferation), ...

  13. Rescue of ATP7B function in hepatocyte-like cells from Wilson's disease induced pluripotent stem cells using gene therapy or the chaperone drug curcumin.

    PubMed

    Zhang, Shiqiang; Chen, Shen; Li, Wen; Guo, Xiangpeng; Zhao, Ping; Xu, Jianyong; Chen, Yan; Pan, Qiong; Liu, Xiaorong; Zychlinski, Daniela; Lu, Hai; Tortorella, Micky D; Schambach, Axel; Wang, Yan; Pei, Duanqing; Esteban, Miguel A

    2011-08-15

    Directed hepatocyte differentiation from human induced pluripotent stem cells (iPSCs) potentially provides a unique platform for modeling liver genetic diseases and performing drug-toxicity screening in vitro. Wilson's disease is a genetic disease caused by mutations in the ATP7B gene, whose product is a liver transporter protein responsible for coordinated copper export into bile and blood. Interestingly, the spectrum of ATP7B mutations is vast and can influence clinical presentation (a variable spectrum of hepatic and neural manifestations), though the reason is not well understood. We describe the generation of iPSCs from a Chinese patient with Wilson's disease that bears the R778L Chinese hotspot mutation in the ATP7B gene. These iPSCs were pluripotent and could be readily differentiated into hepatocyte-like cells that displayed abnormal cytoplasmic localization of mutated ATP7B and defective copper transport. Moreover, gene correction using a self-inactivating lentiviral vector that expresses codon optimized-ATP7B or treatment with the chaperone drug curcumin could reverse the functional defect in vitro. Hence, our work describes an attractive model for studying the pathogenesis of Wilson's disease that is valuable for screening compounds or gene therapy approaches aimed to correct the abnormality. In the future, once relevant safety concerns (including the stability of the mature liver-like phenotype) and technical issues for the transplantation procedure are solved, hepatocyte-like cells from similarly genetically corrected iPSCs could be an option for autologous transplantation in Wilson's disease.

  14. Multiple giant cell lesions in patients with Noonan syndrome and cardio-facio-cutaneous syndrome.

    PubMed

    Neumann, Thomas E; Allanson, Judith; Kavamura, Ines; Kerr, Bronwyn; Neri, Giovanni; Noonan, Jacqueline; Cordeddu, Viviana; Gibson, Kate; Tzschach, Andreas; Krüger, Gabriele; Hoeltzenbein, Maria; Goecke, Timm O; Kehl, Hans Gerd; Albrecht, Beate; Luczak, Klaudiusz; Sasiadek, Maria M; Musante, Luciana; Laurie, Rohan; Peters, Hartmut; Tartaglia, Marco; Zenker, Martin; Kalscheuer, Vera

    2009-04-01

    Noonan syndrome (NS) and cardio-facio-cutaneous syndrome (CFCS) are related developmental disorders caused by mutations in genes encoding various components of the RAS-MAPK signaling cascade. NS is associated with mutations in the genes PTPN11, SOS1, RAF1, or KRAS, whereas CFCS can be caused by mutations in BRAF, MEK1, MEK2, or KRAS. The NS phenotype is rarely accompanied by multiple giant cell lesions (MGCL) of the jaw (Noonan-like/MGCL syndrome (NL/MGCLS)). PTPN11 mutations are the only genetic abnormalities reported so far in some patients with NL/MGCLS and in one individual with LEOPARD syndrome and MGCL. In a cohort of 75 NS patients previously tested negative for mutations in PTPN11 and KRAS, we detected SOS1 mutations in 11 individuals, four of whom had MGCL. To explore further the relevance of aberrant RAS-MAPK signaling in syndromic MGCL, we analyzed the established genes causing CFCS in three subjects with MGCL associated with a phenotype fitting CFCS. Mutations in BRAF or MEK1 were identified in these patients. All mutations detected in these seven patients with syndromic MGCL had previously been described in NS or CFCS without apparent MGCL. This study demonstrates that MGCL may occur in NS and CFCS with various underlying genetic alterations and no obvious genotype-phenotype correlation. This suggests that dysregulation of the RAS-MAPK pathway represents the common and basic molecular event predisposing to giant cell lesion formation in patients with NS and CFCS rather than specific mutation effects.

  15. Multiple giant cell lesions in patients with Noonan syndrome and cardio-facio-cutaneous syndrome

    PubMed Central

    Neumann, Thomas E; Allanson, Judith; Kavamura, Ines; Kerr, Bronwyn; Neri, Giovanni; Noonan, Jacqueline; Cordeddu, Viviana; Gibson, Kate; Tzschach, Andreas; Krüger, Gabriele; Hoeltzenbein, Maria; Goecke, Timm O; Kehl, Hans Gerd; Albrecht, Beate; Luczak, Klaudiusz; Sasiadek, Maria M; Musante, Luciana; Laurie, Rohan; Peters, Hartmut; Tartaglia, Marco; Zenker, Martin; Kalscheuer, Vera

    2009-01-01

    Noonan syndrome (NS) and cardio-facio-cutaneous syndrome (CFCS) are related developmental disorders caused by mutations in genes encoding various components of the RAS-MAPK signaling cascade. NS is associated with mutations in the genes PTPN11, SOS1, RAF1, or KRAS, whereas CFCS can be caused by mutations in BRAF, MEK1, MEK2, or KRAS. The NS phenotype is rarely accompanied by multiple giant cell lesions (MGCL) of the jaw (Noonan-like/MGCL syndrome (NL/MGCLS)). PTPN11 mutations are the only genetic abnormalities reported so far in some patients with NL/MGCLS and in one individual with LEOPARD syndrome and MGCL. In a cohort of 75 NS patients previously tested negative for mutations in PTPN11 and KRAS, we detected SOS1 mutations in 11 individuals, four of whom had MGCL. To explore further the relevance of aberrant RAS-MAPK signaling in syndromic MGCL, we analyzed the established genes causing CFCS in three subjects with MGCL associated with a phenotype fitting CFCS. Mutations in BRAF or MEK1 were identified in these patients. All mutations detected in these seven patients with syndromic MGCL had previously been described in NS or CFCS without apparent MGCL. This study demonstrates that MGCL may occur in NS and CFCS with various underlying genetic alterations and no obvious genotype–phenotype correlation. This suggests that dysregulation of the RAS-MAPK pathway represents the common and basic molecular event predisposing to giant cell lesion formation in patients with NS and CFCS rather than specific mutation effects. PMID:18854871

  16. CRISPR-mediated genotypic and phenotypic correction of a chronic granulomatous disease mutation in human iPS cells.

    PubMed

    Flynn, Rowan; Grundmann, Alexander; Renz, Peter; Hänseler, Walther; James, William S; Cowley, Sally A; Moore, Michael D

    2015-10-01

    Chronic granulomatous disease (CGD) is a rare genetic disease characterized by severe and persistent childhood infections. It is caused by the lack of an antipathogen oxidative burst, normally performed by phagocytic cells to contain and clear bacterial and fungal growth. Restoration of immune function can be achieved with heterologous bone marrow transplantation; however, autologous bone marrow transplantation would be a preferable option. Thus, a method is required to recapitulate the function of the diseased gene within the patient's own cells. Gene therapy approaches for CGD have employed randomly integrating viruses with concomitant issues of insertional mutagenesis, inaccurate gene dosage, and gene silencing. Here, we explore the potential of the recently described clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9 site-specific nuclease system to encourage repair of the endogenous gene by enhancing the levels of homologous recombination. Using induced pluripotent stem cells derived from a CGD patient containing a single intronic mutation in the CYBB gene, we show that footprintless gene editing is a viable option to correct disease mutations. Gene correction results in restoration of oxidative burst function in iPS-derived phagocytes by reintroduction of a previously skipped exon in the cytochrome b-245 heavy chain (CYBB) protein. This study provides proof-of-principle for a gene therapy approach to CGD treatment using CRISPR-Cas9. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

  17. Northwestern’s Kelleher Laboratory Develops Top-Down KRAS Isoform Assay to Detect Protein Mutations and Modifications | Office of Cancer Clinical Proteomics Research

    Cancer.gov

    Mutations in the RAS genes — KRAS, HRAS, and NRAS — have been identified in approximately 30% of all human cancers. While RAS gene family members encode proteins that are pivotal for cytoplasmic cell signaling, RAS oncogenes

  18. Mutations in the Kinase Domain of the HER2/ERBB2 Gene Identified in a Wide Variety of Human Cancers.

    PubMed

    Wen, Wenhsiang; Chen, Wangjuh Sting; Xiao, Nick; Bender, Ryan; Ghazalpour, Anatole; Tan, Zheng; Swensen, Jeffrey; Millis, Sherri Z; Basu, Gargi; Gatalica, Zoran; Press, Michael F

    2015-09-01

    The HER2 (official name ERBB2) gene encodes a membrane receptor in the epidermal growth factor receptor family amplified and overexpressed in adenocarcinoma. Activating mutations also occur in several cancers. We report mutation analyses of the HER2 kinase domain in 7497 histologically diverse cancers. Forty-five genes, including the kinase domain of HER2 with HER2 IHC and dual in situ hybridization, were analyzed in tumors from 7497 patients with cancer, including 850 breast, 770 colorectal, 910 non-small cell lung, 823 uterine or cervical, 1372 ovarian, and 297 pancreatic cancers, as well as 323 melanomas and 2152 other solid tumors. Sixty-nine HER2 kinase domain mutations were identified in tumors from 68 patients (approximately 1% of all cases, ranging from absent in sarcomas to 4% in urothelial cancers), which included previously published activating mutations and 13 novel mutations. Fourteen cases with coexisting HER2 mutation and amplification and/or overexpression were identified. Fifty-two of 68 patients had additional mutations in other analyzed genes, whereas 16 patients (23%) had HER2 mutations identified as the sole driver mutation. HER2 mutations coexisted with HER2 gene amplification and overexpression and with mutations in other functionally important genes. HER2 mutations were identified as the only driver mutation in a significant proportion of solid cancers. Evaluation of anti-HER2 therapies in nonamplified, HER2-mutated cancers is warranted. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  19. Overview of the mutation spectrum in familial exudative vitreoretinopathy and Norrie disease with identification of 21 novel variants in FZD4, LRP5, and NDP.

    PubMed

    Nikopoulos, Konstantinos; Venselaar, Hanka; Collin, Rob W J; Riveiro-Alvarez, Rosa; Boonstra, F Nienke; Hooymans, Johanna M M; Mukhopadhyay, Arijit; Shears, Deborah; van Bers, Marleen; de Wijs, Ilse J; van Essen, Anthonie J; Sijmons, Rolf H; Tilanus, Mauk A D; van Nouhuys, C Erik; Ayuso, Carmen; Hoefsloot, Lies H; Cremers, Frans P M

    2010-06-01

    Wnt signaling is a crucial component of the cell machinery orchestrating a series of physiological processes such as cell survival, proliferation, and migration. Among the plethora of roles that Wnt signaling plays, its canonical branch regulates eye organogenesis and angiogenesis. Mutations in the genes encoding the low density lipoprotein receptor protein 5 (LRP5) and frizzled 4 (FZD4), acting as coreceptors for Wnt ligands, cause familial exudative vitreoretinopathy (FEVR). Moreover, mutations in the gene encoding NDP, a ligand for these Wnt receptors, cause Norrie disease and FEVR. Both FEVR and Norrie disease share similar phenotypic characteristics, including abnormal vascularization of the peripheral retina and formation of fibrovascular masses in the eye that can lead to blindness. In this mutation update, we report 21 novel variants for FZD4, LRP5, and NDP, and discuss the putative functional consequences of missense mutations. In addition, we provide a comprehensive overview of all previously published variants in the aforementioned genes and summarize the phenotypic characteristics in mouse models carrying mutations in the orthologous genes. The increasing molecular understanding of Wnt signaling, related to ocular development and blood supply, offers more tools for accurate disease diagnosis that may be important in the development of therapeutic interventions.

  20. Adult high-grade B-cell lymphoma with Burkitt lymphoma signature: genomic features and potential therapeutic targets.

    PubMed

    Bouska, Alyssa; Bi, Chengfeng; Lone, Waseem; Zhang, Weiwei; Kedwaii, Ambreen; Heavican, Tayla; Lachel, Cynthia M; Yu, Jiayu; Ferro, Roberto; Eldorghamy, Nanees; Greiner, Timothy C; Vose, Julie; Weisenburger, Dennis D; Gascoyne, Randy D; Rosenwald, Andreas; Ott, German; Campo, Elias; Rimsza, Lisa M; Jaffe, Elaine S; Braziel, Rita M; Siebert, Reiner; Miles, Rodney R; Dave, Sandeep; Reddy, Anupama; Delabie, Jan; Staudt, Louis M; Song, Joo Y; McKeithan, Timothy W; Fu, Kai; Green, Michael; Chan, Wing C; Iqbal, Javeed

    2017-10-19

    The adult high-grade B-cell lymphomas sharing molecular features with Burkitt lymphoma (BL) are highly aggressive lymphomas with poor clinical outcome. High-resolution structural and functional genomic analysis of adult Burkitt lymphoma (BL) and high-grade B-cell lymphoma with BL gene signature (adult-molecularly defined BL [mBL]) revealed the MYC-ARF-p53 axis as the primary deregulated pathway. Adult-mBL had either unique or more frequent genomic aberrations (del13q14, del17p, gain8q24, and gain18q21) compared with pediatric-mBL, but shared commonly mutated genes. Mutations in genes promoting the tonic B-cell receptor (BCR)→PI3K pathway ( TCF3 and ID3 ) did not differ by age, whereas effectors of chronic BCR→NF-κB signaling were associated with adult-mBL. A subset of adult-mBL had BCL2 translocation and mutation and elevated BCL2 mRNA and protein expression, but had a mutation profile similar to mBL. These double-hit lymphomas may have arisen from a tumor precursor that acquired both BCL2 and MYC translocations and/or KMT2D ( MLL2 ) mutation. Gain/amplification of MIR17HG and its paralogue loci was observed in 50% of adult-mBL. In vitro studies suggested miR-17∼92 's role in constitutive activation of BCR signaling and sensitivity to ibrutinib. Overall integrative analysis identified an interrelated gene network affected by copy number and mutation, leading to disruption of the p53 pathway and the BCR→PI3K or NF-κB activation, which can be further exploited in vivo by small-molecule inhibitors for effective therapy in adult-mBL.

  1. Diverse Developmental Disorders from The One Ring: Distinct Molecular Pathways Underlie the Cohesinopathies

    PubMed Central

    Horsfield, Julia A.; Print, Cristin G.; Mönnich, Maren

    2012-01-01

    The multi-subunit protein complex, cohesin, is responsible for sister chromatid cohesion during cell division. The interaction of cohesin with DNA is controlled by a number of additional regulatory proteins. Mutations in cohesin, or its regulators, cause a spectrum of human developmental syndromes known as the “cohesinopathies.” Cohesinopathy disorders include Cornelia de Lange Syndrome and Roberts Syndrome. The discovery of novel roles for chromatid cohesion proteins in regulating gene expression led to the idea that cohesinopathies are caused by dysregulation of multiple genes downstream of mutations in cohesion proteins. Consistent with this idea, Drosophila, mouse, and zebrafish cohesinopathy models all show altered expression of developmental genes. However, there appears to be incomplete overlap among dysregulated genes downstream of mutations in different components of the cohesion apparatus. This is surprising because mutations in all cohesion proteins would be predicted to affect cohesin’s roles in cell division and gene expression in similar ways. Here we review the differences and similarities between genetic pathways downstream of components of the cohesion apparatus, and discuss how such differences might arise, and contribute to the spectrum of cohesinopathy disorders. We propose that mutations in different elements of the cohesion apparatus have distinct developmental outcomes that can be explained by sometimes subtly different molecular effects. PMID:22988450

  2. Nivolumab and Plinabulin in Treating Patients With Stage IIIB-IV, Recurrent, or Metastatic Non-small Cell Lung Cancer

    ClinicalTrials.gov

    2017-08-29

    ALK Gene Translocation; EGFR Activating Mutation; Recurrent Non-Small Cell Lung Carcinoma; ROS1 Gene Translocation; Stage IIIB Non-Small Cell Lung Cancer AJCC v7; Stage IV Non-Small Cell Lung Cancer AJCC v7

  3. Introduction of a point mutation into the mouse genome by homologous recombination in embryonic stem cells using a replacement type vector with a selectable marker.

    PubMed

    Rubinstein, M; Japón, M A; Low, M J

    1993-06-11

    The introduction of small mutations instead of null alleles into the mouse genome has broad applications to the study of protein structure-function relationships and the creation of animal models of human genetic diseases. To test a simple mutational strategy we designed a targeting vector for the mouse proopiomelanocortin (POMC) gene containing a single nucleotide insertion that converts the initial tyrosine codon of beta-endorphin 1-31 to a premature translational termination codon and introduces a unique Hpal endonuclease restriction site. The targeting vector also contains a neo cassette immediately 3' to the last POMC exon and a herpes simplex virus thymidine kinase cassette to allow positive and negative selection. Homologous recombination occurred at a frequency of 1/30 clones of electroporated embryonic stem cells selected in G418 and gancyclovir. 10/11 clones identified initially by a polymerase chain reaction (PCR) strategy had the predicted structure without evidence of concatemer formation by Southern blot analysis. We used a combination of Hpa I digestion of PCR amplified fragments and direct nucleotide sequencing to further confirm that the point mutation was retained in 9/10 clones. The POMC gene was transcriptionally silent in embryonic stem cells and the targeted allele was not activated by the downstream phosphoglycerate kinase-1 promoter that transcribed the neo gene. Under the electroporation conditions used, we have demonstrated that a point mutation can be introduced with high efficiency and precision into the POMC gene using a replacement type vector containing a retained selectable marker without affecting expression of the allele in the embryonic stem cells. A similar strategy may be useful for a wide range of genes.

  4. Introduction of a point mutation into the mouse genome by homologous recombination in embryonic stem cells using a replacement type vector with a selectable marker.

    PubMed Central

    Rubinstein, M; Japón, M A; Low, M J

    1993-01-01

    The introduction of small mutations instead of null alleles into the mouse genome has broad applications to the study of protein structure-function relationships and the creation of animal models of human genetic diseases. To test a simple mutational strategy we designed a targeting vector for the mouse proopiomelanocortin (POMC) gene containing a single nucleotide insertion that converts the initial tyrosine codon of beta-endorphin 1-31 to a premature translational termination codon and introduces a unique Hpal endonuclease restriction site. The targeting vector also contains a neo cassette immediately 3' to the last POMC exon and a herpes simplex virus thymidine kinase cassette to allow positive and negative selection. Homologous recombination occurred at a frequency of 1/30 clones of electroporated embryonic stem cells selected in G418 and gancyclovir. 10/11 clones identified initially by a polymerase chain reaction (PCR) strategy had the predicted structure without evidence of concatemer formation by Southern blot analysis. We used a combination of Hpa I digestion of PCR amplified fragments and direct nucleotide sequencing to further confirm that the point mutation was retained in 9/10 clones. The POMC gene was transcriptionally silent in embryonic stem cells and the targeted allele was not activated by the downstream phosphoglycerate kinase-1 promoter that transcribed the neo gene. Under the electroporation conditions used, we have demonstrated that a point mutation can be introduced with high efficiency and precision into the POMC gene using a replacement type vector containing a retained selectable marker without affecting expression of the allele in the embryonic stem cells. A similar strategy may be useful for a wide range of genes. Images PMID:8392702

  5. ApcMin, A Mutation in the Murine Apc Gene, Predisposes to Mammary Carcinomas and Focal Alveolar Hyperplasias

    NASA Astrophysics Data System (ADS)

    Moser, Amy Rapaich; Mattes, Ellen M.; Dove, William F.; Lindstrom, Mary J.; Haag, Jill D.; Gould, Michael N.

    1993-10-01

    ApcMin (Min, multiple intestinal neoplasia) is a point mutation in the murine homolog of the APC gene. Min/+ mice develop multiple intestinal adenomas, as do humans carrying germ-line mutations in APC. Female mice carrying Min are also prone to develop mammary tumors. Min/+ mammary glands are more sensitive to chemical carcinogenesis than are +/+ mammary glands. Transplantation of mammary cells from Min/+ or +/+ donors into +/+ hosts demonstrates that the propensity to develop mammary tumors is intrinsic to the Min/+ mammary cells. Long-term grafts of Min/+ mammary glands also gave rise to focal alveolar hyperplasias, indicating that the presence of the Min mutation also has a role in the development of these lesions.

  6. CT Radiogenomic Characterization of EGFR, K-RAS, and ALK Mutations in Non-Small Cell Lung Cancer.

    PubMed

    Rizzo, Stefania; Petrella, Francesco; Buscarino, Valentina; De Maria, Federica; Raimondi, Sara; Barberis, Massimo; Fumagalli, Caterina; Spitaleri, Gianluca; Rampinelli, Cristiano; De Marinis, Filippo; Spaggiari, Lorenzo; Bellomi, Massimo

    2016-01-01

    To assess the association between CT features and EGFR, ALK, KRAS mutations in non-small cell lung cancer. Patients undergoing chest CT and testing for the above gene mutations were included. Qualitative evaluation of CTs included: lobe; lesion diameter; shape; margins; ground-glass opacity; density; cavitation; air bronchogram; pleural thickening; intratumoral necrosis; nodules in tumour lobe; nodules in non-tumour lobes; pleural retraction; location; calcifications; emphysema; fibrosis; pleural contact; pleural effusion. Statistical analysis was performed to assess association of features with each gene mutation. ROC curves for gene mutations were drawn; the corresponding area under the curve was calculated. P-values <0.05 were considered significant. Of 285 patients, 60/280 (21.43 %) were positive for EGFR mutation; 31/270 (11.48 %) for ALK rearrangement; 64/240 (26.67 %) for KRAS mutation. EGFR mutation was associated with air bronchogram, pleural retraction, females, non-smokers, small lesion size, and absence of fibrosis. ALK rearrangements were associated with age and pleural effusion. KRAS mutation was associated with round shape, nodules in non-tumour lobes, and smoking. This study disclosed associations between CT features and alterations of EGFR (air bronchogram, pleural retraction, small lesion size, absence of fibrosis), ALK (pleural effusion) and KRAS (round lesion shape, nodules in non-tumour lobes). Air bronchogram, pleural retraction, small size relate to EGFR mutation in NSCLC. Pleural effusion and younger age relate to ALK mutation. Round lesion shape, nodules in non-tumour lobes relate to KRAS mutation.

  7. Assessing somatic hypermutation in Ramos B cells after overexpression or knockdown of specific genes.

    PubMed

    Upton, Dana C; Unniraman, Shyam

    2011-11-01

    B cells start their life with low affinity antibodies generated by V(D)J recombination. However, upon detecting a pathogen, the variable (V) region of an immunoglobulin (Ig) gene is mutated approximately 100,000-fold more than the rest of the genome through somatic hypermutation (SHM), resulting in high affinity antibodies. In addition, class switch recombination (CSR) produces antibodies with different effector functions depending on the kind of immune response that is needed for a particular pathogen. Both CSR and SHM are initiated by activation-induced cytidine deaminase (AID), which deaminates cytosine residues in DNA to produce uracils. These uracils are processed by error-prone forms of repair pathways, eventually leading to mutations and recombination. Our current understanding of the molecular details of SHM and CSR come from a combination of studies in mice, primary cells, cell lines, and cell-free experiments. Mouse models remain the gold standard with genetic knockouts showing critical roles for many repair factors (e.g. Ung, Msh2, Msh6, Exo1, and polymerase η). However, not all genes are amenable for knockout studies. For example, knockouts of several double-strand break repair proteins are embryonically lethal or impair B-cell development. Moreover, sometimes the specific function of a protein in SHM or CSR may be masked by more global defects caused by the knockout. In addition, since experiments in mice can be lengthy, altering expression of individual genes in cell lines has become an increasingly popular first step to identifying and characterizing candidate genes. Ramos - a Burkitt lymphoma cell line that constitutively undergoes SHM - has been a popular cell-line model to study SHM. One advantage of Ramos cells is that they have a built-in convenient semi-quantitative measure of SHM. Wild type cells express IgM and, as they pick up mutations, some of the mutations knock out IgM expression. Therefore, assaying IgM loss by fluorescence-activated cell scanning (FACS) provides a quick read-out for the level of SHM. A more quantitative measurement of SHM can be obtained by directly sequencing the antibody genes. Since Ramos cells are difficult to transfect, we produce stable derivatives that have increased or lowered expression of an individual gene by infecting cells with retroviral or lentiviral constructs that contain either an overexpression cassette or a short hairpin RNA (shRNA), respectively. Here, we describe how we infect Ramos cells and then use these cells to investigate the role of specific genes on SHM (Figure 1).

  8. A novel mutation in PGAP2 gene causes developmental delay, intellectual disability, epilepsy and microcephaly in consanguineous Saudi family.

    PubMed

    Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H

    2016-12-15

    PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Mutant NDUFS3 subunit of mitochondrial complex I causes Leigh syndrome.

    PubMed

    Bénit, P; Slama, A; Cartault, F; Giurgea, I; Chretien, D; Lebon, S; Marsac, C; Munnich, A; Rötig, A; Rustin, P

    2004-01-01

    Respiratory chain complex I deficiency represents a genetically heterogeneous group of diseases resulting from mutations in mitochondrial or nuclear genes. Mutations have been reported in 13 of the 14 subunits encoding the core of complex I (seven mitochondrial and six nuclear genes) and these result in Leigh or Leigh-like syndromes or cardiomyopathy. In this study, a combination of denaturing high performance liquid chromatography and sequence analysis was used to study the NDUFS3 gene in a series of complex I deficient patients. Mutations found in this gene (NADH dehydrogenase iron-sulphur protein 3), coding for the seventh and last subunit of complex I core, were shown to cause late onset Leigh syndrome, optic atrophy, and complex I deficiency. A biochemical diagnosis of complex I deficiency on cultured amniocytes from a later pregnancy was confirmed through the identification of disease causing NDUFS3 mutations in these cells. While mutations in the NDUFS3 gene thus result in Leigh syndrome, a dissimilar clinical phenotype is observed in mutations in the NDUFV2 and NDUFS2 genes, resulting in encephalomyopathy and cardiomyopathy. The reasons for these differences are uncertain.

  10. Mutations in cell elongation genes mreB, mrdA and mrdB suppress the shape defect of RodZ-deficient cells.

    PubMed

    Shiomi, Daisuke; Toyoda, Atsushi; Aizu, Tomoyuki; Ejima, Fumio; Fujiyama, Asao; Shini, Tadasu; Kohara, Yuji; Niki, Hironori

    2013-03-01

    RodZ interacts with MreB and both factors are required to maintain the rod shape of Escherichia coli. The assembly of MreB into filaments regulates the subcellular arrangement of a group of enzymes that synthesizes the peptidoglycan (PG) layer. However, it is still unknown how polymerization of MreB determines the rod shape of bacterial cells. Regulatory factor(s) are likely to be involved in controlling the function and dynamics of MreB. We isolated suppressor mutations to partially recover the rod shape in rodZ deletion mutants and found that some of the suppressor mutations occurred in mreB. All of the mreB mutations were in or in the vicinity of domain IA of MreB. Those mreB mutations changed the property of MreB filaments in vivo. In addition, suppressor mutations were found in the periplasmic regions in PBP2 and RodA, encoded by mrdA and mrdB genes. Similar to MreB and RodZ, PBP2 and RodA are pivotal to the cell wall elongation process. Thus, we found that mutations in domain IA of MreB and in the periplasmic domain of PBP2 and RodA can restore growth and rod shape to ΔrodZ cells, possibly by changing the requirements of MreB in the process. © 2013 Blackwell Publishing Ltd.

  11. Mutations in cell elongation genes mreB, mrdA and mrdB suppress the shape defect of RodZ-deficient cells

    PubMed Central

    Shiomi, Daisuke; Toyoda, Atsushi; Aizu, Tomoyuki; Ejima, Fumio; Fujiyama, Asao; Shini, Tadasu; Kohara, Yuji; Niki, Hironori

    2013-01-01

    RodZ interacts with MreB and both factors are required to maintain the rod shape of Escherichia coli. The assembly of MreB into filaments regulates the subcellular arrangement of a group of enzymes that synthesizes the peptidoglycan (PG) layer. However, it is still unknown how polymerization of MreB determines the rod shape of bacterial cells. Regulatory factor(s) are likely to be involved in controlling the function and dynamics of MreB. We isolated suppressor mutations to partially recover the rod shape in rodZ deletion mutants and found that some of the suppressor mutations occurred in mreB. All of the mreB mutations were in or in the vicinity of domain IA of MreB. Those mreB mutations changed the property of MreB filaments in vivo. In addition, suppressor mutations were found in the periplasmic regions in PBP2 and RodA, encoded by mrdA and mrdB genes. Similar to MreB and RodZ, PBP2 and RodA are pivotal to the cell wall elongation process. Thus, we found that mutations in domain IA of MreB and in the periplasmic domain of PBP2 and RodA can restore growth and rod shape to ΔrodZ cells, possibly by changing the requirements of MreB in the process. PMID:23301723

  12. Colon and Endometrial Cancers with Mismatch Repair Deficiency can Arise from Somatic, Rather Than Germline, Mutations

    PubMed Central

    Haraldsdottir, Sigurdis; Hampel, Heather; Tomsic, Jerneja; Frankel, Wendy L.; Pearlman, Rachel; de la Chapelle, Albert; Pritchard, Colin C.

    2014-01-01

    Background & Aims Patients with Lynch syndrome carry germline mutations in single alleles of genes encoding the MMR proteins MLH1, MSH2, MSH6 and PMS2; when the second allele becomes mutated, cancer can develop. Increased screening for Lynch syndrome has identified patients with tumors that have deficiency in MMR, but no germline mutations in genes encoding MMR proteins. We investigated whether tumors with deficient MMR had acquired somatic mutations in patients without germline mutations in MMR genes using next-generation sequencing. Methods We analyzed blood and tumor samples from 32 patients with colorectal or endometrial cancer who participated in Lynch syndrome screening studies in Ohio and were found to have tumors with MMR deficiency (based on microsatellite instability and/or absence of MMR proteins in immunohistochemical analysis, without hypermethylation of MLH1), but no germline mutations in MMR genes. Tumor DNA was sequenced for MLH1, MSH2, MSH6, PMS2, EPCAM, POLE and POLD1 with ColoSeq and mutation frequencies were established. Results Twenty-two of 32 patients (69%) were found to have two somatic (tumor) mutations in MMR genes encoding proteins that were lost from tumor samples, based on immunohistochemistry. Of the 10 tumors without somatic mutations in MMR genes, 3 had somatic mutations with possible loss of heterozygosity that could lead to MMR deficiency, 6 were found to be false-positive results (19%), and 1 had no mutations known to be associated with MMR deficiency. All of the tumors found to have somatic MMR mutations were of the hypermutated phenotype (>12 mutations/Mb); 6 had mutation frequencies >200 per Mb, and 5 of these had somatic mutations in POLE, which encodes a DNA polymerase. Conclusions Some patients are found to have tumors with MMR deficiency during screening for Lynch syndrome, yet have no identifiable germline mutations in MMR genes. We found that almost 70% of these patients acquire somatic mutations in MMR genes, leading to a hypermutated phenotype of tumor cells. Patients with colon or endometrial cancers with MMR deficiency not explained by germline mutations might undergo analysis for tumor mutations in MMR genes, to guide future surveillance guidelines. PMID:25194673

  13. Mutational analysis of single circulating tumor cells by next generation sequencing in metastatic breast cancer.

    PubMed

    De Luca, Francesca; Rotunno, Giada; Salvianti, Francesca; Galardi, Francesca; Pestrin, Marta; Gabellini, Stefano; Simi, Lisa; Mancini, Irene; Vannucchi, Alessandro Maria; Pazzagli, Mario; Di Leo, Angelo; Pinzani, Pamela

    2016-05-03

    Circulating Tumor Cells (CTCs) represent a "liquid biopsy" of the tumor potentially allowing real-time monitoring of cancer biology and therapies in individual patients.The purpose of the study was to explore the applicability of a protocol for the molecular characterization of single CTCs by Next Generation Sequencing (NGS) in order to investigate cell heterogeneity and provide a tool for a personalized medicine approach.CTCs were enriched and enumerated by CellSearch in blood from four metastatic breast cancer patients and singularly isolated by DEPArray. Upon whole genome amplification 3-5 single CTCs per patient were analyzed by NGS for 50 cancer-related genes.We found 51 sequence variants in 25 genes. We observed inter- and intra-patient heterogeneity in the mutational status of CTCs.The highest number of somatic deleterious mutations was found in the gene TP53, whose mutation is associated with adverse prognosis in breast cancer.The discordance between the mutational status of the primary tumor and CTCs observed in 3 patients suggests that, in advanced stages of cancer, CTC characteristics are more closely linked to the dynamic modifications of the disease status.In one patient the mutational profiles of CTCs before and during treatment shared only few sequence variants.This study supports the applicability of a non-invasive approach based on the liquid biopsy in metastatic breast cancer patients which, in perspective, should allow investigating the clonal evolution of the tumor for the development of new therapeutic strategies in precision medicine.

  14. Common Variable Immunodeficiency Caused by FANC Mutations.

    PubMed

    Sekinaka, Yujin; Mitsuiki, Noriko; Imai, Kohsuke; Yabe, Miharu; Yabe, Hiromasa; Mitsui-Sekinaka, Kanako; Honma, Kenichi; Takagi, Masatoshi; Arai, Ayako; Yoshida, Kenichi; Okuno, Yusuke; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Miyano, Satoru; Muramatsu, Hideki; Kojima, Seiji; Hira, Asuka; Takata, Minoru; Ohara, Osamu; Ogawa, Seishi; Morio, Tomohiro; Nonoyama, Shigeaki

    2017-07-01

    Common variable immunodeficiency (CVID) is the most common adult-onset primary antibody deficiency disease due to various causative genes. Several genes, which are known to be the cause of different diseases, have recently been reported as the cause of CVID in patients by performing whole exome sequencing (WES) analysis. Here, we found FANC gene mutations as a cause of adult-onset CVID in two patients. B cells were absent and CD4 + T cells were skewed toward CD45RO + memory T cells. T-cell receptor excision circles (TRECs) and signal joint kappa-deleting recombination excision circles (sjKRECs) were undetectable in both patients. Both patients had no anemia, neutropenia, or thrombocytopenia. Using WES, we identified compound heterozygous mutations of FANCE in one patient and homozygous mutation of FANCA in another patient. The impaired function of FANC protein complex was confirmed by a monoubiquitination assay and by chromosome fragility test. We then performed several immunological evaluations including quantitative lymphocyte analysis and TRECs/sjKRECs analysis for 32 individuals with Fanconi anemia (FA). In total, 22 FA patients (68.8%) were found to have immunological abnormalities, suggesting that such immunological findings may be common in FA patients. These data indicate that FANC mutations are involved in impaired lymphogenesis probably by the accumulation of DNA replication stress, leading to CVID. It is important to diagnose FA because it drastically changes clinical management. We propose that FANC mutations can cause isolated immunodeficiency in addition to bone marrow failure and malignancy.

  15. Genotyping non-small cell lung cancer (NSCLC) in Latin America.

    PubMed

    Arrieta, Oscar; Cardona, Andrés Felipe; Federico Bramuglia, Guillermo; Gallo, Aly; Campos-Parra, Alma D; Serrano, Silvia; Castro, Marcelo; Avilés, Alejandro; Amorin, Edgar; Kirchuk, Ricardo; Cuello, Mauricio; Borbolla, José; Riemersma, Omar; Becerra, Henry; Rosell, Rafael

    2011-11-01

    Frequency of mutations in EGFR and KRAS in non-small cell lung cancer (NSCLC) is different between ethnic groups; however, there is no information in Latin-American population. A total of 1150 biopsies of NSCLC patients from Latin America (Argentina, Colombia, Peru, and Mexico) were used extracting genomic DNA to perform direct sequencing of EGFR gene (exons 18 and 21) and KRAS gene in 650 samples. In Mexico, Scorpions ARMS was also used to obtain a genetic profile. We report the frequency of mutations in EGFR and KRAS genes in four Latin-American countries (n = 1150). Frequency of EGFR mutations in NSCLC was 33.2% (95% confidence interval [CI] 30.5-35.9) (Argentina 19.3%, Colombia 24.8%, Mexico 31.2%, and Peru 67%). The frequency of KRAS mutations was 16.6% (95% CI 13.8-19.4). EGFR mutations were independently associated with adenocarcinoma histology, older age, nonsmokers, and absence of KRAS mutations. Overall response rate to tyrosine kinase inhibitors in EGFR-mutated patients (n = 56) was 62.5% (95% CI 50-75) with a median overall survival of 16.5 months (95% CI 12.4-20.6). Our findings suggest that the frequency of EGFR mutations in Latin America lies between that of Asian and Caucasian populations and therefore support the genetic heterogeneity of NSCLC around the world.

  16. Modeling Treatment Response for Lamin A/C Related Dilated Cardiomyopathy in Human Induced Pluripotent Stem Cells.

    PubMed

    Lee, Yee-Ki; Lau, Yee-Man; Cai, Zhu-Jun; Lai, Wing-Hon; Wong, Lai-Yung; Tse, Hung-Fat; Ng, Kwong-Man; Siu, Chung-Wah

    2017-07-28

    Precision medicine is an emerging approach to disease treatment and prevention that takes into account individual variability in the environment, lifestyle, and genetic makeup of patients. Patient-specific human induced pluripotent stem cells hold promise to transform precision medicine into real-life clinical practice. Lamin A/C (LMNA)-related cardiomyopathy is the most common inherited cardiomyopathy in which a substantial proportion of mutations in the LMNA gene are of nonsense mutation. PTC124 induces translational read-through over the premature stop codon and restores production of the full-length proteins from the affected genes. In this study we generated human induced pluripotent stem cells-derived cardiomyocytes from patients who harbored different LMNA mutations (nonsense and frameshift) to evaluate the potential therapeutic effects of PTC124 in LMNA -related cardiomyopathy. We generated human induced pluripotent stem cells lines from 3 patients who carried distinctive mutations (R225X, Q354X, and T518fs) in the LMNA gene. The cardiomyocytes derived from these human induced pluripotent stem cells lines reproduced the pathophysiological hallmarks of LMNA -related cardiomyopathy. Interestingly, PTC124 treatment increased the production of full-length LMNA proteins in only the R225X mutant, not in other mutations. Functional evaluation experiments on the R225X mutant further demonstrated that PTC124 treatment not only reduced nuclear blebbing and electrical stress-induced apoptosis but also improved the excitation-contraction coupling of the affected cardiomyocytes. Using cardiomyocytes derived from human induced pluripotent stem cells carrying different LMNA mutations, we demonstrated that the effect of PTC124 is codon selective. A premature stop codon UGA appeared to be most responsive to PTC124 treatment. © 2017 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

  17. Distinct contributions of replication and transcription to mutation rate variation of human genomes.

    PubMed

    Cui, Peng; Ding, Feng; Lin, Qiang; Zhang, Lingfang; Li, Ang; Zhang, Zhang; Hu, Songnian; Yu, Jun

    2012-02-01

    Here, we evaluate the contribution of two major biological processes--DNA replication and transcription--to mutation rate variation in human genomes. Based on analysis of the public human tissue transcriptomics data, high-resolution replicating map of Hela cells and dbSNP data, we present significant correlations between expression breadth, replication time in local regions and SNP density. SNP density of tissue-specific (TS) genes is significantly higher than that of housekeeping (HK) genes. TS genes tend to locate in late-replicating genomic regions and genes in such regions have a higher SNP density compared to those in early-replication regions. In addition, SNP density is found to be positively correlated with expression level among HK genes. We conclude that the process of DNA replication generates stronger mutational pressure than transcription-associated biological processes do, resulting in an increase of mutation rate in TS genes while having weaker effects on HK genes. In contrast, transcription-associated processes are mainly responsible for the accumulation of mutations in highly-expressed HK genes. Copyright © 2012 Beijing Genomics Institute. Published by Elsevier Ltd. All rights reserved.

  18. Genetics and Pathogenesis of Diffuse Large B-Cell Lymphoma.

    PubMed

    Schmitz, Roland; Wright, George W; Huang, Da Wei; Johnson, Calvin A; Phelan, James D; Wang, James Q; Roulland, Sandrine; Kasbekar, Monica; Young, Ryan M; Shaffer, Arthur L; Hodson, Daniel J; Xiao, Wenming; Yu, Xin; Yang, Yandan; Zhao, Hong; Xu, Weihong; Liu, Xuelu; Zhou, Bin; Du, Wei; Chan, Wing C; Jaffe, Elaine S; Gascoyne, Randy D; Connors, Joseph M; Campo, Elias; Lopez-Guillermo, Armando; Rosenwald, Andreas; Ott, German; Delabie, Jan; Rimsza, Lisa M; Tay Kuang Wei, Kevin; Zelenetz, Andrew D; Leonard, John P; Bartlett, Nancy L; Tran, Bao; Shetty, Jyoti; Zhao, Yongmei; Soppet, Dan R; Pittaluga, Stefania; Wilson, Wyndham H; Staudt, Louis M

    2018-04-12

    Diffuse large B-cell lymphomas (DLBCLs) are phenotypically and genetically heterogeneous. Gene-expression profiling has identified subgroups of DLBCL (activated B-cell-like [ABC], germinal-center B-cell-like [GCB], and unclassified) according to cell of origin that are associated with a differential response to chemotherapy and targeted agents. We sought to extend these findings by identifying genetic subtypes of DLBCL based on shared genomic abnormalities and to uncover therapeutic vulnerabilities based on tumor genetics. We studied 574 DLBCL biopsy samples using exome and transcriptome sequencing, array-based DNA copy-number analysis, and targeted amplicon resequencing of 372 genes to identify genes with recurrent aberrations. We developed and implemented an algorithm to discover genetic subtypes based on the co-occurrence of genetic alterations. We identified four prominent genetic subtypes in DLBCL, termed MCD (based on the co-occurrence of MYD88 L265P and CD79B mutations), BN2 (based on BCL6 fusions and NOTCH2 mutations), N1 (based on NOTCH1 mutations), and EZB (based on EZH2 mutations and BCL2 translocations). Genetic aberrations in multiple genes distinguished each genetic subtype from other DLBCLs. These subtypes differed phenotypically, as judged by differences in gene-expression signatures and responses to immunochemotherapy, with favorable survival in the BN2 and EZB subtypes and inferior outcomes in the MCD and N1 subtypes. Analysis of genetic pathways suggested that MCD and BN2 DLBCLs rely on "chronic active" B-cell receptor signaling that is amenable to therapeutic inhibition. We uncovered genetic subtypes of DLBCL with distinct genotypic, epigenetic, and clinical characteristics, providing a potential nosology for precision-medicine strategies in DLBCL. (Funded by the Intramural Research Program of the National Institutes of Health and others.).

  19. Detection of Ultra-Rare Mitochondrial Mutations in Breast Stem Cells by Duplex Sequencing.

    PubMed

    Ahn, Eun Hyun; Hirohata, Kensen; Kohrn, Brendan F; Fox, Edward J; Chang, Chia-Cheng; Loeb, Lawrence A

    2015-01-01

    Long-lived adult stem cells could accumulate non-repaired DNA damage or mutations that increase the risk of tumor formation. To date, studies on mutations in stem cells have concentrated on clonal (homoplasmic) mutations and have not focused on rarely occurring stochastic mutations that may accumulate during stem cell dormancy. A major challenge in investigating these rare mutations is that conventional next generation sequencing (NGS) methods have high error rates. We have established a new method termed Duplex Sequencing (DS), which detects mutations with unprecedented accuracy. We present a comprehensive analysis of mitochondrial DNA mutations in human breast normal stem cells and non-stem cells using DS. The vast majority of mutations occur at low frequency and are not detectable by NGS. The most prevalent point mutation types are the C>T/G>A and A>G/T>C transitions. The mutations exhibit a strand bias with higher prevalence of G>A, T>C, and A>C mutations on the light strand of the mitochondrial genome. The overall rare mutation frequency is significantly lower in stem cells than in the corresponding non-stem cells. We have identified common and unique non-homoplasmic mutations between non-stem and stem cells that include new mutations which have not been reported previously. Four mutations found within the MT-ND5 gene (m.12684G>A, m.12705C>T, m.13095T>C, m.13105A>G) are present in all groups of stem and non-stem cells. Two mutations (m.8567T>C, m.10547C>G) are found only in non-stem cells. This first genome-wide analysis of mitochondrial DNA mutations may aid in characterizing human breast normal epithelial cells and serve as a reference for cancer stem cell mutation profiles.

  20. Anaerobic growth of Bacillus subtilis alters the spectrum of spontaneous mutations in the rpoB gene leading to rifampicin resistance.

    PubMed

    Nicholson, Wayne L; Park, Roy

    2015-12-01

    Spontaneous rifampicin-resistant (RFM(R)) mutants were isolated from Bacillus subtilis 168 cultivated in the presence or absence of oxygen. By DNA sequencing, the mutations were located within Cluster I of the rpoB gene encoding the β subunit of RNA polymerase. The spectrum of RFM(R) rpoB mutations isolated from B. subtilis cells grown anaerobically differed from aerobically grown cells, not only with respect to the location of mutations within Cluster I but also in the class of mutation observed (transition versus transversion). In the absence of RFM, RFM(R) mutants exhibited poorer growth under anaerobic conditions than did the wild-type strain, indicating their lower fitness in the absence of antibiotic selection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Highly Efficient and Versatile Plasmid-Based Gene Editing in Primary T Cells

    PubMed Central

    Kornete, Mara

    2018-01-01

    Adoptive cell transfer is an important approach for basic research and emerges as an effective treatment for various diseases, including infections and blood cancers. Direct genetic manipulation of primary immune cells opens up unprecedented research opportunities and could be applied to enhance cellular therapeutic products. In this article, we report highly efficient genome engineering in primary murine T cells using a plasmid-based RNA-guided CRISPR system. We developed a straightforward approach to ablate genes in up to 90% of cells and to introduce precisely targeted single nucleotide polymorphisms in up to 25% of the transfected primary T cells. We used gene editing–mediated allele switching to quantify homology-directed repair, systematically optimize experimental parameters, and map a native B cell epitope in primary T cells. Allele switching of a surrogate cell surface marker can be used to enrich cells, with successful simultaneous editing of a second gene of interest. Finally, we applied the approach to correct two disease-causing mutations in the Foxp3 gene. Repairing the cause of the scurfy syndrome, a 2-bp insertion in Foxp3, and repairing the clinically relevant Foxp3K276X mutation restored Foxp3 expression in primary T cells. PMID:29445007

  2. De novo activating epidermal growth factor mutations (EGFR) in small-cell lung cancer.

    PubMed

    Thai, Alesha; Chia, Puey L; Russell, Prudence A; Do, Hongdo; Dobrovic, Alex; Mitchell, Paul; John, Thomas

    2017-09-01

    In Australia, mutations in epidermal growth factor mutations (EGFR) occur in 15% of patients diagnosed with non-small-cell lung cancer and are found with higher frequency in female, non-smokers of Asian ethnicity. Activating mutations in the EGFR gene are rarely described in SCLC. We present two cases of de novo EGFR mutations in patients with SCLC detected in tissue and in plasma cell free DNA, both of whom were of Asian ethnicity and never-smokers. These two cases add to the growing body of evidence suggesting that screening for EGFR mutations in SCLC should be considered in patients with specific clinical features. © 2017 Royal Australasian College of Physicians.

  3. Biallelic mutations in IRF8 impair human NK cell maturation and function

    PubMed Central

    Mace, Emily M.; Gunesch, Justin T.; Chinn, Ivan K.; Angelo, Laura S.; Maisuria, Sheetal; Keller, Michael D.; Togi, Sumihito; Watkin, Levi B.; LaRosa, David F.; Jhangiani, Shalini N.; Muzny, Donna M.; Stray-Pedersen, Asbjørg; Coban Akdemir, Zeynep; Smith, Jansen B.; Hernández-Sanabria, Mayra; Le, Duy T.; Hogg, Graham D.; Cao, Tram N.; Freud, Aharon G.; Szymanski, Eva P.; Collin, Matthew; Cant, Andrew J.; Gibbs, Richard A.; Holland, Steven M.; Caligiuri, Michael A.; Ozato, Keiko; Paust, Silke; Doody, Gina M.; Lupski, James R.; Orange, Jordan S.

    2016-01-01

    Human NK cell deficiencies are rare yet result in severe and often fatal disease, particularly as a result of viral susceptibility. NK cells develop from hematopoietic stem cells, and few monogenic errors that specifically interrupt NK cell development have been reported. Here we have described biallelic mutations in IRF8, which encodes an interferon regulatory factor, as a cause of familial NK cell deficiency that results in fatal and severe viral disease. Compound heterozygous or homozygous mutations in IRF8 in 3 unrelated families resulted in a paucity of mature CD56dim NK cells and an increase in the frequency of the immature CD56bright NK cells, and this impairment in terminal maturation was also observed in Irf8–/–, but not Irf8+/–, mice. We then determined that impaired maturation was NK cell intrinsic, and gene expression analysis of human NK cell developmental subsets showed that multiple genes were dysregulated by IRF8 mutation. The phenotype was accompanied by deficient NK cell function and was stable over time. Together, these data indicate that human NK cells require IRF8 for development and functional maturation and that dysregulation of this function results in severe human disease, thereby emphasizing a critical role for NK cells in human antiviral defense. PMID:27893462

  4. Biallelic mutations in IRF8 impair human NK cell maturation and function.

    PubMed

    Mace, Emily M; Bigley, Venetia; Gunesch, Justin T; Chinn, Ivan K; Angelo, Laura S; Care, Matthew A; Maisuria, Sheetal; Keller, Michael D; Togi, Sumihito; Watkin, Levi B; LaRosa, David F; Jhangiani, Shalini N; Muzny, Donna M; Stray-Pedersen, Asbjørg; Coban Akdemir, Zeynep; Smith, Jansen B; Hernández-Sanabria, Mayra; Le, Duy T; Hogg, Graham D; Cao, Tram N; Freud, Aharon G; Szymanski, Eva P; Savic, Sinisa; Collin, Matthew; Cant, Andrew J; Gibbs, Richard A; Holland, Steven M; Caligiuri, Michael A; Ozato, Keiko; Paust, Silke; Doody, Gina M; Lupski, James R; Orange, Jordan S

    2017-01-03

    Human NK cell deficiencies are rare yet result in severe and often fatal disease, particularly as a result of viral susceptibility. NK cells develop from hematopoietic stem cells, and few monogenic errors that specifically interrupt NK cell development have been reported. Here we have described biallelic mutations in IRF8, which encodes an interferon regulatory factor, as a cause of familial NK cell deficiency that results in fatal and severe viral disease. Compound heterozygous or homozygous mutations in IRF8 in 3 unrelated families resulted in a paucity of mature CD56dim NK cells and an increase in the frequency of the immature CD56bright NK cells, and this impairment in terminal maturation was also observed in Irf8-/-, but not Irf8+/-, mice. We then determined that impaired maturation was NK cell intrinsic, and gene expression analysis of human NK cell developmental subsets showed that multiple genes were dysregulated by IRF8 mutation. The phenotype was accompanied by deficient NK cell function and was stable over time. Together, these data indicate that human NK cells require IRF8 for development and functional maturation and that dysregulation of this function results in severe human disease, thereby emphasizing a critical role for NK cells in human antiviral defense.

  5. Generation of biallelic knock-out sheep via gene-editing and somatic cell nuclear transfer

    PubMed Central

    Li, Honghui; Wang, Gui; Hao, Zhiqiang; Zhang, Guozhong; Qing, Yubo; Liu, Shuanghui; Qing, Lili; Pan, Weirong; Chen, Lei; Liu, Guichun; Zhao, Ruoping; Jia, Baoyu; Zeng, Luyao; Guo, Jianxiong; Zhao, Lixiao; Zhao, Heng; Lv, Chaoxiang; Xu, Kaixiang; Cheng, Wenmin; Li, Hushan; Zhao, Hong-Ye; Wang, Wen; Wei, Hong-Jiang

    2016-01-01

    Transgenic sheep can be used to achieve genetic improvements in breeds and as an important large-animal model for biomedical research. In this study, we generated a TALEN plasmid specific for ovine MSTN and transfected it into fetal fibroblast cells of STH sheep. MSTN biallelic-KO somatic cells were selected as nuclear donor cells for SCNT. In total, cloned embryos were transferred into 37 recipient gilts, 28 (75.7%) becoming pregnant and 15 delivering, resulting in 23 lambs, 12 of which were alive. Mutations in the lambs were verified via sequencing and T7EI assay, and the gene mutation site was consistent with that in the donor cells. Off-target analysis was performed, and no off-target mutations were detected. MSTN KO affected the mRNA expression of MSTN relative genes. The growth curve for the resulting sheep suggested that MSTN KO caused a remarkable increase in body weight compared with those of wild-type sheep. Histological analyses revealed that MSTN KO resulted in muscle fiber hypertrophy. These findings demonstrate the successful generation of MSTN biallelic-KO STH sheep via gene editing in somatic cells using TALEN technology and SCNT. These MSTN mutant sheep developed and grew normally, and exhibited increased body weight and muscle growth. PMID:27654750

  6. The GLABRA2 homeodomain protein directly regulates CESA5 and XTH17 gene expression in Arabidopsis roots.

    PubMed

    Tominaga-Wada, Rumi; Iwata, Mineko; Sugiyama, Junji; Kotake, Toshihisa; Ishida, Tetsuya; Yokoyama, Ryusuke; Nishitani, Kazuhiko; Okada, Kiyotaka; Wada, Takuji

    2009-11-01

    Arabidopsis root hair formation is determined by the patterning genes CAPRICE (CPC), GLABRA3 (GL3), WEREWOLF (WER) and GLABRA2 (GL2), but little is known about the later changes in cell wall material during root hair formation. A combined Fourier-transform infrared microspectroscopy-principal components analysis (FTIR-PCA) method was used to detect subtle differences in the cell wall material between wild-type and root hair mutants in Arabidopsis. Among several root hair mutants, only the gl2 mutation affected root cell wall polysaccharides. Five of the 10 genes encoding cellulose synthase (CESA1-10) and 4 of 33 xyloglucan endotransglucosylase (XTH1-33) genes in Arabidopsis are expressed in the root, but only CESA5 and XTH17 were affected by the gl2 mutation. The L1-box sequence located in the promoter region of these genes was recognized by the GL2 protein. These results indicate that GL2 directly regulates cell wall-related gene expression during root development.

  7. Mutation analysis of 13 driver genes of colorectal cancer-related pathways in Taiwanese patients

    PubMed Central

    Chang, Yuli Christine; Chang, Jan-Gowth; Liu, Ta-Chih; Lin, Chien-Yu; Yang, Shu-Fen; Ho, Cheng-Mao; Chen, William Tzu-Liang; Chang, Ya-Sian

    2016-01-01

    AIM: To investigate the driver gene mutations associated with colorectal cancer (CRC) in the Taiwanese population. METHODS: In this study, 103 patients with CRC were evaluated. The samples consisted of 66 men and 37 women with a median age of 59 years and an age range of 26-86 years. We used high-resolution melting analysis (HRM) and direct DNA sequencing to characterize the mutations in 13 driver genes of CRC-related pathways. The HRM assays were conducted using the LightCycler® 480 Instrument provided with the software LightCycler® 480 Gene Scanning Software Version 1.5. We also compared the clinicopathological data of CRC patients with the driver gene mutation status. RESULTS: Of the 103 patients evaluated, 73.79% had mutations in one of the 13 driver genes. We discovered 18 novel mutations in APC, MLH1, MSH2, PMS2, SMAD4 and TP53 that have not been previously reported. Additionally, we found 16 de novo mutations in APC, BMPR1A, MLH1, MSH2, MSH6, MUTYH and PMS2 in cancerous tissues previously reported in the dbSNP database; however, these mutations could not be detected in peripheral blood cells. The APC mutation correlates with lymph node metastasis (34.69% vs 12.96%, P = 0.009) and cancer stage (34.78% vs 14.04%, P = 0.013). No association was observed between other driver gene mutations and clinicopathological features. Furthermore, having two or more driver gene mutations correlates with the degree of lymph node metastasis (42.86% vs 24.07%, P = 0.043). CONCLUSION: Our findings confirm the importance of 13 CRC-related pathway driver genes in the development of CRC in Taiwanese patients. PMID:26900293

  8. Mutation analysis of 13 driver genes of colorectal cancer-related pathways in Taiwanese patients.

    PubMed

    Chang, Yuli Christine; Chang, Jan-Gowth; Liu, Ta-Chih; Lin, Chien-Yu; Yang, Shu-Fen; Ho, Cheng-Mao; Chen, William Tzu-Liang; Chang, Ya-Sian

    2016-02-21

    To investigate the driver gene mutations associated with colorectal cancer (CRC) in the Taiwanese population. In this study, 103 patients with CRC were evaluated. The samples consisted of 66 men and 37 women with a median age of 59 years and an age range of 26-86 years. We used high-resolution melting analysis (HRM) and direct DNA sequencing to characterize the mutations in 13 driver genes of CRC-related pathways. The HRM assays were conducted using the LightCycler® 480 Instrument provided with the software LightCycler® 480 Gene Scanning Software Version 1.5. We also compared the clinicopathological data of CRC patients with the driver gene mutation status. Of the 103 patients evaluated, 73.79% had mutations in one of the 13 driver genes. We discovered 18 novel mutations in APC, MLH1, MSH2, PMS2, SMAD4 and TP53 that have not been previously reported. Additionally, we found 16 de novo mutations in APC, BMPR1A, MLH1, MSH2, MSH6, MUTYH and PMS2 in cancerous tissues previously reported in the dbSNP database; however, these mutations could not be detected in peripheral blood cells. The APC mutation correlates with lymph node metastasis (34.69% vs 12.96%, P = 0.009) and cancer stage (34.78% vs 14.04%, P = 0.013). No association was observed between other driver gene mutations and clinicopathological features. Furthermore, having two or more driver gene mutations correlates with the degree of lymph node metastasis (42.86% vs 24.07%, P = 0.043). Our findings confirm the importance of 13 CRC-related pathway driver genes in the development of CRC in Taiwanese patients.

  9. [X-linked immunodeficiency with magnesium defect, Epstein-Barr virus infection, and neoplasia: report of a family and literature review].

    PubMed

    He, T Y; Xia, Y; Li, C G; Li, C R; Qi, Z X; Yang, J

    2018-01-02

    Objective: To investigate the clinical features and genetic characteristics of cases with X-linked immunodeficiency with magnesium defect, Epstein-Barr virus (EBV) infection, and neoplasia (XMEN). Methods: Characteristics of clinical material, immunological data and gene mutation of two cases with XMEN in the same family in China were retrospectively analyzed. The related reports literature were searched by using search terms'MAGT1 gene'or'XMEN'. Results: The proband, a 2-year-eight-month old boy, was admitted due to 'Urine with deepened color for two days and yellow stained skin for one day'. He had suffered from recurrent upper respiratory tract infection and sinusitis previously. Hemoglobin level was 38 g/L. The absolute count of reticulocytes was 223.2×10(9)/L. Urobilinogen level was 38 μmol/L (3-16 μmol/L). Coomb's test was positive. Both total (77.2 μmol/L) and indirect bilirubin (66 μmol/L) levels were elevated. There was an inverted CD4(+)/CD8(+)T cell ratio (0.89). The gene sequencing results showed MAGT1 gene c.472delG, p.D158Mfs*6 mutation. His 1-year-6-month old brother, was also identified to have MAGT1 gene c.472delG, p.D158Mfs*6 mutation.The younger brother mainly suffered from recurrent upper respiratory tract infection, accompanied by an inverted CD4(+)/CD8(+)T cell ratio (0.45), an elevated ratio and number of total B cells (45.7%). A total of 7 reports were retrieved including 11 male cases caused by MAGT1 gene mutation. These 11 cases were characterized by EBV viremia (11 cases), recurrent upper respiratory tract infection, otitis media or sinusitis (10 cases), secondary neoplasia diseases (8 cases), reduction of CD4(+)/CD8(+) T cell ratio (7 cases),and autoimmune thrombocytopenia or hemolytic anemia (2 cases). Conclusion: XMEN often manifests as male onset, recurrent upper respiratory tract infection, otitis media or sinusitis, EBV viremia, lymphoproliferative disease or lymphoma, autoimmune diseases and reduction of CD4(+)/CD8 (+)T cell ratio. NKG2D expression in NK cells is significantly reduced, and gene sequencing analysis shows a pathogenic mutation in MAGT1 gene.

  10. A repetitive mutation and selection system for bacterial evolution to increase the specific affinity to pancreatic cancer cells.

    PubMed

    Osawa, Masaki

    2018-01-01

    It is difficult to target and kill cancer cells. One possible approach is to mutate bacteria to enhance their binding to cancer cells. In the present study, Gram-negative Escherichia coli and Gram-positive Bacillus subtilis were randomly mutated, and then were positively and negatively selected for binding cancer vs normal cells. With repetitive mutation and selection both bacteria successfully evolved to increase affinity to the pancreatic cancer cell line (Mia PaCa-2) but not normal cells (HPDE: immortalized human pancreatic ductal epithelial cells). The mutant E. coli and B. subtilis strains bound to Mia PaCa-2 cells about 10 and 25 times more than to HPDE cells. The selected E. coli strain had mutations in biofilm-related genes and the regulatory region for a type I pilus gene. Consistent with type I pili involvement, mannose could inhibit the binding to cells. The results suggest that weak but specific binding is involved in the initial step of adhesion. To test their ability to kill Mia PaCa-2 cells, hemolysin was expressed in the mutant strain. The hemolysin released from the mutant strain was active and could kill Mia PaCa-2 cells. In the case of B. subtilis, the initial binding to the cells was a weak interaction of the leading pole of the motile bacteria. The frequency of this interaction to Mia PaCa-2 cells dramatically increased in the evolved mutant strain. This mutant strain could also specifically invade beneath Mia PaCa-2 cells and settle there. This type of mutation/selection strategy may be applicable to other combinations of cancer cells and bacterial species.

  11. A novel missense mutation in GRIN2A causes a nonepileptic neurodevelopmental disorder.

    PubMed

    Fernández-Marmiesse, Ana; Kusumoto, Hirofumi; Rekarte, Saray; Roca, Iria; Zhang, Jin; Myers, Scott J; Traynelis, Stephen F; Couce, Mª Luz; Gutierrez-Solana, Luis; Yuan, Hongjie

    2018-04-11

    Mutations in the GRIN2A gene, which encodes the GluN2A (glutamate [NMDA] receptor subunit epsilon-1) subunit of the N-methyl-d-aspartate receptor, have been identified in patients with epilepsy-aphasia spectrum disorders, idiopathic focal epilepsies with centrotemporal spikes, and epileptic encephalopathies with severe developmental delay. However, thus far, mutations in this gene have not been associated with a nonepileptic neurodevelopmental disorder with dystonia. The objective of this study was to identify the disease-causing gene in 2 siblings with neurodevelopmental and movement disorders with no epileptiform abnormalities. The study method was targeted next-generation sequencing panel for neuropediatric disorders and subsequent electrophysiological studies. The 2 siblings carry a novel missense mutation in the GRIN2A gene (p.Ala643Asp) that was not detected in genomic DNA isolated from blood cells of their parents, suggesting that the mutation is the consequence of germinal mosaicism in 1 progenitor. In functional studies, the GluN2A-A643D mutation increased the potency of the agonists L-glutamate and glycine and decreased the potency of endogenous negative modulators, including protons, magnesium and zinc but reduced agonist-evoked peak current response in mammalian cells, suggesting that this mutation has a mixed effect on N-methyl-d-aspartate receptor function. De novo GRIN2A mutations can give rise to a neurodevelopmental and movement disorder without epilepsy. © 2018 International Parkinson and Movement Disorder Society. © 2018 International Parkinson and Movement Disorder Society.

  12. Spectrum of somatic EGFR, KRAS, BRAF, PTEN mutations and TTF-1 expression in Brazilian lung cancer patients.

    PubMed

    Carneiro, Juliana G; Couto, Patricia G; Bastos-Rodrigues, Luciana; Bicalho, Maria Aparecida C; Vidigal, Paula V; Vilhena, Alyne; Amaral, Nilson F; Bale, Allen E; Friedman, Eitan; De Marco, Luiz

    2014-01-01

    Lung cancer is the leading global cause of cancer-related mortality. Inter-individual variability in treatment response and prognosis has been associated with genetic polymorphisms in specific genes: EGFR, KRAS, BRAF, PTEN and TTF-1. Somatic mutations in EGFR and KRAS genes are reported at rates of 15-40% in non-small cell lung cancer (NSCLC) in ethnically diverse populations. BRAF and PTEN are commonly mutated genes in various cancer types, including NSCLC, with PTEN mutations exerting an effect on the therapeutic response of EGFR/AKT/PI3K pathway inhibitors. TTF-1 is expressed in approximately 80% of lung adenocarcinomas and its positivity correlates with higher prevalence of EGFR mutation in this cancer type. To determine molecular markers for lung cancer in Brazilian patients, the rate of the predominant EGFR, KRAS, BRAF and PTEN mutations, as well as TTF-1 expression, was assessed in 88 Brazilian NSCLC patients. EGFR exon 19 deletions (del746-750) were detected in 3/88 (3·4%) patients. Activating KRAS mutations in codons 12 and 61 were noted in five (5·7%) and two (2·3%) patients, respectively. None of the common somatic mutations were detected in either the BRAF or PTEN genes. TTF-1 was overexpressed in 40·7% of squamous-cell carcinoma (SCC). Our findings add to a growing body of data that highlights the genetic heterogeneity of the abnormal EGFR pathway in lung cancer among ethnically diverse populations.

  13. Monoallelic expression of Pax5: a paradigm for the haploinsufficiency of mammalian Pax genes?

    PubMed

    Nutt, S L; Busslinger, M

    1999-06-01

    It is generally assumed that most mammalian genes are transcribed from both alleles. Hence, the diploid state of the genome offers the advantage that a loss-of-function mutation in one allele can be compensated for by the remaining wild-type allele of the same gene. Indeed, the vast majority of human disease syndromes and engineered mutations in the mouse genome are recessive, indicating that recessiveness is the 'default' state. However, a minority of genes are semi-dominant, as heterozygous loss-of-function mutation in these genes leads to phenotypic abnormalities. This condition, known as haploinsufficiency, has been described for five of the nine mammalian Pax genes, which are associated with mouse developmental mutants and human disease syndromes. Recently we have reported that the Pax5 gene is subject to allele-specific regulation during B cell development. Pax5 is predominantly transcribed from only one of its two alleles in early B-lymphoid progenitors and mature B cells, while it transiently switches to a biallelic mode of transcription in pre-B and immature B cells. As a consequence, B-lymphoid tissues are mosaic with regard to the transcribed allele, and heterozygous mutation of Pax5 therefore results in deletion of B lymphocytes expressing only the mutant allele. The allele-specific regulation of Pax5 raises the intriguing possibility that monoallelic expression may also be the mechanism causing the haploinsufficiency of other Pax genes. In this review, we discuss different models accounting for the haploinsufficiency of mammalian Pax genes, provide further evidence in support of the allele-specific regulation of Pax5 and discuss the implication of these findings in the context of the recent literature describing the stochastic and monoallelic activation of other hematopoietic genes.

  14. Mutation Pattern of Paired Immunoglobulin Heavy and Light Variable Domains in Chronic Lymphocytic Leukemia B Cells

    PubMed Central

    Ghiotto, Fabio; Marcatili, Paolo; Tenca, Claudya; Calevo, Maria Grazia; Yan, Xiao-Jie; Albesiano, Emilia; Bagnara, Davide; Colombo, Monica; Cutrona, Giovanna; Chu, Charles C; Morabito, Fortunato; Bruno, Silvia; Ferrarini, Manlio; Tramontano, Anna; Fais, Franco; Chiorazzi, Nicholas

    2011-01-01

    B-cell chronic lymphocytic leukemia (CLL) patients display leukemic clones bearing either germline or somatically mutated immunoglobulin heavy variable (IGHV ) genes. Most information on CLL immunoglobulins (Igs), such as the definition of stereotyped B-cell receptors (BCRs), was derived from germline unmutated Igs. In particular, detailed studies on the distribution and nature of mutations in paired heavy- and light-chain domains of CLL clones bearing mutated Igs are lacking. To address the somatic hyper-mutation dynamics of CLL Igs, we analyzed the mutation pattern of paired IGHV–diversity-joining (IGHV-D-J ) and immunoglobulin kappa/lambda variable-joining (IGK/LV-J ) rearrangements of 193 leukemic clones that displayed ≥2% mutations in at least one of the two immunoglobulin variable (IGV ) genes (IGHV and/or IGK/LV ). The relationship between the mutation frequency in IGHV and IGK/LV complementarity determining regions (CDRs) and framework regions (FRs) was evaluated by correlation analysis. Replacement (R) mutation frequency within IGK/LV chain CDRs correlated significantly with mutation frequency of paired IGHV CDRs in λ but not κ isotype CLL clones. CDRs of IGKV-J rearrangements displayed a lower percentage of R mutations than IGHVs. The frequency/pattern of mutations in kappa CLL Igs differed also from that in κ-expressing normal B cells described in the literature. Instead, the mutation frequency within the FRs of IGHV and either IGKV or IGLV was correlated. Notably, the amount of diversity introduced by replaced amino acids was comparable between IGHVs and IGKVs. The data indicate a different mutation pattern between κ and λ isotype CLL clones and suggest an antigenic selection that, in κ samples, operates against CDR variation. PMID:21785810

  15. Correction of β-thalassemia mutant by base editor in human embryos.

    PubMed

    Liang, Puping; Ding, Chenhui; Sun, Hongwei; Xie, Xiaowei; Xu, Yanwen; Zhang, Xiya; Sun, Ying; Xiong, Yuanyan; Ma, Wenbin; Liu, Yongxiang; Wang, Yali; Fang, Jianpei; Liu, Dan; Songyang, Zhou; Zhou, Canquan; Huang, Junjiu

    2017-11-01

    β-Thalassemia is a global health issue, caused by mutations in the HBB gene. Among these mutations, HBB -28 (A>G) mutations is one of the three most common mutations in China and Southeast Asia patients with β-thalassemia. Correcting this mutation in human embryos may prevent the disease being passed onto future generations and cure anemia. Here we report the first study using base editor (BE) system to correct disease mutant in human embryos. Firstly, we produced a 293T cell line with an exogenous HBB -28 (A>G) mutant fragment for gRNAs and targeting efficiency evaluation. Then we collected primary skin fibroblast cells from a β-thalassemia patient with HBB -28 (A>G) homozygous mutation. Data showed that base editor could precisely correct HBB -28 (A>G) mutation in the patient's primary cells. To model homozygous mutation disease embryos, we constructed nuclear transfer embryos by fusing the lymphocyte or skin fibroblast cells with enucleated in vitro matured (IVM) oocytes. Notably, the gene correction efficiency was over 23.0% in these embryos by base editor. Although these embryos were still mosaic, the percentage of repaired blastomeres was over 20.0%. In addition, we found that base editor variants, with narrowed deamination window, could promote G-to-A conversion at HBB -28 site precisely in human embryos. Collectively, this study demonstrated the feasibility of curing genetic disease in human somatic cells and embryos by base editor system.

  16. Preselection of EGFR mutations in non-small-cell lung cancer patients by immunohistochemistry: comparison with DNA-sequencing, EGFR wild-type expression, gene copy number gain and clinicopathological data.

    PubMed

    Gaber, Rania; Watermann, Iris; Kugler, Christian; Vollmer, Ekkehard; Perner, Sven; Reck, Martin; Goldmann, Torsten

    2017-01-01

    Targeting epidermal growth factor receptor (EGFR) in patients with non-small-cell lung cancer (NSCLC) having EGFR mutations is associated with an improved overall survival. The aim of this study is to verify, if EGFR mutations detected by immunohistochemistry (IHC) is a convincing way to preselect patients for DNA-sequencing and to figure out, the statistical association between EGFR mutation, wild-type EGFR overexpression, gene copy number gain, which are the main factors inducing EGFR tumorigenic activity and the clinicopathological data. Two hundred sixteen tumor tissue samples of primarily chemotherapeutic naïve NSCLC patients were analyzed for EGFR mutations E746-A750del and L858R and correlated with DNA-sequencing. Two hundred six of which were assessed by IHC, using 6B6 and 43B2 specific antibodies followed by DNA-sequencing of positive cases and 10 already genotyped tumor tissues were also included to investigate debugging accuracy of IHC. In addition, EGFR wild-type overexpression was IHC evaluated and EGFR gene copy number determination was performed by fluorescence in situ hybridization (FISH). Forty-one÷206 (19.9%) cases were positive for mutated EGFR by IHC. Eight of them had EGFR mutations of exons 18-21 by DNA-sequencing. Hit rate of 10 already genotyped NSCLC mutated cases was 90% by IHC. Positive association was found between EGFR mutations determined by IHC and both EGFR overexpression and increased gene copy number (p=0.002 and p<0.001, respectively). Additionally, positive association was detected between EGFR mutations, high tumor grade and clinical stage (p<0.001). IHC staining with mutation specific antibodies was demonstrated as a possible useful screening test to preselect patients for DNA-sequencing.

  17. Systematic discovery of mutation-specific synthetic lethals by mining pan-cancer human primary tumor data

    NASA Astrophysics Data System (ADS)

    Sinha, Subarna; Thomas, Daniel; Chan, Steven; Gao, Yang; Brunen, Diede; Torabi, Damoun; Reinisch, Andreas; Hernandez, David; Chan, Andy; Rankin, Erinn B.; Bernards, Rene; Majeti, Ravindra; Dill, David L.

    2017-05-01

    Two genes are synthetically lethal (SL) when defects in both are lethal to a cell but a single defect is non-lethal. SL partners of cancer mutations are of great interest as pharmacological targets; however, identifying them by cell line-based methods is challenging. Here we develop MiSL (Mining Synthetic Lethals), an algorithm that mines pan-cancer human primary tumour data to identify mutation-specific SL partners for specific cancers. We apply MiSL to 12 different cancers and predict 145,891 SL partners for 3,120 mutations, including known mutation-specific SL partners. Comparisons with functional screens show that MiSL predictions are enriched for SLs in multiple cancers. We extensively validate a SL interaction identified by MiSL between the IDH1 mutation and ACACA in leukaemia using gene targeting and patient-derived xenografts. Furthermore, we apply MiSL to pinpoint genetic biomarkers for drug sensitivity. These results demonstrate that MiSL can accelerate precision oncology by identifying mutation-specific targets and biomarkers.

  18. Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

    PubMed Central

    McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

    2015-01-01

    Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

  19. Molecular profiling of appendiceal epithelial tumors using massively parallel sequencing to identify somatic mutations.

    PubMed

    Liu, Xiaoying; Mody, Kabir; de Abreu, Francine B; Pipas, J Marc; Peterson, Jason D; Gallagher, Torrey L; Suriawinata, Arief A; Ripple, Gregory H; Hourdequin, Kathryn C; Smith, Kerrington D; Barth, Richard J; Colacchio, Thomas A; Tsapakos, Michael J; Zaki, Bassem I; Gardner, Timothy B; Gordon, Stuart R; Amos, Christopher I; Wells, Wendy A; Tsongalis, Gregory J

    2014-07-01

    Some epithelial neoplasms of the appendix, including low-grade appendiceal mucinous neoplasm and adenocarcinoma, can result in pseudomyxoma peritonei (PMP). Little is known about the mutational spectra of these tumor types and whether mutations may be of clinical significance with respect to therapeutic selection. In this study, we identified somatic mutations using the Ion Torrent AmpliSeq Cancer Hotspot Panel v2. Specimens consisted of 3 nonneoplastic retention cysts/mucocele, 15 low-grade mucinous neoplasms (LAMNs), 8 low-grade/well-differentiated mucinous adenocarcinomas with pseudomyxoma peritonei, and 12 adenocarcinomas with/without goblet cell/signet ring cell features. Barcoded libraries were prepared from up to 10 ng of extracted DNA and multiplexed on single 318 chips for sequencing. Data analysis was performed using Golden Helix SVS. Variants that remained after the analysis pipeline were individually interrogated using the Integrative Genomics Viewer. A single Janus kinase 3 (JAK3) mutation was detected in the mucocele group. Eight mutations were identified in the V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) and GNAS complex locus (GNAS) genes among LAMN samples. Additional gene mutations were identified in the AKT1 (v-akt murine thymoma viral oncogene homolog 1), APC (adenomatous polyposis coli), JAK3, MET (met proto-oncogene), phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA), RB1 (retinoblastoma 1), STK11 (serine/threonine kinase 11), and tumor protein p53 (TP53) genes. Among the PMPs, 6 mutations were detected in the KRAS gene and also in the GNAS, TP53, and RB1 genes. Appendiceal cancers showed mutations in the APC, ATM (ataxia telangiectasia mutated), KRAS, IDH1 [isocitrate dehydrogenase 1 (NADP+)], NRAS [neuroblastoma RAS viral (v-ras) oncogene homolog], PIK3CA, SMAD4 (SMAD family member 4), and TP53 genes. Our results suggest molecular heterogeneity among epithelial tumors of the appendix. Next generation sequencing efforts have identified mutational spectra in several subtypes of these tumors that may suggest a phenotypic heterogeneity showing mutations that are relevant for targeted therapies. © 2014 The American Association for Clinical Chemistry.

  20. Cell cloning-based transcriptome analysis in Rett patients: relevance to the pathogenesis of Rett syndrome of new human MeCP2 target genes.

    PubMed

    Nectoux, J; Fichou, Y; Rosas-Vargas, H; Cagnard, N; Bahi-Buisson, N; Nusbaum, P; Letourneur, F; Chelly, J; Bienvenu, T

    2010-07-01

    More than 90% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked methyl-CpG binding protein 2 (MECP2) gene that encodes the methyl-CpG-binding protein 2, a transcriptional modulator. Because MECP2 is subjected to X chromosome inactivation (XCI), girls with RTT either express the wild-type or mutant allele in each individual cell. To test the consequences of MECP2 mutations resulting from a genome-wide transcriptional dysregulation and to identify its target genes in a system that circumvents the functional mosaicism resulting from XCI, we carried out gene expression profiling of clonal populations derived from fibroblast primary cultures expressing exclusively either the wild-type or the mutant MECP2 allele. Clonal cultures were obtained from skin biopsy of three RTT patients carrying either a non-sense or a frameshift MECP2 mutation. For each patient, gene expression profiles of wild-type and mutant clones were compared by oligonucleotide expression microarray analysis. Firstly, clustering analysis classified the RTT patients according to their genetic background and MECP2 mutation. Secondly, expression profiling by microarray analysis and quantitative RT-PCR indicated four up-regulated genes and five down-regulated genes significantly dysregulated in all our statistical analysis, including excellent potential candidate genes for the understanding of the pathophysiology of this neurodevelopmental disease. Thirdly, chromatin immunoprecipitation analysis confirmed MeCP2 binding to respective CpG islands in three out of four up-regulated candidate genes and sequencing of bisulphite-converted DNA indicated that MeCP2 preferentially binds to methylated-DNA sequences. Most importantly, the finding that at least two of these genes (BMCC1 and RNF182) were shown to be involved in cell survival and/or apoptosis may suggest that impaired MeCP2 function could alter the survival of neurons thus compromising brain function without inducing cell death.

  1. ATM Mutations and the Development of Severe Radiation-Induced Morbidity Following Radiotherapy for Breast Cancer

    DTIC Science & Technology

    2005-07-01

    repair of radiation-induced damage. Furthermore, cells possessing a mutated copy of this gene are more radiosensitive than cells from individuals with...AD Award Number: DAMD17-02-1-0503 TITLE: ATM Mutations and the Development of Severe Radiation-Induced Morbidity Following Radiotherapy for Breast...2005 Annual 1 Jul 2004 - 30 Jun 2005 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER ATM Mutations and the Development of Severe Radiation-Induced Morbidity

  2. Monoallelic mutation analysis (MAMA) for identifying germline mutations.

    PubMed

    Papadopoulos, N; Leach, F S; Kinzler, K W; Vogelstein, B

    1995-09-01

    Dissection of germline mutations in a sensitive and specific manner presents a continuing challenge. In dominantly inherited diseases, mutations occur in only one allele and are often masked by the normal allele. Here we report the development of a sensitive and specific diagnostic strategy based on somatic cell hybridization termed MAMA (monoallelic mutation analysis). We have demonstrated the utility of this strategy in two different hereditary colorectal cancer syndromes, one caused by a defective tumour suppressor gene on chromosome 5 (familial adenomatous polyposis, FAP) and the other caused by a defective mismatch repair gene on chromosome 2 (hereditary non-polyposis colorectal cancer, HNPCC).

  3. Review: the Contribution of both Nature and Nurture to Carcinogenesis and Progression in Solid Tumours.

    PubMed

    Hyndman, Iain Joseph

    2016-04-01

    Cancer is a leading cause of mortality worldwide. Cancer arises due to a series of somatic mutations that accumulate within the nucleus of a cell which enable the cell to proliferate in an unregulated manner. These mutations arise as a result of both endogenous and exogenous factors. Genes that are commonly mutated in cancer cells are involved in cell cycle regulation, growth and proliferation. It is known that both nature and nurture play important roles in cancer development through complex gene-environment interactions; however, the exact mechanism of these interactions in carcinogenesis is presently unclear. Key environmental factors that play a role in carcinogenesis include smoking, UV light and oncoviruses. Angiogenesis, inflammation and altered cell metabolism are important factors in carcinogenesis and are influenced by both genetic and environmental factors. Although the exact mechanism of nature-nurture interactions in solid tumour formation are not yet fully understood, it is evident that neither nature nor nurture can be considered in isolation. By understanding more about gene-environment interactions, it is possible that cancer mortality could be reduced.

  4. ITK Gene Mutation: Effect on Survival of Children with Severe Hemophagocytic Lymphohistiocytosis.

    PubMed

    Zheng, Fang; Li, Juan; Zha, Hui; Zhang, Jue; Zhang, Zhiquan; Cheng, Fangjun

    2016-11-01

    Hemophagocytic lymphohistiocytosis (HLH) is characterized by deadly hyperinflammatory syndrome, but data on severe HLH with multi-organ dysfunction in children are scant. The authors report a retrospective study of 8 cases with severe HLH from a pediatric intensive care unit (PICU) over a 1-y period and found that Epstein barr virus (EBV) -infection was the most common etiology. All patients had genetic analysis, which showed that four patients with EBV -infection had one homozygous mutation, c.985+75G>A (at position chr5:156667232) in exon10 of the ITK gene with poor survival rates. ITK + mutation group had higher percentages of CD3 + CD8 + T cells (36.0 ± 8.4 %) than those in ITK - mutation group (28.8 ± 5.5 %), while they had similar levels of CD3 + CD4 + T cells. ITK + mutation group had lower proportion of CD3 - CD19 + B cells (16.3 ± 2.9 %) and CD16 + CD56 + NK cells (8.4 ± 2.6 %) than ITK - mutation group (29.6 ± 5.1 % and 15.9 ± 9.0 % respectively). Most importantly, patients with EBV infection with c.985+75G>A mutation in ITK had lower survival rates than ITK - mutation group which it may be related with cellular immune dysfunction.

  5. Mutator gene and hereditary non-polyposis colorectal cancer

    DOEpatents

    de la Chapelle, Albert [Helsingfors, FI; Vogelstein, Bert [Baltimore, MD; Kinzler, Kenneth W [Baltimore, MD

    2008-02-05

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  6. [Clinical significance of JAK2、CALR and MPL gene mutations in 1 648 Philadelphia chromosome negative myeloproliferative neoplasms patients from a single center].

    PubMed

    Li, M Y; Chao, H Y; Sun, A N; Qiu, H Y; Jin, Z M; Tang, X W; Han, Y; Fu, C C; Chen, S N; Wu, D P

    2017-04-14

    Objective: To explore the prevalences of JAK2, CALR and MPL gene mutations and the mutation types in patients with Philadelphia chromosome negative myeloproliferative neoplasms (MPNs) , and to compare their clinical characteristics of different mutation types with each other and mutation negative group. Methods: The mutations of JAK2 V617F, JAK2 gene at exon 12, CALR gene at exon 9 and MPL gene at exon 10 in 1 648 Ph negative MPNs patients were detected by direct sequencing. Results: ① The JAK2V617F mutation was found in 471 (92.7%) of 508 PV patients, 819 (78.1%) of 1 049 ET patients and 74 (81.3%) of 91 PMF patients respectively, with the total mutation rate as 82.8% (1 364/1 648) . The JAK2 exon12 mutation was found in 9 (1.7%) of 508 PV patients, none was found in ET or PMF patients, with the total mutation rate as 0.5% (9/1 648) . The CALR mutation was found in 132 (12.6%) of 1 049 ET patients and 11 (12.1%) of 91 PMF patients respectively, with the total mutation rate as 8.7% (143/1 648) ; the MPL mutation was found in 9 (0.9%) of 1 049 ET patients and 1 (1.1%) of 91 PMF patients respectively, with the total mutation rate as 0.6% (10/1 648) . The co-occurrence of any two types of driver gene mutations was not detected by direct sequencing. ②The median onset age of patients with JAK2V617F[61 (15-95) y] was significant higher than of with JAK2 exon12 mutation[49 (33-62) y] or without mutations[42 (3-78) y] ( P <0.001) , but not for patients with CALR[57 (17-89) y] or MPL mutation[59 (22-71) y] ( P >0.05) . Patients with JAK2V617F had higher white blood cell count and hemoglobin level ( P <0.05) when compared with patients with CALR mutation or without mutations, or only significantly higher white blood cell count when compared with patients with MPL mutation ( P =0.013) . The platelet count of patients with CALR mutation was significantly higher than of with JAK2V617F[966 (400-2 069) ×10(9)/L vs 800 (198-3 730) ×10(9)/L, P <0.001]. ③Karyotype analysis was conducted in 1 160 patients with MPNs, the rates of karyotype abnormality of patients with and without CALR mutation were 9.8% (8/82) and 7.4% (80/1 078) ( P =0.441) respectively; The rates of karyotype abnormality of patients with and without JAK2V617F mutation were 7.7% (75/971) and 6.9% (13/189) ( P =0.688) respectively. The incidence of karyotype abnormality of patients with CALR mutation was higher than of with JAK2V617F[9.8% (8/82) vs 7.7% (75/971) ] without statistically significant difference ( P =0.512) . The karyotype analysis of 7 cases of JAK2 exon12 mutation and 6 ones with MPL gene mutation revealed normal karyotype. Conclusions: Driver gene mutations detection could ensure the diagnosis and prognosis judgment of MPN more reliable, different subtypes of MPNs had different profiles of driver gene mutations, the latter lead to unique clinical phenotype.

  7. Nivolumab, Cabozantinib S-Malate, and Ipilimumab in Treating Patients With Recurrent Stage IV Non-small Cell Lung Cancer

    ClinicalTrials.gov

    2018-06-28

    c-MET Gene Amplification; MET Exon 14 Mutation; Metastatic Non-Squamous Non-Small Cell Lung Carcinoma; Recurrent Non-Squamous Non-Small Cell Lung Carcinoma; RET/PTC Rearrangement; ROS1 Gene Rearrangement; Stage IV Non-Small Cell Lung Cancer AJCC v7

  8. Novel APC gene mutations associated with protein alteration in diffuse type gastric cancer.

    PubMed

    Ghatak, Souvik; Chakraborty, Payel; Sarkar, Sandeep Roy; Chowdhury, Biswajit; Bhaumik, Arup; Kumar, Nachimuthu Senthil

    2017-06-02

    The role of adenomatous polyposis coli (APC) gene in mitosis might be critical for regulation of genomic stability and chromosome segregation. APC gene mutations have been associated to have a role in colon cancer and since gastric and colon tumors share some common genetic lesions, it is relevant to investigate the role of APC tumor suppressor gene in gastric cancer. We investigated for somatic mutations in the Exons 14 and 15 of APC gene from 40 diffuse type gastric cancersamples. Rabbit polyclonal anti-APC antibody was used, which detects the wild-type APC protein and was recommended for detection of the respective protein in human tissues. Cell cycle analysis was done from tumor and adjacent normal tissue. APC immunoreactivity showed positive expression of the protein in stages I, II, III and negative expression in Stages III and IV. Two novel deleterious variations (g.127576C > A, g.127583C > T) in exon 14 sequence were found to generate stop codon (Y622* and Q625*)in the tumor samples. Due to the generation of stop codon, the APC protein might be truncated and all the regulatory features could be lost which has led to the down-regulation of protein expression. Our results indicate that aneuploidy might occurdue to the codon 622 and 625 APC-driven gastric tumorigenesis, in agreement with our cell cycle analysis. The APC gene function in mitosis and chromosomal stability might be lost and G1 might be arrested with high quantity of DNA in the S phase. Six missense somatic mutations in tumor samples were detected in exon 15 A-B, twoof which showed pathological and disease causing effects based on SIFT, Polyphen2 and SNPs & GO score and were not previously reported in the literature or the public mutation databases. The two novel pathological somatic mutations (g.127576C > A, g.127583C > T) in exon 14 might be altering the protein expression leading to development of gastric cancer in the study population. Our study showed that mutations in the APC gene alter the protein expression and cell cycle regulation in diffuse type gastric adenocarcinoma.

  9. The genomic landscape of phaeochromocytoma.

    PubMed

    Flynn, Aidan; Benn, Diana; Clifton-Bligh, Roderick; Robinson, Bruce; Trainer, Alison H; James, Paul; Hogg, Annette; Waldeck, Kelly; George, Joshy; Li, Jason; Fox, Stephen B; Gill, Anthony J; McArthur, Grant; Hicks, Rodney J; Tothill, Richard W

    2015-05-01

    Phaeochromocytomas (PCCs) and paragangliomas (PGLs) are rare neural crest-derived tumours originating from adrenal chromaffin cells or extra-adrenal sympathetic and parasympathetic tissues. More than a third of PCC/PGL cases are associated with heritable syndromes involving 13 or more known genes. These genes have been broadly partitioned into two groups based on pseudo-hypoxic and receptor tyrosine kinase (RTK) signalling pathways. Many of these genes can also become somatically mutated, although up to one third of sporadic cases have no known genetic driver. Furthermore, little is known of the genes that co-operate with known driver genes to initiate and drive tumourigenesis. To explore the genomic landscape of PCC/PGL, we applied exome sequencing, high-density SNP-array analysis, and RNA sequencing to 36 PCCs and four functional PGL tumours. All tumours displayed low mutation frequency, in contrast to frequent large segmental copy-number alterations, aneuploidy, and evidence for chromothripsis in one case. Multi-region sampling of one benign familial PCC tumour provided evidence for the timing of mutations during tumourigenesis and ongoing clonal evolution. Thirty-one of 40 (77.5%) cases could be explained by germline or somatic mutations or structural alterations affecting known PCC/PGL genes. Deleterious somatic mutations were also identified in known tumour-suppressor genes associated with genome maintenance and epigenetic modulation. A multitude of other genes were also found mutated that are likely important for normal neuroendocrine cell function. We revisited the gene-expression subtyping of PCC/PGL by integrating published microarray data with our RNA-seq data, enabling the identification of six robust gene-expression subtypes. The majority of cases in our cohort with no identifiable driver mutation were classified into a gene-expression subtype bearing similarity to MAX mutant PCC/PGL. Our data suggest there are yet unknown PCC/PGL cancer genes that can phenocopy MAX mutant PCC/PGL tumours. This study provides new insight into the molecular diversity and genetic origins of PCC/PGL tumours. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  10. Genomic instability and tumorigenic induction in immortalized human bronchial epithelial cells by heavy ions

    NASA Astrophysics Data System (ADS)

    Hei, T. K.; Piao, C. Q.; Wu, L. J.; Willey, J. C.; Hall, E. J.

    1998-11-01

    Carcinogenesis is postulated to be a progressive multistage process characterized by an increase in genomic instability and clonal selection with each mutational event endowing a selective growth advantage. Genomic instability as manifested by the amplification of specific gene fragments is common among tumor and transformed cells. In the present study, immortalized human bronchial (BEP2D) cells were irradiated with graded doses of either 1GeV/nucleon 56Fe ions or 150 keV/μm alpha particles. Transformed cells developed through a series of successive steps before becoming tumorigenic in nude mice. Tumorigenic cells showed neither ras mutations nor deletion in the p16 tumor suppressor gene. In contrast, they harbored mutations in the p53 gene and over-expressed cyclin D1. Genomic instability among transformed cells at various stage of the carcinogenic process was examined based on frequencies of PALA resistance. Incidence of genomic instability was highest among established tumor cell lines relative to transformed, non-tumorigenic and control cell lines. Treatment of BEP2D cells with a 4 mM dose of the aminothiol WR-1065 significantly reduced their neoplastic transforming response to 56Fe particles. This model provides an opportunity to study the cellular and molecular mechanisms involved in malignant transformation of human epithelial cells by heavy ions.

  11. cea-kil operon of the ColE1 plasmid.

    PubMed Central

    Sabik, J F; Suit, J L; Luria, S E

    1983-01-01

    We isolated a series of Tn5 transposon insertion mutants and chemically induced mutants with mutations in the region of the ColE1 plasmid that includes the cea (colicin) and imm (immunity) genes. Bacterial cells harboring each of the mutant plasmids were tested for their response to the colicin-inducing agent mitomycin C. All insertion mutations within the cea gene failed to bring about cell killing after mitomycin C treatment. A cea- amber mutation exerted a polar effect on killing by mitomycin C. Two insertions beyond the cea gene but within or near the imm gene also prevented the lethal response to mitomycin C. These findings suggest the presence in the ColE1 plasmid of an operon containing the cea and kil genes whose product is needed for mitomycin C-induced lethality. Bacteria carrying ColE1 plasmids with Tn5 inserted within the cea gene produced serologically cross-reacting fragments of the colicin E1 molecule, the lengths of which were proportional to the distance between the insertion and the promoter end of the cea gene. Images PMID:6298187

  12. Epigenome Aberrations: Emerging Driving Factors of the Clear Cell Renal Cell Carcinoma

    PubMed Central

    Mehdi, Ali; Riazalhosseini, Yasser

    2017-01-01

    Clear cell renal cell carcinoma (ccRCC), the most common form of Kidney cancer, is characterized by frequent mutations of the von Hippel-Lindau (VHL) tumor suppressor gene in ~85% of sporadic cases. Loss of pVHL function affects multiple cellular processes, among which the activation of hypoxia inducible factor (HIF) pathway is the best-known function. Constitutive activation of HIF signaling in turn activates hundreds of genes involved in numerous oncogenic pathways, which contribute to the development or progression of ccRCC. Although VHL mutations are considered as drivers of ccRCC, they are not sufficient to cause the disease. Recent genome-wide sequencing studies of ccRCC have revealed that mutations of genes coding for epigenome modifiers and chromatin remodelers, including PBRM1, SETD2 and BAP1, are the most common somatic genetic abnormalities after VHL mutations in these tumors. Moreover, recent research has shed light on the extent of abnormal epigenome alterations in ccRCC tumors, including aberrant DNA methylation patterns, abnormal histone modifications and deregulated expression of non-coding RNAs. In this review, we discuss the epigenetic modifiers that are commonly mutated in ccRCC, and our growing knowledge of the cellular processes that are impacted by them. Furthermore, we explore new avenues for developing therapeutic approaches based on our knowledge of epigenome aberrations of ccRCC. PMID:28812986

  13. Epigenome Aberrations: Emerging Driving Factors of the Clear Cell Renal Cell Carcinoma.

    PubMed

    Mehdi, Ali; Riazalhosseini, Yasser

    2017-08-16

    Clear cell renal cell carcinoma (ccRCC), the most common form of Kidney cancer, is characterized by frequent mutations of the von Hippel-Lindau ( VHL ) tumor suppressor gene in ~85% of sporadic cases. Loss of pVHL function affects multiple cellular processes, among which the activation of hypoxia inducible factor (HIF) pathway is the best-known function. Constitutive activation of HIF signaling in turn activates hundreds of genes involved in numerous oncogenic pathways, which contribute to the development or progression of ccRCC. Although VHL mutations are considered as drivers of ccRCC, they are not sufficient to cause the disease. Recent genome-wide sequencing studies of ccRCC have revealed that mutations of genes coding for epigenome modifiers and chromatin remodelers, including PBRM1 , SETD2 and BAP1 , are the most common somatic genetic abnormalities after VHL mutations in these tumors. Moreover, recent research has shed light on the extent of abnormal epigenome alterations in ccRCC tumors, including aberrant DNA methylation patterns, abnormal histone modifications and deregulated expression of non-coding RNAs. In this review, we discuss the epigenetic modifiers that are commonly mutated in ccRCC, and our growing knowledge of the cellular processes that are impacted by them. Furthermore, we explore new avenues for developing therapeutic approaches based on our knowledge of epigenome aberrations of ccRCC.

  14. A Novel FOXE1 Mutation (R73S) in Bamforth–Lazarus Syndrome Causing Increased Thyroidal Gene Expression

    PubMed Central

    Carré, Aurore; Hamza, Rasha T.; Kariyawasam, Dulanjalee; Guillot, Loïc; Teissier, Raphaël; Tron, Elodie; Castanet, Mireille; Dupuy, Corinne; El Kholy, Mohamed; Polak, Michel

    2014-01-01

    Background: Homozygous loss-of-function mutations in the FOXE1 gene have been reported in several patients with partial or complete Bamforth–Lazarus syndrome: congenital hypothyroidism (CH) with thyroid dysgenesis (usually athyreosis), cleft palate, spiky hair, with or without choanal atresia, and bifid epiglottis. Here, our objective was to evaluate potential functional consequences of a FOXE1 mutation in a patient with a similar clinical phenotype. Methods: FOXE1 was sequenced in eight patients with thyroid dysgenesis and cleft palate. Transient transfection was performed in HEK293 cells using the thyroglobulin (TG) and thyroid peroxidase (TPO) promoters in luciferase reporter plasmids to assess the functional impact of the FOXE1 mutations. Primary human thyrocytes transfected with wild type and mutant FOXE1 served to assess the impact of the mutation on endogenous TG and TPO expression. Results: We identified and characterized the function of a new homozygous FOXE1 missense mutation (p.R73S) in a boy with a typical phenotype (athyreosis, cleft palate, and partial choanal atresia). This new mutation located within the forkhead domain was inherited from the heterozygous healthy consanguineous parents. In vitro functional studies in HEK293 cells showed that this mutant gene enhanced the activity of the TG and TPO gene promoters (1.5-fold and 1.7-fold respectively vs. wild type FOXE1; p<0.05), unlike the five mutations previously reported in Bamforth–Lazarus syndrome. The gain-of-function effect of the FOXE1-p.R73S mutant gene was confirmed by an increase in endogenous TG production in primary human thyrocytes. Conclusion: We identified a new homozygous FOXE1 mutation responsible for enhanced expression of the TG and TPO genes in a boy whose phenotype is similar to that reported previously in patients with loss-of-function FOXE1 mutations. This finding further delineates the role for FOXE1 in both thyroid and palate development, and shows that enhanced gene activity should be considered among the mechanisms underlying Bamforth–Lazarus syndrome. PMID:24219130

  15. Additive loss-of-function proteasome subunit mutations in CANDLE/PRAAS patients promote type I IFN production

    PubMed Central

    Brehm, Anja; Liu, Yin; Sheikh, Afzal; Marrero, Bernadette; Omoyinmi, Ebun; Zhou, Qing; Montealegre, Gina; Biancotto, Angelique; Reinhardt, Adam; Almeida de Jesus, Adriana; Pelletier, Martin; Tsai, Wanxia L.; Remmers, Elaine F.; Kardava, Lela; Hill, Suvimol; Kim, Hanna; Lachmann, Helen J.; Megarbane, Andre; Chae, Jae Jin; Brady, Jilian; Castillo, Rhina D.; Brown, Diane; Casano, Angel Vera; Gao, Ling; Chapelle, Dawn; Huang, Yan; Stone, Deborah; Chen, Yongqing; Sotzny, Franziska; Lee, Chyi-Chia Richard; Kastner, Daniel L.; Torrelo, Antonio; Zlotogorski, Abraham; Moir, Susan; Gadina, Massimo; McCoy, Phil; Wesley, Robert; Rother, Kristina; Hildebrand, Peter W.; Brogan, Paul; Krüger, Elke; Aksentijevich, Ivona; Goldbach-Mansky, Raphaela

    2015-01-01

    Autosomal recessive mutations in proteasome subunit β 8 (PSMB8), which encodes the inducible proteasome subunit β5i, cause the immune-dysregulatory disease chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature (CANDLE), which is classified as a proteasome-associated autoinflammatory syndrome (PRAAS). Here, we identified 8 mutations in 4 proteasome genes, PSMA3 (encodes α7), PSMB4 (encodes β7), PSMB9 (encodes β1i), and proteasome maturation protein (POMP), that have not been previously associated with disease and 1 mutation in PSMB8 that has not been previously reported. One patient was compound heterozygous for PSMB4 mutations, 6 patients from 4 families were heterozygous for a missense mutation in 1 inducible proteasome subunit and a mutation in a constitutive proteasome subunit, and 1 patient was heterozygous for a POMP mutation, thus establishing a digenic and autosomal dominant inheritance pattern of PRAAS. Function evaluation revealed that these mutations variably affect transcription, protein expression, protein folding, proteasome assembly, and, ultimately, proteasome activity. Moreover, defects in proteasome formation and function were recapitulated by siRNA-mediated knockdown of the respective subunits in primary fibroblasts from healthy individuals. Patient-isolated hematopoietic and nonhematopoietic cells exhibited a strong IFN gene-expression signature, irrespective of genotype. Additionally, chemical proteasome inhibition or progressive depletion of proteasome subunit gene transcription with siRNA induced transcription of type I IFN genes in healthy control cells. Our results provide further insight into CANDLE genetics and link global proteasome dysfunction to increased type I IFN production. PMID:26524591

  16. Different mutations of the human c-mpl gene indicate distinct haematopoietic diseases.

    PubMed

    He, Xin; Chen, Zhigang; Jiang, Yangyan; Qiu, Xi; Zhao, Xiaoying

    2013-01-25

    The human c-mpl gene (MPL) plays an important role in the development of megakaryocytes and platelets as well as the self-renewal of haematopoietic stem cells. However, numerous MPL mutations have been identified in haematopoietic diseases. These mutations alter the normal regulatory mechanisms and lead to autonomous activation or signalling deficiencies. In this review, we summarise 59 different MPL mutations and classify these mutations into four different groups according to the associated diseases and mutation rates. Using this classification, we clearly distinguish four diverse types of MPL mutations and obtain a deep understand of their clinical significance. This will prove to be useful for both disease diagnosis and the design of individual therapy regimens based on the type of MPL mutations.

  17. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    PubMed

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  18. Prediction of BRCA1 and BRCA2 mutation status using post-irradiation assays of lymphoblastoid cell lines is compromised by inter-cell-line phenotypic variability.

    PubMed

    Lovelock, Paul K; Wong, Ee Ming; Sprung, Carl N; Marsh, Anna; Hobson, Karen; French, Juliet D; Southey, Melissa; Sculley, Tom; Pandeya, Nirmala; Brown, Melissa A; Chenevix-Trench, Georgia; Spurdle, Amanda B; McKay, Michael J

    2007-09-01

    Assays to determine the pathogenicity of unclassified sequence variants in disease-associated genes include the analysis of lymphoblastoid cell lines (LCLs). We assessed the ability of several assays of LCLs to distinguish carriers of germline BRCA1 and BRCA2 gene mutations from mutation-negative controls to determine their utility for use in a diagnostic setting. Post-ionising radiation cell viability and micronucleus formation, and telomere length were assayed in LCLs carrying BRCA1 or BRCA2 mutations, and in unaffected mutation-negative controls. Post-irradiation cell viability and micronucleus induction assays of LCLs from individuals carrying pathogenic BRCA1 mutations, unclassified BRCA1 sequence variants or wildtype BRCA1 sequence showed significant phenotypic heterogeneity within each group. Responses were not consistent with predicted functional consequences of known pathogenic or normal sequences. Telomere length was also highly heterogeneous within groups of LCLs carrying pathogenic BRCA1 or BRCA2 mutations, and normal BRCA1 sequences, and was not predictive of mutation status. Given the significant degree of phenotypic heterogeneity of LCLs after gamma-irradiation, and the lack of association with BRCA1 or BRCA2 mutation status, we conclude that the assays evaluated in this study should not be used as a means of differentiating pathogenic and non-pathogenic sequence variants for clinical application. We suggest that a range of normal controls must be included in any functional assays of LCLs to ensure that any observed differences between samples reflect the genotype under investigation rather than generic inter-individual variation.

  19. Corin mutations K317E and S472G from preeclamptic patients alter zymogen activation and cell surface targeting. [Corrected].

    PubMed

    Dong, Ningzheng; Zhou, Tiantian; Zhang, Yue; Liu, Meng; Li, Hui; Huang, Xiaoyi; Liu, Zhenzhen; Wu, Yi; Fukuda, Koichi; Qin, Jun; Wu, Qingyu

    2014-06-20

    Corin is a membrane-bound serine protease that acts as the atrial natriuretic peptide (ANP) convertase in the heart. Recent studies show that corin also activates ANP in the pregnant uterus to promote spiral artery remodeling and prevent pregnancy-induced hypertension. Two CORIN gene mutations, K317E and S472G, were identified in preeclamptic patients and shown to have reduced activity in vitro. In this study, we carried out molecular modeling and biochemical experiments to understand how these mutations impair corin function. By molecular modeling, the mutation K317E was predicted to alter corin LDL receptor-2 module conformation. Western blot analysis of K317E mutant in HEK293 cells showed that the mutation did not block corin expression on the cell surface but inhibited corin zymogen activation. In contrast, the mutation S472G was predicted to abolish a β-sheet critical for corin frizzled-2 module structure. In Western blot analysis and flow cytometry, S472G mutant was not detected on the cell surface in transfected HEK293 cells. By immunostaining, the S472G mutant was found in the ER, indicating that the mutation S472G disrupted the β-sheet, causing corin misfolding and ER retention. Thus, these results show that mutations in the CORIN gene may impair corin function by entirely different mechanisms. Together, our data provide important insights into the molecular basis underlying corin mutations that may contribute to preeclampsia in patients. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. MET exon 14 skipping mutation in triple-negative pulmonary adenocarcinomas and pleomorphic carcinomas: An analysis of intratumoral MET status heterogeneity and clinicopathological characteristics.

    PubMed

    Kwon, Dohee; Koh, Jaemoon; Kim, Sehui; Go, Heounjeong; Kim, Young A; Keam, Bhumsuk; Kim, Tae Min; Kim, Dong-Wan; Jeon, Yoon Kyung; Chung, Doo Hyun

    2017-04-01

    MET mutations leading to exon 14 skipping rarely occur in non-small cell lung cancer (NSCLC). Recently, small molecule inhibitors targeting MET mutations showed clinical benefit. However, the clinicopathological characteristics of NSCLC harboring MET mutations, and the correlation among mutations, protein expression, and gene copy number of MET in NSCLC remain unclear. Therefore, we address these issues. MET exon 14 skipping mutations were evaluated using real-time quantitative reverse-transcription-PCR (qRT-PCR) in 102 triple-negative (i.e., EGFR mutation (-)/ALK translocation (-)/KRAS mutation (-)) pulmonary adenocarcinomas, and 45 pleomorphic carcinomas. MET mutation and gene copy were also examined in microdissected tissues obtained from tumor areas with heterogeneous MET immunohistochemical expression. MET mutations were detected in 8.8% (9/102) of triple-negative adenocarcinomas and 20% (9/45) of pleomorphic carcinomas of the lung. Patients with MET-mutated adenocarcinomas was significantly older than those without MET mutations (P=0.015). The male to female and ever-to never-smoker ratios were 3:6 and 2:7, respectively, among patients with MET-mutated adenocarcinomas. All (9/9) of the MET-mutated adenocarcinomas showed acinar predominant histology with associated lepidic patterns. In contrast, the male to female and ever- to never-smoker ratios were 8:1 and 7:1, respectively, among patients with MET-mutated pleomorphic carcinomas. The carcinoma component of MET-mutated pleomorphic carcinomas was mostly adenocarcinoma of acinar pattern (8/9). MET mutation was detected by qRT-PCR in all samples with heterogeneous MET expression microdissected from five cases with MET-mutated adenocarcinoma, while MET gene amplification was detected in tumor areas expressing high MET protein levels among MET-mutated adenocarcinomas. MET-mutated NSCLC is characterized by older age in patients with adenocarcinoma and by an acinar histology and variable MET expression in patients with adenocarcinoma and pleomorphic carcinomas. Moreover, MET gene amplification might occur in the tumor cells harboring the MET mutation. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Immunohistochemical detection of tumor suppressor gene p53 protein in feline injection site-associated sarcomas.

    PubMed

    Nambiar, P R; Jackson, M L; Ellis, J A; Chelack, B J; Kidney, B A; Haines, D M

    2001-03-01

    Sarcomas associated with injection sites are a rare but important problem in cats. Immunohistochemical detection of p53 protein may correlate to mutation of the p53 tumor suppressor gene, a gene known to be important in oncogenesis. The expression of nuclear p53 protein in 40 feline injection site-assocated sarcomas was examined by immunohistochemical staining. In 42.5% (17/40), tumor cell nuclei were stained darkly; in 20% (8/40), tumor cell nuclei were stained palely; and in 37.5% (15/40), tumor cell nuclei were unstained. Immunohistochemical detection of p53 protein in a proportion of injection site-associated sarcomas suggests that mutation of the p53 gene may play a role in the pathogenesis of these tumors.

  2. Ras1 interacts with multiple new signaling and cytoskeletal loci in Drosophila eggshell patterning and morphogenesis.

    PubMed Central

    Schnorr, J D; Holdcraft, R; Chevalier, B; Berg, C A

    2001-01-01

    Little is known about the genes that interact with Ras signaling pathways to regulate morphogenesis. The synthesis of dorsal eggshell structures in Drosophila melanogaster requires multiple rounds of Ras signaling followed by dramatic epithelial sheet movements. We took advantage of this process to identify genes that link patterning and morphogenesis; we screened lethal mutations on the second chromosome for those that could enhance a weak Ras1 eggshell phenotype. Of 1618 lethal P-element mutations tested, 13 showed significant enhancement, resulting in forked and fused dorsal appendages. Our genetic and molecular analyses together with information from the Berkeley Drosophila Genome Project reveal that 11 of these lines carry mutations in previously characterized genes. Three mutations disrupt the known Ras1 cell signaling components Star, Egfr, and Blistered, while one mutation disrupts Sec61beta, implicated in ligand secretion. Seven lines represent cell signaling and cytoskeletal components that are new to the Ras1 pathway; these are Chickadee (Profilin), Tec29, Dreadlocks, POSH, Peanut, Smt3, and MESK2, a suppressor of dominant-negative Ksr. A twelfth insertion disrupts two genes, Nrk, a "neurospecific" receptor tyrosine kinase, and Tpp, which encodes a neuropeptidase. These results suggest that Ras1 signaling during oogenesis involves novel components that may be intimately associated with additional signaling processes and with the reorganization of the cytoskeleton. To determine whether these Ras1 Enhancers function upstream or downstream of the Egf receptor, four mutations were tested for their ability to suppress an activated Egfr construct (lambdatop) expressed in oogenesis exclusively in the follicle cells. Mutations in Star and l(2)43Bb had no significant effect upon the lambdatop eggshell defect whereas smt3 and dock alleles significantly suppressed the lambdatop phenotype. PMID:11606538

  3. Ras1 interacts with multiple new signaling and cytoskeletal loci in Drosophila eggshell patterning and morphogenesis.

    PubMed

    Schnorr, J D; Holdcraft, R; Chevalier, B; Berg, C A

    2001-10-01

    Little is known about the genes that interact with Ras signaling pathways to regulate morphogenesis. The synthesis of dorsal eggshell structures in Drosophila melanogaster requires multiple rounds of Ras signaling followed by dramatic epithelial sheet movements. We took advantage of this process to identify genes that link patterning and morphogenesis; we screened lethal mutations on the second chromosome for those that could enhance a weak Ras1 eggshell phenotype. Of 1618 lethal P-element mutations tested, 13 showed significant enhancement, resulting in forked and fused dorsal appendages. Our genetic and molecular analyses together with information from the Berkeley Drosophila Genome Project reveal that 11 of these lines carry mutations in previously characterized genes. Three mutations disrupt the known Ras1 cell signaling components Star, Egfr, and Blistered, while one mutation disrupts Sec61beta, implicated in ligand secretion. Seven lines represent cell signaling and cytoskeletal components that are new to the Ras1 pathway; these are Chickadee (Profilin), Tec29, Dreadlocks, POSH, Peanut, Smt3, and MESK2, a suppressor of dominant-negative Ksr. A twelfth insertion disrupts two genes, Nrk, a "neurospecific" receptor tyrosine kinase, and Tpp, which encodes a neuropeptidase. These results suggest that Ras1 signaling during oogenesis involves novel components that may be intimately associated with additional signaling processes and with the reorganization of the cytoskeleton. To determine whether these Ras1 Enhancers function upstream or downstream of the Egf receptor, four mutations were tested for their ability to suppress an activated Egfr construct (lambdatop) expressed in oogenesis exclusively in the follicle cells. Mutations in Star and l(2)43Bb had no significant effect upon the lambdatop eggshell defect whereas smt3 and dock alleles significantly suppressed the lambdatop phenotype.

  4. Production of Gene-Corrected Adult Beta Globin Protein in Human Erythrocytes Differentiated from Patient iPSCs After Genome Editing of the Sickle Point Mutation.

    PubMed

    Huang, Xiaosong; Wang, Ying; Yan, Wei; Smith, Cory; Ye, Zhaohui; Wang, Jing; Gao, Yongxing; Mendelsohn, Laurel; Cheng, Linzhao

    2015-05-01

    Human induced pluripotent stem cells (iPSCs) and genome editing provide a precise way to generate gene-corrected cells for disease modeling and cell therapies. Human iPSCs generated from sickle cell disease (SCD) patients have a homozygous missense point mutation in the HBB gene encoding adult β-globin proteins, and are used as a model system to improve strategies of human gene therapy. We demonstrate that the CRISPR/Cas9 system designer nuclease is much more efficient in stimulating gene targeting of the endogenous HBB locus near the SCD point mutation in human iPSCs than zinc finger nucleases and TALENs. Using a specific guide RNA and Cas9, we readily corrected one allele of the SCD HBB gene in human iPSCs by homologous recombination with a donor DNA template containing the wild-type HBB DNA and a selection cassette that was subsequently removed to avoid possible interference of HBB transcription and translation. We chose targeted iPSC clones that have one corrected and one disrupted SCD allele for erythroid differentiation assays, using an improved xeno-free and feeder-free culture condition we recently established. Erythrocytes from either the corrected or its parental (uncorrected) iPSC line were generated with similar efficiencies. Currently ∼6%-10% of these differentiated erythrocytes indeed lacked nuclei, characteristic of further matured erythrocytes called reticulocytes. We also detected the 16-kDa β-globin protein expressed from the corrected HBB allele in the erythrocytes differentiated from genome-edited iPSCs. Our results represent a significant step toward the clinical applications of genome editing using patient-derived iPSCs to generate disease-free cells for cell and gene therapies. Stem Cells 2015;33:1470-1479. © 2015 AlphaMed Press.

  5. Efficient Generation of Somatic Cell Nuclear Transfer-Competent Porcine Cells with Mutated Alleles at Multiple Target Loci by Using CRISPR/Cas9 Combined with Targeted Toxin-Based Selection System.

    PubMed

    Sato, Masahiro; Miyoshi, Kazuchika; Nakamura, Shingo; Ohtsuka, Masato; Sakurai, Takayuki; Watanabe, Satoshi; Kawaguchi, Hiroaki; Tanimoto, Akihide

    2017-12-04

    The recent advancement in genome editing such a CRISPR/Cas9 system has enabled isolation of cells with knocked multiple alleles through a one-step transfection. Somatic cell nuclear transfer (SCNT) has been frequently employed as one of the efficient tools for the production of genetically modified (GM) animals. To use GM cells as SCNT donor, efficient isolation of transfectants with mutations at multiple target loci is often required. The methods for the isolation of such GM cells largely rely on the use of drug selection-based approach using selectable genes; however, it is often difficult to isolate cells with mutations at multiple target loci. In this study, we used a novel approach for the efficient isolation of porcine cells with at least two target loci mutations by one-step introduction of CRISPR/Cas9-related components. A single guide (sg) RNA targeted to GGTA1 gene, involved in the synthesis of cell-surface α-Gal epitope (known as xenogenic antigen), is always a prerequisite. When the transfected cells were reacted with toxin-labeled BS-I-B₄ isolectin for 2 h at 37 C to eliminate α-Gal epitope-expressing cells, the surviving clones lacked α-Gal epitope expression and were highly expected to exhibit induced mutations at another target loci. Analysis of these α-Gal epitope-negative surviving cells demonstrated a 100% occurrence of genome editing at target loci. SCNT using these cells as donors resulted in the production of cloned blastocysts with the genotype similar to that of the donor cells used. Thus, this novel system will be useful for SCNT-mediated acquisition of GM cloned piglets, in which multiple target loci may be mutated.

  6. Permanent Neonatal Diabetes Caused by Dominant, Recessive, or Compound Heterozygous SUR1 Mutations with Opposite Functional Effects

    PubMed Central

    Ellard, Sian ; Flanagan, Sarah E. ; Girard, Christophe A. ; Patch, Ann-Marie ; Harries, Lorna W. ; Parrish, Andrew ; Edghill, Emma L. ; Mackay, Deborah J. G. ; Proks, Peter ; Shimomura, Kenju ; Haberland, Holger ; Carson, Dennis J. ; Shield, Julian P. H. ; Hattersley, Andrew T. ; Ashcroft, Frances M. 

    2007-01-01

    Heterozygous activating mutations in the KCNJ11 gene encoding the pore-forming Kir6.2 subunit of the pancreatic beta cell KATP channel are the most common cause of permanent neonatal diabetes (PNDM). Patients with PNDM due to a heterozygous activating mutation in the ABCC8 gene encoding the SUR1 regulatory subunit of the KATP channel have recently been reported. We studied a cohort of 59 patients with permanent diabetes who received a diagnosis before 6 mo of age and who did not have a KCNJ11 mutation. ABCC8 gene mutations were identified in 16 of 59 patients and included 8 patients with heterozygous de novo mutations. A recessive mode of inheritance was observed in eight patients with homozygous, mosaic, or compound heterozygous mutations. Functional studies of selected mutations showed a reduced response to ATP consistent with an activating mutation that results in reduced insulin secretion. A novel mutational mechanism was observed in which a heterozygous activating mutation resulted in PNDM only when a second, loss-of-function mutation was also present. PMID:17668386

  7. Mutagenesis of diploid mammalian genes by gene entrapment

    PubMed Central

    Lin, Qing; Donahue, Sarah L.; Moore-Jarrett, Tracy; Cao, Shang; Osipovich, Anna B.; Ruley, H. Earl

    2006-01-01

    The present study describes a genome-wide method for biallelic mutagenesis in mammalian cells. Novel poly(A) gene trap vectors, which contain features for direct cloning vector–cell fusion transcripts and for post-entrapment genome engineering, were used to generate a library of 979 mutant ES cells. The entrapment mutations generally disrupted gene expression and were readily transmitted through the germline, establishing the library as a resource for constructing mutant mice. Cells homozygous for most entrapment loci could be isolated by selecting for enhanced expression of an inserted neomycin-resistance gene that resulted from losses of heterozygosity (LOH). The frequencies of LOH measured at 37 sites in the genome ranged from 1.3 × 10−5 to 1.2 × 10−4 per cell and increased with increasing distance from the centromere, implicating mitotic recombination in the process. The ease and efficiency of obtaining homozygous mutations will (i) facilitate genetic studies of gene function in cultured cells, (ii) permit genome-wide studies of recombination events that result in LOH and mediate a type of chromosomal instability important in carcinogenesis, and (iii) provide new strategies for phenotype-driven mutagenesis screens in mammalian cells. PMID:17062627

  8. A Knock-in Mouse Model of Human PHD2 Gene-associated Erythrocytosis Establishes a Haploinsufficiency Mechanism*

    PubMed Central

    Arsenault, Patrick R.; Pei, Fei; Lee, Rebecca; Kerestes, Heddy; Percy, Melanie J.; Keith, Brian; Simon, M. Celeste; Lappin, Terence R. J.; Khurana, Tejvir S.; Lee, Frank S.

    2013-01-01

    The central pathway for controlling red cell mass is the PHD (prolyl hydroxylase domain protein):hypoxia-inducible factor (HIF) pathway. HIF, which is negatively regulated by PHD, activates numerous genes, including ones involved in erythropoiesis, such as the ERYTHROPOIETIN (EPO) gene. Recent studies have implicated PHD2 as the key PHD isoform regulating red cell mass. Studies of humans have identified erythrocytosis-associated, heterozygous point mutations in the PHD2 gene. A key question concerns the mechanism by which human mutations lead to phenotypes. In the present report, we generated and characterized a mouse line in which a P294R knock-in mutation has been introduced into the mouse Phd2 locus to model the first reported human PHD2 mutation (P317R). Phd2P294R/+ mice display a degree of erythrocytosis equivalent to that seen in Phd2+/− mice. The Phd2P294R/+-associated erythrocytosis is reversed in a Hif2a+/−, but not a Hif1a+/− background. Additional studies using various conditional knock-outs of Phd2 reveal that erythrocytosis can be induced by homozygous and heterozygous knock-out of Phd2 in renal cortical interstitial cells using a Pax3-Cre transgene or by homozygous knock-out of Phd2 in hematopoietic progenitors driven by a Vav1-Cre transgene. These studies formally prove that a missense mutation in PHD2 is the cause of the erythrocytosis, show that this occurs through haploinsufficiency, and point to multifactorial control of red cell mass by PHD2. PMID:24121508

  9. CVID-associated TACI mutations affect autoreactive B cell selection and activation

    PubMed Central

    Romberg, Neil; Chamberlain, Nicolas; Saadoun, David; Gentile, Maurizio; Kinnunen, Tuure; Ng, Yen Shing; Virdee, Manmeet; Menard, Laurence; Cantaert, Tineke; Morbach, Henner; Rachid, Rima; Martinez-Pomar, Natalia; Matamoros, Nuria; Geha, Raif; Grimbacher, Bodo; Cerutti, Andrea; Cunningham-Rundles, Charlotte; Meffre, Eric

    2013-01-01

    Common variable immune deficiency (CVID) is an assorted group of primary diseases that clinically manifest with antibody deficiency, infection susceptibility, and autoimmunity. Heterozygous mutations in the gene encoding the tumor necrosis factor receptor superfamily member TACI are associated with CVID and autoimmune manifestations, whereas two mutated alleles prevent autoimmunity. To assess how the number of TACI mutations affects B cell activation and tolerance checkpoints, we analyzed healthy individuals and CVID patients carrying one or two TACI mutations. We found that TACI interacts with the cleaved, mature forms of TLR7 and TLR9 and plays an important role during B cell activation and the central removal of autoreactive B cells in healthy donors and CVID patients. However, only subjects with a single TACI mutation displayed a breached immune tolerance and secreted antinuclear antibodies (ANAs). These antibodies were associated with the presence of circulating B cell lymphoma 6–expressing T follicular helper (Tfh) cells, likely stimulating autoreactive B cells. Thus, TACI mutations may favor CVID by altering B cell activation with coincident impairment of central B cell tolerance, whereas residual B cell responsiveness in patients with one, but not two, TACI mutations enables autoimmune complications. PMID:24051380

  10. Variations in the S and P regions of the hepatitis B virus genome under immunosuppression in vitro and in vivo.

    PubMed

    Shen, Zhong-Yang; Zheng, Wei-Ping; Deng, Yong-Lin; Song, Hong-Li

    2012-10-01

    To provide a basis for improved prevention and treatment of hepatitis B virus (HBV) re-infection after liver transplantation, variations in the S and P genes of HBV under immunosuppression in vitro and their association with patient prognosis were investigated. For the in vitro study, HepG2.2.15 hepatocellular carcinoma cells stably producing HBV particles were treated with the immunosuppressants methylprednisolone (MP) and tacrolimus (FK506) at doses found to be non-toxic by the methylthiazolyl tetrazolium (MTT) cell viability assay. MP dose-dependently inhibited HBV DNA expression in HepG2.2.15 cells, while FK506 did not, as determined by quantitative real-time PCR (qRT-PCR). By gene sequencing, both MP and FK506 were found to cause variations in HBV S, P, and S/P overlapping regions. MP- but not FK506-induced mutations were common in the glucocorticoid response element of the P region, while both immunosuppressants caused mutations outside the nucleoside analogue resistance sites. For the in vivo study, 14 patients with HBV-related end-stage liver disease re-infected after liver transplantation, and 20 cases without HBV re-infection as controls, were studied. Seventy-five percent of re-infected recipients showed multi-loci amino acid mutations at different sites besides lamivudine (LAM)-resistant loci in the P region, including in the glucocorticoid response element. Fifty percent of re-infected recipients had mutations in the "a" determinant region and flanking sequences. Re-infection was associated with negative serum hepatitis B immunoglobulin (HBIG), as measured by a microparticle capture enzyme immunoassay. Nucleotide mutations in the S region caused missense or synonymous mutations, which caused synonymous mutations in the overlapping P region. These results showed that effects of immunosuppressants on HBV genes in vitro were different from those in clinical recipients. Positive HBV DNA and gene mutations pre-transplantation were factors affecting re-infection post-transplantation. Multiple mutations found in the P and S genes suggest that the formation of quasispecies contributes to HBV re-infection after liver transplantation.

  11. The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

    PubMed Central

    Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

    2017-01-01

    Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

  12. Mutations in the ABCA4 (ABCR) gene are the major cause of autosomal recessive cone-rod dystrophy.

    PubMed

    Maugeri, A; Klevering, B J; Rohrschneider, K; Blankenagel, A; Brunner, H G; Deutman, A F; Hoyng, C B; Cremers, F P

    2000-10-01

    The photoreceptor cell-specific ATP-binding cassette transporter gene (ABCA4; previously denoted "ABCR") is mutated, in most patients, with autosomal recessive (AR) Stargardt disease (STGD1) or fundus flavimaculatus (FFM). In addition, a few cases with AR retinitis pigmentosa (RP) and AR cone-rod dystrophy (CRD) have been found to have ABCA4 mutations. To evaluate the importance of the ABCA4 gene as a cause of AR CRD, we selected 5 patients with AR CRD and 15 patients from Germany and The Netherlands with isolated CRD. Single-strand conformation-polymorphism analysis and sequencing revealed 19 ABCA4 mutations in 13 (65%) of 20 patients. In six patients, mutations were identified in both ABCA4 alleles; in seven patients, mutations were detected in one allele. One complex ABCA4 allele (L541P;A1038V) was found exclusively in German patients with CRD; one patient carried this complex allele homozygously, and five others were compound heterozygous. These findings suggest that mutations in the ABCA4 gene are the major cause of AR CRD. A primary role of the ABCA4 gene in STGD1/FFM and AR CRD, together with the gene's involvement in an as-yet-unknown proportion of cases with AR RP, strengthens the idea that mutations in the ABCA4 gene could be the most frequent cause of inherited retinal dystrophy in humans.

  13. Clonal evolution in relapsed and refractory diffuse large B-cell lymphoma is characterized by high dynamics of subclones.

    PubMed

    Melchardt, Thomas; Hufnagl, Clemens; Weinstock, David M; Kopp, Nadja; Neureiter, Daniel; Tränkenschuh, Wolfgang; Hackl, Hubert; Weiss, Lukas; Rinnerthaler, Gabriel; Hartmann, Tanja N; Greil, Richard; Weigert, Oliver; Egle, Alexander

    2016-08-09

    Little information is available about the role of certain mutations for clonal evolution and the clinical outcome during relapse in diffuse large B-cell lymphoma (DLBCL). Therefore, we analyzed formalin-fixed-paraffin-embedded tumor samples from first diagnosis, relapsed or refractory disease from 28 patients using next-generation sequencing of the exons of 104 coding genes. Non-synonymous mutations were present in 74 of the 104 genes tested. Primary tumor samples showed a median of 8 non-synonymous mutations (range: 0-24) with the used gene set. Lower numbers of non-synonymous mutations in the primary tumor were associated with a better median OS compared with higher numbers (28 versus 15 months, p=0.031). We observed three patterns of clonal evolution during relapse of disease: large global change, subclonal selection and no or minimal change possibly suggesting preprogrammed resistance. We conclude that targeted re-sequencing is a feasible and informative approach to characterize the molecular pattern of relapse and it creates novel insights into the role of dynamics of individual genes.

  14. A lack of Birbeck granules in Langerhans cells is associated with a naturally occurring point mutation in the human Langerin gene.

    PubMed

    Verdijk, Pauline; Dijkman, Remco; Plasmeijer, Elsemieke I; Mulder, Aat A; Zoutman, Willem H; Mieke Mommaas, A; Tensen, Cornelis P

    2005-04-01

    A heterozygous mutation in the Langerin gene corresponding to position 837 in the Langerin mRNA was identified in a person deficient in Birbeck granules (BG). This mutation results in an amino acid replacement of tryptophan by arginine at position 264 in the carbohydrate recognition domain of the Langerine protein. Expression of mutated Langerin in human fibroblasts induces tubular-like structures that are negative for BG-specific antibodies and do not resemble the characteristic structural features of BG.

  15. Mutations in the estrogen receptor alpha hormone binding domain promote stem cell phenotype through notch activation in breast cancer cell lines.

    PubMed

    Gelsomino, L; Panza, S; Giordano, C; Barone, I; Gu, G; Spina, E; Catalano, S; Fuqua, S; Andò, S

    2018-04-24

    The detection of recurrent mutations affecting the hormone binding domain (HBD) of estrogen receptor alpha (ERα/ESR1) in endocrine therapy-resistant and metastatic breast cancers has prompted interest in functional characterization of these genetic alterations. Here, we explored the role of HBD-ESR1 mutations in influencing the behavior of breast cancer stem cells (BCSCs), using various BC cell lines stably expressing wild-type or mutant (Y537 N, Y537S, D538G) ERα. Compared to WT-ERα clones, mutant cells showed increased CD44 + /CD24 - ratio, mRNA levels of stemness genes, Mammosphere Forming Efficiency (MFE), Self-Renewal and migratory capabilities. Mutant clones exhibited high expression of NOTCH receptors/ligands/target genes and blockade of NOTCH signaling reduced MFE and migratory potential. Mutant BCSC activity was dependent on ERα phosphorylation at serine 118, since its inhibition decreased MFE and NOTCH4 activation only in mutant cells. Collectively, we demonstrate that the expression of HBD-ESR1 mutations may drive BC cells to acquire stem cell traits through ER/NOTCH4 interplay. We propose the early detection of HBD-ESR1 mutations as a challenge in precision medicine strategy, suggesting the development of tailored-approaches (i.e. NOTCH inhibitors) to prevent disease development and metastatic spread in BC mutant-positive patients. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Genome engineering using a synthetic gene circuit in Bacillus subtilis.

    PubMed

    Jeong, Da-Eun; Park, Seung-Hwan; Pan, Jae-Gu; Kim, Eui-Joong; Choi, Soo-Keun

    2015-03-31

    Genome engineering without leaving foreign DNA behind requires an efficient counter-selectable marker system. Here, we developed a genome engineering method in Bacillus subtilis using a synthetic gene circuit as a counter-selectable marker system. The system contained two repressible promoters (B. subtilis xylA (Pxyl) and spac (Pspac)) and two repressor genes (lacI and xylR). Pxyl-lacI was integrated into the B. subtilis genome with a target gene containing a desired mutation. The xylR and Pspac-chloramphenicol resistant genes (cat) were located on a helper plasmid. In the presence of xylose, repression of XylR by xylose induced LacI expression, the LacIs repressed the Pspac promoter and the cells become chloramphenicol sensitive. Thus, to survive in the presence of chloramphenicol, the cell must delete Pxyl-lacI by recombination between the wild-type and mutated target genes. The recombination leads to mutation of the target gene. The remaining helper plasmid was removed easily under the chloramphenicol absent condition. In this study, we showed base insertion, deletion and point mutation of the B. subtilis genome without leaving any foreign DNA behind. Additionally, we successfully deleted a 2-kb gene (amyE) and a 38-kb operon (ppsABCDE). This method will be useful to construct designer Bacillus strains for various industrial applications. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

    PubMed

    Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

    2017-07-01

    In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

  18. Complete Reconstitution of the Vancomycin-Intermediate Staphylococcus aureus Phenotype of Strain Mu50 in Vancomycin-Susceptible S. aureus

    PubMed Central

    Sekine, Miwa; Hishinuma, Tomomi; Aiba, Yoshifumi; Hiramatsu, Keiichi

    2016-01-01

    Complete reconstitution of the vancomycin-intermediate Staphylococcus aureus (VISA) phenotype of strain Mu50 was achieved by sequentially introducing mutations into six genes of vancomycin-susceptible S. aureus (VSSA) strain N315ΔIP. The six mutated genes were detected in VISA strain Mu50 but not in N315ΔIP. Introduction of the mutation Ser329Leu into vraS, encoding the sensor histidine kinase of the vraSR two-component regulatory (TCR) system, and another mutation, Glu146Lys, into msrR, belonging to the LytR-CpsA-Psr (LCP) family, increased the level of vancomycin resistance to that detected in heterogeneous vancomycin-intermediate S. aureus (hVISA) strain Mu3. Introduction of two more mutations, Asn197Ser into graR of the graSR TCR system and His481Tyr into rpoB, encoding the β subunit of RNA polymerase, converted the hVISA strain into a VISA strain with the same level of vancomycin resistance as Mu50. Surprisingly, however, the constructed quadruple mutant strain ΔIP4 did not have a thickened cell wall, a cardinal feature of the VISA phenotype. Subsequent study showed that cell wall thickening was an inducible phenotype in the mutant strain, whereas it was a constitutive one in Mu50. Finally, introduction of the Ala297Val mutation into fdh2, which encodes a putative formate dehydrogenase, or a 67-amino-acid sequence deletion into sle1 [sle1(Δ67aa)], encoding the hydrolase of N-acetylmuramyl-l-alanine amidase in the peptidoglycan, converted inducible cell wall thickening into constitutive cell wall thickening. sle1(Δ67aa) was found to cause a drastic decrease in autolysis activity. Thus, all six mutated genes required for acquisition of the VISA phenotype were directly or indirectly involved in the regulation of cell physiology. The VISA phenotype seemed to be achieved through multiple genetic events accompanying drastic changes in cell physiology. PMID:27067329

  19. BRCA1 Mutation Status and Follicular Fluid Exposure Alters NFκB Signaling and ISGylation in Human Fallopian Tube Epithelial Cells.

    PubMed

    Hollingsworth, Julia; Lau, Angela; Tone, Alicia; Kollara, Alexandra; Allen, Lisa; Colgan, Terence J; Dube, Valerie; Rosen, Barry; Murphy, K Joan; Greenblatt, Ellen M; Feigenberg, Tomer; Virtanen, Carl; Brown, Theodore J

    2018-05-28

    Germline BRCA1 or BRCA2 mutations (mtBRCA1 and mtBRCA2) increase risk for high-grade serous ovarian cancer (HGSOC), the most commonly diagnosed epithelial ovarian cancer histotype. Other identified risk factors for this cancer, which originates primarily in the distal fallopian tube epithelium (FTE), implicate ovulation, during which the FTE cells become transiently exposed to follicular fluid (FF). To test whether mtBRCA1 or mtBRCA2 nonmalignant FTE cells respond differently to periovulatory FF exposure than control patient FTE cells, gene expression profiles from primary FTE cultures derived from BRCA1 or BRCA2 mutation carriers or control patients were compared at baseline, 24 hours after FF exposure, and 24 hours after FF replacement with culture medium. Hierarchical clustering revealed both FF exposure and BRCA mutation status affect gene expression, with BRCA1 mutation having the greatest impact. Gene set enrichment analysis revealed increased NFκB and EGFR signaling at baseline in mtBRCA1 samples, with increased interferon target gene expression, including members of the ISGylation pathway, observed after recovery from FF exposure. Gene set enrichment analysis did not identify altered pathway signaling in mtBRCA2 samples. An inverse relationship between EGFR signaling and ISGylation with BRCA1 protein levels was verified in an immortalized FTE cell line, OE-E6/E7, stably transfected with BRCA1 cDNA. Suppression of ISG15 and ISGylated protein levels by increased BRCA1 expression was found to be mediated by decreased NFκB signaling. These studies indicate that increased NFκB signaling associated with decreased BRCA1 expression results in increased ISG15 and protein ISGylation following FF exposure, which may be involved in predisposition to HGSOC. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Chronic active Epstein-Barr virus infection associated with mutations in perforin that impair its maturation.

    PubMed

    Katano, Harutaka; Ali, Mir A; Patera, Andriani C; Catalfamo, Marta; Jaffe, Elaine S; Kimura, Hiroshi; Dale, Janet K; Straus, Stephen E; Cohen, Jeffrey I

    2004-02-15

    Chronic active Epstein-Barr virus infection (CAEBV) is a rare disease in which previously healthy persons develop severe, life-threatening illness. Mutations in the perforin gene have been found in familial hemophagocytic lymphohistiocytosis, which shares some features with CAEBV. We studied a patient who died at age 18, 10 years after the onset of CAEBV. The patient had high titers of antibodies to EBV, EBV RNA in lymph nodes, T-cell lymphoproliferative disease, and hemophagocytic lymphohistiocytosis. DNA sequencing showed novel mutations in both alleles of the perforin gene that resulted in amino acid changes in the protein. The quantity of the native form of perforin from the patient's stimulated peripheral blood mononuclear cells (PBMCs) was extremely low and immunoblotting showed accumulation of an uncleaved precursor form of perforin. Stimulated PBMCs from the patient were defective for Fas-independent cytotoxicity. These data imply that mutations in this patient resulted in reduced perforin-mediated cytotoxicity by his lymphocytes. This is the first case in which perforin mutations have been shown to result in accumulation of the uncleaved, immature form of perforin. Mutations in the perforin gene are associated with some cases of CAEBV with hemophagocytic lymphohistiocytosis.

  1. Simultaneous Identification of Multiple Driver Pathways in Cancer

    PubMed Central

    Leiserson, Mark D. M.; Blokh, Dima

    2013-01-01

    Distinguishing the somatic mutations responsible for cancer (driver mutations) from random, passenger mutations is a key challenge in cancer genomics. Driver mutations generally target cellular signaling and regulatory pathways consisting of multiple genes. This heterogeneity complicates the identification of driver mutations by their recurrence across samples, as different combinations of mutations in driver pathways are observed in different samples. We introduce the Multi-Dendrix algorithm for the simultaneous identification of multiple driver pathways de novo in somatic mutation data from a cohort of cancer samples. The algorithm relies on two combinatorial properties of mutations in a driver pathway: high coverage and mutual exclusivity. We derive an integer linear program that finds set of mutations exhibiting these properties. We apply Multi-Dendrix to somatic mutations from glioblastoma, breast cancer, and lung cancer samples. Multi-Dendrix identifies sets of mutations in genes that overlap with known pathways – including Rb, p53, PI(3)K, and cell cycle pathways – and also novel sets of mutually exclusive mutations, including mutations in several transcription factors or other genes involved in transcriptional regulation. These sets are discovered directly from mutation data with no prior knowledge of pathways or gene interactions. We show that Multi-Dendrix outperforms other algorithms for identifying combinations of mutations and is also orders of magnitude faster on genome-scale data. Software available at: http://compbio.cs.brown.edu/software. PMID:23717195

  2. Human pluripotent stem cells recurrently acquire and expand dominant negative P53 mutations

    PubMed Central

    Kamitaki, Nolan; Mitchell, Jana; Avior, Yishai; Mello, Curtis; Kashin, Seva; Mekhoubad, Shila; Ilic, Dusko; Charlton, Maura; Saphier, Genevieve; Handsaker, Robert E.; Genovese, Giulio; Bar, Shiran; Benvenisty, Nissim; McCarroll, Steven A.; Eggan, Kevin

    2017-01-01

    Human pluripotent stem cells (hPSCs) can self-renew indefinitely, making them an attractive source for regenerative therapies. This expansion potential has been linked with acquisition of large copy number variants (CNVs) that provide mutant cells with a growth advantage in culture1–3. However, the nature, extent, and functional impact of other acquired genome sequence mutations in cultured hPSCs is not known. Here, we sequenced the protein-coding genes (exomes) of 140 independent human embryonic stem cell (hESC) lines, including 26 lines prepared for potential clinical use4. We then applied computational strategies for identifying mutations present in a subset of cells5. Though such mosaic mutations were generally rare, we identified five unrelated hESC lines that carried six mutations in the TP53 gene that encodes the tumor suppressor P53. Notably, the TP53 mutations we observed are dominant negative and are the mutations most commonly seen in human cancers. We used droplet digital PCR to demonstrate that the TP53 mutant allelic fraction increased with passage number under standard culture conditions, suggesting that P53 mutation confers selective advantage. When we then mined published RNA sequencing data from 117 hPSC lines, we observed another nine TP53 mutations, all resulting in coding changes in the DNA binding domain of P53. Strikingly, in three lines, the allelic fraction exceeded 50%, suggesting additional selective advantage resulting from loss of heterozygosity at the TP53 locus. As the acquisition and favored expansion of cancer-associated mutations in hPSCs may go unnoticed during most applications, we suggest that careful genetic characterization of hPSCs and their differentiated derivatives should be carried out prior to clinical use. PMID:28445466

  3. A recurrent WARS mutation is a novel cause of autosomal dominant distal hereditary motor neuropathy.

    PubMed

    Tsai, Pei-Chien; Soong, Bing-Wen; Mademan, Inès; Huang, Yen-Hua; Liu, Chia-Rung; Hsiao, Cheng-Tsung; Wu, Hung-Ta; Liu, Tze-Tze; Liu, Yo-Tsen; Tseng, Yen-Ting; Lin, Kon-Ping; Yang, Ueng-Cheng; Chung, Ki Wha; Choi, Byung-Ok; Nicholson, Garth A; Kennerson, Marina L; Chan, Chih-Chiang; De Jonghe, Peter; Cheng, Tzu-Hao; Liao, Yi-Chu; Züchner, Stephan; Baets, Jonathan; Lee, Yi-Chung

    2017-05-01

    Distal hereditary motor neuropathy is a heterogeneous group of inherited neuropathies characterized by distal limb muscle weakness and atrophy. Although at least 15 genes have been implicated in distal hereditary motor neuropathy, the genetic causes remain elusive in many families. To identify an additional causal gene for distal hereditary motor neuropathy, we performed exome sequencing for two affected individuals and two unaffected members in a Taiwanese family with an autosomal dominant distal hereditary motor neuropathy in which mutations in common distal hereditary motor neuropathy-implicated genes had been excluded. The exome sequencing revealed a heterozygous mutation, c.770A > G (p.His257Arg), in the cytoplasmic tryptophanyl-tRNA synthetase (TrpRS) gene (WARS) that co-segregates with the neuropathy in the family. Further analyses of WARS in an additional 79 Taiwanese pedigrees with inherited neuropathies and 163 index cases from Australian, European, and Korean distal hereditary motor neuropathy families identified the same mutation in another Taiwanese distal hereditary motor neuropathy pedigree with different ancestries and one additional Belgian distal hereditary motor neuropathy family of Caucasian origin. Cell transfection studies demonstrated a dominant-negative effect of the p.His257Arg mutation on aminoacylation activity of TrpRS, which subsequently compromised protein synthesis and reduced cell viability. His257Arg TrpRS also inhibited neurite outgrowth and led to neurite degeneration in the neuronal cell lines and rat motor neurons. Further in vitro analyses showed that the WARS mutation could potentiate the angiostatic activities of TrpRS by enhancing its interaction with vascular endothelial-cadherin. Taken together, these findings establish WARS as a gene whose mutations may cause distal hereditary motor neuropathy and alter canonical and non-canonical functions of TrpRS. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    PubMed

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. The phenotype of mes-2, mes-3, mes-4 and mes-6, maternal-effect genes required for survival of the germline in Caenorhabditis elegans, is sensitive to chromosome dosage.

    PubMed Central

    Garvin, C; Holdeman, R; Strome, S

    1998-01-01

    Mutations in mes-2, mes-3, mes-4, and mes-6 result in maternal-effect sterility: hermaphrodite offspring of mes/mes mothers are sterile because of underproliferation and death of the germ cells, as well as an absence of gametes. Mutant germ cells do not undergo programmed cell death, but instead undergo a necrotic-type death, and their general poor health apparently prevents surviving germ cells from forming gametes. Male offspring of mes mothers display a significantly less severe germline phenotype than their hermaphrodite siblings, and males are often fertile. This differential response of hermaphrodite and male offspring to the absence of mes+ product is a result of their different X chromosome compositions; regardless of their sexual phenotype, XX worms display a more severe germline phenotype than XO worms, and XXX worms display the most severe phenotype. The sensitivity of the mutant phenotype to chromosome dosage, along with the similarity of two MES proteins to chromatin-associated regulators of gene expression in Drosophila, suggest that the essential role of the mes genes is in control of gene expression in the germline. An additional, nonessential role of the mes genes in the soma is suggested by the surprising finding that mutations in the mes genes, like mutations in dosage compensation genes, feminize animals whose male sexual identity is somewhat ambiguous. We hypothesize that the mes genes encode maternally supplied regulators of chromatin structure and gene expression in the germline and perhaps in somatic cells of the early embryo, and that at least some of their targets are on the X chromosomes. PMID:9475730

  6. Factors affecting the loss of MED12-mutated leiomyoma cells during in vitro growth.

    PubMed

    Bloch, Jeannine; Holzmann, Carsten; Koczan, Dirk; Helmke, Burkhard Maria; Bullerdiek, Jörn

    2017-05-23

    Uterine leiomyomas (UL) are the most prevalent symptomatic human tumors at all and somatic mutations of the gene encoding mediator subcomplex 12 (MED12) constitute the most frequent driver mutations in UL. Recently, a rapid loss of mutated cells during in vitro growth of UL-derived cell cultures was reported, resulting in doubts about the benefits of UL-derived cell cultures. To evaluate if the rapid loss of MED12-mutated cells in UL cell cultures depends on in vitro passaging, we set up cell cultures from nine UL from 40-50 year old Caucasian patients with at least one UL. Cultured UL cells were investigated for loss of MED12-mutated cells. Genetic characterization of native tumor samples and adjacent myometrium was done by array analysis. "Aged" primary cultures without passaging were compared to cells of three subsequent passages. Comparative analyses of the mutated/non-mutated ratios between native tissue, primary cells, and cultured tumor cells revealed a clear decrease of MED12-mutated cells. None of the tumors showed gross alterations of the array profiles, excluding the presence of gross genomic imbalances besides the MED12 mutations as a reason for the intertumoral variation in the loss of MED12-mutated cells. Albeit at a lesser rate, loss of MED12-mutated cells from cell cultures of UL occurs even without passaging thus indicating the requirement of soluble factors or matrix components lacking in vitro. Identification of these factors can help to understand the mechanisms of the growth of the most frequent type of uterine leiomyomas and to decipher novel drug targets.

  7. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

    PubMed

    Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.

  8. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

    PubMed Central

    Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104

  9. TP53 mutations, expression and interaction networks in human cancers

    PubMed Central

    Wang, Xiaosheng; Sun, Qingrong

    2017-01-01

    Although the associations of p53 dysfunction, p53 interaction networks and oncogenesis have been widely explored, a systematic analysis of TP53 mutations and its related interaction networks in various types of human cancers is lacking. Our study explored the associations of TP53 mutations, gene expression, clinical outcomes, and TP53 interaction networks across 33 cancer types using data from The Cancer Genome Atlas (TCGA). We show that TP53 is the most frequently mutated gene in a number of cancers, and its mutations appear to be early events in cancer initiation. We identified genes potentially repressed by p53, and genes whose expression correlates significantly with TP53 expression. These gene products may be especially important nodes in p53 interaction networks in human cancers. This study shows that while TP53-truncating mutations often result in decreased TP53 expression, other non-truncating TP53 mutations result in increased TP53 expression in some cancers. Survival analyses in a number of cancers show that patients with TP53 mutations are more likely to have worse prognoses than TP53-wildtype patients, and that elevated TP53 expression often leads to poor clinical outcomes. We identified a set of candidate synthetic lethal (SL) genes for TP53, and validated some of these SL interactions using data from the Cancer Cell Line Project. These predicted SL genes are promising candidates for experimental validation and the development of personalized therapeutics for patients with TP53-mutated cancers. PMID:27880943

  10. TP53 mutations, expression and interaction networks in human cancers.

    PubMed

    Wang, Xiaosheng; Sun, Qingrong

    2017-01-03

    Although the associations of p53 dysfunction, p53 interaction networks and oncogenesis have been widely explored, a systematic analysis of TP53 mutations and its related interaction networks in various types of human cancers is lacking. Our study explored the associations of TP53 mutations, gene expression, clinical outcomes, and TP53 interaction networks across 33 cancer types using data from The Cancer Genome Atlas (TCGA). We show that TP53 is the most frequently mutated gene in a number of cancers, and its mutations appear to be early events in cancer initiation. We identified genes potentially repressed by p53, and genes whose expression correlates significantly with TP53 expression. These gene products may be especially important nodes in p53 interaction networks in human cancers. This study shows that while TP53-truncating mutations often result in decreased TP53 expression, other non-truncating TP53 mutations result in increased TP53 expression in some cancers. Survival analyses in a number of cancers show that patients with TP53 mutations are more likely to have worse prognoses than TP53-wildtype patients, and that elevated TP53 expression often leads to poor clinical outcomes. We identified a set of candidate synthetic lethal (SL) genes for TP53, and validated some of these SL interactions using data from the Cancer Cell Line Project. These predicted SL genes are promising candidates for experimental validation and the development of personalized therapeutics for patients with TP53-mutated cancers.

  11. A germline mutation of CDKN2A and a novel RPLP1-C19MC fusion detected in a rare melanotic neuroectodermal tumor of infancy: a case report.

    PubMed

    Barnes, David J; Hookway, Edward; Athanasou, Nick; Kashima, Takeshi; Oppermann, Udo; Hughes, Simon; Swan, Daniel; Lueerssen, Dietrich; Anson, John; Hassan, A Bassim

    2016-08-12

    Melanotic neuroectodermal tumor of infancy (MNTI) is exceptionally rare and occurs predominantly in the head and neck (92.8 % cases). The patient reported here is only the eighth case of MNTI presenting in an extremity, and the first reported in the fibula. A 2-month-old female presented with a mass arising in the fibula. Exhaustive genomic, transcriptomic, epigenetic and pathological characterization was performed on the excised primary tumor and a derived cell line. Whole-exome analysis of genomic DNA from both the tumor and blood indicated no somatic, non-synonymous coding mutations within the tumor, but a heterozygous, unique germline, loss of function mutation in CDKN2A (p16(INK4A), D74A). SNP-array CGH on DNA samples revealed the tumor to be euploid, with no detectable gene copy number variants. Multiple chromosomal translocations were identified by RNA-Seq, and fusion genes included RPLP1-C19MC, potentially deregulating the C19MC cluster, an imprinted locus containing microRNA genes reactivated by gene fusion in embryonal tumors with multilayered rosettes. Since the presumed cell of origin of MNTI is from the neural crest, we also compared gene expression with a dataset from human neural crest cells and identified 185 genes with significantly different expression. Consistent with the melanotic phenotype of the tumor, elevated expression of tyrosinase was observed. Other highly expressed genes encoded muscle proteins and modulators of the extracellular matrix. A derived MNTI cell line was sensitive to inhibitors of lysine demethylase, but not to compounds targeting other epigenetic regulators. In the absence of somatic copy number variations or mutations, the fully transformed phenotype of the MNTI may have arisen in infancy because of the combined effects of a germline CDKN2A mutation, tumor promoting somatic fusion genes and epigenetic deregulation. Very little is known about the etiology of MNTI and this report advances knowledge of these rare tumors by providing the first comprehensive genomic, transcriptomic and epigenetic characterization of a case.

  12. Sequence variants of KHDRBS1 as high penetrance susceptibility risks for primary ovarian insufficiency by mis-regulating mRNA alternative splicing.

    PubMed

    Wang, Binbin; Li, Lin; Zhu, Ying; Zhang, Wei; Wang, Xi; Chen, Beili; Li, Tengyan; Pan, Hong; Wang, Jing; Kee, Kehkooi; Cao, Yunxia

    2017-10-01

    Does a novel heterozygous KHDRBS1 variant, identified using whole-exome sequencing (WES) in two patients with primary ovarian insufficiency (POI) in a pedigree, cause defects in mRNA alternative splicing? The heterozygous variant of KHDRBS1 was confirmed to cause defects in alternative splicing of many genes involved in DNA replication and repair. Studies in mice revealed that Khdrbs1 deficient females are subfertile, which manifests as delayed sexual maturity and significantly reduced numbers of secondary and pre-antral follicles. No mutation of KHDRBS1, however, has been reported in patients with POI. This genetic and functional study used WES to find putative mutations in a POI pedigree. Altogether, 215 idiopathic POI patients and 400 healthy controls were screened for KHDRBS1 mutations. Two POI patients were subjected to WES to identify sequence variants. Mutational analysis of the KHDRBS1 gene in 215 idiopathic POI patients and 400 healthy controls were performed. RNA-sequencing was carried out to find the mis-regulation of gene expression due to KHDRBS1 mutation. Bioinformatics was used to analyze the change in alternative splicing events. We identified a heterozygous mutation (c.460A > G, p.M154V) in KHDRBS1 in two patients. Further mutational analysis of 215 idiopathic POI patients with the KHDRBS1 gene found one heterozygous mutation (c.263C > T, p.P88L). We failed to find these two mutations in 400 healthy control women. Using RNA-sequencing, we found that the KGN cells expressing the M154V KHDRBS1 mutant had different expression of 66 genes compared with wild-type (WT) cells. Furthermore, 145 genes were alternatively spliced in M154V cells, and these genes were enriched for DNA replication and repair function, revealing a potential underlying mechanism of the pathology that leads to POI. Although the in vitro assays demonstrated the effect of the KHDRBS1 variant on alternative splicing, further studies are needed to validate the in vivo effects on germ cell and follicle development. This finding provides researchers and clinicians a better understanding of the etiology and molecular mechanism of POI. This study was supported by the Ministry of Science and Technology of China (2012CB944704; 2012CB966702), National Research Institute for Family Planning (2017GJZ05), the National Natural Science Foundation of China (31171429) and Beijing Advanced Innovation Center for Structural Biology. The authors declare no conflict of interest. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  13. Autism Spectrum Disorder

    MedlinePlus

    ... person’s cells, recent research has also shown that de novo , or spontaneous, gene mutations can influence the risk of developing autism spectrum disorder. De novo mutations are changes in sequences of deoxyribonucleic ...

  14. Tumor infiltrating BRAFV600E-specific CD4 T cells correlated with complete clinical response in melanoma. | Office of Cancer Genomics

    Cancer.gov

    T cells specific for neoantigens encoded by mutated genes in cancers are increasingly recognized as mediators of tumor destruction after immune checkpoint inhibitor therapy or adoptive cell transfer. Unfortunately, most neoantigens result from random mutations and are patient specific, and some cancers contain few mutations to serve as potential antigens. We describe a patient with stage IV acral melanoma who obtained a complete response following adoptive transfer of tumor infiltrating lymphocytes (TIL).

  15. Mutation of Breast Cancer Cell Genomic DNA by APOBEC3B

    DTIC Science & Technology

    2013-09-01

    lethal prostate cancers. Proc. Natl Acad. Sci. USA 108, 17087–17092 (2011). 5. Parsons, D. W. et al. The genetic landscape of the childhood cancer...7. Stransky, N. et al. The mutational landscape of head and neck squamous cell carcinoma. Science 333, 1157–1160 (2011). 8. Nik-Zainal, S. et al...Mutational processes molding the genomes of 21 breast cancers. Cell 149, 979–993 (2012). 9. Stephens, P. J. et al. The landscape of cancer genes and

  16. Integrative analysis of RUNX1 downstream pathways and target genes

    PubMed Central

    Michaud, Joëlle; Simpson, Ken M; Escher, Robert; Buchet-Poyau, Karine; Beissbarth, Tim; Carmichael, Catherine; Ritchie, Matthew E; Schütz, Frédéric; Cannon, Ping; Liu, Marjorie; Shen, Xiaofeng; Ito, Yoshiaki; Raskind, Wendy H; Horwitz, Marshall S; Osato, Motomi; Turner, David R; Speed, Terence P; Kavallaris, Maria; Smyth, Gordon K; Scott, Hamish S

    2008-01-01

    Background The RUNX1 transcription factor gene is frequently mutated in sporadic myeloid and lymphoid leukemia through translocation, point mutation or amplification. It is also responsible for a familial platelet disorder with predisposition to acute myeloid leukemia (FPD-AML). The disruption of the largely unknown biological pathways controlled by RUNX1 is likely to be responsible for the development of leukemia. We have used multiple microarray platforms and bioinformatic techniques to help identify these biological pathways to aid in the understanding of why RUNX1 mutations lead to leukemia. Results Here we report genes regulated either directly or indirectly by RUNX1 based on the study of gene expression profiles generated from 3 different human and mouse platforms. The platforms used were global gene expression profiling of: 1) cell lines with RUNX1 mutations from FPD-AML patients, 2) over-expression of RUNX1 and CBFβ, and 3) Runx1 knockout mouse embryos using either cDNA or Affymetrix microarrays. We observe that our datasets (lists of differentially expressed genes) significantly correlate with published microarray data from sporadic AML patients with mutations in either RUNX1 or its cofactor, CBFβ. A number of biological processes were identified among the differentially expressed genes and functional assays suggest that heterozygous RUNX1 point mutations in patients with FPD-AML impair cell proliferation, microtubule dynamics and possibly genetic stability. In addition, analysis of the regulatory regions of the differentially expressed genes has for the first time systematically identified numerous potential novel RUNX1 target genes. Conclusion This work is the first large-scale study attempting to identify the genetic networks regulated by RUNX1, a master regulator in the development of the hematopoietic system and leukemia. The biological pathways and target genes controlled by RUNX1 will have considerable importance in disease progression in both familial and sporadic leukemia as well as therapeutic implications. PMID:18671852

  17. A genetic screen for temperature-sensitive cell-division mutants of Caenorhabditis elegans.

    PubMed Central

    O'Connell, K F; Leys, C M; White, J G

    1998-01-01

    A novel screen to isolate conditional cell-division mutants in Caenorhabditis elegans has been developed. The screen is based on the phenotypes associated with existing cell-division mutations: some disrupt postembryonic divisions and affect formation of the gonad and ventral nerve cord-resulting in sterile, uncoordinated animals-while others affect embryonic divisions and result in lethality. We obtained 19 conditional mutants that displayed these phenotypes when shifted to the restrictive temperature at the appropriate developmental stage. Eighteen of these mutations have been mapped; 17 proved to be single alleles of newly identified genes, while 1 proved to be an allele of a previously identified gene. Genetic tests on the embryonic lethal phenotypes indicated that for 13 genes, embryogenesis required maternal expression, while for 6, zygotic expression could suffice. In all cases, maternal expression of wild-type activity was found to be largely sufficient for embryogenesis. Cytological analysis revealed that 10 mutants possessed embryonic cell-division defects, including failure to properly segregate DNA, failure to assemble a mitotic spindle, late cytokinesis defects, prolonged cell cycles, and improperly oriented mitotic spindles. We conclude that this approach can be used to identify mutations that affect various aspects of the cell-division cycle. PMID:9649522

  18. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

    PubMed Central

    Chen, Kaifu; Chen, Zhong; Wu, Dayong; Zhang, Lili; Lin, Xueqiu; Su, Jianzhong; Rodriguez, Benjamin; Xi, Yuanxin; Xia, Zheng; Chen, Xi; Shi, Xiaobing; Wang, Qianben; Li, Wei

    2016-01-01

    Tumor suppressors are mostly defined by inactivating mutations in tumors, yet little is known about their epigenetic features in normal cells. Through integrative analysis of 1,134 genome-wide epigenetic profiles, mutations from >8,200 tumor-normal pairs, and our experimental data from clinical samples, we discovered broad H3K4me3 (wider than 4 kb) as the first epigenetic signature for tumor suppressors in normal cells. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity together leading to exceptionally high gene expression, and is distinct from other broad epigenetic features, such as super-enhancers. Broad H3K4me3 conserved across normal cells may represent pan-cancer tumor suppressors, such as P53 and PTEN, whereas cell-type-specific broad H3K4me3 may indicate cell-identity genes and cell-type-specific tumor suppressors. Furthermore, widespread shortening of broad H3K4me3 in cancers is associated with repression of tumor suppressors. Together, the broad H3K4me3 epigenetic signature provides mutation-independent information for the discovery and characterization of novel tumor suppressors. PMID:26301496

  19. CACNA1H missense mutations associated with amyotrophic lateral sclerosis alter Cav3.2 T-type calcium channel activity and reticular thalamic neuron firing.

    PubMed

    Rzhepetskyy, Yuriy; Lazniewska, Joanna; Blesneac, Iulia; Pamphlett, Roger; Weiss, Norbert

    2016-11-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease that affects nerve cells in the brain and the spinal cord. In a recent study by Steinberg and colleagues, 2 recessive missense mutations were identified in the Cav3.2 T-type calcium channel gene (CACNA1H), in a family with an affected proband (early onset, long duration ALS) and 2 unaffected parents. We have introduced and functionally characterized these mutations using transiently expressed human Cav3.2 channels in tsA-201 cells. Both of these mutations produced mild but significant changes on T-type channel activity that are consistent with a loss of channel function. Computer modeling in thalamic reticular neurons suggested that these mutations result in decreased neuronal excitability of thalamic structures. Taken together, these findings implicate CACNA1H as a susceptibility gene in amyotrophic lateral sclerosis.

  20. Efficient CRISPR-Cas9-mediated generation of knockin human pluripotent stem cells lacking undesired mutations at the targeted locus.

    PubMed

    Merkle, Florian T; Neuhausser, Werner M; Santos, David; Valen, Eivind; Gagnon, James A; Maas, Kristi; Sandoe, Jackson; Schier, Alexander F; Eggan, Kevin

    2015-05-12

    The CRISPR-Cas9 system has the potential to revolutionize genome editing in human pluripotent stem cells (hPSCs), but its advantages and pitfalls are still poorly understood. We systematically tested the ability of CRISPR-Cas9 to mediate reporter gene knockin at 16 distinct genomic sites in hPSCs. We observed efficient gene targeting but found that targeted clones carried an unexpectedly high frequency of insertion and deletion (indel) mutations at both alleles of the targeted gene. These indels were induced by Cas9 nuclease, as well as Cas9-D10A single or dual nickases, and often disrupted gene function. To overcome this problem, we designed strategies to physically destroy or separate CRISPR target sites at the targeted allele and developed a bioinformatic pipeline to identify and eliminate clones harboring deleterious indels at the other allele. This two-pronged approach enables the reliable generation of knockin hPSC reporter cell lines free of unwanted mutations at the targeted locus. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Top