Science.gov

Sample records for cell tracts approach

  1. Small round blue cell tumors of the sinonasal tract: a differential diagnosis approach.

    PubMed

    Thompson, Lester Dr

    2017-01-01

    One of the most challenging diagnostic categories within tumors of the sinonasal tract is the small round blue cell tumors. Biopsies are usually small and limited, resulting in considerable diagnostic difficulty for practicing surgical pathologists. These tumors share several overlapping histologic and immunophenotypic findings while also showing considerable variation within and between cases. Specific tumor site of origin, imaging findings, and clinical findings must be combined with the histology and pertinent ancillary studies if the correct diagnosis is to be reached. Discrimination between neoplasms is critical as there are significant differences in therapy and overall outcome. It is important to have a well developed differential diagnosis for this category of tumors, where each of the diagnoses is considered, evaluated, and either confirmed or excluded from further consideration. In an undifferentiated tumor, showing a small round blue cell morphology, using the mnemonic 'MR SLEEP' helps to highlight tumors to consider: melanoma, mesenchymal chondrosarcoma, rhabdomyosarcoma, sinonasal undifferentiated carcinoma, squamous cell carcinoma (including NUT carcinoma), small cell osteosarcoma, lymphoma, esthesioneuroblastoma (olfactory neuroblastoma), Ewing sarcoma/primitive neuroectodermal tumor, pituitary adenoma, and plasmacytoma. A panel of pertinent immunohistochemistry studies, histochemistries and/or molecular tests should aid in reaching a diagnosis, especially when taking the pattern and intensity of reactions into consideration.

  2. Approach to urinary tract infections

    PubMed Central

    Najar, M. S.; Saldanha, C. L.; Banday, K. A.

    2009-01-01

    Urinary tract infection (UTI) is the most common infection experienced by humans after respiratory and gastro-intestinal infections, and also the most common cause of both community-acquired and nosocomial infections for patients admitted to hospitals. For better management and prognosis, it is mandatory to know the possible site of infection, whether the infection is uncomplicated or complicated, re-infection or relapse, or treatment failure and its pathogenesis and risk factors. Asymptomatic bacteriuria is common in certain age groups and has different connotations. It needs to be treated and completely cured in pregnant women and preschool children. Reflux nephropathy in children could result in chronic kidney disease; otherwise, urinary tract infections do not play a major role in the pathogenesis of end-stage renal disease. Symptomatic urinary tract infections occur most commonly in women of child-bearing age. Cystitis predominates, but needs to be distinguished from acute urethral syndrome that affects both sexes and has a different management plan than UTIs. The prostatitis symptoms are much more common than bacterial prostatic infections. The treatment needs to be prolonged in bacterial prostatitis and as cure rates are not very high and relapses are common, the classification of prostatitis needs to be understood. The consensus conference convened by National Institute of Health added two more groups of patients, namely, chronic prostatitis/chronic pelvic pain syndrome and asymptomatic inflammatory prostatitis, in addition to acute and chronic bacterial prostatitis. Although white blood cells in urine signify inflammation, they do not always signify UTI. Quantitative cultures of urine provide definitive evidence of UTI. Imaging studies should be done 3-6 weeks after cure of acute infection to identify abnormalities predisposing to infection or renal damage or which may affect management. Treatment of cystitis in women should be a three-day course and if

  3. Approach to urinary tract infections.

    PubMed

    Najar, M S; Saldanha, C L; Banday, K A

    2009-10-01

    Urinary tract infection (UTI) is the most common infection experienced by humans after respiratory and gastro-intestinal infections, and also the most common cause of both community-acquired and nosocomial infections for patients admitted to hospitals. For better management and prognosis, it is mandatory to know the possible site of infection, whether the infection is uncomplicated or complicated, re-infection or relapse, or treatment failure and its pathogenesis and risk factors. Asymptomatic bacteriuria is common in certain age groups and has different connotations. It needs to be treated and completely cured in pregnant women and preschool children. Reflux nephropathy in children could result in chronic kidney disease; otherwise, urinary tract infections do not play a major role in the pathogenesis of end-stage renal disease. Symptomatic urinary tract infections occur most commonly in women of child-bearing age. Cystitis predominates, but needs to be distinguished from acute urethral syndrome that affects both sexes and has a different management plan than UTIs. The prostatitis symptoms are much more common than bacterial prostatic infections. The treatment needs to be prolonged in bacterial prostatitis and as cure rates are not very high and relapses are common, the classification of prostatitis needs to be understood. The consensus conference convened by National Institute of Health added two more groups of patients, namely, chronic prostatitis/chronic pelvic pain syndrome and asymptomatic inflammatory prostatitis, in addition to acute and chronic bacterial prostatitis. Although white blood cells in urine signify inflammation, they do not always signify UTI. Quantitative cultures of urine provide definitive evidence of UTI. Imaging studies should be done 3-6 weeks after cure of acute infection to identify abnormalities predisposing to infection or renal damage or which may affect management. Treatment of cystitis in women should be a three-day course and if

  4. Endoscopic management of upper tract transitional cell carcinoma.

    PubMed

    Forster, James A; Palit, Victor; Browning, Anthony J; Biyani, Chandra Shekhar

    2010-04-01

    Upper urinary tract transitional cell carcinoma (TCC) accounts for up to 10% of cases of neoplasm of the upper urinary tract. The "gold standard" management of upper tract TCC is nephroureterectomy. Technological innovations, miniaturisations and increased availability of energy sources such as Holmium laser fibers have improved the armamentarium of endoscopic management of upper tract TCC. Endoscopic management of upper tract TCC includes the percutaneous (antegrade) and retrograde approaches. Modern flexible ureterorenoscopy allows retrograde approach to small (<1.5cm), low grade and noninvasive tumors, which is inaccessible to standard rigid ureteroscopes without breaching the urothelial barrier. In patients with large tumors or in whom retrograde access is difficult, the percutaneous approach to the renal pelvis, although more invasive, provides an alternative access and control. Both retrograde and percutaneous approaches allow instillation of various chemotherapeutic agents. Careful selection of patients is the key point in the successful endoscopic management of upper tract TCC. Patient selection is based on tumor size, grade and multifocality and other patient factors such as comorbidities, single kidney, post kidney transplant and patient choice. Both motivation and compliance of patients are needed for long-term successes. However, until large randomized trials with long term follow-up are available, endoscopic management of upper tract TCC should be reserved for only selected group of patients. This review summarizes the current techniques, indications, contraindications and outcomes of endoscopic management of UTTCC and the key published data.

  5. Urinary tract infections. Current approaches, future directions.

    PubMed

    Colgan, R; Hooton, T M; Gupta, K; Gomolin, I H; Childs, S; Gould, M

    2000-12-01

    Urinary tract infection (UTI) is a common problem that is distressing for patients and costly for the healthcare system. UTIs commonly affect young, sexually active women; the elderly; and patients who have predisposing factors, such as catheterization. Recurrent infections are likely to occur in all these patients groups. Patients who are pregnant or have predisposing factors are at increased risk for complications related to untreated UTIs, such as long-term renal damage. Given these risks and the public health burden associated with the condition, it is important that clinicians have up-to-date information regarding the classification, symptoms, pathogenesis, and empiric treatment of UTIs.

  6. Novel Approaches to Preventing Urinary Tract Infection in Women

    DTIC Science & Technology

    1997-09-01

    in young women, Escherichia coli and Staphylococcus saprophyticus , as well as their interactions with glycosphingolipids (GSLs) on the cell surface of...Detrick, Maryland 21702-5012. 13. -ABSTRACT (Maximum 200 Urinary tract infections (UTIs), generally caused by Escherichia coli or Staphylococcus ... saprophyticus , are extremely common among young women and 25% of these patients develop frequent recurrent infections. Although UTIs can be treated, we

  7. Inhibition of experimental ascending urinary tract infection by an epithelial cell-surface receptor analogue

    NASA Astrophysics Data System (ADS)

    Edén, C. Svanborg; Freter, R.; Hagberg, L.; Hull, R.; Hull, S.; Leffler, H.; Schoolnik, G.

    1982-08-01

    It has been shown that the establishment of urinary tract infection by Escherichia coli is dependent on attachment of the bacteria to epithelial cells1-4. The attachment involves specific epithelial cell receptors, which have been characterized as glycolipids5-10. Reversible binding to cell-surface mannosides may also be important4,11-13. This suggests an approach to the treatment of infections-that of blocking bacterial attachment with cell membrane receptor analogues. Using E. coli mutants lacking one or other of the two binding specificities (glycolipid and mannose), we show here that glycolipid analogues can block in vitro adhesion and in vivo urinary tract infection.

  8. Tract specific analysis in patients with sickle cell disease

    NASA Astrophysics Data System (ADS)

    Chai, Yaqiong; Coloigner, Julie; Qu, Xiaoping; Choi, Soyoung; Bush, Adam; Borzage, Matt; Vu, Chau; Lepore, Natasha; Wood, John

    2015-12-01

    Sickle cell disease (SCD) is a hereditary blood disorder in which the oxygen-carrying hemoglobin molecule in red blood cells is abnormal. It affects numerous people in the world and leads to a shorter life span, pain, anemia, serious infections and neurocognitive decline. Tract-Specific Analysis (TSA) is a statistical method to evaluate white matter alterations due to neurocognitive diseases, using diffusion tensor magnetic resonance images. Here, for the first time, TSA is used to compare 11 major brain white matter (WM) tracts between SCD patients and age-matched healthy subjects. Alterations are found in the corpus callosum (CC), the cortico-spinal tract (CST), inferior fronto-occipital fasciculus (IFO), inferior longitudinal fasciculus (ILF), superior longitudinal fasciculus (SLF), and uncinated fasciculus (UNC). Based on previous studies on the neurocognitive functions of these tracts, the significant areas found in this paper might be related to several cognitive impairments and depression, both of which are observed in SCD patients.

  9. Computer aided classification of cell nuclei in the gastrointestinal tract by volume and principal axis

    NASA Astrophysics Data System (ADS)

    Sagstetter, Ann M.; Camp, Jon J.; Lurken, Matthew S.; Szurszewski, Joseph H.; Farrugia, Gianrico; Gibbons, Simon J.; Robb, Richard A.

    2007-03-01

    Normal function of the gastrointestinal tract involves the coordinated activity of several cell types Human disorders of motor function of the gastrointestinal tract are often associated with changes in the number of these cells. For example, in diabetic patients, abnormalities in gastrointestinal transit are associated with changes in nerves and interstitial cells of Cajal (ICC), two key cells that generate and regulate motility. ICC are cells of mesenchymal origin that function as pacemakers and amplify neuronal signals in the gastrointestinal tract. Quantifying the changes in number of specific cell types in tissues from patients with motility disorders is challenging and requires immunolabeling for specific antigens. The shape of nuclei differs between the cell types in the wall of the gastrointestinal tract. Therefore the objective of this study was to determine whether cell nuclei can be classified by analyzing the 3D morphology of the nuclei. Furthermore, the orientation of the long axis of nuclei changes within and between the muscle layers. These features can be used to classify and differentially label the nuclei in confocal volume images of the tissue by computing the principal axis of the coordinates of the set of voxels forming each nucleus and thereby to identify cells by their nuclear morphology. Using this approach, we were able to separate and quantify nuclei in the smooth muscle layers of the tissue. Therefore we conclude that computer-aided classification of cell nuclei can be used to identify changes in the cell types expressed in gastrointestinal smooth muscle.

  10. Clonal Evolution of Stem Cells in the Gastrointestinal Tract.

    PubMed

    Fink, Juergen; Koo, Bon-Kyoung

    The field of gastrointestinal epithelial stem cells is a rapidly developing area of adult stem cell research. The discovery of Lgr5(+) intestinal stem cells has enabled us to study many hidden aspects of the biology of gastrointestinal adult stem cells. Marked by Lgr5 and Troy, several novel endodermal stem cells have been identified in the gastrointestinal tract. A precise working model of stem cell propagation, dynamics, and plasticity has been revealed by a genetic labeling method, termed lineage tracing. This chapter introduces the reidentification of crypt base columnar cells as Lgr5(+) stem cells in the intestine. Subsequently, it will discuss dynamic clonal evolution and cellular plasticity in the intestinal stem cell zone, as well as in stem cell zones of stomach glands.

  11. Endourologic Management of Upper Tract Transitional Cell Carcinoma following Cystectomy and Urinary Diversion

    PubMed Central

    Tomaszewski, Jeffrey John; Smaldone, Marc Christopher; Ost, Michael Cecil

    2009-01-01

    Traditionally, nephroureterectomy is the gold standard therapy for upper tract recurrence of transitional cell carcinoma (TCC) following cystectomy and urinary diversion. With advances in endoscopic equipment and improvements in technique, conservative endourologic management via a retrograde or antegrade approach is technically feasible with acceptable outcomes in patients with bilateral disease, solitary renal units, chronic renal insufficiency, or significant medical comorbidities. Contemporary studies have expanded the utility of these techniques to include low-grade, low-volume disease in patients with a normal contralateral kidney. The aim of this report is to review the current outcomes of conservative management for upper tract disease and discuss its application and relevance in patients following cystectomy with lower urinary tract reconstruction. PMID:19125199

  12. [Stem/progenitor cells in diseases of the respiratory tract].

    PubMed

    Płusa, Tadeusz

    2017-03-21

    Stem cells (SCs - stem cells) are characterized by plasticity and the ability to differentiate into other cell types. They are obtained from bone marrow, peripheral blood and cord blood. Mesenchymal stem cells (MSCs) shows a broad immunomodulating, increases the number of regulatory T cells (Treg), modifies the activity of T cells, dendritic cells and NK (natural killer). Direct impact on reducing the release of proinflammatory cytokines and increased release of proinflammatory cytokines. Within the respiratory tract has a number of resident stem and progenitor cells referred to as L-MSCs (lung mesenchymal stem cells) whose presence was confirmed by markers as defined in the trachea, epithelial cells and alveolar. Demonstrated the efficacy of MSCs administration in the first stage of septic shock and acute respiratory distress syndrome (ARDS - acute respiratory distress syndrome). There was a significant stimulation of repair processes, along with an improvement in lung function. Embryonic stem cells (ESCs - embryonic stem cells) are the latest addition in the treatment of congenital and acquired diseases of the airways and lung parenchyma. In patients with sarcoidosis MSCs are obtained from umbilical cord blood (PDA - placenta-derived mesenchymal-like cells) with phenotype CD34 +, CD10 +, CD105 + and CD200 +. The results of this therapy are very encouraging, and for this reason it is taken in subsequent research centers.

  13. An Example-Based Multi-Atlas Approach to Automatic Labeling of White Matter Tracts

    PubMed Central

    Yoo, Sang Wook; Guevara, Pamela; Jeong, Yong; Yoo, Kwangsun; Shin, Joseph S.; Mangin, Jean-Francois; Seong, Joon-Kyung

    2015-01-01

    We present an example-based multi-atlas approach for classifying white matter (WM) tracts into anatomic bundles. Our approach exploits expert-provided example data to automatically classify the WM tracts of a subject. Multiple atlases are constructed to model the example data from multiple subjects in order to reflect the individual variability of bundle shapes and trajectories over subjects. For each example subject, an atlas is maintained to allow the example data of a subject to be added or deleted flexibly. A voting scheme is proposed to facilitate the multi-atlas exploitation of example data. For conceptual simplicity, we adopt the same metrics in both example data construction and WM tract labeling. Due to the huge number of WM tracts in a subject, it is time-consuming to label each WM tract individually. Thus, the WM tracts are grouped according to their shape similarity, and WM tracts within each group are labeled simultaneously. To further enhance the computational efficiency, we implemented our approach on the graphics processing unit (GPU). Through nested cross-validation we demonstrated that our approach yielded high classification performance. The average sensitivities for bundles in the left and right hemispheres were 89.5% and 91.0%, respectively, and their average false discovery rates were 14.9% and 14.2%, respectively. PMID:26225419

  14. Evidence for the Role of Mast Cells in Cystitis-Associated Lower Urinary Tract Dysfunction: A Multidisciplinary Approach to the Study of Chronic Pelvic Pain Research Network Animal Model Study

    PubMed Central

    O'Donnell, Michael; Lutgendorf, Susan; Bradley, Catherine; Schrepf, Andrew; Liu, Liwei; Kreder, Karl; Luo, Yi

    2016-01-01

    Bladder inflammation frequently causes cystitis pain and lower urinary tract dysfunction (LUTD) such as urinary frequency and urgency. Although mast cells have been identified to play a critical role in bladder inflammation and pain, the role of mast cells in cystitis-associated LUTD has not been demonstrated. Interstitial cystitis/bladder pain syndrome (IC/BPS) is a chronic and debilitating inflammatory condition of the urinary bladder characterized by the hallmark symptoms of pelvic pain and LUTD. In this study we investigated the role of mast cells in LUTD using a transgenic autoimmune cystitis model (URO-OVA) that reproduces many clinical correlates of IC/BPS. URO-OVA mice express the membrane form of the model antigen ovalbumin (OVA) as a self-antigen on the urothelium and develop bladder inflammation upon introduction of OVA-specific T cells. To investigate the role of mast cells, we crossed URO-OVA mice with mast cell-deficient KitW-sh mice to generate URO-OVA/KitW-sh mice that retained urothelial OVA expression but lacked endogenous mast cells. We compared URO-OVA mice with URO-OVA/KitW-sh mice with and without mast cell reconstitution in response to cystitis induction. URO-OVA mice developed profound bladder inflammation with increased mast cell counts and LUTD, including increased total number of voids, decreased mean volume voided per micturition, and decreased maximum volume voided per micturition, after cystitis induction. In contrast, similarly cystitis-induced URO-OVA/KitW-sh mice developed reduced bladder inflammation with no mast cells and LUTD detected. However, after mast cell reconstitution URO-OVA/KitW-sh mice restored the ability to develop bladder inflammation and LUTD following cystitis induction. We further treated URO-OVA mice with cromolyn, a mast cell membrane stabilizer, and found that cromolyn treatment reversed bladder inflammation and LUTD in the animal model. Our results provide direct evidence for the role of mast cells in cystitis

  15. A systematic review: perivascular epithelioid cell tumor of gastrointestinal tract

    PubMed Central

    Chen, Zehong; Han, Siqi; Wu, Jialin; Xiong, Minmin; Huang, Yanqiao; Chen, Jianhui; Yuan, Yujie; Peng, Jianjun; Song, Wu

    2016-01-01

    Abstract Perivascular epithelioid cell tumor (PEComa) is a rare entity with distinctive morphology and of expressing myomelanocytic markers. Gastrointestinal tract (GI) is one of the most common anatomic sites of origin and counts for 20% to 25% of all reported cases of perivascular epithelioid cell tumors not otherwise specified (PEComas-NOS). However, the biologic behavior of perivascular epithelioid cell tumors of gastrointestinal tract (GI PEComas-NOS) is still unclear. The aim of conducting this systematic review is to sum up what is known so far of the epidemiology, natural history, management and prognosis of GI PEComas-NOS. A systematic research was performed on PubMed and EMBASE using the following terms: (“perivascular epithelioid cell tumor” or “PEComa”) and (“gastrointestinal tract” or “GI” or “oral ” or “mouth” or “esophagus” or “gullet” or “gastric” or “stomach” or “duodenum” or “jejunum” or “ileum” or “cecum” or “colon” or “colorectal” or “sigmoid” or “rectum” or “anus” or “mesentery”) up to December 1, 2015. Retrieved GI PEComas-NOS publications, which included these terms, contains case reports, case series to case characteristic researches. A total of 168 articles were reviewed, 41 GI PEComa-NOS English studies among which were retrieved for analysis. We reviewed epidemiology, natural history, management and prognosis of GI PEComa-NOS. Generally GI PEComa-NOS is believed to have women predomination. The most frequently involved location is colon with non-specific clinical signs. Pathologically, GI PEComas-NOS shows epithelioid predominance (70%), meanwhile coexpresses melanocytic and muscle markers characteristically, while immunohistochemistry is a useful tool for identify, which indicates that HMB-45 is regarded as the most sensitive reagent. Complete resection served as mainstay of treatment, while chemotherapy should be unanimously considered to apply in malignant

  16. Therapeutic approaches to the treatment of recurrent respiratory papillomatosis of the aerodigestive tract (a clinical study)

    PubMed Central

    Avramov, Toma; Vetckova, Evelina; Nikolova, Maria; Valev, Dinko; Manolova, Antoaneta; Tafradgiiska, Maya; Kostadinov, Dimitar; Tchalacov, Ivan

    2014-01-01

    Recurrent respiratory papillomatosis (RRP) is a rare disease, characterized by recurrent proliferation of benign squamous cell papillomas in the larynx as well as in the other parts of the aerodigestive tract. We have compared different treatment options for RRP of the aerodigestive tract including surgical, conservative and combined approaches. A total of 43 patients with papillomatosis that received a combined therapy were followed in the period from 2009 to 2013. The treatment included electrosurgery and CO2 laser surgery alongside with either immunotherapy with Bacillus Calmette-Guerin (BCG) (Calgevax) or α-interferon. In the control group without immunotherapy (n = 16) we used conventional microlaryngeal surgery. During the follow-up, relapse occurred in two patients for the CO2 laser surgery with Calgevax immunotherapy group (n = 16). In the group treated with α-interferon preceded by CO2 laser surgery (n = 9) and electrosurgery (n = 2), relapse had occurred in three patients. Among the control group, recurrence was observed in six patients. This required re-operation. Our data showed a three times more frequent relapses among patients who were operated with conventional surgery as compared to those operated with CO2 laser surgery and Calgevax immunotherapy, and two times more often relapses in patients operated with conventional surgery as compared to those with electrosurgery and CO2 laser surgery and application of α-interferon therapy. Conventional and laser surgeries have a palliative effect, though playing an important role in ensuring the airway patency. While specific antivirus treatment for human papilloma viruses does not exist, the immune modulation with Calgevax considerably reduces the frequency of relapses, by stimulating cellular immune effector mechanisms. The combined protocol allows rarefication of relapses and improvement of patients’ quality of life, but not complete healing. PMID:26692782

  17. Novel Approaches to Preventing Urinary Tract Infection in Women

    DTIC Science & Technology

    2000-09-01

    culturing VECs) as well as McCoy mouse fibroblast cells were used as positive controls in the anti-fibroblast antibody assays. Cultures of VEC cultures... fucosyltransferase was identified in Helicobacter a genomic fragment of 1295 bp derived by PCR with primer pair HCRS122 (5’-CCAGCCTTGGCTCTGGCTGATG) and HCRS126 (5...8217- pylor using a short sequence motif conserved among mamma- CCCGGTGGCAGCTCGGGCCTC) located downstream and upstream lian a3- fucosyltransferases (14

  18. Natural approaches to prevention and treatment of infections of the lower urinary tract.

    PubMed

    Head, Kathleen A

    2008-09-01

    Infections of the lower urinary tract are common occurrences in young women, during pregnancy, and in peri- and postmenopausal women. Because of the chronic nature of urinary tract infections (UTIs) and the potential for antibiotic resistance, a natural approach to prevention and treatment is desirable. Clinical research suggests the best natural options for long-term prevention include cranberry, mannose, and probiotics. Botanicals that can be effective at the first sign of an infection and for short-term prophylaxis include berberine and uva ursi. Estriol cream and vitamins A and C have also been shown to prevent UTIs, while potassium salts can alkalinize the urine and reduce dysuria.

  19. Unraveling the pathogenesis of ARX polyalanine tract variants using a clinical and molecular interfacing approach

    PubMed Central

    Marques, Isabel; Sá, Maria João; Soares, Gabriela; Mota, Maria do Céu; Pinheiro, Carla; Aguiar, Lisa; Amado, Marta; Soares, Christina; Calado, Angelina; Dias, Patrícia; Sousa, Ana Berta; Fortuna, Ana Maria; Santos, Rosário; Howell, Katherine B; Ryan, Monique M; Leventer, Richard J; Sachdev, Rani; Catford, Rachael; Friend, Kathryn; Mattiske, Tessa R; Shoubridge, Cheryl; Jorge, Paula

    2015-01-01

    The Aristaless-related homeobox (ARX) gene is implicated in intellectual disability with the most frequent pathogenic mutations leading to expansions of the first two polyalanine tracts. Here, we describe analysis of the ARX gene outlining the approaches in the Australian and Portuguese setting, using an integrated clinical and molecular strategy. We report variants in the ARX gene detected in 19 patients belonging to 17 families. Seven pathogenic variants, being expansion mutations in both polyalanine tract 1 and tract 2, were identifyed, including a novel mutation in polyalanine tract 1 that expands the first tract to 20 alanines. This precise number of alanines is sufficient to cause pathogenicity when expanded in polyalanine tract 2. Five cases presented a probably non-pathogenic variant, including the novel HGVS: c.441_455del, classified as unlikely disease causing, consistent with reports that suggest that in frame deletions in polyalanine stretches of ARX rarely cause intellectual disability. In addition, we identified five cases with a variant of unclear pathogenic significance. Owing to the inconsistent ARX variants description, publications were reviewed and ARX variant classifications were standardized and detailed unambiguously according to recommendations of the Human Genome Variation Society. In the absence of a pathognomonic clinical feature, we propose that molecular analysis of the ARX gene should be included in routine diagnostic practice in individuals with either nonsyndromic or syndromic intellectual disability. A definitive diagnosis of ARX-related disorders is crucial for an adequate clinical follow-up and accurate genetic counseling of at-risk family members. PMID:26029707

  20. The Importance of Interstitial Cells of Cajal in the Gastrointestinal Tract

    PubMed Central

    Al-Shboul, Othman A.

    2013-01-01

    Gastrointestinal (GI) motility function and its regulation is a complex process involving collaboration and communication of multiple cell types such as enteric neurons, interstitial cells of Cajal (ICC), and smooth muscle cells. Recent advances in GI research made a better understanding of ICC function and their role in the GI tract, and studies based on different types of techniques have shown that ICC, as an integral part of the GI neuromuscular apparatus, transduce inputs from enteric motor neurons, generate intrinsic electrical rhythmicity in phasic smooth muscles, and have a mechanical sensation ability. Absence or improper function of these cells has been linked to some GI tract disorders. This paper provides a general overview of ICC; their discovery, subtypes, function, locations in the GI tract, and some disorders associated with their loss or disease, and highlights some controversial issues with regard to the importance of ICC in the GI tract. PMID:23319032

  1. Recent achievements in stem cell therapy for pediatric gastrointestinal tract disease.

    PubMed

    Bae, Sun Hwan

    2013-03-01

    The field of stem cell research has been rapidly expanding. Although the clinical usefulness of research remains to be ascertained through human trials, the use of stem cells as a therapeutic option for currently disabling diseases holds fascinating potential. Many pediatric gastrointestinal tract diseases have defect in enterocytes, enteric nervous system cells, smooth muscles, and interstitial cells of Cajal. Various kinds of therapeutic trials using stem cells could be applied to these diseases. This review article focuses on the recent achievements in stem cell applications for pediatric gastrointestinal tract diseases.

  2. Recent Achievements in Stem Cell Therapy for Pediatric Gastrointestinal Tract Disease

    PubMed Central

    2013-01-01

    The field of stem cell research has been rapidly expanding. Although the clinical usefulness of research remains to be ascertained through human trials, the use of stem cells as a therapeutic option for currently disabling diseases holds fascinating potential. Many pediatric gastrointestinal tract diseases have defect in enterocytes, enteric nervous system cells, smooth muscles, and interstitial cells of Cajal. Various kinds of therapeutic trials using stem cells could be applied to these diseases. This review article focuses on the recent achievements in stem cell applications for pediatric gastrointestinal tract diseases. PMID:24010100

  3. Lung dendritic cells induce migration of protective T cells to the gastrointestinal tract.

    PubMed

    Ruane, Darren; Brane, Lucas; Reis, Bernardo Sgarbi; Cheong, Cheolho; Poles, Jordan; Do, Yoonkyung; Zhu, Hongfa; Velinzon, Klara; Choi, Jae-Hoon; Studt, Natalie; Mayer, Lloyd; Lavelle, Ed C; Steinman, Ralph M; Mucida, Daniel; Mehandru, Saurabh

    2013-08-26

    Developing efficacious vaccines against enteric diseases is a global challenge that requires a better understanding of cellular recruitment dynamics at the mucosal surfaces. The current paradigm of T cell homing to the gastrointestinal (GI) tract involves the induction of α4β7 and CCR9 by Peyer's patch and mesenteric lymph node (MLN) dendritic cells (DCs) in a retinoic acid-dependent manner. This paradigm, however, cannot be reconciled with reports of GI T cell responses after intranasal (i.n.) delivery of antigens that do not directly target the GI lymphoid tissue. To explore alternative pathways of cellular migration, we have investigated the ability of DCs from mucosal and nonmucosal tissues to recruit lymphocytes to the GI tract. Unexpectedly, we found that lung DCs, like CD103(+) MLN DCs, up-regulate the gut-homing integrin α4β7 in vitro and in vivo, and induce T cell migration to the GI tract in vivo. Consistent with a role for this pathway in generating mucosal immune responses, lung DC targeting by i.n. immunization induced protective immunity against enteric challenge with a highly pathogenic strain of Salmonella. The present report demonstrates novel functional evidence of mucosal cross talk mediated by DCs, which has the potential to inform the design of novel vaccines against mucosal pathogens.

  4. An Extremely Rare Case of Advanced Metastatic Small Cell Neuroendocrine Carcinoma of Sinonasal Tract.

    PubMed

    Thar, Yu Yu; Patel, Poras; Huang, Tiangui; Guevara, Elizabeth

    2016-01-01

    Small cell neuroendocrine carcinoma (SNEC) is a rare form of malignancy. It mainly presents as bronchogenic neoplasm, and the extrapulmonary form accounts for only 0.1% to 0.4% of all cancers. These extrapulmonary tumors have been described most frequently in the urinary bladder, prostate, esophagus, stomach, colon and rectum, gall bladder, head and neck, cervix, and skin. Primary SNEC of the sinonasal tract is extremely rare with only less than 100 cases reported in the literature. Because of extreme rarity and aggressiveness of the tumor, the management for this entity varies considerably mandating multimodality approach. In this paper, we report a patient presented with left-sided facial swelling, and the histopathologic examination confirmed primary SNEC of left sinonasal tract. The tumor involved multiple paranasal sinuses with invasion into the left orbit and left infratemporal fossa and metastasized to cervical lymph nodes and bone. The patient encountered devastating outcome in spite of optimal medical management and treatment with palliative chemotherapy highlighting the necessity for further research of primary SNEC of head and neck.

  5. An Extremely Rare Case of Advanced Metastatic Small Cell Neuroendocrine Carcinoma of Sinonasal Tract

    PubMed Central

    Guevara, Elizabeth

    2016-01-01

    Small cell neuroendocrine carcinoma (SNEC) is a rare form of malignancy. It mainly presents as bronchogenic neoplasm, and the extrapulmonary form accounts for only 0.1% to 0.4% of all cancers. These extrapulmonary tumors have been described most frequently in the urinary bladder, prostate, esophagus, stomach, colon and rectum, gall bladder, head and neck, cervix, and skin. Primary SNEC of the sinonasal tract is extremely rare with only less than 100 cases reported in the literature. Because of extreme rarity and aggressiveness of the tumor, the management for this entity varies considerably mandating multimodality approach. In this paper, we report a patient presented with left-sided facial swelling, and the histopathologic examination confirmed primary SNEC of left sinonasal tract. The tumor involved multiple paranasal sinuses with invasion into the left orbit and left infratemporal fossa and metastasized to cervical lymph nodes and bone. The patient encountered devastating outcome in spite of optimal medical management and treatment with palliative chemotherapy highlighting the necessity for further research of primary SNEC of head and neck. PMID:27529044

  6. Clear cell adenocarcinoma of the renal pelvis: an extremely rare neoplasm of the upper urinary tract.

    PubMed

    Liu, K-W; Lin, V C-H; Chang, I-W

    2013-12-01

    Clear cell adenocarcinoma (CCA) in the urinary tract is a rare neoplasm morphologically identical to the Müllerian counterpart. Clear cell adenocarcinoma is extremely rare in the upper urinary tract. We present a case with CCA of the renal pelvis. Microscopically, the tumor exhibited exophytic growth with predominantly tubulocystic structures, as well as solid and papillary patterns. The neoplastic cells were cuboidal with clear to pale eosinophilic cytoplasm and abundant intracellular and extracellular eosinophilic hyaline globules. By immunohistochemically, the tumor was labeled by cytokeratins and hepatocyte nuclear factor-1β. The patient was still alive without evidence of recurrence in the follow-up period of nineteen months after diagnosis.

  7. Effectiveness of syndromic approach in management of reproductive tract infections in women.

    PubMed

    Singh, M M; Devi, R; Garg, S; Mehra, M

    2001-04-01

    Syndromic approach was used to identify reproductive tract infections (RTI) by a trained public health nurse among 130 ever-married women aged 15-45 years selected by a systematic random sampling method in a resettlement colony, Chandigarh. A lady medical officer in the dispensary examined and treated 48 (37%) referred symptomatic women as per syndromic approach guidelines. They were suffering from vaginitis (52.1%), cervicitis (20.8%), pelvic inflammatory disease (PID) (14.6%), urinary tract infections and PID (4.2%) and 4 did not have any clinical abnormality. Poor menstrual hygiene was observed among 72.7% women with RTI. Follow-up done after one month showed effectiveness in terms of symptomatic relied in 72.7% while 9.1% discontinued treatment and 4.5% did not comply with the medications. Training of nurses, health workers, dais, anganwadi workers regarding RTI identification and referral using syndromic approach and promotion of menstrual hygiene, genital hygiene and health care seeking behaviour would help in reducing the burden of RTI in the community.

  8. Effects of androgen receptor polyglutamine tract expansion on proliferation of NG108-15 cells.

    PubMed

    Nakajima, H; Kimura, F; Nakagawa, T; Ikemoto, T; Furutama, D; Shinoda, K; Kato, S; Shimizu, A; Ohsawa, N

    1997-01-31

    Expansion of the polyglutamine tracts in the androgen receptor (AR) has been recognized as a cause of X-linked spinal and bulbar muscular atrophy (SBMA). In the present study, NG108-15 cells were stably transfected with expression vectors coding for either the wild type (WT) AR gene (CAG repeat number = 22) or a mutated (MT) AR gene (CAG repeat number = 52). Cells proliferation and cell cycle parameters were evaluated for NG108-15-WT and NG108-15-MT cells in the presence or absence of androgen. NG108-15-WT cells demonstrated an androgen-dependent increase in cell number, while NG108-15-MT cells did not. Our results demonstrate that expansion of polyglutamine tracts in the AR may affect the proliferation and differentiation of nerve cells.

  9. The mucosa of the digestive tract in Micropogonias furnieri: a light and electron microscope approach.

    PubMed

    Diaz, A O; García, A M; Figueroa, D E; Goldemberg, A L

    2008-08-01

    The histomorphological aspects as well as the histochemical content and distribution of glycoproteins (GPs) in the mucosa of the digestive tract of the white croaker Micropogonias furnieri were studied. The buccopharyngeal cavity and the esophagous showed a squamous stratified epithelium with mucous cells. The stomach presented three portions: cardias, fundus and pylorus. Tubular glands formed by a single type of gland cell were located along the cardias and fundus. Histochemical tests showed that the buccopharyngeal cavity and the esophagous presented the largest amount of the different types of mucosubstances. Both organs showed abundant secretory mucous cells that synthesize large quantities of neutral, sulphated and sialylated GPs. The surface epithelium in the cardias and fundus synthesized and secreted scarce sialylated and neutral GPs whereas the secretions of the apical surface were abundant. The pylorus secreted large amounts of neutral as well as sulphated and sialylated GPs. Gland cells secreted neutral GPs. The ultrastructural features of the gut cells were quite similar to those of other teleosts. The buccopharyngeal cavity and the esophagous surface epithelial cells, identified by their superficial localization, were characterized by cytoplasmic vesicles of different size. Abundant goblet cells with secretory mucous granules were also present. Gastric glands in the stomach contained just one form of cell with a fine structure similar to cells that secrete pepsinogen.

  10. Spectrum of bacterial colonization associated with urothelial cells from patients with chronic lower urinary tract symptoms.

    PubMed

    Khasriya, Rajvinder; Sathiananthamoorthy, Sanchutha; Ismail, Salim; Kelsey, Michael; Wilson, Mike; Rohn, Jennifer L; Malone-Lee, James

    2013-07-01

    Chronic lower urinary tract symptoms (LUTS), such as urgency and incontinence, are common, especially among the elderly, but their etiology is often obscure. Recent studies of acute urinary tract infections implicated invasion by Escherichia coli into the cytoplasm of urothelial cells, with persistence of long-term bacterial reservoirs, but the role of infection in chronic LUTS is unknown. We conducted a large prospective study with eligible patients with LUTS and controls over a 3-year period, comparing routine urine cultures of planktonic bacteria with cultures of shed urothelial cells concentrated in centrifuged urinary sediments. This comparison revealed large numbers of bacteria undetected by routine cultures. Next, we typed the bacterial species cultured from patient and control sediments under both aerobic and anaerobic conditions, and we found that the two groups had complex but significantly distinct profiles of bacteria associated with their shed bladder epithelial cells. Strikingly, E. coli, the organism most responsible for acute urinary tract infections, was not the only or even the main offending pathogen in this more-chronic condition. Antibiotic protection assays with shed patient cells and in vitro infection studies using patient-derived strains in cell culture suggested that LUTS-associated bacteria are within or extremely closely associated with shed epithelial cells, which explains how routine cultures might fail to detect them. These data have strong implications for the need to rethink our common diagnoses and treatments of chronic urinary tract symptoms.

  11. Small cell neuroendocrine carcinoma of the urinary tract successfully managed with neoadjuvant chemotherapy.

    PubMed

    Ahsaini, Mustapha; Riyach, Omar; Tazi, Mohammed Fadl; El Fassi, Mohammed Jamal; Farih, My Hassan; Elfatmi, Hind; Amarti, Afaf

    2013-01-01

    Introduction. Small cell neuroendocrine carcinomas of the urinary tract is an extremely rare entity and very few cases have been reported in the literature. Small cell neuroendocrine carcinoma of the urinary tract (SCC-UT) is the association between bladder and urinary upper tract-small cell carcinoma (UUT-SCC). It characterized by an aggressive clinical course. The prognosis is poor due to local or distant metastases, and usually the muscle of the bladder is invaded. Case Presentation. We report a rare case of a 54-year-old Arab male native of moroccan; he is a smoker and was referred to our institution for intermittent hematuria. Following a diagnosis of small cell neuroendocrine carcinomas of the ureter and the bladder, thoracoabdominal-pelvic CT was done, and the staging of the tumor was done in the bladder (T2N0M0) and (T1N0M0) in the ureter. Neoadjuvant alternating doublet chemotherapy with ifosfamide/doxorubicin and etoposide/cisplatin was realized, and nephroureterectomy associated to a cystoprostatectomy was carried out. After 24 months of followup, no local or distant metastasis was detected. Conclusion. The purpose of this review is to present a rare case of pure small cell neuroendocrine carcinoma of the urinary tract and review the literature about the place of neoadjuvant chemotherapy in this rare tumors.

  12. Small Cell Neuroendocrine Carcinoma of the Urinary Tract Successfully Managed with Neoadjuvant Chemotherapy

    PubMed Central

    Ahsaini, Mustapha; Riyach, Omar; Tazi, Mohammed Fadl; El Fassi, Mohammed Jamal; Farih, My Hassan; Elfatmi, Hind; Amarti, Afaf

    2013-01-01

    Introduction. Small cell neuroendocrine carcinomas of the urinary tract is an extremely rare entity and very few cases have been reported in the literature. Small cell neuroendocrine carcinoma of the urinary tract (SCC-UT) is the association between bladder and urinary upper tract-small cell carcinoma (UUT-SCC). It characterized by an aggressive clinical course. The prognosis is poor due to local or distant metastases, and usually the muscle of the bladder is invaded. Case Presentation. We report a rare case of a 54-year-old Arab male native of moroccan; he is a smoker and was referred to our institution for intermittent hematuria. Following a diagnosis of small cell neuroendocrine carcinomas of the ureter and the bladder, thoracoabdominal-pelvic CT was done, and the staging of the tumor was done in the bladder (T2N0M0) and (T1N0M0) in the ureter. Neoadjuvant alternating doublet chemotherapy with ifosfamide/doxorubicin and etoposide/cisplatin was realized, and nephroureterectomy associated to a cystoprostatectomy was carried out. After 24 months of followup, no local or distant metastasis was detected. Conclusion. The purpose of this review is to present a rare case of pure small cell neuroendocrine carcinoma of the urinary tract and review the literature about the place of neoadjuvant chemotherapy in this rare tumors. PMID:24024065

  13. CD4+ T-cell survival in the GI tract requires dectin-1 during fungal infection

    PubMed Central

    Drummond, R A; Dambuza, I M; Vautier, S; Taylor, J A; Reid, D M; Bain, C C; Underhill, D M; Masopust, D; Kaplan, D H; Brown, G D

    2016-01-01

    Dectin-1 is an innate antifungal C-type lectin receptor necessary for protective antifungal immunity. We recently discovered that Dectin-1 is involved in controlling fungal infections of the gastrointestinal (GI) tract, but how this C-type lectin receptor mediates these activities is unknown. Here, we show that Dectin-1 is essential for driving fungal-specific CD4+ T-cell responses in the GI tract. Loss of Dectin-1 resulted in abrogated dendritic cell responses in the mesenteric lymph nodes (mLNs) and defective T-cell co-stimulation, causing substantial increases in CD4+ T-cell apoptosis and reductions in the cellularity of GI-associated lymphoid tissues. CD8+ T-cell responses were unaffected by Dectin-1 deficiency. These functions of Dectin-1 have significant implications for our understanding of intestinal immunity and susceptibility to fungal infections. PMID:26349660

  14. [Protocol for ureteroscopy in the diagnosis and treatment of the upper urinary tract transitional cell carcinoma].

    PubMed

    Palou, Juan; Vicente, José; Segarra, José; Huguet, Jorge; Salvador, José; Villavicencio, Humberto

    2004-04-01

    Since Pérez-Castro and Martínez-Piñeiro initiated diagnostic and therapeutic ureteroscopy this technique has gained a place in the management of upper urinary tract tumors. Improvement of the equipment (rigid and flexible), better diagnosis and knowledge of outcomes and allows to treat a group of patients with transitional cell carcinoma of the ureter and pelvis by the conservative retrograde technique. In this article, we present an overview of indications and management of the upper urinary tract tumor by ureteroscopy.

  15. Transitional cell carcinoma of the upper urinary tract: spectrum of imaging findings.

    PubMed

    Browne, Ronan F J; Meehan, Conor P; Colville, Jane; Power, Raymond; Torreggiani, William C

    2005-01-01

    Transitional cell carcinoma (TCC) accounts for up to 10% of neoplasms of the upper urinary tract and usually manifests as hematuria. Imaging plays an important role in assessment of upper tract disease, unlike in bladder TCC, diagnosis of which is usually made at cystoscopy. Traditional imaging modalities, such as excretory urography, retrograde pyelography, and ultrasonography, still play pivotal roles in diagnosis of upper tract TCC, in combination with endourologic techniques. The multicentric nature of TCC makes assessment of the entire urothelium essential before treatment. The advent of minimally invasive surgery, which allows renal preservation in selected patients, makes accurate tumor staging mandatory to determine the appropriate therapy; staging is usually performed with computed tomography (CT) or magnetic resonance (MR) imaging. Vigilant urologic and radiologic follow-up is warranted to assess for metachronous lesions and recurrence. The emerging technique of CT urography allows detection of urinary tract tumors and calculi, assessment of perirenal tissues, and staging of lesions; it may offer the opportunity for one-stop evaluation in the initial assessment of hematuria and in follow-up of TCC. Similar MR imaging protocols can be used in patients who are not candidates for CT urography, although detection of urinary tract calcifications may be suboptimal.

  16. Cerebellar cortical neuron responses evoked from the spinal border cell tract.

    PubMed

    Geborek, Pontus; Spanne, Anton; Bengtsson, Fredrik; Jörntell, Henrik

    2013-01-01

    Spinocerebellar systems are likely to be crucial for cerebellar hallmark functions such as coordination. However, in terms of cerebellar functional analyses, these are perhaps among the least explored systems. The aim of the present study is to achieve activation of a single component of the spinocerebellar systems and to explore to what extent it can influence the spike output of granule cells, Golgi cells, molecular layer (ML) interneurons (stellate and basket cells) and Purkinje cells (PCs). For this purpose, we took advantage of a unique arrangement discovered in neuroanatomical studies, in which the spinal border cell (SBC) component of the ventral spinocerebellar system was found to be the only spinocerebellar tract which ascends in the contralateral lateral funiculus (coLF) and have terminations in sublobulus C1 of the paramedian lobule in the posterior cerebellum. Using electrical stimulation of this tract, we find a subset of the cerebellar cortical neurons in this region to be moderately or powerfully activated. For example, some of our granule cells displayed high intensity responses whereas the majority of the granule cells displayed no response at all. The finding that more than half of the PCs were activated by stimulation of the SBC tract indicated that this system is capable of directly influencing cerebellar cortical output. The implications of these findings for the view of the integrative functions of the cerebellar cortex are discussed.

  17. Keratinocyte growth factor induces proliferation of hepatocytes and epithelial cells throughout the rat gastrointestinal tract.

    PubMed

    Housley, R M; Morris, C F; Boyle, W; Ring, B; Biltz, R; Tarpley, J E; Aukerman, S L; Devine, P L; Whitehead, R H; Pierce, G F

    1994-11-01

    Keratinocyte growth factor (KGF), a member of the fibroblast growth factor (FGF) family, was identified as a specific keratinocyte mitogen after isolation from a lung fibroblast line. Recently, recombinant (r)KGF was found to influence proliferation and differentiation patterns of multiple epithelial cell lineages within skin, lung, and the reproductive tract. In the present study, we designed experiments to identify additional target tissues, and focused on the rat gastrointestinal (GI) system, since a putative receptor, K-sam, was originally identified in a gastric carcinoma. Expression of KGF receptor and KGF mRNA was detected within the entire GI tract, suggesting the gut both synthesized and responded to KGF. Therefore, rKGF was administered to adult rats and was found to induce markedly increased proliferation of epithelial cells from the foregut to the colon, and of hepatocytes, one day after systemic treatment. Daily treatment resulted in the marked selective induction of mucin-producing cell lineages throughout the GI tract in a dose-dependent fashion. Other cell lineages were either unaffected (e.g., Paneth cells), or relatively decreased (e.g., parietal cells, enterocytes) in rKGF-treated rats. The direct effect of rKGF was confirmed by demonstrating markedly increased carcinoembryonic antigen production in a human colon carcinoma cell line, LIM1899. Serum levels of albumin were specifically and significantly elevated after daily treatment. These results demonstrate rKGF can induce epithelial cell activation throughout the GI tract and liver. Further, endogenous KGF may be a normal paracrine mediator of growth within the gut.

  18. Dendritic cells and macrophages in the uveal tract of the normal mouse eye

    PubMed Central

    McMenamin, P.

    1999-01-01

    BACKGROUND/AIMS—Dendritic cells (DC) and macrophages are components of the immune cell populations in the uveal tract whose density, distribution, turnover, and function may play a role in the maintenance of immunological homeostasis in the eye. Little is known of these cells in the mouse eye despite this being the predominant experimental model in many studies of ocular immune responses and immunoinflammatory mediated eye diseases. The aim of the present study was to obtain further immunophenotypic data on resident tissue macrophages and DC populations in the mouse uveal tract.
METHODS—Pieces of iris, ciliary body, and choroid dissected from perfusion fixed BALB/c mice were incubated whole in a variety of anti-macrophage and DC monoclonal antibodies (mAbs). Labelled cells were visualised using either single or double immunoperoxidase techniques.
RESULTS—Quantitative analysis and double immunolabelling revealed that 80% of F4/80+ cells (a mAb that recognises both DC and macrophages) in the iris are macrophages (SER4+). The iris contained a network of Ia+ cells (412 (SD 130) cells/mm2) of which two thirds appear to be DC. A similar pattern was observed in the ciliary body and choroid. Only a few DC in the uveal tract were very weakly reactive for mAbs which recognise B7-1 (CD80), B7-2 (CD86), β2 integrin (mAb N418), and multivesicular bodies associated with antigen presentation (mAb M342).
CONCLUSIONS—The present study reveals that the mouse uveal tract, like the rat, contains rich networks of DC and resident tissue macrophages. The networks of resident tissue macrophages in the mouse uveal tract closely resemble similar networks in non-ocular tissues. The phenotype of uveal tract DC suggests they are in the "immature" phase of their life cycle, similar to Langerhans cells of the skin, thus implying their role in situ within the eye is antigen capture and not antigen presentation.

 PMID:10216062

  19. Protection of human upper respiratory tract cell lines against sulphur mustard toxicity by hexamethylenetetramine (HMT).

    PubMed

    Andrew, D J; Lindsay, C D

    1998-07-01

    1. Sulphur mustard ('mustard gas', HD) is a highly toxic chemical warfare agent which affects the skin and respiratory tract. The primary targets of inhaled HD are the epithelia of the upper respiratory tract. Hexamethylenetetramine (HMT) has been shown to protect human lung cells against HD toxicity and has also been shown to be effective in vivo against the chemical warfare agent phosgene. The ability of HMT to protect against the toxicity of HD was investigated in the human upper respiratory tract cell lines BEAS-2B and RPMI 2650. 2. HD was highly toxic to both cell lines, with LC50 values of 15-30 microM. HMT, at a concentration of 10 mM, was shown to protect the cell lines against the toxic effects of 20 microM and 40 microM HD. Results demonstrated that it was necessary for HMT to be in situ at the time of exposure to HD for effective cytoprotection. No protection was seen when cells were treated with HMT following exposure to HD, or where HMT was removed prior to HD exposure. 3. Results suggest that HMT may be effective prophylaxis for exposure to HD by inhalation.

  20. Dorsal horn cells connected to the lissauer tract and their relation to the dorsal root potential in the rat.

    PubMed

    Lidierth, M; Wall, P D

    1998-08-01

    We have examined the role of dorsal horn cells that respond to Lissauer tract stimulation in regulating primary afferent depolarization (PAD). PAD was monitored by recording the dorsal root potential (DRP) in the roots of the lumbar cord. Recordings were made of the discharges of Lissauer tract-responsive cells, and their discharges were correlated with the DRPs occurring spontaneously and those evoked by stimulation. Electrical microstimulation of the Lissauer tract (<10 microA; 200 micros) was used to activate the tract selectively and evoke a characteristic long-latency DRP. Cells that were excited by Lissauer tract stimulation were found in the superficial laminae of the dorsal horn. They exhibited low rates of ongoing discharge and responded to Lissauer tract stimulation typically with a burst of impulses with a latency to onset of 5.6 +/- 2.7 ms (mean +/- SD) and to termination of 13.6 +/- 4.1 ms (n = 105). Lissauer tract-responsive cells in L5 were shown to receive convergent inputs from cutaneous and muscle afferents as they responded to stimulation of the sural nerve (100%, n = 19) and the nerve to gastrocnemius (95%, n = 19). The latency of the response to sural nerve stimulation was 3.7 +/- 1.5 ms and to gastrocnemius nerve stimulation, 8.3 +/- 3.6 ms. Stimulation through a microelectrode at a depth of 1.5 mm in the sensorimotor cortex (100 microA, 200 micros) evoked a response in 17 of 31 Lissauer tract-responsive cells (55%) with a latency to onset of 21.9 +/- 2.8 ms (n = 17). Stimulation of the sural nerve, nerve to gastrocnemius or sensorimotor cortex was shown to depress the response of Lissauer tract-responsive cells to a subsequent Lissauer tract stimulus. The ongoing discharges of Lissauer tract-responsive cells were correlated to the spontaneous DRP using spike-triggered averaging. Of 123 cells analyzed in this way, 117 (95%) were shown to be correlated to the DRP. In addition, the peaks of spontaneous negative DRPs in spinally transected

  1. Transitional cell cancer of the urinary tract and renal cell cancer in relation to acetaminophen use (United States).

    PubMed

    Rosenberg, L; Rao, R S; Palmer, J R; Strom, B L; Zauber, A; Warshauer, M E; Stolley, P D; Shapiro, S

    1998-01-01

    Experimental and epidemiologic evidence have suggested that phenacetin use increases the risk of transitional cell cancers of the urinary tract. The drug is no longer marketed but a commonly used metabolite, acetaminophen, has been linked recently to an increased risk of renal cancer. We assessed the relation of acetaminophen use to the risk of transitional cell cancer of the urinary tract and of renal cell cancer with data from a hospital-based study of cancers and medication use conducted from 1976-96 in the eastern United States. We compared 498 cases of transitional cell cancer and 383 cases of renal cell cancer with 8,149 noncancer controls and 6,499 cancer controls and controlled confounding factors with logistic regression. For transitional cell cancer, the relative risk (RR) estimate for regular acetaminophen use that had begun at least a year before admission was 1.1 (95 percent confidence interval [CI] = 0.6-1.9) based on noncancer controls, and 0.9 (CI = 0.5-1.6) based on cancer controls. RR estimates for use that lasted at least five years, and for nonregular use, were also close to 1.0. For renal cell cancer, the corresponding estimates were again close to 1.0. Our results suggest that acetaminophen, as used in present study population, does not influence the risk of transitional cell cancer of the urinary tract or of renal cell cancer.

  2. EpCAM-dependent extracellular vesicles from intestinal epithelial cells maintain intestinal tract immune balance

    PubMed Central

    Jiang, Lingling; Shen, Yingying; Guo, Danfeng; Yang, Diya; Liu, Jiajun; Fei, Xuefeng; Yang, Yunshan; Zhang, Buyi; Lin, Zhendong; Yang, Fei; Wang, Xiaojian; Wang, Keyi; Wang, Jianli; Cai, Zhijian

    2016-01-01

    How the intestinal tract develops a tolerance to foreign antigens is still largely unknown. Here we report that extracellular vesicles (EVs) with TGF-β1-dependent immunosuppressive activity are produced by intestinal epithelial cells (IECs) under physiological conditions. Transfer of these EVs into inflammatory bowel disease (IBD) mice induced by dextran sulfate sodium salt decreases IBD severity by inducing regulatory T cells and immunosuppressive dendritic cells. In contrast, decreased endogenous EV production promotes IBD development. IECs produce EVs with increased levels of TGF-β1 upon IBD development in an ERK-dependent manner. Furthermore, these EVs tend to localize in the intestinal tract associated with epithelial cell adhesion molecule (EpCAM). Knockdown of EpCAM in vivo increases the severity of murine IBD, and the protective effect of EVs from IECs with decreased EpCAM on murine IBD is blunted. Therefore, our study indicates that EVs from IECs participate in maintaining the intestinal tract immune balance. PMID:27721471

  3. A Novel Class of Interstitial Cells in the Mouse and Monkey Female Reproductive Tracts1

    PubMed Central

    Peri, Lauren E.; Koh, Byoung H.; Ward, Grace K.; Bayguinov, Yulia; Hwang, Sung Jin; Gould, Thomas W.; Mullan, Catrina J.; Sanders, Kenton M.; Ward, Sean M.

    2015-01-01

    ABSTRACT Growing evidence suggests important roles for specialized platelet-derived growth factor receptor alpha-positive (PDGFRalpha+) cells in regulating the behaviors of visceral smooth muscle organs. Examination of the female reproductive tracts of mice and monkeys showed that PDGFRalpha+ cells form extensive networks in ovary, oviduct, and uterus. PDGFRalpha+ cells were located in discrete locations within these organs, and their distribution and density were similar in rodents and primates. PDGFRalpha+ cells were distinct from smooth muscle cells and interstitial cells of Cajal (ICC). This was demonstrated with immunohistochemical techniques and by performing molecular expression studies on PDGFRalpha+ cells from mice with enhanced green fluorescent protein driven off of the endogenous promoter for Pdgfralpha. Significant differences in gene expression were found in PDGFRalpha+ cells from ovary, oviduct, and uterus. Differences in gene expression were also detected in cells from different tissue regions within the same organ (e.g., uterine myometrium vs. endometrium). PDGFRalpha+ cells are unlikely to provide pacemaker activity because they lack significant expression of key pacemaker genes found in ICC (Kit and Ano1). Gja1 encoding connexin 43 was expressed at relatively high levels in PDGFRalpha+ cells (except in the ovary), suggesting these cells can form gap junctions to one another and neighboring smooth muscle cells. PDGFRalpha+ cells also expressed the early response transcription factor and proto-oncogene Fos, particularly in the ovary. These data demonstrate extensive distribution of PDGFRalpha+ cells throughout the female reproductive tract. These cells are a heterogeneous population of cells that are likely to contribute to different aspects of physiological regulation in the various anatomical niches they occupy. PMID:25788664

  4. Distribution of CD163-positive cell and MHC class II-positive cell in the normal equine uveal tract

    PubMed Central

    SANO, Yuto; MATSUDA, Kazuya; OKAMOTO, Minoru; TAKEHANA, Kazushige; HIRAYAMA, Kazuko; TANIYAMA, Hiroyuki

    2015-01-01

    Antigen-presenting cells (APCs) in the uveal tract participate in ocular immunity including immune homeostasis and the pathogenesis of uveitis. In horses, although uveitis is the most common ocular disorder, little is known about ocular immunity, such as the distribution of APCs. In this study, we investigated the distribution of CD163-positive and MHC II-positive cells in the normal equine uveal tract using an immunofluorescence technique. Eleven eyes from 10 Thoroughbred horses aged 1 to 24 years old were used. Indirect immunofluorescence was performed using the primary antibodies CD163, MHC class II (MHC II) and CD20. To demonstrate the site of their greatest distribution, positive cells were manually counted in 3 different parts of the uveal tract (ciliary body, iris and choroid), and their average number was assessed by statistical analysis. The distribution of pleomorphic CD163- and MHC II-expressed cells was detected throughout the equine uveal tract, but no CD20-expressed cells were detected. The statistical analysis demonstrated the distribution of CD163- and MHC II-positive cells focusing on the ciliary body. These results demonstrated that the ciliary body is the largest site of their distribution in the normal equine uveal tract, and the ciliary body is considered to play important roles in uveal and/or ocular immune homeostasis. The data provided in this study will help further understanding of equine ocular immunity in the normal state and might be beneficial for understanding of mechanisms of ocular disorders, such as equine uveitis. PMID:26537548

  5. Altered Function in CD8+ T Cells following Paramyxovirus Infection of the Respiratory Tract

    PubMed Central

    Gray, Peter M.; Arimilli, Subhashini; Palmer, Ellen M.; Parks, Griffith D.; Alexander-Miller, Martha A.

    2005-01-01

    For many respiratory pathogens, CD8+ T cells have been shown to play a critical role in clearance. However, there are still many unanswered questions with regard to the factors that promote the most efficacious immune response and the potential for immunoregulation of effector cells at the local site of infection. We have used infection of the respiratory tract with the model paramyxovirus simian virus 5 (SV5) to study CD8+ T-cell responses in the lung. For the present study, we report that over time a population of nonresponsive, virus-specific CD8+ T cells emerged in the lung, culminating in a lack of function in ∼85% of cells specific for the immunodominant epitope from the viral matrix (M) protein by day 40 postinfection. Concurrent with the induction of nonresponsiveness, virus-specific cells that retained function at later times postinfection exhibited an increased requirement for CD8 engagement. This change was coupled with a nearly complete loss of functional phosphoprotein-specific cells, a response previously shown to be almost exclusively CD8 independent. These studies add to the growing evidence for immune dysregulation following viral infection of the respiratory tract. PMID:15731228

  6. Dendritic Cells from the Human Female Reproductive Tract Rapidly Capture and respond to HIV

    PubMed Central

    Rodriguez-Garcia, M; Shen, Zheng; Barr, Fiona D.; Boesch, Austin W.; Ackerman, Margaret E.; Kappes, John C.; Ochsenbauer, Christina; Wira, Charles R.

    2016-01-01

    Dendritic cells (DCs) throughout the female reproductive tract (FRT) were examined for phenotype, HIV capture ability and innate anti-HIV responses. Two main CD11c+ DC subsets were identified: CD11b+ and CD11blow DCs. CD11b+CD14+ DCs were the most abundant throughout the tract.A majority of CD11c+CD14+ cells corresponded to CD1c+ myeloid DCs while the rest lacked CD1c and CD163 expression (macrophage marker) and may represent monocyte-derived cells. Additionally we identified CD103+ DCs, located exclusively in the endometrium, while DC-SIGN+ DCs were broadly distributed throughout the FRT. Following exposure to GFP-labeled HIV particles, CD14+ DC-SIGN+ as well as CD14+ DC-SIGN- cells captured virus, with approximately 30% of these cells representing CD1c+ myeloid DCs. CD103+ DCs lacked HIV capture ability. Exposure of FRT DCs to HIV induced secretion of CCL2, CCR5 ligands, IL-8, elafin and SLPI within 3h of exposure, while classical pro-inflammatory molecules did not change and IFNα2 and IL10 were undetectable. Furthermore, elafin and SLPI up-regulation, but not CCL5, were suppressed by estradiol pretreatment. Our results suggest that specific DC subsets in the FRT have the potential for capture and dissemination of HIV, exert antiviral responses and likely contribute to the recruitment of HIV-target cells through the secretion of innate immune molecules. PMID:27579858

  7. Cutaneous squamous cell carcinoma presenting as a wound with discharging sinus tracts in a wild African lion (Panthera leo).

    PubMed

    Mwase, M; Mumba, C; Square, D; Kawarai, S; Madarame, H

    2013-11-01

    A female wild African lion (Panthera leo) was presented with an 8-month history of a wound with multiple discharging sinus tracts on the left paw. Microscopical examination revealed squamous cell carcinoma (SCC). To the best of our knowledge, this is the first report of cutaneous SCC in an African lion. Cutaneous SCC presenting as discharging sinus tracts lined by neoplastic squamous cells has not been reported previously in animals.

  8. An Evidence-Based Approach To the Prevention of Catheter-Associated Urinary Tract Infections.

    PubMed

    Carter, Nina M; Reitneier, Laura; Goodloe, Lauren R

    2014-01-01

    This article describes a bundle of interventions that effectively reduced the incidence of catheter-associated urinary tract infections on the Acute Care Medicine' Unit, a general medicine/telemetry unit. A series of evidence-based interventions were implemented in October 2011, and since the implementation of these interventions, the 28-bed unit has seen a significant reduction in catheter-associated urinary tract infections.

  9. Cell Aging of Mouse Gastrointestinal Tract Observed by Light and Electron Microscopic Radioautography

    PubMed Central

    Nagata, Tetsuji

    2014-01-01

    The term “cell aging” initially means how the cells change due to their aging. There are two meanings, i.e. how a cell changes when it is isolated from original animals such as in vitro cells in cell culture, otherwise how all the cells of an animal change in vivo due to the aging of the individual animal. We have been studying the latter changes from the viewpoint of the cell nutrients, the precursors for the macromolecular synthesis such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA), proteins, glucides and lipids, which are incorporated and synthesized into various cells of individual animals. Therefore, this article deals with only the cell aging of animal cells in vivo, how the metabolism, i.e. incorporations and syntheses of respective nutrient precursors in various kinds of cells change due to the aging of individual experimental animals such as mice by means of microscopic radioautography to localize the RI-labeled precursors. The incorporations and syntheses of various precursors for macromolecules such as DNA, RNA, proteins, glucides, lipids and others in various kinds of cells of various organs in the gastrointestinal tract such as the mouth, esophagus, stomach and intestines are reviewed referring many original papers already published from our laboratory during these 60 years since the late 20th century. PMID:27785275

  10. Regulation of immunologic homeostasis in peripheral tissues by dendritic cells: the respiratory tract as a paradigm.

    PubMed

    Holt, P G; Stumbles, P A

    2000-03-01

    Dendritic cells are now recognized as the gatekeepers of the immune response, possessing a unique potential for acquisition of antigens at extremely low exposure levels and for efficient presentation of these in an immunogenic form to the naive T-cell system. Dendritic cell populations throughout the body exhibit a wide range of features in common that are associated with their primary functions, and these are considered in the initial section of this review. In addition, it is becoming evident that the properties and functions of these cells are refined by microenvironmental factors unique to their tissues of residence, a prime example being mucosal microenvironments such as those in respiratory tract tissues, and the latter represents the focus of the second section of this review.

  11. Rapidly Growing Right Ventricular Outflow Tract Mass in Patient with Sarcomatoid Renal Cell Carcinoma

    PubMed Central

    Hwang, Jongmin; Choi, Kyung Un; Kim, Jeong Su; Hwang, Ki Won; Lee, Sang Hyun; Chon, Min Ku; Lee, Soo Yong; Lee, Dae Sung

    2016-01-01

    Cardiac metastasis from renal cell carcinoma (RCC) without inferior vena cava (IVC) involvements is extremely rare with few reported cases. Sarcomatoid RCC with rhabdoid feature is a rare pathologic type of RCC having aggressive behavior due to great metastatic potential. Here, we report a case of rapidly growing cardiac metastasis of RCC which brought on right ventricular outflow tract (RVOT) obstruction without IVC and right atrial involvement in a 61-year-old woman. Cardiac arrest occurred during radical nephrectomy and echocardiography revealed mass nearly obstructing the RVOT which was not recognized by preoperative echocardiography 1 month ago. Postoperative immunohistochemical evaluation of renal mass revealed sarcomatoid RCC with rhabdoid feature. PMID:28090262

  12. Mechanosensitive ion channels in interstitial cells of Cajal and smooth muscle of the gastrointestinal tract.

    PubMed

    Kraichely, R E; Farrugia, G

    2007-04-01

    Normal gastrointestinal (GI) motility is required to mix digestive enzymes and food and to move content along the GI tract. Underlying the complex motor patterns of the gut are electrical events that reflect ion flux across cell membranes. Smooth muscle electrical activity is directly influenced by GI interstitial cells of Cajal, whose rhythmic oscillations in membrane potential in part determine the excitability of GI smooth muscle and its response to neuronal input. Coordinated activity of the ion channels responsible for the conductances that underlie ion flux in both smooth muscle and interstitial cells is a requisite for normal motility. These conductances are regulated by many factors, including mechanical stress. Recent studies have revealed mechanosensitivity at the level of the ion channels, and the mechanosensor within the channel has been identified in many cases. This has led to better comprehension of the role of mechanosensitive conductances in normal physiology and will undoubtedly lead to understanding of the consequences of disturbances in these conductances.

  13. Distribution of endocrine cells in the digestive tract of Alligator sinensis during the active and hibernating period.

    PubMed

    Wang, Huan; Zhang, Shengzhou; Zhou, Naizhen; Wang, Chaolin; Wu, Xiaobing

    2014-10-01

    The digestive tract is the largest endocrine organ in the body; the distribution pattern of endocrine cells varies with different pathological and physiological states. The aim of the present study was to investigate the distributed density of 5-hydroxytryptamine (5-HT), gastrin (GAS), somatostatin (SS) and vasoactive intestinal peptide (VIP) immunoreactive (IR) cells in the digestive tract of Alligator sinensis during the active and hibernating period by immunohistochemical (IHC) method. The results indicated that 5-HT-IR cells were distributed throughout the entire digestive tract, which were most predominant in duodenum and jejunum. The density increased significantly in stomach and duodenum during hibernation. GAS-IR cells were limited in small stomach and small intestine. The density decreased significantly in small stomach during hibernation, while increased in duodenum. What's more, most of the endocrine cells in duodenum were generally spindle shaped with long cytoplasmic processes ending in the lumen during hibernation. SS-IR cells were limited in stomach and small stomach. The density increased in stomach while decreased in small stomach during hibernation, meanwhile, fewer IR cells occurred in small intestine. VIP-IR cells occurred in stomach and small stomach. The density decreased in small stomach, while increased in stomach during hibernation. These results indicated that the endocrine cells in different parts of digestive tract varied differently during hibernation, their changes were adaptive response to the hibernation.

  14. Influence of Mesenchymal Stem Cells Conditioned Media on Proliferation of Urinary Tract Cancer Cell Lines and Their Sensitivity to Ciprofloxacin.

    PubMed

    Maj, Malgorzata; Bajek, Anna; Nalejska, Ewelina; Porowinska, Dorota; Kloskowski, Tomasz; Gackowska, Lidia; Drewa, Tomasz

    2017-06-01

    Mesenchymal stem cells (MSCs) are known to interact with cancer cells through direct cell-to-cell contact and secretion of paracrine factors, although their exact influence on tumor progression in vivo remains unclear. To better understand how fetal and adult stem cells affect tumors, we analyzed viability of human renal (786-0) and bladder (T24) carcinoma cell lines cultured in conditioned media harvested from amniotic fluid-derived stem cells (AFSCs) and adipose-derived stem cells (ASCs). Both media reduced metabolic activity of 786-0 cells, however, decreased viability of T24 cells was noted only after incubation with conditioned medium from ASCs. To test the hypothesis that MSCs-secreted factors might be involved in chemoresistance acquisition, we further analyzed influence of mesenchymal stem cell conditioned media (MSC-CM) on cancer cells sensitivity to ciprofloxacin, that is considered as potential candidate agent for urinary tract cancers treatment. Significantly increased resistance to tested drug indicates that MSCs may protect cancer cells from chemotherapy. J. Cell. Biochem. 118: 1361-1368, 2017. © 2016 Wiley Periodicals, Inc.

  15. Immunofluorescent localization of enteroglucagon cells in the gastrointestinal tract of the dog

    PubMed Central

    Polak, Julia M.; Bloom, S.; Coulling, I.; Pearse, A. G. E.

    1971-01-01

    Localization of the endocrine polypeptide cells responsible for `glucagon-like immunoreactivity' in the gastrointestinal tract of the dog has been achieved with an immunofluorescent technique using antibodies raised against porcine pancreatic glucagon. The cells, for which we prefer the term `enteroglucagon', could only be demonstrated by this technique in tissues fixed in carbodiimide. The enteroglucagon cells possess cytological, cytochemical, and ultrastructural characteristics in common with those of the pancreatic α2 cell and they are equivalent in the stomach to the A cell and in the intestine to the L cell of the Wiesbaden terminology. Their distribution, predominantly in fundus and jejunum, correlates precisely with the distribution of glucagon-like immunoreactivity by radioimmunoassay and bioassay. The storage form of enteroglucagon differs in many respects from that of pancreatic glucagon although there are some close resemblances between the two forms of specific hormone-containing granule. Elucidation of the role of enteroglucagon should be assisted by the ability to demonstrate enteroglucagon cells. ImagesFig. 1Fig. 2Fig. 3Fig. 4Fig. 5Fig. 6Fig. 7 PMID:4930155

  16. Escherichia coli pili as possible mediators of attachment to human urinary tract epithelial cells.

    PubMed Central

    Edén, C S; Hansson, H A

    1978-01-01

    Presence of pili of fimbriae on Escherichia coli bacteria isolated from the urine of patients with urinary tract infection was related to the ability of the bacteria to attach to human uroepithelial cells. Piliated E. coli strains agglutinated guinea pig erythrocytes. D-Mannose and alpha-methyl-D-mannopyranoside inhibited this agglutination with all but one of the 12 strains tested. D-Mannose, D-galactose, alpha-methyl-D-mannopyranoside, and L-fucose did not afect attachment of piliated strains to uroepithelial cells. Heating as well as washing of piliated strains caused a parallel decrease of piliation and adhesive ability. Growth in glucose-enriched medium increased capsule formation but decreased piliation and adhesion. Capsulated strains retained their adhesive ability provided that pili extended outside the capsule. Images PMID:361565

  17. Deletion of Dicer in Somatic Cells of the Female Reproductive Tract Causes Sterility

    PubMed Central

    Nagaraja, Ankur K.; Andreu-Vieyra, Claudia; Franco, Heather L.; Ma, Lang; Chen, Ruihong; Han, Derek Y.; Zhu, Huifeng; Agno, Julio E.; Gunaratne, Preethi H.; DeMayo, Francesco J.; Matzuk, Martin M.

    2008-01-01

    Dicer is an evolutionarily conserved ribonuclease III that is necessary for microRNA (miRNA) processing and the synthesis of small interfering RNAs from long double-stranded RNA. Although it has been shown that Dicer plays important roles in the mammalian germline and early embryogenesis, the functions of Dicer-dependent pathways in the somatic cells of the female reproductive tract are unknown. Using a transgenic line in which Cre recombinase is driven by the anti-Müllerian hormone receptor type 2 promoter, we conditionally inactivated Dicer1 in the mesenchyme of the developing Müllerian ducts and postnatally in ovarian granulosa cells and mesenchyme-derived cells of the oviducts and uterus. Deletion of Dicer in these cell types results in female sterility and multiple reproductive defects including decreased ovulation rates, compromised oocyte and embryo integrity, prominent bilateral paratubal (oviductal) cysts, and shorter uterine horns. The paratubal cysts act as a reservoir for spermatozoa and oocytes and prevent embryos from transiting the oviductal isthmus and passing the uterotubal junction to enter the uterus for implantation. Deep sequencing of small RNAs in oviduct revealed down-regulation of specific miRNAs in Dicer conditional knockout females compared with wild type. The majority of these differentially expressed miRNAs are predicted to regulate genes important for Müllerian duct differentiation and mesenchyme-derived structures, and several of these putative target genes were significantly up-regulated upon conditional deletion of Dicer1. Thus, our findings reveal diverse and critical roles for Dicer and its miRNA products in the development and function of the female reproductive tract. PMID:18687735

  18. Very long haplotype tracts characterized at high resolution from HLA homozygous cell lines

    PubMed Central

    Norman, Paul J.; Norberg, Steve; Nemat-Gorgani, Neda; Royce, Thomas; Hollenbach, Jill A.; Won, Melissa Shults; Guethlein, Lisbeth A.; Gunderson, Kevin L.; Ronaghi, Mostafa; Parham, Peter

    2015-01-01

    The HLA region of chromosome 6 contains the most polymorphic genes in humans. Spanning ~5Mbp the densely packed region encompasses approximately 175 expressed genes including the highly polymorphic HLA class I and II loci. Most of the other genes and functional elements are also polymorphic, and many of them are directly implicated in immune function or immune-related disease. For these reasons this complex genomic region is subject to intense scrutiny by researchers with the common goal of aiding further understanding and diagnoses of multiple immune-related diseases and syndromes. To aid assay development and characterization of the classical loci, a panel of cell lines partially or fully homozygous for HLA class I and II was assembled over time by the International Histocompatibility Working Group (IHWG). Containing a minimum of 88 unique HLA haplotypes, we show this panel represents a significant proportion of European HLA allelic and haplotype diversity (60–95%). Using a high-density whole genome array that includes 13,331 HLA region SNPs, we analyzed 99 IHWG cells to map the coordinates of the homozygous tracts at a fine scale. The mean homozygous tract length within chromosome 6 from these individuals is 21Mbp. Within HLA the mean haplotype length is 4.3Mbp, and 65% of the cell lines were shown to be homozygous throughout the entire region. In addition, four cell lines are homozygous throughout the complex KIR region of chromosome 19 (~250kbp). The data we describe will provide a valuable resource for characterizing haplotypes, designing and refining imputation algorithms and developing assay controls. PMID:26198775

  19. Very long haplotype tracts characterized at high resolution from HLA homozygous cell lines.

    PubMed

    Norman, Paul J; Norberg, Steve J; Nemat-Gorgani, Neda; Royce, Thomas; Hollenbach, Jill A; Shults Won, Melissa; Guethlein, Lisbeth A; Gunderson, Kevin L; Ronaghi, Mostafa; Parham, Peter

    2015-09-01

    The HLA region of chromosome 6 contains the most polymorphic genes in humans. Spanning ~5 Mbp the densely packed region encompasses approximately 175 expressed genes including the highly polymorphic HLA class I and II loci. Most of the other genes and functional elements are also polymorphic, and many of them are directly implicated in immune function or immune-related disease. For these reasons, this complex genomic region is subject to intense scrutiny by researchers with the common goal of aiding further understanding and diagnoses of multiple immune-related diseases and syndromes. To aid assay development and characterization of the classical loci, a panel of cell lines partially or fully homozygous for HLA class I and II was assembled over time by the International Histocompatibility Working Group (IHWG). Containing a minimum of 88 unique HLA haplotypes, we show that this panel represents a significant proportion of European HLA allelic and haplotype diversity (60-95 %). Using a high-density whole genome array that includes 13,331 HLA region SNPs, we analyzed 99 IHWG cells to map the coordinates of the homozygous tracts at a fine scale. The mean homozygous tract length within chromosome 6 from these individuals is 21 Mbp. Within HLA, the mean haplotype length is 4.3 Mbp, and 65 % of the cell lines were shown to be homozygous throughout the entire region. In addition, four cell lines are homozygous throughout the complex KIR region of chromosome 19 (~250 kbp). The data we describe will provide a valuable resource for characterizing haplotypes, designing and refining imputation algorithms and developing assay controls.

  20. Alternative Approaches to Conventional Treatment of Acute Uncomplicated Urinary Tract Infection in Women

    PubMed Central

    Foxman, Betsy; Buxton, Miatta

    2013-01-01

    The increasing resistance of uropathogens to antibiotics, and recognition of generally self-limiting nature of uncomplicated urinary tract infection (UTI) suggests that it is time to reconsider empirical treatment of UTI using antibiotics. Identifying new and effective strategies to prevent recurrences and alterative treatment strategies are a high priority. We review the recent literature regarding the effects of functional food products, probiotics, vaccines, and alternative treatments on treating and preventing UTI. PMID:23378124

  1. Surgical management for upper urinary tract transitional cell carcinoma (UUT-TCC): a systematic review.

    PubMed

    Rai, Bhavan Prasad; Shelley, Mike; Coles, Bernadette; Somani, Bhaskar; Nabi, Ghulam

    2012-11-01

    Surgical management of upper urinary tract transitional cell carcinoma (UUT-TCC) has significantly changed over the past two decades. Data for several new surgical techniques, including nephron-sparing surgery (NSS), is emerging. The study systematically reviewed the literature comparing (randomised and observational studies) surgical and oncological outcomes for various surgical techniques MEDLINE, EMBASE, Cochrane Library, CINAHL, British Nursing Index, AMED, LILACS, Web of Science, Scopus, Biosis, TRIP, Biomed Central, Dissertation Abstracts, ISI proceedings, and PubMed were searched to identify suitable studies. Data were extracted from each identified paper independently by two reviewers (B.R. and B.S.) and cross checked by a senior member of the team. The data analysis was performed using the Cochrane software Review manager version 5. Comparable data from each study was combined in a meta-analysis where possible. For dichotomous data, odds ratios with 95% confidence intervals (CIs) were estimated based on the fixed-effects model and according to an intention-to-treat analysis. If the data available were deemed not suitable for a meta-analysis it was described in a narrative fashion. One randomised control trial (RCT) and 19 observational studies comparing open nephroureterectomy (ONU) and laparoscopic NU (LNU) were identified. The RCT reported the LNU group to have statistically significantly less blood loss (104 vs 430 mL, P < 0.001) and mean time to discharge (2.30 vs 3.65 days, P < 0.001) than the ONU group. At a median follow-up of 44 months, the overall 5-year cancer-specific survival (CSS; 89.9 vs 79.8%) and 5-year metastasis-free survival rates (77.4 vs 72.5%) for the ONU were better than for LNU, respectively, although not statistically significant. A meta-analysis of the observational studies favoured LNU group for lower urinary recurrence (P < 0.001) and distant metastasis. The meta-analyses for local recurrence for the two groups were comparable

  2. Interstitial cells of Cajal mediate nitrergic inhibitory neurotransmission in the murine gastrointestinal tract.

    PubMed

    Lies, Barbara; Gil, Víctor; Groneberg, Dieter; Seidler, Barbara; Saur, Dieter; Wischmeyer, Erhard; Jiménez, Marcel; Friebe, Andreas

    2014-07-01

    Nitric oxide (NO) is a major inhibitory neurotransmitter in the gastrointestinal (GI) tract. Its main effector, NO-sensitive guanylyl cyclase (NO-GC), is expressed in several GI cell types, including smooth muscle cells (SMC), interstitial cells of Cajal (ICC), and fibroblast-like cells. Up to date, the interplay between neurons and these cells to initiate a nitrergic inhibitory junction potential (IJP) is unclear. Here, we investigate the origin of the nitrergic IJP in murine fundus and colon. IJPs were determined in fundus and colon SMC of mice lacking NO-GC globally (GCKO) and specifically in SMC (SM-GCKO), ICC (ICC-GCKO), and both SMC/ICC (SM/ICC-GCKO). Nitrergic IJP was abolished in ICC-GCKO fundus and reduced in SM-GCKO fundus. In the colon, the amplitude of nitrergic IJP was reduced in ICC-GCKO, whereas nitrergic IJP in SM-GCKO was reduced in duration. These results were corroborated by loss of the nitrergic IJP in global GCKO. In conclusion, our results prove the obligatory role of NO-GC in ICC for the initiation of an IJP. NO-GC in SMC appears to enhance the nitrergic IJP, resulting in a stronger and prolonged hyperpolarization in fundus and colon SMC, respectively. Thus NO-GC in both cell types is mandatory to induce a full nitrergic IJP. Our data from the colon clearly reveal the nitrergic IJP to be biphasic, resulting from individual inputs of ICC and SMC.

  3. Brief and prolonged effects of Lissauer tract stimulation on dorsal horn cells.

    PubMed

    Wall, P D; Lidierth, M; Hillman, P

    1999-12-01

    Increased excitability of dorsal horn neurones may play a critical role in producing some pain states and there is evidence that the excitability of neurones lying throughout the dorsal horn is subject to regulation by cells in its most superficial laminae. This paper examines the effect on dorsal horn cell receptive fields and excitability of the specific activation of Lissauer's tract, a tract containing propriospinal axons which arise from cells in the substantia gelatinosa and which project to the substantia of neighbouring spinal segments. Experiments were carried out on anaesthetised spinal rats in the L3-4 spinal segments with microelectrode stimulation on the surface of the Lissauer tract (LT) and microelectrode recording of single cells or small groups of cells that responded to gentle brushing on the skin. Single shocks or brief trains of low-level stimuli to the LT produced a characteristic long-latency dorsal root potential (DRP) on the L3 dorsal root and a brief burst of firing in superficial cells with no stimulation of primary afferents. Generally, this was accompanied by no excitation of deeper dorsal horn cells but commonly by a period of inhibition, often followed by facilitation. We then turned to the effect of long periods (30-90min) of continual LT stimulation because we had seen hints of prolonged facilitation of the deeper cells after periods of such stimulation. Trains of 5 stimuli separated by 2ms and repeated every 200ms were used with individual pulses of 200 micros duration and less than 10 microA amplitude. This resulted in a shift of the effect on deep cells from primarily inhibition to mainly facilitation. We then examined in detail the effect of these long periods of LT stimulation on the size of receptive fields (RFs) of dorsal horn cells first on single units and then by repeated mapping of the RFs of small groups of cells. Control periods of 60min with no LT stimulation produced no significant RF changes but 30, 60 or 90min of LT

  4. Characterisation of CART-containing neurons and cells in the porcine pancreas, gastro-intestinal tract, adrenal and thyroid glands

    PubMed Central

    Wierup, Nils; Gunnarsdóttir, Anna; Ekblad, Eva; Sundler, Frank

    2007-01-01

    Background The peptide CART is widely expressed in central and peripheral neurons, as well as in endocrine cells. Known peripheral sites of expression include the gastrointestinal (GI) tract, the pancreas, and the adrenal glands. In rodent pancreas CART is expressed both in islet endocrine cells and in nerve fibers, some of which innervate the islets. Recent data show that CART is a regulator of islet hormone secretion, and that CART null mutant mice have islet dysfunction. CART also effects GI motility, mainly via central routes. In addition, CART participates in the regulation of the hypothalamus-pituitary-adrenal-axis. We investigated CART expression in porcine pancreas, GI-tract, adrenal glands, and thyroid gland using immunocytochemistry. Results CART immunoreactive (IR) nerve cell bodies and fibers were numerous in pancreatic and enteric ganglia. The majority of these were also VIP IR. The finding of intrinsic CART containing neurons indicates that pancreatic and GI CART IR nerve fibers have an intrinsic origin. No CART IR endocrine cells were detected in the pancreas or in the GI tract. The adrenal medulla harboured numerous CART IR endocrine cells, most of which were adrenaline producing. In addition CART IR fibers were frequently seen in the adrenal cortex and capsule. The capsule also contained CART IR nerve cell bodies. The majority of the adrenal CART IR neuronal elements were also VIP IR. CART IR was also seen in a substantial proportion of the C-cells in the thyroid gland. The majority of these cells were also somatostatin IR, and/or 5-HT IR, and/or VIP IR. Conclusion CART is a major neuropeptide in intrinsic neurons of the porcine GI-tract and pancreas, a major constituent of adrenaline producing adrenomedullary cells, and a novel peptide of the thyroid C-cells. CART is suggested to be a regulatory peptide in the porcine pancreas, GI-tract, adrenal gland and thyroid. PMID:17625001

  5. Vangl2-regulated polarisation of second heart field-derived cells is required for outflow tract lengthening during cardiac development.

    PubMed

    Ramsbottom, Simon A; Sharma, Vipul; Rhee, Hong Jun; Eley, Lorraine; Phillips, Helen M; Rigby, Hannah F; Dean, Charlotte; Chaudhry, Bill; Henderson, Deborah J

    2014-12-01

    Planar cell polarity (PCP) is the mechanism by which cells orient themselves in the plane of an epithelium or during directed cell migration, and is regulated by a highly conserved signalling pathway. Mutations in the PCP gene Vangl2, as well as in other key components of the pathway, cause a spectrum of cardiac outflow tract defects. However, it is unclear why cells within the mesodermal heart tissue require PCP signalling. Using a new conditionally floxed allele we show that Vangl2 is required solely within the second heart field (SHF) to direct normal outflow tract lengthening, a process that is required for septation and normal alignment of the aorta and pulmonary trunk with the ventricular chambers. Analysis of a range of markers of polarised epithelial tissues showed that in the normal heart, undifferentiated SHF cells move from the dorsal pericardial wall into the distal outflow tract where they acquire an epithelial phenotype, before moving proximally where they differentiate into cardiomyocytes. Thus there is a transition zone in the distal outflow tract where SHF cells become more polarised, turn off progenitor markers and start to differentiate to cardiomyocytes. Membrane-bound Vangl2 marks the proximal extent of this transition zone and in the absence of Vangl2, the SHF-derived cells are abnormally polarised and disorganised. The consequent thickening, rather than lengthening, of the outflow wall leads to a shortened outflow tract. Premature down regulation of the SHF-progenitor marker Isl1 in the mutants, and accompanied premature differentiation to cardiomyocytes, suggests that the organisation of the cells within the transition zone is important for maintaining the undifferentiated phenotype. Thus, Vangl2-regulated polarisation and subsequent acquisition of an epithelial phenotype is essential to lengthen the tubular outflow vessel, a process that is essential for on-going cardiac morphogenesis.

  6. Vangl2-Regulated Polarisation of Second Heart Field-Derived Cells Is Required for Outflow Tract Lengthening during Cardiac Development

    PubMed Central

    Rhee, Hong Jun; Eley, Lorraine; Phillips, Helen M.; Rigby, Hannah F.; Dean, Charlotte; Chaudhry, Bill; Henderson, Deborah J.

    2014-01-01

    Planar cell polarity (PCP) is the mechanism by which cells orient themselves in the plane of an epithelium or during directed cell migration, and is regulated by a highly conserved signalling pathway. Mutations in the PCP gene Vangl2, as well as in other key components of the pathway, cause a spectrum of cardiac outflow tract defects. However, it is unclear why cells within the mesodermal heart tissue require PCP signalling. Using a new conditionally floxed allele we show that Vangl2 is required solely within the second heart field (SHF) to direct normal outflow tract lengthening, a process that is required for septation and normal alignment of the aorta and pulmonary trunk with the ventricular chambers. Analysis of a range of markers of polarised epithelial tissues showed that in the normal heart, undifferentiated SHF cells move from the dorsal pericardial wall into the distal outflow tract where they acquire an epithelial phenotype, before moving proximally where they differentiate into cardiomyocytes. Thus there is a transition zone in the distal outflow tract where SHF cells become more polarised, turn off progenitor markers and start to differentiate to cardiomyocytes. Membrane-bound Vangl2 marks the proximal extent of this transition zone and in the absence of Vangl2, the SHF-derived cells are abnormally polarised and disorganised. The consequent thickening, rather than lengthening, of the outflow wall leads to a shortened outflow tract. Premature down regulation of the SHF-progenitor marker Isl1 in the mutants, and accompanied premature differentiation to cardiomyocytes, suggests that the organisation of the cells within the transition zone is important for maintaining the undifferentiated phenotype. Thus, Vangl2-regulated polarisation and subsequent acquisition of an epithelial phenotype is essential to lengthen the tubular outflow vessel, a process that is essential for on-going cardiac morphogenesis. PMID:25521757

  7. Effects of midbrain and medullary stimulation on spinomesencephalic tract cells in the cat.

    PubMed

    Yezierski, R P

    1990-02-01

    1. The effects of electrical stimulation at different rostrocaudal levels of the midbrain, and at sites in the rostral medulla ipsilateral and contralateral to spinal recording sites, were evaluated against the responses of 46 cells belonging to the cat spinomesencephalic tract (SMT). 2. Inhibitory and/or excitatory effects of brain stem stimulation were observed on SMT cells that responded best (26 cells) or exclusively (12 cells) to noxious mechanical or thermal stimuli, as well as on 7 cells responding only to tap and/or stimulation of deep tissues. Recording sites for 32 cells were located in laminae V-VIII (27 cells) and laminae I-III (5 cells). 3. Midbrain stimulation sites were located in the superior colliculus, central gray (CG), red nucleus, and the midbrain reticular formation. Both inhibitory-only and excitatory-only effects were observed, although the most common effect of midbrain stimulation was excitation followed by inhibition (mixed effects). The effects of stimulation at different midbrain levels were determined for each cell. Stimulation in the caudal, middle, or rostral midbrain was often found to exert different effects on the same SMT cell. 4. Stimulation in the rostral medulla at sites located in nucleus raphe magnus (NRM), nucleus reticularis gigantocellularis, and nucleus reticularis magnocellularis produced the same complement of effects observed with midbrain stimulation. Excitation followed by inhibition was the most common effect observed. 5. Stimulus intensities required to produce excitatory or inhibitory effects from midbrain were 114 +/- 85 (SD) microA and 210 +/- 91 microA, respectively. Stimulus currents required to produce excitatory or inhibitory effects from medullary stimulation sites were 124 +/- 56 microA and 70 +/- 60 microA, respectively. The mean currents required to produce mixed effects were 221 +/- 120 microA (midbrain) and 127 +/- 71 microA (medulla). Increasing the stimulus intensity used to evaluate brain stem

  8. A metaproteomics approach to elucidate host and pathogen protein expression during catheter-associated urinary tract infections (CAUTIs).

    PubMed

    Lassek, Christian; Burghartz, Melanie; Chaves-Moreno, Diego; Otto, Andreas; Hentschker, Christian; Fuchs, Stephan; Bernhardt, Jörg; Jauregui, Ruy; Neubauer, Rüdiger; Becher, Dörte; Pieper, Dietmar H; Jahn, Martina; Jahn, Dieter; Riedel, Katharina

    2015-04-01

    Long-term catheterization inevitably leads to a catheter-associated bacteriuria caused by multispecies bacterial biofilms growing on and in the catheters. The overall goal of the presented study was (1) to unravel bacterial community structure and function of such a uropathogenic biofilm and (2) to elucidate the interplay between bacterial virulence and the human immune system within the urine. To this end, a metaproteomics approach combined with in vitro proteomics analyses was employed to investigate both, the pro- and eukaryotic protein inventory. Our proteome analyses demonstrated that the biofilm of the investigated catheter is dominated by three bacterial species, that is, Pseudomonas aeruginosa, Morganella morganii, and Bacteroides sp., and identified iron limitation as one of the major challenges in the bladder environment. In vitro proteome analysis of P. aeruginosa and M. morganii isolated from the biofilm revealed that these opportunistic pathogens are able to overcome iron restriction via the production of siderophores and high expression of corresponding receptors. Notably, a comparison of in vivo and in vitro protein profiles of P. aeruginosa and M. morganii also indicated that the bacteria employ different strategies to adapt to the urinary tract. Although P. aeruginosa seems to express secreted and surface-exposed proteases to escape the human innate immune system and metabolizes amino acids, M. morganii is able to take up sugars and to degrade urea. Most interestingly, a comparison of urine protein profiles of three long-term catheterized patients and three healthy control persons demonstrated the elevated level of proteins associated with neutrophils, macrophages, and the complement system in the patient's urine, which might point to a specific activation of the innate immune system in response to biofilm-associated urinary tract infections. We thus hypothesize that the often asymptomatic nature of catheter-associated urinary tract infections

  9. Human immunodeficiency virus type 1 infection of cells and tissues from the upper and lower human female reproductive tract.

    PubMed Central

    Howell, A L; Edkins, R D; Rier, S E; Yeaman, G R; Stern, J E; Fanger, M W; Wira, C R

    1997-01-01

    Viable tissue sections and isolated cell cultures from the human fallopian tube, uterus, cervix, and vaginal mucosa were examined for susceptibility to infection with human immunodeficiency virus type 1 (HIV-1). We examined infectivity by using the monocytotropic strain HIV-1(JR-FL) and several primary isolates of HIV-1 obtained from infected neonates. HIV-1 infection was measured by p24 production in short-term culture and by immunofluorescence detection of HIV-1 Nef and p24 proteins by laser scanning confocal microscopy. Three-color immunofluorescence was used to phenotype HIV-infected cells within tissue sections from each site. Our findings indicate that epithelial, stromal, and dendritic cells and cells with CD14+ CD4+, CD14-CD4-, and CD4+ CD14- phenotypes from the female reproductive tract are infectable with HIV-1. Of importance is the finding that tissues from the upper reproductive tract are susceptible to infection with HIV-1. Moreover, tissue samples from women in all stages of the menstrual cycle, including postmenopausal women (inactive), could be infected with HIV-1. Female reproductive tract cells required a minimum of 60 min of exposure to HIV-1 in order for infection to occur, in contrast to peripheral blood lymphocytes, which became infected after being exposed to HIV-1 for only 1 min. These findings demonstrate that HIV-1 can infect cells and tissues from different sites within the female reproductive tract and suggest that multiple cell types, including epithelial cells, may be targets for the initial infection by HIV-1. PMID:9094621

  10. The effects of intestinal tract bacterial diversity on mortality following allogeneic hematopoietic stem cell transplantation

    PubMed Central

    Jenq, Robert R.; Perales, Miguel-Angel; Littmann, Eric R.; Morjaria, Sejal; Ling, Lilan; No, Daniel; Gobourne, Asia; Viale, Agnes; Dahi, Parastoo B.; Ponce, Doris M.; Barker, Juliet N.; Giralt, Sergio; van den Brink, Marcel; Pamer, Eric G.

    2014-01-01

    Highly diverse bacterial populations inhabit the gastrointestinal tract and modulate host inflammation and promote immune tolerance. In allogeneic hematopoietic stem cell transplantation (allo-HSCT), the gastrointestinal mucosa is damaged, and colonizing bacteria are impacted, leading to an impaired intestinal microbiota with reduced diversity. We examined the impact of intestinal diversity on subsequent mortality outcomes following transplantation. Fecal specimens were collected from 80 recipients of allo-HSCT at the time of stem cell engraftment. Bacterial 16S rRNA gene sequences were characterized, and microbial diversity was estimated using the inverse Simpson index. Subjects were classified into high, intermediate, and low diversity groups and assessed for differences in outcomes. Mortality outcomes were significantly worse in patients with lower intestinal diversity; overall survival at 3 years was 36%, 60%, and 67% for low, intermediate, and high diversity groups, respectively (P = .019, log-rank test). Low diversity showed a strong effect on mortality after multivariate adjustment for other clinical predictors (transplant related mortality: adjusted hazard ratio, 5.25; P = .014). In conclusion, the diversity of the intestinal microbiota at engraftment is an independent predictor of mortality in allo-HSCT recipients. These results indicate that the intestinal microbiota may be an important factor in the success or failure in allo-HSCT. PMID:24939656

  11. Detection of invariant natural killer T cells in ejaculates from infertile patients with chronic inflammation of genital tract.

    PubMed

    Duan, Yong-Gang; Chen, Shujian; Haidl, Gerhard; Allam, Jean-Pierre

    2017-04-03

    Chronic inflammation of genital tract is thought to play a major role in male fertility disorder. Natural killer (NK) T cells are a heterogeneous group of T cells that share properties of both T cells and NK cells which display immunoregulatory properties. However, little is known regarding the presence and function of NK T cells in ejaculates from patients with chronic inflammation of genital tract. Invariant NK T (iNK T) cells were detected by invariant (Vα24-JαQ) TCR chain in ejaculates from patients suffering from chronic inflammation of genital tract (CIGT) using flow cytometry and immunofluorescence of double staining (n=40). Inflammatory cytokines interleukin (IL)-6, IL-17, and IFN-γ were detected in cell-free seminal plasma using an enzyme-linked immunosorbent assay (ELISA). The correlation between the percentage of iNK T cells and spermatozoa count, motility, vitality, seminal IL-6, IL-17, and IFN-γ was investigated. Significant percentages of iNK T cells above 10% were detected in 50% (CIGT-NKT(+) group). A negative correlation was detected between the percentage of iNK T cells and spermatozoa count (r=-.5957, P=.0056), motility (r=-.6163, P=.0038), and vitality (r=-.8032, P=.0019) in CIGT-NKT(+) group (n=20). Interestingly, a significant correlation of iNK T cells to seminal IL-6 (r=.7083, P=.0005), IFN-γ (r=.9578, P<.0001) was detected whereas lack of correlation between iNK T cells and IL-17 (r=-.1557, P=.5122) in CIGT-NKT(+) group. The proliferative response of iNK T cells could accompany an inflammatory response to spermatozoa and consequently influence sperm quality through secretion of IFN-γ but not IL-17 under chronic inflammatory condition.

  12. Practical approach to screen vesicoureteral reflux after a first urinary tract infection

    PubMed Central

    Fuente, María Álvarez; Costa, Talía Sainz; García, Begoña Santiago; Serrano, Marcelina Algar; Alonso, Manuel Sosa; Luján, Esther Aleo

    2014-01-01

    Introduction: Vesicoureteral reflux (VUR) is a common pediatric urologic disorder. After the first urinary tract infection (UTI), imaging studies are recommended, starting with a renal ultrasound (RUS). Voiding cystourethrography (VCUG) and dimercaptosuccinic acid (DMSA) scan are the other main radiologic studies used to detect VUR. We evaluated the use of RUS as a screening method for VUR in children below 2 years of age, in order to avoid unnecessary VCUG. Materials and Methods: Medical records and imaging studies of infants (<2 years) who had their first UTI in a 6 year period were retrospectively reviewed. We evaluated the sensitivity, specificity, and negative predictive values of RUS and DMSA for diagnosing VUR. Results: Among 155 children (51% males) with their first UTI, 148 RUS were performed, 128 VCUG and 29 DMSA. VUR was detected in 21% patients; 14.5% low grade and 6.5% high grade. One hundred and twenty-one patients underwent both RUS and VCUG, 101 RUS were normal and 20 abnormal. Of the normal RUS 98% had no or low grade VUR. Among those with an abnormality on RUS 30% had high grade VUR (P < 0.001). Conclusions: After the first UTI in infants (<2 years) RUS is a good screening method for VUR. Among such shildren with a normal RUS, we do not recommend VCUG or DMSA. In our opinion, VCUG should be performed only in patients with abnormal findings in RUS or in recurrent UTI. PMID:25378818

  13. Human and Avian Influenza Viruses Target Different Cells in the Lower Respiratory Tract of Humans and Other Mammals

    PubMed Central

    van Riel, Debby; Munster, Vincent J.; de Wit, Emmie; Rimmelzwaan, Guus F.; Fouchier, Ron A.M.; Osterhaus, Albert D.M.E.; Kuiken, Thijs

    2007-01-01

    Viral attachment to the host cell is critical for tissue and species specificity of virus infections. Recently, pattern of viral attachment (PVA) in human respiratory tract was determined for highly pathogenic avian influenza virus of subtype H5N1. However, PVA of human influenza viruses and other avian influenza viruses in either humans or experimental animals is unknown. Therefore, we compared PVA of two human influenza viruses (H1N1 and H3N2) and two low pathogenic avian influenza viruses (H5N9 and H6N1) with that of H5N1 virus in respiratory tract tissues of humans, mice, ferrets, cynomolgus macaques, cats, and pigs by virus histochemistry. We found that human influenza viruses attached more strongly to human trachea and bronchi than H5N1 virus and attached to different cell types than H5N1 virus. These differences correspond to primary diagnoses of tracheobronchitis for human influenza viruses and diffuse alveolar damage for H5N1 virus. The PVA of low pathogenic avian influenza viruses in human respiratory tract resembled that of H5N1 virus, demonstrating that other properties determine its pathogenicity for humans. The PVA in human respiratory tract most closely mirrored that in ferrets and pigs for human influenza viruses and that in ferrets, pigs, and cats for avian influenza viruses. PMID:17717141

  14. Targeted deletion of Hand2 in cardiac neural crest-derived cells influences cardiac gene expression and outflow tract development

    PubMed Central

    Holler, Kristen L.; Hendershot, Tyler J.; Troy, Sophia E.; Vincentz, Joshua W.; Firulli, Anthony B.; Howard, Marthe J.

    2010-01-01

    The basic helix-loop-helix DNA binding protein Hand2 has critical functions in cardiac development both in neural crest-derived and mesoderm-derived structures. Targeted deletion of Hand2 in the neural crest has allowed us to genetically dissect Hand2-dependent defects specifically in outflow tract and cardiac cushion independent of Hand2 functions in mesoderm-derived structures. Targeted deletion of Hand2 in the neural crest results in misalignment of the aortic arch arteries and outflow tract, contributing to development of double outlet right ventricle (DORV) and ventricular septal defects (VSD). These neural crest-derived developmental anomalies are associated with altered expression of Hand2-target genes we have identified by gene profiling. A number of Hand2 direct target genes have been identified using ChIP and ChIP-on-chip analyses. We have identified and validated a number of genes related to cell migration, proliferation/cell cycle and intracellular signaling whose expression is affected by Hand2 deletion in the neural crest and which are associated with development of VSD and DORV. Our data suggest that Hand2 is a multifunctional DNA binding protein affecting expression of target genes associated with a number of functional interactions in neural crest-derived cells required for proper patterning of the outflow tract, generation of the appropriate number of neural crest-derived cells for elongation of the conotruncus and cardiac cushion organization. Our genetic model has made it possible to investigate the molecular genetics of neural crest contributions to outflow tract morphogenesis and cell differentiation. PMID:20144608

  15. Downregulation of programmed cell death 4 (PDCD4) in tumorigenesis and progression of human digestive tract cancers.

    PubMed

    Ma, Gang; Zhang, Hao; Dong, Ming; Zheng, Xinyu; Ozaki, Iwata; Matsuhashi, Sachiko; Guo, Kejian

    2013-12-01

    Nowadays, digestive tract cancers become the commonest neoplasia and one of the leading causes of cancer deaths worldwide. The development of diagnosis and therapy is urgently required. Programmed cell death 4 (PDCD4), a new tumor suppressor, has been documented to be a potential diagnostic tool and treatment target for neoplasia due to the inhabitation of tumor promotion/progression and metastasis. However, its role in human digestive tract cancers is few available up to now. In this study, we examined the expression of PDCD4 in human digestive tract cancers (61 gastric cancer, 65 colorectal cancer, and 69 pancreatic cancer patients) by Western blot analysis, reverse transcription (RT)-PCR, and immunohistochemistry. Western blot, RT-PCR, and immunohistochemistry examination showed that expressions of PDCD4 were significantly lower in cancers specimens than in noncancerous tissues. Among the different differentiated cancer tissues, PDCD4 expression was significantly lower in moderately or poorly differentiated cancers than in well-differentiated cancers (p < 0.05). Our findings suggested that PDCD4 might be a potentially valuable molecular target in diagnosis and therapy for human digestive tract cancers.

  16. Proteus mirabilis uroepithelial cell adhesin (UCA) fimbria plays a role in the colonization of the urinary tract.

    PubMed

    Pellegrino, Rafael; Scavone, Paola; Umpiérrez, Ana; Maskell, Duncan J; Zunino, Pablo

    2013-03-01

    Urinary tract infections (UTIs) are among the most common bacterial infections in humans. Proteus mirabilis is an opportunistic pathogen, capable of causing severe UTIs, with serious kidney damage that may even lead to death. Several virulence factors are involved in the pathogenicity of this bacterium. Among these, adherence to the uroepithelium mediated by fimbriae appears to be a significant bacterial attribute related to urovirulence. Proteus mirabilis expresses several types of fimbriae that could be involved in the pathogenesis of UTI, including uroepithelial cell adhesin (UCA). In this report, we used an uropathogenic P. mirabilis wild-type strain and an isogenic ucaA mutant unable to express UCA to study the pathogenic role of this fimbria in UTI. Ability of the mutant to adhere to desquamated uroepithelial cells and to infect mice using different experimental UTI models was significantly impaired. These results allow us to conclude that P. mirabilis UCA plays an important role in the colonization of the urinary tract.

  17. A Novel Approach for Characterizing Microsatellite Instability in Cancer Cells

    PubMed Central

    Lu, Yuheng; Soong, T. David; Elemento, Olivier

    2013-01-01

    Microsatellite instability (MSI) is characterized by the expansion or contraction of DNA repeat tracts as a consequence of DNA mismatch repair deficiency (MMRD). Accurate detection of MSI in cancer cells is important since MSI is associated with several cancer subtypes and can help inform therapeutic decisions. Although experimental assays have been developed to detect MSI, they typically depend on a small number of known microsatellite loci or mismatch repair genes and have limited reliability. Here, we report a novel genome-wide approach for MSI detection based on the global detection of insertions and deletions (indels) in microsatellites found in expressed genes. Our large-scale analyses of 20 cancer cell lines and 123 normal individuals revealed striking indel features associated with MSI: there is a significant increase of short microsatellite deletions in MSI samples compared to microsatellite stable (MSS) ones, suggesting a mechanistic bias of repair efficiency between insertions and deletions in normal human cells. By incorporating this observation into our MSI scoring metric, we show that our approach can correctly distinguish between MSI and MSS cancer cell lines. Moreover, when we applied this approach to primal tumor samples, our metric is also well consistent with diagnosed MSI status. Thus, our study offers new insight into DNA mismatch repair system, and also provides a novel MSI diagnosis method for clinical oncology with better reliability. PMID:23671654

  18. Epithelial Cell Secretions from the Human Female Reproductive Tract Inhibit Sexually Transmitted Pathogens and Candida albicans but not Lactobacillus

    PubMed Central

    Wira, CR; Ghosh, M; Smith, JM; Shen, L; Connor, RI; Sundstrom, P; Frechette, Gregory M.; Hill, EM; Fahey, JV

    2011-01-01

    Female reproductive tract (FRT) epithelial cells protect against potential pathogens and sexually transmitted infections. The purpose of this study was to determine if epithelial cells from the upper FRT secrete antimicrobials that inhibit reproductive tract pathogens which threaten women's health. Apical secretions from primary cultures of Fallopian tube, uterine, cervical and ectocervical epithelial cells were incubated with Neisseria gonorrhoeae, Candida albicans (yeast and hyphal forms), HIV-1, and Lactobacillus crispatus, prior to being tested for their ability to grow and/or infect target cells. Epithelial cell secretions from the upper FRT inhibit N. gonorrhoeae and both forms of Candida, as well as reduce HIV-1 (R5) infection of target cells. In contrast, none had an inhibitory effect on L. crispatus. Cytokines and chemokines analysis in uterine secretions revealed several molecules that could account for pathogen inhibition. These findings provide definitive evidence for the critical role of epithelial cells in protecting the FRT from infections, without comprising the beneficial presence of L. crispatus, which is part of the normal vaginal microflora of humans. PMID:21048705

  19. Relative distribution of gastrin-, CCK-8-, NPY- and CGRP-immunoreactive cells in the digestive tract of dorado (Salminus brasiliensis).

    PubMed

    Pereira, R T; Costa, L S; Oliveira, I R C; Araújo, J C; Aerts, M; Vigliano, F A; Rosa, P V

    2015-04-01

    The endocrine cells (ECs) of the gastrointestinal mucosa form the largest endocrine system in the body, not only in terms of cell numbers but also in terms of the different produced substances. Data describing the association between the relative distributions of the peptide-specific ECs in relation to feeding habits can be useful tools that enable the creation of a general expected pattern of EC distribution. We aimed to investigate the distribution of ECs immunoreactive for the peptides gastrin (GAS), cholecystokinin (CCK-8), neuropeptide Y (NPY), and calcitonin gene-related peptide (CGRP) in different segments of the digestive tract of carnivorous fish dorado (Salminus brasiliensis) by using immunohistochemistry procedures. The distribution of endocrine cells immunoreactive for gastrin (GAS), cholecystokinin (CCK-8), neuropeptide Y (NPY), and calcitonin gene-related peptide (CGRP) in digestive tract of dorado S. brasiliensis was examined by immunohistochemistry. The results describe the association between the distribution of the peptide-specific endocrine cells and feeding habits in different carnivorous fish. The largest number of endocrine cells immunoreactive for GAS, CCK-8, and CGRP were found in the pyloric stomach region and the pyloric caeca. However, NPY-immunoreactive endocrine cells were markedly restricted to the midgut. The distribution pattern of endocrine cells identified in S. brasiliensis is similar to that found in other carnivorous fishes.

  20. Modeling the transcriptome of genital tract epithelial cells and macrophages in healthy mucosa versus mucosa inflamed by Chlamydia muridarum infection

    PubMed Central

    Johnson, Raymond M.; Kerr, Micah S.

    2015-01-01

    Chlamydia trachomatis urogenital serovars are intracellular bacteria that parasitize human reproductive tract epithelium. As the principal cell type supporting bacterial replication, epithelial cells are central to Chlamydia immunobiology initially as sentries and innate defenders, and subsequently as collaborators in adaptive immunity-mediated bacterial clearance. In asymptomatic individuals who do not seek medical care a decisive struggle between C. trachomatis and host defenses occurs at the epithelial interface. For this study, we modeled the immunobiology of epithelial cells and macrophages lining healthy genital mucosa and inflamed/infected mucosa during the transition from innate to adaptive immunity. Upper reproductive tract epithelial cell line responses were compared to bone marrow-derived macrophages utilizing gene expression microarray technology. Those comparisons showed minor differences in the intrinsic innate defenses of macrophages and epithelial cells. Major lineage-specific differences in immunobiology relate to epithelial collaboration with adaptive immunity including an epithelial requirement for inflammatory cytokines to express MHC class II molecules, and a paucity and imbalance between costimulatory and coinhibitory ligands on epithelial cells that potentially limits sterilizing immunity (replication termination) to Chlamydia-specific T cells activated with limited or unconventional second signals. PMID:26519447

  1. Clinical effects of p53 overexpression in squamous cell carcinoma of the sinonasal tract

    PubMed Central

    Wang, Xiaowei; Lv, Wei; Qi, Fang; Gao, Zhiqiang; Yang, Hua; Wang, Weiqing; Gao, Yali

    2017-01-01

    Abstract Background: The level of p53 protein expression in sinonasal squamous cell carcinoma (SNSCC) has been estimated, but the results remain inconsistent and the point of consensus has not been reached. This study was first determined to evaluate the clinical effects of p53 expression in SCC of the sinonasal tract. Methods: According to the preferred reporting items for systematic reviews and meta-analyses (PRISMA) statement criteria, the potential literature was searched from diverse databases. The pooled odds ratios (ORs) with corresponding 95% confidence intervals (CIs) were calculated to assess the strength of association between p53 expression and SNSCC. Results: Final 17 eligible studies were included in a total of 258 cases and 748 controls. The result of p53 expression was shown to be notably higher in SNSCC than in benign sinonasal papillomas and normal sinonasal mucosa (OR = 26.93, P < 0.001; OR = 39.79, P < 0.001; respectively). Subgroup analyses of ethnicity revealed that p53 expression had significant association with SNSCC in Asian and Caucasian populations in cancer versus benign sinonasal papillomas or normal sinonasal mucosa. The expression of p53 was notably higher in moderately or poorly differentiated SNSCC than in well-differentiated SNSCC (OR = 3.51, P = 0.021), while p53 expression was not associated with histological type. Conclusion: The results suggested that p53 overexpression may be correlated with the carcinogenesis and progression of SNSCC. The p53 gene may become a novel drug target of SNSCC. Additional studies on the correlation of p53 expression with clinicopathological features are needed. PMID:28328848

  2. [Systemic lymphoma cells with T precursor condition of extreme female genital tract. A case report and literature review].

    PubMed

    Butrón Valdez, Karla; Ramírez Galves, Miguel; Germes Piña, Fernando; Ramos Martínez, Ernesto; Zamora Perea, Arturo

    2009-06-01

    Primary female genital tract non Hodgkin's lymphoma is a rare presentation for a common disease in the childhood, and its classification as primary extranodal lymphoma is still controversial. There are a few cases reported as a primary precursor B-cell lymphoblastic lymphoma of the female genital tract, but there is not any case reported as primary precursor T-cell lymphoblastic lymphoma of the ovary in childhood. Herein we describe a 16 years old young woman with bilateral ovarian tumors, paraaortic lymphoadenophaty and disseminate disease to the female genital tract including extension of the tumor to neighboring organs like the omentum and the appendix. Exploratory laparatomy were performed with bilateral salpingo-oophorectomy, hysterectomy, omentectomy, appendectomy, pelvic and para-aortic lymphadenectomy, pelvic washings and with biopsy of vaginal vault. The chemotherapy regimen comprised of CHOP (Cyclophosphamide, Hydroxydaunorubicin, Oncovin, Prednisone/Prednisolone) and methotrexate, 3 months later presents left facial hemiparesia follow by right facial hemiparesia, 7 months later presents more Central Nervous System (CNS) complications and apparently was complicated with acute lymphocitic leukemia and after 16 months from the diagnosis, following by a torpid evolution, the pacient finally died.

  3. Distribution of obestatin and ghrelin in human tissues: immunoreactive cells in the gastrointestinal tract, pancreas, and mammary glands.

    PubMed

    Grönberg, Malin; Tsolakis, Apostolos V; Magnusson, Linda; Janson, Eva T; Saras, Jan

    2008-09-01

    Obestatin and ghrelin are two peptides derived from the same prohormone. It is well established that ghrelin is produced by endocrine cells in the gastric mucosa. However, the distribution of human obestatin immunoreactive cells is not thoroughly characterized. A polyclonal antibody that specifically recognizes human obestatin was produced. Using this antibody and a commercial antibody vs ghrelin, the distribution of obestatin and ghrelin immunoreactive cells was determined in a panel of human tissues using immunohistochemistry. The two peptides were detected in the mucosa of the gastrointestinal tract, from cardia to ileum, and in the pancreatic islets. Interestingly, epithelial cells in the ducts of mammary glands showed distinct immunoreactivity for both ghrelin and obestatin. By double immunofluorescence microscopy, it was shown that all detected cells were immunoreactive for both peptides. Furthermore, the subcellular localization of obestatin and ghrelin was essentially identical, indicating that obestatin and ghrelin are stored in the same secretory vesicles.

  4. Identification of orexin A- and orexin type 2 receptor-positive cells in the gastrointestinal tract of neonatal dogs.

    PubMed

    Dall'Aglio, C; Pascucci, L; Mercati, F; Giontella, A; Pedini, V; Scocco, P; Ceccarelli, P

    2008-01-01

    The presence and distribution of cells positive to orexin A (OXA) and to orexin type 2 receptor (OX2R) were investigated in the gastrointestinal tract of neonatal dogs by means of immunohistochemical techniques. The orexin A-positive cells were identified with some of the endocrine cells in the stomach and in the duodenum; they were both of the open and closed type and were lacking in the large intestine. In the stomach, a large subset of orexin A-positive cells also showed gastrin-like immunoreactivity while, in the duodenum, many of them seemed to store serotonin. The orexin type 2 receptor-positive cells were evidenced all along the gastrointestinal tract examined, also in the large intestine, and they showed the same morphological characteristics as those positive to orexin A. Moreover, the immunohistochemical techniques revealed intense positivity for both orexin A and orexin type 2 receptor in the neurons and fibers of the enteric nervous system. A large subset of orexin A-positive neurons seemed to store substance P.

  5. Characterization of a gastrointestinal tract microscale cell culture analog used to predict drug toxicity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The lining of the gastrointestinal (GI) tract is the largest surface exposed to the external environment in the human body. One of the main functions of the small intestine is absorption, and intestinal absorption is a route used by essential nutrients, chemicals, and pharmaceuticals to enter the sy...

  6. Cell adhesion molecules P-cadherin and CD24 are markers for carcinoma and dysplasia in the biliary tract.

    PubMed

    Riener, Marc-Oliver; Vogetseder, Alexander; Pestalozzi, Bernhard C; Clavien, Pierre-Alain; Probst-Hensch, Nicole; Kristiansen, Glen; Jochum, Wolfram

    2010-11-01

    P-cadherin (CDH3) and CD24 are cell adhesion molecules that control morphogenic processes, cell motility, and invasive growth of tumor cells. The aim of our study was to investigate P-cadherin and CD24 expression in carcinomas and dysplastic lesions of the biliary tract and to evaluate the potential diagnostic usefulness of these cell adhesion molecules. Using immunohistochemistry on tissue microarrays, we analyzed P-cadherin, CD24, and p53 expression in 117 carcinomas of the biliary tract (19 intrahepatic cholangiocarcinomas, 59 extrahepatic cholangiocarcinomas, and 39 gallbladder carcinomas) and correlated our findings with clinicopathologic parameters. We found P-cadherin positivity in 37% of intrahepatic cholangiocarcinomas, 73% of extrahepatic cholangiocarcinomas, and 64% of gallbladder carcinomas, respectively. CD24 reactivity was observed in 21% of intrahepatic cholangiocarcinomas, 58% of extrahepatic cholangiocarcinomas, and 42% of gallbladder carcinomas. Nuclear p53 expression was found in 37% of intrahepatic cholangiocarcinomas, 46% of extrahepatic cholangiocarcinomas, and 45% of gallbladder carcinomas. We also studied P-cadherin, CD24, and p53 expression in normal (n = 30), inflamed (n = 22), and dysplastic (n = 21) biliary epithelium of extrahepatic bile ducts. Dysplastic biliary epithelium was positive for P-cadherin in 91%, for CD24 in 71%, and for p53 in 24% of lesions, respectively. In contrast, normal and inflamed epithelia were negative for all 3 proteins. We conclude that P-cadherin and CD24 are expressed in carcinomas of the biliary tract with high frequency and at an early stage of carcinogenesis. Therefore, they may be useful markers for early detection and as targets for therapy of cholangiocarcinoma.

  7. Sublingual immunization with an HIV subunit vaccine induces antibodies and cytotoxic T cells in the mouse female genital tract.

    PubMed

    Hervouet, Catherine; Luci, Carmelo; Cuburu, Nicolas; Cremel, Magali; Bekri, Selma; Vimeux, Lene; Marañon, Concepcion; Czerkinsky, Cecil; Hosmalin, Anne; Anjuère, Fabienne

    2010-08-02

    A vaccine against heterosexual transmission by human immunodeficiency virus (HIV) should generate cytotoxic and antibody responses in the female genital tract and in extra-genital organs. We report that sublingual immunization with HIV-1 gp41 and a reverse transcriptase polypeptide coupled to the cholera toxin B subunit (CTB) induced gp41-specific IgA antibodies and antibody-secreting cells, as well as reverse transcriptase-specific CD8 T cells in the genital mucosa, contrary to intradermal immunization. Conjugation of the reverse transcriptase peptide to CTB favored its cross-presentation by human dendritic cells to a T cell line from an HIV(+) patient. Sublingual vaccination could represent a promising vaccine strategy against heterosexual transmission of HIV-1.

  8. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

    USGS Publications Warehouse

    Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

    2004-01-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  9. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique Tilapia (Oreochromis mossambicus) by polymerase chain reaction.

    PubMed

    Nol, P; Williamson, J L; Rocke, T E; Yuill, T M

    2004-10-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5 x 104 cells per 0.25 g material or 1.9 x 103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  10. Phenotype and susceptibility to HIV infection of CD4+ Th17 cells in the human female reproductive tract.

    PubMed

    Rodriguez-Garcia, M; Barr, F D; Crist, S G; Fahey, J V; Wira, C R

    2014-11-01

    Prevention of sexual acquisition of HIV in women requires a substantial increase in our knowledge about HIV-target cell availability and regulation in the female reproductive tract (FRT). In this study, we analyzed the phenotype and susceptibility to HIV infection of CD4(+) T cell in the endometrium (EM), endocervix (END), and ectocervix (ECT) of the FRT. We found that T helper type 17 (Th17) cells represent a major subset in FRT tissues analyzed and that Th17 cells were the main CD4(+) T-cell population expressing C-C motif chemokine receptor 5 (CCR5) and CD90. In premenopausal women, CD4(+) T cells and Th17 cells, in particular, were significantly lower in EM relative to END and ECT. Th17 cells were elevated in EM from postmenopausal women relative to premenopausal tissues but not changed in END and ECT. Susceptibility of CD4(+) T cells to HIV infection measured as intracellular p24 was lowest in the EM and highest in the ECT. Additionally, we found that Th17 cells co-expressing CCR5 and CD90 were the most susceptible to HIV infection. Our results provide valuable information for designing preventive strategies directed at targeting highly susceptible target cells in the FRT.

  11. The BMI1 inhibitor PTC-209 is a potential compound to halt cellular growth in biliary tract cancer cells

    PubMed Central

    Mayr, Christian; Wagner, Andrej; Loeffelberger, Magdalena; Bruckner, Daniela; Jakab, Martin; Berr, Frieder; Di Fazio, Pietro; Ocker, Matthias; Neureiter, Daniel; Pichler, Martin; Kiesslich, Tobias

    2016-01-01

    BMI1 is a core component of the polycomb repressive complex 1 (PRC1) and is up-regulated in biliary tract cancer (BTC), contributing to aggressive clinical features. In this study we investigated the cytotoxic effects of PTC-209, a recently developed inhibitor of BMI1, in BTC cells. PTC-209 reduced overall viability in BTC cell lines in a dose-dependent fashion (0.04 - 20 μM). Treatment with PTC-209 led to slightly enhanced caspase activity and stop of cell proliferation. Cell cycle analysis revealed that PTC-209 caused cell cycle arrest at the G1/S checkpoint. A comprehensive investigation of expression changes of cell cycle-related genes showed that PTC-209 caused significant down-regulation of cell cycle-promoting genes as well as of genes that contribute to DNA synthesis initiation and DNA repair, respectively. This was accompanied by significantly elevated mRNA levels of cell cycle inhibitors. In addition, PTC-209 reduced sphere formation and, in a cell line-dependent manner, aldehyde dehydrogease-1 positive cells. We conclude that PTC-209 might be a promising drug for future in vitro and in vivo studies in BTC. PMID:26623561

  12. [Neoplasms of the disseminated neuroendocrine cell system of the gastrointestinal tract].

    PubMed

    Klöppel, G

    2015-05-01

    The classification of neuroendocrine neoplasms (NEN) of the gastrointestinal tract and also the pancreas is based on the World Health Organization (WHO) classification from 2010, the site-related TNM stage classification and the clinicopathological characterization. This allows a classification of NEN that is adapted to the individual patient, is of high prognostic relevance and serves the needs of an adequate treatment. This article summarizes the current knowledge on the clinical pathology of gastrointestinal NEN, in order to enable a rapid diagnostic orientation.

  13. [Therapeutic approaches using genetically modified cells].

    PubMed

    Anliker, Brigitte; Renner, Matthias; Schweizer, Matthias

    2015-11-01

    Medicinal products containing genetically modified cells are, in most cases, classified as gene therapy and cell therapy medicinal products. Although no medicinal product containing genetically modified cells has been licensed in Europe yet, a variety of therapeutic strategies using genetically modified cells are in different stages of clinical development for the treatment of acquired and inherited diseases. In this chapter, several examples of promising approaches are presented, with an emphasis on gene therapy for inherited immunodeficiencies and on tumour immunotherapy with genetically modified T-cells expressing a chimeric antigen receptor or a recombinant T-cell receptor.

  14. Mortality rates of human metapneumovirus and respiratory syncytial virus lower respiratory tract infections in hematopoietic cell transplantation recipients.

    PubMed

    Renaud, Christian; Xie, Hu; Seo, Sachiko; Kuypers, Jane; Cent, Anne; Corey, Lawrence; Leisenring, Wendy; Boeckh, Michael; Englund, Janet A

    2013-08-01

    Human metapneumovirus (HMPV), a common respiratory virus, can cause severe disease in pre- and post-hematopoietic cell transplantation (HCT) recipients. We conducted a retrospective cohort analysis in HCT patients with HMPV (n = 23) or respiratory syncytial virus (n = 23) detected in bronchoalveolar lavage samples by reverse transcription PCR between 2006 and 2011 to determine disease characteristics and factors associated with outcome. Mortality rates at 100 days were 43% for both HMPV and respiratory syncytial virus lower respiratory tract disease. Steroid therapy, oxygen requirement >2 L or mechanical ventilation, and bone marrow as cell source were significant risk factors for overall and virus-related mortality in multivariable models, whereas the virus type was not. The presence of centrilobular/nodular radiographic infiltrates was a possible protective factor for mechanical ventilation. Thus, HMPV lower respiratory tract disease is associated with high mortality in HCT recipients. Earlier detection in combination with new antiviral therapy is needed to reduce mortality among HCT recipients.

  15. Lower Respiratory Tract Diseases Caused by Common Respiratory Viruses among Stem Cell Transplantation Recipients: A Single Center Experience in Korea

    PubMed Central

    Hong, Kyung-Wook; Choi, Su-Mi; Cho, Sung-Yeon; Lee, Hyo-Jin; Choi, Jae-Ki; Kim, Si-Hyun; Park, Sun Hee; Choi, Jung-Hyun; Yoo, Jin-Hong; Lee, Jong-Wook

    2017-01-01

    Purpose To describe the incidence, clinical courses, and risk factors for mortality of lower respiratory tract diseases (LRDs) caused by common respiratory viruses (CRVs) in stem cell transplantation (SCT) recipients. Materials and Methods We retrospectively reviewed the medical records of 1038 patients who received SCT between January 2007 and August 2011 at a single center in Korea. Results Seventy-one CRV-LRDs were identified in 67 (6.5%) patients. The human parainfluenza virus (HPIV) was the most common causative pathogen of CRV-LRDs at 100 days [cumulative incidence estimate, 23.5%; 95% confidence interval (CI), 3.3–43.7] and 1 year (cumulative incidence estimate, 69.2%; 95% CI, 45.9–92.5) following SCT. The 30-day overall mortality rates due to influenza-LRDs, respiratory syncytial virus-LRDs, HPIV-LRDs, and human rhinovirus-LRDs were 35.7, 25.8, 31.6, and 42.8%, respectively. Co-pathogens in respiratory specimens were detected in 23 (33.8%) patients. The overall mortality at day 30 after CRV-LRD diagnosis was 32.8% (22/67). High-dose steroid usage (p=0.025), a severe state of immunodeficiency (p=0.033), and lymphopenia (p=0.006) were significantly associated with death within 30 days following CRV-LRD diagnosis in a univariate analysis. Multivariate logistic regression analysis revealed that high-dose steroid usage [odds ratio (OR), 4.05; 95% CI, 1.12–14.61; p=0.033] and lymphopenia (OR, 6.57; 95% CI, 1.80–24.03; p=0.004) were independent risk factors for mortality within 30 days of CRV-LRDs. Conclusion CRV-LRDs among SCT recipients showed substantially high morbidity and mortality rates. Therefore, the implement of an active diagnostic approaches for CRV infections is required for SCT recipients with respiratory symptoms, especially those receiving high-dose steroids or with lymphopenia. PMID:28120567

  16. A genital tract peptide epitope vaccine targeting TLR-2 efficiently induces local and systemic CD8 + T cells and protects against herpes simplex virus type 2 challenge

    PubMed Central

    Dasgupta, G; Nesburn, AB; Wu, M; Zhu, X; Carpenter, D; Wechsler, SL; You, S; BenMohamed, L

    2015-01-01

    The next generation of needle-free mucosal vaccines is being rationally designed according to rules that govern the way in which the epitopes are recognized by and stimulate the genital mucosal immune system. We hypothesized that synthetic peptide epitopes extended with an agonist of Toll-like receptor 2 (TLR-2), that are abundantly expressed by dendritic and epithelial cells of the vaginal mucosa, would lead to induction of protective immunity against genital herpes. To test this hypothesis, we intravaginally (IVAG) immunized wild-type B6, TLR-2 (TLR2 −/−) or myeloid differentiation factor 88 deficient (MyD88 −/−) mice with a herpes simplex virus type 2 (HSV-2) CD8 + T-cell peptide epitope extended by a palmitic acid moiety (a TLR-2 agonist). IVAG delivery of the lipopeptide generated HSV-2-specific memory CD8 + cytotoxic T cells both locally in the genital tract draining lymph nodes and systemically in the spleen. Moreover, lipopeptide-immunized TLR2 −/− and MyD88 −/− mice developed significantly less HSV-specific CD8 + T-cell response, earlier death, faster disease progression, and higher vaginal HSV-2 titers compared to lipopeptide-immunized wild-type B6 mice. IVAG immunization with self-adjuvanting lipid-tailed peptides appears to be a novel mucosal vaccine approach, which has attractive practical and immunological features. PMID:19129756

  17. Approaches to encapsulation of flexible CIGS cells

    NASA Astrophysics Data System (ADS)

    Olsen, L. C.; Gross, M. E.; Graff, G. L.; Kundu, S. N.; Chu, Xi; Lin, Steve

    2008-08-01

    Thin-film solar cells based on CIGS are being considered for large scale power plants as well as building integrated photovoltaic (BIPV) applications. Past studies indicate that CIGS cells degrade rapidly when exposed to moisture. As a result, an effective approach to encapsulation is required for CIGS cells to satisfy the international standard IEC 61646. CIGS modules fabricated for use in large power plants can be encapsulated with glass sheets on the top and bottom surfaces and can be effectively sealed around the edges. In the case of BIPV applications, however, it is desirable to utilize CIGS cells grown on flexible substrates, both for purposes of achieving reduced weight and for cases involving non-flat surfaces. For these cases, approaches to encapsulation must be compatible with the flexible substrate requirement. Even in the case of large power plants, the glass-to-glass approach to encapsulation may eventually be considered too costly. We are investigating encapsulation of flexible CIGS cells by lamination. Sheets of PET or PEN coated with multilayer barrier coatings are used to laminate the flexible cells. Results are discussed for laminated cells from two CIGS manufacturers. In both cases, the cell efficiency decreases less than 10% after 1000 hours of exposure to an environment of 85°C/85%RH. This paper discusses these two approaches, and reviews results for uncoated cells and mini-modules fabricated by the former Shell Solar Industries (SSI).

  18. TREATMENT EFFECTS OF WST11 VASCULAR TARGETED PHOTODYNAMIC THERAPY IN UROTHELIAL CELL CARCINOMA AND FEASIBILITY, SAFETY, AND LONG TERM OUTCOMES IN THE UPPER URINARY TRACT OF SWINE

    PubMed Central

    Murray, Katie S; Winter, Ashley G; Corradi, Renato Beluco; LaRosa, Stephen; Jebiwott, Sylvia; Somma, Alexander; Takaki, Haruyuki; Srimathveeravalli, Govindarajan; Lepherd, Michelle; Monette, Sebastien; Kim, Kwanghee; Scherz, Avigdor; Coleman, Jonathan A

    2016-01-01

    Purpose Surgical management of upper tract urothelial carcinoma requires removal of kidney and ureter, compromising renal function. Non-surgical alternatives have potentially prohibitive safety concerns. We examine the feasibility and safety of ablation of the ureter and renal pelvis using endoluminal vascular-targeted photodynamic therapy in a porcine model and report efficacy of WST11 vascular-targeted photodynamic therapy in a murine model. Materials and Methods Following approval, we performed 28 endoluminal ablations in the ureters and renal pelvis of 18 swine. Intravenous infusion of WST11 (4mg/kg) followed by laser illumination (10 minutes) was performed via percutaneous access or retrograde ureteroscopic approach. Animals were followed clinically with laboratory testing, imaging and histology was evaluated at several post-ablation time points. A murine xenograft was created with the 5637 human urothelial cell carcinoma line to determine sensitivity to this therapy. Results At 24 hours, 50 mW/cm laser fluence produced superficial necrosis of the ureter and deeper necrosis (penetrating the muscularis propria or adventitia) was produced by treatment with 200 mW/cm in the ureter and renal pelvis. At 4 weeks, superficial urothelium had regenerated over the treatment site. No symptomatic obstruction, clinically relevant hydronephrosis, or abnormality of lab testing was noted up to 4 weeks. In mice, 80% had no evidence of tumor at 19 days after WST11 vascular-targeted photodynamic therapy. Conclusions Urothelial cell carcinoma appears to be sensitive to WST11 vascular-targeted photodynamic therapy. Depth of WST11 vascular-targeted photodynamic therapy treatment effects can be modulated in a dose-dependent manner by titration of light intensity. Moreover, this treatment modality, applied to the porcine upper urinary tract, is feasible via antegrade and retrograde access. PMID:26860792

  19. Synthetic biology approaches to engineer T cells.

    PubMed

    Wu, Chia-Yung; Rupp, Levi J; Roybal, Kole T; Lim, Wendell A

    2015-08-01

    There is rapidly growing interest in learning how to engineer immune cells, such as T lymphocytes, because of the potential of these engineered cells to be used for therapeutic applications such as the recognition and killing of cancer cells. At the same time, our knowhow and capability to logically engineer cellular behavior is growing rapidly with the development of synthetic biology. Here we describe how synthetic biology approaches are being used to rationally alter the behavior of T cells to optimize them for therapeutic functions. We also describe future developments that will be important in order to construct safe and precise T cell therapeutics.

  20. In vitro growth of human urinary tract smooth muscle cells on laminin and collagen type I-coated membranes under static and dynamic conditions.

    PubMed

    Hubschmid, Ulrich; Leong-Morgenthaler, Phaik-Mooi; Basset-Dardare, Aurelia; Ruault, Sylvie; Frey, Peter

    2005-01-01

    This study investigates in vitro growth of human urinary tract smooth muscle cells under static conditions and mechanical stimulation. The cells were cultured on collagen type I- and laminin-coated silicon membranes. Using a Flexcell device for mechanical stimulation, a cyclic strain of 0-20% was applied in a strain-stress-time model (stretch, 104 min relaxation, 15 s), imitating physiological bladder filling and voiding. Cell proliferation and alpha-actin, calponin, and caldesmon phenotype marker expression were analyzed. Nonstretched cells showed significant better growth on laminin during the first 8 days, thereafter becoming comparable to cells grown on collagen type I. Cyclic strain significantly reduced cell growth on both surfaces; however, better growth was observed on laminin. Neither the type of surface nor mechanical stimulation influenced the expression pattern of phenotype markers; alpha-actin was predominantly expressed. Coating with the extracellular matrix protein laminin improved in vitro growth of human urinary tract smooth muscle cells.

  1. Comparison of acid mucin goblet cell distribution and Hox13 expression patterns in the developing vertebrate digestive tract.

    PubMed

    Theodosiou, Nicole A; Hall, Daniel A; Jowdry, Andrea L

    2007-07-15

    The digestive tract of vertebrates is a complex organ system required for the digestion of food and the absorption of nutrients. The colon evolved as a water absorption organ essential for vertebrates to survive on land. In contrast to land vertebrates, the Chondrichthyes (sharks, skates and rays) are nearly iso-osmotic with their ocean environment and do not reabsorb water from food waste. To understand the origin of the vertebrate colon, we examined the distribution of sulfated and sialyated mucus-producing cells in the little skate, Raja erinacea, as an indication of water absorption function in the chondrichthian digestive tract. The percentage of acid mucin producing goblet cells was analyzed in the spiral valve and hindgut of little skate and the small intestine and colon of mouse embryos. Levels of acid mucins in the hindgut of the little skate was comparable to that of the small intestines of terrestrial vertebrates, whereas the distal region of the spiral valve contained high levels of acid mucin producing cells similar to the colon of mouse and chick. The low numbers of acid mucins in the little skate hindgut confirms that a functional colon for water absorption is absent in the Chondrichthyes. Interestingly, the presence of high levels of acid mucins in the posterior spiral valve provides evidence for a possible primordial water-absorbing organ in the elasmobranchs. Hoxd13 patterns acid mucins in the colons of terrestrial vertebrates. Expression of Hoxd13 and Hoxa13 in R. erinacea suggests conserved roles for Hox genes in patterning the early hindgut.

  2. Iron Levels in Hepatocytes and Portal Tract Cells Predict Progression and Outcome of Patients with Advanced Chronic Hepatitis C1

    PubMed Central

    Lambrecht, Richard W.; Sterling, Richard K.; Naishadham, Deepa; Stoddard, Anne M.; Rogers, Thomas; Morishima, Chihiro; Morgan, Timothy R.; Bonkovsky, Herbert L.

    2011-01-01

    Background & Aims Iron might influence severity and progression of non-hemochromatotic liver diseases. We assessed the relationships between iron, variants in HFE, and progression and outcomes using data from the HALT-C Trial. We determined whether therapy with pegylated interferon (PegIFN) affects iron variables. Methods Participants were randomly assigned to groups given long-term therapy with PegIFN (n=400) or no therapy (n=413) for 3.5 y and followed for up to 8.7 y (median 6.0 y). Associations between patient characteristics and iron variables, at baseline and over time, were made using Kaplan-Meier analyses, Cox regression models, and repeated measures analysis of covariance. Iron was detected by Prussian blue staining. Results Patients with poor outcomes (increase in Child-Turcotte-Pugh score to ≥ 7, development of ascites, encephalopathy, variceal bleeding, spontaneous bacterial peritonitis, hepatocellular carcinoma, death) had significantly higher baseline scores for stainable iron in hepatocytes and cells in portal tracts than those without outcomes. Staining for iron in portal triads correlated with lobular and total Ishak inflammatory and fibrosis scores (P<0.0001). High baseline levels of iron in triads increased the risk for poor outcome (hazard ratio=1.35, P=0.02). Iron staining decreased in hepatocytes but increased in portal stromal cells over time (P<0.0001). Serum levels of iron and total iron binding capacity decreased significantly over time (P <0.0001), as did serum ferritin (P=0.0003). Long-term therapy with PegIFN did not affect levels of iron staining. Common variants in HFE did not correlate with outcomes, including development of hepatocellular carcinoma. Conclusions Degree of stainable iron in hepatocytes and portal tract cells predicts progression and clinical and histological outcomes of patients with advanced chronic hepatitis C. Long-term therapy with low-dose PegIFN did not improve outcomes or iron variables. PMID:21335007

  3. Gastrointestinal tract spindle cell lesions--just like real estate, it's all about location.

    PubMed

    Voltaggio, Lysandra; Montgomery, Elizabeth A

    2015-01-01

    Interpretation of gastrointestinal tract mesenchymal lesions is simplified merely by knowing in which anatomic layer they are usually found. For example, Kaposi sarcoma is detected on mucosal biopsies, whereas inflammatory fibroid polyp is nearly always in the submucosa. Gastrointestinal stromal tumors (GISTs) are generally centered in the muscularis propria. Schwannomas are essentially always in the muscularis propria. Mesenteric lesions are usually found in the small bowel mesentery. Knowledge of the favored layer is even most important in interpreting colon biopsies, as many mesenschymal polyps are encountered in the colon. Although GISTs are among the most common mesenchymal lesions, we will concentrate our discussion on other mesenchymal lesions, some of which are in the differential diagnosis of GIST, and point out some diagnostic pitfalls, particularly in immunolabeling.

  4. A Defective Interfering Influenza RNA Inhibits Infectious Influenza Virus Replication in Human Respiratory Tract Cells: A Potential New Human Antiviral

    PubMed Central

    Smith, Claire M.; Scott, Paul D.; O’Callaghan, Christopher; Easton, Andrew J.; Dimmock, Nigel J.

    2016-01-01

    Defective interfering (DI) viruses arise during the replication of influenza A virus and contain a non-infective version of the genome that is able to interfere with the production of infectious virus. In this study we hypothesise that a cloned DI influenza A virus RNA may prevent infection of human respiratory epithelial cells with infection by influenza A. The DI RNA (244/PR8) was derived by a natural deletion process from segment 1 of influenza A/PR/8/34 (H1N1); it comprises 395 nucleotides and is packaged in the DI virion in place of a full-length genome segment 1. Given intranasally, 244/PR8 DI virus protects mice and ferrets from clinical influenza caused by a number of different influenza A subtypes and interferes with production of infectious influenza A virus in cells in culture. However, evidence that DI influenza viruses are active in cells of the human respiratory tract is lacking. Here we show that 244/PR8 DI RNA is replicated by an influenza A challenge virus in human lung diploid fibroblasts, bronchial epithelial cells, and primary nasal basal cells, and that the yield of challenge virus is significantly reduced in a dose-dependent manner indicating that DI influenza virus has potential as a human antiviral. PMID:27556481

  5. A Defective Interfering Influenza RNA Inhibits Infectious Influenza Virus Replication in Human Respiratory Tract Cells: A Potential New Human Antiviral.

    PubMed

    Smith, Claire M; Scott, Paul D; O'Callaghan, Christopher; Easton, Andrew J; Dimmock, Nigel J

    2016-08-22

    Defective interfering (DI) viruses arise during the replication of influenza A virus and contain a non-infective version of the genome that is able to interfere with the production of infectious virus. In this study we hypothesise that a cloned DI influenza A virus RNA may prevent infection of human respiratory epithelial cells with infection by influenza A. The DI RNA (244/PR8) was derived by a natural deletion process from segment 1 of influenza A/PR/8/34 (H1N1); it comprises 395 nucleotides and is packaged in the DI virion in place of a full-length genome segment 1. Given intranasally, 244/PR8 DI virus protects mice and ferrets from clinical influenza caused by a number of different influenza A subtypes and interferes with production of infectious influenza A virus in cells in culture. However, evidence that DI influenza viruses are active in cells of the human respiratory tract is lacking. Here we show that 244/PR8 DI RNA is replicated by an influenza A challenge virus in human lung diploid fibroblasts, bronchial epithelial cells, and primary nasal basal cells, and that the yield of challenge virus is significantly reduced in a dose-dependent manner indicating that DI influenza virus has potential as a human antiviral.

  6. Tenofovir Inhibits Wound Healing of Epithelial Cells and Fibroblasts from the Upper and Lower Human Female Reproductive Tract

    PubMed Central

    Rodriguez-Garcia, Marta; Patel, Mickey V.; Shen, Zheng; Bodwell, Jack; Rossoll, Richard M.; Wira, Charles R.

    2017-01-01

    Disruption of the epithelium in the female reproductive tract (FRT) is hypothesized to increase HIV infection risk by interfering with barrier protection and facilitating HIV-target cell recruitment. Here we determined whether Tenofovir (TFV), used vaginally in HIV prevention trials, and Tenofovir alafenamide (TAF), an improved prodrug of TFV, interfere with wound healing in the human FRT. TFV treatment of primary epithelial cells and fibroblasts from the endometrium (EM), endocervix (CX) and ectocervix (ECX) significantly delayed wound closure. Reestablishment of tight junctions was compromised in EM and CX epithelial cells even after wound closure occurred. In contrast, TAF had no inhibitory effect on wound closure or tight junction formation following injury. TAF accumulated inside genital epithelial cells as TFV-DP, the active drug form. At elevated levels of TAF treatment to match TFV intracellular TFV-DP concentrations, both equally impaired barrier function, while wound closure was more sensitive to TFV. Furthermore, TFV but not TAF increased elafin and MIP3a secretion following injury, molecules known to be chemotactic for HIV-target cells. Our results highlight the need of evaluating antiretroviral effects on genital wound healing in future clinical trials. A possible link between delayed wound healing and increased risk of HIV acquisition deserves further investigation. PMID:28368028

  7. The distribution of mucous secreting cells in the gastrointestinal tracts of three small rodents from Saudi Arabia: Acomys dimidiatus, Meriones rex and Meriones libycus.

    PubMed

    Johnson, Olga; Marais, Sumine; Walters, Jacklynn; van der Merwe, Elizabeth L; Alagaili, Abdulaziz N; Mohammed, Osama B; Bennett, Nigel C; Kotzé, Sanet H

    2016-03-01

    The proportion of mucin phenotypes (which form the protective biofilm of the gastrointestinal tract) differs between intestinal regions. This study examines the distribution of mucin secreting cells in the gastrointestinal tracts of the Eastern spiny mouse (Acomys dimidiatus), King jird (Meriones rex) and Libyan jird (Meriones libycus), which inhabit the dry and hot deserts of Saudi Arabia. Intestinal tract samples were processed to wax and tissue sections stained with Alcian Blue-Periodic Acid Schiff (AB-PAS) and High Iron Diamine-Alcian Blue (HID-AB) in order to determine different mucin phenotypes by quantitative analysis. Mixed mucin secreting cells (combined neutral and acid) was the predominant mucin secreting cell type observed throughout the gastrointestinal tract in all species. Acid mucin secreting goblet cells were mainly located in the colon. A. dimidiatus presented with significantly more total sialo than sulfomucin secreting cells while the opposite was true for both Meriones species. The distribution of mucin secreting cells is therefore similar to previously reported results for small mammals not living under arid conditions.

  8. Approaches to Encapsulation of Flexible CIGS Cells

    SciTech Connect

    Olsen, Larry C.; Gross, Mark E.; Graff, Gordon L.; Kundu, Sambhu N.; Chu, Xi; Lin, Steve

    2008-07-16

    Thin-film solar cells based on CIGS are being considered for large scale power plants as well as building integrated photovoltaic (BIPV) applications. Past studies indicate that CIGS cells degrade rapidly when exposed to moisture. As a result, an effective approach to encapsulation is required for CIGS cells to satisfy the international standard IEC 61646. CIGS modules fabricated for use in large power plants can be encapsulated with glass sheets on the top and bottom surfaces and can be effectively sealed around the edges. In the case of BIPV applications, however, it is desirable to utilize CIGS cells grown on flexible substrates, both for purposes of achieving reduced weight and for cases involving non-flat surfaces. For these cases, approaches to encapsulation must be compatible with the flexible substrate requirement. Even in the case of large power plants, the glass-to-glass approach to encapsulation may eventually be considered too costly. We are investigating encapsulation of flexible CIGS cells by lamination. Sheets of PET or PEN coated with multilayer barrier coatings are used to laminate the flexible cells. Results are discussed for laminated cells from two CIGS manufacturers. In both cases, the cell efficiency decreases less than 10% after 1000 hours of exposure to an environment of 85C/85%RH. This paper discusses these two approaches, reviews results achieved with cells and mini-modules fabricated by the former Shell Solar, Industries (SSI) stressed at 60C/90%RH (60/90), and recent studies of encapsulated IEC cells subjected to an environment of 85ºC/85%RH (85/85).

  9. Mammalian Cell-Derived Respiratory Syncytial Virus-Like Particles Protect the Lower as well as the Upper Respiratory Tract.

    PubMed

    Walpita, Pramila; Johns, Lisa M; Tandon, Ravi; Moore, Martin L

    2015-01-01

    Globally, Respiratory Syncytial Virus (RSV) is a leading cause of bronchiolitis and pneumonia in children less than one year of age and in USA alone, between 85,000 and 144,000 infants are hospitalized every year. To date, there is no licensed vaccine. We have evaluated vaccine potential of mammalian cell-derived native RSV virus-like particles (RSV VLPs) composed of the two surface glycoproteins G and F, and the matrix protein M. Results of in vitro testing showed that the VLPs were functionally assembled and immunoreactive, and that the recombinantly expressed F protein was cleaved intracellularly similarly to the virus-synthesized F protein to produce the F1 and F2 subunits; the presence of the F1 fragment is critical for vaccine development since all the neutralizing epitopes present in the F protein are embedded in this fragment. Additional in vitro testing in human macrophage cell line THP-1 showed that both virus and the VLPs were sensed by TLR-4 and induced a Th1-biased cytokine response. Cotton rats vaccinated with RSV VLPs adjuvanted with alum and monophosphoryl lipid A induced potent neutralizing antibody response, and conferred protection in the lower as well as the upper respiratory tract based on substantial virus clearance from these sites. To the best of our knowledge, this is the first VLP/virosome vaccine study reporting protection of the lower as well as the upper respiratory tract: Prevention from replication in the nose is an important consideration if the target population is infants < 6 months of age. This is because continued virus replication in the nose results in nasal congestion and babies at this age are obligate nose breathers. In conclusion, these results taken together suggest that our VLPs show promise to be a safe and effective vaccine for RSV.

  10. The effects of endothelial cells-preserving technique on microsurgical vascular reconstruction in biliary tract malignancy: report of twenty cases.

    PubMed

    Miyagi, Shigehito; Nakanishi, Wataru; Kawagishi, Naoki; Yoshida, Hiroshi; Unno, Michiaki; Ohuchi, Noriaki

    2014-01-01

    We describe our experience of resectional surgery with microsurgical reconstruction of the hepatic arteries in 20 cases with biliary tract malignancy. Hepatic artery thrombosis (HAT) is a lethal complication; therefore, it is important to perform microsurgical reconstruction safely. Recently, we adopted the back wall support suture technique with double needle sutures that does not require the damaged short arteries to be turned over. In this technique, each stitch is placed from the inner side to the outer side to keep endothelial cells. The purpose of this study was to develop safety methods. From 2003 to 2012, 20 patients with biliary tract malignancy with possible involvement of the hepatic arteries underwent resectional surgery with microvascular reconstruction (cholangiocarcinoma: n = 15; others: n = 5). For this cohort study, patients were divided into two groups: group I (n = 5) included patients who underwent the conventional 'twist technique' and group II (n = 15) included patients who underwent the microsurgical back wall support suture technique with double needle sutures and received gabexate mesilate, a strong serine protease inhibitor (40 mg/kg/day) for 7 days. We investigated HAT using Doppler ultrasonography for 10 days. No postoperative mortality was observed. The incidence of HAT was only one case in group I, and there was no significant difference between the two groups. However, the value of the pulsatile index and acceleration time were significantly improved in group II. In conclusion, the back wall support suture technique with gabexate mesilate administration during microvascular reconstruction was found to be safe. It is important to keep endothelial cells healthy for microvascular reconstruction.

  11. The Effects of Endothelial Cells-Preserving Technique on Microsurgical Vascular Reconstruction in Biliary Tract Malignancy: Report of Twenty Cases

    PubMed Central

    Miyagi, Shigehito; Nakanishi, Wataru; Kawagishi, Naoki; Yoshida, Hiroshi; Unno, Michiaki; Ohuchi, Noriaki

    2014-01-01

    We describe our experience of resectional surgery with microsurgical reconstruction of the hepatic arteries in 20 cases with biliary tract malignancy. Hepatic artery thrombosis (HAT) is a lethal complication; therefore, it is important to perform microsurgical reconstruction safely. Recently, we adopted the back wall support suture technique with double needle sutures that does not require the damaged short arteries to be turned over. In this technique, each stitch is placed from the inner side to the outer side to keep endothelial cells. The purpose of this study was to develop safety methods. From 2003 to 2012, 20 patients with biliary tract malignancy with possible involvement of the hepatic arteries underwent resectional surgery with microvascular reconstruction (cholangiocarcinoma: n = 15; others: n = 5). For this cohort study, patients were divided into two groups: group I (n = 5) included patients who underwent the conventional ‘twist technique’ and group II (n = 15) included patients who underwent the microsurgical back wall support suture technique with double needle sutures and received gabexate mesilate, a strong serine protease inhibitor (40 mg/kg/day) for 7 days. We investigated HAT using Doppler ultrasonography for 10 days. No postoperative mortality was observed. The incidence of HAT was only one case in group I, and there was no significant difference between the two groups. However, the value of the pulsatile index and acceleration time were significantly improved in group II. In conclusion, the back wall support suture technique with gabexate mesilate administration during microvascular reconstruction was found to be safe. It is important to keep endothelial cells healthy for microvascular reconstruction. PMID:24574945

  12. Phenylethyl isothiocyanate reverses cisplatin resistance in biliary tract cancer cells via glutathionylation-dependent degradation of Mcl-1.

    PubMed

    Li, Qiwei; Zhan, Ming; Chen, Wei; Zhao, Benpeng; Yang, Kai; Yang, Jie; Yi, Jing; Huang, Qihong; Mohan, Man; Hou, Zhaoyuan; Wang, Jian

    2016-03-01

    Biliary tract cancer (BTC) is a highly malignant cancer. BTC exhibits a low response rate to cisplatin (CDDP) treatment, and therefore, an understanding of the mechanism of CDDP resistance is urgently needed. Here, we show that BTC cells develop CDDP resistance due, in part, to upregulation of myeloid cell leukemia 1 (Mcl-1). Phenylethyl isothiocyanate (PEITC), a natural compound found in watercress, could enhance the efficacy of CDDP by degrading Mcl-1. PEITC-CDDP co-treatment also increased the rate of apoptosis of cancer stem-like side population (SP) cells and inhibited xenograft tumor growth without obvious toxic effects. In vitro, PEITC decreased reduced glutathione (GSH), which resulted in decreased GSH/oxidized glutathione (GSSG) ratio and increased glutathionylation of Mcl-1, leading to rapid proteasomal degradation of Mcl-1. Furthermore, we identified Cys16 and Cys286 as Mcl-1 glutathionylation sites, and mutating them resulted in PEITC-mediated degradation resistant Mcl-1 protein. In conclusion, we demonstrate for the first time that CDDP resistance is partially associated with Mcl-1 in BTC cells and we identify a novel mechanism that PEITC can enhance CDDP-induced apoptosis via glutathionylation-dependent degradation of Mcl-1. Hence, our results provide support that dietary intake of watercress may help reverse CDDP resistance in BTC patients.

  13. Phenylethyl isothiocyanate reverses cisplatin resistance in biliary tract cancer cells via glutathionylation-dependent degradation of Mcl-1

    PubMed Central

    Li, Qiwei; Zhan, Ming; Chen, Wei; Zhao, Benpeng; Yang, Kai; Yang, Jie; Yi, Jing; Huang, Qihong; Mohan, Man; Hou, Zhaoyuan; Wang, Jian

    2016-01-01

    Biliary tract cancer (BTC) is a highly malignant cancer. BTC exhibits a low response rate to cisplatin (CDDP) treatment, and therefore, an understanding of the mechanism of CDDP resistance is urgently needed. Here, we show that BTC cells develop CDDP resistance due, in part, to upregulation of myeloid cell leukemia 1 (Mcl-1). Phenylethyl isothiocyanate (PEITC), a natural compound found in watercress, could enhance the efficacy of CDDP by degrading Mcl-1. PEITC-CDDP co-treatment also increased the rate of apoptosis of cancer stem-like side population (SP) cells and inhibited xenograft tumor growth without obvious toxic effects. In vitro, PEITC decreased reduced glutathione (GSH), which resulted in decreased GSH/oxidized glutathione (GSSG) ratio and increased glutathionylation of Mcl-1, leading to rapid proteasomal degradation of Mcl-1. Furthermore, we identified Cys16 and Cys286 as Mcl-1 glutathionylation sites, and mutating them resulted in PEITC-mediated degradation resistant Mcl-1 protein. In conclusion, we demonstrate for the first time that CDDP resistance is partially associated with Mcl-1 in BTC cells and we identify a novel mechanism that PEITC can enhance CDDP-induced apoptosis via glutathionylation-dependent degradation of Mcl-1. Hence, our results provide support that dietary intake of watercress may help reverse CDDP resistance in BTC patients. PMID:26848531

  14. Primary human epithelial cell culture system for studying interactions between female upper genital tract and sexually transmitted viruses, HSV-2 and HIV-1.

    PubMed

    Kaushic, Charu; Nazli, Aisha; Ferreira, Victor H; Kafka, Jessica K

    2011-10-01

    Evidence from clinical and epidemiological studies indicates that women are disproportionately susceptible to sexually transmitted viral infections. To understand the underlying biological basis for this increased susceptibility, more studies are needed to examine the acute events in the female reproductive tract following exposure to viruses during sexual transmission. The epithelial lining of the female reproductive tract is the primary barrier that sexually transmitted viruses, such as HIV-1 and HSV-2 need to infect or traverse, in order to initiate and establish productive infection. We have established an ex-vivo primary culture system to grow genital epithelial cells from upper reproductive tract tissues of women. Using these cultures, we have extensively examined the interactions between epithelial cells of the female genital tract and HSV-2 and HIV-1. In this review, we describe in detail the experimental protocol to grow these cultures, monitor their differentiation and inoculate with HSV-2 and HIV-1. Prospective use of these cultures to re-create the microenvironment in the reproductive tract is discussed.

  15. Superficial leiomyomas of the gastrointestinal tract with interstitial cells of Cajal

    PubMed Central

    Janevska, Vesna; Qerimi, Adelina; Basheska, Neli; Stojkova, Elena; Janevski, Vlado; Jovanovic, Rubens; Zhivadinovik, Julija; Spasevska, Liljana

    2015-01-01

    Objective: Some authors suggest common origin of gastrointestinal stromal tumors from stem cells, which may show diverse differentiation. There are reports in which cells morphologically identical to the interstitial cells of Cajal are found in deep leiomyomas. The aim of this study was to demonstrate CD117 positive cells in superficial gastrointestinal (GI) leiomyomas and to find other cells that would suggest diverse differentiation in histologically typical leiomyoma. Materials and methods: We analyzed 8 cases of superficial leiomyomas and one deep leiomyoma, received in our institutions as endoscopically or surgically obtained material. The tumor sections were immunohistochemicaly stained with CD117, CD34, NF, S100, αSMA, desmin, caldesmon and mast cell antigen. Results: All leiomyomas showed diffuse positivity for αSMA, caldesmon and desmin. All of them had CD117 and CD34 positive cells morphologically identical to the interstitial cells of Cajal between smooth muscle fibers, 5 had S-100 and NF positive cells and 2 showed positivity for GFAP. The cells were found in different quantity; they were usually diffusely scattered through the tumors without predilection site, forming small groups in some areas. Conclusion: CD177, CD34, S-100 and NF positive cells are present in superficial leiomyomas and they may suggest common origin of GI stromal tumors. PMID:26884872

  16. Polypyrimidine tract-binding protein induces p19(Ink4d) expression and inhibits the proliferation of H1299 cells.

    PubMed

    Lin, Shankung; Wang, Ming Jen; Tseng, Kuo-Yun

    2013-01-01

    The expression of polypyrimidine tract-binding protein (PTB) is up-regulated in many types of cancer. Here, we studied the role of PTB in the growth of non small cell lung cancer cells. Data showed that PTB overexpression inhibited the growth of H1299 cells at least by inhibiting DNA synthesis. Quantitative real-time PCR and Western blot analyses showed that PTB overexpression in H1299 cells specifically induced the expression of p19(Ink4d), an inhibitor of cyclin-dependent kinase 4. Repression of p19(Ink4d) expression partially rescued PTB-caused proliferation inhibition. PTB overexpression also inhibited the growth and induced the expression of p19(Ink4d) mRNA in A549 cells. However, Western blot analyses failed to detect the presence of p19(Ink4d) protein in A549 cells. To address how PTB induced p19(Ink4d) in H1299 cells, we showed that PTB might up-regulate the activity of p19(Ink4d) gene (CDKN2D) promoter. Besides, PTB lacking the RNA recognition motif 3 (RRM3) was less effective in growth inhibition and p19(Ink4d) induction, suggesting that RNA-binding activity of PTB plays an important role in p19(Ink4d) induction. However, immunoprecipitation of ribonuclearprotein complexes plus quantitative real-time PCR analyses showed that PTB might not bind p19(Ink4d) mRNA, suggesting that PTB overexpression might trigger the other RNA-binding protein(s) to bind p19(Ink4d) mRNA. Subsequently, RNA electrophoretic mobility-shift assays revealed a 300-base segment (designated as B2) within the 3'UTR of p19(Ink4d) mRNA, with which the cytoplasmic lysates of PTB-overexpressing cells formed more prominent complexes than did control cell lysates. Insertion of B2 into a reporter construct increased the expression of the chimeric luciferase transcripts in transfected PTB-overexpressing cells but not in control cells; conversely, overexpression of B2-containing reporter construct in PTB-overexpressing cells abolished the induction of p19(Ink4d) mRNA. In sum, we have shown that

  17. Prickle1 mutation causes planar cell polarity and directional cell migration defects associated with cardiac outflow tract anomalies and other structural birth defects

    PubMed Central

    Gibbs, Brian C.; Damerla, Rama Rao; Vladar, Eszter K.; Chatterjee, Bishwanath; Wan, Yong; Liu, Xiaoqin; Cui, Cheng; Gabriel, George C.; Zahid, Maliha; Yagi, Hisato; Szabo-Rogers, Heather L.; Suyama, Kaye L.; Axelrod, Jeffrey D.; Lo, Cecilia W.

    2016-01-01

    ABSTRACT Planar cell polarity (PCP) is controlled by a conserved pathway that regulates directional cell behavior. Here, we show that mutant mice harboring a newly described mutation termed Beetlejuice (Bj) in Prickle1 (Pk1), a PCP component, exhibit developmental phenotypes involving cell polarity defects, including skeletal, cochlear and congenital cardiac anomalies. Bj mutants die neonatally with cardiac outflow tract (OFT) malalignment. This is associated with OFT shortening due to loss of polarized cell orientation and failure of second heart field cell intercalation mediating OFT lengthening. OFT myocardialization was disrupted with cardiomyocytes failing to align with the direction of cell invasion into the outflow cushions. The expression of genes mediating Wnt signaling was altered. Also noted were shortened but widened bile ducts and disruption in canonical Wnt signaling. Using an in vitro wound closure assay, we showed Bj mutant fibroblasts cannot establish polarized cell morphology or engage in directional cell migration, and their actin cytoskeleton failed to align with the direction of wound closure. Unexpectedly, Pk1 mutants exhibited primary and motile cilia defects. Given Bj mutant phenotypes are reminiscent of ciliopathies, these findings suggest Pk1 may also regulate ciliogenesis. Together these findings show Pk1 plays an essential role in regulating cell polarity and directional cell migration during development. PMID:26883626

  18. Prickle1 mutation causes planar cell polarity and directional cell migration defects associated with cardiac outflow tract anomalies and other structural birth defects.

    PubMed

    Gibbs, Brian C; Damerla, Rama Rao; Vladar, Eszter K; Chatterjee, Bishwanath; Wan, Yong; Liu, Xiaoqin; Cui, Cheng; Gabriel, George C; Zahid, Maliha; Yagi, Hisato; Szabo-Rogers, Heather L; Suyama, Kaye L; Axelrod, Jeffrey D; Lo, Cecilia W

    2016-02-16

    Planar cell polarity (PCP) is controlled by a conserved pathway that regulates directional cell behavior. Here, we show that mutant mice harboring a newly described mutation termed Beetlejuice (Bj) in Prickle1 (Pk1), a PCP component, exhibit developmental phenotypes involving cell polarity defects, including skeletal, cochlear and congenital cardiac anomalies. Bj mutants die neonatally with cardiac outflow tract (OFT) malalignment. This is associated with OFT shortening due to loss of polarized cell orientation and failure of second heart field cell intercalation mediating OFT lengthening. OFT myocardialization was disrupted with cardiomyocytes failing to align with the direction of cell invasion into the outflow cushions. The expression of genes mediating Wnt signaling was altered. Also noted were shortened but widened bile ducts and disruption in canonical Wnt signaling. Using an in vitro wound closure assay, we showed Bj mutant fibroblasts cannot establish polarized cell morphology or engage in directional cell migration, and their actin cytoskeleton failed to align with the direction of wound closure. Unexpectedly, Pk1 mutants exhibited primary and motile cilia defects. Given Bj mutant phenotypes are reminiscent of ciliopathies, these findings suggest Pk1 may also regulate ciliogenesis. Together these findings show Pk1 plays an essential role in regulating cell polarity and directional cell migration during development.

  19. Distribution and ultrastructural characteristics of dark cells in squamous metaplasias of the respiratory tract epithelium. [Rats

    SciTech Connect

    Klein-Szanto, A.J.P.; Nettesheim, P.; Pine, A.; Martin, D.

    1981-05-01

    Dark epithelial basal cells were found in both carcinogen-induced and non-carcinogen-induced squamous metaplasias of the tracheal epithelium. Formaldehyde-induced squamous metaplasias exhibited 4% dark cells in the basal layer. Metaplasias induced by vitamin A deficiency and those induced by dimethylbenz(a)anthracene (DMBA) without atypia showed 18-20% basal dark cells. DMBA-induced metaplasias with moderate to severe atypia exhibited 50% basal dark cells. The labeling index of basal cells in metaplastic epithelia, regardless of the inducing agent, was 16-18%, ie, the same as that of the normal esophageal stratified squamous epithelium. The percentage of labeled dark basal cells per total dark cell population was approximately 19% in the non-carcinogen-induced metaplasias and in the DMBA-induced metaplasias without atypia. In the atypical metaplasias induced by DMA this percentage increased to 26. On the basis of ultrastructural observations, five types of dark epithelial cells could be distinguished in the metaplastic epithelia. Each type of squamous metaplasia could thus be recognized by a determined numerical distribution of dark cells in the basal layer and a specific pattern of distribution of the ultrastructurally defined dark cell categories.

  20. A role for stem cell factor (SCF): c-kit interaction(s) in the intestinal tract response to Salmonella typhimurium infection

    PubMed Central

    1996-01-01

    Cholera toxin (CT) has been shown to induce stem cell factor (SCF) production in mouse ligated intestinal loops. Further, SCF interaction(s) with its receptor (c-kit) was shown to be important for the intestinal tract secretory response after CT exposure. In this study, we have investigated whether SCF production is induced in the intestinal tract after exposure to Salmonella typhimurium and whether this production could be an important intestinal tract response to Salmonella infection. Using a mouse ligated intestinal loop model, increased levels of SCF mRNA were detected at 2-4 h post-Salmonella challenge. Intestinal fluid obtained from Salmonella-challenged loops contained high levels of SCF by ELISA. Human and murine intestinal epithelial cell lines were also shown to have increased levels of SCF mRNA after exposure to Salmonella. Inhibition of Salmonella invasion of epithelial cells was shown to be one potentially important role for SCF:c-kit interactions in host defense to Salmonella infection. Pretreatment of human or murine intestinal cell lines with SCF resulted in a cellular state that was resistant to Salmonella invasion. Finally, mice having mutations in the white spotting (W) locus, which encodes the SCF-receptor (c-kit), were significantly more susceptible to oral Salmonella challenge than their control littermates. Taken together, the above results suggest that an important intestinal tract response to Salmonella infection is an enhanced production of SCF and its subsequent interactions with c-kit. PMID:8691142

  1. The antibody approach of labeling blood cells

    SciTech Connect

    Srivastava, S.C.

    1992-12-31

    Although the science of blood cell labeling using monoclonal antibodies directed against specific cellular antigens is still in its early stages, considerable progress has recently been accomplished in this area. The monoclonal antibody approach offers the promise of greater selectivity and enhanced convenience since specific cell types can be labeled in vivo, thus eliminating the need for complex and damaging cell separation procedures. This article focuses on these developments with primary emphasis on antibody labeling of platelets and leukocytes. The advantages and the shortcomings of the recently reported techniques are critically assessed and evaluated.

  2. The antibody approach of labeling blood cells

    SciTech Connect

    Srivastava, S.C.

    1991-12-31

    Although the science of blood cell labeling using monoclonal antibodies directed against specific cellular antigens is still in its early stages, considerable progress has recently been accomplished in this area. The monoclonal antibody approach offers the promise of greater selectivity and enhanced convenience since specific cell types can be labeled in vivo, thus eliminating the need for complex and damaging cell separation procedures. This article focuses on these developments with primary emphasis on antibody labeling of platelets and leukocytes. The advantages and the shortcomings of the recently reported techniques are criticality assessed and evaluated.

  3. The antibody approach of labeling blood cells

    SciTech Connect

    Srivastava, S.C.

    1991-01-01

    Although the science of blood cell labeling using monoclonal antibodies directed against specific cellular antigens is still in its early stages, considerable progress has recently been accomplished in this area. The monoclonal antibody approach offers the promise of greater selectivity and enhanced convenience since specific cell types can be labeled in vivo, thus eliminating the need for complex and damaging cell separation procedures. This article focuses on these developments with primary emphasis on antibody labeling of platelets and leukocytes. The advantages and the shortcomings of the recently reported techniques are criticality assessed and evaluated.

  4. Non-canonical Wnt signaling regulates cell polarity in female reproductive tract development via van gogh-like 2

    PubMed Central

    vandenBerg, Alysia L.; Sassoon, David A.

    2009-01-01

    Summary Wnt signaling effectors direct the development and adult remodeling of the female reproductive tract (FRT); however, the role of non-canonical Wnt signaling has not been explored in this tissue. The non-canonical Wnt signaling protein van gogh-like 2 is mutated in loop-tail (Lp) mutant mice (Vangl2Lp), which display defects in multiple tissues. We find that Vangl2Lp mutant uterine epithelium displays altered cell polarity, concommitant with changes in cytoskeletal actin and scribble (scribbled, Scrb1) localization. The postnatal mutant phenotype is an exacerbation of that seen at birth, exhibiting more smooth muscle and reduced stromal mesenchyme. These data suggest that early changes in cell polarity have lasting consequences for FRT development. Furthermore, Vangl2 is required to restrict Scrb1 protein to the basolateral epithelial membrane in the neonatal uterus, and an accumulation of fibrillar-like structures observed by electron microscopy in Vangl2Lp mutant epithelium suggests that mislocalization of Scrb1 in mutants alters the composition of the apical face of the epithelium. Heterozygous and homozygous Vangl2Lp mutant postnatal tissues exhibit similar phenotypes and polarity defects and display a 50% reduction in Wnt7a levels, suggesting that the Vangl2Lp mutation acts dominantly in the FRT. These studies demonstrate that the establishment and maintenance of cell polarity through non-canonical Wnt signaling are required for FRT development. PMID:19363157

  5. Biological effects of diesel exhaust particles (DEP) on tissues and cells isolated from respiratory tracts of guinea pigs.

    PubMed

    Hirafuji, M; Sakakibara, M; Endo, T; Murakami, S; Mori, Y; Sagai, M; Minami, M

    1995-11-01

    Diesel engine-powered vehicles emit some 30 to 100 times more particles than do gasoline engine cars. We previously reported that diesel exhaust particles (DEP) instilled intratracheally into mouse caused lung edema accompanying endothelial cell damage. In order to clarify further the biological effects of DEP on the respiratory system, the primary target of DEP instillation, we examined the direct action of DEP on isolated tissues and the cytotoxicity of DEP on cultured cells of respiratory tracts in guinea pigs. DEP were collected on glass fiber filters from a light-duty (2730 cc), four cylinder diesel engine. DEP induced a dose-dependent relaxation in tracheal smooth muscle and lung parenchymal preparations from guinea pigs. Neither propranolol nor ranitidine inhibited the relaxing effect of DEP on tracheal preparations. DEP also exhibited concentration- and time-dependent cytotoxicity on cultured tracheal smooth muscle cells and lung fibroblasts from guinea pigs, as assessed by specific [51Cr] release. These cytotoxicities induced by DEP were significantly inhibited by catalase, deferoxamine and MK-447, whereas SOD and mannitol had little effect. These inhibitory effects were blunted by the higher concentration of DEP. These results suggest that the cytotoxicity of DEP may cause dysfunction of respiratory tissues, which are mediated via oxygen radicals, probably hydroxyl radicals or hydrogen peroxides.

  6. Development of a gastrointestinal tract microscale cell culture analog to predict drug transport

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Microscale cell culture analogs (uCCAs) are used to study the metabolism and toxicity of a chemical or drug. These in vitro devices are physical replicas of physiologically based pharmacokinetic models that combine microfabrication and cell culture. The goal of this project is to add an independent ...

  7. Association of perceived neighborhood problems and census tract income with poor self-rated health in adults: a multilevel approach.

    PubMed

    Höfelmann, Doroteia Aparecida; Diez Roux, Ana V; Antunes, José Leopoldo Ferreira; Peres, Marco Aurélio

    2015-11-01

    Neighborhood problems constitute sources of chronic stress that may increase the risk of poor self-rated health. The associations of census tract level income and perceived neighborhood problems with self-rated health were examined in Florianópolis, Santa Catarina State, Brazil (1,720 adults). Odds ratios (OR) and their 95% confidence intervals (95%CI) of poor self-rated health were estimated through multilevel models. Residents in census tracts in the lower and intermediate tertiles of income reported poorer health than those in the highest tertile. OR of reporting poorer health was 2.44 (95%CI: 2.35- 2.54) in the higher tertile of social disorder (adjusting for mental health). The chances of reporting the poorer health with neighborhood problems ranged from 1.07 (95%CI: 1.03-1.11) to 2.02 (95%CI: 1.95-2.10) for the higher tertile of social disorder (physical health) and physical problem (health-related variables). Perceived neighborhood problems were independently associated with poor health. The perception of a neighborhood among its residents should be considered by health policymakers.

  8. [Influence of human gastrointestinal tract bacterial pathogens on host cell apoptosis].

    PubMed

    Wronowska, Weronika; Godlewska, Renata; Jagusztyn-Krynicka, Elzbieta Katarzyna

    2005-01-01

    Several pathogenic bacteria are able to trigger apoptosis in the host cell, but the mechanisms by which it occurs differ, and the resulting pathology can take different courses. Induction and/or blockage of programmed cell death upon infection is a result of complex interaction of bacterial proteins with cellular proteins involved in signal transduction and apoptosis. In this review we focus on pro/anti-apoptotic activities exhibited by two enteric pathogens Salmonella enterica, Yersinia spp. and gastric pathogen Helicobacter pylori. We present current knowledge on how interaction between mammalian and bacterial cell relates to the molecular pathways of apoptosis, and what is the role of apoptosis in pathogenesis.

  9. Impact of cell regeneration in human respiratory tract on simultaneous viral infections

    NASA Astrophysics Data System (ADS)

    Pinky, Lubna Jahan Rashid; Dobrovolny, Hana

    2015-03-01

    Studies have found that ~ 40% of patients hospitalized with influenza-like illness are infected with at least two different viruses. In these longer infections, we need to consider the role of cell regeneration. Several mathematical models have been used to describe cell regeneration in infection models, though the effect of model choice on the predicted time course of simultaneous viral infections is not clear. We investigate a series of mathematical models of cell regeneration during simultaneous respiratory virus infections to determine the effect of cell regeneration on infection dynamics. We perform a nonlinear stability analysis for each model. The analysis suggests that coexistence of two viral species is not possible for any form of regeneration. We find that chronic illness is possible, but with only one viral species.

  10. [Recommendation for guidelines in the treatment of squamous cell cancer of the upper aerodigestive tract].

    PubMed

    Burian, Martin

    2008-01-01

    If we look at the historical development of the treatment of head and neck cancer, we can see that initially, decisions about therapy lay solely in the hands of the surgeons (Otorhinolaryngologists, oral and maxilla-facial surgeons) This was also true of the decision as to whether an operation was feasible or whether primary radio therapy was to be carried out. At the end of the last century, after chemotherapy had become an integral part of curative therapy, inter-disciplinary conferences (tumour boards) were set up so that the surgeons could make joint decisions about therapy together with radio oncologists and medical oncologists. In addition, the increasingly important role of chemotherapy in curative therapy in the last fifteen years has led to a marked increase in the number of clinical studies in head and neck cancer. Inter-disciplinary treatment decisions can be based only on current scientific knowledge and are geared towards a standard treatment as recommended for an individual tumour stage. It is precisely in the upper aerodigestive tract that there are various therapeutical procedures, due to the different site of primaries (oral cavity, oro-, hypoparynx and larynx) and the different grade of locoregional metastasis. One possible way to assure a high degree of transparency of these various therapies and making them available to a high number of colleagues is the development guidelines [1]. Many medical associations and organisations in Austria are currently engaged in the formulation and definition of guidelines, in order to provide the highest possible quality of medical treatment and care for each individual patient. By guidelines are meant recommendations for treatments which allow a certain amount of flexibility in the treatment and provide a medical consensus in line with current scientific knowledge. In principle, they are binding, but in exceptional but reasonable cases, they may (and even must) be departed from. The following proposal is

  11. Characterization of the Molecular Interplay between Moraxella catarrhalis and Human Respiratory Tract Epithelial Cells

    PubMed Central

    de Vries, Stefan P. W.; Eleveld, Marc J.; Hermans, Peter W. M.; Bootsma, Hester J.

    2013-01-01

    Moraxella catarrhalis is a mucosal pathogen that causes childhood otitis media and exacerbations of chronic obstructive pulmonary disease in adults. During the course of infection, M. catarrhalis needs to adhere to epithelial cells of different host niches such as the nasopharynx and lungs, and consequently, efficient adhesion to epithelial cells is considered an important virulence trait of M. catarrhalis. By using Tn-seq, a genome-wide negative selection screenings technology, we identified 15 genes potentially required for adherence of M. catarrhalis BBH18 to pharyngeal epithelial Detroit 562 and lung epithelial A549 cells. Validation with directed deletion mutants confirmed the importance of aroA (3-phosphoshikimate 1-carboxyvinyl-transferase), ecnAB (entericidin EcnAB), lgt1 (glucosyltransferase), and MCR_1483 (outer membrane lipoprotein) for cellular adherence, with ΔMCR_1483 being most severely attenuated in adherence to both cell lines. Expression profiling of M. catarrhalis BBH18 during adherence to Detroit 562 cells showed increased expression of 34 genes in cell-attached versus planktonic bacteria, among which ABC transporters for molybdate and sulfate, while reduced expression of 16 genes was observed. Notably, neither the newly identified genes affecting adhesion nor known adhesion genes were differentially expressed during adhesion, but appeared to be constitutively expressed at a high level. Profiling of the transcriptional response of Detroit 562 cells upon adherence of M. catarrhalis BBH18 showed induction of a panel of pro-inflammatory genes as well as genes involved in the prevention of damage of the epithelial barrier. In conclusion, this study provides new insight into the molecular interplay between M. catarrhalis and host epithelial cells during the process of adherence. PMID:23936538

  12. Combined small cell carcinoma of the sinonasal tract associated with syndrome of inappropriate secretion of antidiuretic hormone: A case report.

    PubMed

    Kayakabe, Mikiko; Takahashi, Katsumasa; Okamiya, Tomofumi; Segawa, Atsuki; Oyama, Tetsunari; Chikamatsu, Kazuaki

    2014-04-01

    Combined small cell carcinoma (SmCC) and squamous cell carcinoma (SqCC) is a rare malignant neoplasm in the head and neck. This study presents the first reported case of combined SmCC and SqCC originating from the sinonasal tract accompanied by syndrome of inappropriate secretion of antidiuretic hormone (SIADH). An 80-year-old female presented with a four-week history of right nasal discharge, nasal obstruction and left neck swelling. Imaging studies revealed a tumorous lesion in the maxillary sinus encroaching upon the right nasal cavity and left cervical lymph node (LN) swelling. An incisional biopsy carried out from the right maxillary sinus and LNs resulted in a diagnosis of combined SmCC with SqCC, staged as T4aN2cM0. Clinical examination revealed a sustained increase of antidiuretic hormone, hyponatremia with urinary sodium increase, and serum hypo-osmosis, resulting in SIADH. Water restriction to <1,000 ml/day was effective in improving sodium and osmotic imbalance. Curative treatment for the tumor was not prescribed due to the poor condition of the patient. Palliative treatment was administered and the patient succumbed to cachexia five months after histological diagnosis. The presence of SIADH may have marked implications for the treatment and prognosis of this disease.

  13. The Role of Cell Surface Architecture of Lactobacilli in Host-Microbe Interactions in the Gastrointestinal Tract

    PubMed Central

    Altermann, Eric; Anderson, Rachel C.; McNabb, Warren C.; Moughan, Paul J.; Roy, Nicole C.

    2013-01-01

    Lactobacillus species can exert health promoting effects in the gastrointestinal tract (GIT) through many mechanisms, which include pathogen inhibition, maintenance of microbial balance, immunomodulation, and enhancement of the epithelial barrier function. Different species of the genus Lactobacillus can evoke different responses in the host, and not all strains of the same species can be considered beneficial. Strain variations may be related to diversity of the cell surface architecture of lactobacilli and the bacteria's ability to express certain surface components or secrete specific compounds in response to the host environment. Lactobacilli are known to modify their surface structures in response to stress factors such as bile and low pH, and these adaptations may help their survival in the face of harsh environmental conditions encountered in the GIT. In recent years, multiple cell surface-associated molecules have been implicated in the adherence of lactobacilli to the GIT lining, immunomodulation, and protective effects on intestinal epithelial barrier function. Identification of the relevant bacterial ligands and their host receptors is imperative for a better understanding of the mechanisms through which lactobacilli exert their beneficial effects on human health. PMID:23576850

  14. Recruitment of phagocytizing cells into the respiratory tract as a response to the cytotoxic action of deposited particles

    SciTech Connect

    Katsnelson, B.A.; Privalova, L.I.

    1984-01-01

    Recruitment of phagocytizing cells into the lower respiratory tract plays a very important role in the pulmonary dust clearance, depending both on the number of particles deposited therein and on their aggressiveness. The higher cytotoxicity of the particles, the greater the number of such cells recruited and the higher the contribution of the neutrophilic leukocytes (NL) into the free cellular population of airways which normally is represented chiefly by alveolar macrophages (AM). Adaptation of the alveolar dust phagocytosis to properties of inhaled particles operates through autoregulation of this process in which a key role is played by macrophage breakdown products (PMB). A series of experiments in vitro and in vivo showed that PMB stimulate AM and NL, enhance their recruitment into airways with a dose-dependent increase of the NL/AM ratio, promote recruitment of their precursors via blood and replenishment of such precursor reserves. The most active factor of the PMB appears to be lipidic by nature. The variability between individuals and between groups of alveolar phagocytosis response to particles of a given cytotoxicity may be due to differences of the host's neurohormonal status. It was shown that influencing the latter significantly shifts response to a standard dose of the PMB.

  15. Combined small cell carcinoma of the sinonasal tract associated with syndrome of inappropriate secretion of antidiuretic hormone: A case report

    PubMed Central

    KAYAKABE, MIKIKO; TAKAHASHI, KATSUMASA; OKAMIYA, TOMOFUMI; SEGAWA, ATSUKI; OYAMA, TETSUNARI; CHIKAMATSU, KAZUAKI

    2014-01-01

    Combined small cell carcinoma (SmCC) and squamous cell carcinoma (SqCC) is a rare malignant neoplasm in the head and neck. This study presents the first reported case of combined SmCC and SqCC originating from the sinonasal tract accompanied by syndrome of inappropriate secretion of antidiuretic hormone (SIADH). An 80-year-old female presented with a four-week history of right nasal discharge, nasal obstruction and left neck swelling. Imaging studies revealed a tumorous lesion in the maxillary sinus encroaching upon the right nasal cavity and left cervical lymph node (LN) swelling. An incisional biopsy carried out from the right maxillary sinus and LNs resulted in a diagnosis of combined SmCC with SqCC, staged as T4aN2cM0. Clinical examination revealed a sustained increase of antidiuretic hormone, hyponatremia with urinary sodium increase, and serum hypo-osmosis, resulting in SIADH. Water restriction to <1,000 ml/day was effective in improving sodium and osmotic imbalance. Curative treatment for the tumor was not prescribed due to the poor condition of the patient. Palliative treatment was administered and the patient succumbed to cachexia five months after histological diagnosis. The presence of SIADH may have marked implications for the treatment and prognosis of this disease. PMID:24944702

  16. Disheveled mediated planar cell polarity signaling is required in the second heart field lineage for outflow tract morphogenesis.

    PubMed

    Sinha, Tanvi; Wang, Bing; Evans, Sylvia; Wynshaw-Boris, Anthony; Wang, Jianbo

    2012-10-01

    Disheveled (Dvl) is a key regulator of both the canonical Wnt and the planar cell polarity (PCP) pathway. Previous genetic studies in mice indicated that outflow tract (OFT) formation requires Dvl1 and 2, but it was unclear which pathway was involved and whether Dvl1/2-mediated signaling was required in the second heart field (SHF) or the cardiac neural crest (CNC) lineage, both of which are critical for OFT development. In this study, we used Dvl1/2 null mice and a set of Dvl2 BAC transgenes that function in a pathway-specific fashion to demonstrate that Dvl1/2-mediated PCP signaling is essential for OFT formation. Lineage-specific gene-ablation further indicated that Dvl1/2 function is dispensable in the CNC, but required in the SHF for OFT lengthening to promote cardiac looping. Mutating the core PCP gene Vangl2 and non-canonical Wnt gene Wnt5a recapitulated the OFT morphogenesis defects observed in Dvl1/2 mutants. Consistent with genetic interaction studies suggesting that Wnt5a signals through the PCP pathway, Dvl1/2 and Wnt5a mutants display aberrant cell packing and defective actin polymerization and filopodia formation specifically in SHF cells in the caudal splanchnic mesoderm (SpM), where Wnt5a and Dvl2 are co-expressed specifically. Our results reveal a critical role of PCP signaling in the SHF during early OFT lengthening and cardiac looping and suggest that a Wnt5a→ Dvl PCP signaling cascade may regulate actin polymerization and protrusive cell behavior in the caudal SpM to promote SHF deployment, OFT lengthening and cardiac looping.

  17. Disheveled Mediated Planar Cell Polarity Signaling is Required in the Second Heart Field Lineage for Outflow Tract Morphogenesis

    PubMed Central

    Sinha, Tanvi; Wang, Bing; Evans, Sylvia; Wynshaw-Boris, Anthony; Wang, Jianbo

    2012-01-01

    Disheveled (Dvl) is a key regulator of both the canonical Wnt and the planar cell polarity (PCP) pathway. Previous genetic studies in mice indicated that outflow tract (OFT) formation requires Dvl1 and 2, but it was unclear which pathway was involved and whether Dvl1/2-mediated signaling was required in the second heart field (SHF) or the cardiac neural crest (CNC) lineage, both of which are critical for OFT development. In this study, we used Dvl1/2 null mice and a set of Dvl2 BAC transgenes that function in a pathway-specific fashion to demonstrate that Dvl1/2-mediated PCP signaling is essential for OFT formation. Lineage-specific gene ablation further indicated that Dvl1/2 function is dispensable in the CNC, but required in the SHF for OFT lengthening to promote cardiac looping. Mutating the core PCP gene Vangl2 and non-canonical Wnt gene Wnt5a recapitulated the OFT morphogenesis defects observed in Dvl1/2 mutants. Consistent with genetic interaction studies suggesting that Wnt5a signals through the PCP pathway, Dvl1/2 and Wnt5a mutants display aberrant cell packing and defective actin polymerization and filopodia formation specifically in SHF cells in the caudal splanchnic mesoderm (SpM), where Wnt5a and Dvl2 are co-expressed specifically. Our results reveal a critical role of PCP signaling in the SHF during early OFT lengthening and cardiac looping and suggest that a Wnt5a→ Dvl PCP signaling cascade may regulate actin polymerization and protrusive cell behavior in the caudal SpM to promote SHF deployment, OFT lengthening and cardiac looping. PMID:22841628

  18. CD4+ T cell expression of MyD88 is essential for normal resolution of Chlamydia muridarum genital tract infection1

    PubMed Central

    Frazer, Lauren C.; Sullivan, Jeanne E.; Zurenski, Matthew A.; Mintus, Margaret; Tomasak, Tammy E.; Prantner, Daniel; Nagarajan, Uma M.; Darville, Toni

    2013-01-01

    Resolution of Chlamydia genital tract infection is delayed in the absence of MyD88. In these studies, we first used bone marrow chimeras to demonstrate a requirement for MyD88 expression by hematopoietic cells in the presence of a wild-type epithelium. Using mixed bone marrow chimeras we then determined that MyD88 expression was specifically required in the adaptive immune compartment. Furthermore, adoptive transfer experiments revealed that CD4+ T cell expression of MyD88 was necessary for normal resolution of genital tract infection. This requirement was associated with a reduced ability of MyD88−/− CD4+ T cells to accumulate in the draining lymph nodes and genital tract when exposed to the same inflammatory milieu as wild-type CD4+ T cells. We also demonstrated that the impaired infection control we observed in the absence of MyD88 could not be recapitulated by deficiencies in TLR or IL-1R signaling. In vitro, we detected an increased frequency of apoptotic MyD88−/− CD4+ T cells upon activation in the absence of exogenous ligands for receptors upstream of MyD88. These data reveal an intrinsic requirement for MyD88 in CD4+ T cells during Chlamydia infection and indicate that the importance of MyD88 extends beyond innate immune responses by directly influencing adaptive immunity. PMID:24038087

  19. CD4+ T cell expression of MyD88 is essential for normal resolution of Chlamydia muridarum genital tract infection.

    PubMed

    Frazer, Lauren C; Sullivan, Jeanne E; Zurenski, Matthew A; Mintus, Margaret; Tomasak, Tammy E; Prantner, Daniel; Nagarajan, Uma M; Darville, Toni

    2013-10-15

    Resolution of Chlamydia genital tract infection is delayed in the absence of MyD88. In these studies, we first used bone marrow chimeras to demonstrate a requirement for MyD88 expression by hematopoietic cells in the presence of a wild-type epithelium. Using mixed bone marrow chimeras we then determined that MyD88 expression was specifically required in the adaptive immune compartment. Furthermore, adoptive transfer experiments revealed that CD4(+) T cell expression of MyD88 was necessary for normal resolution of genital tract infection. This requirement was associated with a reduced ability of MyD88(-/-)CD4(+) T cells to accumulate in the draining lymph nodes and genital tract when exposed to the same inflammatory milieu as wild-type CD4(+) T cells. We also demonstrated that the impaired infection control we observed in the absence of MyD88 could not be recapitulated by deficiencies in TLR or IL-1R signaling. In vitro, we detected an increased frequency of apoptotic MyD88(-/-)CD4(+) T cells upon activation in the absence of exogenous ligands for receptors upstream of MyD88. These data reveal an intrinsic requirement for MyD88 in CD4(+) T cells during Chlamydia infection and indicate that the importance of MyD88 extends beyond innate immune responses by directly influencing adaptive immunity.

  20. Memory B cell compartment constitution and susceptibility to recurrent lower respiratory tract infections in young children.

    PubMed

    Siebert, Johan N; L'huillier, Arnaud G; Grillet, Stéphane; Delhumeau, Cécile; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2013-06-01

    A proportion of children have recurrent LRTIs, mostly as a result of Spn, which persist after 2 years of age. Here, we investigate, by flow cytofluorometry, the constitution of the memory B cell compartment in 90 healthy children and 49 children with recurrent LRTIs to determine if an increased susceptibility to recurrent LRTIs results from a delayed or abnormal ontogeny with poor antibody-mediated protection. Total IgA, IgM, IgG, and IgG subclasses were measured by nephelometry, as well as antipneumococcal antibodies by ELISA. Pneumococcal vaccination status was obtained. We show that the memory B cells increase between birth and 2 years of age (1.6% vs. 21.1%, P<0.001) without further significant increase noted per additional years (3-4 years old: 23.3%; 4-5 years old: 22.2%, P>0.40) to reach adult-like values (31.8±11.8%, P=0.08). Proportions of switched and IgM memory B cells were similar in children and adults. Comparatively, LRTI children had no delay in the constitution of their memory B cell compartment (2-3 years old: 26.9%; 3-4 years old: 18.2%; 4-5 years old: 26.8%, P>0.05). Their switched and IgM memory B cells were similar among age categories, and the distribution was overall similar to that of healthy controls. LRTI children had normal total and pneumococcal serotype-specific antibody values but showed a rapid waning of antipneumococcal antibody levels after vaccination. In summary, our results show that the memory B cell compartment is already similarly constituted at 2 years of age in healthy and LRTI children and thus, cannot explain the increased susceptibility to bacterial pneumonia. However, the waning of antibodies might predispose children to recurrent infections in the absence of revaccination.

  1. Cell sorting using efficient light shaping approaches

    NASA Astrophysics Data System (ADS)

    Bañas, Andrew; Palima, Darwin; Villangca, Mark; Glückstad, Jesper

    2016-03-01

    Early detection of diseases can save lives. Hence, there is emphasis in sorting rare disease-indicating cells within small dilute quantities such as in the confines of lab-on-a-chip devices. In our work, we use optical forces to isolate red blood cells detected by machine vision. This approach is gentler, less invasive and more economical compared to conventional FACS systems. As cells are less responsive to plastic or glass beads commonly used in the optical manipulation literature, and since laser safety would be an issue in clinical use, we develop efficient approaches in utilizing lasers and light modulation devices. The Generalized Phase Contrast (GPC) method that can be used for efficiently illuminating spatial light modulators or creating well-defined contiguous optical traps is supplemented by diffractive techniques capable of integrating the available light and creating 2D or 3D beam distributions aimed at the positions of the detected cells. Furthermore, the beam shaping freedom provided by GPC can allow optimizations in the beam's propagation and its interaction with the catapulted cells.

  2. Microfluidic approach of Sickled Cell Anemia

    NASA Astrophysics Data System (ADS)

    Abkarian, Manouk; Loiseau, Etienne; Massiera, Gladys

    2012-11-01

    Sickle Cell Anemia is a disorder of the microcirculation caused by a genetic point mutation that produces an altered hemoglobin protein called HbS. HbS self-assembles reversibly into long rope like fibers inside the red blood cells. The resulting distorded sickled red blood cells are believed to block the smallest capillaries of the tissues producing anemia. Despite the large amount of work that provided a thorough understanding of HbS polymerization in bulk as well as in intact red blood cells at rest, no consequent cellular scale approaches of the study of polymerization and its link to the capillary obstruction have been proposed in microflow, although the problem of obstruction is in essence a circulatory problem. Here, we use microfluidic channels, designed to mimic physiological conditions (flow velocity, oxygen concentration, hematocrit...) of the microcirculation to carry out a biomimetic study at the cellular scale of sickled cell vaso-occlusion. We show that flow geometry, oxygen concentration, white blood cells and free hemoglobin S are essential in the formation of original cell aggregates which could play a role in the vaso-occlusion events.

  3. Effect of oral N-acetylcysteine (NAC) on volume and albumin content of respiratory tract fluid but not on epithelial secretory cell number in "smoking" rats.

    PubMed

    Robinson, N; Brattsand, R; Dahlbäck, M

    1990-03-01

    This study was designed to look at the effect of N-acetylcysteine (NAC) on epithelial secretory cells and the respiratory tract fluid volume and albumin content from the lower airways of "bronchitic" rats. Rats were exposed either to tobacco smoke (TS), TS and NAC, or NAC alone. TS caused a significant increase in epithelial secretory cell number which was not reduced by concomitant NAC administration; NAC alone had no effect on cell numbers. TS increased respiratory tract fluid volume and albumin content by a small but non-significant amount, whereas TS and NAC increased the volume and albumin content by a greater and significant amount; NAC alone was also shown to significantly increase both fluid volume and albumin content.

  4. Non-transitional cell carcinoma of the upper urinary tract: A case series among 305 cases at a tertiary urology institute

    PubMed Central

    Elawdy, Mohamed Mohamed; Taha, Diaa-Eldin; Osman, Yasser; El-Hamid, Mohamed Abd; El-Mekresh, Mohsen

    2017-01-01

    Non-transitional cell carcinomas (non-TCC) of the upper urinary tract as squamous cell carcinoma (SCC), adenocarcinoma, and small cell carcinoma (SmCC) are rare with few case reports in the literature. We retrospectively reviewed our patients who surgically treated for upper tract urothelial carcinoma from 1983 to 2013 for non-TCC pathological cancer characteristics and survival. Among 305 patients, only 5 (1.6%) cases were found: One case of SmCC, another had adenocarcinoma, and 3 SCC cases. None of them had intravesical recurrence and the cancer-specific survival for non-TCC cohort is markedly decreased (log-rank = 0.01) compared to TCC patients. PMID:28216943

  5. Reserve stem cells: Differentiated cells reprogram to fuel repair, metaplasia, and neoplasia in the adult gastrointestinal tract.

    PubMed

    Mills, Jason C; Sansom, Owen J

    2015-07-14

    It has long been known that differentiated cells can switch fates, especially in vitro, but only recently has there been a critical mass of publications describing the mechanisms adult, postmitotic cells use in vivo to reverse their differentiation state. We propose that this sort of cellular reprogramming is a fundamental cellular process akin to apoptosis or mitosis. Because reprogramming can invoke regenerative cells from mature cells, it is critical to the long-term maintenance of tissues like the pancreas, which encounter large insults during adulthood but lack constitutively active adult stem cells to repair the damage. However, even in tissues with adult stem cells, like the stomach and intestine, reprogramming may allow mature cells to serve as reserve ("quiescent") stem cells when normal stem cells are compromised. We propose that the potential downside to reprogramming is that it increases risk for cancers that occur late in adulthood. Mature, long-lived cells may have years of exposure to mutagens. Mutations that affect the physiological function of differentiated, postmitotic cells may lead to apoptosis, but mutations in genes that govern proliferation might not be selected against. Hence, reprogramming with reentry into the cell cycle might unmask those mutations, causing an irreversible progenitor-like, proliferative state. We review recent evidence showing that reprogramming fuels irreversible metaplastic and precancerous proliferation in the stomach and pancreas. Finally, we illustrate how we think reprogrammed differentiated cells are likely candidates as cells of origin for cancers of the intestine.

  6. Reserve stem cells: Reprogramming of differentiated cells fuels repair, metaplasia, and neoplasia in the adult gastrointestinal tract

    PubMed Central

    Mills, Jason C.; Sansom, Owen J.

    2016-01-01

    It has long been known that differentiated cells can switch fates, especially in vitro, but only recently has there been a critical mass of publications describing the mechanisms adult, post-mitotic cells use in vivo to reverse their differentiation state. We propose that this sort of cellular reprogramming is a fundamental cellular process akin to apoptosis or mitosis. Because reprogramming can invoke regenerative cells from mature cells, it is critical to the longterm maintenance of tissues like the pancreas, which encounter large insults during adulthood but lack constitutively active adult stem cells to repair the damage. However, even in tissues with adult stem cells, like stomach and intestine, reprogramming may allow mature cells to serve as reserve (“quiescent”) stem cells when normal stem cells are compromised. We propose that the potential downside to reprogramming is that it increases risk for cancers that occur late in adulthood. Mature, long-lived cells may have years of exposure to mutagens. Mutations that affect the physiological function of differentiated, post-mitotic cells may lead to apoptosis, but mutations in genes that govern proliferation might not be selected against. Hence, reprogramming with reentry into the cell cycle might unmask those mutations, causing an irreversible progenitor-like, proliferative state. We review recent evidence showing that reprogramming fuels irreversible metaplastic and precancerous proliferations in stomach and pancreas. Finally, we illustrate how we think reprogrammed differentiated cells are likely candidates as cells of origin for cancers of the intestine. PMID:26175494

  7. β-glucan Exposure on the Fungal Cell Wall Tightly Correlates with Competitive Fitness of Candida Species in the Mouse Gastrointestinal Tract

    PubMed Central

    Sem, XiaoHui; Le, Giang T. T.; Tan, Alrina S. M.; Tso, Gloria; Yurieva, Marina; Liao, Webber W. P.; Lum, Josephine; Srinivasan, Kandhadayar G.; Poidinger, Michael; Zolezzi, Francesca; Pavelka, Norman

    2016-01-01

    Candida albicans is responsible for ~400,000 systemic fungal infections annually, with an associated mortality rate of 46–75%. The human gastrointestinal (GI) tract represents the largest natural reservoir of Candida species and is a major source of systemic fungal infections. However, the factors that control GI colonization by Candida species are not completely understood. We hypothesized that the fungal cell wall would play an important role in determining the competitive fitness of Candida species in the mammalian GI tract. To test this hypothesis, we generated a systematic collection of isogenic C. albicans cell wall mutants and measured their fitness in the mouse GI tract via quantitative competition assays. Whereas a large variation in competitive fitness was found among mutants, no correlation was observed between GI fitness and total levels of individual cell wall components. Similar results were obtained in a set of distantly-related Candida species, suggesting that total amounts of individual cell wall components do not determine the ability of fungi to colonize the GI tract. We then subjected this collection of Candida strains and species to an extensive quantitative phenotypic profiling in search for features that might be responsible for their differences in GI fitness, but found no association with the ability to grow in GI-mimicking and stressful environments or with in vitro and in vivo virulence. The most significant association with GI fitness was found to be the strength of signaling through the Dectin-1 receptor. Using a quantitative assay to measure the amount of exposed β-glucan on the surface of fungal cells, we found this parameter, unlike total β-glucan levels, to be strongly predictive of competitive fitness in the mouse GI tract. These data suggest that fungal cell wall architecture, more so than its crude composition, critically determines the ability of fungi to colonize the mammalian GI tract. In particular, recognition of exposed

  8. β-glucan Exposure on the Fungal Cell Wall Tightly Correlates with Competitive Fitness of Candida Species in the Mouse Gastrointestinal Tract.

    PubMed

    Sem, XiaoHui; Le, Giang T T; Tan, Alrina S M; Tso, Gloria; Yurieva, Marina; Liao, Webber W P; Lum, Josephine; Srinivasan, Kandhadayar G; Poidinger, Michael; Zolezzi, Francesca; Pavelka, Norman

    2016-01-01

    Candida albicans is responsible for ~400,000 systemic fungal infections annually, with an associated mortality rate of 46-75%. The human gastrointestinal (GI) tract represents the largest natural reservoir of Candida species and is a major source of systemic fungal infections. However, the factors that control GI colonization by Candida species are not completely understood. We hypothesized that the fungal cell wall would play an important role in determining the competitive fitness of Candida species in the mammalian GI tract. To test this hypothesis, we generated a systematic collection of isogenic C. albicans cell wall mutants and measured their fitness in the mouse GI tract via quantitative competition assays. Whereas a large variation in competitive fitness was found among mutants, no correlation was observed between GI fitness and total levels of individual cell wall components. Similar results were obtained in a set of distantly-related Candida species, suggesting that total amounts of individual cell wall components do not determine the ability of fungi to colonize the GI tract. We then subjected this collection of Candida strains and species to an extensive quantitative phenotypic profiling in search for features that might be responsible for their differences in GI fitness, but found no association with the ability to grow in GI-mimicking and stressful environments or with in vitro and in vivo virulence. The most significant association with GI fitness was found to be the strength of signaling through the Dectin-1 receptor. Using a quantitative assay to measure the amount of exposed β-glucan on the surface of fungal cells, we found this parameter, unlike total β-glucan levels, to be strongly predictive of competitive fitness in the mouse GI tract. These data suggest that fungal cell wall architecture, more so than its crude composition, critically determines the ability of fungi to colonize the mammalian GI tract. In particular, recognition of exposed

  9. [Sporadic upper urinary tract urothelial cell carcinomas: identification of interaction between toxic carcinogens and individuals genetic susceptibility].

    PubMed

    Colin, P; Koenig, P; Ballereau, C; Phé, V; Berthon, N; Villers, A; Biserte, J; Rouprêt, M

    2010-01-01

    Upper urinary tract urothelial cell carcinomas (UUT UCC) are rare sporadic tumors. Recent epidemiologic and molecular data have shown a singular susceptibility of UUT UCCs for specific risk factors. The main exogenic factors involved in UUT UCCs carcinogenesis remain tobacco and occupational exposure (aromatic amines, polycyclic hydrocarbures and chlored solvents). Enzymatic variants of detoxification system may be responsible of carcinogenesis with these toxics. Tumors induced by phenacetine consumption are decreasing since it was banned in the 1970s. Also, acid aristolochic exposure (Balkan nephropathy, Chinese Herb nephropathy) has been demonstrated to specifically induce UUT UCCs. Familial genic polymorphism of detoxification system would explain geographic distribution in endemic areas. In Taiwan, chronic arsenic exposition would constitute the main risk factor of UUT UCC. However, theses mechanisms of carcinogenesis remain unclear. The knowledge of UUT UCC development mechanisms implying toxic detoxification systems is still incomplete. To date, there is a growing body of evidence supporting that the interaction between individual genetic susceptibilities and environmental toxic exposure is a key to explain carcinogenesis in the majority of sporadic UUT UCC occurrence.

  10. Urinary tract infection in older adults

    PubMed Central

    Rowe, Theresa A; Juthani-Mehta, Manisha

    2013-01-01

    Urinary tract infection and asymptomatic bacteriuria are common in older adults. Unlike in younger adults, distinguishing symptomatic urinary tract infection from asymptomatic bacteriuria is problematic, as older adults, particularly those living in long-term care facilities, are less likely to present with localized genitourinary symptoms. Consensus guidelines have been published to assist clinicians with diagnosis and treatment of urinary tract infection; however, a single evidence-based approach to diagnosis of urinary tract infection does not exist. In the absence of a gold standard definition of urinary tract infection that clinicians agree upon, overtreatment with antibiotics for suspected urinary tract infection remains a significant problem, and leads to a variety of negative consequences including the development of multidrug-resistant organisms. Future studies improving the diagnostic accuracy of urinary tract infections are needed. This review will cover the prevalence, diagnosis and diagnostic challenges, management, and prevention of urinary tract infection and asymptomatic bacteriuria in older adults. PMID:24391677

  11. Urinary tract infection in older adults.

    PubMed

    Rowe, Theresa A; Juthani-Mehta, Manisha

    2013-10-01

    Urinary tract infection and asymptomatic bacteriuria are common in older adults. Unlike in younger adults, distinguishing symptomatic urinary tract infection from asymptomatic bacteriuria is problematic, as older adults, particularly those living in long-term care facilities, are less likely to present with localized genitourinary symptoms. Consensus guidelines have been published to assist clinicians with diagnosis and treatment of urinary tract infection; however, a single evidence-based approach to diagnosis of urinary tract infection does not exist. In the absence of a gold standard definition of urinary tract infection that clinicians agree upon, overtreatment with antibiotics for suspected urinary tract infection remains a significant problem, and leads to a variety of negative consequences including the development of multidrug-resistant organisms. Future studies improving the diagnostic accuracy of urinary tract infections are needed. This review will cover the prevalence, diagnosis and diagnostic challenges, management, and prevention of urinary tract infection and asymptomatic bacteriuria in older adults.

  12. Polypyrimidine Tract-Binding Protein 1 promotes proliferation, migration and invasion in clear-cell renal cell carcinoma by regulating alternative splicing of PKM

    PubMed Central

    Jiang, Junyi; Chen, Xu; Liu, Hao; Shao, Jing; Xie, Ruihui; Gu, Peng; Duan, Chaohui

    2017-01-01

    Polypyrimidine Tract-Binding Protein 1 (PTBP1) is an essential RNA-binding protein that regulates diverse biological events through regulating alternative splice of mRNA. PTBP1 induces cancer-promoting splice variants and is related to tumorigenesis in several cancers. However, both the expression patterns and biological mechanisms of PTBP1 in clear-cell renal cell carcinoma (ccRCC) are unclear. We investigated PTBP1 expression in 533 ccRCC patients from TCGA and 30 ccRCC patients by immunohistochemistry, and found that PTBP1 expression levels were significantly increased in ccRCC tissues and that high PTBP1 expression was closely correlated with advanced tumor stage, AJCC stage and poor prognosis. Cell biological assays with siRNA-mediated knockdown and lentivirus vector-mediated over-expression demonstrated that PTBP1 promoted proliferation, migration and invasion in ccRCC cells in vitro. Furthermore, PTBP1 increased the transformation from pyruvate kinase muscle 1 (PKM1) to PKM2. Knockdown of PKM2 mainly abolished PTBP1-induced proliferation, migration and invasion in ccRCC cells in vitro. In conclusion, our study indicates that PTBP1 plays a tumorigenic role in ccRCC by mediating PKM2 alternative splicing and it may be a potential prognostic marker and a promising target for treatment of ccRCC. PMID:28337374

  13. Cell and tissue polarity in the intestinal tract during tumourigenesis: cells still know the right way up, but tissue organization is lost.

    PubMed

    Fatehullah, Aliya; Appleton, Paul L; Näthke, Inke S

    2013-01-01

    Cell and tissue polarity are tightly coupled and are vital for normal tissue homeostasis. Changes in cellular and tissue organization are common to even early stages of disease, particularly cancer. The digestive tract is the site of the second most common cause of cancer deaths in the developed world. Tumours in this tissue arise in an epithelium that has a number of axes of cell and tissue polarity. Changes in cell and tissue polarity in response to genetic changes that are known to underpin disease progression provide clues about the link between molecular-, cellular- and tissue-based mechanisms that accompany cancer. Mutations in adenomatous polyposis coli (APC) are common to most colorectal cancers in humans and are sufficient to cause tumours in mouse intestine. Tissue organoids mimic many features of whole tissue and permit identifying changes at different times after inactivation of APC. Using gut organoids, we show that tissue polarity is lost very early during cancer progression, whereas cell polarity, at least apical-basal polarity, is maintained and changes only at later stages. These observations reflect the situation in tumours and validate tissue organoids as a useful system to investigate the relationship between cell polarity and tissue organization.

  14. Inflammatory cells and cellular activation in the lower respiratory tract in Churg-Strauss syndrome

    PubMed Central

    Schnabel, A.; Csernok, E.; Braun, J.; Gross, W.

    1999-01-01

    BACKGROUND—To obtain insight into the mechanisms of tissue injury in lung disease due to Churg-Strauss syndrome (CSS), the bronchoalveolar lavage (BAL) cell profile and the levels in the BAL fluid of cell products released by activated eosinophils and neutrophils were assessed.
METHODS—Thirteen patients with active progressive CSS (n = 7) or CSS in partial remission (n = 6) underwent clinical staging and bronchoalveolar lavage. The levels of eosinophil cationic protein (ECP), myeloperoxidase (MPO), and peroxidase activity in the BAL fluid were determined and the results were compared with those of 19 patients with pulmonary active Wegener's granulomatosis (WG) and nine control subjects.
RESULTS—In patients with progressive CSS the BAL cell profile was dominated by eosinophils, neutrophil elevation being the exception. The eosinophilia was associated with high ECP levels (4.39 ng/ml and 0.40 ng/ml in the two CSS groups compared with unmeasurable values in the controls). Individual patients with highly active CSS also had raised MPO levels, comparable to the levels in the most active WG patients. Peroxidase activity in the BAL fluid was 1.26 U/ml and 0.10 U/ml in the two groups of patients with CSS and 0.20 U/ml in the controls. Pulmonary disease in patients with WG was characterised by an extensive increase in MPO (0.30ng/ml versus 0.13 ng/ml in the controls) together with high peroxidase activity in the BAL fluid (4.37 U/ml), but only a small increase in ECP levels was seen. No correlation was found between the ECP and MPO levels in patients with CSS which suggests that eosinophil and neutrophil activation vary independently of each other.
CONCLUSIONS—These findings suggest that, in addition to eosinophil activation, neutrophil activation is an important feature in some patients with highly active CSS. The balance of neutrophil and eosinophil involvement appears to be variable and this may be one explanation for the individually variable treatment

  15. Mouse strain-dependent chemokine regulation of the genital tract T helper cell type 1 immune response.

    PubMed

    Darville, T; Andrews, C W; Sikes, J D; Fraley, P L; Braswell, L; Rank, R G

    2001-12-01

    Vaginal infection with the mouse pneumonitis agent of Chlamydia trachomatis (MoPn) produces shorter courses of infection in C57BL/6 and BALB/c mice than in C3H/HeN mice, while C57BL/6 mice are more resistant to oviduct pathology. A robust Th1 response is extremely important in host defense against chlamydia. In this study we examined gamma interferon (IFN-gamma), interleukin 10 (IL-10), and the T-cell-regulatory chemokines macrophage inflammatory protein-1alpha (MIP-1alpha) and monocyte chemoattractant protein-1 (MCP-1) to determine if differences in these responses were associated with the differential courses of infection seen in these three strains of mice. Increased and prolonged IFN-gamma responses and lower IL-10 responses were observed in the C57BL/6 strain compared to BALB/c and C3H. Examination of genital tract chemokines revealed a marked predominance of MIP-1alpha over MCP-1 only in the C57 strain. Thus, a pattern of high MIP-1alpha and low MCP-1 levels during the first week of infection is associated with an increased Th1 response and a shorter, more benign chlamydial infection. Inhibition of the MCP-1 response in C3H mice increased their later T-cell production of IFN-gamma but decreased their early IFN-gamma response and had no effect on the course or outcome of infection. Inhibition of MCP-1 is not beneficial in chlamydial infection because of its pleiotropic effects.

  16. Detection of KI WU and Merkel cell polyomavirus in respiratory tract of cystic fibrosis patients.

    PubMed

    Iaria, M; Caccuri, F; Apostoli, P; Giagulli, C; Pelucchi, F; Padoan, R F; Caruso, A; Fiorentini, S

    2015-06-01

    In the last few years, many reports have confirmed the presence of WU, KI and Merkel cell (MC) polyomaviruses (PyV) in respiratory samples wordwide, but their pathogenic role in patients with underlying conditions such as cystic fibrosis is still debated. To determine the prevalence of MCPyV, WUPyV and KIPyV, we conducted a 1-year-long microbiological testing of respiratory specimens from 93 patients with cystic fibrosis in Brescia, Italy. We detected PyV DNA in 94 out of 337 analysed specimens. KIPyV was the most common virus detected (12.1%), followed by WUPyV (8.9%) and MCPyV (6.8%). We found an intriguing association between the presence of MCPyV and the concurrent isolation of Pseudomonas aeruginosa, as well as with the patient status, classified as chronically colonized with P. aeruginosa. Our study adds perspective on the prevalence and the potential pathogenic role of PyV infections.

  17. Squamous cell carcinoma arising in a chronic osteomyelitic sinus tract in the peri-anal region involving pelvis: a rare occurrence.

    PubMed

    Karumbaiah, K P; Shruthi, M S; Ragavendran, V; Kariappa, T M

    2014-01-01

    Squamous cell carcinoma is a rare, but well documented complication of chronic osteomyelitis. Squamous cell carcinoma arising in a sinus tract following chronic osteomyelitis of the pelvic bone is a very rare occurrence. The patient presented with multiple draining sinuses and an ulcerative growth at the mouth of one of the sinuses in the peri-anal region. X-ray findings and sinogram showed de- struction of part of pubic bone. Biopsy from the growth confirmed a well differentiated squamous cell carcinoma. Therefore it is imperative that these lesions be biopsied for accurate diagnosis, adequate therapy and follow-up.

  18. Fecal transplantation – the new, inexpensive, safe, and rapidly effective approach in the treatment of gastrointestinal tract diseases

    PubMed Central

    Oprita, R; Bratu, M; Oprita, B; Diaconescu, B

    2016-01-01

    Introduction. Fecal transplantation was shown to effectively reduce the reoccurrence in patients with refractory Clostridium difficile infection. New data suggest that fecal transplantation could also be efficient in other gastrointestinal diseases, for instance in inflammatory bowel disease, irritable bowel syndrome, but, there are also some data that could imply the efficacy outside the gastrointestinal tract. Fecal transplantation should be considered a unique agent, capable of treating severe diseases, with essentially no adverse reactions, presenting a cure rate of over 90%. Materials and methods. This prospective study included 33 patients, of whom 28 patients with recurrent or resistant Clostridium difficile infection, who failed to be treated with conventional therapy, which presupposed vancomycin administration and 5 patients with inflammatory bowel disease, more precisely with ulcerative colitis, refractory on biologic agents (infliximab and adalimumab). In most of the cases, fecal transplant was realized with the infusion of stool through colonoscopy. Results. Most of the patients from both groups (Clostridium difficile infection and Ulcerative Colitis) responded (31 patients) with a total relief of the symptoms, after 1 FMT for Clostridium difficile group and after more than one for the ulcerative colitis group. The so-called primary cure rate was 96.42% for Clostridium group. For ulcerative colitis, group 3 of the patients needed 3 or 4 infusions for symptom relief. One patient was categorized as non-responsive (patient with UC) and needed surgery. Due to non-fecal transplant related causes, one death was reported. Conclusions. Fecal transplant is highly effective, safe, with practically no adverse effects, inexpensive, a procedure easy to be done that could be introduced in Clostridium difficile treatment protocols. As for ulcerative colitis treatment with FMT, future randomized controlled trials are needed to prove its efficiency. PMID:27453747

  19. Sublingual immunization with nonreplicating antigens induces antibody-forming cells and cytotoxic T cells in the female genital tract mucosa and protects against genital papillomavirus infection.

    PubMed

    Cuburu, Nicolas; Kweon, Mi-Na; Hervouet, Catherine; Cha, Hye-Ran; Pang, Yuk-Ying S; Holmgren, Jan; Stadler, Konrad; Schiller, John T; Anjuère, Fabienne; Czerkinsky, Cecil

    2009-12-15

    We have recently reported that the sublingual (s.l.) mucosa is an efficient site for inducing systemic and mucosal immune responses. In this study, the potential of s.l. immunization to induce remote Ab responses and CD8(+) cytotoxic responses in the female genital tract was examined in mice by using a nonreplicating Ag, OVA, and cholera toxin (CT) as an adjuvant. Sublingual administration of OVA and CT induced Ag-specific IgA and IgG Abs in blood and in cervicovaginal secretions. These responses were associated with large numbers of IgA Ab-secreting cells (ASCs) in the genital mucosa. Genital ASC responses were similar in magnitude and isotype distribution after s.l., intranasal, or vaginal immunization and were superior to those seen after intragastric immunization. Genital, but not blood or spleen, IgA ASC responses were inhibited by treatment with anti-CCL28 Abs, suggesting that the chemokine CCL28 plays a major role in the migration of IgA ASC progenitors to the reproductive tract mucosa. Furthermore, s.l. immunization with OVA induced OVA-specific effector CD8(+) cytolytic T cells in the genital mucosa, and these responses required coadministration of the CT adjuvant. Furthermore, s.l. administration of human papillomavirus virus-like particles with or without the CT adjuvant conferred protection against genital challenge with human papillomavirus pseudovirions. Taken together, these findings underscore the potential of s.l. immunization as an efficient vaccination strategy for inducing genital immune responses and should impact on the development of vaccines against sexually transmitted diseases.

  20. Primary Squamous Cell Carcinoma of the Upper Genital Tract: Utility of p16INK4a Expression and HPV DNA Status in its Differential Diagnosis from Extended Cervical Squamous Cell Carcinoma

    PubMed Central

    Yoo, Su Hyun; Son, Eun-Mi; Sung, Chang Okh

    2013-01-01

    Background Primary squamous cell carcinoma (SCC) of the upper genital tract, including the endometrium, fallopian tubes, and ovaries, is extremely rare. It must be distinguished from the mucosal extension of primary cervical SCC because determination of the primary tumor site is important for tumor staging. However, patients with SCC of the fallopian tubes or ovarian surface have often undergone prior hysterectomy with inadequate examination of the cervix, making it difficult to determine the primary site. Methods We compared histologic findings, p16INK4a expression, and human papillomavirus (HPV) DNA status in four patients with primary SCC of the upper genital tract and five patients with primary cervical SCC extending to the mucosa of the upper genital tract. Results All five SCCs of cervical origin showed strong expression of p16INK4a, whereas all four SCCs of the upper genital tract were negative, although one showed weak focal staining. Three of the five cervical SCCs were positive for HPV16 DNA, whereas all four primary SCCs of the upper genital tract were negative for HPV DNA. Conclusions Although a thorough histological examination is important, immunonegativity for p16INK4a and negative for HPV DNA may be useful adjuncts in determining primary SCCs of the upper genital tract. PMID:24421848

  1. Immunophenotypic and Clinical Differences Between the Nasal and Extranasal Subtypes of Upper Aerodigestive Tract Natural Killer/T-Cell Lymphoma

    SciTech Connect

    Liu, Qing-Feng; Wang, Wei-Hu; Wang, Shu-Lian; Liu, Yue-Ping; Huang, Wen-Ting; Lu, Ning; Zhou, Li-Qiang; Ouyang, Han; Jin, Jing; Li, Ye-Xiong

    2014-03-15

    Purpose: To investigate, in a large cohort of patients, the immunophenotypic and clinical differences of nasal and extranasal extranodal nasal-type natural killer/T-cell lymphoma of the upper aerodigestive tract (UADT-NKTCL) and examine the relevance of the immunophenotype on the clinical behavior, prognosis, and treatment. Methods and Materials: A total of 231 patients with UADT-NKTCL were recruited. One hundred eighty-one patients had primary location in the nasal cavity (nasal UADT-NKTCL), and 50 patients had primary extranasal UADT-NKTCL. Results: Patients with extranasal UADT-NKTCL had more adverse clinical features, including advanced-stage disease, regional lymph node involvement, B symptoms, and poor performance status, than patients with nasal UADT-NKTCL. In addition, CD56 and granzyme B were less frequently expressed in extranasal UADT-NKTCL. The 5-year overall survival rate was 74.1% for the entire group and 76.0% for early-stage disease. The 5-year overall survival rate for extranasal UADT-NKTCL was similar or superior to that of nasal UADT-NKTCL for all disease stages (76.9% vs 73.4%, P=.465), stage I disease (75.9% vs 79.2%, P=.786), and stage II disease (83.3% vs 50.3%, P=.018). CD56 expression and a Ki-67 proliferation rate ≥50% predicted poorer survival for extranasal UADT-NKTCL but not for nasal UADT-NKTCL. Conclusions: Patients with nasal and extranasal UADT-NKTCL have significantly different clinical features, immunophenotypes, and prognosis. Extranasal UADT-NKTCL should be considered as a distinct subgroup apart from the most commonly diagnosed prototype of nasal UADT-NKTCL.

  2. Independent levels of cell-free and cell-associated human immunodeficiency virus-1 in genital-tract secretions of clinically asymptomatic, treatment-naive African women.

    PubMed

    Andréoletti, Laurent; Chomont, Nicolas; Grésenguet, Gérard; Matta, Mathieu; de Dieu Longo, Jean; Carreno, Marie-Paule; Si-Mohamed, Ali; Legoff, Jérôme; Kazatchkine, Michel D; Bélec, Laurent

    2003-08-15

    Using ultrasensitive polymerase chain reaction-based techniques, we assessed levels of cell-free and cell-associated human immunodeficiency virus (HIV)-1 in paired blood and genital samples of 30 clinically asymptomatic, treatment-naive women. Levels of HIV-1 RNA in cervicovaginal-lavage samples were positively correlated with those in plasma samples (r=.50; P=.008), whereas levels of HIV-1 DNA in genital samples were loosely correlated with those in blood samples (r=.31; P=.041). In plasma of peripheral blood, levels of HIV-1 DNA were positively correlated with those of HIV-1 RNA (r=.64; P<.001), whereas no correlation between HIV-1 DNA and HIV-1 RNA was evident in genital secretions. Our results indicate that levels of HIV-1 RNA and HIV-1 DNA are unrelated in the genital tracts of treatment-naive women and suggest that the level of genital HIV-1 RNA is influenced by systemic viral replication-in contrast to genital HIV-1 provirus, which may be influenced as well by local cofactors triggering the migration of HIV-infected cells originating from the cervicovaginal submucosa. These features may be relevant for an understanding of HIV-1 transmission in heterosexual individuals.

  3. Bombesin receptor subtype-3 is expressed by the enteric nervous system and by interstitial cells of Cajal in the rat gastrointestinal tract.

    PubMed

    Porcher, Christophe; Juhem, Aurélie; Peinnequin, André; Bonaz, Bruno

    2005-04-01

    Bombesin receptor subtype-3 (BRS-3), a G-protein-coupled orphan receptor, shares 47% and 55% homology with other known mammalian bombesin receptors. Despite the molecular characterization of BRS-3, its function remains unclear as a consequence of its low affinity for bombesin and the absence of an identified natural ligand. Although the other mammalian bombesin receptors are widely distributed in the gut and central nervous system, expression of BRS-3 in the gastrointestinal tract has not been previously described. We report the expression of BRS-3 mRNA and protein in the tunica muscularis of the rat gastrointestinal tract. The mRNA expression pattern was studied by reverse transcription followed by quantitative polymerase chain reaction. To identify the cellular sites of expression of BRS-3, we performed immunocytochemistry by using a N-terminus-specific affinity-purified antiserum. BRS-3 was found to be widely expressed in the rat gastrointestinal tract at both the mRNA and protein levels. BRS-3-like immunoreactivity (BRS-3-LI) was localized in neurons of the myenteric and submucosal ganglia, being primarily concentrated near the neuronal plasma membrane, and in fibers distributed in the longitudinal and circular muscle layers. In addition, BRS-3-LI was observed in the cell bodies and processes of c-kit+ interstitial cells of Cajal. These data have functional applications for the effects mediated by the activation of BRS-3 on gut motility through distinct neuronal and non-neuronal pathways.

  4. Molecular Cloning of Ghrelin and Characteristics of Ghrelin-Producing Cells in the Gastrointestinal Tract of the Common Marmoset (Callithrix jacchus).

    PubMed

    Takemi, Shota; Sakata, Ichiro; Apu, Auvijit Saha; Tsukahara, Shinji; Yahashi, Satowa; Katsuura, Goro; Iwashige, Fumihiro; Akune, Atsushi; Inui, Akio; Sakai, Takafumi

    2016-10-01

    Ghrelin was first isolated from human and rat as an endogenous ligand for the growth hormone secretagogue receptor (GHS-R). In the present study, we determined the ghrelin cDNA sequence of the common marmoset (Callithrix jacchus), a small-bodied New World monkey, and investigated the distribution of ghrelin-producing cells in the gastrointestinal tract and localization profiles with somatostatin-producing cells. The marmoset ghrelin cDNA coding region was 354 base pairs, and showed high homology to that in human, rhesus monkey, and mouse. Marmoset ghrelin consists of 28 amino acids, and the N-terminal region is highly conserved as found in other mammalian species. Marmoset preproghrelin and mature ghrelin have 86.3% and 92.9% homology, respectively, to their human counterparts. Quantitative RT-PCR analysis showed that marmoset ghrelin mRNA is highly expressed in the stomach, but it is not detected in other tissues of the gastrointestinal tract. In addition, a large number of ghrelin mRNA-expressing cells and ghrelin-immunopositive cells were detected in the mucosal layer of the stomach, but not in the myenteric plexus. Moreover, all the ghrelin cells examined in the stomach were observed to be closed-type. Double staining showed that somatostatin-immunopositive cells were not co-localized with ghrelin-producing cells; however, a subset of somatostatin-immunopositive cells is directly adjacent to ghrelin-immunopositive cells. These findings suggest that the distribution of ghrelin cells in marmoset differs from that in rodents, and thus the marmoset may be a more useful model for the translational study of ghrelin in primates. In conclusion, we have clarified the expression and cell distribution of ghrelin in marmoset, which may represent a useful model in translational study.

  5. Interval Biliary Stent Placement Via Percutaneous Ultrasound Guided Cholecystostomy: Another Approach to Palliative Treatment in Malignant Biliary Tract Obstruction

    SciTech Connect

    Harding, James Mortimer, Alex; Kelly, Michael; Loveday, Eric

    2010-12-15

    Percutaneous cholecystostomy is a minimally invasive procedure for providing gallbladder decompression, often in critically ill patients. It can be used in malignant biliary obstruction following failed endoscopic retrograde cholangiopancreatography when the intrahepatic ducts are not dilated or when stent insertion is not possible via the bile ducts. In properly selected patients, percutaneous cholecystostomy in obstructive jaundice is a simple, safe, and rapid option for biliary decompression, thus avoiding the morbidity and mortality involved with percutaneous transhepatic biliary stenting. Subsequent use of a percutaneous cholecystostomy for definitive biliary stent placement is an attractive concept and leaves patients with no external drain. To the best of our knowledge, it has only been described on three previous occasions in the published literature, on each occasion forced by surgical or technical considerations. Traditionally, anatomic/technical considerations and the risk of bile leak have precluded such an approach, but improvements in catheter design and manufacture may now make it more feasible. We report a case of successful interval metal stent placement via percutaneous cholecystostomy which was preplanned and achieved excellent palliation for the patient. The pros and cons of the procedure and approach are discussed.

  6. Resting Respiratory Tract Dendritic Cells Preferentially Stimulate T Helper Cell Type 2 (Th2) Responses and Require Obligatory Cytokine Signals for Induction of  Th1 Immunity

    PubMed Central

    Stumbles, Philip A.; Thomas, Jennifer A.; Pimm, Carolyn L.; Lee, Peter T.; Venaille, Thierry J.; Proksch, Stephen; Holt, Patrick G.

    1998-01-01

    Consistent with their role in host defense, mature dendritic cells (DCs) from central lymphoid organs preferentially prime for T helper cell type 1 (Th1)-polarized immunity. However, the “default” T helper response at mucosal surfaces demonstrates Th2 polarity, which is reflected in the cytokine profiles of activated T cells from mucosal lymph nodes. This study on rat respiratory tract DCs (RTDCs) provides an explanation for this paradox. We demonstrate that freshly isolated RTDCs are functionally immature as defined in vitro, being surface major histocompatibility complex (MHC) II lo, endocytosishi, and mixed lymphocyte reactionlo, and these cells produce mRNA encoding interleukin (IL)-10. After ovalbumin (OVA)-pulsing and adoptive transfer, freshly isolated RTDCs preferentially stimulated Th2-dependent OVA-specific immunoglobulin (Ig)G1 responses, and antigen-stimulated splenocytes from recipient animals produced IL-4 in vitro. However, preculture with granulocyte/macrophage colony stimulating factor increased their in vivo IgG priming capacity by 2–3 logs, inducing production of both Th1- and Th2-dependent IgG subclasses and high levels of IFN-γ by antigen-stimulated splenocytes. Associated phenotypic changes included upregulation of surface MHC II and B7 expression and IL-12 p35 mRNA, and downregulation of endocytosis, MHC II processing– associated genes, and IL-10 mRNA expression. Full expression of IL-12 p40 required additional signals, such as tumor necrosis factor α or CD40 ligand. These results suggest that the observed Th2 polarity of the resting mucosal immune system may be an inherent property of the resident DC population, and furthermore that mobilization of Th1 immunity relies absolutely on the provision of appropriate microenvironmental costimuli. PMID:9841916

  7. Imaging for approach selection of TAVI: assessment of the aorto-iliac tract diameter by computed tomography-angiography versus projection angiography.

    PubMed

    Wiegerinck, E M A; Marquering, H A; Oldenburger, N Y; Elattar, M A; Planken, R N; De Mol, B A J M; Piek, J J; Baan, J

    2014-02-01

    The choice of preferred access route for transcatheter aortic valve implantation (TAVI) is mainly guided by the minimal aorto-femoral tract diameter. Currently, projection angiography (XA) and CT-angiography (CTA) are used interchangeably to assess this diameter in the TAVI work-up. We aimed to assess the agreement of XA and CTA diameter measurements in TAVI candidates. Diameters of 700 aorta-iliac segments of 102 TAVI candidates were analyzed on both XA and CTA. The diameters on XA were measured manually, for the CTA-based analysis semi-automated segmentation software was used. Paired sample T test was used to evaluate differences in diameter measurements between the modalities. Disagreement on the suitability for a transfemoral (TF)-TAVI approach was identified. The interobserver agreement for both measurements was assessed by calculating the intraclass correlation coefficient (ICC). The average diameters were 10.1 ± 1.8 mm and 8.4 ± 1.7 for XA and CTA respectively. The mean paired difference was 1.73 mm (p < 0.001). For 18 patients (17.6 %) diameters measured on CTA images, were bilaterally less than 6 mm, whilst XA indicated a minimum diameter exceeding 6 mm. For both modalities, the interobserver agreement was excellent (ICC 0.95). Diameters measured semi-automatically on CTA were statistically significantly smaller compared to XA. This should be acknowledged in the work-up for selecting the most appropriate approach for TAVI. In our population 17.6 % of patients would have been denied a transfemoral TAVI based on CTA measurements, whilst XA suggested diameters sufficient for a TF approach.

  8. A chicken influenza virus recognizes fucosylated α2,3 sialoglycan receptors on the epithelial cells lining upper respiratory tracts of chickens.

    PubMed

    Hiono, Takahiro; Okamatsu, Masatoshi; Nishihara, Shoko; Takase-Yoden, Sayaka; Sakoda, Yoshihiro; Kida, Hiroshi

    2014-05-01

    Influenza viruses recognize sialoglycans as receptors. Although viruses isolated form chickens preferentially bind to sialic acid α2,3 galactose (SAα2,3Gal) glycans as do those of ducks, chickens were not experimentally infected with viruses isolated from ducks. A chicken influenza virus, A/chicken/Ibaraki/1/2005 (H5N2) (Ck/IBR) bound to fucose-branched SAα2,3Gal glycans, whereas the binding towards linear SAα2,3Gal glycans was weak. On the epithelial cells of the upper respiratory tracts of chickens, fucose-branched SAα2,3Gal glycans were detected, but not linear SAα2,3Gal glycans. The growth of Ck/IBR in MDCK-FUT cells, which were genetically prepared to express fucose-branched SAα2,3Gal glycans, was significantly higher than that in the parental MDCK cells. The present results indicate that fucose-branched SAα2,3Gal glycans existing on the epithelial cells lining the upper respiratory tracts of chickens are critical for recognition by Ck/IBR.

  9. Multiscale white matter fiber tract coregistration: a new feature-based approach to align diffusion tensor data.

    PubMed

    Leemans, A; Sijbers, J; De Backer, S; Vandervliet, E; Parizel, P

    2006-06-01

    In this paper an automatic multiscale feature-based rigid-body coregistration technique for diffusion tensor imaging (DTI) based on the local curvature kappa and torsion tau of the white matter (WM) fiber pathways is presented. As a similarity measure, the mean squared difference (MSD) of corresponding fiber pathways in (kappa, tau)-space is chosen. After the MSD is minimized along the arc length of the curve, principal component analysis is applied to calculate the transformation parameters. In addition, a scale-space representation of the space curves is incorporated, resulting in a multiscale robust coregistration technique. This fully automatic technique inherently allows one to apply region of interest (ROI) coregistration, and is adequate for performing both global and local transformations. Simulations were performed on synthetic DT data to evaluate the coregistration accuracy and precision. An in vivo coregistration example is presented and compared with a voxel-based coregistration approach, demonstrating the feasibility and advantages of the proposed technique to align DT data of the human brain.

  10. 3D-SSF: A bio-inspired approach for dynamic multi-subject clustering of white matter tracts.

    PubMed

    Chekir, A; Hassas, S; Descoteaux, M; Côté, M; Garyfallidis, E; Oulebsir-Boumghar, F

    2017-01-27

    There is growing interest in the study of white matter (WM) variation across subjects, and in particular the analysis of specific WM bundles, to better understand brain development and aging, as well as to improve early detection of some diseases. Several WM multi-subject clustering methods have been proposed to study WM bundles. These methods aim to overcome the complexity of the problem, which includes the huge size of the WM tractography datasets generated from multiple subjects, the existence of various streamlines with different positions, lengths and geometric forms, as well as the presence of outliers. However, the current methods are not sufficiently flexible to address all of these constraints. Here we introduce a novel dynamic multi-subject clustering framework based on a distributed multiagent implementation of the Multiple Species Flocking model, that we name 3D-Streamlines Stream Flocking (3D-SSF). Specifically, we consider streamlines from different subjects as data streams, and each streamline is assigned to a mobile agent. Agents work together following flocking rules in order to form a flock. Thanks to a similarity function, the agents that are associated with similar streamlines form a flock, whereas the agents that are associated with dissimilar streamlines are considered outliers. We use various experiments performed on noisy synthetic and real human brain data to validate 3D-SSF and demonstrate that it is more efficient and robust to outliers compared to other classical approaches. 3D-SSF is able to extract WM bundles at a population level, while considering WM variation across subjects and eliminating outlier streamlines.

  11. Emerging molecular approaches in stem cell biology.

    PubMed

    Jaishankar, Amritha; Vrana, Kent

    2009-04-01

    Stem cells are characterized by their ability to self-renew and differentiate into multiple adult cell types. Although substantial progress has been made over the last decade in understanding stem cell biology, recent technological advances in molecular and systems biology may hold the key to unraveling the mystery behind stem cell self-renewal and plasticity. The most notable of these advances is the ability to generate induced pluripotent cells from somatic cells. In this review, we discuss our current understanding of molecular similarities and differences among various stem cell types. Moreover, we survey the current state of systems biology and forecast future needs and direction in the stem cell field.

  12. Diminished CD103 (αEβ7) Expression on Resident T Cells from the Female Genital Tract of HIV-Positive Women

    PubMed Central

    Moylan, David C.; Goepfert, Paul A.; Kempf, Mirjam-Colette; Saag, Michael S.; Richter, Holly E.; Mestecky, Jiri; Sabbaj, Steffanie

    2017-01-01

    Background Tissue resident memory T cells (TrM) provide an enhanced response against infection at mucosal surfaces, yet their function has not been extensively studied in humans, including the female genital tract (FGT). Methods Using polychromatic flow cytometry, we studied TrM cells, defined as CD62L−CCR7−CD103+CD69+ CD4+ and CD8+ T cells in mucosa-derived T cells from healthy and HIV-positive women. Results We demonstrate that TrM are present in the FGT of healthy and HIV-positive women. The expression of the mucosal retention receptor, CD103, from HIV-positive women was reduced compared to healthy women and was lowest in women with CD4 counts < 500 cells/mm3. Furthermore, CD103 expression on mucosa-derived CD8+ T cells correlated with antigen-specific IFN-γ production by mucosal CD4+ T cells and was inversely correlated with T-bet from CD8+CD103+ mucosa-derived T cells. Conclusions These data suggest that CD4+ T cells, known to be impaired during HIV-1 infection and necessary for the expression of CD103 in murine models, may play a role in the expression of CD103 on resident T cells from the human FGT. PMID:28164171

  13. Distribution, parabrachial region projection, and coexistence of neuropeptide and catecholamine cells of the nucleus of the solitary tract in the pigeon.

    PubMed

    Berk, M L; Smith, S E; Mullins, L A

    1993-01-15

    The chemical nature of the cells of the nucleus of the solitary tract (NTS) that project to the parabrachial nucleus (PB) was investigated in the pigeon by the use of fluorescent bead retrograde tracer and immunofluorescence for the detection of substance P (SP), leucine-enkephalin (LENK), cholecystokinin (CCK), neurotensin (NT), somatostatin (SS), and tyrosine hydroxylase (TH). Cells immunoreactive for CCK were located in subnuclei lateralis dorsalis pars anterior (LDa) and medialis superficialis pars posterior, and caudal NTS (cNTS); 22-26.5% of these cells were double-labeled bilaterally. Immunoreactive SP cells were found in ventral NTS subnuclei; 24-25% of these cells were double-labeled bilaterally. Cells immunoreactive for LENK and NT were concentrated in the anterior NTS; 5.5-7.5% of the LENK cells were double-labeled bilaterally, while 11% (ipsilateral) and 21% (contralateral) of the NT immunoreactive cells were double-labeled. Many SS immunoreactive cells were found in peripherally located subnuclei; 5.5-6.5% of these cells were double-labeled bilaterally. Catecholamine cells were distributed in LDa, peripheral subnuclei, and cNTS; 23% of these cells were double-labeled ipsilaterally and 8.5% contralaterally. A two-color double-labeling immunofluorescence technique revealed many cells immunoreactive for both NT and LENK, only a rare cell immunoreactive for both SS and SP, and no cells immunoreactive for both TH and SP. Cells immunoreactive for SP, CCK, NT, and TH are major contributors to NTS projections to PB. The confinement of these substances to specific NTS subnuclei, which receive visceral sensory information from specific organs, may contribute to the chemical encoding of ascending visceral information.

  14. Increases in Endogenous or Exogenous Progestins Promote Virus-Target Cell Interactions within the Non-human Primate Female Reproductive Tract

    PubMed Central

    Carias, Ann M.; Fought, Angela J.; Kotnik Halavaty, Katarina; Anderson, Meegan R.; Jimenez, Maria L.; McRaven, Michael D.; Gioia, Casey J.; Henning, Tara R.; Smith, James M.; Pereira, Lara E.; Butler, Katherine; McNicholl, S. Janet M.; Hendry, R. Michael; Hope, Thomas J.

    2016-01-01

    Currently, there are mounting data suggesting that HIV-1 acquisition in women can be affected by the use of certain hormonal contraceptives. However, in non-human primate models, endogenous or exogenous progestin-dominant states are shown to increase acquisition. To gain mechanistic insights into this increased acquisition, we studied how mucosal barrier function and CD4+ T-cell and CD68+ macrophage density and localization changed in the presence of natural progestins or after injection with high-dose DMPA. The presence of natural or injected progestins increased virus penetration of the columnar epithelium and the infiltration of susceptible cells into a thinned squamous epithelium of the vaginal vault, increasing the likelihood of potential virus interactions with target cells. These data suggest that increasing either endogenous or exogenous progestin can alter female reproductive tract barrier properties and provide plausible mechanisms for increased HIV-1 acquisition risk in the presence of increased progestin levels. PMID:27658293

  15. Characterization of obestatin- and ghrelin-producing cells in the gastrointestinal tract and pancreas of rats: an immunohistochemical and electron-microscopic study.

    PubMed

    Zhao, Chun-Mei; Furnes, Marianne W; Stenström, Björn; Kulseng, Bård; Chen, Duan

    2008-03-01

    Both ghrelin and obestatin are derived from preproghrelin by post-translational processing. We have morphologically characterized the cells that produce obestatin and ghrelin in new-born and adult Sprague-Dawley rats that were freely fed, fasted, or subjected to gastric bypass surgery or reserpine treatment. Tissue samples collected from the gastrointestinal tract and pancreas were examined by double-immunofluorescence staining, immunoelectron microscopy, and conventional electron microscopy. Obestatin was present in the stomach, duodenum, jejunum, colon, and pancreas. In the stomach, differences were noted in the development of obestatin- and preproghrelin-immunreactive (IR) cells on the one hand and ghrelin-IR cells on the other, particularly 2 weeks after birth. Preproghrelin- and obestatin-IR cells were more numerous than ghrelin-IR cells in the stomach, suggesting the lack of ghrelin in some A-like cells. Most obestatin-producing cells in the stomach were distributed in the basal part of the oxyntic mucosa; these cells co-localized with chromogranin A (pancreastatin) and vesicle monoamine transporters type 1 and 2, but not with serotonin or histidine decarboxylase. Immunoelectron microscopy revealed the obestatin- and ghrelin-producing cells to be A-like cells, characterized by numerous highly electron-dense granules containing ghrelin and obestatin. Some granules exhibited an even electron density with thin electron-lucent halos, suggestive of monoamines. Feeding status, gastric bypass surgery, and reserpine treatment had no obvious effect on the A-like cells. In the pancreas, obestatin was present in the peripheral part of the islets, with a distribution distinct from that of glucagon-producing A cells, insulin-producing beta cells, and cells producing pancreatic polypeptide Y. Thus, obestatin and ghrelin co-localize with an anticipated monoamine in A-like cells in the stomach, and obestatin is found in pancreatic islets.

  16. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system.

    PubMed

    Pelaseyed, Thaher; Bergström, Joakim H; Gustafsson, Jenny K; Ermund, Anna; Birchenough, George M H; Schütte, André; van der Post, Sjoerd; Svensson, Frida; Rodríguez-Piñeiro, Ana M; Nyström, Elisabeth E L; Wising, Catharina; Johansson, Malin E V; Hansson, Gunnar C

    2014-07-01

    The gastrointestinal tract is covered by mucus that has different properties in the stomach, small intestine, and colon. The large highly glycosylated gel-forming mucins MUC2 and MUC5AC are the major components of the mucus in the intestine and stomach, respectively. In the small intestine, mucus limits the number of bacteria that can reach the epithelium and the Peyer's patches. In the large intestine, the inner mucus layer separates the commensal bacteria from the host epithelium. The outer colonic mucus layer is the natural habitat for the commensal bacteria. The intestinal goblet cells secrete not only the MUC2 mucin but also a number of typical mucus components: CLCA1, FCGBP, AGR2, ZG16, and TFF3. The goblet cells have recently been shown to have a novel gate-keeping role for the presentation of oral antigens to the immune system. Goblet cells deliver small intestinal luminal material to the lamina propria dendritic cells of the tolerogenic CD103(+) type. In addition to the gel-forming mucins, the transmembrane mucins MUC3, MUC12, and MUC17 form the enterocyte glycocalyx that can reach about a micrometer out from the brush border. The MUC17 mucin can shuttle from a surface to an intracellular vesicle localization, suggesting that enterocytes might control and report epithelial microbial challenge. There is communication not only from the epithelial cells to the immune system but also in the opposite direction. One example of this is IL10 that can affect and improve the properties of the inner colonic mucus layer. The mucus and epithelial cells of the gastrointestinal tract are the primary gate keepers and controllers of bacterial interactions with the host immune system, but our understanding of this relationship is still in its infancy.

  17. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system

    PubMed Central

    Pelaseyed, Thaher; Bergström, Joakim H.; Gustafsson, Jenny K.; Ermund, Anna; Birchenough, George M. H.; Schütte, André; van der Post, Sjoerd; Svensson, Frida; Rodríguez-Piñeiro, Ana M.; Nyström, Elisabeth E.L.; Wising, Catharina; Johansson, Malin E.V.; Hansson, Gunnar C.

    2014-01-01

    Summary The gastrointestinal tract is covered by mucus that has different properties in the stomach, small intestine and colon. The large highly glycosylated gel-forming mucins MUC2 and MUC5AC are the major components of the mucus in the intestine and stomach, respectively. In the small intestine mucus limits the number of bacteria that can reach the epithelium and the Peyer’s patches. In the large intestine the inner mucus layer separates the commensal bacteria from the host epithelium. The outer colonic mucus layer is the natural habitat for the commensal bacteria. The intestinal goblet cells not only secrete the MUC2 mucin, but also a number of typical mucus components: CLCA1, FCGBP, AGR2, ZG16, and TFF3. The goblet cells have recently been shown to have a novel gate-keeping role for the presentation of oral antigens to the immune system. Goblet cells deliver small intestinal luminal material to the lamina propria dendritic cells of the tolerogenic CD103+-type. In addition to the gel forming mucins, the transmembrane mucins MUC3, MUC12 and MUC17 form the enterocyte glycocalyx that can reach about a micrometer out from the brush border. The MUC17 mucin can shuttle from a surface to an intracellular vesicle localization suggesting that enterocytes might control and report epithelial microbial challenge. There is not only communication from the epithelial cells to the immune system, but also in the opposite direction. One example of this is IL10 that can affect and improve the properties of the inner colonic mucus layer. The mucus and epithelial cells of the gastrointestinal tract are the primary gate keepers and controllers of bacterial interactions with the host immune system, but our understanding of this relationship is still in its infancy. PMID:24942678

  18. Activation of the aryl hydrocarbon receptor pathway enhances cancer cell invasion by upregulating the MMP expression and is associated with poor prognosis in upper urinary tract urothelial cancer.

    PubMed

    Ishida, Masaru; Mikami, Shuji; Kikuchi, Eiji; Kosaka, Takeo; Miyajima, Akira; Nakagawa, Ken; Mukai, Makio; Okada, Yasunori; Oya, Mototsugu

    2010-02-01

    Aryl hydrocarbon receptor (AhR) and the activation of the AhR pathway are involved in xenobiotic-induced toxicity and carcinogenesis. Although xenobiotics, such as cigarette smoke, contribute to the development of urothelial carcinoma (UC), the relationship between AhR and UC is unclear. In the present study, we investigated AhR expression in 209 patients with upper urinary tract UC. The nuclear expression of AhR was significantly associated with histological grade, pathological T stage, lymphovascular invasion and lymph node involvement. A multivariate Cox analysis revealed that nuclear AhR expression was a significant and independent predictor for disease-specific survival (hazard ratio = 2.469, P = 0.013). To determine whether the AhR pathway can be activated in the T24 UC cell line, we examined the expression of cytochrome P450 (CYP) 1A1 and CYP1B1, which are target genes of the AhR pathway, following exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), a ligand of AhR. TCDD treatment upregulated the expression levels of AhR, CYP1A1 and CYP1B1. TCDD enhanced T24 cell invasion associated with the upregulation of matrix metalloproteinase (MMP)-1 and MMP-9. Furthermore, targeting AhR messenger RNA (mRNA) expression in T24 cells with small interfering RNA (siRNA) downregulated the mRNA expression of AhR, CYP1A1, CYP1B1, MMP-1, MMP-2 and MMP-9; furthermore, the cells transfected with siRNA for AhR showed decreased invasion activity in comparison with the cells transfected with a non-targeting siRNA. Our results therefore suggest that AhR plays a role in the invasiveness of UC cells and can serve as a marker for the prognosis of upper urinary tract UC.

  19. Herpes Simplex Virus Type 2 Glycoprotein H Interacts with Integrin αvβ3 To Facilitate Viral Entry and Calcium Signaling in Human Genital Tract Epithelial Cells

    PubMed Central

    Cheshenko, Natalia; Trepanier, Janie B.; González, Pablo A.; Eugenin, Eliseo A.; Jacobs, William R.

    2014-01-01

    ABSTRACT Herpes simplex virus (HSV) entry requires multiple interactions at the cell surface and activation of a complex calcium signaling cascade. Previous studies demonstrated that integrins participate in this process, but their precise role has not been determined. These studies were designed to test the hypothesis that integrin αvβ3 signaling promotes the release of intracellular calcium (Ca2+) stores and contributes to viral entry and cell-to-cell spread. Transfection of cells with small interfering RNA (siRNA) targeting integrin αvβ3, but not other integrin subunits, or treatment with cilengitide, an Arg-Gly-Asp (RGD) mimetic, impaired HSV-induced Ca2+ release, viral entry, plaque formation, and cell-to-cell spread of HSV-1 and HSV-2 in human cervical and primary genital tract epithelial cells. Coimmunoprecipitation studies and proximity ligation assays indicated that integrin αvβ3 interacts with glycoprotein H (gH). An HSV-2 gH-null virus was engineered to further assess the role of gH in the virus-induced signaling cascade. The gH-2-null virus bound to cells and activated Akt to induce a small Ca2+ response at the plasma membrane, but it failed to trigger the release of cytoplasmic Ca2+ stores and was impaired for entry and cell-to-cell spread. Silencing of integrin αvβ3 and deletion of gH prevented phosphorylation of focal adhesion kinase (FAK) and the transport of viral capsids to the nuclear pore. Together, these findings demonstrate that integrin signaling is activated downstream of virus-induced Akt signaling and facilitates viral entry through interactions with gH by activating the release of intracellular Ca2+ and FAK phosphorylation. These findings suggest a new target for HSV treatment and suppression. IMPORTANCE Herpes simplex viruses are the leading cause of genital disease worldwide, the most common infection associated with neonatal encephalitis, and a major cofactor for HIV acquisition and transmission. There is no effective vaccine

  20. Novel bacteriochlorine for high tissue-penetration: photodynamic properties in human biliary tract cancer cells in vitro and in a mouse tumour model.

    PubMed

    Oertel, Michael; Schastak, Stanislaw I; Tannapfel, Andrea; Hermann, Ralf; Sack, Ulrich; Mössner, Joachim; Berr, Frieder

    2003-10-15

    Photodynamic therapy of bile duct cancer using hematoporphyrin derivative (HPD) and laser light of 630 nm wavelength is confined to a tumouricidal tissue penetration of 4 mm, which might be doubled with laser light between 700 and 800 nm. Therefore, we investigated the photosensitising properties of a novel bacteriochlorine, tetrakis-pyridyl-tetrahydroporphyrin tosylat (THP) with high absorption at 763 nm. Two biliary cancer cell lines (BDC, GBC) were incubated with HPD or THP to assess cellular uptake kinetics, dark cytotoxicity, and photodynamic cytotoxicity (laser light exposure 1-20 J/cm2). Tumours grown from BDC cells in subcutaneous tissue of severe combined immunodeficient mice were treated with laser light of 30 J/cm2 after injection of THP. The concentrations that killed 50% of cells in the dark were 680 microg/ml of HPD, but > 6400 microg/ml of THP in BDC cells, and 220 microg/ml of HPD, but 6400 microg/ml of THP in GBC cells. Both cell lines exhibited uptake and retention of THP and photodynamic cytotoxicity (up to 86% cells killed). THP induced tumour-selective phototoxicity in the cholangiocarcinoma model. The novel bacteriochlorine THP exhibits photosensitiser properties in biliary tract cancer cells in vitro and in vivo and could achieve deep tumouricidal tissue penetration due to photoactivation at 763 nm.

  1. [A case of spindle cell carcinoma of the stomach presenting with hematochezia and weight loss due to fistulous tract formation with colon].

    PubMed

    An, Ji Won; Cheung, Dae Young; Seo, Min Woo; Lee, Hyun Jung; Lee, In Kyu; Kim, Tae Jung; Kim, Jin Il; Kim, Jae Kwang

    2013-08-25

    Spindle cell carcinoma (SpCC) is a rare tumor consisting of spindle cells which express cytokeratin. Despite recent advances in immunohistochemical and genetic studies, precise histogenesis of SpCC is still controversial and this tumor had been referred to with a wide range of names (in the past): carcinosarcoma, pseudosarcoma, sarcomatoid carcinoma, pseudosarcomatous carcinoma, and collision tumor. Recently, the authors experienced an extremely rare case of SpCC arising from the stomach. A 64-year-old male presented with unintended weight loss and hematochezia. Endoscopic examination revealed a fistulous tract between the stomach and the transverse colon which was made by direct invasion of SpCC of the stomach to the colon. Histologically, the tumor was positive for both vimentin and cytokeratin but negative for CD117, CD34, actin, and desmin. Herein, we report a case of SpCC arising from the stomach that formed a fistulous tract with the colon which was diagnosed during evaluation of hematochezia and weight loss.

  2. Identification of homing receptors that mediate the recruitment of CD4 T cells to the genital tract following intravaginal infection with Chlamydia trachomatis.

    PubMed Central

    Kelly, K A; Rank, R G

    1997-01-01

    Murine genital infection induced with the mouse pneumonitis biovar of Chlamydia trachomatis (MoPn) elicits a short-lived protective immunity mediated primarily by Th1 CD4 cells. To understand the development of local cell-mediated immunity against C. trachomatis infection, we investigated the mechanism(s) which mediates CD4 lymphocyte migration to the genital mucosa by identifying molecules that could support this process. We found that primarily CD4 cells were recruited to the genital tract (GT) during primary and challenge MoPn infection. Peak levels were found 21 days after primary inoculation (15.4% +/- 2.7%) and 7 days (31.3% +/- 8.5%) after challenge but diminished after resolution of infection. The CD4 cells appeared to be recruited to the GT in response to infection since these cells expressed the profile of activated, or memory, cells. We also observed up-regulation of homing receptors containing LFA-1 (CD11a) and alpha4 (CD49d) on GT CD4 cells over the course of infection. Furthermore, the mucosal homing receptor chain, beta7, but not the peripheral homing receptor chain beta1 (CD29), was detected on GT CD4 cells. MoPn-infected GT tissue expressed the endothelial cell ligands vascular cell adhesion molecule 1 (VCAM-1), intracellular adhesion molecule 1 (ICAM-1), and mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1), which correspond to the homing receptors on GT CD4 cells. Interestingly, VCAM-1 and MAdCAM-1 were not expressed in the GTs of uninfected mice but were temporarily induced following infection, indicating that expression of endothelial ligands in the GT are regulated by chlamydial infection. These data suggest that recruitment of CD4 cells to the GT is mediated through LFA-1:ICAM-1 and alpha4beta7:MAdCAM-1-VCAM-1 interactions. PMID:9393816

  3. A Multifaceted Approach to Reduction of Catheter-Associated Urinary Tract Infections in the Intensive Care Unit With an Emphasis on "Stewardship of Culturing".

    PubMed

    Mullin, Katherine M; Kovacs, Christopher S; Fatica, Cynthia; Einloth, Colette; Neuner, Elizabeth A; Guzman, Jorge A; Kaiser, Eric; Menon, Venu; Castillo, Leticia; Popovich, Marc J; Manno, Edward M; Gordon, Steven M; Fraser, Thomas G

    2017-02-01

    BACKGROUND Catheter-associated urinary tract infections (CAUTIs) are among the most common hospital-acquired infections (HAIs). Reducing CAUTI rates has become a major focus of attention due to increasing public health concerns and reimbursement implications. OBJECTIVE To implement and describe a multifaceted intervention to decrease CAUTIs in our ICUs with an emphasis on indications for obtaining a urine culture. METHODS A project team composed of all critical care disciplines was assembled to address an institutional goal of decreasing CAUTIs. Interventions implemented between year 1 and year 2 included protocols recommended by the Centers for Disease Control and Prevention for placement, maintenance, and removal of catheters. Leaders from all critical care disciplines agreed to align routine culturing practice with American College of Critical Care Medicine (ACCCM) and Infectious Disease Society of America (IDSA) guidelines for evaluating a fever in a critically ill patient. Surveillance data for CAUTI and hospital-acquired bloodstream infection (HABSI) were recorded prospectively according to National Healthcare Safety Network (NHSN) protocols. Device utilization ratios (DURs), rates of CAUTI, HABSI, and urine cultures were calculated and compared. RESULTS The CAUTI rate decreased from 3.0 per 1,000 catheter days in 2013 to 1.9 in 2014. The DUR was 0.7 in 2013 and 0.68 in 2014. The HABSI rates per 1,000 patient days decreased from 2.8 in 2013 to 2.4 in 2014. CONCLUSIONS Effectively reducing ICU CAUTI rates requires a multifaceted and collaborative approach; stewardship of culturing was a key and safe component of our successful reduction efforts. Infect Control Hosp Epidemiol 2017;38:186-188.

  4. Identification of C-kit-positive interstitial cells in the dog lower urinary tract and relationship with smooth muscle and nerves. Hypotheses for a likely pacemaker role.

    PubMed

    Arrighi, Silvana; Bosi, Giampaolo; Groppetti, Debora; Cremonesi, Fausto

    2010-01-01

    The aim of this work was to give an evidence of the likely presence of interstitial cells in the canine lower urinary tract and to study their possible interactions with the musculature and the intramural innervation. Cryosections of normal canine bladder and urethra were immunofluorescently labelled with c-kit, a transmembrane, tyrosine kinase growth factor receptor, known to be expressed on the interstitial cells of Cajal (ICCs) of the gut. The relationship with antiactin positive smooth muscle cells and PGP9.5-positive intramural innervation was also investigated by confocal microscopy. Anti-c-kit labelling demonstrated a network of elongated and branched c-kit positive cells, which were located in interstitial spaces, oriented in parallel to the smooth muscle bundles that form the bladder muscular layer, irrespective of dog sex. Cells with a similar localization were also PAS- and NADPH-diaphorase-positive. A contact between c-kit immunofluorescent cells and intramural innervation was demonstrated, too. The roles of interstitial cells might include regulation of smooth muscle activity of the bladder detrusor, integrating neuronal signals during urine storage and voiding.

  5. Small molecule-based approaches to adult stem cell therapies.

    PubMed

    Lairson, Luke L; Lyssiotis, Costas A; Zhu, Shoutian; Schultz, Peter G

    2013-01-01

    There is considerable interest in the development of stem cell-based strategies for the treatment of a broad range of human diseases, including neurodegenerative, autoimmune, cardiovascular, and musculoskeletal diseases. To date, such regenerative approaches have focused largely on the development of cell transplantation therapies using cells derived from pluripotent embryonic stem cells (ESCs). Although there have been exciting preliminary reports describing the efficacy of ESC-derived replacement therapies, approaches involving ex vivo manipulated ESCs are hindered by issues of mutation, immune rejection, and ethical controversy. An alternative approach involves direct in vivo modulation or ex vivo expansion of endogenous adult stem cell populations using drug-like small molecules. Here we describe chemical approaches to the regulation of somatic stem cell biology that are yielding new biological insights and that may ultimately lead to innovative new medicines.

  6. Kidneys and Urinary Tract

    MedlinePlus

    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Kidneys and Urinary Tract KidsHealth > For Teens > Kidneys and ... be a sign of diabetes . continue What the Kidneys and Urinary Tract Do Although the two kidneys ...

  7. Uvangoletin induces mitochondria-mediated apoptosis in HL-60 cells in vitro and in vivo without adverse reactions of myelosuppression, leucopenia and gastrointestinal tract disturbances.

    PubMed

    Zheng, Zhuanzhen; Qiao, Zhenhua; Gong, Rong; Wang, Yalin; Zhang, Yiqun; Ma, Yanping; Zhang, Li; Lu, Yujin; Jiang, Bo; Li, Guoxia; Dong, Chunxia; Chen, Wenliang

    2016-02-01

    This study investigated the cytotoxic effect of uvangoletin on HL-60 cells, and the effects of uvangoletin on myelosuppression, leucopenia, gastrointestinal tract disturbances and the possible cytotoxic mechanisms by using CCK-8, flow cytometry, western blot, xenograft, cyclophosphamide-induced leucopenia, copper sulfate-induced emesis and ethanol-induced gastric mucosal lesions assays. The results of CCK-8, flow cytometry and western blot assays indicated that uvangoletin showed the cytotoxic effect on HL-60 cells and induced the apoptosis of HL-60 cells by downregulating the expression levels of anti-apoptotic proteins (Survivin, Bcl-xl and Bcl-2), upregulating the expression levels of pro-apoptotic proteins (Smac, Bax, Bad, c-caspase-3 and c-caspase-9), and promoting the release of cytochrome c from mitochondria to cytoplasm. Further, the results of xenograft assay suggested that uvangoletin inhibited the HL-60-induced tumor growth without adverse effect on body weight of nude mice in vivo by regulating the expression levels of above apoptotic proteins. The results indicated that the reductions of WBCs count and thighbone marrow granulocytes percentage in cyclophosphamide-induced leucopenia assay, the incubation period and number of emesis in copper sulfate-induced emesis assay and the gastric mucosal lesions in ethanol-induced gastric mucosal lesions assay were not exacerbated or reversed by uvangoletin. In conclusion, the research preliminarily indicated that uvangoletin induced apoptosis of HL-60 cells in vitro and in vivo without adverse reactions of myelosuppression, leucopenia and gastrointestinal tract disturbances, and the pro-apoptotic mechanisms may be related to mitochondria-mediated apoptotic pathway.

  8. Fungal Colonization of the Respiratory Tract in Allogeneic and Autologous Hematopoietic Stem Cell Transplant Recipients: A Study of 573 Transplanted Patients

    PubMed Central

    Markowski, Jarosław; Helbig, Grzegorz; Widziszowska, Agnieszka; Likus, Wirginia; Kyrcz-Krzemień, Sławomira; Jarosz, Urszula; Dziubdziela, Włodzimierz; Markiewicz, Mirosław

    2015-01-01

    Background Fungal colonization and infections remain a major cause of infection morbidity and mortality following hematopoietic stem cell transplantation (HSCT) in patients with hematological malignancies. The aim of this study was to analyze the spectrum of fungal microflora of the respiratory tract (oral cavity, pharynx, epiglottis, and sputum) in patients undergoing HSCT and to evaluate the relationship between HSCT type and incidence of mycotic colonization and infections. Material/Methods Retrospective analysis of fungal isolates collected from the respiratory tract (oral cavity, pharynx, epiglottis, and sputum) of 573 patients undergoing HSCT was performed. Results The overall rate of fungal colonization in patients undergoing HSCT was 8.7%. Patients undergoing allogeneic HSCT were statistically significantly more often colonized (12.95%) compared to autologous HSCT recipients (4.7%). Colonizing cultures were mainly C. albicans and C. krusei, and sporadically C. glabrata, C. famata, Aspergillus spp. and Saccharomyces cerevisiae. C. albicans was the most frequent species found in isolates from the pharynx, sputum, and oral cavity collected from patients undergoing HSCT. Aspergillosis was more common after allogeneic than after autologous HSCT. The pharynx was the most frequently colonized site. Conclusions Allogeneic HSCT recipients are more susceptible to fungal infections compared to the autologous group. Selection of species during prophylaxis and antifungal therapy requires developing more effective prevention and treatment strategies based on new antifungal drugs and microbe-specific diagnoses. PMID:25907308

  9. [Specific features of centriole formation and ciliogenesis in ciliary epithelium cells of respiratory tracts in patients with Kartagener syndrome].

    PubMed

    Domaratskiĭ, K E; Uvakina, E V; Volkov, I K; Onishchenko, G E

    2005-01-01

    An electron microscopic study of the ciliary epithelium of respiratory tracts was carried out in children (members of the same family) with Kartagener syndrome, which is a variant of ciliary dyskinesia. It was shown that in the case of both mobile cilia and ciliary dyskinesia in man, centrioles are formed during formation of the ciliary basal bodies predominantly de novo, involving deuterosomes. A wide spectrum of pathological changes was described in literature, such as the absence of dynein arms in the axoneme and disorganization of axoneme structure. In addition to these changes in the ciliary system, we found integration of several ciliary axonemes by the same plasma membrane, running of microtubules from the plasma membrane as bundles, different orientation of basal legs, etc.

  10. A 3-way collision tumor of the upper respiratory tract: a composite of 2 immunophenotypically distinct mantle cell lymphomas and a plasmacytoma.

    PubMed

    Wang, Huan-You; Karandikar, Nitin; Payne, Deborah; Maleki, Atousa; Schultz, Barbara A; Collins, Robert; McKenna, Robert W

    2008-05-01

    Composite lymphoma (CL) is composed of 2 or more morphologically and immunophenotypically distinct lymphomas in a single anatomical site. Here we report a unique CL of the upper respiratory tract in an elderly male patient. Morphologically, the lymphoma was composed of 2 distinct and well-demarcated areas consisting of monotonous small to medium-sized lymphocytes and sheets of mature-appearing plasma cells. Immunophenotyping by both flow cytometry and immunohistochemistry revealed that the small to medium-sized lymphocytes were composed of 2 distinct subpopulations sharing a CD5(+)/CD19(+)/CD20(+)/CD22(+)/CD23(-)/FMC-7(+)/cyclin D1(+) immunophenotype but with different immunoglobulin (Ig) light and heavy chain expression, consistent with 2 immunophenotypically distinct mantle cell lymphomas (MCLs); the plasma cells were composed of CD38(bright +)/CD138(+)/IgG kappa-restricted plasma cells, consistent with a plasmacytoma. Fluorescence in situ hybridization showed the t(11;14) translocation present in the lymphocyte region but absent in the plasma cell area. Ig heavy chain gene rearrangement studies on manually dissected populations showed 2 distinct patterns for the MCL and plasmacytoma. To our knowledge, this is the first report of a 3-way CL consisting of 2 immunophenotypically distinct MCLs and a plasmacytoma.

  11. Electrical stimulation of the medullary pyramid promotes proliferation and differentiation of oligodendrocyte progenitor cells in the corticospinal tract of the adult rat

    PubMed Central

    Li, Qun; Brus-Ramer, Marcel; Martin, John H.; McDonald, John W.

    2010-01-01

    Endogenous tri-potential neural stem cells (eNSCs) exist in the adult spinal cord and differentiate primarily into oligodendrocytes (OLs) and astrocytes. Previous in vivo and in vitro studies have shown that during development proliferation and differentiation of oligodendrocyte progenitor cells (OPCs) depend on activity in neighboring axons. However, this activity-dependent development of OPCs has not been examined in the adult CNS. In the present study, we stimulated unilateral corticospinal (CS) axons of the adult rat and investigated proliferation and differentiation of OPCs in dorsal corticospinal tract (dCST). eNSCs were labeled with the mitotic indicator 5-Bromo-2′-deoxyuridine (BrdU). Phenotypes of proliferating cells were identified by double-immunolabeling of BrdU with a panel of antibodies to cell markers: NG2, Nkx2.2, APC, GFAP, and Glut-1. Electrical stimulation of CS axons increased BrdU labeled eNSCs and promoted the proliferation and differentiation of OPCs, but not astrocytes and endothelial cells. Our findings demonstrate the importance of neural activity in regulating OPC proliferation/differentiation in the mature CNS. Selective pathway electrical stimulation could be used to promote remyelination and recovery of function in CNS injury and disease. PMID:20493923

  12. A Case Report of NK-Cell Lymphoproliferative Disease With a Wide Involvement of Digestive Tract Develop Into Epstein–Barr Virus Associated NK/T Cell Lymphoma in an Immunocompetent Patient

    PubMed Central

    Chen, Haotian; Zhang, Yu; Jiang, Zhinong; Zhou, Wei; Cao, Qian

    2016-01-01

    Abstract Epstein–Barr virus (EBV) plays an important role in various diseases. EBV-associated lymphoproliferative disease (LPD) is a rare disease with a canceration tendency. It is difficult to differentiate LPD with involvement of digestive tract from Crohn disease due to similar clinical and endoscopic manifestations. We present a case report of multiple ulcers with esophagus, small bowel and the entire colon involved, proved to be NK-Cell LPD, developed into EBV-associated NK/T Cell lymphoma, in an immunocompetent man who was initially misdiagnosed as Crohn disease. This report underscores that intestinal ulcers should be cautiously diagnosed, for it sometimes could be a precancerous lesion. PMID:27015206

  13. A different approach to solar cell simulation

    SciTech Connect

    Kavasoglu, Nese; Kavasoglu, A. Sertap; Metin, Bengul

    2015-10-15

    Highlights: • A new simulation program has been developed and operated for the Au/n-GaN device. • Device inhomogeneity is introduced to program via fluctuation factor term. • The barrier height fluctuation factor strongly affects the device characteristics. - Abstract: Zero barrier height inhomogeneity in the device is generally assumed to conform to Gaussian distribution in the literature. In this study, zero barrier height inhomogeneity has been adopted to obey random distribution. Cell was divided into elementary diodes, which were connected in parallel to each other. The current–voltage characteristics of the cell were obtained by developed device modeling program for various zero barrier height inhomogeneity levels at room temperature in dark and under light conditions. The cell parameters were then calculated by using simulated current–voltage data. It is displayed that increase in zero barrier height inhomogeneity results in Schottky barrier height enhancement and decrease in the diode factor of the cell. Fill factor and V{sub oc} values showed a decreasing trend with increasing zero barrier height inhomogeneity. Also, random distribution of zero barrier height effect on interface state density was examined. Interface state density increases with increasing zero barrier height inhomogeneity.

  14. Malignant gastrointestinal neuroectodermal tumor: clinicopathologic, immunohistochemical, ultrastructural, and molecular analysis of 16 cases with a reappraisal of clear cell sarcoma-like tumors of the gastrointestinal tract.

    PubMed

    Stockman, David L; Miettinen, Markku; Suster, Saul; Spagnolo, Dominic; Dominguez-Malagon, Hugo; Hornick, Jason L; Adsay, Volkan; Chou, Pauline M; Amanuel, Benhur; Vantuinen, Peter; Zambrano, Eduardo V

    2012-06-01

    patients were alive with regional, lymph node, and liver metastases, and 2 patients were alive with no evidence of disease. The tumor described here is an aggressive form of neuroectodermal tumor that should be separated from other primitive epithelioid and spindle cell tumors of the gastrointestinal tract. The distinctive ultrastructural features and absence of melanocytic differentiation serve to separate them from soft tissue clear cell sarcomas involving the gastrointestinal tract. The designation "malignant gastrointestinal neuroectodermal tumor" is proposed for this tumor type.

  15. The protective effects of total phenols in magnolia officinalix rehd. et wils on gastrointestinal tract dysmotility is mainly based on its influence on interstitial cells of cajal

    PubMed Central

    Tian, Hui; Huang, Dazhi; Li, Tao; Huang, Lihua; Zheng, Xingguang; Tang, Danxia; Zhang, Lu; Wang, Jian

    2015-01-01

    Magnolia officinalix Rehd. et Wils is a kind of herb which is widely used for gastrointestinal tract mobility disorder in Asian countries. In this study, we investigated whether the total phenols of Magnolia officinalix Rehd. et Wils (TPM) treatment improves gastrointestinal tract dysmobility induced by intraperitoneal injection of atropine (5 mg/kg) in rats. Rats were randomly grouped into three units: TPM-pretreated/atropine-treated group, atropinetreated group and control group. TPM were administrated for 7 days. Gastric residual rate and intestinal transit were measured 20 min after atropine injected, and gastrointestinal hormones (including: gastrin (GAS), motilin (MTL), somatostatin (SS) and p substance (PS) levels in serum were also measured by ELISA kits. The number and distribution of interstitial cells of Cajal (ICCs) in stomach were detected by immunohistochemistry analysis, while c-kit and stem cell factor (SCF) expressions in stomach were also measured by western blotting. We found that TPM pretreatment significantly improved atropine-induced gastric residual rate increase, while had no significantly effects on intestinal transit; it also significantly normalized GAS, MTL and PS serum levels. Atropine-induced ICCs numbers decreased in both sinuses ventriculi and body of stomach, which is improved by TPM pretreatment. Western blotting results showed the expressions of c-kit and SCF were down-regulated after atropine injection, which can be reversed with TPM pretreatment. These results above indicates that TPM treatment can significantly protected atropine-induced gastric dysmoblility, which may owed to its regulation on c-kit/SCF signing pathway. PMID:26884941

  16. The Antiproliferative Effect of Chakasaponins I and II, Floratheasaponin A, and Epigallocatechin 3-O-Gallate Isolated from Camellia sinensis on Human Digestive Tract Carcinoma Cell Lines

    PubMed Central

    Kitagawa, Niichiro; Morikawa, Toshio; Motai, Chiaki; Ninomiya, Kiyofumi; Okugawa, Shuhei; Nishida, Ayaka; Yoshikawa, Masayuki; Muraoka, Osamu

    2016-01-01

    Acylated oleanane-type triterpene saponins, namely chakasaponins I (1) and II (2), floratheasaponin A (3), and their analogs, together with catechins—including (–)-epigallocatechin 3-O-gallate (4), flavonoids, and caffeine—have been isolated as characteristic functional constituents from the extracts of “tea flower”, the flower buds of Camellia sinensis (Theaceae), which have common components with that of the leaf part. These isolates exhibited antiproliferative activities against human digestive tract carcinoma HSC-2, HSC-4, MKN-45, and Caco-2 cells. The antiproliferative activities of the saponins (1–3, IC50 = 4.4–14.1, 6.2–18.2, 4.5–17.3, and 19.3–40.6 µM, respectively) were more potent than those of catechins, flavonoids, and caffeine. To characterize the mechanisms of action of principal saponin constituents 1–3, a flow cytometric analysis using annexin-V/7-aminoactinomycin D (7-AAD) double staining in HSC-2 cells was performed. The percentage of apoptotic cells increased in a concentration-dependent manner. DNA fragmentation and caspase-3/7 activation were also detected after 48 h. These results suggested that antiproliferative activities of 1–3 induce apoptotic cell death via activation of caspase-3/7. PMID:27898032

  17. Phase II Trial Of PS-341 (Bortezomib) In Patients With Previously Treated Advanced Urothelial Tract Transitional Cell Carcinoma

    ClinicalTrials.gov

    2013-06-04

    Metastatic Transitional Cell Cancer of the Renal Pelvis and Ureter; Recurrent Bladder Cancer; Recurrent Transitional Cell Cancer of the Renal Pelvis and Ureter; Recurrent Urethral Cancer; Stage III Bladder Cancer; Stage III Urethral Cancer; Stage IV Bladder Cancer; Stage IV Urethral Cancer; Transitional Cell Carcinoma of the Bladder; Ureter Cancer

  18. Super-resolution Microscopy Approaches for Live Cell Imaging

    PubMed Central

    Godin, Antoine G.; Lounis, Brahim; Cognet, Laurent

    2014-01-01

    By delivering optical images with spatial resolutions below the diffraction limit, several super-resolution fluorescence microscopy techniques opened new opportunities to study biological structures with details approaching molecular structure sizes. They have now become methods of choice for imaging proteins and their nanoscale dynamic organizations in live cells. In this mini-review, we describe and compare the main far-field super-resolution approaches that allow studying endogenous or overexpressed proteins in live cells. PMID:25418158

  19. Statistical approaches and software for clustering islet cell functional heterogeneity

    PubMed Central

    Wills, Quin F.; Boothe, Tobias; Asadi, Ali; Ao, Ziliang; Warnock, Garth L.; Kieffer, Timothy J.

    2016-01-01

    ABSTRACT Worldwide efforts are underway to replace or repair lost or dysfunctional pancreatic β-cells to cure diabetes. However, it is unclear what the final product of these efforts should be, as β-cells are thought to be heterogeneous. To enable the analysis of β-cell heterogeneity in an unbiased and quantitative way, we developed model-free and model-based statistical clustering approaches, and created new software called TraceCluster. Using an example data set, we illustrate the utility of these approaches by clustering dynamic intracellular Ca2+ responses to high glucose in ∼300 simultaneously imaged single islet cells. Using feature extraction from the Ca2+ traces on this reference data set, we identified 2 distinct populations of cells with β-like responses to glucose. To the best of our knowledge, this report represents the first unbiased cluster-based analysis of human β-cell functional heterogeneity of simultaneous recordings. We hope that the approaches and tools described here will be helpful for those studying heterogeneity in primary islet cells, as well as excitable cells derived from embryonic stem cells or induced pluripotent cells. PMID:26909740

  20. Orthogonal cross-seeding: an approach to explore protein aggregates in living cells.

    PubMed

    Hinz, Justyna; Gierasch, Lila M; Ignatova, Zoya

    2008-04-08

    Protein aggregation is associated with the pathology of many diseases, especially neurodegenerative diseases. A variety of structurally polymorphic aggregates or preaggregates including amyloid fibrils is accessible to any aggregating protein. Preaggregates are now believed to be the toxic culprits in pathologies rather than mature aggregates. Although clearly valuable, understanding the mechanism of formation and the structural characteristics of these prefibrillar species is currently lacking. We report here a simple new approach to map the nature of the aggregate core of transient aggregated species directly in the cell. The method is conceptually based on the highly discriminating ability of aggregates to recruit new monomeric species with equivalent molecular structure. Different soluble segments comprising parts of an amyloidogenic protein were transiently pulse-expressed in a tightly controlled, time-dependent manner along with the parent aggregating full-length protein, and their recruitment into the insoluble aggregate was monitored immunochemically. We used this approach to determine the nature of the aggregate core of the metastable aggregate species formed during the course of aggregation of a chimera containing a long polyglutamine repeat tract in a bacterial host. Strikingly, we found that different segments of the full-length protein dominated the aggregate core at different times during the course of aggregation. In its simplicity, the approach is also potentially amenable to screen also for compounds that can reshape the aggregate core and induce the formation of alternative nonamyloidogenic species.

  1. Electromagnetic waves and living cells: A kinetic thermodynamic approach

    NASA Astrophysics Data System (ADS)

    Lucia, Umberto

    2016-11-01

    Cells are complex thermodynamic systems. Their energy transfer, thermo-electro-chemical processes and transports phenomena can occur across the cells membranes, the border of the complex system. Moreover, cells can also actively modify their behaviours in relation to any change of their environment. All the living systems waste heat, which is no more than the result of their internal irreversibility. This heat is dissipated into their environment. But, this wasted heat represents also a sort of information, which outflows from the cell towards its environment, completely accessible to any observer. The analysis of irreversibility related to this wasted heat can represent a new useful approach to the study of the cells behaviour. This approach allows us to consider the living systems as black boxes and analyse only the inflows and outflows and their changes in relation to any environmental change. This analysis allows also the explanation of the effects of electromagnetic fields on the cell behaviour.

  2. Algal Cell Factories: Approaches, Applications, and Potentials

    PubMed Central

    Fu, Weiqi; Chaiboonchoe, Amphun; Khraiwesh, Basel; Nelson, David R.; Al-Khairy, Dina; Mystikou, Alexandra; Alzahmi, Amnah; Salehi-Ashtiani, Kourosh

    2016-01-01

    With the advent of modern biotechnology, microorganisms from diverse lineages have been used to produce bio-based feedstocks and bioactive compounds. Many of these compounds are currently commodities of interest, in a variety of markets and their utility warrants investigation into improving their production through strain development. In this review, we address the issue of strain improvement in a group of organisms with strong potential to be productive “cell factories”: the photosynthetic microalgae. Microalgae are a diverse group of phytoplankton, involving polyphyletic lineage such as green algae and diatoms that are commonly used in the industry. The photosynthetic microalgae have been under intense investigation recently for their ability to produce commercial compounds using only light, CO2, and basic nutrients. However, their strain improvement is still a relatively recent area of work that is under development. Importantly, it is only through appropriate engineering methods that we may see the full biotechnological potential of microalgae come to fruition. Thus, in this review, we address past and present endeavors towards the aim of creating productive algal cell factories and describe possible advantageous future directions for the field. PMID:27983586

  3. Algal Cell Factories: Approaches, Applications, and Potentials.

    PubMed

    Fu, Weiqi; Chaiboonchoe, Amphun; Khraiwesh, Basel; Nelson, David R; Al-Khairy, Dina; Mystikou, Alexandra; Alzahmi, Amnah; Salehi-Ashtiani, Kourosh

    2016-12-13

    With the advent of modern biotechnology, microorganisms from diverse lineages have been used to produce bio-based feedstocks and bioactive compounds. Many of these compounds are currently commodities of interest, in a variety of markets and their utility warrants investigation into improving their production through strain development. In this review, we address the issue of strain improvement in a group of organisms with strong potential to be productive "cell factories": the photosynthetic microalgae. Microalgae are a diverse group of phytoplankton, involving polyphyletic lineage such as green algae and diatoms that are commonly used in the industry. The photosynthetic microalgae have been under intense investigation recently for their ability to produce commercial compounds using only light, CO₂, and basic nutrients. However, their strain improvement is still a relatively recent area of work that is under development. Importantly, it is only through appropriate engineering methods that we may see the full biotechnological potential of microalgae come to fruition. Thus, in this review, we address past and present endeavors towards the aim of creating productive algal cell factories and describe possible advantageous future directions for the field.

  4. Effects of Electroacupuncture on Interstitial Cells of Cajal (ICC) Ultrastructure and Connexin 43 Protein Expression in the Gastrointestinal Tract of Functional Dyspepsia (FD) Rats

    PubMed Central

    Zhang, Guoshan; Xie, Shen; Hu, Wei; Liu, Yuer; Liu, Mailan; Liu, Mi; Chang, Xiaorong

    2016-01-01

    Background Gastrointestinal motility disorder is the main clinical manifestation in functional dyspepsia (FD) patients. Electroacupuncture is effective in improving gastrointestinal motility disorder in FD; however, the underlying mechanism remains unclear. It has been demonstrated that interstitial cells of Cajal (ICC) are pacemaker cells in the gastrointestinal tract, and the pacemaker potential is transmitted to nearby cells through gap junctions between ICC or ICC and the smooth muscle. Therefore, this study aimed to assess the effects of electroacupuncture on ICC ultrastructure and expression of the gap junction protein connexin 43 (Cx43) in FD rats. Material/Methods The animals were randomized into 3 groups: control, model, and electroacupuncture. Electroacupuncture was applied at Zusanli (ST36) in the electroacupuncture group daily for 10 days, while no electroacupuncture was applied to model group animals. Results Ultrastructure of ICC recovered normally in gastric antrum and small intestine specimens was improved, with Cx43 expression levels in these tissues significantly increased in the electroacupuncture group compared with the model group. Conclusions These findings indicated that electroacupuncture is effective in alleviating ICC damage and reduces Cx43 levels in FD rats, and suggest that ICC and Cx43 are involved in electroacupuncture treatment in rats with FD to improve gastrointestinal motility disorders. PMID:27297942

  5. Conditional Deletion of the Relaxin Receptor Gene in Cells of Smooth Muscle Lineage Affects Lower Reproductive Tract in Pregnant Mice1

    PubMed Central

    Kaftanovskaya, Elena M.; Huang, Zaohua; Lopez, Carolina; Conrad, Kirk; Agoulnik, Alexander I.

    2015-01-01

    ABSTRACT Relaxin hormone secreted into the circulation during pregnancy was discovered through its effects on pubic symphysis relaxation and parturition. Genetic inactivation of the relaxin gene or its cognate relaxin family peptide receptor 1 (RXFP1) in mice caused failure of parturition and mammary nipple enlargement, as well as increased collagen fiber density in the cervix and vagina. However, the relaxin effect on discrete cells and tissues has yet to be determined. Using transgenic mice with a knockin LacZ reporter in the Rxfp1 allele, we showed strong expression of this gene in vaginal and cervical stromal cells, as well as pubic ligament cells. We produced a floxed Rxfp1 allele that was used in combination with the Tagln-cre transgene to generate mice with a smooth muscle-specific gene knockout. In pregnant females, the ROSA26 reporter activated by Tagln-cre was detected in smooth muscle cells of the cervix, vagina, uterine artery, and in cells of the pubic symphysis. In late pregnant females with conditional gene ablation, the length of pubic symphysis was significantly reduced compared with wild-type or heterozygous Rxfp1+/− females. Denser collagen content was revealed by Masson trichrome staining in reproductive tract organs, uterine artery, and pubic symphysis. The cervical and vaginal epithelium was less developed than in heterozygous or wild-type females, although nipple size was normal and the dams were able to nurse their pups. In summary, our data indicate that relaxin/RXFP1 signaling in smooth muscle cells is important for normal collagen turnover and relaxation of the pubic symphysis during pregnancy. PMID:25715795

  6. [Inhibition of carbohydrate metabilsm enzymes by pentachlorophenol in cells of pectinolytic bacteria from gastrointestinal tract of animals and effect of clinoptilolite adsorbents on this process].

    PubMed

    Kalachniuk, L H; Rusnak, N I; Kalachniuk, H I; Marounek, M; Savka, O H; Mel'nychuk, D O

    2006-01-01

    Changes in functional activity of specific enzyme reactions in the cells of pectinolytic bacteria from the gastrointestinal tract of animals in vitro cultivated in the medium containing pectin or glucose were studied against a background of the low dose effect of the wide spread biocide pentachlorophenol alone as well as in combination with the natural sorbents clinoptilolites. Regardless of the absence of transketolase reaction in the cells of all studied strains, they metabolized highly the above substrates that are dissimilar in chemical structure and produced different products of their degradation. It has been shown that the high metabolic level in the cells is provided by the function of the unique enzymatic reaction catalyzed by 2-keto-3-desoxy-6-phosphogluconate aldolase (EC 4.1.2.14) that permits to use effectively the metabolic pathway of Entner-Doudoroff. Cells could also utilize the same substrates via the Embden-Meyerhof-Parnas pathway, therefore they possess the other key reaction that is catalyzed by fructosobiphosphate aldolase (EC 4.1.2.13). Even a low dose of PCP (20 microM) decreased sharply activity of the mentioned key enzymes and intermediates' production in the cells of the studied strains with the use of both substrates. However, presence of clinoptilolites in the medium reduced significantly the biocide inhibition effect. Furthermore, in the medium with glucose, protection of intracellular metabolism with the help of sorbents was registered more clearly than with pectin. This can evidence for more mobile and simpler possibilities of accelerated production of necessary intermediates from glucose that are capable to induce activation of the key enzymatic reactions in cells utilizing selectively the substrates (which are different in accessibility and other characteristics) under the toxic agent effect.

  7. Enrichment of herpes simplex virus type 2 (HSV-2) reactive mucosal T cells in the human female genital tract.

    PubMed

    Posavad, C M; Zhao, L; Dong, L; Jin, L; Stevens, C E; Magaret, A S; Johnston, C; Wald, A; Zhu, J; Corey, L; Koelle, D M

    2017-01-04

    Local mucosal cellular immunity is critical in providing protection from HSV-2. To characterize and quantify HSV-2-reactive mucosal T cells, lymphocytes were isolated from endocervical cytobrush and biopsy specimens from 17 HSV-2-infected women and examined ex vivo for the expression of markers associated with maturation and tissue residency and for functional T-cell responses to HSV-2. Compared with their circulating counterparts, cervix-derived CD4+ and CD8+ T cells were predominantly effector memory T cells (CCR7-/CD45RA-) and the majority expressed CD69, a marker of tissue residency. Co-expression of CD103, another marker of tissue residency, was highest on cervix-derived CD8+ T cells. Functional HSV-2 reactive CD4+ and CD8+ T-cell responses were detected in cervical samples and a median of 17% co-expressed CD103. HSV-2-reactive CD4+ T cells co-expressed IL-2 and were significantly enriched in the cervix compared with blood. This first direct ex vivo documentation of local enrichment of HSV-2-reactive T cells in the human female genital mucosa is consistent with the presence of antigen-specific tissue-resident memory T cells. Ex vivo analysis of these T cells may uncover tissue-specific mechanisms of local control of HSV-2 to assist the development of vaccine strategies that target protective T cells to sites of HSV-2 infection.Mucosal Immunology advance online publication, 4 January 2017; doi:10.1038/mi.2016.118.

  8. Giant cell tumor of bone: Multimodal approach

    PubMed Central

    Gupta, AK; Nath, R; Mishra, MP

    2007-01-01

    Background: The clinical behavior and treatment of giant cell tumor of bone is still perplexing. The aim of this study is to clarify the clinico-pathological correlation of tumor and its relevance in treatment and prognosis. Materials and Methods: Ninety -three cases of giant cell tumor were treated during 1980-1990 by different methods. The age of the patients varied from 18-58 yrs with male and female ratio as 5:4. The upper end of the tibia was most commonly involved (n=31), followed by the lower end of the femur(n=21), distal end of radius(n=14), upper end of fibula (n=9), proximal end of femur(n=5), upper end of the humerus(n=3), iliac bone(n=2), phalanx (n=2) and spine(n=1). The tumors were also encountered on uncommon sites like metacarpals (n=4) and metatarsal(n=1). Fifty four cases were treated by curettage and bone grafting. Wide excision and reconstruction was performed in twenty two cases. Nine cases were treated by wide excision while primary amputation was performed in four cases. One case required only curettage. Three inaccessible lesions of ilium and spine were treated by radiotherapy. Results: 19 of 54 treated by curettage and bone grafting showed a recurrence. The repeat curettage and bone grafting was performed in 18 cases while amputation was done in one. One each out of the cases treated by wide excision and reconstruction and wide excision alone recurred. In this study we observed that though curettage and bone grafting is still the most commonly adopted treatment, wide excision of tumor with reconstruction has shown lesser recurrence. Conclusion: For radiologically well-contained and histologically typical tumor, curettage and autogenous bone grafting is the treatment of choice. The typical tumors with radiologically deficient cortex, clinically aggressive tumors and tumors with histological Grade III should be treated by wide excision and reconstruction. PMID:21139762

  9. Mucoadhesion and the gastrointestinal tract.

    PubMed

    Varum, Felipe J O; McConnell, Emma L; Sousa, Joao J S; Veiga, Francisco; Basit, Abdul W

    2008-01-01

    The concept of mucoadhesion is one that has the potential to improve the highly variable residence times experienced by drugs and dosage forms at various sites in the gastrointestinal tract, and consequently, to reduce variability and improve efficacy. Intimate contact with the mucosa should enhance absorption or improve topical therapy. A variety of approaches have been investigated for mucoadhesion in the gastrointestinal tract, particularly for the stomach and small intestine. Despite interesting results in these sites, mucoadhesive approaches have not yet shown success in humans. The potential of the lower gut for these applications has been largely neglected, although the large intestine in particular may benefit, and the colon has several factors that suggest mucoadhesion could be successful there, including lower motility and the possibility of a lower mucus turnover and thicker mucus layer. In vitro studies on colonic mucoadhesion show promise, and rectal administration has shown some positive results in vivo. This review considers the background to mucoadhesion with respect to the physiological conditions of the gastrointestinal tract as well as the principles that underlie this concept. Mucoadhesive approaches to gastrointestinal drug delivery will be examined, with particular attention given to the lower gut.

  10. Concomitantly elevated serum matrix metalloproteinases 3 and 9 can predict survival of synchronous squamous cell carcinoma of the upper aero-digestive tract.

    PubMed

    Wang, Wen-Lun; Chang, Wei-Lun; Yeh, Yi-Chun; Lee, Ching-Tai; Chang, Chi-Yang; Lin, Jaw-Town; Sheu, Bor-Shyang

    2013-06-01

    Matrix metalloproteinases (MMPs) are elevated in patients with squamous cell carcinoma (SCC) over either the head and neck (HNSCC) or the esophagus (ESCC). Synchronous SCC with both HNSCC and ESCC predispose to worse survival. This study tested if serum MMP levels correlate with clinical features and predict survival for HNSCC, ESCC, and synchronous SCC. One hundred and thirty patients with SCCs in upper aero-digestive tract (70 ESCC, 20 HNSCC, and 40 synchronous SCC) and 74 healthy controls were assessed for serum MMP-3, -7, and -9 titers by enzyme-linked immunosorbent assay. The titers were validated to their correlations to clinical features and survival rates of the different SCC groups. Patients with SCCs had significantly higher serum MMP-3, -7, and -9 titers than the controls (P < 0.001) but there was no difference among the three SCC groups. Based on the optimal MMP cut-off values by ROC curve, elevated MMP-3 and MMP-9, but not MMP-7, correlated with distant metastasis and poor survival (P < 0.05). Concomitantly elevated MMP-3 (>14 ng/mL) and MMP-9 (>329.3 ng/mL) independently correlated with poor two-year survival (P = 0.002, by log rank test). Cox regression confirmed that such concomitant elevation was superior to the tumor stage of either ESCC or HNSCC in predicting survival for synchronous SCC. Serum MMPs are elevated in SCC of the upper aero-digestive tract. Especially for synchronous SCC, concomitantly elevated MMP-3 and MMP-9 levels serve as better biomarkers to predict prognosis than TNM staging of ESCC or HNSCC.

  11. Direct targeting of cancer cells: a multiparameter approach.

    PubMed

    Heinrich, Eileen L; Welty, Lily Anne Y; Banner, Lisa R; Oppenheimer, Steven B

    2005-01-01

    Lectins have been widely used in cell surface studies and in the development of potential anticancer drugs. Many past studies that have examined lectin toxicity have only evaluated the effects on cancer cells, not their non-cancer counterparts. In addition, few past studies have evaluated the relationship between lectin-cell binding and lectin toxicity on both cell types. Here we examine these parameters in one study: lectin-cell binding and lectin toxicity with both cancer cells and their normal counterparts. We found that the human colon cancer cell line CCL-220/Colo320DM bound to agarose beads derivatized with Phaseolus vulgaris agglutinin (PHA-L) and wheat germ agglutinin (WGA), while the non-cancer human colon cell line CRL-1459/CCD-18Co did not. When these lectins were tested for their effects on cell viability in culture, both cell lines were affected by the lectins but at 6, 48 and 72 h incubation times, PHA-L was most toxic to the cancer cell line in a concentration dependent manner. At 48 h incubation, WGA was more toxic to the cancer cell line. The results suggest that it may be possible to develop lectin protocols that selectively target cancer cells for death. In any case, examination of both malignant cells and their non-malignant counterparts, analysis of their binding characteristics to immobilized lectins, and examination of the toxicity of free lectins in culture, provides a multiparameter model for obtaining more comprehensive information than from more limited approaches.

  12. Anti-viral activity of water extract of Paeonia lactiflora pallas against human respiratory syncytial virus in human respiratory tract cell lines.

    PubMed

    Lin, Tzeng-Jih; Wang, Kuo-Chih; Lin, Chun-Ching; Chiang, Lien-Chai; Chang, Jung-San

    2013-01-01

    Paeonia lactiflora Pallas (P. lactiflora, Ranunculaceae) is a common ingredient of Sheng-Ma-Ge-Gen-Tang (SMGGT; Shoma-kakkon-to) and Ge-Gen-Tang (GGT; kakkon-to). SMGGT and GGT are different prescriptions of traditional Chinese medicine with different ingredients designed for airway symptoms. Both SMGGT and GGT have anti-viral activity against human respiratory syncytial virus (HRSV). Therefore, P. lactiflora was hypothesized to be the effective ingredient of both SMGGT and GGT against HRSV. However, P. lactiflora does not have any proven antiviral activity. This study used both human upper (Human larynx epidermoid carcinoma cell line, HEp-2) and lower (human lung carcinoma cell line, A549) respiratory tract cells to test the hypothesis that a hot water extract of P. lactiflora could effectively inhibit plaque formation induced by HRSV infection. The ability of P. lactiflora to stimulate anti-viral cytokines was evaluated by enzyme-linked immunosorbent assay (ELISA). The results showed that P. lactiflora was time-dependently and dose-dependently effective against HRSV in HEp-2 and A549 cells, particularly supplemented before viral inoculation (p < 0.0001). 10 μg/ml P. lactiflora had a comparable anti-HRSV activity with 10 μg/ml ribavirin, a broad-spectrum antiviral agent. P. lactiflora was dose-dependently effective against viral attachment (p < 0.0001), with a better effect on A549 cells (p < 0.0001). P. lactiflora was time-dependently (p < 0.0001) and dose-dependently (p < 0.0001) effective against viral penetration. Moreover, P. lactiflora stimulated IFN-β secretion without any effect on TNF-α secretion. Therefore, P. lactiflora could be beneficial at preventing HRSV infection by inhibiting viral attachment, internalization, and stimulating IFN secretion.

  13. Alternative approach of cell encapsulation by Volvox spheres.

    PubMed

    Teong, Benjamin; Manousakas, Ioannis; Chang, Shwu Jen; Huang, Han Hsiang; Ju, Kuen-Cheng; Kuo, Shyh Ming

    2015-10-01

    Volvox sphere is a bio-mimicking concept of a biomaterial structure design able to encapsulate chemicals, drugs and/or cells. The aim of this study was to prepare Volvox spheres encapsulating AML12 liver cells and mesenchymal stem cells (MSCs) via a high voltage electrostatic field system. The results demonstrated that AML12 liver cells and MSCs could be successfully encapsulated into the inner spheres and the outer sphere of the Volvox spheres. The improved cell viability of MSCs was achieved by the addition of collagen and polyethylene glycol into the preparation components of the Volvox spheres. Collagen material potentially provides extracellular matrix-like structure for cell adhesion while polyethylene glycol provides a void/loose space for permeability of metabolites. The encapsulated MSCs were able to differentiate into hepatocytes or hepatocyte-like cells and express liver cell markers including albumin, alpha feto-protein and cytokeratin 18. The encapsulated cells secreted albumin to about 140 ng on day 14. Based on these observations, we conclude that Volvox spheres can be used as an alternative approach to encapsulate multiple types of cells, here AML12 hepatocyte cell line and MSCs. Nevertheless, efforts are still needed to improve the viability of the encapsulated cells and increase the differentiation of MSCs into functional liver cells.

  14. Indolent T-cell lymphoproliferative disease of the gastrointestinal tract after treatment with adalimumab in resistant Crohn's colitis.

    PubMed

    Edison, Natalia; Belhanes-Peled, Hila; Eitan, Yuval; Guthmann, Yifat; Yeremenko, Yelena; Raffeld, Mark; Elmalah, Irit; Trougouboff, Philippe

    2016-11-01

    We report a case of intestinal indolent T-cell lymphoproliferative disease (TCLPD) occurring after the initiation of tumor necrosis factor-α (TNF-α) inhibitor therapy for resistant Crohn's disease. A prominent T-cell infiltrate positive for CD8, TIA-1, and T-cell receptor-βF1 was associated with the foci of active inflammation. T-cell receptor gene clonality studies (BIOMED-2) demonstrated monoclonality. After the TNF-α inhibitor treatment was withdrawn, the T-cell infiltrates regressed, but 2 years later, the same monoclonal T-cell infiltrate reappeared at the only site of active inflammation. To the best of our knowledge, this report is the first to show a link between active inflammation and the TCLPD. In addition, it suggests a possible influence of the TNF-α inhibitor treatment on the evolution of the TCLPD. A high degree of suspicion is required in the presence of any unusual lymphoid infiltrate in inflammatory bowel disease to avoid overlooking an indolent TCLPD or misdiagnose an aggressive lymphoma.

  15. Computational approaches to substrate-based cell motility

    NASA Astrophysics Data System (ADS)

    Ziebert, Falko; Aranson, Igor S.

    2016-07-01

    Substrate-based crawling motility of eukaryotic cells is essential for many biological functions, both in developing and mature organisms. Motility dysfunctions are involved in several life-threatening pathologies such as cancer and metastasis. Motile cells are also a natural realisation of active, self-propelled 'particles', a popular research topic in nonequilibrium physics. Finally, from the materials perspective, assemblies of motile cells and evolving tissues constitute a class of adaptive self-healing materials that respond to the topography, elasticity and surface chemistry of the environment and react to external stimuli. Although a comprehensive understanding of substrate-based cell motility remains elusive, progress has been achieved recently in its modelling on the whole-cell level. Here we survey the most recent advances in computational approaches to cell movement and demonstrate how these models improve our understanding of complex self-organised systems such as living cells.

  16. In Vitro Passage Selects for Chlamydia muridarum with Enhanced Infectivity in Cultured Cells but Attenuated Pathogenicity in Mouse Upper Genital Tract

    PubMed Central

    Chen, Chaoqun; Zhou, Zhou; Conrad, Turner; Yang, Zhangsheng; Dai, Jin; Li, Zhongyu

    2015-01-01

    Although modern Chlamydia muridarum has been passaged for decades, there are no reports on the consequences of serial passage with strong selection pressure on its fitness. In order to explore the potential for Pasteurian selection to induce genomic and phenotypic perturbations to C. muridarum, a starter population was passaged in cultured cells for 28 generations without standard infection assistance. The resultant population, designated CMG28, displays markedly reduced in vitro dependence on centrifugation for infection and low incidence and severity of upper genital tract pathology following intravaginal inoculation into mice compared to the parental C. muridarum population, CMG0. Deep sequencing of CMG0 and CMG28 revealed novel protein variants in the hypothetical genes TC0237 (Q117E) and TC0668 (G322R). In vitro attachment assays of isogenic plaque clone pairs with mutations in either TC0237 and TC0668 or only TC0237 reveal that TC0237(Q117E) is solely responsible for enhanced adherence to host cells. Paradoxically, double mutants, but not TC0237(Q117E) single mutants, display severely attenuated in vivo pathogenicity. These findings implicate TC0237 and TC0668 as novel genetic factors involved in chlamydial attachment and pathogenicity, respectively, and show that serial passage under selection pressure remains an effective tool for studying Chlamydia pathogenicity. PMID:25712926

  17. FXR agonists enhance the sensitivity of biliary tract cancer cells to cisplatin via SHP dependent inhibition of Bcl-xL expression

    PubMed Central

    Wang, Wei; Zhan, Ming; Li, Qi; Chen, Wei; Chu, Huiling; Huang, Qihong; Hou, Zhaoyuan; Man, Mohan; Wang, Jian

    2016-01-01

    Chemoresistance is common in patients with biliary tract cancer (BTC) including gallbladder cancer (GBC) and cholangiocarcinoma (CC). Therefore, it is necessary to identify effective chemotherapeutic agents for BTC. In the present study, we for the first time tested the effect of farnesoid X receptor (FXR) agonists GW4064 and CDCA (chenodeoxycholic acid) in combination with cisplatin (CDDP) on increasing the chemosensitivity in BTC. Our results show that co-treatment of CDDP with FXR agonists remarkably enhance chemosensitivity of BTC cells. Mechanistically, we found that activation of FXR induced expression of small heterodimer partner (SHP), which in turn inhibited signal transducer and activator of transcription 3 (STAT3) phosphorylation and resulted in down-regulation of Bcl-xL expression in BTC cells, leading to increased susceptibility to CDDP. Moreover, the experiments on tumor-bearing mice showed that GW4064/CDDP co-treatment inhibited the tumor growth in vivo by up-regulating SHP expression and down-regulating STAT3 phosphorylation. These results suggest CDDP in combination with FXR agonists could be a potential new therapeutic strategy for BTC. PMID:27127878

  18. A Voronoi Interface approach to cell aggregate electropermeabilization

    NASA Astrophysics Data System (ADS)

    Guittet, Arthur; Poignard, Clair; Gibou, Frederic

    2017-03-01

    We present a Voronoi Interface approach to the study of cell electropermeabilization. We consider the nonlinear electropermeabilization model of Poignard et al. [20], which takes into account the jump in the voltage potential across cells' membrane. The jump condition is imposed in a sharp manner, using the Voronoi Interface Method of Guittet et al. [14], while adaptive Quad/Oc-tree grids are employed to automatically refine near the cells boundary for increased accuracy. Numerical results are provided to illustrate the accuracy of the methods. We also carry out simulations in three spatial dimensions to investigate the influence of shadowing and of the cells shape on the degree of permeabilization.

  19. Congenital optic tract hypoplasia.

    PubMed

    Hatsukawa, Yoshikazu; Fujio, Takahiro; Nishikawa, Masanori; Taylor, David

    2015-08-01

    We report a case of isolated unilateral optic tract hypoplasia, described only twice previously. Bilateral optic disk hypoplasia was seen ophthalmoscopically and visual field studies showed an incongruous right homonymous hemianopia. Magnetic resonance imaging showed bilateral hypoplasia of both optic nerves and the left optic tract. Spectral domain optical coherence tomography mapping correlated well with the visual field studies.

  20. Vertebrate mRNAs with a 5'-terminal pyrimidine tract are candidates for translational repression in quiescent cells: characterization of the translational cis-regulatory element.

    PubMed Central

    Avni, D; Shama, S; Loreni, F; Meyuhas, O

    1994-01-01

    The translation of mammalian ribosomal protein (rp) mRNAs is selectively repressed in nongrowing cells. This response is mediated through a regulatory element residing in the 5' untranslated region of these mRNAs and includes a 5' terminal oligopyrimidine tract (5' TOP). To further characterize the translational cis-regulatory element, we monitored the translational behavior of various endogenous and heterologous mRNAs or hybrid transcripts derived from transfected chimeric genes. The translational efficiency of these mRNAs was assessed in cells that either were growing normally or were growth arrested under various physiological conditions. Our experiments have yielded the following results: (i) the translation of mammalian rp mRNAs is properly regulated in amphibian cells, and likewise, amphibian rp mRNA is regulated in mammalian cells, indicating that all of the elements required for translation control of rp mRNAs are conserved among vertebrate classes; (ii) selective translational control is not confined to rp mRNAs, as mRNAs encoding the naturally occurring ubiquitin-rp fusion protein and elongation factor 1 alpha, which contain a 5' TOP, also conform this mode of regulation; (iii) rat rpP2 mRNA contains only five pyrimidines in its 5' TOP, yet this mRNA is translationally controlled in the same fashion as other rp mRNAs with a 5' TOP of eight or more pyrimidines; (iv) full manifestation of this mode of regulation seems to require both the 5' TOP and sequences immediately downstream; and (v) an intact translational regulatory element from rpL32 mRNA fails to exert its regulatory properties even when preceded by a single A residue. Images PMID:8196625

  1. Microfluidic approaches for epithelial cell layer culture and characterisation

    PubMed Central

    Thuenauer, Roland; Rodriguez-Boulan, Enrique; Römer, Winfried

    2014-01-01

    In higher eukaryotes, epithelial cell layers line most body cavities and form selective barriers that regulate the exchange of solutes between compartments. In order to fulfil these functions, the cells assume a polarised architecture and maintain two distinct plasma membrane domains, the apical domain facing the lumen and the basolateral domain facing other cells and the extracellular matrix. Microfluidic biochips offer the unique opportunity to establish novel in vitro models of epithelia in which the in vivo microenvironment of epithelial cells is precisely reconstituted. In addition, analytical tools to monitor biologically relevant parameters can be directly integrated on-chip. In this review we summarise recently developed biochip designs for culturing epithelial cell layers. Since endothelial cell layers, which line blood vessels, have similar barrier functions and polar organisation as epithelial cell layers, we also discuss biochips for culturing endothelial cell layers. Furthermore, we review approaches to integrate tools to analyse and manipulate epithelia and endothelia in microfluidic biochips, including methods to perform electrical impedance spectroscopy, methods to detect substances undergoing trans-epithelial transport via fluorescence, spectrophotometry, and mass spectrometry, techniques to mechanically stimulate cells via stretching and fluid flow-induced shear stress, and methods to carry out high-resolution imaging of vesicular trafficking with light microscopy. Taken together, this versatile microfluidic toolbox enables novel experimental approaches to characterise epithelial monolayers. PMID:24668405

  2. Site-specific prevalence and cell densities of selected microbes in the lower reproductive tract of menstruating tampon users.

    PubMed Central

    Hochwalt, Anne E; Berg, Ronald W; Meyer, Sandy J; Eusebio, Rachelle

    2002-01-01

    OBJECTIVE: To assess differences in prevalence and cell densities of enterococci, Gram negative enterics (GNEs), yeast and Staphylococcus aureus among four genital sites and to examine whether the presence of organisms at one site affected the presence of organisms at other sites. METHODS: Swab samples from the perineum, below and above the hymen, and the posterior fornix obtained from 52 tampon users on menstrual cycle day 3 were analyzed for site-specific prevalence and cell densities of microorganisms. RESULTS: Enterococci and GNEs were the most prevalent study organisms at all sites and decreased in prevalence from the perineum to the posterior fornix. Cell densities similarly decreased from below the hymen to the posterior fornix. Yeast were detected at the hymen only; S. aureus frequency was similarly low at all sites. Yeast and S. aureus site-specific cell densities were similar. The above- and below-hymen sites were similar in prevalence and cell density of organisms. An above-chance association existed between the presence of any study organism below the hymen and above the hymen and was strongest for GNEs. CONCLUSIONS: The pattern of genital colonization with enterococci and GNEs reflects their likely gastrointestinal source. The absence of significant differences in the prevalence and cell densities of study microflora above and below the hymen combined with an above-chance association of the presence of microorganisms at these regions suggests that the regions above and below the hymen are not different with respect to the presence of the organisms evaluated in this study. PMID:12625970

  3. Bacterial Vaginosis Is Associated with Loss of Gamma Delta T Cells in the Female Reproductive Tract in Women in the Miami Women Interagency HIV Study (WIHS): A Cross Sectional Study

    PubMed Central

    Romero, Laura; Jones, Deborah L.; Rodriguez, Violeta J.; Arheart, Kristopher; Martinez, Octavio; Bolivar, Hector; Podack, Eckhard R.; Fischl, Margaret A.

    2016-01-01

    Bacterial vaginosis (BV) is the most common female reproductive tract infection and is associated with an increased risk of acquiring and transmitting HIV by a mechanism that is not well understood. Gamma delta (GD) T cells are essential components of the adaptive and innate immune system, are present in the female reproductive tract, and play an important role in epithelial barrier protection. GD1 cells predominate in the mucosal tissue and are important in maintaining mucosal integrity. GD2 cells predominate in peripheral blood and play a role in humoral immunity and in the immune response to pathogens. HIV infection is associated with changes in GD T cells frequencies in the periphery and in the female reproductive tract. The objective of this study is to evaluate if changes in vaginal flora occurring with BV are associated with changes in endocervical GD T cell responses, which could account for increased susceptibility to HIV. Seventeen HIV-infected (HIV+) and 17 HIV-uninfected (HIV-) pre-menopausal women underwent collection of vaginal swabs and endocervical cytobrushes. Vaginal flora was assessed using the Nugent score. GD T cells were assessed in cytobrush samples by flow cytometry. Median Nugent score was 5.0 and 41% of women had abnormal vaginal flora. In HIV uninfected women there was a negative correlation between Nugent score and cervical GD1 T cells (b for interaction = - 0.176, p<0.01); cervical GD1 T cells were higher in women with normal vaginal flora than in those with abnormal flora (45.00% vs 9.95%, p = 0.005); and cervical GD2 T cells were higher in women with abnormal flora than in those with normal flora (1.70% vs 0.35%, p = 0.023). GD T cells in the genital tract are protective (GD1) and are targets for HIV entry (GD2). The decrease in cervical GD1 and increase in GD2 T cells among women with abnormal vaginal flora predisposes women with BV to HIV acquisition. We propose to use GD T cell as markers of female genital tract vulnerability to

  4. Bacterial Vaginosis Is Associated with Loss of Gamma Delta T Cells in the Female Reproductive Tract in Women in the Miami Women Interagency HIV Study (WIHS): A Cross Sectional Study.

    PubMed

    Alcaide, Maria L; Strbo, Natasa; Romero, Laura; Jones, Deborah L; Rodriguez, Violeta J; Arheart, Kristopher; Martinez, Octavio; Bolivar, Hector; Podack, Eckhard R; Fischl, Margaret A

    2016-01-01

    Bacterial vaginosis (BV) is the most common female reproductive tract infection and is associated with an increased risk of acquiring and transmitting HIV by a mechanism that is not well understood. Gamma delta (GD) T cells are essential components of the adaptive and innate immune system, are present in the female reproductive tract, and play an important role in epithelial barrier protection. GD1 cells predominate in the mucosal tissue and are important in maintaining mucosal integrity. GD2 cells predominate in peripheral blood and play a role in humoral immunity and in the immune response to pathogens. HIV infection is associated with changes in GD T cells frequencies in the periphery and in the female reproductive tract. The objective of this study is to evaluate if changes in vaginal flora occurring with BV are associated with changes in endocervical GD T cell responses, which could account for increased susceptibility to HIV. Seventeen HIV-infected (HIV+) and 17 HIV-uninfected (HIV-) pre-menopausal women underwent collection of vaginal swabs and endocervical cytobrushes. Vaginal flora was assessed using the Nugent score. GD T cells were assessed in cytobrush samples by flow cytometry. Median Nugent score was 5.0 and 41% of women had abnormal vaginal flora. In HIV uninfected women there was a negative correlation between Nugent score and cervical GD1 T cells (b for interaction = - 0.176, p<0.01); cervical GD1 T cells were higher in women with normal vaginal flora than in those with abnormal flora (45.00% vs 9.95%, p = 0.005); and cervical GD2 T cells were higher in women with abnormal flora than in those with normal flora (1.70% vs 0.35%, p = 0.023). GD T cells in the genital tract are protective (GD1) and are targets for HIV entry (GD2). The decrease in cervical GD1 and increase in GD2 T cells among women with abnormal vaginal flora predisposes women with BV to HIV acquisition. We propose to use GD T cell as markers of female genital tract vulnerability to

  5. MyD88 deficiency leads to decreased NK cell gamma interferon production and T cell recruitment during Chlamydia muridarum genital tract infection, but a predominant Th1 response and enhanced monocytic inflammation are associated with infection resolution.

    PubMed

    Nagarajan, Uma M; Sikes, James; Prantner, Daniel; Andrews, Charles W; Frazer, Lauren; Goodwin, Anna; Snowden, Jessica N; Darville, Toni

    2011-01-01

    We have previously shown that MyD88 knockout (KO) mice exhibit delayed clearance of Chlamydia muridarum genital infection compared to wild-type (WT) mice. A blunted Th1 response and ineffective suppression of the Th2 response were also observed in MyD88 KO mice. The goal of the present study was to investigate specific mechanisms whereby absence of MyD88 leads to these effects and address the compensatory mechanisms in the genital tract that ultimately clear infection in the absence of MyD88. It was observed that NK cells recruited to the genital tract in MyD88 KO mice failed to produce gamma interferon (IFN-γ) mRNA and protein. This defect was associated with decreased local production of interleukin-17 (IL-17), IL-18, and tumor necrosis factor alpha (TNF-α) but normal levels of IL-12p70. Additionally, recruitment of CD4 T cells to the genital tract was reduced in MyD88 KO mice compared to that in WT mice. Although chronic infection in MyD88 KO mice resulted in oviduct pathology comparable to that of WT mice, increased histiocytic inflammation was observed in the uterine horns. This was associated with increased CCL2 levels and recruitment of macrophages as a potential compensatory mechanism. Further deletion of TLR4-TRIF signaling in MyD88 KO mice, using TLR4/MyD88 double-KO mice, did not further compromise host defense against chlamydiae, suggesting that compensatory mechanisms are Toll-like receptor (TLR) independent. Despite some polarization toward a Th2 response, a Th1 response remained predominant in the absence of MyD88, and it provided equivalent protection against a secondary infection as observed in WT mice.

  6. Nicotine interferes with purinergic signaling in smooth muscle cells isolated from urinary bladders of patients with lower urinary tract symptoms.

    PubMed

    Jenes, Agnes; Szigeti, Gyula P; Ruzsnavszky, Ferenc; Varga, Attila; Lorincz, Laszlo; Csernoch, Laszlo

    2013-09-01

    In patients with outlet obstruction, the contraction of the base is reduced compared to that of healthy individuals, while the contraction of the dome is not affected. Here, we investigated the cellular mechanisms that might be responsible for cholinergic effects blocking non-adrenergic non-cholinergic contractions in the base of the urinary bladder. Smooth muscle cells either from the base or from the dome of human urinary bladders were cultured to determine the contribution of cholinergic and purinergic mechanisms to their Ca2+ homeostasis. While ATP evoked Ca2+ transients in all the cells, nicotine and carbachol induced Ca2+ transients only in 56% and 44% of the cells, respectively. When ATP was administered together with nicotine or carbachol, the amplitudes of the Ca2+ transients recorded from cells prepared from the base of bladders were significantly smaller (42 ± 6% with nicotine and 56 ± 9% with carbachol) than those evoked by ATP alone. This inhibition was much less apparent in the dome of bladders. The inhibition between the cholinergic and purinergic signaling pathways reported in this work may decrease the strength of the contraction of the base of the urinary bladder in patients with outlet obstruction during voiding.

  7. Hydrogen Fuel Cell on a Helicopter: A System Engineering Approach

    NASA Astrophysics Data System (ADS)

    Nesheiwat, Rod

    Hydrogen fuel cells have been previously investigated as a viable replacement to traditional gas turbine auxiliary power unit onboard fixed wing commercial jets. However, so far no study has attempted to extend their applicability to rotary wing aircrafts. To aid in the advancement of such innovative technologies, a holistic technical approach is required to ensure risk reduction and cost effectiveness throughout the product lifecycle. This paper will evaluate the feasibility of replacing a gas turbine auxiliary power unit on a helicopter with a direct hydrogen, air breathing, proton exchange membrane fuel cell, all while emphasizing a system engineering approach that utilize a specialized set of tools and artifacts.

  8. Approaches to semi-synthetic minimal cells: a review

    NASA Astrophysics Data System (ADS)

    Luisi, Pier Luigi; Ferri, Francesca; Stano, Pasquale

    2006-01-01

    Following is a synthetic review on the minimal living cell, defined as an artificial or a semi-artificial cell having the minimal and sufficient number of components to be considered alive. We describe concepts and experiments based on these constructions, and we point out that an operational definition of minimal cell does not define a single species, but rather a broad family of interrelated cell-like structures. The relevance of these researches, considering that the minimal cell should also correspond to the early simple cell in the origin of life and early evolution, is also explained. In addition, we present detailed data in relation to minimal genome, with observations cited by several authors who agree on setting the theoretical full-fledged minimal genome to a figure between 200 and 300 genes. However, further theoretical assumptions may significantly reduce this number (i.e. by eliminating ribosomal proteins and by limiting DNA and RNA polymerases to only a few, less specific molecular species). Generally, the experimental approach to minimal cells consists in utilizing liposomes as cell models and in filling them with genes/enzymes corresponding to minimal cellular functions. To date, a few research groups have successfully induced the expression of single proteins, such as the green fluorescence protein, inside liposomes. Here, different approaches are described and compared. Present constructs are still rather far from the minimal cell, and experimental as well as theoretical difficulties opposing further reduction of complexity are discussed. While most of these minimal cell constructions may represent relatively poor imitations of a modern full-fledged cell, further studies will begin precisely from these constructs. In conclusion, we give a brief outline of the next possible steps on the road map to the minimal cell.

  9. A quality risk management model approach for cell therapy manufacturing.

    PubMed

    Lopez, Fabio; Di Bartolo, Chiara; Piazza, Tommaso; Passannanti, Antonino; Gerlach, Jörg C; Gridelli, Bruno; Triolo, Fabio

    2010-12-01

    International regulatory authorities view risk management as an essential production need for the development of innovative, somatic cell-based therapies in regenerative medicine. The available risk management guidelines, however, provide little guidance on specific risk analysis approaches and procedures applicable in clinical cell therapy manufacturing. This raises a number of problems. Cell manufacturing is a poorly automated process, prone to operator-introduced variations, and affected by heterogeneity of the processed organs/tissues and lot-dependent variability of reagent (e.g., collagenase) efficiency. In this study, the principal challenges faced in a cell-based product manufacturing context (i.e., high dependence on human intervention and absence of reference standards for acceptable risk levels) are identified and addressed, and a risk management model approach applicable to manufacturing of cells for clinical use is described for the first time. The use of the heuristic and pseudo-quantitative failure mode and effect analysis/failure mode and critical effect analysis risk analysis technique associated with direct estimation of severity, occurrence, and detection is, in this specific context, as effective as, but more efficient than, the analytic hierarchy process. Moreover, a severity/occurrence matrix and Pareto analysis can be successfully adopted to identify priority failure modes on which to act to mitigate risks. The application of this approach to clinical cell therapy manufacturing in regenerative medicine is also discussed.

  10. Cell viability of microencapsulated Bifidobacterium animalis subsp. lactis under freeze-drying, storage and gastrointestinal tract simulation conditions.

    PubMed

    Shamekhi, Fatemeh; Shuhaimi, Mustafa; Ariff, Arbakariya; Manap, Yazid A

    2013-03-01

    The purpose of this study was to improve the survival of Bifidobacterium animalis subsp. lactis 10140 during freeze-drying process by microencapsulation, using a special pediatric prebiotics mixture (galactooligosaccharides and fructooligosaccharides). Probiotic microorganisms were encapsulated with a coat combination of prebiotics-calcium-alginate prior to freeze-drying. Both encapsulated and free cells were then freeze-dried in their optimized combinations of skim milk and prebiotics. Response surface methodology (RSM) was used to produce a coating combination as well as drying medium with the highest cell viability during freeze-drying. The optimum encapsulation composition was found to be 2.1 % Na-alginate, 2.9 % prebiotic, and 21.7 % glycerol. Maximum survival predicted by the model was 81.2 %. No significant (p > 0.05) difference between the predicted and experimental values verified the adequacy of final reduced models. The protection ability of encapsulation was then examined over 120 days of storage at 4 and 25 °C and exposure to a sequential model of infantile GIT conditions including both gastric conditions (pH 3.0 and 4.0, 90 min, 37 °C) and intestinal conditions (pH 7.5, 5 h, 37 °C). Significantly improved cell viability showed that microencapsulation of B. lactis 10140 with the prebiotics was successful in producing a stable symbiotic powdery nutraceutical.

  11. Campylobacter protein oxidation influences epithelial cell invasion or intracellular survival as well as intestinal tract colonization in chickens.

    PubMed

    Lasica, A M; Wyszynska, A; Szymanek, K; Majewski, P; Jagusztyn-Krynicka, E K

    2010-01-01

    The Dsb family of redox proteins catalyzes disulfide bond formation and isomerization. Since mutations in dsb genes change the conformation and stability of many extracytoplasmic proteins, and since many virulence factors of pathogenic bacteria are extracytoplasmic, inactivation of dsb genes often results in pathogen attenuation. This study investigated the role of 2 membrane-bound oxidoreductases, DsbB and DsbI, in the Campylobacter jejuni oxidative Dsb pathway. Campylobacter mutants, lacking DsbB or DsbI or both, were constructed by allelic replacement and used in the human intestinal epithelial T84 cell line for the gentamicin protection assay (invasion assay) and chicken colonization experiments. In C. coli strain 23/1, the inactivation of the dsbB or dsbI gene separately did not significantly affect the colonization process. However, simultaneous disruption of both membrane-bound oxidoreductase genes significantly decreased the strain’s ability to colonize chicken intestines. Moreover, C. jejuni strain 81-176 with mutated dsbB or dsbI genes showed reduced invasion/intracellular survival abilities. No cells of the double mutants (dsbB⁻ dsbI⁻) of C. jejuni 81-176 were recovered from human cells after 3 h of invasion.

  12. Bioinformatics approaches to single-cell analysis in developmental biology.

    PubMed

    Yalcin, Dicle; Hakguder, Zeynep M; Otu, Hasan H

    2016-03-01

    Individual cells within the same population show various degrees of heterogeneity, which may be better handled with single-cell analysis to address biological and clinical questions. Single-cell analysis is especially important in developmental biology as subtle spatial and temporal differences in cells have significant associations with cell fate decisions during differentiation and with the description of a particular state of a cell exhibiting an aberrant phenotype. Biotechnological advances, especially in the area of microfluidics, have led to a robust, massively parallel and multi-dimensional capturing, sorting, and lysis of single-cells and amplification of related macromolecules, which have enabled the use of imaging and omics techniques on single cells. There have been improvements in computational single-cell image analysis in developmental biology regarding feature extraction, segmentation, image enhancement and machine learning, handling limitations of optical resolution to gain new perspectives from the raw microscopy images. Omics approaches, such as transcriptomics, genomics and epigenomics, targeting gene and small RNA expression, single nucleotide and structural variations and methylation and histone modifications, rely heavily on high-throughput sequencing technologies. Although there are well-established bioinformatics methods for analysis of sequence data, there are limited bioinformatics approaches which address experimental design, sample size considerations, amplification bias, normalization, differential expression, coverage, clustering and classification issues, specifically applied at the single-cell level. In this review, we summarize biological and technological advancements, discuss challenges faced in the aforementioned data acquisition and analysis issues and present future prospects for application of single-cell analyses to developmental biology.

  13. [Recurrent urinary tract infections].

    PubMed

    Pigrau-Serrallach, Carlos

    2005-12-01

    Recurrent urinary tract infections (RUTI) are a frequent clinical problem in sexually active young women, pregnant or postmenopausal women and in patients with underlying urological abnormalities. The present chapter reviews RUTI based on their classification: relapses, which usually occur early (< 1 month), are caused by the same microorganism and are associated with underlying urological abnormalities, and reinfections, which usually occur later and are caused by a new distinct microorganism (or by the same microorganism usually located in the rectum or uroepithelial cells). The pathogenesis of RUTI is reviewed and the risk factors associated with RUTI in premenopausal women (usually related to sexual activity), postmenopausal women (in whom estrogen deficiency has a significant effect on the vaginal Lactobacillus flora), and in pregnant women are discussed. Likewise, an extensive review of the distinct therapeutic strategies to prevent RUTI is provided: self-treatment of cystitis, continuous antibiotic prophylaxis, postcoital antibiotic prophylaxis, topical vaginal estrogens, Lactobacillus, cranberry juice, intravesical administration of non-virulent E. coli strains and vaccines, among others. Several diagnostic-therapeutic algorithms are included. These algorithms are based on the type of urinary infection (relapse-reinfection), on the type of patient (young, postmenopausal, or pregnant women) and on the number of episodes of RUTI.

  14. Potential Beneficial Effects of Si-Wu-Tang on White Blood Cell Numbers and the Gastrointestinal Tract of γ-Ray Irradiated Mice

    PubMed Central

    Ni, Jin; Romero-Weaver, Ana L.; Kennedy, Ann R.

    2014-01-01

    Si-Wu-Tang (SWT) is a decoction consisting of a mixture of ingredients of Rehmanniae Radix, Angelica Radix, Chuanxiong Rhizoma and Paeoniae Radix. As a traditional Chinese herbal decoction, SWT has been widely used for the treatment of diseases characterized as blood and/or energy deficit. The present study was performed to evaluate the effects of SWT on the different populations of circulating white blood cells (WBCs) and gastrointestinal changes in γ-ray irradiated mice. Female mice were treated daily with orally administered SWT seven days before irradiation, until one day before irradiation or until one day before sample collection. WBC counts were determined from peripheral blood samples taken from the mice at different times post-irradiation. Hematoxylin and eosin (H&E) staining, as well as immunohistochemical analysis of fibrinogen, were utilized to evaluate the effects of SWT in the intestines of mice after radiation exposure. The results of the present studies demonstrate that SWT has protective effects against radiation damage to circulating WBCs, specifically to lymphocytes, and to the gastrointestinal tract of the irradiated animals. PMID:25324699

  15. Fibrous Hydrogels for Cell Encapsulation: A Modular and Supramolecular Approach

    PubMed Central

    Włodarczyk-Biegun, Małgorzata K.; Farbod, Kambiz; Werten, Marc W. T.; Slingerland, Cornelis J.; de Wolf, Frits A.; van den Beucken, Jeroen J. J. P.; Leeuwenburgh, Sander C. G.; Cohen Stuart, Martien A.; Kamperman, Marleen

    2016-01-01

    Artificial 3-dimensional (3D) cell culture systems, which mimic the extracellular matrix (ECM), hold great potential as models to study cellular processes under controlled conditions. The natural ECM is a 3D structure composed of a fibrous hydrogel that provides both mechanical and biochemical cues to instruct cell behavior. Here we present an ECM-mimicking genetically engineered protein-based hydrogel as a 3D cell culture system that combines several key features: (1) Mild and straightforward encapsulation meters (1) ease of ut I am not so sure.encapsulation of the cells, without the need of an external crosslinker. (2) Supramolecular assembly resulting in a fibrous architecture that recapitulates some of the unique mechanical characteristics of the ECM, i.e. strain-stiffening and self-healing behavior. (3) A modular approach allowing controlled incorporation of the biochemical cue density (integrin binding RGD domains). We tested the gels by encapsulating MG-63 osteoblastic cells and found that encapsulated cells not only respond to higher RGD density, but also to overall gel concentration. Cells in 1% and 2% (weight fraction) protein gels showed spreading and proliferation, provided a relative RGD density of at least 50%. In contrast, in 4% gels very little spreading and proliferation occurred, even for a relative RGD density of 100%. The independent control over both mechanical and biochemical cues obtained in this modular approach renders our hydrogels suitable to study cellular responses under highly defined conditions. PMID:27223105

  16. Novel Immunotherapeutic Approaches for Head and Neck Squamous Cell Carcinoma

    PubMed Central

    Bann, Darrin V.; Deschler, Daniel G.; Goyal, Neerav

    2016-01-01

    The immune system plays a key role in preventing tumor formation by recognizing and destroying malignant cells. For over a century, researchers have attempted to harness the immune response as a cancer treatment, although this approach has only recently achieved clinical success. Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer worldwide and is associated with cigarette smoking, alcohol consumption, betel nut use, and human papillomavirus infection. Unfortunately, worldwide mortality from HNSCC remains high, partially due to limits on therapy secondary to the significant morbidity associated with current treatments. Therefore, immunotherapeutic approaches to HNSCC treatment are attractive for their potential to reduce morbidity while improving survival. However, the application of immunotherapies to this disease has been challenging because HNSCC is profoundly immunosuppressive, resulting in decreased absolute lymphocyte counts, impaired natural killer cell function, reduced antigen-presenting cell function, and a tumor-permissive cytokine profile. Despite these challenges, numerous clinical trials testing the safety and efficacy of immunotherapeutic approaches to HNSCC treatment are currently underway, many of which have produced promising results. This review will summarize immunotherapeutic approaches to HNSCC that are currently undergoing clinical trials. PMID:27669306

  17. Effect of dietary supplementation with live-cell yeast at two dosages on lactation performance, ruminal fermentation, and total-tract nutrient digestibility in dairy cows.

    PubMed

    Ferraretto, L F; Shaver, R D; Bertics, S J

    2012-07-01

    The experimental objective was to determine the effect of dietary supplementation with live-cell yeast (LCY; Procreatin-7, Lesaffre Feed Additives, Milwaukee, WI) at 2 dosages in high-starch (HS) diets [30% starch in dry matter (DM)] on lactation performance, ruminal fermentation, and total-tract nutrient digestibility in dairy cows compared with HS or low-starch (LS; 20% starch in DM) non-LCY diets. Sixty-four multiparous Holstein cows (114 ± 37 d in milk and 726 ± 74 kg of body weight at trial initiation) were randomly assigned to 32 electronic gate feeders (2 cows per feeder), which were randomly assigned to 1 of 4 treatments in a completely randomized design. A 2-wk covariate adjustment period with cows fed a 50:50 mixture of the HS and LS diets was followed by a 12-wk treatment period with cows fed their assigned treatment diets. The HS diets were fed without (HS0) and with 2 (HS2) or 4 (HS4) g/cow per day of LCY. The LS diet did not contain LCY (LS0) and was formulated by partially replacing dry ground shelled corn with soy hulls. Cows fed LS0 consumed more DM than cows fed HS diets during wk 3, 10, 11, and 12. Yields of actual (44.5 kg/d, on average), fat-, energy-, and solids-corrected milk were unaffected by treatment. Milk fat content tended to be greater for LS0 than for HS0 and HS2 but not different from HS4. Milk urea nitrogen contents were greater for cows fed LS0 than for cows fed the HS diets. Feed conversion (kg of milk/kg of DM intake) was numerically greater for HS diets than for LS0. Ruminal pH was unaffected by treatment. Ruminal molar proportion of acetate was greater, whereas that of propionate was lower, for LS0 compared with HS diets. Dry matter and organic matter digestibilities were greater for HS2 and HS4 than for HS0. Digestibility of neutral detergent fiber was greater for HS4 than for HS0 and HS2. Dry matter, organic matter, and neutral detergent fiber digestibilities were greater for LS0 than for HS diets; starch digestibility was

  18. Quantitative microscopy of the lung: a problem-based approach. Part 2: stereological parameters and study designs in various diseases of the respiratory tract.

    PubMed

    Mühlfeld, Christian; Ochs, Matthias

    2013-08-01

    Design-based stereology provides efficient methods to obtain valuable quantitative information of the respiratory tract in various diseases. However, the choice of the most relevant parameters in a specific disease setting has to be deduced from the present pathobiological knowledge. Often it is difficult to express the pathological alterations by interpretable parameters in terms of volume, surface area, length, or number. In the second part of this companion review article, we analyze the present pathophysiological knowledge about acute lung injury, diffuse parenchymal lung diseases, emphysema, pulmonary hypertension, and asthma to come up with recommendations for the disease-specific application of stereological principles for obtaining relevant parameters. Worked examples with illustrative images are used to demonstrate the work flow, estimation procedure, and calculation and to facilitate the practical performance of equivalent analyses.

  19. Simultaneous determination of creatinine and acetate by capillary electrophoresis with contactless conductivity detector as a feasible approach for urinary tract infection diagnosis.

    PubMed

    Grochocki, Wojciech; Markuszewski, Michał J; Quirino, Joselito P

    2017-04-15

    Urinary tract infection (UTI) is one of the most common bacterial infection in human but its diagnosis is difficult. Metabolomic studies with nuclear magnetic resonance of urine have shown that acetic acid/creatinine ratio may be used for early UTI diagnosis. Here, a method for simultaneous determination of acetate and creatinine by capillary zone electrophoresis with contactless conductivity detector was developed for the first time. The separation was with 40mM MES and 20mM l-histidine as a background solution. The total time of a single run, including capillary conditioning, was less than 12min. The method was successfully demonstrated for analysis of actual and fortified human urine samples after methanol dilution. Analytical figures of merit such as linearity, LOQ, and repeatability (intraday and interday) were studied.

  20. A probabilistic gastrointestinal tract dosimetry model

    NASA Astrophysics Data System (ADS)

    Huh, Chulhaeng

    In internal dosimetry, the tissues of the gastrointestinal (GI) tract represent one of the most radiosensitive organs of the body with the hematopoietic bone marrow. Endoscopic ultrasound is a unique tool to acquire in-vivo data on GI tract wall thicknesses of sufficient resolution needed in radiation dosimetry studies. Through their different echo texture and intensity, five layers of differing echo patterns for superficial mucosa, deep mucosa, submucosa, muscularis propria and serosa exist within the walls of organs composing the alimentary tract. Thicknesses for stomach mucosa ranged from 620 +/- 150 mum to 1320 +/- 80 mum (total stomach wall thicknesses from 2.56 +/- 0.12 to 4.12 +/- 0.11 mm). Measurements made for the rectal images revealed rectal mucosal thicknesses from 150 +/- 90 mum to 670 +/- 110 mum (total rectal wall thicknesses from 2.01 +/- 0.06 to 3.35 +/- 0.46 mm). The mucosa thus accounted for 28 +/- 3% and 16 +/- 6% of the total thickness of the stomach and rectal wall, respectively. Radiation transport simulations were then performed using the Monte Carlo N-particle transport code (MCNP) 4C transport code to calculate S values (Gy/Bq-s) for penetrating and nonpenetrating radiations such as photons, beta particles, conversion electrons and auger electrons of selected nuclides, I123, I131, Tc 99m and Y90 under two source conditions: content and mucosa sources, respectively. The results of this study demonstrate generally good agreement with published data for the stomach mucosa wall. The rectal mucosa data are consistently higher than published data compared with the large intestine due to different radiosensitive cell thicknesses (350 mum vs. a range spanning from 149 mum to 729 mum) and different geometry when a rectal content source is considered. Generally, the ICRP models have been designed to predict the amount of radiation dose in the human body from a "typical" or "reference" individual in a given population. The study has been performed to

  1. Upper respiratory tract (image)

    MedlinePlus

    The major passages and structures of the upper respiratory tract include the nose or nostrils, nasal cavity, mouth, throat (pharynx), and voice box (larynx). The respiratory system is lined with a mucous membrane that ...

  2. Diffusion-based population statistics using tract probability maps.

    PubMed

    Wassermann, Demian; Kanterakis, Efstathios; Gur, Ruben C; Deriche, Rachid; Verma, Ragini

    2010-01-01

    We present a novel technique for the tract-based statistical analysis of diffusion imaging data. In our technique, we represent each white matter (WM) tract as a tract probability map (TPM): a function mapping a point to its probability of belonging to the tract. We start by automatically clustering the tracts identified in the brain via tractography into TPMs using a novel Gaussian process framework. Then, each tract is modeled by the skeleton of its TPM, a medial representation with a tubular or sheet-like geometry. The appropriate geometry for each tract is implicitly inferred from the data instead of being selected a priori, as is done by current tract-specific approaches. The TPM representation makes it possible to average diffusion imaging based features along directions locally perpendicular to the skeleton of each WM tract, increasing the sensitivity and specificity of statistical analyses on the WM. Our framework therefore facilitates the automated analysis of WM tract bundles, and enables the quantification and visualization of tract-based statistical differences between groups. We have demonstrated the applicability of our framework by studying WM differences between 34 schizophrenia patients and 24 healthy controls.

  3. [Urinary tract infections].

    PubMed

    Hörl, W H

    2011-09-01

    Urinary tract infections occur very frequently in the community and in hospitalized patients and are mainly caused by Escherichia (E.) coli. Depending on virulence determinants of uropathogenic microorganisms and host-specific defense mechanisms, urinary tract infections can manifest as cystitis, pyelonephritis (bacterial interstitial nephritis), bacteremia or urosepsis. Uncomplicated urinary tract infections in otherwise healthy women should be treated for 3-7 days depending on the antibiotic therapy chosen, even if spontaneous remission rates of up to 40% have been reported. Antibiotics of the first choice for empirical treatment of uncomplicated urinary tract infection are fluoroquinolones, pivmecillinam and fosfomycin. A huge problem is the increasing antimicrobial resistance of uropathogenic microorganisms. Complicated urinary tract infections associated with anatomical and/or functional abnormalities of the urinary tract and/or comorbidities such as diabetes or immunosuppressive therapy, need longer antibiotic treatment (e.g. 10-14 days) as well as interdisciplinary diagnostic procedures. Treatment of community acquired urosepsis includes cephalosporins of the third generation, piperacillin/tazobactam or ciprofloxacin. For nosocomial urosepsis the combination with an aminoglycoside or a carbapenem is recommended.

  4. Two novel cultured cell lines, A3/Kawakami and A4/Fukuda, derived from malignant lymphoma of B(non-T)-cell nature of the gastrointestinal tract.

    PubMed

    Hirose, M; Minato, K; Tobinai, K; Shimoyama, M; Watanabe, S; Abe, T; Deura, K

    1983-02-01

    A3/Kawakami was derived from ascitic lymphoma cells of a 68-year-old female patient with malignant lymphoma (non-Hodgkin's lymphoma, diffuse, large cell type) of the stomach and A4/Fukuda was derived from ascitic lymphoma cells of a 52-year-old female patient with double cancer of the colon (well-differentiated papillary adenocarcinoma and non-Hodgkin's lymphoma, diffuse, large cell type). The fresh ascitic lymphoma cells in the case of A3/Kawakami were surface immunoglobulin-positive, but the cultured A3/Kawakami cells no longer expressed any distinct markers. In the case of A4/Fukuda, the fresh ascitic lymphoma cells and cultured cells did not express any specific surface markers. Only 20% of A4/Fukuda cells were reactive with OKI1. However, a small amount of IgM could be detected in the cell extract and concentrated culture supernate of A4/Fukuda. In addition, A4/Fukuda cells heterotransplanted into anti-thymocyte sera-treated newborn hamster or athymic nude mice with a BALB/c genetic background were found to have weak surface immunoglobulin and distinct cytoplasmic immunoglobulin (gamma, mu). These data suggest that A4/Fukuda cells share the characteristics of the late differentiation stage of B-cell lineage (intermediate between mature B-cells and plasma cells). It was found that monoclonal antibodies, OKT4 and anti-Leu 3a, which are known to react specifically with inducer/helper T-cells, reacted to both A3/Kawakami and A4/Fukuda cells. The karyotypes of both A3/Kawakami and A4/Fukuda cells were very complicated but included some marker chromosomes such as 14q+.

  5. Hyperammonemia in Urinary Tract Infections

    PubMed Central

    Kenzaka, Tsuneaki; Kato, Ken; Kitao, Akihito; Kosami, Koki; Minami, Kensuke; Yahata, Shinsuke; Fukui, Miho; Okayama, Masanobu

    2015-01-01

    Objectives The present study investigated the incidence of hyperammonemia in urinary tract infections and explored the utility of urinary obstruction relief and antimicrobial administration to improve hyperammonemia. Methods This was an observational study. Subjects were patients who were diagnosed with urinary tract infection and hospitalized between June 2008 and June 2009. We measured plasma ammonia levels on admission in patients who were clinically diagnosed with urinary tract infection and hospitalized. We assessed each patient's level of consciousness on admission using the Glasgow Coma Scale (GCS) and performed urine and blood cultures. We also assessed hearing prior to hospitalization using the Eastern Cooperative Oncology Group performance status (ECOG-PS). In cases with high ammonia levels on admission, plasma ammonia and GCS were measured 24 hours and 5–7 days later. Results Sixty-seven candidates were enrolled; of these, 60 cases (89.6%) with bacterial cell counts ≥104 CFU/mL were studied. Five cases (8.3%) presented with high plasma ammonia levels. Cases with hyperammonemia were significantly more likely to present with low GCS scores and urinary retention rate. All five cases received antimicrobial therapy with an indwelling bladder catheter to relieve urinary retention. The case 5 patient died shortly after admission due to complicated aspiration pneumonia; in the remaining cases, plasma ammonia levels were rapidly normalized and the level of consciousness improved. Conclusions The occurrence of hyperammonemia in urinary tract infections is not rare. The cause of hyperammonemia is urinary retention obstruction. Therefore, along with antimicrobial administration, relief of obstruction is important for the treatment of hyperammonemia caused by this mechanism. PMID:26292215

  6. Differentiated cell behavior: a multiscale approach using measure theory.

    PubMed

    Colombi, Annachiara; Scianna, Marco; Tosin, Andrea

    2015-11-01

    This paper deals with the derivation of a collective model of cell populations out of an individual-based description of the underlying physical particle system. By looking at the spatial distribution of cells in terms of time-evolving measures, rather than at individual cell paths, we obtain an ensemble representation stemming from the phenomenological behavior of the single component cells. In particular, as a key advantage of our approach, the scale of representation of the system, i.e., microscopic/discrete vs. macroscopic/continuous, can be chosen a posteriori according only to the spatial structure given to the aforesaid measures. The paper focuses in particular on the use of different scales based on the specific functions performed by cells. A two-population hybrid system is considered, where cells with a specialized/differentiated phenotype are treated as a discrete population of point masses while unspecialized/undifferentiated cell aggregates are represented by a continuous approximation. Numerical simulations and analytical investigations emphasize the role of some biologically relevant parameters in determining the specific evolution of such a hybrid cell system.

  7. Single-cell approaches for molecular classification of endocrine tumors

    PubMed Central

    Koh, James; Allbritton, Nancy L.; Sosa, Julie A.

    2015-01-01

    Purpose of review In this review, we summarize recent developments in single-cell technologies that can be employed for the functional and molecular classification of endocrine cells in normal and neoplastic tissue. Recent findings The emergence of new platforms for the isolation, analysis, and dynamic assessment of individual cell identity and reactive behavior enables experimental deconstruction of intratumoral heterogeneity and other contexts, where variability in cell signaling and biochemical responsiveness inform biological function and clinical presentation. These tools are particularly appropriate for examining and classifying endocrine neoplasias, as the clinical sequelae of these tumors are often driven by disrupted hormonal responsiveness secondary to compromised cell signaling. Single-cell methods allow for multidimensional experimental designs incorporating both spatial and temporal parameters with the capacity to probe dynamic cell signaling behaviors and kinetic response patterns dependent upon sequential agonist challenge. Summary Intratumoral heterogeneity in the provenance, composition, and biological activity of different forms of endocrine neoplasia presents a significant challenge for prognostic assessment. Single-cell technologies provide an array of powerful new approaches uniquely well suited for dissecting complex endocrine tumors. Studies examining the relationship between clinical behavior and tumor compositional variations in cellular activity are now possible, providing new opportunities to deconstruct the underlying mechanisms of endocrine neoplasia. PMID:26632769

  8. Association between injectable progestin-only contraceptives and HIV acquisition and HIV target cell frequency in the female genital tract in South African women: a prospective cohort study

    PubMed Central

    Byrne, Elizabeth H; Anahtar, Melis N; Cohen, Kathleen E; Moodley, Amber; Padavattan, Nikita; Ismail, Nasreen; Bowman, Brittany A; Olson, Gregory S; Mabhula, Amanda; Leslie, Alasdair; Ndung’u, Thumbi; Walker, Bruce D; Ghebremichael, Musie S; Dong, Krista L; Kwon, Douglas S

    2017-01-01

    Summary Background The use of injectable progestin-only contraceptives has been associated with increased risk of HIV acquisition in observational studies, but the biological mechanisms of this risk remain poorly understood. We aimed to assess the effects of progestins on HIV acquisition risk and the immune environment in the female genital tract. Methods In this prospective cohort, we enrolled HIV-negative South African women aged 18–23 years who were not pregnant and were living in Umlazi, South Africa from the Females Rising through Education, Support, and Health (FRESH) study. We tested for HIV-1 twice per week to monitor incident infection. Every 3 months, we collected demographic and behavioural data in addition to blood and cervical samples. The study objective was to characterise host immune determinants of HIV acquisition risk, including those associated with injectable progestin-only contraceptive use. Hazard ratios (HRs) were estimated using Cox proportional hazards methods. Findings Between Nov 19, 2012, and May 31, 2015, we characterised 432 HIV-uninfected South African women from the FRESH study. In this cohort, 152 women used injectable progestin-only contraceptives, 43 used other forms of contraception, and 222 women used no method of long-term contraception. Women using injectable progestin-only contraceptives were at substantially higher risk of acquiring HIV (12·06 per 100 person-years, 95% CI 6·41–20·63) than women using no long-term contraception (3·71 per 100 person-years, 1·36–8·07; adjusted hazard ratio [aHR] 2·93, 95% CI 1·09–7·868, p=0·0326). HIV-negative injectable progestin-only contraceptive users had 3·92 times the frequency of cervical HIV target cells (CCR5+ CD4 T cells) compared with women using no long-term contraceptive (p=0·0241). Women using no long-term contraceptive in the luteal phase of the menstrual cycle also had a 3·25 times higher frequency of cervical target cells compared with those in the

  9. Towards a whole-cell modeling approach for synthetic biology

    NASA Astrophysics Data System (ADS)

    Purcell, Oliver; Jain, Bonny; Karr, Jonathan R.; Covert, Markus W.; Lu, Timothy K.

    2013-06-01

    Despite rapid advances over the last decade, synthetic biology lacks the predictive tools needed to enable rational design. Unlike established engineering disciplines, the engineering of synthetic gene circuits still relies heavily on experimental trial-and-error, a time-consuming and inefficient process that slows down the biological design cycle. This reliance on experimental tuning is because current modeling approaches are unable to make reliable predictions about the in vivo behavior of synthetic circuits. A major reason for this lack of predictability is that current models view circuits in isolation, ignoring the vast number of complex cellular processes that impinge on the dynamics of the synthetic circuit and vice versa. To address this problem, we present a modeling approach for the design of synthetic circuits in the context of cellular networks. Using the recently published whole-cell model of Mycoplasma genitalium, we examined the effect of adding genes into the host genome. We also investigated how codon usage correlates with gene expression and find agreement with existing experimental results. Finally, we successfully implemented a synthetic Goodwin oscillator in the whole-cell model. We provide an updated software framework for the whole-cell model that lays the foundation for the integration of whole-cell models with synthetic gene circuit models. This software framework is made freely available to the community to enable future extensions. We envision that this approach will be critical to transforming the field of synthetic biology into a rational and predictive engineering discipline.

  10. Cellular uptake and cell-to-cell transfer of polyelectrolyte microcapsules within a triple co-culture system representing parts of the respiratory tract

    NASA Astrophysics Data System (ADS)

    Kuhn, Dagmar A.; Hartmann, Raimo; Fytianos, Kleanthis; Petri-Fink, Alke; Rothen-Rutishauser, Barbara; Parak, Wolfgang J.

    2015-06-01

    Polyelectrolyte multilayer microcapsules around 3.4 micrometers in diameter were added to epithelial cells, monocyte-derived macrophages, and dendritic cells in vitro and their uptake kinetics were quantified. All three cell types were combined in a triple co-culture model, mimicking the human epithelial alveolar barrier. Hereby, macrophages were separated in a three-dimensional model from dendritic cells by a monolayer of epithelial cells. While passing of small nanoparticles has been demonstrated from macrophages to dendritic cells across the epithelial barrier in previous studies, for the micrometer-sized capsules, this process could not be observed in a significant amount. Thus, this barrier is a limiting factor for cell-to-cell transfer of micrometer-sized particles.

  11. Stem cell approaches in psychiatry--challenges and opportunities.

    PubMed

    Benninghoff, Jens

    2009-01-01

    Exploring stem cells is a fascinating task, especially in a discipline where the use of stem cells seems far-fetched at first glance, as is the case in psychiatry. In this article we would like to provide a brief overview of the current situation in relation to the treatment of mental diseases. For reasons that we will explain, this review will focus on affective disorders. The following section will give a more detailed account of stem-cell biology including current basic science approaches presenting in-vivo and in-vitro techniques. The final part will then look into future perspectives of using these stem cells to cure mental illnesses, and discuss the related challenges and opportunities.

  12. The adaptive, cut-cell Cartesian approach (warts and all)

    NASA Astrophysics Data System (ADS)

    Powell, Kenneth G.

    1995-10-01

    Solution-adaptive methods based on cutting bodies out of Cartesian grids are gaining popularity now that the ways of circumventing the accuracy problems associated with small cut cells have been developed. Researchers are applying Cartesian-based schemes to a broad class of problems now, and, although there is still development work to be done, it is becoming clearer which problems are best suited to the approach (and which are not). The purpose of this paper is to give a candid assessment, based on applying Cartesian schemes to a variety of problems, of the strengths and weaknesses of the approach as it is currently implemented.

  13. The adaptive, cut-cell Cartesian approach (warts and all)

    NASA Technical Reports Server (NTRS)

    Powell, Kenneth G.

    1995-01-01

    Solution-adaptive methods based on cutting bodies out of Cartesian grids are gaining popularity now that the ways of circumventing the accuracy problems associated with small cut cells have been developed. Researchers are applying Cartesian-based schemes to a broad class of problems now, and, although there is still development work to be done, it is becoming clearer which problems are best suited to the approach (and which are not). The purpose of this paper is to give a candid assessment, based on applying Cartesian schemes to a variety of problems, of the strengths and weaknesses of the approach as it is currently implemented.

  14. [Urinary tract infections in children].

    PubMed

    Lellig, E; Apfelbeck, M; Straub, J; Karl, A; Tritschler, S; Stief, C G; Riccabona, M

    2017-02-01

    Urinary tract infections (UTI) are the most common bacterial infections in children. The symptoms are not very specific and range from abdominal pain, poor feeding to nocturnal urinary incontinence. The technique of collecting urine plays an important role for securing the diagnosis. The best way to obtain urine in non-toilet-trained children is catheterization or suprapubic bladder aspiration. In toilet-trained children midstream urine is an acceptable alternative after cleaning the foreskin or labia. In the case of an infection a prompt empirical antibiotic therapy is necessary to reduce the risk of parenchymal scarring of the kidneys. There are different approaches to diagnose vesicoureteral reflux in different countries. The commonly used standard approach in Germany is voiding cystourethrography. In the case of reflux dimercaptosuccinic acid (DMSA) scintigraphy should be performed additionally to exclude renal scarring (bottom-up approach).

  15. A Proteomic Analysis of the Body Wall, Digestive Tract, and Reproductive Tract of Brugia malayi.

    PubMed

    Morris, C Paul; Bennuru, Sasisekhar; Kropp, Laura E; Zweben, Jesse A; Meng, Zhaojing; Taylor, Rebekah T; Chan, King; Veenstra, Timothy D; Nutman, Thomas B; Mitre, Edward

    2015-01-01

    Filarial worms are parasitic nematodes that cause devastating diseases such as lymphatic filariasis (LF) and onchocerciasis. Filariae are nematodes with complex anatomy including fully developed digestive tracts and reproductive organs. To better understand the basic biology of filarial parasites and to provide insights into drug targets and vaccine design, we conducted a proteomic analysis of different anatomic fractions of Brugia malayi, a causative agent of LF. Approximately 500 adult female B. malayi worms were dissected, and three anatomical fractions (body wall, digestive tract, and reproductive tract) were obtained. Proteins from each anatomical fraction were extracted, desalted, trypsinized, and analyzed by microcapillary reverse-phase liquid chromatography-tandem-mass spectrometry. In total, we identified 4,785 B. malayi proteins. While 1,894 were identified in all three anatomic fractions, 396 were positively identified only within the digestive tract, 114 only within the body wall, and 1,011 only within the reproductive tract. Gene set enrichment analysis revealed a bias for transporters to be present within the digestive tract, suggesting that the intestine of adult filariae is functional and important for nutrient uptake or waste removal. As expected, the body wall exhibited increased frequencies of cytoskeletal proteins, and the reproductive tract had increased frequencies of proteins involved in nuclear regulation and transcription. In assessing for possible vaccine candidates, we focused on proteins sequestered within the digestive tract, as these could possibly represent "hidden antigens" with low risk of prior allergic sensitization. We identified 106 proteins that are enriched in the digestive tract and are predicted to localize to the surface of cells in the the digestive tract. It is possible that some of these proteins are on the luminal surface and may be accessible by antibodies ingested by the worm. A subset of 27 of these proteins appear

  16. Krüppel-like factor 4 is widely expressed in the mouse male and female reproductive tract and responds as an immediate early gene to activation of the protein kinase A in TM4 Sertoli cells.

    PubMed

    Godmann, M; Kosan, C; Behr, R

    2010-04-01

    Krüppel-like factor 4 (KLF4) is a zinc finger transcription factor critically involved in cell proliferation, differentiation, and carcinogenesis. Recently, KLF4 has also been used for the generation of induced pluripotent stem cells. In this study, we analyzed Klf4 expression in different mouse tissues using northern blot analysis and immunohistochemistry. Focusing on the male and female reproductive tract, we showed for the first time that KLF4 is expressed in the epithelia of the murine uterus and the vagina. In the male reproductive tract, we detected KLF4 in the epithelia of the epididymis, ductus deferens, coagulating gland, and the penis. As KLF4 is strongly inducible by FSH signaling in Sertoli cells and as this transcription factor is also involved in Sertoli cell development, we employed the mouse Sertoli cell line TM4 as a model system to investigate i) the induction kinetics of Klf4 upon activation of the cAMP/protein kinase A pathway by forskolin and ii) the effects of Klf4 induction on TM4 cell cycle progression. Interestingly, Klf4 mRNA and protein were rapidly but transiently induced, reaching peak levels after 90-120 min and declining to basal levels within 4 h. Compared with the inducible cAMP early repressor, an immediate early response gene, the induction kinetics of Klf4 is much faster. In conclusion, Klf4 is an immediate early gene in TM4 cells and its expression in several epithelia of the male and female reproductive tract suggests an important role of Klf4 in mouse reproductive functions.

  17. Targeting the genital tract mucosa with a lipopeptide/recombinant adenovirus prime/boost vaccine induces potent and long-lasting CD8+ T cell immunity against herpes: importance of MyD88.

    PubMed

    Zhang, Xiuli; Dervillez, Xavier; Chentoufi, Aziz Alami; Badakhshan, Tina; Bettahi, Ilham; Benmohamed, Lbachir

    2012-11-01

    Targeting of the mucosal immune system of the genital tract with subunit vaccines has failed to induce potent and durable local CD8(+) T cell immunity, which is crucial for protection against many sexually transmitted viral pathogens, including HSV type 2 (HSV-2), which causes genital herpes. In this study, we aimed to investigate the potential of a novel lipopeptide/adenovirus type 5 (Lipo/rAdv5) prime/boost mucosal vaccine for induction of CD8(+) T cell immunity to protect the female genital tract from herpes. The lipopeptide vaccine and the rAdv5 vaccine express the immunodominant HSV-2 CD8(+) T cell epitope (gB(498-505)), and both were delivered intravaginally in the progesterone-induced B6 mouse model of genital herpes. Compared with mice immunized with the homologous lipopeptide/lipopeptide (Lipo/Lipo) vaccine, the Lipo/rAdv5 prime/boost immunized mice 1) developed potent and sustained HSV-specific CD8(+) T cells, detected in both the genital tract draining nodes and in the vaginal mucosa; 2) had significantly lower virus titers; 3) had decreased overt signs of genital herpes disease; and 4) did not succumb to lethal infection (p < 0.005) after intravaginal HSV-2 challenge. Polyfunctional CD8(+) T cells, producing IFN-γ, TNF-α, and IL-2 and exhibiting cytotoxic activity, were associated with protection (p < 0.005). The protective CD8(+) T cell response was significantly compromised in the absence of the adapter MyD88 (p = 0.0001). Taken together, these findings indicate that targeting of the vaginal mucosa with a Lipo/rAdv5 prime/boost vaccine elicits a potent, MyD88-dependent, and long-lasting mucosal CD8(+) T cell protective immunity against sexually transmitted herpes infection and disease.

  18. Comprehensive Management of Upper Tract Urothelial Carcinoma

    PubMed Central

    Koukourakis, Georgios; Zacharias, Georgios; Koukourakis, Michael; Pistevou-Gobaki, Kiriaki; Papaloukas, Christos; Kostakopoulos, Athanasios; Kouloulias, Vassilios

    2009-01-01

    Urothelial carcinoma of the upper urinary tract represents only 5% of all urothelial cancers. The 5-year cancer-specific survival in the United States is roughly 75% with grade and stage being the most powerful predictors of survival. Nephroureterectomy with excision of the ipsilateral ureteral orifice and bladder cuff en bloc remains the gold standard treatment of the upper urinary tract urothelial cancers, while endoscopic and laparoscopic approaches are rapidly evolving as reasonable alternatives of care depending on grade and stage of disease. Several controversies remain in their management, including a selection of endoscopic versus laparoscopic approaches, management strategies on the distal ureter, the role of lymphadenectomy, and the value of chemotherapy in upper tract disease. Aims of this paper are to critically review the management of such tumors, including endoscopic management, laparoscopic nephroureterectomy and management of the distal ureter, the role of lymphadenectomy, and the emerging role of chemotherapy in their treatment. PMID:19096525

  19. Water extract of Pueraria lobata Ohwi has anti-viral activity against human respiratory syncytial virus in human respiratory tract cell lines.

    PubMed

    Lin, Tzeng-Jih; Yeh, Chia-Feng; Wang, Kuo-Chih; Chiang, Lien-Chai; Tsai, Jih-Jin; Chang, Jung-San

    2013-12-01

    Human respiratory syncytial virus (HRSV) infects all age groups and causes bronchiolitis, pneumonia, and acute respiratory distress syndrome with a significant mortality rate. To date, only ribavirin has been used to manage HRSV infection. However, ribavirin is expensive with an only modest effect. Furthermore, ribavirin has several side effects, which means it has limited clinical benefit. Pueraria lobata Ohwi (P. lobata) is a common ingredient of Ge-Gen-Tang (Kakkon-to) and Sheng-Ma-Ge-Gen-Tang (Shoma-kakkon-to), which are prescriptions of Chinese traditional medicine proven to have antiviral activity against HRSV. Therefore, it was hypothesized that P. lobata might be effective against HRSV. To find a cost-effective therapeutic modality, both human upper (HEp-2) and lower (A549) respiratory tract cell lines were used to test the hypothesis that P. lobata could inhibit HRSV-induced plaque formation. Results showed that the water extract of P. lobata was effective (p < 0.0001) against HRSV-induced plaque formation. P. lobata was more effective when given prior to viral inoculation (p < 0.0001) by inhibiting viral attachment (p < 0.0001) and penetration (p < 0.0001). However, supplementation with P. lobata could not stimulate interferon secretion after HRSV infection. In conclusion, P. lobata has antiviral activity against HRSV-induced plaque formation in airway mucosa mainly by inhibiting viral attachment and internalization. Further identification of effective constituents could contribute to the prevention of HRSV infection.

  20. Protein-Coated Nanoparticles Are Internalized by the Epithelial Cells of the Female Reproductive Tract and Induce Systemic and Mucosal Immune Responses

    PubMed Central

    Howe, Savannah E.; Konjufca, Vjollca H.

    2014-01-01

    The female reproductive tract (FRT) includes the oviducts (fallopian tubes), uterus, cervix and vagina. A layer of columnar epithelium separates the endocervix and uterus from the outside environment, while the vagina is lined with stratified squamous epithelium. The mucosa of the FRT is exposed to antigens originating from microflora, and occasionally from infectious microorganisms. Whether epithelial cells (ECs) of the FRT take up (sample) the lumen antigens is not known. To address this question, we examined the uptake of 20–40 nm nanoparticles (NPs) applied vaginally to mice which were not treated with hormones, epithelial disruptors, or adjuvants. We found that 20 and 40 nm NPs are quickly internalized by ECs of the upper FRT and within one hour could be observed in the lymphatic ducts that drain the FRT, as well as in the ileac lymph nodes (ILNs) and the mesenteric lymph nodes (MLNs). Chicken ovalbumin (Ova) conjugated to 20 nm NPs (NP-Ova) when administered vaginally reaches the internal milieu in an immunologically relevant form; thus vaginal immunization of mice with NP-Ova induces systemic IgG to Ova antigen. Most importantly, vaginal immunization primes the intestinal mucosa for secretion of sIgA. Sub-cutaneous (s.c) boosting immunization with Ova in complete Freund's adjuvant (CFA) further elevates the systemic (IgG1 and IgG2c) as well as mucosal (IgG1 and sIgA) antibody titers. These findings suggest that the modes of antigen uptake at mucosal surfaces and pathways of antigen transport are more complex than previously appreciated. PMID:25490456

  1. [Mechanisms of urinary tract sterility maintenance].

    PubMed

    Okrągła, Emilia; Szychowska, Katarzyna; Wolska, Lidia

    2014-06-02

    Physiologically, urine and the urinary tract are maintained sterile because of physical and chemical properties of urine and the innate immune system's action. The urinary tract is constantly exposed to the invasion of microorganisms from the exterior environment, also because of the anatomical placement of the urethra, in the vicinity of the rectum. Particularly vulnerable to urinary tract infections (UTI) are women (an additional risk factor is pregnancy), but also the elderly and children. The main pathogens causing UTI are bacteria; in 70-95% of cases it is the bacterium Escherichia coli. Infections caused by viruses and fungi are less common and are associated with decreased immunity, pharmacotherapy, or some diseases. Bacteria have evolved a number of factors that facilitate the colonization of the urinary tract: the cover and cell membrane antigens O and K1, lipopolysaccharide (LPS), fimbriae, pile and cilia. On the other hand, the human organism has evolved mechanisms to hinder colonization of the urinary tract: mechanisms arising from the anatomical structure of the urinary tract, the physicochemical properties of the urine and the activity of the innate immune system, also known as non-specific, which isolates and destroys pathogens using immunological processes, and the mechanisms for release of antimicrobial substances such as Tamm-Horsfall protein, mucopolysaccharides, immunoglobulins IgA and IgG, lactoferrin, lipocalin, neutrophils, cytokines and antimicrobial peptides. This review aims to analyze the state of knowledge on the mechanisms to maintain the sterility of the urinary tract used by the human organism and bacterial virulence factors to facilitate the colonization of the urinary tract.

  2. Mobile Applications in Cell Biology Present New Approaches for Cell Modelling

    ERIC Educational Resources Information Center

    de Oliveira, Mayara Lustosa; Galembeck, Eduardo

    2016-01-01

    Cell biology apps were surveyed in order to identify whether there are new approaches for modelling cells allowed by the new technologies implemented in tablets and smartphones. A total of 97 apps were identified in 3 stores surveyed (Apple, Google Play and Amazon), they are presented as: education 48.4%, games 26.8% and medicine 15.4%. The apps…

  3. [Renal and upper urinary tract tumors: what the nephrologist should know].

    PubMed

    Gigante, Margherita; Cicione, Raffaele Ivan; Ranieri, Elena

    2010-01-01

    Urinary tract carcinomas are among the most common malignancies and are derived from neoplastic transformation of the urothelium. They can be located in the lower (bladder, urethra) or upper (pyelocaliceal cavities, ureter) urinary tract. Urothelial carcinomas are the fourth most common cancer type after prostate or breast cancer, lung cancer, and colorectal cancer. Bladder cancer accounts for 90-95% of urothelial carcinomas and it is the most common malignancy of the urinary tract. Renal cancer also belongs to the urothelial carcinomas and is a relatively uncommon solid tumor, accounting for about 3% of all adult malignancies, although its incidence is on the rise. The most common histological subtype, renal cell carcinoma (RCC), is a clear cell carcinoma that makes up approximately 70-80% of all renal neoplasms and appears to be the only histological subtype that is partially responsive to immunotherapeutic approaches. The current review gives an overview of upper urinary tract tumors and renal cancer, in particular RCC, highlighting issues related to its molecular pathogenesis and the new immunotherapeutic approaches.

  4. Insights into nuclear dynamics using live-cell imaging approaches.

    PubMed

    Bigley, Rachel B; Payumo, Alexander Y; Alexander, Jeffrey M; Huang, Guo N

    2017-03-01

    The nucleus contains the genetic blueprint of the cell and myriad interactions within this subcellular structure are required for gene regulation. In the current scientific era, characterization of these gene regulatory networks through biochemical techniques coupled with systems-wide 'omic' approaches has become commonplace. However, these strategies are limited because they represent a mere snapshot of the cellular state. To obtain a holistic understanding of nuclear dynamics, relevant molecules must be studied in their native contexts in living systems. Live-cell imaging approaches are capable of providing quantitative assessment of the dynamics of gene regulatory interactions within the nucleus. We survey recent insights into what live-cell imaging approaches have provided the field of nuclear dynamics. In this review, we focus on interactions of DNA with other DNA loci, proteins, RNA, and the nuclear envelope. WIREs Syst Biol Med 2017, 9:e1372. doi: 10.1002/wsbm.1372 For further resources related to this article, please visit the WIREs website.

  5. Virus integration and genome influence in approaches to stem cell based therapy for andro-urology.

    PubMed

    Li, Longkun; Zhang, Deying; Li, Peng; Damaser, Margot; Zhang, Yuanyuan

    2015-03-01

    Despite the potential of stem cells in cell-based therapy, major limitations such as cell retention, ingrowth, and trans-differentiation after implantation remain. One technique for genetic modification of cells for tissue repair is the introduction of specific genes using molecular biology techniques, such as virus integration, to provide a gene that adds new functions to enhance cellular function, and to secrete trophic factors for recruiting resident cells to participate in tissue repair. Stem cells can be labeled to track cell survival, migration, and lineage. Increasing evidence demonstrates that cell therapy and gene therapy in combination remarkably improve differentiation of implanted mesenchymal stromal cells (MSCs), revascularization, and innervation in genitourinary tissues, especially to treat urinary incontinence, erectile dysfunction, lower urinary tract reconstruction, and renal failure. This review discusses the benefits, safety, side effects, and alternatives for using genetically modified MSCs in tissue regeneration in andro-urology.

  6. Virus Integration and Genome Influence in Approaches to Stem Cell Based Therapy for Andro-Urology

    PubMed Central

    Li, Longkun; Zhang, Deying; Li, Peng; Damaser, Margot; Zhang, Yuanyuan

    2014-01-01

    Despite the potential of stem cells in cell-based therapy, major limitations such as cell retention, ingrowth, and trans-differentiation after implantation remain. One technique for genetic modification of cells for tissue repair is the introduction of specific genes using molecular biology techniques, such as virus integration, to provide a gene that adds new functions to enhance cellular function, and to secrete trophic factors for recruiting resident cells to participate in tissue repair. Stem cells can be labelled to track cell survival, migration, and lineage. Increasing evidence demonstrates that cell therapy and gene therapy in combination remarkably improve myogenic differentiation of implanted mesenchymal stromal cells (MSCs), revascularization, and innervation in genitourinary tissues, especially to treat urinary incontinence, erectile dysfunction, lower urinary tract reconstruction, and renal failure. This review discusses the benefits, safety, side effects, and alternatives for using genetically modified MSCs in tissue regeneration in andro-urology. PMID:25453258

  7. The activity and localization patterns of cathepsins B and X in cells of the mouse gastrointestinal tract differ along its length.

    PubMed

    Tamhane, Tripti; Arampatzidou, Maria; Gerganova, Veneta; Tacke, Marlene; Illukkumbura, Rukshala; Dauth, Stephanie; Schaschke, Norbert; Peters, Christoph; Reinheckel, Thomas; Brix, Klaudia

    2014-10-01

    Cysteine cathepsins are expressed in most tissues, including the gastrointestinal tract. We demonstrated an involvement of mouse intestinal cathepsin B in extracellular matrix remodeling for regeneration from trauma. The present study aimed at elucidating roles of cysteine cathepsins in the non-traumatized gastrointestinal tract of mice. Thus we investigated expression and localization patterns of cathepsin B and its closest relative, cathepsin X, along the length of the gastrointestinal tract, and determined the effects of their absence. Cathepsin B showed the highest protein levels in the anterior segments of the gastrointestinal tract, whereas the highest activity was observed in the jejunum, as revealed by cathepsin B-specific activity-based probe labeling. Cathepsin X was most abundant in the jejunum and protein levels were elevated in duodenum and colon of Ctsb-/- mice. The segmental pattern of cathepsin expression was reflected by a compartmentalized distribution of junction proteins and basal lamina constituents, changes in tissue architecture and altered activities of the brush border enzyme aminopeptidase N. In conclusion, we observed different compensatory effects and activity levels of cysteine peptidases along the length of the small and large intestines in a segment-specific manner suggesting specific in situ functions of these enzymes in particular parts of the gastrointestinal tract.

  8. Modern approach for determination of lactulose, mannitol and sucrose in human urine using HPLC-MS/MS for the studies of intestinal and upper digestive tract permeability.

    PubMed

    Kubica, Paweł; Kot-Wasik, Agata; Wasik, Andrzej; Namieśnik, Jacek; Landowski, Piotr

    2012-10-15

    A new analytical procedure was described for the simultaneous determination of lactulose, mannitol and sucrose in urine, in which HILIC chromatography and tandem mass spectrometry detection are used. Sugars are orally administered for the estimation of intestinal permeability in children digestive tract. Samples were purified by dispersive solid phase extraction (d-SPE) using Amberlite MB150 resin. Raffinose was selected as an internal standard. The chosen chromatographic separation was carried out on ZIC(®)-HILIC column in 10 min at a flow rate of 0.3 mL/min, using mixture of acetonitrile (ACN) and ammonium acetate (NH(4)Ac) in water (H(2)O) as the mobile phase. Within-run precision (CV) measured at three concentrations was 1.08%, 0.32% and 0.49% for lactulose; 1.88%, 0.47% and 0.75% for mannitol, 2.95%, 1.31% and 0.6% for sucrose. Between-run CVs were 0.75%, 1.1% and 1.2% for lactulose; 1.1%, 1.02% and 1.01% for mannitol; 1.17%, 1.4% and 1.05% for sucrose. Analytical recovery of all three sugar probes was 95.06-99.92%. The detection limits were: 15.94 ng/mL for lactulose, 17.10 ng/mL for sucrose and 11.48 ng/mL for mannitol. The proposed method is rapid, simple, sensitive and suitable for the determination of intestinal permeability of the sugar derivatives in children.

  9. From DNA radiation damage to cell death: theoretical approaches.

    PubMed

    Ballarini, Francesca

    2010-10-05

    Some representative models of radiation-induced cell death, which is a crucial endpoint in radiobiology, were reviewed. The basic assumptions were identified, their consequences on predicted cell survival were analyzed, and the advantages and drawbacks of each approach were outlined. In addition to "historical" approaches such as the Target Theory, the Linear-Quadratic model, the Theory of Dual Radiation Action and Katz' model, the more recent Local Effect Model was discussed, focusing on its application in Carbon-ion hadrontherapy. Furthermore, a mechanistic model developed at the University of Pavia and based on the relationship between cell inactivation and chromosome aberrations was presented, together with recent results; the good agreement between model predictions and literature experimental data on different radiation types (photons, protons, alpha particles, and Carbon ions) supported the idea that asymmetric chromosome aberrations like dicentrics and rings play a fundamental role for cell death. Basing on these results, a reinterpretation of the TDRA was also proposed, identifying the TDRA "sublesions" and "lesions" as clustered DNA double-strand breaks and (lethal) chromosome aberrations, respectively.

  10. From DNA Radiation Damage to Cell Death: Theoretical Approaches

    PubMed Central

    Ballarini, Francesca

    2010-01-01

    Some representative models of radiation-induced cell death, which is a crucial endpoint in radiobiology, were reviewed. The basic assumptions were identified, their consequences on predicted cell survival were analyzed, and the advantages and drawbacks of each approach were outlined. In addition to “historical” approaches such as the Target Theory, the Linear-Quadratic model, the Theory of Dual Radiation Action and Katz' model, the more recent Local Effect Model was discussed, focusing on its application in Carbon-ion hadrontherapy. Furthermore, a mechanistic model developed at the University of Pavia and based on the relationship between cell inactivation and chromosome aberrations was presented, together with recent results; the good agreement between model predictions and literature experimental data on different radiation types (photons, protons, alpha particles, and Carbon ions) supported the idea that asymmetric chromosome aberrations like dicentrics and rings play a fundamental role for cell death. Basing on these results, a reinterpretation of the TDRA was also proposed, identifying the TDRA “sublesions” and “lesions” as clustered DNA double-strand breaks and (lethal) chromosome aberrations, respectively. PMID:20976308

  11. An analytical approach for solid oxide cell electrode geometric design

    NASA Astrophysics Data System (ADS)

    Nelson, George J.

    2015-12-01

    An analytical model for gas distributions in porous solid oxide cell electrodes is applied to develop dimensionless metrics that describe electrode performance. These metrics include two forms of a dimensionless reactant depletion current density and a geometry sensitive Damköhler number used to assess electrode catalytic effectiveness. The first dimensionless depletion current density defines when reducing electrode thickness no longer benefits mass transfer performance for a given cell geometry. The second dimensionless depletion current density provides a gage of deviation from the limiting current behavior predicted using button-cell experimental and modeling approaches. The Damköhler number and related catalytic effectiveness quantify two-dimensional transport effects under non-depleted operating conditions, providing a means of generalizing insights from reactant depletion behavior for typical cell operating conditions. A finite element solution for gas transport based on the dusty-gas model is used as a benchmark for the analytical model and dimensionless metrics. Estimates of concentration polarization based on analytical and numerical models compare well to published experimental data. Analytical performance predictions provide clear demonstration of the influence of two-dimensional electrode geometry on solid oxide cell performance. These results agree with finite element predictions and suggest that reduction of electrode thickness does not exclusively benefit cell performance.

  12. Interactive Exploration and Visualization using MetaTracts extracted from Carbon Fiber Reinforced Composites.

    PubMed

    Bhattacharya, Arindam; Weissenbock, Johannes; Wenger, Rephael; Amirkhanov, Artem; Kastner, Johann; Heinzl, Christoph

    2016-06-16

    This work introduces a tool for interactive exploration and visualization using MetaTracts. MetaTracts is a novel method for extraction and visualization of individual fiber bundles and weaving patterns from X-ray computed tomography (XCT) scans of endless carbon fiber reinforced polymers (CFRPs). It is designed specifically to handle XCT scans of low resolutions where the individual fibers are barely visible, which makes extraction of fiber bundles a challenging problem. The proposed workflow is used to analyze unit cells of CFRP materials integrating a recurring weaving pattern. First, a coarse version of integral curves is used to trace subsections of the individual fiber bundles in the woven CFRP materials. We call these sections MetaTracts. In the second step, these extracted fiber bundle sections are clustered using a two-step approach: first by orientation, then by proximity. The tool can generate volumetric representations as well as surface models of the extracted fiber bundles to be exported for further analysis. In addition a custom interactive tool for exploration and visual analysis of MetaTracts is designed. We evaluate the proposed workflow on a number of real world datasets and demonstrate that MetaTracts effectively and robustly identifies and extracts fiber bundles.

  13. Biofabrication and Bone Tissue Regeneration: Cell Source, Approaches, and Challenges

    PubMed Central

    Orciani, Monia; Fini, Milena; Di Primio, Roberto; Mattioli-Belmonte, Monica

    2017-01-01

    The growing occurrence of bone disorders and the increase in aging population have resulted in the need for more effective therapies to meet this request. Bone tissue engineering strategies, by combining biomaterials, cells, and signaling factors, are seen as alternatives to conventional bone grafts for repairing or rebuilding bone defects. Indeed, skeletal tissue engineering has not yet achieved full translation into clinical practice because of several challenges. Bone biofabrication by additive manufacturing techniques may represent a possible solution, with its intrinsic capability for accuracy, reproducibility, and customization of scaffolds as well as cell and signaling molecule delivery. This review examines the existing research in bone biofabrication and the appropriate cells and factors selection for successful bone regeneration as well as limitations affecting these approaches. Challenges that need to be tackled with the highest priority are the obtainment of appropriate vascularized scaffolds with an accurate spatiotemporal biochemical and mechanical stimuli release, in order to improve osseointegration as well as osteogenesis. PMID:28386538

  14. Biofabrication and Bone Tissue Regeneration: Cell Source, Approaches, and Challenges.

    PubMed

    Orciani, Monia; Fini, Milena; Di Primio, Roberto; Mattioli-Belmonte, Monica

    2017-01-01

    The growing occurrence of bone disorders and the increase in aging population have resulted in the need for more effective therapies to meet this request. Bone tissue engineering strategies, by combining biomaterials, cells, and signaling factors, are seen as alternatives to conventional bone grafts for repairing or rebuilding bone defects. Indeed, skeletal tissue engineering has not yet achieved full translation into clinical practice because of several challenges. Bone biofabrication by additive manufacturing techniques may represent a possible solution, with its intrinsic capability for accuracy, reproducibility, and customization of scaffolds as well as cell and signaling molecule delivery. This review examines the existing research in bone biofabrication and the appropriate cells and factors selection for successful bone regeneration as well as limitations affecting these approaches. Challenges that need to be tackled with the highest priority are the obtainment of appropriate vascularized scaffolds with an accurate spatiotemporal biochemical and mechanical stimuli release, in order to improve osseointegration as well as osteogenesis.

  15. Stem cell approaches in psychiatry - challenges and opportunities

    PubMed Central

    Benninghoff, Jens

    2009-01-01

    Exploring stem ceils is a fascinating task, especially in a discipline where the use of stem cells seems far-fetched at first glance, as is the case in psychiatry. In this article we would like to provide a brief overview of the current situation in relation to the treatment of mental diseases. For reasons that we will explain, this review will focus on affective disorders. The following section will give a more detailed account of stem-cell biology, including current basic science approaches presenting in-vivo andin-vitro techniques. The final part will then look into future perspectives of using these stem cells to cure mental illnesses, and discuss the related challenges and opportunities. PMID:20135897

  16. Porous Media Approach for Modeling Closed Cell Foam

    NASA Technical Reports Server (NTRS)

    Ghosn, Louis J.; Sullivan, Roy M.

    2006-01-01

    In order to minimize boil off of the liquid oxygen and liquid hydrogen and to prevent the formation of ice on its exterior surface, the Space Shuttle External Tank (ET) is insulated using various low-density, closed-cell polymeric foams. Improved analysis methods for these foam materials are needed to predict the foam structural response and to help identify the foam fracture behavior in order to help minimize foam shedding occurrences. This presentation describes a continuum based approach to modeling the foam thermo-mechanical behavior that accounts for the cellular nature of the material and explicitly addresses the effect of the internal cell gas pressure. A porous media approach is implemented in a finite element frame work to model the mechanical behavior of the closed cell foam. The ABAQUS general purpose finite element program is used to simulate the continuum behavior of the foam. The soil mechanics element is implemented to account for the cell internal pressure and its effect on the stress and strain fields. The pressure variation inside the closed cells is calculated using the ideal gas laws. The soil mechanics element is compatible with an orthotropic materials model to capture the different behavior between the rise and in-plane directions of the foam. The porous media approach is applied to model the foam thermal strain and calculate the foam effective coefficient of thermal expansion. The calculated foam coefficients of thermal expansion were able to simulate the measured thermal strain during heat up from cryogenic temperature to room temperature in vacuum. The porous media approach was applied to an insulated substrate with one inch foam and compared to a simple elastic solution without pore pressure. The porous media approach is also applied to model the foam mechanical behavior during subscale laboratory experiments. In this test, a foam layer sprayed on a metal substrate is subjected to a temperature variation while the metal substrate is

  17. New Modeling Approaches to Investigate Cell Signaling in Radiation Response

    NASA Technical Reports Server (NTRS)

    Plante, Ianik; Cucinotta, Francis A.; Ponomarev, Artem L.

    2011-01-01

    Ionizing radiation damages individual cells and tissues leading to harmful biological effects. Among many radiation-induced lesions, DNA double-strand breaks (DSB) are considered the key precursors of most early and late effects [1] leading to direct mutation or aberrant signal transduction processes. In response to damage, a flow of information is communicated to cells not directly hit by the radiation through signal transduction pathways [2]. Non-targeted effects (NTE), which includes bystander effects and genomic instability in the progeny of irradiated cells and tissues, may be particularly important for space radiation risk assessment [1], because astronauts are exposed to a low fluence of heavy ions and only a small fraction of cells are traversed by an ion. NTE may also have important consequences clinical radiotherapy [3]. In the recent years, new simulation tools and modeling approaches have become available to study the tissue response to radiation. The simulation of signal transduction pathways require many elements such as detailed track structure calculations, a tissue or cell culture model, knowledge of biochemical pathways and Brownian Dynamics (BD) propagators of the signaling molecules in their micro-environment. Recently, the Monte-Carlo simulation code of radiation track structure RITRACKS was used for micro and nano-dosimetry calculations [4]. RITRACKS will be used to calculate the fraction of cells traversed by an ion and delta-rays and the energy deposited in cells in a tissue model. RITRACKS also simulates the formation of chemical species by the radiolysis of water [5], notably the .OH radical. This molecule is implicated in DNA damage and in the activation of the transforming growth factor beta (TGF), a signaling molecule involved in NTE. BD algorithms for a particle near a membrane comprising receptors were also developed and will be used to simulate trajectories of signaling molecules in the micro-environment and characterize autocrine

  18. Visual Analytics approach for Lightning data analysis and cell nowcasting

    NASA Astrophysics Data System (ADS)

    Peters, Stefan; Meng, Liqiu; Betz, Hans-Dieter

    2013-04-01

    Thunderstorms and their ground effects, such as flash floods, hail, lightning, strong wind and tornadoes, are responsible for most weather damages (Bonelli & Marcacci 2008). Thus to understand, identify, track and predict lightning cells is essential. An important aspect for decision makers is an appropriate visualization of weather analysis results including the representation of dynamic lightning cells. This work focuses on the visual analysis of lightning data and lightning cell nowcasting which aim to detect and understanding spatial-temporal patterns of moving thunderstorms. Lightnings are described by 3D coordinates and the exact occurrence time of lightnings. The three-dimensionally resolved total lightning data used in our experiment are provided by the European lightning detection network LINET (Betz et al. 2009). In all previous works, lightning point data, detected lightning cells and derived cell tracks are visualized in 2D. Lightning cells are either displayed as 2D convex hulls with or without the underlying lightning point data. Due to recent improvements of lightning data detection and accuracy, there is a growing demand on multidimensional and interactive visualization in particular for decision makers. In a first step lightning cells are identified and tracked. Then an interactive graphic user interface (GUI) is developed to investigate the dynamics of the lightning cells: e.g. changes of cell density, location, extension as well as merging and splitting behavior in 3D over time. In particular a space time cube approach is highlighted along with statistical analysis. Furthermore a lightning cell nowcasting is conducted and visualized. The idea thereby is to predict the following cell features for the next 10-60 minutes including location, centre, extension, density, area, volume, lifetime and cell feature probabilities. The main focus will be set to a suitable interactive visualization of the predicted featured within the GUI. The developed visual

  19. A lectin-based cell microarray approach to analyze the mammalian granulosa cell surface glycosylation profile.

    PubMed

    Accogli, Gianluca; Desantis, Salvatore; Martino, Nicola Antonio; Dell'Aquila, Maria Elena; Gemeiner, Peter; Katrlík, Jaroslav

    2016-10-01

    The high complexity of glycome, the repertoire of glycans expressed in a cell or in an organism, is difficult to analyze and the use of new technologies has accelerated the progress of glycomics analysis. In the last decade, the microarray approaches, and in particular glycan and lectin microarrays, have provided new insights into evaluation of cell glycosylation status. Here we present a cell microarray method based on cell printing on microarray slides for the analysis of the glycosylation pattern of the cell glycocalyx. In order to demonstrate the reliability of the developed method, the glycome profiles of equine native uncultured mural granulosa cells (uGCs) and in vitro cultured mural granulosa cells (cGCs) were determined and compared. The method consists in the isolation of GCs, cell printing into arrays on microarray slide, incubation with a panel of biotinylated lectins, reaction with fluorescent streptavidin and signal intensity detection by a microarray scanner. Cell microarray technology revealed that glycocalyx of both uGCs and cGCs contains N-glycans, sialic acid terminating glycans, N-acetylglucosamine and O-glycans. The comparison of uGCs and cGCs glycan signals indicated an increase in the expression of sialic acids, N-acetylglucosamine, and N-glycans in cGCs. Glycan profiles determined by cell microarray agreed with those revealed by lectin histochemistry. The described cell microarray method represents a simple and sensitive procedure to analyze cell surface glycome in mammalian cells.

  20. A discrete approach for modeling cell-matrix adhesions

    NASA Astrophysics Data System (ADS)

    Escribano, J.; Sánchez, M. T.; García-Aznar, J. M.

    2014-06-01

    During recent years the interaction between the extracellular matrix and the cytoskeleton of the cell has been object of numerous studies due to its importance in cell migration processes. These interactions are performed through protein clutches, known as focal adhesions. For migratory cells these focal adhesions along with force generating processes in the cytoskeleton are responsible for the formation of protrusion structures like lamellipodia or filopodia. Much is known about these structures: the different proteins that conform them, the players involved in their formation or their role in cell migration. Concretely, growth-cone filopodia structures have attracted significant attention because of their role as cell sensors of their surrounding environment and its complex behavior. On this matter, a vast myriad of mathematical models has been presented to explain its mechanical behavior. In this work, we aim to study the mechanical behavior of these structures through a discrete approach. This numerical model provides an individual analysis of the proteins involved including spatial distribution, interaction between them, and study of different phenomena, such as clutches unbinding or protein unfolding.

  1. Bioengineering approaches to guide stem cell-based organogenesis.

    PubMed

    Gjorevski, Nikolche; Ranga, Adrian; Lutolf, Matthias P

    2014-05-01

    During organogenesis, various molecular and physical signals are orchestrated in space and time to sculpt multiple cell types into functional tissues and organs. The complex and dynamic nature of the process has hindered studies aimed at delineating morphogenetic mechanisms in vivo, particularly in mammals. Recent demonstrations of stem cell-driven tissue assembly in culture offer a powerful new tool for modeling and dissecting organogenesis. However, despite the highly organotypic nature of stem cell-derived tissues, substantial differences set them apart from their in vivo counterparts, probably owing to the altered microenvironment in which they reside and the lack of mesenchymal influences. Advances in the biomaterials and microtechnology fields have, for example, afforded a high degree of spatiotemporal control over the cellular microenvironment, making it possible to interrogate the effects of individual microenvironmental components in a modular fashion and rapidly identify organ-specific synthetic culture models. Hence, bioengineering approaches promise to bridge the gap between stem cell-driven tissue formation in culture and morphogenesis in vivo, offering mechanistic insight into organogenesis and unveiling powerful new models for drug discovery, as well as strategies for tissue regeneration in the clinic. We draw on several examples of stem cell-derived organoids to illustrate how bioengineering can contribute to tissue formation ex vivo. We also discuss the challenges that lie ahead and potential ways to overcome them.

  2. Inductive and Deductive Approaches to Acute Cell Injury

    PubMed Central

    DeGracia, Donald J.; Tri Anggraini, Fika; Taha, Doaa Taha Metwally; Huang, Zhi-Feng

    2014-01-01

    Many clinically relevant forms of acute injury, such as stroke, traumatic brain injury, and myocardial infarction, have resisted treatments to prevent cell death following injury. The clinical failures can be linked to the currently used inductive models based on biological specifics of the injury system. Here we contrast the application of inductive and deductive models of acute cell injury. Using brain ischemia as a case study, we discuss limitations in inductive inferences, including the inability to unambiguously assign cell death causality and the lack of a systematic quantitative framework. These limitations follow from an overemphasis on qualitative molecular pathways specific to the injured system. Our recently developed nonlinear dynamical theory of cell injury provides a generic, systematic approach to cell injury in which attractor states and system parameters are used to quantitatively characterize acute injury systems. The theoretical, empirical, and therapeutic implications of shifting to a deductive framework are discussed. We illustrate how a deductive mathematical framework offers tangible advantages over qualitative inductive models for the development of therapeutics of acutely injured biological systems. PMID:27437490

  3. Contactin‑associated protein‑like 2 expression in SH‑SY5Y cells is upregulated by a FOXP2 mutant with a shortened poly‑glutamine tract.

    PubMed

    Zhao, Yunjing; Liu, Xiaoliang; Sun, Hongwei; Wang, Yueping; Yang, Wenzhu; Ma, Hongwei

    2015-12-01

    The forkhead box protein P2 (FOXP2) gene encodes an important transcription factor that contains a polyglutamine (poly‑Q) tract and a forkhead DNA binding domain. It has been observed that FOXP2 is associated with speech sound disorder (SSD), and mutations that decrease the length of the poly‑Q tract were identified in the FOXP2 gene of SSD patients. However, the exact role of poly‑Q reduction is not well understood. In the present study, constructs expressing wild‑type and poly‑Q reduction mutants of FOXP2 were generated by polymerase chain reaction (PCR) using lentiviral vectors and transfected into the SH‑SY5Y neuronal cell line. Quantitative reverse transcription (qRT)‑PCR and western blotting indicated that infected cells stably expressed high levels of FOXP2. Using this cell model, the impact of FOXP2 on the expression of contactin‑associated protein‑like 2 (CNTNAP2) were investigated, and CNTNAP2 mRNA expression levels were observed to be significantly higher in cells expressing poly‑Q‑reduced FOXP2. In addition, the expression level of CASPR2, a mammalian homolog of Drosophila Neurexin IV, was increased in cells expressing the FOXP2 mutant. Demonstration of regulation by FOXP2 indicates that CNTNAP2 may also be involved in SSD.

  4. Benzodiazepines: electron affinity, receptors and cell signaling - a multifaceted approach.

    PubMed

    Kovacic, Peter; Ott, Nadia; Cooksy, Andrew L

    2013-12-01

    This report entails a multifaceted approach to benzodiazepine (BZ) action, involving electron affinity, receptors, cell signaling and other aspects. Computations of the electron affinities (EAs) of different BZs have been carried out to establish the effect of various substituents on their EA. These computations were undertaken to serve as a first step in determining what role electron transfer (ET) plays in BZ activity. The calculations were conducted on the premise that the nature of the substituent will either decrease or increase the electron density of the benzene ring, thus altering the ability of the molecule to accept an electron. Investigations were performed on the effect of drug protonation on EA. Similarities involving substituent effects in prior electrochemical studies are also discussed. As part of the multifaceted approach, EA is linked to ET, which appears to play a role in therapeutic activity and toxicity. There is extensive literature dealing with the role of receptors in BZ activity. Significant information on receptor involvement was reported more than 40 years ago. Gamma-aminobutyric acid (GABA) is known to be importantly involved. GABA is a probable mediator of BZ effects. BZ and GABA receptors, although not identical, are physiologically linked. Cell signaling is known to play a part in the biochemistry of BZ action. Various factors participated, such as gene expression, allosteric influence, toxic effects and therapeutic action. Evidence points to involvement of EA and ET in the mode of action in cell signaling. Oxidative stress and antioxidant effects are also addressed.

  5. Scientific Approach to Renewable Energy Through Solar Cells

    NASA Astrophysics Data System (ADS)

    Rao, M. C.

    Renewable energy is increasingly viewed as critically important globally. Solar cells convert the energy of the sun into electricity. The method of converting solar energy to electricity is pollution free, and appears a good practical solution to the global energy problems. Energy policies have pushed for different technologies to decrease pollutant emissions and reduce global climate change. Photovoltaic technology, which utilizes sunlight to generate energy, is an attractive alternate energy source because it is renewable, harmless and domestically secure. Transparent conducting metal oxides, being n-type were used extensively in the production of heterojunction cells using p-type Cu2O. The long held consensus is that the best approach to improve cell efficiency in Cu2O-based photovoltaic devices is to achieve both p- and n-type Cu2O and thus p-n homojunction of Cu2O solar cells. Silicon, which, next to oxygen, is the most represented element in the earth's crust, is used for the production of monocrystalline silicon solar cells. Silicon is easily obtained and processed and it is not toxic and does not form compounds that would be environmentally harmful. In contemporary electronic industry silicon is the main semiconducting element. Thin-film cadmium telluride (CdTe) solar cells are the basis of a significant technology with major commercial impact on solar energy production. Polycrystalline thin-film solar cells such as CuInSe2 (CIS), Cu (In, Ga) Se2 (CIGS) and CdTe compound semiconductors are important for terrestrial applications because of their high efficiency, long-term stable performance and potential for low-cost production. Highest record efficiencies of 19.2% for CIGS and 16.5% for CdTe have been achieved.

  6. Urinary Tract Infections.

    ERIC Educational Resources Information Center

    Plummer, Nancy; Michael, Nancy, Ed.

    This module on urinary tract infections is intended for use in inservice or continuing education programs for persons who administer medications in long-term care facilities. Instructor information, including teaching suggestions, and a listing of recommended audiovisual materials and their sources appear first. The module goal and objectives are…

  7. Age-related EBV-associated B-cell lymphoproliferative disorders: diagnostic approach to a newly recognized clinicopathological entity.

    PubMed

    Shimoyama, Yoshie; Asano, Naoko; Kojima, Masaru; Morishima, Satoko; Yamamoto, Kazuhito; Oyama, Takashi; Kinoshita, Tomohiro; Nakamura, Shigeo

    2009-12-01

    EBV is prevalent among healthy individuals, and is implicated in numerous reactive and neoplastic processes in the immune system. The authors originally identified a series of senile or age-related EBV-associated B-cell lymphoproliferative disorders (LPD) bearing a resemblance to immunodeficiency-associated ones, which may be associated with immune senescence in the elderly and which are now incorporated into the 2008 World Health Organization lymphoma classification as EBV-positive diffuse large B-cell lymphoma (DLBCL) of the elderly. This newly described disease is pathologically characterized by a proliferation of atypical large B cells including Reed-Sternberg-like cells with reactive components, which pose a diagnostic problem for pathologists. Clinically, this disease may present with lymphadenopathy, and is often extranodal, frequently involving the skin, gastrointestinal tract, or lung. Onset is usually after the age of 50; the median patient age is 70-79 years, and incidence continues to increase with age, providing additional support to the nosological term of EBV+ DLBCL of the elderly. These patients have a worse prognosis than those with EBV-negative DLBCL or EBV+ classical Hodgkin lymphoma (CHL). The aim of the present review was to summarize the clinicopathological profile of age-related EBV+ LPD and EBV+ Hodgkin lymphoma to facilitate diagnostic approach.

  8. Cancer immunotherapy: nanodelivery approaches for immune cell targeting and tracking

    NASA Astrophysics Data System (ADS)

    Conniot, João; Silva, Joana; Fernandes, Joana; Silva, Liana; Gaspar, Rogério; Brocchini, Steve; Florindo, Helena; Barata, Teresa

    2014-11-01

    Cancer is one of the most common diseases afflicting people globally. New therapeutic approaches are needed due to the complexity of cancer as a disease. Many current treatments are very toxic and have modest efficacy at best. Increased understanding of tumor biology and immunology has allowed the development of specific immunotherapies with minimal toxicity. It is important to highlight the performance of monoclonal antibodies, immune adjuvants, vaccines and cell-based treatments. Although these approaches have shown varying degrees of clinical efficacy, they illustrate the potential to develop new strategies. Targeted immunotherapy is being explored to overcome the heterogeneity of malignant cells and the immune suppression induced by both the tumor and its microenvironment. Nanodelivery strategies seek to minimize systemic exposure to target therapy to malignant tissue and cells. Intracellular penetration has been examined through the use of functionalized particulates. These nano-particulate associated medicines are being developed for use in imaging, diagnostics and cancer targeting. Although nano-particulates are inherently complex medicines, the ability to confer, at least in principle, different types of functionality allows for the plausible consideration these nanodelivery strategies can be exploited for use as combination medicines. The development of targeted nanodelivery systems in which therapeutic and imaging agents are merged into a single platform is an attractive strategy. Currently, several nanoplatform-based formulations, such as polymeric nanoparticles, micelles, liposomes and dendrimers are in preclinical and clinical stages of development. Herein, nanodelivery strategies presently investigated for cancer immunotherapy, cancer targeting mechanisms and nanocarrier functionalization methods will be described. We also intend to discuss the emerging nano-based approaches suitable to be used as imaging techniques and as cancer treatment options.

  9. Cancer immunotherapy: nanodelivery approaches for immune cell targeting and tracking

    PubMed Central

    Conniot, João; Silva, Joana M.; Fernandes, Joana G.; Silva, Liana C.; Gaspar, Rogério; Brocchini, Steve; Florindo, Helena F.; Barata, Teresa S.

    2014-01-01

    Cancer is one of the most common diseases afflicting people globally. New therapeutic approaches are needed due to the complexity of cancer as a disease. Many current treatments are very toxic and have modest efficacy at best. Increased understanding of tumor biology and immunology has allowed the development of specific immunotherapies with minimal toxicity. It is important to highlight the performance of monoclonal antibodies, immune adjuvants, vaccines and cell-based treatments. Although these approaches have shown varying degrees of clinical efficacy, they illustrate the potential to develop new strategies. Targeted immunotherapy is being explored to overcome the heterogeneity of malignant cells and the immune suppression induced by both the tumor and its microenvironment. Nanodelivery strategies seek to minimize systemic exposure to target therapy to malignant tissue and cells. Intracellular penetration has been examined through the use of functionalized particulates. These nano-particulate associated medicines are being developed for use in imaging, diagnostics and cancer targeting. Although nano-particulates are inherently complex medicines, the ability to confer, at least in principle, different types of functionality allows for the plausible consideration these nanodelivery strategies can be exploited for use as combination medicines. The development of targeted nanodelivery systems in which therapeutic and imaging agents are merged into a single platform is an attractive strategy. Currently, several nanoplatform-based formulations, such as polymeric nanoparticles, micelles, liposomes and dendrimers are in preclinical and clinical stages of development. Herein, nanodelivery strategies presently investigated for cancer immunotherapy, cancer targeting mechanisms and nanocarrier functionalization methods will be described. We also intend to discuss the emerging nano-based approaches suitable to be used as imaging techniques and as cancer treatment options

  10. Digestive-tract sarcoidosis

    PubMed Central

    Ghrenassia, Etienne; Mekinian, Arsene; Chapelon-Albric, Catherine; Levy, Pierre; Cosnes, Jacques; Sève, Pascal; Lefèvre, Guillaume; Dhôte, Robin; Launay, David; Prendki, Virginie; Morell-Dubois, Sandrine; Sadoun, Danielle; Mehdaoui, Anas; Soussan, Michael; Bourrier, Anne; Ricard, Laure; Benamouzig, Robert; Valeyre, Dominique; Fain, Olivier

    2016-01-01

    Abstract Digestive tract sarcoidosis (DTS) is rare and case-series are lacking. In this retrospective case–control study, we aimed to compare the characteristics, outcome, and treatment of patients with DTS, nondigestive tract sarcoidosis (NDTS), and Crohn disease. We included cases of confirmed sarcoidosis, symptomatic digestive tract involvement, and noncaseating granuloma in any digestive tract. Each case was compared with 2 controls with sarcoidoisis without digestive tract involvement and 4 with Crohn disease. We compared 25 cases of DTS to 50 controls with NDTS and 100 controls with Crohn disease. The major digestive clinical features were abdominal pain (56%), weight loss (52%), nausea/vomiting (48%), diarrhea (32%), and digestive bleeding (28%). On endoscopy of DTS, macroscopic lesions were observed in the esophagus (9%), stomach (78%), duodenum (9%), colon, (25%) and rectum (19%). As compared with NDTS, DTS was associated with weight loss (odds ratio [OR] 5.8; 95% confidence interval [CI] 1.44–23.3) and the absence of thoracic adenopathy (OR 5.0; 95% CI 1.03–25). As compared with Crohn disease, DTS was associated with Afro-Caribbean origin (OR 27; 95% CI 3.6–204) and the absence of ileum or colon macroscopic lesions (OR 62.5; 95% CI 10.3–500). On the last follow-up, patients with DTS showed no need for surgery (versus 31% for patients with Crohn disease; P = 0.0013), and clinical digestive remission was frequent (76% vs. 35% for patients with Crohn disease; P = 0.0002). The differential diagnosis with Crohn disease could be an issue with DTS. Nevertheless, the 2 diseases often have different clinical presentation and outcome. PMID:27442665

  11. Sickle cell anaemia: The need for new approaches in management.

    PubMed

    Ghosh, Kanjaksha

    2015-01-01

    Sickle cell anaemia is an important genetic disorder in India and is associated with considerable morbidity and mortality. Over 100 000 people are affected by this disorder and 10%-40% of the 85 million tribal population carries this gene. Conventional management and therapy with hydroxyurea provides symptomatic relief. A search for an anti-sickling agent has so far proved unsuccessful. However, improving upon existing compounds; looking for newer products using modern tools of bioinformatics, monoclonal antibody and aptamer technology; and evaluating medicines from ethno-pharmacology are promising approaches in managing this disease.

  12. Preclinical approaches in chronic myeloid leukemia: from cells to systems.

    PubMed

    Clarke, Cassie J; Holyoake, Tessa L

    2017-03-01

    Advances in the design of targeted therapies for the treatment of chronic myeloid leukemia (CML) have transformed the prognosis for patients diagnosed with this disease. However, leukemic stem cell persistence, drug intolerance, drug resistance, and advanced-phase disease represent unmet clinical needs demanding the attention of CML investigators worldwide. The availability of appropriate preclinical models is essential to efficiently translate findings from the bench to the clinic. Here we review the current approaches taken to preclinical work in the CML field, including examples of commonly used in vivo models and recent successes from systems biology-based methodologies.

  13. Optimizing Dendritic Cell-Based Approaches for Cancer Immunotherapy

    PubMed Central

    Datta, Jashodeep; Terhune, Julia H.; Lowenfeld, Lea; Cintolo, Jessica A.; Xu, Shuwen; Roses, Robert E.; Czerniecki, Brian J.

    2014-01-01

    Dendritic cells (DC) are professional antigen-presenting cells uniquely suited for cancer immunotherapy. They induce primary immune responses, potentiate the effector functions of previously primed T-lymphocytes, and orchestrate communication between innate and adaptive immunity. The remarkable diversity of cytokine activation regimens, DC maturation states, and antigen-loading strategies employed in current DC-based vaccine design reflect an evolving, but incomplete, understanding of optimal DC immunobiology. In the clinical realm, existing DC-based cancer immunotherapy efforts have yielded encouraging but inconsistent results. Despite recent U.S. Federal and Drug Administration (FDA) approval of DC-based sipuleucel-T for metastatic castration-resistant prostate cancer, clinically effective DC immunotherapy as monotherapy for a majority of tumors remains a distant goal. Recent work has identified strategies that may allow for more potent “next-generation” DC vaccines. Additionally, multimodality approaches incorporating DC-based immunotherapy may improve clinical outcomes. PMID:25506283

  14. Alzheimer’s Disease: Mechanism and Approach to Cell Therapy

    PubMed Central

    Amemori, Takashi; Jendelova, Pavla; Ruzicka, Jiri; Machova Urdzikova, Lucia; Sykova, Eva

    2015-01-01

    Alzheimer’s disease (AD) is the most common form of dementia. The risk of AD increases with age. Although two of the main pathological features of AD, amyloid plaques and neurofibrillary tangles, were already recognized by Alois Alzheimer at the beginning of the 20th century, the pathogenesis of the disease remains unsettled. Therapeutic approaches targeting plaques or tangles have not yet resulted in satisfactory improvements in AD treatment. This may, in part, be due to early-onset and late-onset AD pathogenesis being underpinned by different mechanisms. Most animal models of AD are generated from gene mutations involved in early onset familial AD, accounting for only 1% of all cases, which may consequently complicate our understanding of AD mechanisms. In this article, the authors discuss the pathogenesis of AD according to the two main neuropathologies, including senescence-related mechanisms and possible treatments using stem cells, namely mesenchymal and neural stem cells. PMID:26556341

  15. Alzheimer's Disease: Mechanism and Approach to Cell Therapy.

    PubMed

    Amemori, Takashi; Jendelova, Pavla; Ruzicka, Jiri; Urdzikova, Lucia Machova; Sykova, Eva

    2015-11-04

    Alzheimer's disease (AD) is the most common form of dementia. The risk of AD increases with age. Although two of the main pathological features of AD, amyloid plaques and neurofibrillary tangles, were already recognized by Alois Alzheimer at the beginning of the 20th century, the pathogenesis of the disease remains unsettled. Therapeutic approaches targeting plaques or tangles have not yet resulted in satisfactory improvements in AD treatment. This may, in part, be due to early-onset and late-onset AD pathogenesis being underpinned by different mechanisms. Most animal models of AD are generated from gene mutations involved in early onset familial AD, accounting for only 1% of all cases, which may consequently complicate our understanding of AD mechanisms. In this article, the authors discuss the pathogenesis of AD according to the two main neuropathologies, including senescence-related mechanisms and possible treatments using stem cells, namely mesenchymal and neural stem cells.

  16. Modeling polymer electrolyte fuel cells: an innovative approach

    NASA Astrophysics Data System (ADS)

    Maggio, G.; Recupero, V.; Pino, L.

    In this paper, a mathematical simulation model is proposed to describe the water transport in proton conductive membranes, used in polymer electrolyte fuel cells (PEFCs). The model, which includes the calculation of electrochemical parameters of a PEFC, represents a quite innovative approach. In fact, it is based on the use of original mathematical relationships taking into account diffusional and ohmic overpotentials for electrode flooding and membrane dehydration problems. The calculated performance of polymer fuel cells using a Nafion 117 membrane clearly demonstrates the model validation (±3% variation with respect to experimental data). Besides, analysis of model results allows a useful comparison of two different membranes (Nafion 117, Dow) in order to define the best membrane/electrode assembly.

  17. Mapping Diffusion in a Living Cell via the Phasor Approach

    PubMed Central

    Ranjit, Suman; Lanzano, Luca; Gratton, Enrico

    2014-01-01

    Diffusion of a fluorescent protein within a cell has been measured using either fluctuation-based techniques (fluorescence correlation spectroscopy (FCS) or raster-scan image correlation spectroscopy) or particle tracking. However, none of these methods enables us to measure the diffusion of the fluorescent particle at each pixel of the image. Measurement using conventional single-point FCS at every individual pixel results in continuous long exposure of the cell to the laser and eventual bleaching of the sample. To overcome this limitation, we have developed what we believe to be a new method of scanning with simultaneous construction of a fluorescent image of the cell. In this believed new method of modified raster scanning, as it acquires the image, the laser scans each individual line multiple times before moving to the next line. This continues until the entire area is scanned. This is different from the original raster-scan image correlation spectroscopy approach, where data are acquired by scanning each frame once and then scanning the image multiple times. The total time of data acquisition needed for this method is much shorter than the time required for traditional FCS analysis at each pixel. However, at a single pixel, the acquired intensity time sequence is short; requiring nonconventional analysis of the correlation function to extract information about the diffusion. These correlation data have been analyzed using the phasor approach, a fit-free method that was originally developed for analysis of FLIM images. Analysis using this method results in an estimation of the average diffusion coefficient of the fluorescent species at each pixel of an image, and thus, a detailed diffusion map of the cell can be created. PMID:25517145

  18. Mapping diffusion in a living cell via the phasor approach.

    PubMed

    Ranjit, Suman; Lanzano, Luca; Gratton, Enrico

    2014-12-16

    Diffusion of a fluorescent protein within a cell has been measured using either fluctuation-based techniques (fluorescence correlation spectroscopy (FCS) or raster-scan image correlation spectroscopy) or particle tracking. However, none of these methods enables us to measure the diffusion of the fluorescent particle at each pixel of the image. Measurement using conventional single-point FCS at every individual pixel results in continuous long exposure of the cell to the laser and eventual bleaching of the sample. To overcome this limitation, we have developed what we believe to be a new method of scanning with simultaneous construction of a fluorescent image of the cell. In this believed new method of modified raster scanning, as it acquires the image, the laser scans each individual line multiple times before moving to the next line. This continues until the entire area is scanned. This is different from the original raster-scan image correlation spectroscopy approach, where data are acquired by scanning each frame once and then scanning the image multiple times. The total time of data acquisition needed for this method is much shorter than the time required for traditional FCS analysis at each pixel. However, at a single pixel, the acquired intensity time sequence is short; requiring nonconventional analysis of the correlation function to extract information about the diffusion. These correlation data have been analyzed using the phasor approach, a fit-free method that was originally developed for analysis of FLIM images. Analysis using this method results in an estimation of the average diffusion coefficient of the fluorescent species at each pixel of an image, and thus, a detailed diffusion map of the cell can be created.

  19. Molecular bulk heterojunctions: an emerging approach to organic solar cells.

    PubMed

    Roncali, Jean

    2009-11-17

    The predicted exhaustion of fossil energy resources and the pressure of environmental constraints are stimulating an intensification of research on renewable energy sources, in particular, on the photovoltaic conversion of solar energy. In this context, organic solar cells are attracting increasing interest that is motivated by the possibility of fabricating large-area, lightweight, and flexible devices using simple techniques with low environmental impact. Organic solar cells are based on a heterojunction resulting from the contact of a donor (D) and an acceptor (A) material. Absorption of solar photons creates excitons, Coulombically bound electron-hole pairs, which diffuse to the D/A interface, where they are dissociated into free holes and electrons by the electric field. D/A heterojunctions can be created with two types of architectures, namely, bilayer heterojunction and bulk heterojunction (BHJ) solar cells. BHJ cells combine the advantages of easier fabrication and higher conversion efficiency due to the considerably extended D/A interface. Until now, the development of BHJ solar cells has been essentially based on the use of soluble pi-conjugated polymers as donor material. Intensive interdisciplinary research carried out in the past 10 years has led to an increase in the conversion efficiency of BHJ cells from 0.10 to more than 5.0%. These investigations have progressively established regioregular poly(3-hexylthiophene) (P3HT) as the standard donor material for BHJ solar cells, owing to a useful combination of optical and charge-transport properties. However, besides the limit imposed to the maximum conversion efficiency by its intrinsic electronic properties, P3HT and more generally polymers pose several problems related to the control of their structure, molecular weight, polydispersity, and purification. In this context, recent years have seen the emergence of an alternative approach based on the replacement of polydisperse polymers by soluble

  20. Urinary tract infections. An overview.

    PubMed

    Jepsen, O B

    1987-06-01

    Urinary tract infection remains the most prevalent infection acquired by hospitalized patients. The association with manipulations of the urinary tract is well known and the etiology of these infections is studied in detail. The excess cost of preventable UTI has not been established. It may be negligible for the single case but a high prevalence of nosocomial UTI could add substantially to hospital expenses. Differences in practices of bladder drainage between hospitals and countries have been identified, and educational efforts would seem effective in the management of incontinent patients when hospitalized. Though the infection is often self-limiting, when the catheter is removed, complications are seen. The lower survival with bacteriuria in old age is best explained by the presence of fatal disease in bacteriuric patients. Prevention of the infection with the catheter in situ is discouraging, and measures intended to interfere with the endogenous source of infection have largely failed or postponed infection. A radical approach to the use of indwelling catheters in hospitalized patients may seem the only way out, requiring highly skilled nursing care instead.

  1. Sense of taste in the gastrointestinal tract.

    PubMed

    Iwatsuki, Ken; Uneyama, Hisayuki

    2012-01-01

    Recent advances in molecular biology have led to the investigation of the molecular mechanism by which chemicals such as odors and tastants are perceived by specific chemosensory organs. For example, G protein-coupled receptors expressed within the nasal epithelium and taste receptors in the oral cavity have been identified as odorant and taste receptors, respectively. However, there is much evidence to indicate that these chemosensory receptors are not restricted to primary chemosensory cells; they are also expressed and have function in other cells such as those in the airways and gastrointestinal (GI) tract. This short review describes the possible mechanisms by which taste signal transduction occurs in the oral cavity and tastants/nutrients are sensed in the GI tract by taste-like cells, mainly enteroendocrine and brush cells. Furthermore, it discusses the future perspectives of chemosensory studies.

  2. En bloc aortic and mitral valve replacement and left ventricular outflow tract enlargement using a combined transaortic and trans-septal atrial approach.

    PubMed

    Hassan, Mohammed; Windsor, Jimmy; Ricci, Marco

    2015-12-01

    Aortic and mitral valve replacement with division and reconstruction of the inter-valvular fibrous body has been described in clinical situations involving infective endocarditis, extensive annular calcifications and diminutive valve annuli. Herein, we describe a combined transaortic and trans-septal approach with division of the inter-valvular fibrosa for combined aortic and mitral valve replacement. The reconstruction of the inter-valvular fibrous body, atrial walls and aortic root was carried out using a 'three-patch' technique with bovine pericardium.

  3. [Nocosomial urinary tract infections].

    PubMed

    Pigrau, Carlos

    2013-11-01

    Nosocomial urinary tract infections (UTI) are mainly related to urinary catheterisation. In this paper we review the pathogenic mechanisms, particularly the route by which the microorganisms colonise the urinary tract, their adhesion ability, and their capacity to form biofilms, and are related not only to the microorganism but also to the type of urinary catheter. The aetiology of catheter related UTI is variable, and multiresistant microorganisms are often isolated, making empirical antibiotic therapy complex. Clinical findings are frequently atypical, and its diagnosis is difficult. The therapeutic management of catheter-related UTI should be stratified according to the type of UTI: asymptomatic bacteriuria should not be habitually treated, but patients with septic shock should receive a broad spectrum antibiotic. In this review, the value of the different preventive measures are discussed.

  4. Nonstoichiometric Adduct Approach for High-Efficiency Perovskite Solar Cells.

    PubMed

    Park, Nam-Gyu

    2017-01-03

    Since the groundbreaking report on a solid-state perovskite solar cell employing a methylammonium lead iodide-sensitized mesoporous TiO2 film and an organic hole conducting layer in 2012 by our group, the swift surge of perovskite photovoltaics opens a new paradigm in solar-cell research. As a result, ca. 1300 peer-reviewed research articles were published in 2015. In this Inorganic Chemistry Forum on Halide Perovskite, the researches with highlights of work on perovskite solar cells in my laboratory are reviewed. We have developed a size-controllable two-step spin-coating method and found that minimal nonradiative recombination in perovskite crystals could lead to high photovoltaic performance. A Lewis acid based adduct method and self-formed grain boundary process were developed for high-efficiency devices with reproducibility. A power conversion efficiency of 20.4% was achieved via grain boundary engineering based on a nonstoichiometric adduct approach. The incorporation of cesium in a formamidinium lead iodide perovskite was found to show better photostability and moisture-stability. A reduction in the dimensionality from a three-dimensitonal nanocrystal to a one-dimensional nanowire led to a hypsochromic shift of absorption and fluorescence. To enhance the charge-carrier transport and light-harvesting efficiency, a nanoarchitecture of oxide layers was proposed.

  5. The clinical approach toward giant cell tumor of bone.

    PubMed

    van der Heijden, Lizz; Dijkstra, P D Sander; van de Sande, Michiel A J; Kroep, Judith R; Nout, Remi A; van Rijswijk, Carla S P; Bovée, Judith V M G; Hogendoorn, Pancras C W; Gelderblom, Hans

    2014-05-01

    We provide an overview of imaging, histopathology, genetics, and multidisciplinary treatment of giant cell tumor of bone (GCTB), an intermediate, locally aggressive but rarely metastasizing tumor. Overexpression of receptor activator of nuclear factor κB ligand (RANKL) by mononuclear neoplastic stromal cells promotes recruitment of numerous reactive multinucleated giant cells. Conventional radiographs show a typical eccentric lytic lesion, mostly located in the meta-epiphyseal area of long bones. GCTB may also arise in the axial skeleton and very occasionally in the small bones of hands and feet. Magnetic resonance imaging is necessary to evaluate the extent of GCTB within bone and surrounding soft tissues to plan a surgical approach. Curettage with local adjuvants is the preferred treatment. Recurrence rates after curettage with phenol and polymethylmethacrylate (PMMA; 8%-27%) or cryosurgery and PMMA (0%-20%) are comparable. Resection is indicated when joint salvage is not feasible (e.g., intra-articular fracture with soft tissue component). Denosumab (RANKL inhibitor) blocks and bisphosphonates inhibit GCTB-derived osteoclast resorption. With bisphosphonates, stabilization of local and metastatic disease has been reported, although level of evidence was low. Denosumab has been studied to a larger extent and seems to be effective in facilitating intralesional surgery after therapy. Denosumab was recently registered for unresectable disease. Moderate-dose radiotherapy (40-55 Gy) is restricted to rare cases in which surgery would lead to unacceptable morbidity and RANKL inhibitors are contraindicated or unavailable.

  6. Hawaii Census 2000 Tracts

    EPA Pesticide Factsheets

    This data layer represents Census 2000 demographic data derived from the PL94-171 redistricting files and SF3. Census geographic entities include blocks, blockgroups and tracts. Tiger line files are the source of the geometry representing the Census blocks. Attributes include total population counts, racial/ethnic, and poverty/income information. Racial/ethnic classifications are represented in units of blocks, blockgroups and tracts. Poverty and income data are represented in units of blockgroups and tracts. Percentages of each racial/ethnic group have been calculated from the population counts. Total Minority counts and percentages were compiled from each racial/ethnic non-white category. Categories compiled to create the Total Minority count includes the following: African American, Asian, American Indian, Pacific Islander, White Hispanic, Other and all mixed race categories. The percentage poverty attribute represents the percent of the population living at or below poverty level. The per capita income attribute represents the sum of all income within the geographic entity, divided by the total population of that entity. Special fields designed to be used for EJ analysis have been derived from the PL data and include the following: Percentage difference of block, blockgroup and total minority from the state and county averages, percentile rank for each percent total minority within state and county entitie

  7. Detecting sweet and umami tastes in the gastrointestinal tract.

    PubMed

    Iwatsuki, K; Ichikawa, R; Uematsu, A; Kitamura, A; Uneyama, H; Torii, K

    2012-02-01

    Information about nutrients is a critical part of food selection in living creatures. Each animal species has developed its own way to safely seek and obtain the foods necessary for them to survive and propagate. Necessarily, humans and other vertebrates have developed special chemosensory organs such as taste and olfactory organs. Much attention, recently, has been given to the gastrointestinal (GI) tract as another chemosensory organ. Although the GI tract had been considered to be solely for digestion and absorption of foods and nutrients, researchers have recently found taste-signalling elements, including receptors, in this tissue. Further studies have revealed that taste cells in the oral cavity and taste-like cells in the GI tract appear to share common characteristics. Major receptors to detect umami, sweet and bitter are found in the GI tract, and it is now proposed that taste-like cells reside in the GI tract to sense nutrients and help maintain homeostasis. In this review, we summarize recent findings of chemoreception especially through sweet and umami sensors in the GI tract. In addition, the possibility of purinergic transmission from taste-like cells in the GI tract to vagus nerves is discussed.

  8. Influence of LVAD cannula outflow tract location on hemodynamics in the ascending aorta: a patient-specific computational fluid dynamics approach.

    PubMed

    Karmonik, Christof; Partovi, Sasan; Loebe, Matthias; Schmack, Bastian; Ghodsizad, Ali; Robbin, Mark R; Noon, George P; Kallenbach, Klaus; Karck, Matthias; Davies, Mark G; Lumsden, Alan B; Ruhparwar, Arjang

    2012-01-01

    To develop a better understanding of the hemodynamic alterations in the ascending aorta, induced by variation of the cannula outflow position of the left ventricular assist device (LVAD) device based on patient-specific geometries, transient computational fluid dynamics (CFD) simulations using the realizable k-ε turbulent model were conducted for two of the most common LVAD outflow geometries. Thoracic aortic flow patterns, pressures, wall shear stresses (WSSs), turbulent dissipation, and energy were quantified in the ascending aorta at the location of the cannula outflow. Streamlines for the lateral geometry showed a large region of disturbed flow surrounding the LVAD outflow with an impingement zone at the contralateral wall exhibiting increased WSSs and pressures. Flow disturbance was reduced for the anterior geometries with clearly reduced pressures and WSSs. Turbulent dissipation was higher for the lateral geometry and turbulent energy was lower. Variation in the position of the cannula outflow clearly affects hemodynamics in the ascending aorta favoring an anterior geometry for a more ordered flow pattern. The new patient-specific approach used in this study for LVAD patients emphasizes the potential use of CFD as a truly translational technique.

  9. Construction of a flagellum-negative mutant of Proteus mirabilis: effect on internalization by human renal epithelial cells and virulence in a mouse model of ascending urinary tract infection.

    PubMed Central

    Mobley, H L; Belas, R; Lockatell, V; Chippendale, G; Trifillis, A L; Johnson, D E; Warren, J W

    1996-01-01

    To examine the role of flagella in pathogenesis of urinary tract infection caused by Proteus mirabilis, we constructed a nonmotile, nonswarming flagellum mutant of strain WPM111 (an hpmA hemolysin mutant of strain BA6163, chosen because of its lack of in vitro cytotoxicity in renal epithelial cell internalization studies). A nonpolar mutation was introduced into the flaD gene, which encodes the flagellar cap protein. This mutation does not affect the synthesis of flagellin but rather prevents the assembly of an intact flagellar filament. In in vitro assays, the genetically characterized nonmotile mutant was found to be internalized by cultured human renal proximal tubular epithelial cells in numbers less than 1% of those of the flagellated parent strain. Internalization of the nonmotile mutant was increased significantly (14- to 21-fold) by centrifugation onto the monolayer. To assess virulence in vivo, CBA mice were challenged transurethrally with 10(7) CFU of P. mirabilis BA6163 (wild type) (n = 16), WPM111 (hpmA mutant) (n = 46), or BB2401 (hmpA flaD mutant) (n = 46). Differences in quantitative cultures between the parent strain and the hemolysin-negative mutant were not significant. However, the hpmA flaD mutant was recovered in numbers approximately 100-fold lower than those of the hmpA mutant or the wild-type parent strain and thus was clearly attenuated. We conclude that while hemolysin does not significantly influence virulence, flagella contribute significantly to the ability of P. mirabilis to colonize the urinary tract and cause acute pyelonephritis in an experimental model of ascending urinary tract infection. PMID:8945585

  10. SnapShot: Hormones of the gastrointestinal tract.

    PubMed

    Coate, Katie C; Kliewer, Steven A; Mangelsdorf, David J

    2014-12-04

    Specialized endocrine cells secrete a variety of peptide hormones all along the gastrointestinal (GI) tract, making it one of the largest endocrine organs in the body. Nutrients and developmental and neural cues trigger the secretion of gastrointestinal (GI) hormones from specialized endocrine cells along the GI tract. These hormones act in target tissues to facilitate digestion and regulate energy homeostasis. This SnapShot summarizes the production and functions of GI hormones.

  11. Technical approaches to induce selective cell death of pluripotent stem cells.

    PubMed

    Jeong, Ho-Chang; Cho, Seung-Ju; Lee, Mi-Ok; Cha, Hyuk-Jin

    2017-02-28

    Despite the recent promising results of clinical trials using human pluripotent stem cell (hPSC)-based cell therapies for age-related macular degeneration (AMD), the risk of teratoma formation resulting from residual undifferentiated hPSCs remains a serious and critical hurdle for broader clinical implementation. To mitigate the tumorigenic risk of hPSC-based cell therapy, a variety of approaches have been examined to ablate the undifferentiated hPSCs based on the unique molecular properties of hPSCs. In the present review, we offer a brief overview of recent attempts at selective elimination of undifferentiated hPSCs to decrease the risk of teratoma formation in hPSC-based cell therapy.

  12. Urinary Signatures of Renal Cell Carcinoma Investigated by Peptidomic Approaches

    PubMed Central

    De Sio, Gabriele; Smith, Andrew James; Gianazza, Erica; Grasso, Angelica; Rocco, Francesco; Signorini, Stefano; Grasso, Marco; Bosari, Silvano; Zoppis, Italo; Dakna, Mohammed; van der Burgt, Yuri E. M.; Mauri, Giancarlo; Magni, Fulvio

    2014-01-01

    Renal Cell Carcinoma (RCC) is typically asymptomatic and surgery usually increases patient's lifespan only for early stage tumours. Moreover, solid renal masses cannot be confidently differentiated from RCC. Therefore, markers to distinguish malignant kidney tumours and for their detection are needed. Two different peptide signatures were obtained by a MALDI-TOF profiling approach based on urine pre-purification by C8 magnetic beads. One cluster of 12 signals could differentiate malignant tumours (n = 137) from benign renal masses and controls (n = 153) with sensitivity of 76% and specificity of 87% in the validation set. A second cluster of 12 signals distinguished clear cell RCC (n = 118) from controls (n = 137) with sensitivity and specificity values of 84% and 91%, respectively. Most of the peptide signals used in the two models were observed at higher abundance in patient urines and could be identified as fragments of proteins involved in tumour pathogenesis and progression. Among them: the Meprin 1α with a pro-angiogenic activity, the Probable G-protein coupled receptor 162, belonging to the GPCRs family and known to be associated with several key functions in cancer, the Osteopontin that strongly correlates to tumour stages and invasiveness, the Phosphorylase b kinase regulatory subunit alpha and the SeCreted and TransMembrane protein 1. PMID:25202906

  13. Urinary signatures of Renal Cell Carcinoma investigated by peptidomic approaches.

    PubMed

    Chinello, Clizia; Cazzaniga, Marta; De Sio, Gabriele; Smith, Andrew James; Gianazza, Erica; Grasso, Angelica; Rocco, Francesco; Signorini, Stefano; Grasso, Marco; Bosari, Silvano; Zoppis, Italo; Dakna, Mohammed; van der Burgt, Yuri E M; Mauri, Giancarlo; Magni, Fulvio

    2014-01-01

    Renal Cell Carcinoma (RCC) is typically asymptomatic and surgery usually increases patient's lifespan only for early stage tumours. Moreover, solid renal masses cannot be confidently differentiated from RCC. Therefore, markers to distinguish malignant kidney tumours and for their detection are needed. Two different peptide signatures were obtained by a MALDI-TOF profiling approach based on urine pre-purification by C8 magnetic beads. One cluster of 12 signals could differentiate malignant tumours (n = 137) from benign renal masses and controls (n = 153) with sensitivity of 76% and specificity of 87% in the validation set. A second cluster of 12 signals distinguished clear cell RCC (n = 118) from controls (n = 137) with sensitivity and specificity values of 84% and 91%, respectively. Most of the peptide signals used in the two models were observed at higher abundance in patient urines and could be identified as fragments of proteins involved in tumour pathogenesis and progression. Among them: the Meprin 1α with a pro-angiogenic activity, the Probable G-protein coupled receptor 162, belonging to the GPCRs family and known to be associated with several key functions in cancer, the Osteopontin that strongly correlates to tumour stages and invasiveness, the Phosphorylase b kinase regulatory subunit alpha and the SeCreted and TransMembrane protein 1.

  14. Urinary tract infections.

    PubMed

    Litza, Janice A; Brill, John R

    2010-09-01

    Urinary tract infection (UTI) is the most common urologic disorder and one of the most common conditions for which physicians are consulted. Patients at increased risk for UTI include women; diabetics; the immunocompromised; and those with anatomic abnormalities, impaired mobility, incontinence, advanced age, and instrumentation. Antibiotic therapy aims to relieve symptoms and prevent complications such as pyelonephritis and renal scarring. Distinguishing asymptomatic bacteriuria from a UTI can be difficult, especially in those with comorbidities. Most experts do not recommend screening for UTI, except in the first trimester of pregnancy.

  15. Cultured High-Fidelity Three-Dimensional Human Urogenital Tract Carcinomas and Process

    NASA Technical Reports Server (NTRS)

    Goodwin, Thomas J. (Inventor); Prewett, Tacey L. (Inventor); Spaulding, Glenn F. (Inventor); Wolf, David A. (Inventor)

    1998-01-01

    Artificial high-fidelity three-dimensional human urogenital tract carcinomas are propagated under in vitro-microgravity conditions from carcinoma cells. Artificial high-fidelity three-dimensional human urogenital tract carcinomas are also propagated from a coculture of normal urogenital tract cells inoculated with carcinoma cells. The microgravity culture conditions may be microgravity or simulated microgravity created in a horizontal rotating wall culture vessel.

  16. Concordance of Two Endoscopic Procedures for Diagnosis of Carcinoma of the Upper Aerodigestive Tract

    ClinicalTrials.gov

    2014-08-15

    Upper Aerodigestive Tract Lesions; Neoplasms, Oropharyngeal; Oropharyngeal Cancer; Neoplasms, Hypopharyngeal; Hypopharyngeal Cancer; Head and Neck Neoplasms; UADT Neoplasms; Carcinoma, Squamous Cell; Papilloma

  17. Merkel cell carcinoma: emerging biology, current approaches, and future directions.

    PubMed

    Tothill, Richard; Estall, Vanessa; Rischin, Danny

    2015-01-01

    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine cutaneous cancer that predominantly occurs in patients who are older, and is associated with a high rate of distant failure and mortality. Current management strategies that incorporate surgery and radiotherapy achieve high rates of locoregional control, but distant failure rates remain problematic, highlighting the need for new effective systemic therapies. Chemotherapy can achieve high response rates of limited duration in the metastatic setting, but its role in definitive management remains unproven. Recent developments in our knowledge about the biology of MCC have led to the identification of new potential therapeutic targets and treatments. A key finding has been the discovery that a human polyomavirus may be a causative agent. However, emerging data suggests that MCC may actually be two distinct entities, viral-associated and viral-negative MCC, which is likely to have implications for the management of MCC in the future and for the development of new treatments. In this review, we discuss recent discoveries about the biology of MCC, current approaches to management, and new therapeutic strategies that are being investigated.

  18. Multidisciplinary Approach to Management of Temporal Bone Giant Cell Tumor

    PubMed Central

    Nicoli, Taija K.; Saat, Riste; Kontio, Risto; Piippo, Anna; Tarkkanen, Maija; Tarkkanen, Jussi; Jero, Jussi

    2016-01-01

    Background Giant cell tumors (GCTs) are rare osseous tumors that rarely appear in the skull. Methods We review the clinical course of a 28-year-old previously healthy woman with a complicated GCT. Results The reviewed patient presented with a middle cranial fossa tumor acutely complicated by reactive mastoiditis. Left tympanomastoidectomy was performed for drainage of the mastoiditis and for biopsies of the tumor. Due to the challenging tumor location, the patient was treated with denosumab, a fully humanized monoclonal antibody against receptor activator of nuclear factor kappa-B ligand, for 7 months, which resulted in significant preoperative tumor shrinkage. Extensive temporal craniotomy and resection of the tumor followed utilizing a temporomandibular joint total endoprosthesis for reconstruction. A recurrence of the tumor was detected on computed tomography at 19 months after surgery and treated with transtemporal tumor resection, parotidectomy, and mandible re-reconstruction. Conclusion A multidisciplinary approach resulted in a good functional result and, finally, an eradication of the challengingly located middle cranial fossa tumor. PMID:28078198

  19. An Effective Vaccination Approach Augments anti-HIV Systemic and Vaginal Immunity in Mice with Decreased HIV-1 Susceptible α4β7high CD4+ T Cells

    PubMed Central

    Zhu, Wei; Shi, Guoping; Tang, Haijun; Lewis, Dorothy E; Song, Xiao-Tong

    2013-01-01

    HIV-1 preferentially infects activated CD4+ T cells expressing α4β7 integrin and conventional vaccination approaches non-selectively induce immune responses including α4β7high CD4+ T cells, suggesting that current candidate AIDS vaccines may produce more target cells for HIV-1 and paradoxically enhance HIV-1 infection. Thus it remains a challenge to selectively induce robust anti-HIV immunity without the unwanted HIV-1 susceptible α4β7high CD4+ T cells. Here we describe a vaccination strategy that targets ALDH1a2, a retinoic acid producing enzyme in dendritic cells (DCs). Silencing ALDH1a2 in DCs enhanced the maturation and production of proinflammatory cytokines of DCs and promoted Th1/Th2 differentiation while suppressing Treg. ALDH1a2-silenced DCs effectively downregulated the expression of guthoming receptors α4β7 and CCR9 on activated T and B lymphocytes. Consequently, intranasal immunization of a lentiviral vaccine encoding ALDH1a2 shRNA and HIV-1 gp140 redirected gp140-specific mucosal T cell and antibody responses from the gut to the vaginal tract, while dramatically enhancing systemic gp140-specific immune responses. We further demonstrated that silencing ALDH1a2 in human DCs resulted in downregulation of β7 expression on activated autologous CD4+ T cells. Hence this study provides a unique and effective strategy to induce α4β7low anti-HIV immune responses. PMID:23157585

  20. An effective vaccination approach augments anti-HIV systemic and vaginal immunity in mice with decreased HIV-1 susceptible α4β7high CD4+ T cells.

    PubMed

    Zhu, Wei; Shi, Guoping; Tang, Haijun; Lewis, Dorothy E; Song, Xiao-Tong

    2013-01-01

    HIV-1 preferentially infects activated CD4(+) T cells expressing α4β7 integrin and conventional vaccination approaches non-selectively induce immune responses including α4β7(high) CD4(+) T cells, suggesting that current candidate AIDS vaccines may produce more target cells for HIV-1 and paradoxically enhance HIV-1 infection. Thus it remains a challenge to selectively induce robust anti-HIV immunity without the unwanted HIV-1 susceptible α4β77(high) CD4(+)+ T cells. Here we describe a vaccination strategy that targets ALDH1a2, a retinoic acid producing enzyme in dendritic cells (DCs). Silencing ALDH1a2 in DCs enhanced the maturation and production of proinflammatory cytokines of DCs and promoted Th1/Th2 differentiation while suppressing Treg. ALDH1a2-silenced DCs effectively downregulated the expression of guthoming receptors α4β77 and CCR9 on activated T and B lymphocytes. Consequently, intranasal immunization of a lentiviral vaccine encoding ALDH1a2 shRNA and HIV-1 gp140 redirected gp140-specific mucosal T cell and antibody responses from the gut to the vaginal tract, while dramatically enhancing systemic gp140-specific immune responses. We further demonstrated that silencing ALDH1a2 in human DCs resulted in downregulation of β7 expression on activated autologous CD4(+) T cells. Hence this study provides a unique and effective strategy to induce α4β7(low) anti-HIV immune responses.

  1. Neonatal Staphylococcus lugdunensis urinary tract infection.

    PubMed

    Hayakawa, Itaru; Hataya, Hiroshi; Yamanouchi, Hanako; Sakakibara, Hiroshi; Terakawa, Toshiro

    2015-08-01

    Staphylococcus lugdunensis is a known pathogen of infective endocarditis, but not of urinary tract infection. We report a previously healthy neonate without congenital anomalies of the kidney and urinary tract who developed urinary tract infection due to Staphylococcus lugdunensis, illustrating that Staphylococcus lugdunensis can cause urinary tract infection even in those with no urinary tract complications.

  2. Managing urinary tract infections.

    PubMed

    Saadeh, Sermin A; Mattoo, Tej K

    2011-11-01

    Urinary tract infections (UTI) are common in childhood. Presence of pyuria and bacteriuria in an appropriately collected urine sample are diagnostic of UTI. The risk of UTI is increased with an underlying urological abnormality such as vesicoureteral reflux, constipation, and voiding dysfunction. Patients with acute pyelonephritis are at risk of renal scarring and subsequent complications such as hypertension, proteinuria with and without FSGS, pregnancy-related complications and even end-stage renal failure. The relevance and the sequence of the renal imaging following initial UTI, and the role of antimicrobial prophylaxis and surgical intervention are currently undergoing an intense debate. Prompt treatment of UTI and appropriate follow-up of those at increased risk of recurrence and/or renal scarring are important.

  3. [Urinary tract infections in adults].

    PubMed

    Emonet, Stéphane; Harbarth, Stephan; van Delden, Christian

    2011-04-27

    Urinary tract infections are commonly seen by general practitioners. Quinolones are frequently prescribed in this setting. The emergence of resistance to these antibiotics has led to new guidelines for the management of uncomplicated UTI, based on the use of fosfomycin and furadantine. This article reviews the epidemiology, pathogenesis, diagnostic and treatment of urinary tract infections in adults.

  4. Advances in alimentary tract imaging.

    PubMed

    Maglinte, Dean-Dt; Sandrasegaran, Kumaresan; Tann, Mark

    2006-05-28

    Advances in imaging techniques are changing the way radiologists undertake imaging of the gastrointestinal tract and their ability to answer questions posed by surgeons. In this paper we discuss the technological improvements of imaging studies that have occurred in the last few years and how these help to better diagnosing alimentary tract disease.

  5. Autologous bone marrow stromal cells are promising candidates for cell therapy approaches to treat bone degeneration in sickle cell disease.

    PubMed

    Lebouvier, Angélique; Poignard, Alexandre; Coquelin-Salsac, Laura; Léotot, Julie; Homma, Yasuhiro; Jullien, Nicolas; Bierling, Philippe; Galactéros, Frédéric; Hernigou, Philippe; Chevallier, Nathalie; Rouard, Hélène

    2015-11-01

    Osteonecrosis of the femoral head is a frequent complication in adult patients with sickle cell disease (SCD). To delay hip arthroplasty, core decompression combined with concentrated total bone marrow (BM) treatment is currently performed in the early stages of the osteonecrosis. Cell therapy efficacy depends on the quantity of implanted BM stromal cells. For this reason, expanded bone marrow stromal cells (BMSCs, also known as bone marrow derived mesenchymal stem cells) can be used to improve osteonecrosis treatment in SCD patients. In this study, we quantitatively and qualitatively evaluated the function of BMSCs isolated from a large number of SCD patients with osteonecrosis (SCD-ON) compared with control groups (patients with osteonecrosis not related to SCD (ON) and normal donors (N)). BM total nuclear cells and colony-forming efficiency values (CFE) were significantly higher in SCD-ON patients than in age and sex-matched controls. The BMSCs from SCD-ON patients were similar to BMSCs from the control groups in terms of their phenotypic and functional properties. SCD-ON patients have a higher frequency of BMSCs that retain their bone regeneration potential. Our findings suggest that BMSCs isolated from SCD-ON patients can be used clinically in cell therapy approaches. This work provides important preclinical data that is necessary for the clinical application of expanded BMSCs in advanced therapies and medical products.

  6. Developing Novel Therapeutic Approaches in Small Cell Lung Carcinoma Using Genetically Engineered Mouse Models and Human Circulating Tumor Cells

    DTIC Science & Technology

    2015-10-01

    Using Genetically Engineered Mouse Models and Human Circulating Tumor Cells PRINCIPAL INVESTIGATOR: Jeffrey Engelman MD PhD CONTRACTING...SUBTITLE Developiing Novel Therapeutic Approaches in Small Cell Lung 5a. CONTRACT NUMBER Carcinoma Using Genetically Engineered Mouse Models and 5b...biomarkers. 15. SUBJECT TERMS Small cell lung cancer (SCLC), Genetically engineered mouse model (GEMM), BH3 mimetic, TORC inhibitor, Apoptosis

  7. Diagnostic approaches for viruses and prions in stem cell banks

    SciTech Connect

    Cobo, Fernando . E-mail: fernancobo@fundacionhvn.org; Talavera, Paloma; Concha, Angel

    2006-03-30

    Some stem cell lines may contain an endogenous virus or can be contaminated with exogenous viruses (even of animal origin) and may secrete viral particles or express viral antigens on their surface. Moreover, certain biotechnological products (e.g. bovine fetal serum, murine feeder cells) may contain prion particles. Viral and prion contamination of cell cultures and 'feeder' cells, which is a common risk in all biotechnological products derived from the cell lines, is the most challenging and potentially serious outcome to address, due to the difficulty involved in virus and prion detection and the potential to cause serious disease in recipients of these cell products. Stem cell banks should introduce adequate quality assurance programs like the microbiological control program and can provide researchers with valuable support in the standardization and safety of procedures and protocols used for the viral and prion testing and in validation programs to assure the quality and safety of the cells.

  8. Allopregnanolone and neurogenesis in the nigrostriatal tract

    PubMed Central

    Wang, Jun Ming

    2014-01-01

    Reinstalling the neurobiological circuits to effectively change the debilitating course of neurodegenerative diseases is of utmost importance. This reinstallation requires generation of new cells which are able to differentiate into specific types of neurons and modification of the local environment suitable for integration of these new neurons into the neuronal circuits. Allopregnanolone (APα) seems to be involved in both of these processes, and therefore, is a potential neurotrophic agent. Loss of dopamine neurons in the substantia nigra (SN) is one of the main pathological features of Parkinson’s and also in, at least, a subset of Alzheimer’s patients. Therefore, reinstallation of the dopamine neurons in nigrostriatal tract is of unique importance for these neurodegenerative diseases. However, for the neurogenic status and the roles of allopregnanolone in the nigrostriatal tract, the evidence is accumulating and debating. This review summarizes recent studies regarding the neurogenic status in the nigrostriatal tract. Furthermore, special attention is placed on evidence suggesting that reductions in allopregnenalone levels are one of the major pathological features in PD and AD. This evidence has also been confirmed in brains of mice that were lesioned with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) or those bearing neurodegenerative mutations. Lastly, we highlight studies showing that allopregnanalone can augment the number of total cells and dopaminergic neurons via peripheral exogenous administration. PMID:25161608

  9. Stem Cells and Biological Approaches to Treatment of Wrist Problems

    PubMed Central

    Chong, Alphonsus K. S.; He, Min

    2013-01-01

    Stem cells are being intensively studied for their potential applications in clinical medicine. Mesenchymal stem cells (MSCs) are an important subset of stem cells which are attractive for application in musculoskeletal disorders. In this article, we review the characteristics of these MSCs that are relevant to clinical practice but that are still largely experimental in nature. PMID:24436835

  10. [Comparative analysis of the susceptibility and productivity of respiratory tract target cells of mice and rats exposed to inflienza virus in vitro].

    PubMed

    Zhukov, V A; Shishkina, L N; Sergeev, A A; Malkova, E M; Riabchikova, E I; Petrishchenko, V A; Sergeev, A N; Ustiuzhanina, N V; Nesvizhskiĭ, Iu V; Vorob'ev, A A

    2008-01-01

    The levels of susceptibility to influenza virus A/Aichi/2/68 H3N2 and the virus yield were determined using primary cells of the trachea and lungs of CD-1 mice and Wistar rats, and for 3 sets of cells obtained from primary lung cells of the both species by centrifugation in the gradient of density and by sedimentation on a surface. The values of ID50 virus dose for 10(6) cells and virus yield per 1 infected cell determined for primary mice cells were 4.0+/-0.47 and 3.2+/-0.27 IgEID50 (lung cells), 3.8+/-0.17 and 3.3+/-0.20 IgEID50 (tracheal cells), and those determined for primary rat cells were 4.0+/-0.35 and 2.1+/-0.24 IgEID50 (lung cells), 3.7+/-0.27 and 2.2+/-0.46 IgEID50 (tracheal cells). The values of ID50 and yield measured for mixtures of cells obtained from primary lung cells by centrifugation in gradient of density and by sedimentation on a surface differed insignificantly (p = 0.05) from the values of the corresponding parameters measured for lung and tracheal cells for both rats and mice. The analysis of data on the variation of the concentrations of different cell types in the experimental cell mixtures shows that type 1 and 2 alveolocytes possess significantly lower (p = 0.05) susceptibility and productivity vs. ciliated cells of the both species. The investigation was conducted within the frame of the ISTC/DARPA#450p project.

  11. In vivo-in vitro comparison of acute respiratory tract toxicity using human 3D airway epithelial models and human A549 and murine 3T3 monolayer cell systems.

    PubMed

    Sauer, Ursula G; Vogel, Sandra; Hess, Annemarie; Kolle, Susanne N; Ma-Hock, Lan; van Ravenzwaay, Bennard; Landsiedel, Robert

    2013-02-01

    The usefulness of in vitro systems to predict acute inhalation toxicity was investigated. Nineteen substances were tested in three-dimensional human airway epithelial models, EpiAirway™ and MucilAir™, and in A549 and 3T3 monolayer cell cultures. IC(50) values were compared to rat four-hour LC(50) values classified according to EPA and GHS hazard categories. Best results were achieved with a prediction model distinguishing toxic from non-toxic substances, with satisfactory specificities and sensitivities. Using a self-made four-level prediction model to classify substances into four in vitro hazard categories, in vivo-in vitro concordance was mediocre, but could be improved by excluding substances causing pulmonary edema and emphysema in vivo. None of the test systems was outstanding, and there was no evidence that tissue or monolayer systems using respiratory tract cells provide an added value. However, the test systems only reflected bronchiole epithelia and alveolar cells and investigated cytotoxicity. Effects occurring in other cells by other mechanisms could not be recognised. Further work should optimise test protocols and expand the set of substances tested to define applicability domains. In vivo respiratory toxicity data for in vitro comparisons should distinguish different modes of action, and their relevance for human health effects should be ensured.

  12. A cell-based approach to the human proteome project.

    PubMed

    Kelleher, Neil L

    2012-10-01

    The general scope of a project to determine the protein molecules that comprise the cells within the human body is framed. By focusing on protein primary structure as expressed in specific cell types, this concept for a cell-based version of the Human Proteome Project (CB-HPP) is crafted in a manner analogous to the Human Genome Project while recognizing that cells provide a primary context in which to define a proteome. Several activities flow from this articulation of the HPP, which enables the definition of clear milestones and deliverables. The CB-HPP highlights major gaps in our knowledge regarding cell heterogeneity and protein isoforms, and calls for development of technology that is capable of defining all human cell types and their proteomes. The main activities will involve mapping and sorting cell types combined with the application of beyond the state-of-the art in protein mass spectrometry.

  13. A Cell-Based Approach to the Human Proteome Project

    NASA Astrophysics Data System (ADS)

    Kelleher, Neil L.

    2012-10-01

    The general scope of a project to determine the protein molecules that comprise the cells within the human body is framed. By focusing on protein primary structure as expressed in specific cell types, this concept for a cell-based version of the Human Proteome Project (CB-HPP) is crafted in a manner analogous to the Human Genome Project while recognizing that cells provide a primary context in which to define a proteome. Several activities flow from this articulation of the HPP, which enables the definition of clear milestones and deliverables. The CB-HPP highlights major gaps in our knowledge regarding cell heterogeneity and protein isoforms, and calls for development of technology that is capable of defining all human cell types and their proteomes. The main activities will involve mapping and sorting cell types combined with the application of beyond the state-of-the art in protein mass spectrometry.

  14. Engineering Approaches Toward Deconstructing and Controlling the Stem Cell Environment

    PubMed Central

    Edalat, Faramarz; Bae, Hojae; Manoucheri, Sam; Cha, Jae Min; Khademhosseini, Ali

    2012-01-01

    Stem cell-based therapeutics have become a vital component in tissue engineering and regenerative medicine. The microenvironment within which stem cells reside, i.e. the niche, plays a crucial role in regulating stem cell self-renewal and differentiation. However, current biological techniques lack the means to recapitulate the complexity of this microenvironment. Nano- and microengineered materials offer innovative methods to: (1) deconstruct the stem cell niche to understand the effects of individual elements; (2) construct complex tissue-like structures resembling the niche to better predict and control cellular processes; and (3) transplant stem cells or activate endogenous stem cell populations for regeneration of aged or diseased tissues. Here, we highlight some of the latest advances in this field and discuss future applications and directions of the use of nano- and microtechnologies for stem cell engineering. PMID:22101755

  15. Stem cell approaches for the treatment of type 1 diabetes mellitus.

    PubMed

    Wagner, Ryan T; Lewis, Jennifer; Cooney, Austin; Chan, Lawrence

    2010-09-01

    Type 1 diabetes is characterized by near total absence of pancreatic b cells. Current treatments consisting of insulin injections and islet transplantation are clinically unsatisfactory. In order to develop a cure for type 1 diabetes, we must find a way to reverse autoimmunity, which underlies b cell destruction, as well as an effective strategy to generate new b cells. This article reviews the different approaches that are being taken to produce new b cells. Much emphasis has been placed on selecting the right non-b cell population, either in vivo or in vitro, as the starting material. Different cell types, including adult stem cells, other types of progenitor cells in situ, and even differentiated cell populations, as well as embryonic stem cells and induced pluripotent stem cells, will require different methods for islet and b cell induction. We discussed the pros and cons of the different strategies that are being used to re-invent the pancreatic b cell.

  16. Nasal Sinus Tract of Odontogenic Origin: Report of a Case

    PubMed Central

    Sareen, Sagar; Pathak, Anjani Kumar; Purwar, Parth; Dixit, Jaya; Singhal, Divya; Sajjanhar, Isha; Goel, Kopal; Gupta, Vaibhav Sheel

    2015-01-01

    Extraoral sinus tract often poses a diagnostic challenge to the clinician owing to its rare occurrence and absence of symptoms. The accurate diagnosis and comprehensive management are inevitable as the aetiology of such lesions is often masked and requires holistic approach. The present case report encompasses the management of an extraoral discharging sinus tract at the base of the right nostril in a chronic smoker. The lesion which was earlier diagnosed to be of nonodontogenic origin persisted even after erratic treatment modalities. Our investigations showed the aetiology of sinus tract to be odontogenic. Initially, a five-step program as recommended by the Agency for Health Care Research and Quality was used for smoking cessation followed by root canal therapy (RCT) and surgical management of the sinus tract. The patient has been under stringent follow-up and no reoccurrence has been noted. PMID:26649208

  17. Neuroendocrine Transdifferentiation in Human Prostate Cancer Cells: An Integrated Approach.

    PubMed

    Cerasuolo, Marianna; Paris, Debora; Iannotti, Fabio A; Melck, Dominique; Verde, Roberta; Mazzarella, Enrico; Motta, Andrea; Ligresti, Alessia

    2015-08-01

    Prostate cancer is highly sensitive to hormone therapy because androgens are essential for prostate cancer cell growth. However, with the nearly invariable progression of this disease to androgen independence, endocrine therapy ultimately fails to control prostate cancer in most patients. Androgen-independent acquisition may involve neuroendocrine transdifferentiation, but there is little knowledge about this process, which is presently controversial. In this study, we investigated this question in a novel model of human androgen-dependent LNCaP cells cultured for long periods in hormone-deprived conditions. Strikingly, characterization of the neuroendocrine phenotype by transcriptomic, metabolomic, and other statistically integrated analyses showed how hormone-deprived LNCaP cells could transdifferentiate to a nonmalignantneuroendocrine phenotype. Notably, conditioned media from neuroendocrine-like cells affected LNCaP cell proliferation. Predictive in silico models illustrated how after an initial period, when LNCaP cell survival was compromised by an arising population of neuroendocrine-like cells, a sudden trend reversal occurred in which the neuroendocrine-like cells functioned to sustain the remaining androgen-dependent LNCaP cells. Our findings provide direct biologic and molecular support for the concept that neuroendocrine transdifferentiation in prostate cancer cell populations influences the progression to androgen independence.

  18. Approaches to solar cell design for pulsed laser power receivers

    NASA Technical Reports Server (NTRS)

    Jain, Raj K.; Landis, Geoffrey A.

    1993-01-01

    Using a laser to beam power from Earth to a photovoltaic receiver in space could be a technology with applications to many space missions. Extremely high average-power lasers would be required in a wavelength range of 700-1000 nm. However, high-power lasers inherently operate in a pulsed format. Existing solar cells are not well designed to respond to pulsed incident power. To better understand cell response to pulsed illumination at high intensity, the PC-1D finite-element computer model was used to analyze the response of solar cells to continuous and pulsed laser illumination. Over 50 percent efficiency was calculated for both InP and GaAs cells under steady-state illumination near the optimum wavelength. The time-dependent response of a high-efficiency GaAs concentrator cell to a laser pulse was modeled, and the effect of laser intensity, wavelength, and bias point was studied. Three main effects decrease the efficiency of a solar cell under pulsed laser illumination: series resistance, L-C 'ringing' with the output circuit, and current limiting due to the output inductance. The problems can be solved either by changing the pulse shape or designing a solar cell to accept the pulsed input. Cell design possibilities discussed are a high-efficiency, light-trapping silicon cell, and a monolithic, low-inductance GaAs cell.

  19. Clinically feasible approaches to potentiating cancer cell-based immunotherapies.

    PubMed

    Seledtsov, V I; Goncharov, A G; Seledtsova, G V

    2015-01-01

    The immune system exerts both tumor-destructive and tumor-protective functions. Mature dendritic cells (DCs), classically activated macrophages (M1), granulocytes, B lymphocytes, aβ and ɣδ T lymphocytes, natural killer T (NKT) cells, and natural killer (NK) cells may be implicated in antitumor immunoprotection. Conversely, tolerogenic DCs, alternatively activated macrophages (M2), myeloid-derived suppressor cells (MDSCs), and regulatory T (Tregs) and B cells (Bregs) are capable of suppressing antitumor immune responses. Anti-cancer vaccination is a useful strategy to elicit antitumor immune responses, while overcoming immunosuppressive mechanisms. Whole tumor cells or lysates derived thereof hold more promise as cancer vaccines than individual tumor-associated antigens (TAAs), because vaccinal cells can elicit immune responses to multiple TAAs. Cancer cell-based vaccines can be autologous, allogeneic or xenogeneic. Clinical use of xenogeneic vaccines is advantageous in that they can be most effective in breaking the preexisting immune tolerance to TAAs. To potentiate immunotherapy, vaccinations can be combined with other modalities that target different immune pathways. These modalities include 1) genetic or chemical modification of cell-based vaccines; 2) cross-priming TAAs to T cells by engaging dendritic cells; 3) T-cell adoptive therapy; 4) stimulation of cytotoxic inflammation by non-specific immunomodulators, toll-like receptor (TLR) agonists, cytokines, chemokines or hormones; 5) reduction of immunosuppression and/or stimulation of antitumor effector cells using antibodies, small molecules; and 6) various cytoreductive modalities. The authors envisage that combined immunotherapeutic strategies will allow for substantial improvements in clinical outcomes in the near future.

  20. Urinary tract infections.

    PubMed

    Chenoweth, Carol E; Saint, Sanjay

    2011-03-01

    Catheter-associated urinary tract infections (CAUTIs) account for approximately 40% of all health care-associated infections. Despite studies showing benefit of interventions for prevention of CAUTI, adoption of these practices has not occurred in many healthcare facilities in the United States. As urinary catheters account for the majority of healthcare-associated UTIs, the most important interventions are directed at avoiding placement of urinary catheters and promoting early removal when appropriate. Alternatives to indwelling catheters such as intermittent catheterization and condom catheters should be considered. If indwelling catheterization is appropriate, proper aseptic practices for catheter insertion and maintenance and use of a closed catheter collection system are essential for preventing CAUTI. The use of antimicrobial catheters also may be considered when the rates of CAUTI remain persistently high despite adherence to other evidence-based practices, or in patients deemed to be at high risk for CAUTI or its complications. Attention toward prevention of CAUTI will likely increase as Center for Medicare and Medicaid Services and other third-party payers no longer reimburse for hospital-acquired UTI.

  1. Cell sheet approach for tissue engineering and regenerative medicine.

    PubMed

    Matsuura, Katsuhisa; Utoh, Rie; Nagase, Kenichi; Okano, Teruo

    2014-09-28

    After the biotech medicine era, regenerative medicine is expected to be an advanced medicine that is capable of curing patients with difficult-to-treat diseases and physically impaired function. Our original scaffold-free cell sheet-based tissue engineering technology enables transplanted cells to be engrafted for a long time, while fully maintaining their viability. This technology has already been applied to various diseases in the clinical setting, including the cornea, esophagus, heart, periodontal ligament, and cartilage using autologous cells. Transplanted cell sheets not only replace the injured tissue and compensate for impaired function, but also deliver growth factors and cytokines in a spatiotemporal manner over a prolonged period, which leads to promotion of tissue repair. Moreover, the integration of stem cell biology and cell sheet technology with sufficient vascularization opens possibilities for fabrication of human three-dimensional vascularized dense and intact tissue grafts for regenerative medicine to parenchymal organs.

  2. Single cell sequencing approaches for complex biological systems.

    PubMed

    Baslan, Timour; Hicks, James

    2014-06-01

    Biological phenotype is the output of complex interactions between heterogeneous cells within a specified niche. These interactions are tightly governed and regulated by the genetic, epigenetic, and transcriptional states of single cells, with deregulation of these states resulting in disease. As such, genome wide single cell investigations are bound to enhance our knowledge of the underlying principles that govern biological systems. Recent technological advances have enabled such investigations in the form of single-cell sequencing. Here, we review the most recent developments in genome wide profiling of single cells, discuss some of the novel biological observations gleaned by such investigations, and touch upon the promise of single cell sequencing in unraveling biological systems.

  3. Prion diseases and the gastrointestinal tract.

    PubMed

    Davies, G A; Bryant, Adam R; Reynolds, John D; Jirik, Frank R; Sharkey, Keith A

    2006-01-01

    The gastrointestinal (GI) tract plays a central role in the pathogenesis of transmissible spongiform encephalopathies. These are human and animal diseases that include bovine spongiform encephalopathy, scrapie and Creutzfeldt-Jakob disease. They are uniformly fatal neurological diseases, which are characterized by ataxia and vacuolation in the central nervous system. Although they are known to be caused by the conversion of normal cellular prion protein to its infectious conformational isoform (PrPsc) the process by which this isoform is propagated and transported to the brain remains poorly understood. M cells, dendritic cells and possibly enteroendocrine cells are important in the movement of infectious prions across the GI epithelium. From there, PrPsc propagation requires B lymphocytes, dendritic cells and follicular dendritic cells of Peyer's patches. The early accumulation of the disease-causing agent in the plexuses of the enteric nervous system supports the contention that the autonomic nervous system is important in disease transmission. This is further supported by the presence of PrPsc in the ganglia of the parasympathetic and sympathetic nerves that innervate the GI tract. Additionally, the lymphoreticular system has been implicated as the route of transmission from the gut to the brain. Although normal cellular prion protein is found in the enteric nervous system, its role has not been characterized. Further research is required to understand how the cellular components of the gut wall interact to propagate and transmit infectious prions to develop potential therapies that may prevent the progression of transmissible spongiform encephalopathies.

  4. Therapeutic approaches for treating hemophilia A using embryonic stem cells.

    PubMed

    Kasuda, Shogo; Tatsumi, Kohei; Sakurai, Yoshihiko; Shima, Midori; Hatake, Katsuhiko

    2016-06-01

    Hemophilia A is an X-linked rescessive bleeding disorder that results from F8 gene aberrations. Previously, we established embryonic stem (ES) cells (tet-226aa/N6-Ainv18) that secrete human factor VIII (hFVIII) by introducing the human F8 gene in mouse Ainv18 ES cells. Here, we explored the potential of cell transplantation therapy for hemophilia A using the ES cells. Transplant tet-226aa/N6-Ainv18 ES cells were injected into the spleens of severe combined immunodeficiency (SCID) mice, carbon tetrachloride (CCl4)-pretreated wild-type mice, and CCl4-pretreated hemophilia A mice. F8 expression was induced by doxycycline in drinking water, and hFVIII-antigen production was assessed in all cell transplantation experiments. Injecting the ES cells into SCID mice resulted in an enhanced expression of the hFVIII antigen; however, teratoma generation was confirmed in the spleen. Transplantation of ES cells into wild-type mice after CCl4-induced liver injury facilitated survival and engraftment of transplanted cells without teratoma formation, resulting in hFVIII production in the plasma. Although CCl4 was lethal to most hemophilia A mice, therapeutic levels of FVIII activity, as well as the hFVIII antigen, were detected in surviving hemophilia A mice after cell transplantation. Immunolocalization results for hFVIII suggested that transplanted ES cells might be engrafted at the periportal area in the liver. Although the development of a safer induction method for liver regeneration is required, our results suggested the potential for developing an effective ES-cell transplantation therapeutic model for treating hemophilia A in the future.

  5. Multidisciplinary approaches to understanding collective cell migration in developmental biology.

    PubMed

    Schumacher, Linus J; Kulesa, Paul M; McLennan, Rebecca; Baker, Ruth E; Maini, Philip K

    2016-06-01

    Mathematical models are becoming increasingly integrated with experimental efforts in the study of biological systems. Collective cell migration in developmental biology is a particularly fruitful application area for the development of theoretical models to predict the behaviour of complex multicellular systems with many interacting parts. In this context, mathematical models provide a tool to assess the consistency of experimental observations with testable mechanistic hypotheses. In this review, we showcase examples from recent years of multidisciplinary investigations of neural crest cell migration. The neural crest model system has been used to study how collective migration of cell populations is shaped by cell-cell interactions, cell-environmental interactions and heterogeneity between cells. The wide range of emergent behaviours exhibited by neural crest cells in different embryonal locations and in different organisms helps us chart out the spectrum of collective cell migration. At the same time, this diversity in migratory characteristics highlights the need to reconcile or unify the array of currently hypothesized mechanisms through the next generation of experimental data and generalized theoretical descriptions.

  6. Histochemical approaches to assess cell-to-cell transmission of misfolded proteins in neurodegenerative diseases

    PubMed Central

    Natale, G.; Pompili, E.; Biagioni, F.; Paparelli, S.; Lenzi, P.; Fornai, F.

    2013-01-01

    Formation, aggregation and transmission of abnormal proteins are common features in neurodegenerative disorders including Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis, and Huntington's disease. The mechanisms underlying protein alterations in neurodegenerative diseases remain controversial. Novel findings highlighted altered protein clearing systems as common biochemical pathways which generate protein misfolding, which in turn causes protein aggregation and protein spreading. In fact, proteinaceous aggregates are prone to cell-tocell propagation. This is reminiscent of what happens in prion disorders, where the prion protein misfolds thus forming aggregates which spread to neighbouring cells. For this reason, the term prionoids is currently used to emphasize how several misfolded proteins are transmitted in neurodegenerative diseases following this prion-like pattern. Histochemical techniques including the use of specific antibodies covering both light and electron microscopy offer a powerful tool to describe these phenomena and investigate specific molecular steps. These include: prion like protein alterations; glycation of prion-like altered proteins to form advanced glycation end-products (AGEs); mechanisms of extracellular secretion; interaction of AGEs with specific receptors placed on neighbouring cells (RAGEs). The present manuscript comments on these phenomena aimed to provide a consistent scenario of the available histochemical approaches to dissect each specific step. PMID:23549464

  7. A nested-cell approach for in situ remediation.

    PubMed

    Luo, Jian; Wu, Weimin; Fienen, Michael N; Jardine, Philip M; Mehlhorn, Tonia L; Watson, David B; Cirpka, Olaf A; Criddle, Craig S; Kitanidis, Peter K

    2006-01-01

    We characterize the hydraulics of an extraction-injection well pair in arbitrarily oriented regional flow by the recirculation ratio, area, and average residence time in the recirculation zone. Erratic regional flow conditions may compromise the performance of the reactor between a single well pair. We propose an alternative four-well system: two downgradient extraction and two upgradient injection wells creating an inner cell nested within an outer cell. The outer cell protects the inner cell from the influence of regional flow. Compared to a two-well system, the proposed four-well system has several advantages: (1) the recirculation ratio within the nested inner cell is less sensitive to the regional flow direction; (2) a transitional recirculation zone between the inner and outer cells can capture flow leakage from the inner cell, minimizing the release of untreated contaminants; and (3) the size of the recirculation zone and residence times can be better controlled within the inner cell by changing the pumping rates. The system is applied at the Field Research Center in Oak Ridge, Tennessee, where experiments on microbial in situ reduction of uranium (VI) are under way.

  8. Phenotypic Approaches to Identify Inhibitors of B Cell Activation

    PubMed Central

    Kim, Suzie; Wiener, Jake; Rao, Navin L.; Milla, Marcos E.; DiSepio, Daniel

    2015-01-01

    An EPIC label-free phenotypic platform was developed to explore B cell receptor (BCR) and CD40R-mediated B cell activation. The phenotypic assay measured the association of RL non-Hodgkin’s lymphoma B cells expressing lymphocyte function-associated antigen 1 (LFA-1) to intercellular adhesion molecule 1 (ICAM-1)-coated EPIC plates. Anti-IgM (immunoglobulin M) mediated BCR activation elicited a response that was blocked by LFA-1/ICAM-1 specific inhibitors and a panel of Bruton’s tyrosine kinase (BTK) inhibitors. LFA-1/ICAM-1 association was further increased on coapplication of anti-IgM and mega CD40L when compared to individual application of either. Anti-IgM, mega CD40L, or the combination of both displayed distinct kinetic profiles that were inhibited by treatment with a BTK inhibitor. We also established a FLIPR-based assay to measure B cell activation in Ramos Burkitt’s lymphoma B cells and an RL cell line. Anti-IgM-mediated BCR activation elicited a robust calcium response that was inhibited by a panel of BTK inhibitors. Conversely, CD40R activation did not elicit a calcium response in the FLIPR assay. Compared to the FLIPR, the EPIC assay has the propensity to identify inhibitors of both BCR and CD40R-mediated B cell activation and may provide more pharmacological depth or novel mechanisms of action for inhibition of B cell activation. PMID:25948491

  9. A Model Approach to the Electrochemical Cell: An Inquiry Activity

    ERIC Educational Resources Information Center

    Cullen, Deanna M.; Pentecost, Thomas C.

    2011-01-01

    In an attempt to address some student misconceptions in electrochemistry, this guided-inquiry laboratory was devised to give students an opportunity to use a manipulative that simulates the particulate-level activity within an electrochemical cell, in addition to using an actual electrochemical cell. Students are led through a review of expected…

  10. STORM: A General Model to Determine the Number and Adaptive Changes of Epithelial Stem Cells in Teleost, Murine and Human Intestinal Tracts

    PubMed Central

    Wang, Zhengyuan; Matsudaira, Paul; Gong, Zhiyuan

    2010-01-01

    Intestinal stem cells play a pivotal role in the epithelial tissue renewal, homeostasis and cancer development. The lack of a general marker for intestinal stem cells across species has hampered analysis of stem cell number in different species and their adaptive changes upon intestinal lesions or during development of cancer. Here a two-dimensional model, named STORM, has been developed to address this issue. By optimizing epithelium renewal dynamics, the model examines the epithelial stem cell number by taking experimental input information regarding epithelium proliferation and differentiation. As the results suggest, there are 2.0–4.1 epithelial stem cells on each pocket section of zebrafish intestine, 2.0–4.1 stem cells on each crypt section of murine small intestine and 1.8–3.5 stem cells on each crypt section of human duodenum. The model is able to provide quick results for stem cell number and its adaptive changes, which is not easy to measure through experiments. Its general applicability to different species makes it a valuable tool for analysis of intestinal stem cells under various pathological conditions. PMID:21124758

  11. Feline Lower Urinary Tract Disease

    MedlinePlus

    ... gland) can cause lower urinary tract disease in cats. Although they are much less common causes, FLUTD ... your veterinarian about the best diet for your cat. Many commercial diets are acceptable, but some urinary ...

  12. Urinary tract infections in adults.

    PubMed

    Cohn, Evan B; Schaeffer, Anthony J

    2004-06-07

    Urinary tract infection (UTI) is an exceedingly common problem prompting seven million office visits and one million hospitalizations in the United States each year. Advances in the understanding of both host and bacterial factors involved in UTI have led to many improvements in therapy. While there have also been advances in the realm of antimicrobials, there have been numerous problems with multiple drug resistant organisms. Providing economical care while minimizing drug resistance requires appropriate diagnosis, evaluation, and treatment of urinary tract infections.

  13. Atrio-His bundle tracts.

    PubMed Central

    Brechenmacher, C

    1975-01-01

    The atrio-His bundle tracts are very rare; only two have been found in 687 hearts studied histologically. These tracts have a similar appearance to those of the atrioventricular bundle and form a complete bypass of the atrioventricular node. In their presence the electrocardiogram may show a short or normal PR interval. They may be responsible for some cases of very rapid ventricular response to supraventricular arrhythmias. Images PMID:1191446

  14. Impact of Inflammation on Male Reproductive Tract

    PubMed Central

    Azenabor, Alfred; Ekun, Ayodele Oloruntoba; Akinloye, Oluyemi

    2015-01-01

    Fertility in the male is dependent on the proper production of sperm cells. This process, called spermatogenesis is very complex and involves the synchronization of numerous factors. The presence of pro–inflammatory cytokines, tumor necrosis factor-alpha (TNF–α), interleukin–1 alpha (IL–1 α) and interleukin 1 beta (IL–1 β) cytokines in the male reproductive tract (testis, epididymis and sperm) may have certain physiological functions. However, when the levels of these cytokines are higher than normal, as seen in conditions of inflammation, they become very harmful to sperm production. Moreover, inflammation is also associated with oxidative stress and the latter is well known to impair sperm function. Epidemiological studies regarding male infertility have revealed that more and more infertile men suffer from acute or chronic inflammation of the genitourinary tract, which often occurs without any symptoms. The inflammatory reactions within the male genital tract are inevitably connected with oxidative stress. Oxidative stress, especially in sperm, is harmful because it damages sperm DNA and causes apoptosis in sperm. This article reviewed the suggested mechanisms and contribution of inflammation to male infertility. In addition, the review was further strengthened by discussing how inflammation affects both fertility and assisted reproductive technologies (ART). PMID:26913230

  15. An approach for configuring space photovoltaic tandem arrays based on cell layer performance

    NASA Technical Reports Server (NTRS)

    Flora, C. S.; Dillard, P. A.

    1991-01-01

    Meeting solar array performance goals of 300 W/Kg requires use of solar cells with orbital efficiencies greater than 20 percent. Only multijunction cells and cell layers operating in tandem produce this required efficiency. An approach for defining solar array design concepts that use tandem cell layers involve the following: transforming cell layer performance at standard test conditions to on-orbit performance; optimizing circuit configuration with tandem cell layers; evaluating circuit sensitivity to cell current mismatch; developing array electrical design around selected circuit; and predicting array orbital performance including seasonal variations.

  16. Studying the Nucleated Mammalian Cell Membrane by Single Molecule Approaches

    PubMed Central

    Wang, Feng; Wu, Jiazhen; Gao, Jing; Liu, Shuheng; Jiang, Junguang; Jiang, Shibo; Wang, Hongda

    2014-01-01

    The cell membrane plays a key role in compartmentalization, nutrient transportation and signal transduction, while the pattern of protein distribution at both cytoplasmic and ectoplasmic sides of the cell membrane remains elusive. Using a combination of single-molecule techniques, including atomic force microscopy (AFM), single molecule force spectroscopy (SMFS) and stochastic optical reconstruction microscopy (STORM), to study the structure of nucleated cell membranes, we found that (1) proteins at the ectoplasmic side of the cell membrane form a dense protein layer (4 nm) on top of a lipid bilayer; (2) proteins aggregate to form islands evenly dispersed at the cytoplasmic side of the cell membrane with a height of about 10–12 nm; (3) cholesterol-enriched domains exist within the cell membrane; (4) carbohydrates stay in microdomains at the ectoplasmic side; and (5) exposed amino groups are asymmetrically distributed on both sides. Based on these observations, we proposed a Protein Layer-Lipid-Protein Island (PLLPI) model, to provide a better understanding of cell membrane structure, membrane trafficking and viral fusion mechanisms. PMID:24806512

  17. A machine learning approach for detecting cell phone usage

    NASA Astrophysics Data System (ADS)

    Xu, Beilei; Loce, Robert P.

    2015-03-01

    Cell phone usage while driving is common, but widely considered dangerous due to distraction to the driver. Because of the high number of accidents related to cell phone usage while driving, several states have enacted regulations that prohibit driver cell phone usage while driving. However, to enforce the regulation, current practice requires dispatching law enforcement officers at road side to visually examine incoming cars or having human operators manually examine image/video records to identify violators. Both of these practices are expensive, difficult, and ultimately ineffective. Therefore, there is a need for a semi-automatic or automatic solution to detect driver cell phone usage. In this paper, we propose a machine-learning-based method for detecting driver cell phone usage using a camera system directed at the vehicle's front windshield. The developed method consists of two stages: first, the frontal windshield region localization using the deformable part model (DPM), next, we utilize Fisher vectors (FV) representation to classify the driver's side of the windshield into cell phone usage violation and non-violation classes. The proposed method achieved about 95% accuracy with a data set of more than 100 images with drivers in a variety of challenging poses with or without cell phones.

  18. Multidisciplinary approaches to understanding collective cell migration in developmental biology

    PubMed Central

    Schumacher, Linus J.; Kulesa, Paul M.; McLennan, Rebecca; Baker, Ruth E.; Maini, Philip K.

    2016-01-01

    Mathematical models are becoming increasingly integrated with experimental efforts in the study of biological systems. Collective cell migration in developmental biology is a particularly fruitful application area for the development of theoretical models to predict the behaviour of complex multicellular systems with many interacting parts. In this context, mathematical models provide a tool to assess the consistency of experimental observations with testable mechanistic hypotheses. In this review, we showcase examples from recent years of multidisciplinary investigations of neural crest cell migration. The neural crest model system has been used to study how collective migration of cell populations is shaped by cell–cell interactions, cell–environmental interactions and heterogeneity between cells. The wide range of emergent behaviours exhibited by neural crest cells in different embryonal locations and in different organisms helps us chart out the spectrum of collective cell migration. At the same time, this diversity in migratory characteristics highlights the need to reconcile or unify the array of currently hypothesized mechanisms through the next generation of experimental data and generalized theoretical descriptions. PMID:27278647

  19. Utility of models of the gastrointestinal tract for assessment of the digestion and absorption of engineered nanomaterials released from food matrices.

    PubMed

    Lefebvre, David E; Venema, Koen; Gombau, Lourdes; Valerio, Luis G; Raju, Jayadev; Bondy, Genevieve S; Bouwmeester, Hans; Singh, R Paul; Clippinger, Amy J; Collnot, Eva-Maria; Mehta, Rekha; Stone, Vicki

    2015-05-01

    Engineered metal/mineral, lipid and biochemical macromolecule nanomaterials (NMs) have potential applications in food. Methodologies for the assessment of NM digestion and bioavailability in the gastrointestinal tract are nascent and require refinement. A working group was tasked by the International Life Sciences Institute NanoRelease Food Additive project to review existing models of the gastrointestinal tract in health and disease, and the utility of these models for the assessment of the uptake of NMs intended for food. Gastrointestinal digestion and absorption could be addressed in a tiered approach using in silico computational models, in vitro non-cellular fluid systems and in vitro cell culture models, after which the necessity of ex vivo organ culture and in vivo animal studies can be considered. Examples of NM quantification in gastrointestinal tract fluids and tissues are emerging; however, few standardized analytical techniques are available. Coupling of these techniques to gastrointestinal models, along with further standardization, will further strengthen methodologies for risk assessment.

  20. A mathematical approach for evaluating nickel-hydrogen cells

    NASA Technical Reports Server (NTRS)

    Leibecki, H. F.

    1986-01-01

    A mathematical equation is presented which gives a quantitative relationship between time-voltage discharge curves, when a cell's ampere-hour capacity is determined at a constant discharge current. In particular the equation quantifies the initial exponential voltage decay; the rate of voltage decay; the overall voltage shift of the curve and the total capacity of the cell at the given discharge current. The results of 12 nickel-hydrogen boiler plate cells cycled to 80 percent depth-of-discharge (DOD) are discussed in association with these equations.

  1. Bacterial cell division: experimental and theoretical approaches to the divisome.

    PubMed

    Broughton, Claire E; Roper, David I; Van Den Berg, Hugo A; Rodger, Alison

    2015-01-01

    Cell division is a key event in the bacterial life cycle. It involves constriction at the midcell, so that one cell can give rise to two daughter cells. This constriction is mediated by a ring composed offibrous multimers of the protein FtsZ. However a host of additional factors is involved in the formation and dynamics of this "Z-ring" and this complicated apparatus is collectively known as the "divisome". We review the literature, with an emphasis on mathematical modelling, and show how such theoretical efforts have helped experimentalists to make sense of the at times bewildering data, and plan further experiments.

  2. Surface charge-conversion polymeric nanoparticles for photodynamic treatment of urinary tract bacterial infections.

    PubMed

    Liu, Shijie; Qiao, Shenglin; Li, Lili; Qi, Guobin; Lin, Yaoxin; Qiao, Zengying; Wang, Hao; Shao, Chen

    2015-12-11

    Urinary tract infections are typical bacterial infections which result in a number of economic burdens. With increasing antibiotic resistance, it is urgent that new approaches are explored that can eliminate pathogenic bacteria without inducing drug resistance. Antimicrobial photodynamic therapy (PDT) is a new promising tactic. It is a gentle in situ photochemical reaction in which a photosensitizer (PS) generates reactive oxygen species (ROS) under laser irradiation. In this work, we have demonstrated Chlorin e6 (Ce6) encapsulated charge-conversion polymeric nanoparticles (NPs) for efficiently targeting and killing pathogenic bacteria in a weakly acidic urinary tract infection environment. Owing to the surface charge conversion of NPs in an acidic environment, the NPs exhibited enhanced recognition for Gram-positive (ex. S. aureus) and Gram-negative (ex. E. coli) bacteria due to the charge interaction. Also, those NPs showed significant antibacterial efficacy in vitro with low cytotoxicity. The MIC value of NPs to E. coli is 17.91 μg ml(-1), compared with the free Ce6 value of 29.85 μg ml(-1). Finally, a mouse acute cystitis model was used to assess the photodynamic therapy effects in urinary tract infections. A significant decline (P < 0.05) in bacterial cells between NPs and free Ce6 occurred in urine after photodynamic therapy treatment. And the plated counting results revealed a remarkable bacterial cells drop (P < 0.05) in the sacrificed bladder tissue. Above all, this nanotechnology strategy opens a new door for the treatment of urinary tract infections with minimal side effects.

  3. Surface charge-conversion polymeric nanoparticles for photodynamic treatment of urinary tract bacterial infections

    NASA Astrophysics Data System (ADS)

    Liu, Shijie; Qiao, Shenglin; Li, Lili; Qi, Guobin; Lin, Yaoxin; Qiao, Zengying; Wang, Hao; Shao, Chen

    2015-12-01

    Urinary tract infections are typical bacterial infections which result in a number of economic burdens. With increasing antibiotic resistance, it is urgent that new approaches are explored that can eliminate pathogenic bacteria without inducing drug resistance. Antimicrobial photodynamic therapy (PDT) is a new promising tactic. It is a gentle in situ photochemical reaction in which a photosensitizer (PS) generates reactive oxygen species (ROS) under laser irradiation. In this work, we have demonstrated Chlorin e6 (Ce6) encapsulated charge-conversion polymeric nanoparticles (NPs) for efficiently targeting and killing pathogenic bacteria in a weakly acidic urinary tract infection environment. Owing to the surface charge conversion of NPs in an acidic environment, the NPs exhibited enhanced recognition for Gram-positive (ex. S. aureus) and Gram-negative (ex. E. coli) bacteria due to the charge interaction. Also, those NPs showed significant antibacterial efficacy in vitro with low cytotoxicity. The MIC value of NPs to E. coli is 17.91 μg ml-1, compared with the free Ce6 value of 29.85 μg ml-1. Finally, a mouse acute cystitis model was used to assess the photodynamic therapy effects in urinary tract infections. A significant decline (P < 0.05) in bacterial cells between NPs and free Ce6 occurred in urine after photodynamic therapy treatment. And the plated counting results revealed a remarkable bacterial cells drop (P < 0.05) in the sacrificed bladder tissue. Above all, this nanotechnology strategy opens a new door for the treatment of urinary tract infections with minimal side effects.

  4. [Endobronchial granular cell tumor - what approach to take].

    PubMed

    Rego, Ana; Amado, Joana; Esteves, Idália; Almeida, José; Furtado, Antónia; Couceiro, António; Moura e Sá, João

    2006-01-01

    Granular cell tumor is a mesenchymal neoplasm almost always benign, with tendency to recurrence. Although it is more frequent in in the head and neck it has been described in almost all areas of the body. Its occurrence in the lung is extremely rare. The authors describe two cases of endobronchial granular cell tumours, discuss the particularities of this pathology as well as the treatment options, with particular attention to the use of endobronchial excision and criotherapy.

  5. Lung Regeneration: Endogenous and Exogenous Stem Cell Mediated Therapeutic Approaches.

    PubMed

    Akram, Khondoker M; Patel, Neil; Spiteri, Monica A; Forsyth, Nicholas R

    2016-01-19

    The tissue turnover of unperturbed adult lung is remarkably slow. However, after injury or insult, a specialised group of facultative lung progenitors become activated to replenish damaged tissue through a reparative process called regeneration. Disruption in this process results in healing by fibrosis causing aberrant lung remodelling and organ dysfunction. Post-insult failure of regeneration leads to various incurable lung diseases including chronic obstructive pulmonary disease (COPD) and idiopathic pulmonary fibrosis. Therefore, identification of true endogenous lung progenitors/stem cells, and their regenerative pathway are crucial for next-generation therapeutic development. Recent studies provide exciting and novel insights into postnatal lung development and post-injury lung regeneration by native lung progenitors. Furthermore, exogenous application of bone marrow stem cells, embryonic stem cells and inducible pluripotent stem cells (iPSC) show evidences of their regenerative capacity in the repair of injured and diseased lungs. With the advent of modern tissue engineering techniques, whole lung regeneration in the lab using de-cellularised tissue scaffold and stem cells is now becoming reality. In this review, we will highlight the advancement of our understanding in lung regeneration and development of stem cell mediated therapeutic strategies in combating incurable lung diseases.

  6. Lung Regeneration: Endogenous and Exogenous Stem Cell Mediated Therapeutic Approaches

    PubMed Central

    Akram, Khondoker M.; Patel, Neil; Spiteri, Monica A.; Forsyth, Nicholas R.

    2016-01-01

    The tissue turnover of unperturbed adult lung is remarkably slow. However, after injury or insult, a specialised group of facultative lung progenitors become activated to replenish damaged tissue through a reparative process called regeneration. Disruption in this process results in healing by fibrosis causing aberrant lung remodelling and organ dysfunction. Post-insult failure of regeneration leads to various incurable lung diseases including chronic obstructive pulmonary disease (COPD) and idiopathic pulmonary fibrosis. Therefore, identification of true endogenous lung progenitors/stem cells, and their regenerative pathway are crucial for next-generation therapeutic development. Recent studies provide exciting and novel insights into postnatal lung development and post-injury lung regeneration by native lung progenitors. Furthermore, exogenous application of bone marrow stem cells, embryonic stem cells and inducible pluripotent stem cells (iPSC) show evidences of their regenerative capacity in the repair of injured and diseased lungs. With the advent of modern tissue engineering techniques, whole lung regeneration in the lab using de-cellularised tissue scaffold and stem cells is now becoming reality. In this review, we will highlight the advancement of our understanding in lung regeneration and development of stem cell mediated therapeutic strategies in combating incurable lung diseases. PMID:26797607

  7. Reducing urinary tract infections in catheterised patients.

    PubMed

    Howe, Pam; Adams, John

    2015-01-20

    Urinary tract infections in catheterised patients continue to present a challenge in reducing healthcare-associated infection. In this article, an infection prevention and control team in one NHS trust reports on using audit results to focus attention on measures to reduce bacterial infections. Educational initiatives have an important role in reducing infection, but there is no single solution to the problem. Practice can be improved using a multi-targeted approach, peer review and clinical audit to allow for shared learning and experiences. These, along with informal education in the clinical area and more formal classroom lectures, can ultimately lead to improved patient outcomes.

  8. Finding degrees of separation: Experimental approaches for astroglial and oligodendroglial cell isolation and genetic targeting

    PubMed Central

    Chew, Li-Jin; DeBoy, Cynthia A.; Senatorov, Vladimir V

    2014-01-01

    The study of CNS glial cell function requires experimental methods to detect, purify, and manipulate each cell population with fidelity and specificity. With the identification and cloning of cell- and stage-specific markers, glial cell analysis techniques have grown beyond physical methods of tissue dissociation and cell culture, and become highly specific with immunoselection of cell cultures in vitro and genetic targeting in vivo. The unique plasticity of glial cells offers the potential for cell replacement therapies in neurological disease that utilize neural cells derived from transplanted neural stem and progenitor cells. In this mini-review, we outline general physical and genetic approaches for macroglial cell generation. We summarize cell culture methods to obtain astrocytes and oligodendrocytes and their precursors, from developing and adult tissue, as well as approaches to obtain human neural progenitor cells through the establishment of stem cells. We discuss popular targeting rodent strains designed for cell-specific detection, selection and manipulation of neuroglial cell progenitors and their committed progeny. Based on shared markers between astrocytes and stem cells, we discuss genetically modified mouse strains with overlapping expression, and highlight SOX-expressing strains available for targeting of stem and progenitor cell populations. We also include recently established mouse strains for detection, and tag-assisted RNA and miRNA analysis. This discussion aims to provide a brief overview of the rapidly expanding collection of experimental approaches and genetic resources for the isolation and targeting of macroglial cells, their sources, progeny and gene products to facilitate our understanding of their properties and potential application in pathology. PMID:25169049

  9. Finding degrees of separation: experimental approaches for astroglial and oligodendroglial cell isolation and genetic targeting.

    PubMed

    Chew, Li-Jin; DeBoy, Cynthia A; Senatorov, Vladimir V

    2014-10-30

    The study of CNS glial cell function requires experimental methods to detect, purify, and manipulate each cell population with fidelity and specificity. With the identification and cloning of cell- and stage-specific markers, glial cell analysis techniques have grown beyond physical methods of tissue dissociation and cell culture, and become highly specific with immunoselection of cell cultures in vitro and genetic targeting in vivo. The unique plasticity of glial cells offers the potential for cell replacement therapies in neurological disease that utilize neural cells derived from transplanted neural stem and progenitor cells. In this mini-review, we outline general physical and genetic approaches for macroglial cell generation. We summarize cell culture methods to obtain astrocytes and oligodendrocytes and their precursors, from developing and adult tissue, as well as approaches to obtain human neural progenitor cells through the establishment of stem cells. We discuss popular targeting rodent strains designed for cell-specific detection, selection and manipulation of neuroglial cell progenitors and their committed progeny. Based on shared markers between astrocytes and stem cells, we discuss genetically modified mouse strains with overlapping expression, and highlight SOX-expressing strains available for targeting of stem and progenitor cell populations. We also include recently established mouse strains for detection, and tag-assisted RNA and miRNA analysis. This discussion aims to provide a brief overview of the rapidly expanding collection of experimental approaches and genetic resources for the isolation and targeting of macroglial cells, their sources, progeny and gene products to facilitate our understanding of their properties and potential application in pathology.

  10. Sonographic investigations of the gastrointestinal tract of granivorous birds.

    PubMed

    Krautwald-Junghanns, Maria-Elisabeth; Stahl, Anja; Pees, Michael; Enders, Frank; Bartels, Thomas

    2002-01-01

    This article describes the sonographic examination of the normal gastrointestinal tract of granivorous birds. Preliminary tests with dead birds were performed to get an idea of the sonographic echotexture of the avian gastrointestinal tract. Later, clinically healthy seedeaters of different weights were examined sonographically. As equipment a convex microcurved scanner with a particularly small coupling surface and an adjustable frequency from 5.5-7.5 MHz was used. For the investigation of the gastrointestinal tract, six sonographic approaches are described. After a starving time of 18 hours in the granivorous birds and water input, the best sonographic image quality could be obtained. Using this method, the crop, ventriculus, intestines, and cloaca could be demonstrated sonographically; whereas, it was not possible to visualize the normal proventriculus in granivorous birds. In contrast to mammals, the different layers of the wall of the gastrointestinal tract could not be visualized with the equipment used. Motility of individual parts of the gastrointestinal tract (GI tract), however, could be well demonstrated.

  11. Live-cell mass profiling: an emerging approach in quantitative biophysics

    PubMed Central

    Zangle, Thomas A; Teitell, Michael A

    2015-01-01

    Cell mass, volume and growth rate are tightly controlled biophysical parameters in cellular development and homeostasis, and pathological cell growth defines cancer in metazoans. The first measurements of cell mass were made in the 1950s, but only recently have advances in computer science and microfabrication spurred the rapid development of precision mass-quantifying approaches. Here we discuss available techniques for quantifying the mass of single live cells with an emphasis on relative features, capabilities and drawbacks for different applications. PMID:25423019

  12. Novel approaches to treatment of sickle cell anaemia.

    PubMed

    Steinberg; Mitchell

    1999-11-01

    Sickle cell anaemia, a chronic and often debilitating disease, results from homozygosity for a single amino acid substitution in the beta-globin subunit of the haemoglobin molecule. Sickle haemoglobin (HbS), the product of this mutation, polymerises when deoxygenated, thus damaging the red blood cell and causing vaso-occlusive complications and haemolytic anaemia. Most cases of sickle cell anaemia are found in Africa. Until recently, treatment was directed at the management of disease complications. Patients with central nervous system events undergo exchange transfusions followed by chronic transfusion programmes. Patients with painful episodes, which result in many days missed from work and school are treated with narcotics and aggressive hydration. Novel therapy for sickle cell anaemia is designed to prevent complications through targeting disease mechanisms. Hydroxyurea is given to severely affected sickle cell anaemia patients in an attempt to prevent painful episodes, reduce hospital days, improve the patients' overall quality of life, and perhaps to prevent or provide some degree of end-organ damage stabilisation. Other novel therapies, such as bone marrow transplantation and gene therapy, pursue a cure. For these novel therapies to be effective on a global basis they must be amenable to underdeveloped and poorer countries of the world.

  13. Evaluation with mTHPC of early squamous cell carcinomas of the cheek pouch mucosa of Golden Syrian hamsters as a model for clinical PDT of early cancers in the upper aerodigestive tract, the esophag

    NASA Astrophysics Data System (ADS)

    Glanzmann, Thomas M.; Theumann, Jean-Francois; Forrer, Martin; Braichotte, Daniel; Wagnieres, Georges A.; van den Bergh, Hubert; Andrejevic-Blant, Snezana; Savary, Jean-Francois; Monnier, Philippe

    1995-03-01

    Golden Syrian hamsters are evaluated as an animal model for light induced fluorescence (LIF) photodetection and phototherapy of early squamous cell carcinomas of the upper aerodigestive tract, the esophagus, and the traecheo-bronchial tree. Carcinomas of this type are induced on the hamster cheek pouch mucosa by the application of the carcinogen 7,12-DMBA. For phototherapeutic experiments on the animals we utilized meso-(tetrahydoxyphenyl) chlorin (mTHPC). This drug is currently in phase I and II clinical trials for ENT patients presenting superficial `early' squamous cell carcinomas. By means of LIF we measured in vivo the kinetics of the uptake and removal of mTHPC in the normal and tumoral cheek mucosa and in the skin. The photodynamic therapy (PDT) reaction of the tissue after excitation of the photosensitizer with laser light at 652 nm was studied. Both pharmacokinetics and PDT efficacy are compared between animal model and clinical results with special emphasis on selectivity between normal and tumoral mucosa. These first experiments show that this tumor model in the hamster cheek pouch seems to be suitable for testing new photosensitizers preceding their clinical application as well as for optimization of the multiple parameters of clinical PDT.

  14. Microbial fuel cells: novel microbial physiologies and engineering approaches.

    PubMed

    Lovley, Derek R

    2006-06-01

    The possibility of generating electricity with microbial fuel cells has been recognized for some time, but practical applications have been slow to develop. The recent development of a microbial fuel cell that can harvest electricity from the organic matter stored in marine sediments has demonstrated the feasibility of producing useful amounts of electricity in remote environments. Further study of these systems has led to the discovery of microorganisms that conserve energy to support their growth by completely oxidizing organic compounds to carbon dioxide with direct electron transfer to electrodes. This suggests that self-sustaining microbial fuel cells that can effectively convert a diverse range of waste organic matter or renewable biomass to electricity are feasible. Significant progress has recently been made to increase the power output of systems designed to convert organic wastes to electricity, but substantial additional optimization will be required for large-scale electricity production.

  15. Flow field design development using the segmented cell approach

    SciTech Connect

    Bender, G.; Ramsey, J. C.

    2002-01-01

    We report on fuel cell flow-field development employing two-dimensional computational fluid dynamics (2-D CFD). Simulation of the flow distribution of a parallel channel flow-field, with a simple one-channel manifold, predicted inhomogeneous performance distribution within the cell. Further modeling, focusing on modification of the inlet and outlet flow fields, was used to predict a more homogeneous flow distribution in the flow-field. Attempts were made to verify the theoretical predictions experimentally by application of the segmented cell system. Measurements of the current distribution and CO transient response supported the 2-D CFD predictions. However, the margin of error between predicted and experimental results was considered insufficient to be of practical use. Future work will involve the evaluation of 3-D CFD to achieve the appropriate level of accuracy.

  16. Acute stress modulates the histamine content of mast cells in the gastrointestinal tract through interleukin-1 and corticotropin-releasing factor release in rats.

    PubMed

    Eutamene, Helene; Theodorou, Vassilia; Fioramonti, Jean; Bueno, Lionel

    2003-12-15

    Stress results in activation of the hypothalamic pituitary adrenal axis and affects illnesses such as neuroinflammatory syndrome. In vivo acute stress (restraint stress) induces gastrointestinal function disturbances through colonic mast cell activation. This study investigated the effect of acute stress in histamine content of colonic mast cells, and the central role of interleukin-1 (IL-1) and corticotropin-releasing factor (CRF) in this effect. After a restraint stress session colonic segments were isolated and submitted to three protocols: (i) determination of histamine levels by radioimmunoassay (RIA) after incubation with 48/80 compound, (ii) evaluation by histology of mucosal mast cell (MMC) number and (iii) determination of histamine immunoreactivity of MMC. These procedures were conducted (1) in sham or stressed rats, (2) in stressed rats previously treated with intracerebroventricular (I.C.V.) IL-1ra or alpha-helical CRF9-41, (3) in naive rats pretreated with I.C.V. rhIL-1beta or CRF and (4) in rats treated with central IL-1beta and CRF plus alpha-helical CRF and IL-1ra, respectively (cross-antagonism reaction). Acute stress increases histamine content in colonic mast cells, without degranulation. I.C.V. pretreatment with IL-1ra or alpha-helical CRF9-41 blocked stress-induced mast cell histamine content increase. Both I.C.V. rhIL-1beta and CRF injections reproduced the stress-linked changes. I.C.V. treatment with CRF antagonist blocked I.C.V. rhIL-1beta-induced mast cell histamine content increase, whereas central IL-1ra did not affect stress events induced by I.C.V. CRF administration. These results suggest that in rats acute stress increases colonic mast cell histamine content. This effect is mediated by the release in cascade in the brain first of IL-1 and secondly of CRF.

  17. High-throughput physically based approach for mammalian cell encapsulation

    NASA Astrophysics Data System (ADS)

    Yu, Jiashing; Wu, Po-Chen; Huang, Chi-Hui; Yang, Chung-Yao; Cheng, Chao-Min

    2013-10-01

    Herein, we wish to tear down the traditional boundaries between physics and life sciences by demonstrating a physically based, flow-focusing method to encapsulate mammalian cells into alginate-based microspheres in a very short period of time. We paid particular attention to the physical properties of the alginate solution as it was critical to create a physiologically relevant environment within the alginate microspheres. The cells we cultured when re-culturing them on Petri dishes could still be maintained for at least 4 days after microsphere encapsulation. We believe that this study would provide interesting insight in biophysics, polymer physics, and applied physics.

  18. Supramolecular Approaches to Nanoscale Morphological Control in Organic Solar Cells.

    PubMed

    Haruk, Alexander M; Mativetsky, Jeffrey M

    2015-06-11

    Having recently surpassed 10% efficiency, solar cells based on organic molecules are poised to become a viable low-cost clean energy source with the added advantages of mechanical flexibility and light weight. The best-performing organic solar cells rely on a nanostructured active layer morphology consisting of a complex organization of electron donating and electron accepting molecules. Although much progress has been made in designing new donor and acceptor molecules, rational control over active layer morphology remains a central challenge. Long-term device stability is another important consideration that needs to be addressed. This review highlights supramolecular strategies for generating highly stable nanostructured organic photovoltaic active materials by design.

  19. Group d salmonella urinary tract infection in an immunocompetent male.

    PubMed

    Jehangir, Asad; Poudel, Dilli; Fareedy, Shoaib Bilal; Salman, Ahmed; Qureshi, Anam; Jehangir, Qasim; Alweis, Richard

    2015-01-01

    A 62-year-old male with past medical history of benign prostatic hyperplasia presented to the emergency department with complaints of decreased urinary flow, inability to fully empty his bladder, and gross hematuria. Physical examination was unremarkable. Urinalysis revealed large amount of blood and more than 700 white blood cells suggesting a urinary tract infection. Urine culture grew group D Salmonella greater than 100,000 colony-forming units per mL. He was prescribed 6 weeks of trimethoprim/sulfamethoxazole and had resolution of symptoms. Retrospectively, he reported a 3-day history of watery diarrhea about a week prior to onset of urinary symptoms that was presumed to be the hematogenous source in this case. Urinary tract infection from nontyphoidal Salmonella (NTS) is rare and is usually associated with immunosuppression, chronic diseases, such as diabetes or structural abnormalities of the genitourinary tract. Genitourinary tract abnormalities previously reported in the literature that predispose to nontyphoidal Salmonella urinary tract infection include nephrolithiasis, chronic pyelonephritis, retrovesicular fistula, urethrorectal fistula, hydrocele, and post-TURP. We present an exceedingly uncommon case of 62-year-old male with group D Salmonella urinary tract infection predisposed by his history of benign prostatic hyperplasia.

  20. Geometric effects in microfluidics on heterogeneous cell stress using an Eulerian-Lagrangian approach.

    PubMed

    Warren, K M; Mpagazehe, J N; LeDuc, P R; Higgs, C F

    2016-02-07

    The response of individual cells at the micro-scale in cell mechanics is important in understanding how they are affected by changing environments. To control cell stresses, microfluidics can be implemented since there is tremendous control over the geometry of the devices. Designing microfluidic devices to induce and manipulate stress levels on biological cells can be aided by computational modeling approaches. Such approaches serve as an efficient precursor to fabricating various microfluidic geometries that induce predictable levels of stress on biological cells, based on their mechanical properties. Here, a three-dimensional, multiphase computational fluid dynamics (CFD) modeling approach was implemented for soft biological materials. The computational model incorporates the physics of the particle dynamics, fluid dynamics and solid mechanics, which allows us to study how stresses affect the cells. By using an Eulerian-Lagrangian approach to treat the fluid domain as a continuum in the microfluidics, we are conducting studies of the cells' movement and the stresses applied to the cell. As a result of our studies, we were able to determine that a channel with periodically alternating columns of obstacles was capable of stressing cells at the highest rate, and that microfluidic systems can be engineered to impose heterogenous cell stresses through geometric configuring. We found that when using controlled geometries of the microfluidics channels with staggered obstructions, we could increase the maximum cell stress by nearly 200 times over cells flowing through microfluidic channels with no obstructions. Incorporating computational modeling in the design of microfluidic configurations for controllable cell stressing could help in the design of microfludic devices for stressing cells such as cell homogenizers.

  1. Tumours of the upper alimentary tract

    PubMed Central

    Head, K. W.

    1976-01-01

    Tumours of the oropharynx of domestic animals are common in most parts of the world, but squamous cell carcinoma of the upper alimentary tract shows differences in prevalence in different geographical areas and occurs at different sites in the various species. Oral tumours of the melanogenic system are more common in dogs than in man. The following main histological categories, which broadly correspond to those used in the classification of tumours of man, are described: papilloma; squamous cell carcinoma; salivary gland tumours; malignant melanoma; tumours of soft (mesenchymal) tissues; tumours of the facial bones; tumours of haematopoietic and related tissues; and odontogenic tumours and jaw cysts. Papilloma, squamous cell carcinoma, malignant melanoma, fibroma, and fibrosarcoma account for about 80% of the tumours that occur in the upper alimentary tract of domestic animals. ImagesFig. 6Fig. 7Fig. 8Fig. 9Fig. 34Fig. 35Fig. 36Fig. 37Fig. 2Fig. 3Fig. 4Fig. 5Fig. 22Fig. 23Fig. 24Fig. 25Fig. 26Fig. 27Fig. 28Fig. 29Fig. 14Fig. 15Fig. 16Fig. 17Fig. 30Fig. 31Fig. 32Fig. 33Fig. 18Fig. 19Fig. 20Fig. 21Fig. 10Fig. 11Fig. 12Fig. 13Fig. 1 PMID:1086147

  2. ATP-Binding Cassette (ABC) Transporters of the Human Respiratory Tract Pathogen, Moraxella catarrhalis: Role in Virulence

    PubMed Central

    Murphy, Timothy F; Brauer, Aimee L.; Johnson, Antoinette; Kirkham, Charmaine

    2016-01-01

    Moraxella catarrhalis is a human respiratory tract pathogen that causes otitis media (middle ear infections) in children and respiratory tract infections in adults with chronic obstructive pulmonary disease. In view of the huge global burden of disease caused by M. catarrhalis, the development of vaccines to prevent these infections and better approaches to treatment have become priorities. In previous work, we used a genome mining approach that identified three substrate binding proteins (SBPs) of ATP-binding cassette (ABC) transporters as promising candidate vaccine antigens. In the present study, we performed a comprehensive assessment of 19 SBPs of 15 ABC transporter systems in the M. catarrhalis genome by engineering knockout mutants and studying their role in assays that assess mechanisms of infection. The capacity of M. catarrhalis to survive and grow in the nutrient-limited and hostile environment of the human respiratory tract, including intracellular growth, account in part for its virulence. The results show that ABC transporters that mediate uptake of peptides, amino acids, cations and anions play important roles in pathogenesis by enabling M. catarrhalis to 1) grow in nutrient-limited conditions, 2) invade and survive in human respiratory epithelial cells and 3) persist in the lungs in a murine pulmonary clearance model. The knockout mutants of SBPs and ABC transporters showed different patterns of activity in the assay systems, supporting the conclusion that different SBPs and ABC transporters function at different stages in the pathogenesis of infection. These results indicate that ABC transporters are nutritional virulence factors, functioning to enable the survival of M catarrhalis in the diverse microenvironments of the respiratory tract. Based on the role of ABC transporters as virulence factors of M. catarrhalis, these molecules represent potential drug targets to eradicate the organism from the human respiratory tract. PMID:27391026

  3. New approaches for high-efficiency solar cells. Final report

    SciTech Connect

    Bedair, S M; El-Masry, N A

    1997-12-01

    This report summarizes the activities carried out in this subcontract. These activities cover, first the atomic layer epitaxy (ALE) growth of GaAs, AlGaAs and InGaP at fairly low growth temperatures. This was followed by using ALE to achieve high levels of doping both n-type and p-type required for tunnel junctions (Tj) in the cascade solar cell structures. Then the authors studied the properties of AlGaAs/InGaP and AlGaAs/GaAs tunnel junctions and their performances at different growth conditions. This is followed by the use of these tunnel junctions in stacked solar cell structures. The effect of these tunnel junctions on the performance of stacked solar cells was studied at different temperatures and different solar fluences. Finally, the authors studied the effect of different types of black surface fields (BSF), both p/n and n/p GaInP solar cell structures, and their potential for window layer applications. Parts of these activities were carried in close cooperation with Dr. Mike Timmons of the Research Triangle Institute.

  4. Modelling of robotic work cells using agent based-approach

    NASA Astrophysics Data System (ADS)

    Sękala, A.; Banaś, W.; Gwiazda, A.; Monica, Z.; Kost, G.; Hryniewicz, P.

    2016-08-01

    In the case of modern manufacturing systems the requirements, both according the scope and according characteristics of technical procedures are dynamically changing. This results in production system organization inability to keep up with changes in a market demand. Accordingly, there is a need for new design methods, characterized, on the one hand with a high efficiency and on the other with the adequate level of the generated organizational solutions. One of the tools that could be used for this purpose is the concept of agent systems. These systems are the tools of artificial intelligence. They allow assigning to agents the proper domains of procedures and knowledge so that they represent in a self-organizing system of an agent environment, components of a real system. The agent-based system for modelling robotic work cell should be designed taking into consideration many limitations considered with the characteristic of this production unit. It is possible to distinguish some grouped of structural components that constitute such a system. This confirms the structural complexity of a work cell as a specific production system. So it is necessary to develop agents depicting various aspects of the work cell structure. The main groups of agents that are used to model a robotic work cell should at least include next pattern representatives: machine tool agents, auxiliary equipment agents, robots agents, transport equipment agents, organizational agents as well as data and knowledge bases agents. In this way it is possible to create the holarchy of the agent-based system.

  5. Common ground: stem cell approaches find shared pathways underlying ALS.

    PubMed

    Matus, Soledad; Medinas, Danilo B; Hetz, Claudio

    2014-06-05

    The development of curative therapies for genetically complex diseases such as ALS has been delayed by the lack of relevant disease models. Recent advances using induced-pluripotent-stem-cell-derived motoneurons from patients harboring distinct ALS mutations have recapitulated essential disease features and have identified some common pathways driving disease pathogenesis.

  6. Mucosal-associated invariant T cells from induced pluripotent stem cells: A novel approach for modeling human diseases

    PubMed Central

    Sugimoto, Chie; Fujita, Hiroyoshi; Wakao, Hiroshi

    2016-01-01

    Mice have frequently been used to model human diseases involving immune dysregulation such as autoimmune and inflammatory diseases. These models help elucidate the mechanisms underlying the disease and in the development of novel therapies. However, if mice are deficient in certain cells and/or effectors associated with human diseases, how can their functions be investigated in this species? Mucosal-associated invariant T (MAIT) cells, a novel innate-like T cell family member, are a good example. MAIT cells are abundant in humans but scarce in laboratory mice. MAIT cells harbor an invariant T cell receptor and recognize nonpeptidic antigens vitamin B2 metabolites from bacteria and yeasts. Recent studies have shown that MAIT cells play a pivotal role in human diseases such as bacterial infections and autoimmune and inflammatory diseases. MAIT cells possess granulysin, a human-specific effector molecule, but granulysin and its homologue are absent in mice. Furthermore, MAIT cells show poor proliferation in vitro. To overcome these problems and further our knowledge of MAIT cells, we have established a method to expand MAIT cells via induced pluripotent stem cells (iPSCs). In this review, we describe recent advances in the field of MAIT cell research and our approach for human disease modeling with iPSC-derived MAIT cells. PMID:27114747

  7. B-cell lymphoma-2 localization in the female reproductive tract of the Chinese soft-shelled turtle, Pelodiscus sinensis and its relationship with sperm storage.

    PubMed

    Le, Yuan; Chen, Shaofan; Hu, Lisi; Zhang, Linli; Ullah, Shakeeb; Liu, Tengfei; Yang, Ping; Liu, Yi; Chen, Qiusheng

    2015-12-01

    The aim of the present study was to investigate the expression and localization of B-cell lymphoma-2 (Bcl-2) in the oviduct of the Chinese soft-shelled turtle, Pelodiscus sinensis, during the reproductive cycle to analyze the relationship between Bcl-2 and sperm storage. Bcl-2 expression was confirmed in the P. sinensis oviduct by western blot analysis. Hematoxylin-eosin staining showed that female P. sinensis stored sperm from November to April of the following year. The oviduct showed positive immunostaining for Bcl-2 of epithelial ciliated cells, gland ducts, and gland cells. Bcl-2 expression in the oviduct was associated with sperm storage occurrence. This indicates that the survival factor Bcl-2 may play a role in P. sinensis sperm storage.

  8. All electronic approach for high-throughput cell trapping and lysis with electrical impedance monitoring.

    PubMed

    Ameri, Shideh Kabiri; Singh, Pramod K; Dokmeci, Mehmet R; Khademhosseini, Ali; Xu, Qiaobing; Sonkusale, Sameer R

    2014-04-15

    We present a portable lab-on-chip device for high-throughput trapping and lysis of single cells with in-situ impedance monitoring in an all-electronic approach. The lab-on-chip device consists of microwell arrays between transparent conducting electrodes within a microfluidic channel to deliver and extract cells using alternating current (AC) dielectrophoresis. Cells are lysed with high efficiency using direct current (DC) electric fields between the electrodes. Results are presented for trapping and lysis of human red blood cells. Impedance spectroscopy is used to estimate the percentage of filled wells with cells and to monitor lysis. The results show impedance between electrodes decreases with increase in the percentage of filled wells with cells and drops to a minimum after lysis. Impedance monitoring provides a reasonably accurate measurement of cell trapping and lysis. Utilizing an all-electronic approach eliminates the need for bulky optical components and cameras for monitoring.

  9. A Microfluidic Approach for Inducing Cell Rotation by Means of Hydrodynamic Forces

    PubMed Central

    Torino, Stefania; Iodice, Mario; Rendina, Ivo; Coppola, Giuseppe; Schonbrun, Ethan

    2016-01-01

    Microfluidic technology allows to realize devices in which cells can be imaged in their three-dimensional shape. However, there are still some limitations in the method, due to the fact that cells follow a straight path while they are flowing in a channel. This can result in a loss in information, since only one side of the cell will be visible. Our work has started from the consideration that if a cell rotates, it is possible to overcome this problem. Several approaches have been proposed for cell manipulation in microfluidics. In our approach, cells are controlled by only taking advantages of hydrodynamic forces. Two different devices have been designed, realized, and tested. The first device induces cell rotation in a plane that is parallel (in-plane) to the observation plane, while the second one induce rotation in a plane perpendicular (out-of-plane) to the observation plane. PMID:27548187

  10. Targeted modulation of cell differentiation in distinct regions of the gastrointestinal tract via oral administration of differently PEG-PEI functionalized mesoporous silica nanoparticles

    PubMed Central

    Desai, Diti; Prabhakar, Neeraj; Mamaeva, Veronika; Karaman, Didem Şen; Lähdeniemi, Iris AK; Sahlgren, Cecilia; Rosenholm, Jessica M; Toivola, Diana M

    2016-01-01

    Targeted delivery of drugs is required to efficiently treat intestinal diseases such as colon cancer and inflammation. Nanoparticles could overcome challenges in oral administration caused by drug degradation at low pH and poor permeability through mucus layers, and offer targeted delivery to diseased cells in order to avoid adverse effects. Here, we demonstrate that functionalization of mesoporous silica nanoparticles (MSNs) by polymeric surface grafts facilitates transport through the mucosal barrier and enhances cellular internalization. MSNs functionalized with poly(ethylene glycol) (PEG), poly(ethylene imine) (PEI), and the targeting ligand folic acid in different combinations are internalized by epithelial cells in vitro and in vivo after oral gavage. Functionalized MSNs loaded with γ-secretase inhibitors of the Notch pathway, a key regulator of intestinal progenitor cells, colon cancer, and inflammation, demonstrated enhanced intestinal goblet cell differentiation as compared to free drug. Drug-loaded MSNs thus remained intact in vivo, further confirmed by exposure to simulated gastric and intestinal fluids in vitro. Drug targeting and efficacy in different parts of the intestine could be tuned by MSN surface modifications, with PEI coating exhibiting higher affinity for the small intestine and PEI–PEG coating for the colon. The data highlight the potential of nanomedicines for targeted delivery to distinct regions of the tissue for strict therapeutic control. PMID:26855569

  11. Cardiac neural crest is dispensable for outflow tract septation in Xenopus.

    PubMed

    Lee, Young-Hoon; Saint-Jeannet, Jean-Pierre

    2011-05-01

    In vertebrate embryos, cardiac precursor cells of the primary heart field are specified in the lateral mesoderm. These cells converge at the ventral midline to form the linear heart tube, and give rise to the atria and the left ventricle. The right ventricle and the outflow tract are derived from an adjacent population of precursors known as the second heart field. In addition, the cardiac neural crest contributes cells to the septum of the outflow tract to separate the systemic and the pulmonary circulations. The amphibian heart has a single ventricle and an outflow tract with an incomplete spiral septum; however, it is unknown whether the cardiac neural crest is also involved in outflow tract septation, as in amniotes. Using a combination of tissue transplantations and molecular analyses in Xenopus we show that the amphibian outflow tract is derived from a second heart field equivalent to that described in birds and mammals. However, in contrast to what we see in amniotes, it is the second heart field and not the cardiac neural crest that forms the septum of the amphibian outflow tract. In Xenopus, cardiac neural crest cells remain confined to the aortic sac and arch arteries and never populate the outflow tract cushions. This significant difference suggests that cardiac neural crest cell migration into the cardiac cushions is an amniote-specific characteristic, presumably acquired to increase the mass of the outflow tract septum with the evolutionary need for a fully divided circulation.

  12. Alveolar epithelial cells are critical in protection of the respiratory tract by secretion of factors able to modulate the activity of pulmonary macrophages and directly control bacterial growth.

    PubMed

    Chuquimia, Olga D; Petursdottir, Dagbjort H; Periolo, Natalia; Fernández, Carmen

    2013-01-01

    The respiratory epithelium is a physical and functional barrier actively involved in the clearance of environmental agents. The alveolar compartment is lined with membranous pneumocytes, known as type I alveolar epithelial cells (AEC I), and granular pneumocytes, type II alveolar epithelial cells (AEC II). AEC II are responsible for epithelial reparation upon injury and ion transport and are very active immunologically, contributing to lung defense by secreting antimicrobial factors. AEC II also secrete a broad variety of factors, such as cytokines and chemokines, involved in activation and differentiation of immune cells and are able to present antigen to specific T cells. Another cell type important in lung defense is the pulmonary macrophage (PuM). Considering the architecture of the alveoli, a good communication between the external and the internal compartments is crucial to mount effective responses. Our hypothesis is that being in the interface, AEC may play an important role in transmitting signals from the external to the internal compartment and in modulating the activity of PuM. For this, we collected supernatants from AEC unstimulated or stimulated in vitro with lipopolysaccharide (LPS). These AEC-conditioned media were used in various setups to test for the effects on a number of macrophage functions: (i) migration, (ii) phagocytosis and intracellular control of bacterial growth, and (iii) phenotypic changes and morphology. Finally, we tested the direct effect of AEC-conditioned media on bacterial growth. We found that AEC-secreted factors had a dual effect, on one hand controlling bacterial growth and on the other hand increasing macrophage activity.

  13. Supramolecular Approaches to Nanoscale Morphological Control in Organic Solar Cells

    PubMed Central

    Haruk, Alexander M.; Mativetsky, Jeffrey M.

    2015-01-01

    Having recently surpassed 10% efficiency, solar cells based on organic molecules are poised to become a viable low-cost clean energy source with the added advantages of mechanical flexibility and light weight. The best-performing organic solar cells rely on a nanostructured active layer morphology consisting of a complex organization of electron donating and electron accepting molecules. Although much progress has been made in designing new donor and acceptor molecules, rational control over active layer morphology remains a central challenge. Long-term device stability is another important consideration that needs to be addressed. This review highlights supramolecular strategies for generating highly stable nanostructured organic photovoltaic active materials by design. PMID:26110382

  14. Therapeutic Approaches for Preserving or Restoring Pancreatic β-Cell Function and Mass

    PubMed Central

    Jung, Kyong Yeun; Kim, Kyoung Min

    2014-01-01

    The goal for the treatment of patients with diabetes has today shifted from merely reducing glucose concentrations to preventing the natural decline in β-cell function and delay the progression of disease. Pancreatic β-cell dysfunction and decreased β-cell mass are crucial in the development of diabetes. The β-cell defects are the main pathogenesis in patients with type 1 diabetes and are associated with type 2 diabetes as the disease progresses. Recent studies suggest that human pancreatic β-cells have a capacity for increased proliferation according to increased demands for insulin. In humans, β-cell mass has been shown to increase in patients showing insulin-resistance states such as obesity or in pregnancy. This capacity might be useful for identifying new therapeutic strategies to reestablish a functional β-cell mass. In this context, therapeutic approaches designed to increase β-cell mass might prove a significant way to manage diabetes and prevent its progression. This review describes the various β-cell defects that appear in patients with diabetes and outline the mechanisms of β-cell failure. We also review common methods for assessing β-cell function and mass and methodological limitations in vivo. Finally, we discuss the current therapeutic approaches to improve β-cell function and increase β-cell mass. PMID:25541605

  15. Cranberry and urinary tract infections.

    PubMed

    Guay, David R P

    2009-01-01

    Urinary tract infection (UTI) refers to the presence of clinical signs and symptoms arising from the genitourinary tract plus the presence of one or more micro-organisms in the urine exceeding a threshold value for significance (ranges from 102 to 103 colony-forming units/mL). Infections are localized to the bladder (cystitis), renal parenchyma (pyelonephritis) or prostate (acute or chronic bacterial prostatitis). Single UTI episodes are very common, especially in adult women where there is a 50-fold predominance compared with adult men. In addition, recurrent UTIs are also common, occurring in up to one-third of women after first-episode UTIs. Recurrences requiring intervention are usually defined as two or more episodes over 6 months or three or more episodes over 1 year (this definition applies only to young women with acute uncomplicated UTIs). A cornerstone of prevention of UTI recurrence has been the use of low-dose once-daily or post-coital antimicrobials; however, much interest has surrounded non-antimicrobial-based approaches undergoing investigation such as use of probiotics, vaccines, oligosaccharide inhibitors of bacterial adherence and colonization, and bacterial interference with immunoreactive extracts of Escherichia coli. Local (intravaginal) estrogen therapy has had mixed results to date. Cranberry products in a variety of formulations have also undergone extensive evaluation over several decades in the management of UTIs. At present, there is no evidence that cranberry can be used to treat UTIs. Hence, the focus has been on its use as a preventative strategy. Cranberry has been effective in vitro and in vivo in animals for the prevention of UTI. Cranberry appears to work by inhibiting the adhesion of type I and P-fimbriated uropathogens (e.g. uropathogenic E. coli) to the uroepithelium, thus impairing colonization and subsequent infection. The isolation of the component(s) of cranberry with this activity has been a daunting task, considering the

  16. Current approaches in evolution: from molecules to cells and organisms.

    PubMed

    Thattai, Mukund; Peisajovich, Sergio G

    2014-11-01

    This is an exciting time to be an evolutionary biologist. Indeed, it is difficult to keep up with all the studies that fall under the broad category of "Evolution" since they span species, traits, and scales of organization. This special issue gives a flavor of exciting new approaches in evolutionary biology, but also emphasizes universal themes. The reviews contained here discuss important aspects of molecular evolution at multiple scales, from individual proteins to complex regulatory networks, as well as from unicellular organisms to macroscopic traits in animals. Though the model systems are diverse, the issues addressed are fundamental: the origin of evolutionary novelties, and the forces that drive them to fixation.

  17. Syntactic processing depends on dorsal language tracts.

    PubMed

    Wilson, Stephen M; Galantucci, Sebastiano; Tartaglia, Maria Carmela; Rising, Kindle; Patterson, Dianne K; Henry, Maya L; Ogar, Jennifer M; DeLeon, Jessica; Miller, Bruce L; Gorno-Tempini, Maria Luisa

    2011-10-20

    Frontal and temporal language areas involved in syntactic processing are connected by several dorsal and ventral tracts, but the functional roles of the different tracts are not well understood. To identify which white matter tract(s) are important for syntactic processing, we examined the relationship between white matter damage and syntactic deficits in patients with primary progressive aphasia, using multimodal neuroimaging and neurolinguistic assessment. Diffusion tensor imaging showed that microstructural damage to left hemisphere dorsal tracts--the superior longitudinal fasciculus including its arcuate component--was strongly associated with deficits in comprehension and production of syntax. Damage to these dorsal tracts predicted syntactic deficits after gray matter atrophy was taken into account, and fMRI confirmed that these tracts connect regions modulated by syntactic processing. In contrast, damage to ventral tracts--the extreme capsule fiber system or the uncinate fasciculus--was not associated with syntactic deficits. Our findings show that syntactic processing depends primarily on dorsal language tracts.

  18. Comprehensive Metaproteomic Analyses of Urine in the Presence and Absence of Neutrophil-Associated Inflammation in the Urinary Tract.

    PubMed

    Yu, Yanbao; Sikorski, Patricia; Smith, Madeline; Bowman-Gholston, Cynthia; Cacciabeve, Nicolas; Nelson, Karen E; Pieper, Rembert

    2017-01-01

    Inflammation in the urinary tract results in a urinary proteome characterized by a high dynamic range of protein concentrations and high variability in protein content. This proteome encompasses plasma proteins not resorbed by renal tubular uptake, renal secretion products, proteins of immune cells and erythrocytes derived from trans-urothelial migration and vascular leakage, respectively, and exfoliating urothelial and squamous epithelial cells. We examined how such proteins partition into soluble urine (SU) and urinary pellet (UP) fractions by analyzing 33 urine specimens 12 of which were associated with a urinary tract infection (UTI). Using mass spectrometry-based metaproteomic approaches, we identified 5,327 non-redundant human proteins, 2,638 and 4,379 of which were associated with SU and UP fractions, respectively, and 1,206 non-redundant protein orthology groups derived from pathogenic and commensal organisms of the urogenital tract. Differences between the SU and UP proteomes were influenced by local inflammation, supported by respective comparisons with 12 healthy control urine proteomes. Clustering analyses showed that SU and UP fractions had proteomic signatures discerning UTIs, vascular injury, and epithelial cell exfoliation from the control group to varying degrees. Cases of UTI revealed clusters of proteins produced by activated neutrophils. Network analysis supported the central role of neutrophil effector proteins in the defense against invading pathogens associated with subsequent coagulation and wound repair processes. Our study expands the existing knowledge of the urinary proteome under perturbed conditions, and should be useful as reference dataset in the search of biomarkers.

  19. In vitro studies on the stability in the proximal gastrointestinal tract and bioaccessibility in Caco-2 cells of chlorogenic acids from spent coffee grounds.

    PubMed

    Monente, Carmen; Ludwig, Iziar A; Stalmach, Angelique; de Peña, Maria Paz; Cid, Concepción; Crozier, Alan

    2015-01-01

    Spent coffee grounds are a potential commercial source of substantial amounts of chlorogenic acids (CGAs). The aim of this study was to evaluate the stability of spent coffee CGAs using in vitro simulated gastroduodenal digestion and to investigate their potential absorption using an in vitro Caco-2 model of human small intestinal epithelium. During in vitro digestion, lactones were partially degraded while caffeoylquinic and feruloylquinic acids were much more stable. Transport and metabolism studies showed that 1% of the total CGAs were absorbed and transported from the apical to the basolateral side of a Caco-2 cell monolayer after 1 h. Lactones and coumaroylquinic acids showed the rate of highest absorption. Caco-2 cells possessed low metabolic activity. In conclusion, spent coffee extracts contain large amounts of CGAs, which remained bioaccessible across the intestinal barrier, albeit to a relatively low degree.

  20. Effects of subinhibitory amounts of ampicillin, amoxycillin and mecillinam on the adhesion of Escherichia coli bacteria to human urinary tract epithelial cells: a preliminary study.

    PubMed

    Svanborg-Edén, C; Sandberg, T; Stenqvist, K; Ahlstedt, S

    1979-01-01

    Attachment to mucous surfaces may be a prerequisite for bacteria colonizing these surfaces or invading underlying tissues. Subinhibitory amounts of ampicillin and amoxycillin but not mecillinam decreased the attachment of Escherichia coli bacteria to human uro-epithelial cells in vitro. No significant synergistic effect on the attachment by the antibiotics was obtained. The present report indicates a new parameter for the study of antibacterial actions of drugs.

  1. Interpolating U.S. Decennial Census Tract Data from as Early as 1970 to 2010: A Longtitudinal Tract Database

    PubMed Central

    Logan, John R.; Xu, Zengwang; Stults, Brian

    2013-01-01

    Differences in the reporting units of data from diverse sources and changes in units over time are common obstacles to analysis of areal data. We compare common approaches to this problem in the context of changes over time in the boundaries of U.S. census tracts. In every decennial census many tracts are split, consolidated, or changed in other ways from the previous boundaries to reflect population growth or decline. We examine two interpolation methods to create a bridge between years, one that relies only on areal weighting and another that also introduces population weights. Results demonstrate that these approaches produce substantially different estimates for variables that involve population counts, but they have a high degree of convergence for variables defined as rates or averages. Finally the paper describes the Longitudinal Tract Data Base (LTDB), through which we are making available public-use tools to implement these methods to create estimates within 2010 tract boundaries for any tract-level data (from the census or other sources) that are available for prior years as early as 1970. PMID:25140068

  2. Circulating tumor cells: approaches to isolation and characterization

    PubMed Central

    Yu, Min; Stott, Shannon; Toner, Mehmet; Maheswaran, Shyamala

    2011-01-01

    Circulating tumor cells (CTCs) shed from primary and metastatic cancers are admixed with blood components and are thus rare, making their isolation and characterization a major technological challenge. CTCs hold the key to understanding the biology of metastasis and provide a biomarker to noninvasively measure the evolution of tumor genotypes during treatment and disease progression. Improvements in technologies to yield purer CTC populations amenable to better cellular and molecular characterization will enable a broad range of clinical applications, including early detection of disease and the discovery of biomarkers to predict treatment responses and disease progression. PMID:21300848

  3. Management and treatment of mucosal melanoma of the genital tract.

    PubMed

    Vaccari, Sabina; Barisani, Alessia; Dika, Emi; Fanti, Pier A; DE Iaco, Pierandrea; Gurioli, Carlotta; Tosti, Giulio

    2017-01-24

    Melanoma of the genital mucosa is a rare melanocytic neoplasm that affects both sexes. The diagnosis is often delayed; a useful diagnostic tool may be represented by videodermatoscopy, The treatment is complex and multidisciplinary. We report the main diagnostic features and therapeutic approaches for mucosal melanoma of the genital tract.

  4. Experimental approaches to study plant cell walls during plant-microbe interactions.

    PubMed

    Xia, Ye; Petti, Carloalberto; Williams, Mark A; DeBolt, Seth

    2014-01-01

    Plant cell walls provide physical strength, regulate the passage of bio-molecules, and act as the first barrier of defense against biotic and abiotic stress. In addition to providing structural integrity, plant cell walls serve an important function in connecting cells to their extracellular environment by sensing and transducing signals to activate cellular responses, such as those that occur during pathogen infection. This mini review will summarize current experimental approaches used to study cell wall functions during plant-pathogen interactions. Focus will be paid to cell imaging, spectroscopic analyses, and metabolic profiling techniques.

  5. Live-cell Imaging Approaches for the Investigation of ...

    EPA Pesticide Factsheets

    BACKGROUND: Oxidant stress is arguably a universal feature in toxicology. Research studies on the role of oxidant stress induced by xenobiotic exposures have typically relied on the identification of damaged biomolecules using a variety of conventional biochemical and molecular techniques. However, there is increasing evidence that low-level exposure to a variety of toxicants dysregulates cellular physiology by interfering with redox-dependent processes.SCOPE OF REVIEW: The study of events involved in redox toxicology requires methodology capable of detecting transient modifications at relatively low signal strength. This article reviews the advantages of live-cell imaging for redox toxicology studies.MAJOR CONCLUSIONS: Toxicological studies with xenobiotics of supra-physiological reactivity require careful consideration when using fluorogenic sensors in order to avoid potential artifacts and false negatives. Fortunately, experiments conducted for the purpose of validating the use of these sensors in toxicological applications often yield unexpected insights into the mechanisms through which xenobiotic exposure induces oxidant stress.GENERAL SIGNIFICANCE: Live-cell imaging using a new generation of small molecule and genetically encoded fluorophores with excellent sensitivity and specificity affords unprecedented spatiotemporal resolution that is optimal for redox toxicology studies. This article is part of a Special Issue entitled Air Pollution, edited by Wenju

  6. The role of cell calcium in current approaches to toxicology.

    PubMed Central

    Pounds, J G

    1990-01-01

    All cells contain elaborate systems for the spatial and temporal regulation of the calcium ion, [Ca2+]i, and diverse Ca2+ receptor and biochemical response systems that are regulated by these changes in [Ca2+]i. Toxicants that perturb the mobilization or homeostasis of [Ca2+]i will place the regulation of these processes outside the normal range of physiological control. Many classes of chemical toxicants, including metals, solvents, and pesticides, may have particular aspects of cell calcium as key cellular and molecular targets of toxicant action. However, experimental proof of these targets as a specific site of toxicant action is challenging and technically difficult as a result of the complexity and diversity of these processes. To fully establish and understand the target role of the calcium messenger system in toxicant action, it is necessary to distinguish between the effects of a toxicant on (a) the calcium mobilization and homeostatic processes, (b) the calcium-mediated processes, and (c) from those processes which co-regulate or counter-regulate these calcium-mediated processes. As our understanding of the calcium messenger system expands, these insights will be increasingly applied to understanding the mechanisms of action of toxic chemicals. PMID:2190820

  7. Neutron Distribution in the Nuclear Fuel Cell using Collision Probability Method with Quadratic Flux Approach

    NASA Astrophysics Data System (ADS)

    Shafii, M. A.; Fitriyani, D.; Tongkukut, S. H. J.; Abdullah, A. G.

    2017-03-01

    To solve the integral neutron transport equation using collision probability (CP) method usually requires flat flux (FF) approach. In this research, it has been carried out in the cylindrical nuclear fuel cell with the spatial of mesh with quadratic flux approach. This means that the neutron flux at any region of the nuclear fuel cell is forced to follow the pattern of a quadratic function. The mechanism may be referred to as the process of non-flat flux (NFF) approach. The parameters that calculated in this study are the k-eff and the distribution of neutron flux. The result shows that all parameters are in accordance with the result of SRAC.

  8. Novel therapeutic approach to counter the recruitment of circulating endothelial progenitor cells to tumors.

    PubMed

    Espinoza, Luis R

    2006-11-01

    Evaluation of: Shaked Y, Ciarrocchi A, Franco M et al. Therapy-induced acute recruitment of circulating endothelial progenitor cells to tumors. Science 313, 1785-1787 (2006). Recently gathered evidence indicates that bone marrow-derived circulating endothelial progenitor cells can contribute to tumor angiogenesis and the growth of certain tumors. The paper under evaluation presents a novel therapeutic approach that disrupts the recruitment of these cells by tumors, therefore facilitating the antitumor activity of chemotherapeutic agents.

  9. Physiologic Status Monitoring via the Gastrointestinal Tract

    PubMed Central

    Schwartz, S.; Hughes, T.; Boettcher, T.; Barman, R.; Langer, R.; Swiston, A.

    2015-01-01

    Reliable, real-time heart and respiratory rates are key vital signs used in evaluating the physiological status in many clinical and non-clinical settings. Measuring these vital signs generally requires superficial attachment of physically or logistically obtrusive sensors to subjects that may result in skin irritation or adversely influence subject performance. Given the broad acceptance of ingestible electronics, we developed an approach that enables vital sign monitoring internally from the gastrointestinal tract. Here we report initial proof-of-concept large animal (porcine) experiments and a robust processing algorithm that demonstrates the feasibility of this approach. Implementing vital sign monitoring as a stand-alone technology or in conjunction with other ingestible devices has the capacity to significantly aid telemedicine, optimize performance monitoring of athletes, military service members, and first-responders, as well as provide a facile method for rapid clinical evaluation and triage. PMID:26580216

  10. Schwannoma of the biliary tract resembling cholangiocarcinoma: A case report and review

    PubMed Central

    Garcia Sanz, I; Muñoz de Nova, JL; Valdés de Anca, A; Martín Pérez, ME

    2016-01-01

    Schwannomas are benign tumours derived from Schwann cells and are extremely rare in the biliary tract. We present the case of a 62-year-old patient with a common bile duct schwannoma that resembled a cholangiocarcinoma. We also review all 17 previously published cases of schwannoma of the biliary tract and discuss the challenges of preoperative diagnosis. PMID:27269434

  11. Investigating the role of retinal Müller cells with approaches in genetics and cell biology.

    PubMed

    Fu, Suhua; Zhu, Meili; Ash, John D; Wang, Yunchang; Le, Yun-Zheng

    2014-01-01

    Müller cells are major macroglia and play many essential roles as a supporting cell in the retina. As Müller cells only constitute a small portion of retinal cells, investigating the role of Müller glia in retinal biology and diseases is particularly challenging. To overcome this problem, we first generated a Cre/lox-based conditional gene targeting system that permits the genetic manipulation and functional dissection of gene of interests in Müller cells. To investigate diabetes-induced alteration of Müller cells, we recently adopted methods to analyze Müller cells survival/death in vitro and in vivo. We also used normal and genetically altered primary cell cultures to reveal the mechanistic insights for Müller cells in biological and disease processes. In this article, we will discuss the applications and limitations of these methodologies, which may be useful for research in retinal Müller cell biology and pathophysiology.

  12. Dissecting the stem cell niche with organoid models: an engineering-based approach.

    PubMed

    Murrow, Lyndsay M; Weber, Robert J; Gartner, Zev J

    2017-03-15

    For many tissues, single resident stem cells grown in vitro under appropriate three-dimensional conditions can produce outgrowths known as organoids. These tissues recapitulate much of the cell composition and architecture of the in vivo organ from which they derive, including the formation of a stem cell niche. This has facilitated the systematic experimental manipulation and single-cell, high-throughput imaging of stem cells within their respective niches. Furthermore, emerging technologies now make it possible to engineer organoids from purified cellular and extracellular components to directly model and test stem cell-niche interactions. In this Review, we discuss how organoids have been used to identify and characterize stem cell-niche interactions and uncover new niche components, focusing on three adult-derived organoid systems. We also describe new approaches to reconstitute organoids from purified cellular components, and discuss how this technology can help to address fundamental questions about the adult stem cell niche.

  13. Modular Approach for Continuous Cell-Level Balancing to Improve Performance of Large Battery Packs: Preprint

    SciTech Connect

    Muneed ur Rehman, M.; Evzelman, M.; Hathaway, K.; Zane, R.; Plett, G. L.; Smith, K.; Wood, E.; Maksimovic, D.

    2014-10-01

    Energy storage systems require battery cell balancing circuits to avoid divergence of cell state of charge (SOC). A modular approach based on distributed continuous cell-level control is presented that extends the balancing function to higher level pack performance objectives such as improving power capability and increasing pack lifetime. This is achieved by adding DC-DC converters in parallel with cells and using state estimation and control to autonomously bias individual cell SOC and SOC range, forcing healthier cells to be cycled deeper than weaker cells. The result is a pack with improved degradation characteristics and extended lifetime. The modular architecture and control concepts are developed and hardware results are demonstrated for a 91.2-Wh battery pack consisting of four series Li-ion battery cells and four dual active bridge (DAB) bypass DC-DC converters.

  14. Genetic engineered molecular imaging probes for applications in cell therapy: emphasis on MRI approach

    PubMed Central

    Cho, In K; Wang, Silun; Mao, Hui; Chan, Anthony WS

    2016-01-01

    Recent advances in stem cell-based regenerative medicine, cell replacement therapy, and genome editing technologies (i.e. CRISPR-Cas 9) have sparked great interest in in vivo cell monitoring. Molecular imaging promises a unique approach to noninvasively monitor cellular and molecular phenomena, including cell survival, migration, proliferation, and even differentiation at the whole organismal level. Several imaging modalities and strategies have been explored for monitoring cell grafts in vivo. We begin this review with an introduction describing the progress in stem cell technology, with a perspective toward cell replacement therapy. The importance of molecular imaging in reporting and assessing the status of cell grafts and their relation to the local microenvironment is highlighted since the current knowledge gap is one of the major obstacles in clinical translation of stem cell therapy. Based on currently available imaging techniques, we provide a brief discussion on the pros and cons of each imaging modality used for monitoring cell grafts with particular emphasis on magnetic resonance imaging (MRI) and the reporter gene approach. Finally, we conclude with a comprehensive discussion of future directions of applying molecular imaging in regenerative medicine to emphasize further the importance of correlating cell graft conditions and clinical outcomes to advance regenerative medicine. PMID:27766183

  15. [Urinary tract infections in adults].

    PubMed

    Ali, Adel Ben; Bagnis, Corinne Isnard

    2014-09-01

    Urinary tract infections in adults are frequent and can induce several septic situations. Their economic cost (drugs, microbiologic samples, consultations and/or hospitalizations and stop working) and ecologic cost (second reasons of antibiotic prescription in winter and first in the rest of the year) are important. A better respect of recommendations can improve the outcome of this different infections and decrease their cost.

  16. Candida urinary tract infection: pathogenesis.

    PubMed

    Fisher, John F; Kavanagh, Kevin; Sobel, Jack D; Kauffman, Carol A; Newman, Cheryl A

    2011-05-01

    Candida species are unusual causes of urinary tract infection (UTI) in healthy individuals, but common in the hospital setting or among patients with predisposing diseases and structural abnormalities of the kidney and collecting system. The urinary tract may be invaded in either an antegrade fashion from the bloodstream or retrograde via the urethra and bladder. Candida species employ a repertoire of virulence factors, including phenotypic switching, dimorphism, galvano - and thigmotropism, and hydrolytic enzymes, to colonize and then invade the urinary tract. Antegrade infection occurs primarily among patients predisposed to candidemia. The process of adherence to and invasion of the glomerulus, renal blood vessels, and renal tubules by Candida species was elegantly described in early histopathologic studies. Armed with modern molecular biologic techniques, the various virulence factors involved in bloodborne infection of the kidney are gradually being elucidated. Disturbances of urine flow, whether congenital or acquired, instrumentation of the urinary tract, diabetes mellitus, antimicrobial therapy, and immunosuppression underlie most instances of retrograde Candida UTI. In addition, bacterial UTIs caused by Enterobacteriaceae may facilitate the initial step in the process. Ascending infections generally do not result in candidemia in the absence of obstruction.

  17. A bag of cells approach for antinuclear antibodies HEp-2 image classification.

    PubMed

    Wiliem, Arnold; Hobson, Peter; Minchin, Rodney F; Lovell, Brian C

    2015-06-01

    The antinuclear antibody (ANA) test via indirect immunofluorescence applied on Human Epithelial type 2 (HEp-2) cells is a pathology test commonly used to identify connective tissue diseases (CTDs). Despite its effectiveness, the test is still considered labor intensive and time consuming. Applying image-based computer aided diagnosis (CAD) systems is one of the possible ways to address these issues. Ideally, a CAD system should be able to classify ANA HEp-2 images taken by a camera fitted to a fluorescence microscope. Unfortunately, most prior works have primarily focused on the HEp-2 cell image classification problem which is one of the early essential steps in the system pipeline. In this work we directly tackle the specimen image classification problem. We aim to develop a system that can be easily scaled and has competitive accuracy. ANA HEp-2 images or ANA images are generally comprised of a number of cells. Patterns exhibiting in the cells are then used to make inference on the ANA image pattern. To that end, we adapted a popular approach for general image classification problems, namely a bag of visual words approach. Each specimen is considered as a visual document containing visual vocabularies represented by its cells. A specimen image is then represented by a histogram of visual vocabulary occurrences. We name this approach as the Bag of Cells approach. We studied the performance of the proposed approach on a set of images taken from 262 ANA positive patient sera. The results show the proposed approach has competitive performance compared to the recent state-of-the-art approaches. Our proposal can also be expanded to other tests involving examining patterns of human cells to make inferences.

  18. Emergence of Form from Function - Mechanical Engineering Approaches to Probe the Role of Stem Cell Mechanoadaptation in Sealing Cell Fate.

    PubMed

    Knothe Tate, Melissa L; Gunning, Peter W; Sansalone, Vittorio

    2016-10-14

    Stem cell "mechanomics" refers to the effect of mechanical cues on stem cell and matrix biology, where cell shape and fate are intrinsic manifestations of form and function. Before specialization, the stem cell itself serves as a sensor and actuator; its structure emerges from its local mechanical milieu as the cell adapts over time. Coupling of novel spatiotemporal imaging and computational methods allows for linking of the energy of adaptation to the structure, biology and mechanical function of the cell. Cutting edge imaging methods enable probing of mechanisms by which stem cells' emergent anisotropic architecture and fate commitment occurs. A novel cell-scale model provides a mechanistic framework to describe stem cell growth and remodeling through mechanical feedback; making use of a generalized virtual power principle, the model accounts for the rate of doing work or the rate of using energy to effect the work. This coupled approach provides a basis to elucidate mechanisms underlying the stem cell's innate capacity to adapt to mechanical stimuli as well as the role of mechanoadaptation in lineage commitment. An understanding of stem cell mechanoadaptation is key to deciphering lineage commitment, during prenatal development, postnatal wound healing, and engineering of tissues.

  19. The Olfactory Receptor OR51E1 Is Present along the Gastrointestinal Tract of Pigs, Co-Localizes with Enteroendocrine Cells and Is Modulated by Intestinal Microbiota

    PubMed Central

    Priori, Davide; Colombo, Michela; Clavenzani, Paolo; Jansman, Alfons J. M.; Lallès, Jean-Paul; Trevisi, Paolo; Bosi, Paolo

    2015-01-01

    The relevance of the butyrate-sensing olfactory receptor OR51E1 for gastrointestinal (GIT) functioning has not been considered so far. We investigated in young pigs the distribution of OR51E1 along the GIT, its relation with some endocrine markers, its variation with age and after interventions affecting the gut environment and intestinal microbiota. Immuno-reactive cells for OR51E1 and chromogranin A (CgA) were counted in cardial (CA), fundic (FU), pyloric (PL) duodenal (DU), jejunal (JE), ileal (IL), cecal (CE), colonic (CO) and rectal (RE) mucosae. OR51E1 co-localization with serotonin (5HT) and peptide YY (PYY) were evaluated in PL and CO respectively. FU and PL tissues were also sampled from 84 piglets reared from sows receiving either or not oral antibiotics (amoxicillin) around parturition, and sacrificed at days 14, 21, 28 (weaning) and 42 of age. JE samples were also obtained from 12 caesarean-derived piglets that were orally associated with simple (SA) or complex (CA) microbiota in the postnatal phase, and of which on days 26–37 of age jejunal loops were perfused for 8 h with enterotoxigenic Escherichia coli F4 (ETEC), Lactobacillus amylovorus or saline (CTRL). Tissue densities of OR51E1+ cells were in decreasing order: PL=DU>FU=CA>JE=IL=CE=CO=RE. OR51E1+ cells showed an enteroendocrine nature containing gastrointestinal hormones such as PYY or 5HT. OR51E1 gene expression in PL and FU increased during and after the suckling period (p<0.05). It was marginally reduced in offspring from antibiotic-treated sows (tendency, p=0.073), vs. control. Jejunal OR51E1 gene expression was reduced in piglets early associated with SA, compared with CA, and in ETEC-perfused loops vs. CTRL (p<0.01). Our results indicate that OR51E1 is related to GIT enteroendocrine activity. Moreover age, pathogen challenge and dietary manipulations influencing the gastrointestinal luminal microenvironment significantly affect the OR51E1 gene expression in GIT tissues presumably in

  20. Tract-based Spatial Statistics and fMRI Analysis in Patients with Small Cell Lung Cancer before Prophylactic Cranial Irradiation

    NASA Astrophysics Data System (ADS)

    Benezi, S.; Bromis, K.; Karavasilis, E.; Karanasiou, I. S.; Koutsoupidou, M.; Matsopoulos, G.; Ventouras, E.; Uzunoglu, N.; Kouloulias, V.; Papathanasiou, M.; Foteineas, A.; Efstathopoulos, E.; Kelekis, N.; Kelekis, D.

    2015-09-01

    Prophylactic cranial irradiation (PCI) is known to increase life expectancy to a significant degree in Small Cell Lung Cancer (SCLC) patients. The overall scope of this research is to investigate changes in structural and functional connectivity between SCLC patients and controls before and after PCI treatment. In the current study specifically we use diffusion tensor imaging (DTI) and functional Magnetic Resonance (fMRI) to identify potential alterations in white matter structure and brain function respectively, in SCLC patients before PCI compared to healthy participants. The results in DTI analysis have showed lower fractional anisotropy (FA) and higher eigenvalues in white matter regions in the patient group. Similarly, in fMRI analysis a lower level of activation in the primary somatosensory cortex was reported. The results presented herein are subject to further investigation with larger patient and control groups.

  1. Binding of hnRNP H and U2AF65 to Respective G-codes and a Poly-Uridine Tract Collaborate in the N50-5'ss Selection of the REST N Exon in H69 Cells

    PubMed Central

    Ortuño-Pineda, Carlos; Galindo-Rosales, José Manuel; Calderón-Salinas, José Victor; Villegas-Sepúlveda, Nicolás; Saucedo-Cárdenas, Odila; De Nova-Ocampo, Mónica; Valdés, Jesús

    2012-01-01

    The splicing of the N exon in the pre-mRNA coding for the RE1-silencing transcription factor (REST) results in a truncated protein that modifies the expression pattern of some of its target genes. A weak 3'ss, three alternative 5'ss (N4-, N50-, and N62-5'ss) and a variety of putative target sites for splicing regulatory proteins are found around the N exon; two GGGG codes (G2-G3) and a poly-Uridine tract (N-PU) are found in front of the N50-5'ss. In this work we analyzed some of the regulatory factors and elements involved in the preferred selection of the N50-5'ss (N50 activation) in the small cell lung cancer cell line H69. Wild type and mutant N exon/β-globin minigenes recapitulated N50 exon splicing in H69 cells, and showed that the N-PU and the G2-G3 elements are required for N50 exon splicing. Biochemical and knockdown experiments identified these elements as U2AF65 and hnRNP H targets, respectively, and that they are also required for N50 exon activation. Compared to normal MRC5 cells, and in keeping with N50 exon activation, U2AF65, hnRNP H and other splicing factors were highly expressed in H69 cells. CLIP experiments revealed that hnRNP H RNA-binding occurs first and is a prerequisite for U2AF65 RNA binding, and EMSA and CLIP experiments suggest that U2AF65-RNA recognition displaces hnRNP H and helps to recruit other splicing factors (at least U1 70K) to the N50-5'ss. Our results evidenced novel hnRNP H and U2AF65 functions: respectively, U2AF65-recruiting to a 5'ss in humans and the hnRNP H-displacing function from two juxtaposed GGGG codes. PMID:22792276

  2. Approaches for Analyzing the Roles of Mast Cells and Their Proteases In Vivo

    PubMed Central

    Galli, Stephen J.; Tsai, Mindy; Marichal, Thomas; Tchougounova, Elena; Reber, Laurent L.; Pejler, Gunnar

    2016-01-01

    The roles of mast cells in health and disease remain incompletely understood. While the evidence that mast cells are critical effector cells in IgE-dependent anaphylaxis and other acute IgE-mediated allergic reactions seems unassailable, studies employing various mice deficient in mast cells or mast cell-associated proteases have yielded divergent conclusions about the roles of mast cells or their proteases in certain other immunological responses. Such “controversial” results call into question the relative utility of various older versus newer approaches to ascertain the roles of mast cells and mast cell proteases in vivo. This review discusses how both older and more recent mouse models have been used to investigate the functions of mast cells and their proteases in health and disease. We particularly focus on settings in which divergent conclusions about the importance of mast cells and their proteases have been supported by studies that employed different models of mast cell or mast cell protease deficiency. We think that two major conclusions can be drawn from such findings: (1) no matter which models of mast cell or mast cell protease deficiency one employs, the conclusions drawn from the experiments always should take into account the potential limitations of the models (particularly abnormalities affecting cell types other than mast cells) and (2) even when analyzing a biological response using a single model of mast cell or mast cell protease deficiency, details of experimental design are critical in efforts to define those conditions under which important contributions of mast cells or their proteases can be identified. PMID:25727288

  3. The formation and function of the female reproductive tract in flowering plants.

    PubMed

    Crawford, Brian C W; Yanofsky, Martin F

    2008-10-28

    In angiosperms, sexual reproduction requires a sperm cell, contained within a pollen tube, to fertilize the egg cell. The pollen tubes are capable of growth but have a difficult journey, as egg cells are buried within the ovary of the carpel. Several tissues, known collectively as the reproductive tract, develop within the carpel to facilitate the journey of the pollen tube. The genes involved in the formation and function of the reproductive tract have largely remained a mystery but are crucial for successful fertilization. This review summarizes recent advances in our understanding of the genetic control of reproductive tract development.

  4. Kidneys and Urinary Tract (For Parents)

    MedlinePlus

    ... younger than 6 years old and affects more boys than girls. It's often treated with steroids. Urinary tract infections ( ... tract (the bladder and urethra). UTIs affect both boys and girls, but in school-age children, girls are more ...

  5. Urinary Tract Infections (UTIs) in Children

    MedlinePlus

    ... tract where stool is changed from liquid to solid. The bacterium Escherichia coli (E. coli) causes most ... tract where stool is changed from liquid to solid. Any child can get a UTI, though girls ...

  6. Computed tomography of the gastrointestinal tract

    SciTech Connect

    Meyers, M.A.

    1986-01-01

    This volume presents computed tomography of the major disease states involving the gastrointestinal tract, mesentery, and peritoneal cavity. Computed Tomography of the Gastrointestinal Tract combined experience of l5 authorities includes illustrations (most of these radiographs).

  7. Lymphopenia is detrimental to therapeutic approaches to type 1 diabetes using regulatory T cells.

    PubMed

    Ash, Shifra; Yarkoni, Shai; Askenasy, Nadir

    2014-01-01

    One of the therapeutic approaches to type 1 diabetes (T1D) focuses on enhancement of regulatory T cell (Treg) activity, either by adoptive transfer or supplementation of supporting cytokines such as interleukin-2 (IL-2). In principle, this therapeutic design would greatly benefit of concomitant reduction in pathogenic cell burden. Experimental evidence indicates that physiological recovery from lymphopenia is dominated by evolution of effector and cytotoxic cells, which abolishes the therapeutic efficacy of Treg cells. Targeted and selective depletion of effector T cells has been achieved with killer Treg using Fas ligand protein and a fusion protein composed of IL-2 and caspase-3, which showed remarkable efficacy in modulating the course of inflammatory insulitis in NOD mice. We emphasize a critical consideration in design of therapeutic approaches to T1D, immunomodulation without lymphoreduction to avoid the detrimental consequences of rebound recovery from lymphopenia.

  8. Controlled Positioning of Cells in Biomaterials—Approaches Towards 3D Tissue Printing

    PubMed Central

    Wüst, Silke; Müller, Ralph; Hofmann, Sandra

    2011-01-01

    Current tissue engineering techniques have various drawbacks: they often incorporate uncontrolled and imprecise scaffold geometries, whereas the current conventional cell seeding techniques result mostly in random cell placement rather than uniform cell distribution. For the successful reconstruction of deficient tissue, new material engineering approaches have to be considered to overcome current limitations. An emerging method to produce complex biological products including cells or extracellular matrices in a controlled manner is a process called bioprinting or biofabrication, which effectively uses principles of rapid prototyping combined with cell-loaded biomaterials, typically hydrogels. 3D tissue printing is an approach to manufacture functional tissue layer-by-layer that could be transplanted in vivo after production. This method is especially advantageous for stem cells since a controlled environment can be created to influence cell growth and differentiation. Using printed tissue for biotechnological and pharmacological needs like in vitro drug-testing may lead to a revolution in the pharmaceutical industry since animal models could be partially replaced by biofabricated tissues mimicking human physiology and pathology. This would not only be a major advancement concerning rising ethical issues but would also have a measureable impact on economical aspects in this industry of today, where animal studies are very labor-intensive and therefore costly. In this review, current controlled material and cell positioning techniques are introduced highlighting approaches towards 3D tissue printing. PMID:24956301

  9. Controlled Positioning of Cells in Biomaterials-Approaches Towards 3D Tissue Printing.

    PubMed

    Wüst, Silke; Müller, Ralph; Hofmann, Sandra

    2011-08-04

    Current tissue engineering techniques have various drawbacks: they often incorporate uncontrolled and imprecise scaffold geometries, whereas the current conventional cell seeding techniques result mostly in random cell placement rather than uniform cell distribution. For the successful reconstruction of deficient tissue, new material engineering approaches have to be considered to overcome current limitations. An emerging method to produce complex biological products including cells or extracellular matrices in a controlled manner is a process called bioprinting or biofabrication, which effectively uses principles of rapid prototyping combined with cell-loaded biomaterials, typically hydrogels. 3D tissue printing is an approach to manufacture functional tissue layer-by-layer that could be transplanted in vivo after production. This method is especially advantageous for stem cells since a controlled environment can be created to influence cell growth and differentiation. Using printed tissue for biotechnological and pharmacological needs like in vitro drug-testing may lead to a revolution in the pharmaceutical industry since animal models could be partially replaced by biofabricated tissues mimicking human physiology and pathology. This would not only be a major advancement concerning rising ethical issues but would also have a measureable impact on economical aspects in this industry of today, where animal studies are very labor-intensive and therefore costly. In this review, current controlled material and cell positioning techniques are introduced highlighting approaches towards 3D tissue printing.

  10. Implications for a Stem Cell Regenerative Medicine Based Approach to Human Intervertebral Disk Degeneration

    PubMed Central

    Kraus, Petra; Lufkin, Thomas

    2017-01-01

    The human body develops from a single cell, the zygote, the product of the maternal oocyte and the paternal spermatozoon. That 1-cell zygote embryo will divide and eventually grow into an adult human which is comprised of ~3.7 × 1013 cells. The tens of trillions of cells in the adult human can be classified into approximately 200 different highly specialized cell types that make up all of the different tissues and organs of the human body. Regenerative medicine aims to replace or restore dysfunctional cells, tissues and organs with fully functional ones. One area receiving attention is regeneration of the intervertebral discs (IVDs), which are located between the vertebrae and function to give flexibility and support load to the spine. Degenerated discs are a major cause of lower back pain. Different stem cell based regenerative medicine approaches to cure disc degeneration are now available, including using autologous mesenchymal stem cells (MSCs), induced pluripotent stem cells (iPSCs) and even attempts at direct transdifferentiation of somatic cells. Here we discuss some of the recent advances, successes, drawbacks, and the failures of the above-mentioned approaches. PMID:28326305

  11. Implications for a Stem Cell Regenerative Medicine Based Approach to Human Intervertebral Disk Degeneration.

    PubMed

    Kraus, Petra; Lufkin, Thomas

    2017-01-01

    The human body develops from a single cell, the zygote, the product of the maternal oocyte and the paternal spermatozoon. That 1-cell zygote embryo will divide and eventually grow into an adult human which is comprised of ~3.7 × 10(13) cells. The tens of trillions of cells in the adult human can be classified into approximately 200 different highly specialized cell types that make up all of the different tissues and organs of the human body. Regenerative medicine aims to replace or restore dysfunctional cells, tissues and organs with fully functional ones. One area receiving attention is regeneration of the intervertebral discs (IVDs), which are located between the vertebrae and function to give flexibility and support load to the spine. Degenerated discs are a major cause of lower back pain. Different stem cell based regenerative medicine approaches to cure disc degeneration are now available, including using autologous mesenchymal stem cells (MSCs), induced pluripotent stem cells (iPSCs) and even attempts at direct transdifferentiation of somatic cells. Here we discuss some of the recent advances, successes, drawbacks, and the failures of the above-mentioned approaches.

  12. Overview of retinal differentiation potential of mesenchymal stem cells: A promising approach for retinal cell therapy.

    PubMed

    Salehi, Hossein; Amirpour, Noushin; Razavi, Shahnaz; Esfandiari, Ebrahim; Zavar, Reihaneh

    2017-03-01

    Retinal disease caused by retinal cell apoptosis leads to irreversible vision loss. Stem cell investigation efforts have been made to solve and cure retinal disorders. There are several sources of stem cells which have been used in these experiments. Numerous studies demonstrated that transplanted stem cells can migrate into and integrate in different layers of retina. Among these, mesenchymal stem cells (MSCs) were considered a promising source for cell therapy. Here, we review the literature assessing the potential of MSCs to differentiate into retinal cells in vivo and in vitro as well as their clinical application. However, more investigation is required to define the protocols that optimize stem cell differentiation and their functional integration in the retina.

  13. Identifying endogenous neural stem cells in the adult brain in vitro and in vivo: novel approaches.

    PubMed

    Rueger, Maria Adele; Androutsellis-Theotokis, Andreas

    2013-01-01

    In the 1960s, Joseph Altman reported that the adult mammalian brain is capable of generating new neurons. Today it is understood that some of these neurons are derived from uncommitted cells in the subventricular zone lining the lateral ventricles, and the dentate gyrus of the hippocampus. The first area generates new neuroblasts which migrate to the olfactory bulb, whereas hippocampal neurogenesis seems to play roles in particular types of learning and memory. A part of these uncommitted (immature) cells is able to divide and their progeny can generate all three major cell types of the nervous system: neurons, astrocytes, and oligodendrocytes; these properties define such cells as neural stem cells. Although the roles of these cells are not yet clear, it is accepted that they affect functions including olfaction and learning/memory. Experiments with insults to the central nervous system also show that neural stem cells are quickly mobilized due to injury and in various disorders by proliferating, and migrating to injury sites. This suggests a role of endogenous neural stem cells in disease. New pools of stem cells are being discovered, suggesting an even more important role for these cells. To understand these cells and to coax them to contribute to tissue repair it would be very useful to be able to image them in the living organism. Here we discuss advances in imaging approaches as well as new concepts that emerge from stem cell biology with emphasis on the interface between imaging and stem cells.

  14. Marijuana: respiratory tract effects.

    PubMed

    Owen, Kelly P; Sutter, Mark E; Albertson, Timothy E

    2014-02-01

    Marijuana is the most commonly used drug of abuse in the USA. It is commonly abused through inhalation and therefore has effects on the lung that are similar to tobacco smoke, including increased cough, sputum production, hyperinflation, and upper lobe emphysematous changes. However, at this time, it does not appear that marijuana smoke contributes to the development of chronic obstructive pulmonary disease. Marijuana can have multiple physiologic effects such as tachycardia, peripheral vasodilatation, behavioral and emotional changes, and possible prolonged cognitive impairment. The carcinogenic effects of marijuana are unclear at this time. Studies are mixed on the ability of marijuana smoke to increase the risk for head and neck squamous cell carcinoma, lung cancer, prostate cancer, and cervical cancer. Some studies show that marijuana is protective for development of malignancy. Marijuana smoke has been shown to have an inhibitory effect on the immune system. Components of cannabis are under investigation as treatment for autoimmune diseases and malignancy. As marijuana becomes legalized in many states for medical and recreational use, other forms of tetrahydrocannabinol (THC) have been developed, such as food products and beverages. As most research on marijuana at this time has been on whole marijuana smoke, rather than THC, it is difficult to determine if the currently available data is applicable to these newer products.

  15. A Mathematical and Computational Approach for Integrating the Major Sources of Cell Population Heterogeneity

    PubMed Central

    Stamatakis, Michail; Zygourakis, Kyriacos

    2010-01-01

    Several approaches have been used in the past to model heterogeneity in bacterial cell populations, with each approach focusing on different source(s) of heterogeneity. However, a holistic approach that integrates all the major sources into a comprehensive framework applicable to cell populations is still lacking. In this work we present the mathematical formulation of a cell population master equation (CPME) that describes cell population dynamics and takes into account the major sources of heterogeneity, namely stochasticity in reaction, DNA-duplication, and division, as well as the random partitioning of species contents into the two daughter cells. The formulation also takes into account cell growth and respects the discrete nature of the molecular contents and cell numbers. We further develop a Monte Carlo algorithm for the simulation of the stochastic processes considered here. To benchmark our new framework, we first use it to quantify the effect of each source of heterogeneity on the intrinsic and the extrinsic phenotypic variability for the well-known two-promoter system used experimentally by Elowitz et al. (2002). We finally apply our framework to a more complicated system and demonstrate how the interplay between noisy gene expression and growth inhibition due to protein accumulation at the single cell level can result in complex behavior at the cell population level. The generality of our framework makes it suitable for studying a vast array of artificial and natural genetic networks. Using our Monte Carlo algorithm, cell population distributions can be predicted for the genetic architecture of interest, thereby quantifying the effect of stochasticity in intracellular reactions or the variability in the rate of physiological processes such as growth and division. Such in silico experiments can give insight into the behavior of cell populations and reveal the major sources contributing to cell population heterogeneity. PMID:20685607

  16. Introducing the Cell Concept with Both Animal and Plant Cells: A Historical and Didactic Approach

    ERIC Educational Resources Information Center

    Clement, Pierre

    2007-01-01

    In France, as well as in several other countries, the cell concept is introduced at school by two juxtaposed drawings, a plant cell and an animal cell. After indicating the didactic obstacles associated with this presentation, this paper focuses on the reasons underlying the persistence of these two prototypes, through three complementary…

  17. [Kidney and urinary tract diseases in pregnancy].

    PubMed

    Sulser, T; John, H; Zimmermann, R

    1999-10-01

    Management of urologic disorders in pregnant patients often increases the anxiety of all involved. Based on a thorough understanding of the physiologic changes seen in various organ systems the urologist has to assume the responsibility for the well-being of the mother and the fetus. Apart from the urinary tract infection, which occurs as frequent as in non-pregnant patients but has a significantly higher risk of acute bacterial pyelonephritis, it is mainly the pregnancy-associated symptomatic hydronephrosis and the urolithiasis which are complicating approximately 1 of every 1000-1500 pregnancies. Urinary tract infections should be treated in any case by antibiotics according to a antibiogram. High risk patients with history of vesicoureteral reflux or recurrent pyelonephritis should be treated prophylactically. Following parturition these patients should be investigated urologically to exclude structural abnormalities of the genitourinary system. In case of symptomatic hydronephrosis and calculous disease the first approach should be a watchful conservatism with symptomatic relief. If the symptoms persist insertion of a double-J-stent or in case of live-threatening situations (e.g. urosepsis) when urgent decompression and rapid evacuation is mandatory a percutaneous nephrostomy can be brought in place under sonographic monitoring completely thereby avoiding any radiation exposure.

  18. A statistical approach to determining criticality of residual host cell DNA.

    PubMed

    Yang, Harry; Wei, Ziping; Schenerman, Mark

    2015-01-01

    We propose a method for determining the criticality of residual host cell DNA, which is characterized through two attributes, namely the size and amount of residual DNA in biopharmaceutical product. By applying a mechanistic modeling approach to the problem, we establish the linkage between residual DNA and product safety measured in terms of immunogenicity, oncogenicity, and infectivity. Such a link makes it possible to establish acceptable ranges of residual DNA size and amount. Application of the method is illustrated through two real-life examples related to a vaccine manufactured in Madin Darby Canine Kidney cell line and a monoclonal antibody using Chinese hamster ovary (CHO) cell line as host cells.

  19. Economic 3D-printing approach for transplantation of human stem cell-derived β-like cells.

    PubMed

    Song, Jiwon; Millman, Jeffrey R

    2016-12-01

    Transplantation of human pluripotent stem cells (hPSC) differentiated into insulin-producing β cells is a regenerative medicine approach being investigated for diabetes cell replacement therapy. This report presents a multifaceted transplantation strategy that combines differentiation into stem cell-derived β (SC-β) cells with 3D printing. By modulating the parameters of a low-cost 3D printer, we created a macroporous device composed of polylactic acid (PLA) that houses SC-β cell clusters within a degradable fibrin gel. Using finite element modeling of cellular oxygen diffusion-consumption and an in vitro culture system that allows for culture of devices at physiological oxygen levels, we identified cluster sizes that avoid severe hypoxia within 3D-printed devices and developed a microwell-based technique for resizing clusters within this range. Upon transplantation into mice, SC-β cell-embedded 3D-printed devices function for 12 weeks, are retrievable, and maintain structural integrity. Here, we demonstrate a novel 3D-printing approach that advances the use of differentiated hPSC for regenerative medicine applications and serves as a platform for future transplantation strategies.

  20. Single-cell technologies are revolutionizing the approach to rare cells.

    PubMed

    Proserpio, Valentina; Lönnberg, Tapio

    2016-03-01

    In the last lustrum single-cell techniques such as single-cell quantitative PCR, RNA and DNA sequencing, and the state-of-the-art cytometry by time of flight (CyTOF) mass cytometer have allowed a detailed analysis of the sub-composition of different organs from the bone marrow hematopoietic compartment to the brain. These fine-grained analyses have highlighted the great heterogeneity within each cell compartment revealing previously unknown subpopulations of cells. In this review, we analyze how this fast technological evolution has improved our understanding of the biological processes with a particular focus on rare cells of the immune system.

  1. Mesenchymal stem cells derived in vitro transdifferentiated insulin-producing cells: A new approach to treat type 1 diabetes.

    PubMed

    Dave, Shruti

    2014-01-01

    The pathophysiology of type 1 diabetes mellitus (T1DM) is largely related to an innate defect in the immune system culminating in a loss of self-tolerance and destruction of the insulin-producing β-cells. Currently, there is no definitive cure for T1DM. Insulin injection does not mimic the precise regulation of β-cells on glucose homeostasis, leading long term to the development of complications. Stem cell therapy is a promising approach and specifically mesenchymal stem cells (MSCs) offer a promising possibility that deserves to be explored further. MSCs are multipotent, nonhematopoietic progenitors. They have been explored as an treatment option in tissue regeneration as well as potential of in vitro transdifferentiation into insulin-secreting cells. Thus, the major therapeutic goals for T1DM have been achieved in this way. The regenerative capabilities of MSCs have been a driving force to initiate studies testing their therapeutic effectiveness; their immunomodulatory properties have been equally exciting; which would appear capable of disabling immune dysregulation that leads to β-cell destruction in T1DM. Furthermore, MSCs can be cultured under specially defined conditions, their transdifferentiation can be directed toward the β-cell phenotype, and the formation of insulin-producing cells (IPCs) can be targeted. To date, the role of MSCs-derived IPC in T1DM-a unique approach with some positive findings-have been unexplored, but it is still in its very early phase. In this study, a new approach of MSCs-derived IPCs, as a potential therapeutic benefit for T1DM in experimental animal models as well as in humans has been summarized.

  2. Innovative Dental Stem Cell-Based Research Approaches: The Future of Dentistry

    PubMed Central

    Mitsiadis, Thimios A.

    2016-01-01

    Over the past decade, the dental field has benefited from recent findings in stem cell biology and tissue engineering that led to the elaboration of novel ideas and concepts for the regeneration of dental tissues or entire new teeth. In particular, stem cell-based regenerative approaches are extremely promising since they aim at the full restoration of lost or damaged tissues, ensuring thus their functionality. These therapeutic approaches are already applied with success in clinics for the regeneration of other organs and consist of manipulation of stem cells and their administration to patients. Stem cells have the potential to self-renew and to give rise to a variety of cell types that ensure tissue repair and regeneration throughout life. During the last decades, several adult stem cell populations have been isolated from dental and periodontal tissues, characterized, and tested for their potential applications in regenerative dentistry. Here we briefly present the various stem cell-based treatment approaches and strategies that could be translated in dental practice and revolutionize dentistry. PMID:27648076

  3. A new approach to the internal thermal management of cylindrical battery cells for automotive applications

    NASA Astrophysics Data System (ADS)

    Worwood, Daniel; Kellner, Quirin; Wojtala, Malgorzata; Widanage, W. D.; McGlen, Ryan; Greenwood, David; Marco, James

    2017-04-01

    Conventional cooling approaches that target either a singular tab or outer surface of common format cylindrical lithium-ion battery cells suffer from a high cell thermal resistance. Under an aggressive duty cycle, this resistance can result in the formation of large in-cell temperature gradients and high hot spot temperatures, which are known to accelerate ageing and further reduce performance. In this paper, a novel approach to internal thermal management of cylindrical battery cells to lower the thermal resistance for heat transport through the inside of the cell is investigated. The effectiveness of the proposed method is analysed for two common cylindrical formats when subject to highly aggressive electrical loading conditions representative of a high performance electric vehicle (EV) and hybrid electric vehicle (HEV). A mathematical model that captures the dominant thermal properties of the cylindrical cell is created and validated using experimental data. Results from the extensive simulation study indicate that the internal cooling strategy can reduce the cell thermal resistance by up to 67.8 ± 1.4% relative to single tab cooling, and can emulate the performance of a more complex pack-level double tab cooling approach whilst targeting cooling at a single tab.

  4. Proteomic analysis as a means to approach limbal stem cell biology in a search for stem cell markers.

    PubMed

    Honoré, Bent; Vorum, Henrik

    2014-04-01

    The cornea consists of three main layers: an outer surface epithelium, the stroma, and the endothelium. A clear cornea is necessary for optimal vision and is maintained and repaired from limbal epithelial stem cells located in the limbus between the cornea and the sclera. Diseases and injury may result in deficiency of the stem cells impairing their ability to renew the corneal epithelium. Patients with limbal stem cell deficiency experience chronic pain and ultimately blindness. Attempts to treat the disease are based on replacement of the stem cells by transplantation or by culturing the stem cells. We here review the proteomic techniques that so far have been used to approach characterization of limbal stem cells and markers to identify them. It is apparent that the field is in a rather inchoate state due to the scarcity and relative inaccessibility of the stem cells. However, the importance of revealing limbal stem cell biology and identifying stem cell biomarkers calls for greater use of emerging methodology. Strategies for future studies are discussed.

  5. Improving efficiency of human pluripotent stem cell differentiation platforms using an integrated experimental and computational approach.

    PubMed

    Selekman, Joshua A; Das, Amritava; Grundl, Nicholas J; Palecek, Sean P

    2013-11-01

    Human pluripotent stem cells (hPSCs) have an unparalleled potential for tissue engineering applications including regenerative therapies and in vitro cell-based models for studying normal and diseased tissue morphogenesis, or drug and toxicological screens. While numerous hPSC differentiation methods have been developed to generate various somatic cell types, the potential of hPSC-based technologies is hinged on the ability to translate these established lab-scale differentiation systems to large-scale processes to meet the industrial and clinical demands for these somatic cell types. Here, we demonstrate a strategy for investigating the efficiency and scalability of hPSC differentiation platforms. Using two previously reported epithelial differentiation systems as models, we fit an ODE-based kinetic model to data representing dynamics of various cell subpopulations present in our culture. This fit was performed by estimating rate constants of each cell subpopulation's cell fate decisions (self-renewal, differentiation, death). Sensitivity analyses on predicted rate constants indicated which cell fate decisions had the greatest impact on overall epithelial cell yield in each differentiation process. In addition, we found that the final cell yield was limited by the self-renewal rate of either the progenitor state or the final differentiated state, depending on the differentiation protocol. Also, the relative impact of these cell fate decision rates was highly dependent on the maximum capacity of the cell culture system. Overall, we outline a novel approach for quantitative analysis of established laboratory-scale hPSC differentiation systems and this approach may ease development to produce large quantities of cells for tissue engineering applications.

  6. Lower Gastrointestinal (GI) Tract X-Ray (Radiography)

    MedlinePlus

    ... Site Index A-Z X-ray (Radiography) - Lower GI Tract Lower gastrointestinal tract radiography or lower GI ... of Lower GI Tract Radiography? What is Lower GI Tract X-ray Radiography (Barium Enema)? Lower gastrointestinal ( ...

  7. [Musculoskeletal rehabilitation and bone. A novel approach to mechanotransduction using cell-adhesion-patterned cells].

    PubMed

    Katanosaka, Yuki; Naruse, Keiji

    2010-04-01

    Human vascular endothelial cells form the interface between the bloodstream and vessel walls and are continuously subjected to mechanical stimulation. When endothelial cells are stretched cyclically, along one axis, they align perpendicular to the axis of stretch. We previously reported that applying a cyclic, uni-axial strain to cells induced tyrosine phosphorylation of focal adhesion kinase and stimulated mitogen-activated protein kinase. However, it is difficult to quantify and analyze the spatial distribution of tyrosine phosphorylation in these cells, as they form focal adhesions randomly. Recently, we developed a system to overcome this problem by preparing individual, uniform, patterned cells that could be stretched cyclically and uni-axially. In this system we were able to statistically analyze cellular responses in these patterned cells, when subjected to a cyclic, uni-axial strain, using fluorescent microscopy.

  8. T cell contamination in flow cytometry gating approaches for analysis of innate lymphoid cells.

    PubMed

    Burkhard, Sara H; Mair, Florian; Nussbaum, Kathrin; Hasler, Sabrina; Becher, Burkhard

    2014-01-01

    Innate lymphoid cells (ILCs) differ from T and B cells as they do not express genetically rearranged antigen receptors. The most prominent member of this group, NK cells, can be identified by numerous surface receptors such as natural cytotoxicity receptors (NCRs). However, novel groups of ILCs have recently been described and classified based on fate-determining transcription factors and cytokines being produced, similarly to T helper cells. Due to the lack of exclusive markers, ILCs are primarily defined by the paucity of lineage markers. Using RORc-fate-mapping mice, we found that the common lineage exclusion using CD3 yields an ILC population containing a large proportion of T cells with recombined TCR loci and low expression of CD3. Thus, we suggest adding CD5 as a marker for thorough elimination of T cells to avoid erroneous interpretations of ILC function in immunity.

  9. T Cell Contamination in Flow Cytometry Gating Approaches for Analysis of Innate Lymphoid Cells

    PubMed Central

    Hasler, Sabrina; Becher, Burkhard

    2014-01-01

    Innate lymphoid cells (ILCs) differ from T and B cells as they do not express genetically rearranged antigen receptors. The most prominent member of this group, NK cells, can be identified by numerous surface receptors such as natural cytotoxicity receptors (NCRs). However, novel groups of ILCs have recently been described and classified based on fate-determining transcription factors and cytokines being produced, similarly to T helper cells. Due to the lack of exclusive markers, ILCs are primarily defined by the paucity of lineage markers. Using RORc-fate-mapping mice, we found that the common lineage exclusion using CD3 yields an ILC population containing a large proportion of T cells with recombined TCR loci and low expression of CD3. Thus, we suggest adding CD5 as a marker for thorough elimination of T cells to avoid erroneous interpretations of ILC function in immunity. PMID:24759759

  10. Fetal lower urinary tract obstruction.

    PubMed

    Lissauer, David; Morris, Rachel K; Kilby, Mark D

    2007-12-01

    Fetal lower urinary tract obstruction affects 2.2 per 10,000 births. It is a consequence of a range of pathological processes, most commonly posterior urethral valves (64%) or urethral atresia (39%). It is a condition of high mortality and morbidity associated with progressive renal dysfunction and oligohydramnios, and hence fetal pulmonary hypoplasia. Accurate detection is possible via ultrasound, but the underlying pathology is often unknown. In future, magnetic resonance imaging (MRI) may be increasingly used alongside ultrasound in the diagnosis and assessment of fetuses with lower urinary tract obstruction. Fetal urine analysis may provide improvements in prenatal determination of renal prognosis, but the optimum criteria to be used remain unclear. It is now possible to decompress the obstruction in utero via percutaneous vesico-amniotic shunting or cystoscopic techniques. In appropriately selected fetuses intervention may improve perinatal survival, but long-term renal morbidity amongst survivors remains problematic.

  11. [Urinary tract infection in pregnancy].

    PubMed

    Herráiz, Miguel Angel; Hernández, Antonio; Asenjo, Eloy; Herráiz, Ignacio

    2005-12-01

    Urinary tract infections, asymptomatic bacteriuria (AB), acute cystitis (AC) and acute pyelonephritis (AP), are favored by the morphological and functional changes involved in pregnancy. AB increases the risk of preterm labor, low birth weight and AP. AB should be detected by uroculture (other methods are not sufficiently effective) and treated early. Approximately 80% of cases are caused by Escherichia coli. The risks and effectiveness of the distinct antibiotic regimens should be evaluated: fosfomycin trometamol in monotherapy or as short course therapy is safe and effective for the treatment of AB and AC. AP is the most frequent cause of hospital admission for medical reasons in pregnant women and can lead to complications in 10% of cases, putting the lives of the mother and fetus at risk. Currently outpatient treatment of AP is recommended in selected cases. Adequate follow-up of pregnant women with urinary tract infections is required due to frequent recurrence.

  12. In Vivo Assessment of Stem Cells for Treating Neurodegenerative Disease: Current Approaches and Future Prospects

    PubMed Central

    2017-01-01

    In recent years, stem cell-related therapies have been widely applied for treating neurodegenerative disease. Despite their potential, stem cell tracking and imaging techniques for the evaluation of in vivo proof-of-concept (PoC) therapies have not been sufficiently represented in the research area. This review summarizes the recent approaches that have been used for tracking and imaging engrafted stem cells in vivo. Furthermore, we introduce tissue clearing technology that can be applied to develop three-dimensional in vivo experiments. Monitoring stem cell survival and migration and graft-host relationships is a useful strategy to evaluate the therapeutic efficacy of regenerative medicine approaches in neurodegenerative disease. PMID:28326106

  13. Extensive upper respiratory tract sarcoidosis.

    PubMed

    Soares, Mafalda Trindade; Sousa, Carolina; Garanito, Luísa; Freire, Filipe

    2016-04-18

    Sarcoidosis is a chronic granulomatous disease of unknown aetiology. It can affect any part of the organism, although the lung is the most frequently affected organ. Upper airway involvement is rare, particularly if isolated. Sarcoidosis is a diagnosis of exclusion, established by histological evidence of non-caseating granulomas and the absence of other granulomatous diseases. The authors report a case of a man with sarcoidosis manifesting as a chronic inflammatory stenotic condition of the upper respiratory tract and trachea.

  14. In situ localization of epidermal stem cells using a novel multi epitope ligand cartography approach.

    PubMed

    Ruetze, Martin; Gallinat, Stefan; Wenck, Horst; Deppert, Wolfgang; Knott, Anja

    2010-06-01

    Precise knowledge of the frequency and localization of epidermal stem cells within skin tissue would further our understanding of their role in maintaining skin homeostasis. As a novel approach we used the recently developed method of multi epitope ligand cartography, applying a set of described putative epidermal stem cell markers. Bioinformatic evaluation of the data led to the identification of several discrete basal keratinocyte populations, but none of them displayed the complete stem cell marker set. The distribution of the keratinocyte populations within the tissue was remarkably heterogeneous, but determination of distance relationships revealed a population of quiescent cells highly expressing p63 and the integrins alpha(6)/beta(1) that represent origins of a gradual differentiation lineage. This population comprises about 6% of all basal cells, shows a scattered distribution pattern and could also be found in keratinocyte holoclone colonies. The data suggest that this population identifies interfollicular epidermal stem cells.

  15. New approaches for the analysis of confluent cell layers with quantitative phase digital holographic microscopy

    NASA Astrophysics Data System (ADS)

    Pohl, L.; Kaiser, M.; Ketelhut, S.; Pereira, S.; Goycoolea, F.; Kemper, Björn

    2016-03-01

    Digital holographic microscopy (DHM) enables high resolution non-destructive inspection of technical surfaces and minimally-invasive label-free live cell imaging. However, the analysis of confluent cell layers represents a challenge as quantitative DHM phase images in this case do not provide sufficient information for image segmentation, determination of the cellular dry mass or calculation of the cell thickness. We present novel strategies for the analysis of confluent cell layers with quantitative DHM phase contrast utilizing a histogram based-evaluation procedure. The applicability of our approach is illustrated by quantification of drug induced cell morphology changes and it is shown that the method is capable to quantify reliable global morphology changes of confluent cell layers.

  16. Young at Heart: Pioneering Approaches to Model Nonischaemic Cardiomyopathy with Induced Pluripotent Stem Cells

    PubMed Central

    Gowran, Aoife; Rasponi, Marco; Perrucci, Gianluca L.; Righetti, Stefano; Zanobini, Marco; Pompilio, Giulio

    2016-01-01

    A mere 9 years have passed since the revolutionary report describing the derivation of induced pluripotent stem cells from human fibroblasts and the first in-patient translational use of cells obtained from these stem cells has already been achieved. From the perspectives of clinicians and researchers alike, the promise of induced pluripotent stem cells is alluring if somewhat beguiling. It is now evident that this technology is nascent and many areas for refinement have been identified and need to be considered before induced pluripotent stem cells can be routinely used to stratify, treat and cure patients, and to faithfully model diseases for drug screening purposes. This review specifically addresses the pioneering approaches to improve induced pluripotent stem cell based models of nonischaemic cardiomyopathy. PMID:27110250

  17. Bone Marrow-Derived Cells as a Therapeutic Approach to Optic Nerve Diseases

    PubMed Central

    Mesentier-Louro, Louise A.; Zaverucha-do-Valle, Camila; Rosado-de-Castro, Paulo H.; Silva-Junior, Almir J.; Pimentel-Coelho, Pedro M.; Mendez-Otero, Rosalia; Santiago, Marcelo F.

    2016-01-01

    Following optic nerve injury associated with acute or progressive diseases, retinal ganglion cells (RGCs) of adult mammals degenerate and undergo apoptosis. These diseases have limited therapeutic options, due to the low inherent capacity of RGCs to regenerate and due to the inhibitory milieu of the central nervous system. Among the numerous treatment approaches investigated to stimulate neuronal survival and axonal extension, cell transplantation emerges as a promising option. This review focuses on cell therapies with bone marrow mononuclear cells and bone marrow-derived mesenchymal stem cells, which have shown positive therapeutic effects in animal models of optic neuropathies. Different aspects of available preclinical studies are analyzed, including cell distribution, potential doses, routes of administration, and mechanisms of action. Finally, published and ongoing clinical trials are summarized. PMID:26649049

  18. Systems and synthetic biology approaches to alter plant cell walls and reduce biomass recalcitrance

    PubMed Central

    Kalluri, Udaya C; Yin, Hengfu; Yang, Xiaohan; Davison, Brian H

    2014-01-01

    Fine-tuning plant cell wall properties to render plant biomass more amenable to biofuel conversion is a colossal challenge. A deep knowledge of the biosynthesis and regulation of plant cell wall and a high-precision genome engineering toolset are the two essential pillars of efforts to alter plant cell walls and reduce biomass recalcitrance. The past decade has seen a meteoric rise in use of transcriptomics and high-resolution imaging methods resulting in fresh insights into composition, structure, formation and deconstruction of plant cell walls. Subsequent gene manipulation approaches, however, commonly include ubiquitous mis-expression of a single candidate gene in a host that carries an intact copy of the native gene. The challenges posed by pleiotropic and unintended changes resulting from such an approach are moving the field towards synthetic biology approaches. Synthetic biology builds on a systems biology knowledge base and leverages high-precision tools for high-throughput assembly of multigene constructs and pathways, precision genome editing and site-specific gene stacking, silencing and/or removal. Here, we summarize the recent breakthroughs in biosynthesis and remodelling of major secondary cell wall components, assess the impediments in obtaining a systems-level understanding and explore the potential opportunities in leveraging synthetic biology approaches to reduce biomass recalcitrance. PMID:25363806

  19. Systems and synthetic biology approaches to alter plant cell walls and reduce biomass recalcitrance.

    PubMed

    Kalluri, Udaya C; Yin, Hengfu; Yang, Xiaohan; Davison, Brian H

    2014-12-01

    Fine-tuning plant cell wall properties to render plant biomass more amenable to biofuel conversion is a colossal challenge. A deep knowledge of the biosynthesis and regulation of plant cell wall and a high-precision genome engineering toolset are the two essential pillars of efforts to alter plant cell walls and reduce biomass recalcitrance. The past decade has seen a meteoric rise in use of transcriptomics and high-resolution imaging methods resulting in fresh insights into composition, structure, formation and deconstruction of plant cell walls. Subsequent gene manipulation approaches, however, commonly include ubiquitous mis-expression of a single candidate gene in a host that carries an intact copy of the native gene. The challenges posed by pleiotropic and unintended changes resulting from such an approach are moving the field towards synthetic biology approaches. Synthetic biology builds on a systems biology knowledge base and leverages high-precision tools for high-throughput assembly of multigene constructs and pathways, precision genome editing and site-specific gene stacking, silencing and/or removal. Here, we summarize the recent breakthroughs in biosynthesis and remodelling of major secondary cell wall components, assess the impediments in obtaining a systems-level understanding and explore the potential opportunities in leveraging synthetic biology approaches to reduce biomass recalcitrance.

  20. Embryonic stem cells and prospects for their use in regenerative medicine approaches to motor neurone disease.

    PubMed

    Christou, Y A; Moore, H D; Shaw, P J; Monk, P N

    2007-10-01

    Human embryonic stem cells are pluripotent cells with the potential to differentiate into any cell type in the presence of appropriate stimulatory factors and environmental cues. Their broad developmental potential has led to valuable insights into the principles of developmental and cell biology and to the proposed use of human embryonic stem cells or their differentiated progeny in regenerative medicine. This review focuses on the prospects for the use of embryonic stem cells in cell-based therapy for motor neurone disease or amyotrophic lateral sclerosis, a progressive neurodegenerative disease that specifically affects upper and lower motor neurones and leads ultimately to death from respiratory failure. Stem cell-derived motor neurones could conceivably be used to replace the degenerated cells, to provide authentic substrates for drug development and screening and for furthering our understanding of disease mechanisms. However, to reliably and accurately culture motor neurones, the complex pathways by which differentiation occurs in vivo must be understood and reiterated in vitro by embryonic stem cells. Here we discuss the need for new therapeutic strategies in the treatment of motor neurone disease, the developmental processes that result in motor neurone formation in vivo, a number of experimental approaches to motor neurone production in vitro and recent progress in the application of stem cells to the treatment and understanding of motor neurone disease.

  1. From the surface to the single cell: Novel endoscopic approaches in inflammatory bowel disease

    PubMed Central

    Rath, Timo; Tontini, Gian Eugenio; Neurath, Markus F; Neumann, Helmut

    2015-01-01

    Inflammatory bowel diseases (IBD) comprise the two major entities Crohn’s disease and ulcerative colitis and endoscopic imaging of the gastrointestinal tract has always been an integral and central part in the management of IBD patients. Within the recent years, mucosal healing emerged as a key treatment goal in IBD that substantially decides about the clinical outcome of IBD patients, thereby demanding for a precise, timely and detailed endoscopic assessment of the mucosal inflammation associated with IBD. Further, molecular imaging has tremendously expanded the clinical utility and applications of modern endoscopy, now encompassing not only diagnosis, surveillance, and treatment but also the prediction of individual therapy response. Within this review we describe novel endoscopic approaches and advanced endoscopic imaging methods for the diagnosis, treatment and surveillance of IBD patients. We begin by providing an overview over novel and advanced imaging techniques such as magnification endoscopy and dye-based and dye-less chromoendoscopy, endomicroscopy and endocytoscopy. We then describe how these techniques can be utilized for the precise and ultrastructural assessment of mucosal inflammation and dysplasia development associated with IBD and outline how they have enabled the endoscopist to gain insight onto the cellular level in real-time. Finally, we provide an outlook on how molecular imaging has rapidly evolved in the recent past and can be used to make individual predictions about the therapeutic response towards biological treatment. PMID:26523101

  2. Urinary tract infections in adults.

    PubMed

    Orenstein, R; Wong, E S

    1999-03-01

    Urinary tract infections remain a significant cause of morbidity in all age groups. Recent studies have helped to better define the population groups at risk for these infections, as well as the most cost-effective management strategies. Initially, a urinary tract infection should be categorized as complicated or uncomplicated. Further categorization of the infection by clinical syndrome and by host (i.e., acute cystitis in young women, acute pyelonephritis, catheter-related infection, infection in men, asymptomatic bacteriuria in the elderly) helps the physician determine the appropriate diagnostic and management strategies. Uncomplicated urinary tract infections are caused by a predictable group of susceptible organisms. These infections can be empirically treated without the need for urine cultures. The most effective therapy for an uncomplicated infection is a three-day course of trimethoprim-sulfamethoxazole. Complicated infections are diagnosed by quantitative urine cultures and require a more prolonged course of therapy. Asymptomatic bacteriuria rarely requires treatment and is not associated with increased morbidity in elderly patients.

  3. A systemic approach to cancer treatment: tumor cell reprogramming focused on endocrine-related cancers.

    PubMed

    Biava, P M; Nicolini, A; Ferrari, P; Carpi, A; Sell, S

    2014-01-01

    The term "cancer cell reprogramming" is used to define any kind of intervention aimed at transforming cancer cells into terminally differentiated cells. Using this approach, new technologies have been applied with different methods for a more systemic approach to cancer treatment. This review reports on advances of these technologies, including our personal contributions, mainly carried out on endocrine-related cancers. Some of the interventions, aimed at reverting cancer cells into a normal phenotype, are based on the evidence that tumor development is suppressed by the embryonic microenvironment. On the basis of this rationale, experiments have been conducted using stem cell differentiation stage factors (SCDSFs) taken at different stages of development of Zebrafish embryos, oocyte extracts, or naïve human umbilical cord matrix derived stem cells (UMDSCs). SCDSFs induce significant growth inhibition on different tumor cell lines in vitro, likely because of increases in cell cycle regulatory molecules, such as p53 and pRb. Treatment with these factors activates apoptosis and differentiation related to caspase-3. This is achieved via p73 apoptotic-dependent pathway activation with a concurrent normalization of the E-cadherin and beta-catenin ratio. Extracts from prophase amphibian oocytes could reprogram relevant epigenetic alterations in MCF-7 and HCC1954 breast cancer cell lines, while un-engineered (naïve) human UMDSCs attenuated growth of MDA-231 human breast carcinoma cells. A product prepared for human treatments, containing SCDSFs at very low doses, yielded favorable results in breast cancer and in intermediate-advanced hepatocellular carcinoma. Other reprogramming interventions used in the models of breast, prostate and ovarian cancer cell lines are described. Finally, current and future perspectives of this novel technology are discussed and a new hallmark of cancer is suggested: the loss of differentiation of cancer cells.

  4. Hermes Regulates Axon Sorting in the Optic Tract by Post-Trancriptional Regulation of Neuropilin 1

    PubMed Central

    Hörnberg, Hanna; Cioni, Jean-Michel; Harris, William A.

    2016-01-01

    The establishment of precise topographic maps during neural development is facilitated by the presorting of axons in the pathway before they reach their targets. In the vertebrate visual system, such topography is seen clearly in the optic tract (OT) and in the optic radiations. However, the molecular mechanisms involved in pretarget axon sorting are poorly understood. Here, we show in zebrafish that the RNA-binding protein Hermes, which is expressed exclusively in retinal ganglion cells (RGCs), is involved in this process. Using a RiboTag approach, we show that Hermes acts as a negative translational regulator of specific mRNAs in RGCs. One of these targets is the guidance cue receptor Neuropilin 1 (Nrp1), which is sensitive to the repellent cue Semaphorin 3A (Sema3A). Hermes knock-down leads to topographic missorting in the OT through the upregulation of Nrp1. Restoring Nrp1 to appropriate levels in Hermes-depleted embryos rescues this effect and corrects the axon-sorting defect in the OT. Our data indicate that axon sorting relies on Hermes-regulated translation of Nrp1. SIGNIFICANCE STATEMENT An important mechanism governing the formation of the mature neural map is pretarget axon sorting within the sensory tract; however, the molecular mechanisms involved in this process remain largely unknown. The work presented here reveals a novel function for the RNA-binding protein Hermes in regulating the topographic sorting of retinal ganglion cell (RGC) axons in the optic tract and tectum. We find that Hermes negatively controls the translation of the guidance cue receptor Neuropilin-1 in RGCs, with Hermes knock-down resulting in aberrant growth cone cue sensitivity and axonal topographic misprojections. We characterize a novel RNA-based mechanism by which axons restrict their translatome developmentally to achieve proper targeting. PMID:27974617

  5. Solution-Adaptive Cartesian Cell Approach for Viscous and Inviscid Flows

    NASA Technical Reports Server (NTRS)

    Coirier, William J.; Powell, Kenneth G.

    1996-01-01

    A Cartesian cell-based approach for adaptively refined solutions of the Euler and Navier-Stokes equations in two dimensions is presented. Grids about geometrically complicated bodies are generated automatically, by the recursive subdivision of a single Cartesian cell encompassing the entire flow domain. Where the resulting cells intersect bodies, polygonal cut cells are created using modified polygon-clipping algorithms. The grid is stored in a binary tree data structure that provides a natural means of obtaining cell-to-cell connectivity and of carrying out solution-adaptive mesh refinement. The Euler and Navier-Stokes equations are solved on the resulting grids using a finite volume formulation. The convective terms are upwinded: A linear reconstruction of the primitive variables is performed, providing input states to an approximate Riemann solver for computing the fluxes between neighboring cells. The results of a study comparing the accuracy and positivity of two classes of cell-centered, viscous gradient reconstruction procedures is briefly summarized. Adaptively refined solutions of the Navier-Stokes equations are shown using the more robust of these gradient reconstruction procedures, where the results computed by the Cartesian approach are compared to theory, experiment, and other accepted computational results for a series of low and moderate Reynolds number flows.

  6. Polyglutamine Tract Expansion Increases S-Nitrosylation of Huntingtin and Ataxin-1

    PubMed Central

    Ni, Chun-Lun; Seth, Divya; Fonseca, Fabio Vasconcelos; Wang, Liwen; Xiao, Tsan Sam; Gruber, Phillip; Sy, Man-Sun; Stamler, Jonathan S.

    2016-01-01

    Expansion of the polyglutamine (polyQ) tract in the huntingtin (Htt) protein causes Huntington’s disease (HD), a fatal inherited movement disorder linked to neurodegeneration in the striatum and cortex. S-nitrosylation and S-acylation of cysteine residues regulate many functions of cytosolic proteins. We therefore used a resin-assisted capture approach to identify these modifications in Htt. In contrast to many proteins that have only a single S-nitrosylation or S-acylation site, we identified sites along much of the length of Htt. Moreover, analysis of cells expressing full-length Htt or a large N-terminal fragment of Htt shows that polyQ expansion strongly increases Htt S-nitrosylation. This effect appears to be general since it is also observed in Ataxin-1, which causes spinocerebellar ataxia type 1 (SCA1) when its polyQ tract is expanded. Overexpression of nitric oxide synthase increases the S-nitrosylation of normal Htt and the frequency of conspicuous juxtanuclear inclusions of Htt N-terminal fragments in transfected cells. Taken together with the evidence that S-nitrosylation of Htt is widespread and parallels polyQ expansion, these subcellular changes show that S-nitrosylation affects the biology of this protein in vivo. PMID:27658206

  7. Endosymbiont gene functions impaired and rescued by polymerase infidelity at poly(A) tracts

    PubMed Central

    Tamas, Ivica; Wernegreen, Jennifer J.; Nystedt, Björn; Kauppinen, Seth N.; Darby, Alistair C.; Gomez-Valero, Laura; Lundin, Daniel; Poole, Anthony M.; Andersson, Siv G. E.

    2008-01-01

    Among host-dependent bacteria that have evolved by extreme reductive genome evolution, long-term bacterial endosymbionts of insects have the smallest (160–790 kb) and most A + T-rich (>70%) bacterial genomes known to date. These genomes are riddled with poly(A) tracts, and 5–50% of genes contain tracts of 10 As or more. Here, we demonstrate transcriptional slippage at poly(A) tracts within genes of Buchnera aphidicola associated with aphids and Blochmannia pennsylvanicus associated with ants. Several tracts contain single frameshift deletions; these apparent pseudogenes showed patterns of constraint consistent with purifying selection on the encoded proteins. Transcriptional slippage yielded a heterogeneous population of transcripts with variable numbers of As in the tract. Across several frameshifted genes, including B. aphidicola cell wall bio