Science.gov

Sample records for cell tracts approach

  1. Small round blue cell tumors of the sinonasal tract: a differential diagnosis approach.

    PubMed

    Thompson, Lester Dr

    2017-01-01

    One of the most challenging diagnostic categories within tumors of the sinonasal tract is the small round blue cell tumors. Biopsies are usually small and limited, resulting in considerable diagnostic difficulty for practicing surgical pathologists. These tumors share several overlapping histologic and immunophenotypic findings while also showing considerable variation within and between cases. Specific tumor site of origin, imaging findings, and clinical findings must be combined with the histology and pertinent ancillary studies if the correct diagnosis is to be reached. Discrimination between neoplasms is critical as there are significant differences in therapy and overall outcome. It is important to have a well developed differential diagnosis for this category of tumors, where each of the diagnoses is considered, evaluated, and either confirmed or excluded from further consideration. In an undifferentiated tumor, showing a small round blue cell morphology, using the mnemonic 'MR SLEEP' helps to highlight tumors to consider: melanoma, mesenchymal chondrosarcoma, rhabdomyosarcoma, sinonasal undifferentiated carcinoma, squamous cell carcinoma (including NUT carcinoma), small cell osteosarcoma, lymphoma, esthesioneuroblastoma (olfactory neuroblastoma), Ewing sarcoma/primitive neuroectodermal tumor, pituitary adenoma, and plasmacytoma. A panel of pertinent immunohistochemistry studies, histochemistries and/or molecular tests should aid in reaching a diagnosis, especially when taking the pattern and intensity of reactions into consideration.

  2. Approach to urinary tract infections.

    PubMed

    Najar, M S; Saldanha, C L; Banday, K A

    2009-10-01

    Urinary tract infection (UTI) is the most common infection experienced by humans after respiratory and gastro-intestinal infections, and also the most common cause of both community-acquired and nosocomial infections for patients admitted to hospitals. For better management and prognosis, it is mandatory to know the possible site of infection, whether the infection is uncomplicated or complicated, re-infection or relapse, or treatment failure and its pathogenesis and risk factors. Asymptomatic bacteriuria is common in certain age groups and has different connotations. It needs to be treated and completely cured in pregnant women and preschool children. Reflux nephropathy in children could result in chronic kidney disease; otherwise, urinary tract infections do not play a major role in the pathogenesis of end-stage renal disease. Symptomatic urinary tract infections occur most commonly in women of child-bearing age. Cystitis predominates, but needs to be distinguished from acute urethral syndrome that affects both sexes and has a different management plan than UTIs. The prostatitis symptoms are much more common than bacterial prostatic infections. The treatment needs to be prolonged in bacterial prostatitis and as cure rates are not very high and relapses are common, the classification of prostatitis needs to be understood. The consensus conference convened by National Institute of Health added two more groups of patients, namely, chronic prostatitis/chronic pelvic pain syndrome and asymptomatic inflammatory prostatitis, in addition to acute and chronic bacterial prostatitis. Although white blood cells in urine signify inflammation, they do not always signify UTI. Quantitative cultures of urine provide definitive evidence of UTI. Imaging studies should be done 3-6 weeks after cure of acute infection to identify abnormalities predisposing to infection or renal damage or which may affect management. Treatment of cystitis in women should be a three-day course and if

  3. Approach to urinary tract infections

    PubMed Central

    Najar, M. S.; Saldanha, C. L.; Banday, K. A.

    2009-01-01

    Urinary tract infection (UTI) is the most common infection experienced by humans after respiratory and gastro-intestinal infections, and also the most common cause of both community-acquired and nosocomial infections for patients admitted to hospitals. For better management and prognosis, it is mandatory to know the possible site of infection, whether the infection is uncomplicated or complicated, re-infection or relapse, or treatment failure and its pathogenesis and risk factors. Asymptomatic bacteriuria is common in certain age groups and has different connotations. It needs to be treated and completely cured in pregnant women and preschool children. Reflux nephropathy in children could result in chronic kidney disease; otherwise, urinary tract infections do not play a major role in the pathogenesis of end-stage renal disease. Symptomatic urinary tract infections occur most commonly in women of child-bearing age. Cystitis predominates, but needs to be distinguished from acute urethral syndrome that affects both sexes and has a different management plan than UTIs. The prostatitis symptoms are much more common than bacterial prostatic infections. The treatment needs to be prolonged in bacterial prostatitis and as cure rates are not very high and relapses are common, the classification of prostatitis needs to be understood. The consensus conference convened by National Institute of Health added two more groups of patients, namely, chronic prostatitis/chronic pelvic pain syndrome and asymptomatic inflammatory prostatitis, in addition to acute and chronic bacterial prostatitis. Although white blood cells in urine signify inflammation, they do not always signify UTI. Quantitative cultures of urine provide definitive evidence of UTI. Imaging studies should be done 3-6 weeks after cure of acute infection to identify abnormalities predisposing to infection or renal damage or which may affect management. Treatment of cystitis in women should be a three-day course and if

  4. Endoscopic management of upper tract transitional cell carcinoma.

    PubMed

    Forster, James A; Palit, Victor; Browning, Anthony J; Biyani, Chandra Shekhar

    2010-04-01

    Upper urinary tract transitional cell carcinoma (TCC) accounts for up to 10% of cases of neoplasm of the upper urinary tract. The "gold standard" management of upper tract TCC is nephroureterectomy. Technological innovations, miniaturisations and increased availability of energy sources such as Holmium laser fibers have improved the armamentarium of endoscopic management of upper tract TCC. Endoscopic management of upper tract TCC includes the percutaneous (antegrade) and retrograde approaches. Modern flexible ureterorenoscopy allows retrograde approach to small (<1.5cm), low grade and noninvasive tumors, which is inaccessible to standard rigid ureteroscopes without breaching the urothelial barrier. In patients with large tumors or in whom retrograde access is difficult, the percutaneous approach to the renal pelvis, although more invasive, provides an alternative access and control. Both retrograde and percutaneous approaches allow instillation of various chemotherapeutic agents. Careful selection of patients is the key point in the successful endoscopic management of upper tract TCC. Patient selection is based on tumor size, grade and multifocality and other patient factors such as comorbidities, single kidney, post kidney transplant and patient choice. Both motivation and compliance of patients are needed for long-term successes. However, until large randomized trials with long term follow-up are available, endoscopic management of upper tract TCC should be reserved for only selected group of patients. This review summarizes the current techniques, indications, contraindications and outcomes of endoscopic management of UTTCC and the key published data.

  5. Oncologic results of nephron sparing endoscopic approach for upper tract low grade transitional cell carcinoma in comparison to nephroureterectomy - a case control study.

    PubMed

    Hoffman, Azik; Yossepowitch, Ofer; Erlich, Yaron; Holland, Ronen; Lifshitz, David

    2014-12-02

    There is paucity of data as to the results of the endoscopic approach in comparison to the golden standard of nephro-ureterectomy in elective, low grade TCC, patients. Our purpose is to report our results of a nephron sparing approach compared to nephro-ureterectomy in those patients. From a retrospective data base we identified 25 patients and 23 patients who underwent a nephron sparing ureterosocpic resection and nephro-reterectomy for low grade UT-TCC, respectively. The endoscopic technique included endoscopic tumor biopsy followed by primary resection and/or fulguration. The nephron sparing group was followed by bi-annual ureteroscopy and upper tract imaging, timely cystoscopy and urine cytology collection. Data for overall and disease related mortality, bladder and ureteral TCC recurrence and renal function are reported in both groups. Median follow - up time was 26 months. 11 (44%) patients developed bladder recurrence at a median period of 9 months after initial ureteroscopy, compared to 9 (39%) in the NUx group (P < 0.05). Recurrent ureteral low grade TCC was observed in 9 patients (median: 9 months). All were treated endoscopicaly successfully. Renal function remained stable in the nephron sparing group. No disease related mortality was recorded in the nephron-sparing group while one patient died of his disease following NUx. Disease related mortality following a nephron sparing endoscopic approach or nephroureterectomy for low grade upper tract TCC is excellent. However, the nephron sparing approach is associated with a relatively high rate of ureteral and bladder recurrence. Therefore, a stringent follow-up protocol is required.

  6. Novel Approaches to Preventing Urinary Tract Infection in Women

    DTIC Science & Technology

    1997-09-01

    in young women, Escherichia coli and Staphylococcus saprophyticus , as well as their interactions with glycosphingolipids (GSLs) on the cell surface of...Detrick, Maryland 21702-5012. 13. -ABSTRACT (Maximum 200 Urinary tract infections (UTIs), generally caused by Escherichia coli or Staphylococcus ... saprophyticus , are extremely common among young women and 25% of these patients develop frequent recurrent infections. Although UTIs can be treated, we

  7. Inhibition of experimental ascending urinary tract infection by an epithelial cell-surface receptor analogue

    NASA Astrophysics Data System (ADS)

    Edén, C. Svanborg; Freter, R.; Hagberg, L.; Hull, R.; Hull, S.; Leffler, H.; Schoolnik, G.

    1982-08-01

    It has been shown that the establishment of urinary tract infection by Escherichia coli is dependent on attachment of the bacteria to epithelial cells1-4. The attachment involves specific epithelial cell receptors, which have been characterized as glycolipids5-10. Reversible binding to cell-surface mannosides may also be important4,11-13. This suggests an approach to the treatment of infections-that of blocking bacterial attachment with cell membrane receptor analogues. Using E. coli mutants lacking one or other of the two binding specificities (glycolipid and mannose), we show here that glycolipid analogues can block in vitro adhesion and in vivo urinary tract infection.

  8. Tract specific analysis in patients with sickle cell disease

    NASA Astrophysics Data System (ADS)

    Chai, Yaqiong; Coloigner, Julie; Qu, Xiaoping; Choi, Soyoung; Bush, Adam; Borzage, Matt; Vu, Chau; Lepore, Natasha; Wood, John

    2015-12-01

    Sickle cell disease (SCD) is a hereditary blood disorder in which the oxygen-carrying hemoglobin molecule in red blood cells is abnormal. It affects numerous people in the world and leads to a shorter life span, pain, anemia, serious infections and neurocognitive decline. Tract-Specific Analysis (TSA) is a statistical method to evaluate white matter alterations due to neurocognitive diseases, using diffusion tensor magnetic resonance images. Here, for the first time, TSA is used to compare 11 major brain white matter (WM) tracts between SCD patients and age-matched healthy subjects. Alterations are found in the corpus callosum (CC), the cortico-spinal tract (CST), inferior fronto-occipital fasciculus (IFO), inferior longitudinal fasciculus (ILF), superior longitudinal fasciculus (SLF), and uncinated fasciculus (UNC). Based on previous studies on the neurocognitive functions of these tracts, the significant areas found in this paper might be related to several cognitive impairments and depression, both of which are observed in SCD patients.

  9. Computer aided classification of cell nuclei in the gastrointestinal tract by volume and principal axis

    NASA Astrophysics Data System (ADS)

    Sagstetter, Ann M.; Camp, Jon J.; Lurken, Matthew S.; Szurszewski, Joseph H.; Farrugia, Gianrico; Gibbons, Simon J.; Robb, Richard A.

    2007-03-01

    Normal function of the gastrointestinal tract involves the coordinated activity of several cell types Human disorders of motor function of the gastrointestinal tract are often associated with changes in the number of these cells. For example, in diabetic patients, abnormalities in gastrointestinal transit are associated with changes in nerves and interstitial cells of Cajal (ICC), two key cells that generate and regulate motility. ICC are cells of mesenchymal origin that function as pacemakers and amplify neuronal signals in the gastrointestinal tract. Quantifying the changes in number of specific cell types in tissues from patients with motility disorders is challenging and requires immunolabeling for specific antigens. The shape of nuclei differs between the cell types in the wall of the gastrointestinal tract. Therefore the objective of this study was to determine whether cell nuclei can be classified by analyzing the 3D morphology of the nuclei. Furthermore, the orientation of the long axis of nuclei changes within and between the muscle layers. These features can be used to classify and differentially label the nuclei in confocal volume images of the tissue by computing the principal axis of the coordinates of the set of voxels forming each nucleus and thereby to identify cells by their nuclear morphology. Using this approach, we were able to separate and quantify nuclei in the smooth muscle layers of the tissue. Therefore we conclude that computer-aided classification of cell nuclei can be used to identify changes in the cell types expressed in gastrointestinal smooth muscle.

  10. Clonal Evolution of Stem Cells in the Gastrointestinal Tract.

    PubMed

    Fink, Juergen; Koo, Bon-Kyoung

    The field of gastrointestinal epithelial stem cells is a rapidly developing area of adult stem cell research. The discovery of Lgr5(+) intestinal stem cells has enabled us to study many hidden aspects of the biology of gastrointestinal adult stem cells. Marked by Lgr5 and Troy, several novel endodermal stem cells have been identified in the gastrointestinal tract. A precise working model of stem cell propagation, dynamics, and plasticity has been revealed by a genetic labeling method, termed lineage tracing. This chapter introduces the reidentification of crypt base columnar cells as Lgr5(+) stem cells in the intestine. Subsequently, it will discuss dynamic clonal evolution and cellular plasticity in the intestinal stem cell zone, as well as in stem cell zones of stomach glands.

  11. [Preclinical experience in stem cell therapy for digestive tract diseases].

    PubMed

    Jeon, Myung Shin; Hong, Soon Sun

    2011-09-25

    Adult stem cells are multipotent and self-renewing cells that contain several functions; i) migration and homing potential: stem cells can migrate to injured and inflamed tissues. ii) differentiation potential: stem cells which migrated to injured tissues can be differentiated into multiple cell types for repairing and regenerating the tissues. iii) immunomodulatory properties: stem cells, especially mesenchymal stem cells can suppress immune system such as inflammation. All those characteristics might be useful for the treatment of the digestive tract diseases which are complex and encompass a broad spectrum of different pathogenesis. Preclinical stem cell therapy showed some promising results, especially in liver failure, pancreatitis, sepsis, and inflammatory bowel disease. If we can understand more about the mechanism of stem cell action, stem cell therapy can become a promising alternative treatment for refractory digestive disease in the near future. In this review, we summarized current preclinical experiences in diseases of the digestive tract using stem cells. (Korean J Gastroenterol 2011;58:133-138).

  12. A pragmatic approach to vasculitis in the gastrointestinal tract.

    PubMed

    Chetty, Runjan; Serra, Stefano

    2017-06-01

    Although vasculitis involving the gastrointestinal tract (GIT) is an uncommon occurrence, occasionally vasculitis can present as haemorrhagic infarction or ischaemia for which a length of bowel is removed. Invariably, the appropriate clinical history is not forthcoming, or vasculitis is not clinically suspected. The purpose of this overview is to provide the practising gastrointestinal (GI) pathologist with a framework to recognise and diagnose vasculitides within the GIT. The classification may be approached by aetiological agent or size of vessel involved; an international consensus group now favours the latter approach. The symptoms that systemic and/or localised vasculitis may cause in the GIT are protean and non-specific. As a result, pathologists examining resection specimens for unexplained haemorrhagic infarction or ischaemia should be aware that vasculitis may be a potential cause. Several well-known systemic vasculitides such as polyarteritis nodosa, microscopic polyangiitis, eosinophilic granulomatosis with polyangiitis or Churg-Strauss syndrome and granulomatosis with polyangiitis or Wegener's granulomatosis can occur in the GIT. The latter three constitute the antineutrophil cytoplasmic antibody-positive vasculitides. In addition, the so-called solitary organ vasculitis (SOV) can occur in the GIT as the harbinger of later onset systemic vasculitis, and be the cause of the GIT symptoms. In addition, SOV can occur incidentally and coexist with GIT disease such as gallstones or polyps, and there may be no manifestations of systemic vasculitis for years, or not at all. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  13. Endourologic Management of Upper Tract Transitional Cell Carcinoma following Cystectomy and Urinary Diversion

    PubMed Central

    Tomaszewski, Jeffrey John; Smaldone, Marc Christopher; Ost, Michael Cecil

    2009-01-01

    Traditionally, nephroureterectomy is the gold standard therapy for upper tract recurrence of transitional cell carcinoma (TCC) following cystectomy and urinary diversion. With advances in endoscopic equipment and improvements in technique, conservative endourologic management via a retrograde or antegrade approach is technically feasible with acceptable outcomes in patients with bilateral disease, solitary renal units, chronic renal insufficiency, or significant medical comorbidities. Contemporary studies have expanded the utility of these techniques to include low-grade, low-volume disease in patients with a normal contralateral kidney. The aim of this report is to review the current outcomes of conservative management for upper tract disease and discuss its application and relevance in patients following cystectomy with lower urinary tract reconstruction. PMID:19125199

  14. Structural anomalies of highly malignant respiratory tract epithelial cells

    SciTech Connect

    Manger, R.L.; Heckman, C.A.

    1982-11-01

    These studies were designed to determine whether cytostructural changes were related to malignancy and the loss of growth control in epithelial cells. Three highly malignant cell lines were derived from transplantable carcinomas of the respiratory tract and compared with three respiratory tract epithelial lines of negligible malignancy. Keratin cytoskeletons were visualized by indirect immunofluorescence staining, and sample photomicrographs representing each line were prepared. The criteria used in making the classifications to identify the features common to the highly malignant lines included the nonuniform spacing of cells in the field of view, the cell shape, and the presence of nonfluorescent areas in the lamellar cytoplasm. Since the nonuniformity of keratin distribution in the periphery of the malignant cells suggested a structural anomaly, the cell lines were also examined by scanning electron microscopy. Unlike cells from the lines of negligible malignancy, cells from two of the highly malignant lines showed thickenings in the subterminal portions of the lamellar cytoplasm. The results suggested that specific architectural changes at the cellular level might be linked to the process of epithelial transformation and tumor progression.

  15. [Stem/progenitor cells in diseases of the respiratory tract].

    PubMed

    Płusa, Tadeusz

    2017-03-21

    Stem cells (SCs - stem cells) are characterized by plasticity and the ability to differentiate into other cell types. They are obtained from bone marrow, peripheral blood and cord blood. Mesenchymal stem cells (MSCs) shows a broad immunomodulating, increases the number of regulatory T cells (Treg), modifies the activity of T cells, dendritic cells and NK (natural killer). Direct impact on reducing the release of proinflammatory cytokines and increased release of proinflammatory cytokines. Within the respiratory tract has a number of resident stem and progenitor cells referred to as L-MSCs (lung mesenchymal stem cells) whose presence was confirmed by markers as defined in the trachea, epithelial cells and alveolar. Demonstrated the efficacy of MSCs administration in the first stage of septic shock and acute respiratory distress syndrome (ARDS - acute respiratory distress syndrome). There was a significant stimulation of repair processes, along with an improvement in lung function. Embryonic stem cells (ESCs - embryonic stem cells) are the latest addition in the treatment of congenital and acquired diseases of the airways and lung parenchyma. In patients with sarcoidosis MSCs are obtained from umbilical cord blood (PDA - placenta-derived mesenchymal-like cells) with phenotype CD34 +, CD10 +, CD105 + and CD200 +. The results of this therapy are very encouraging, and for this reason it is taken in subsequent research centers.

  16. Holmium:YAG laser ablation of upper urinary tract transitional cell carcinoma with new Olympus digital flexible ureteroscope

    PubMed Central

    Abad, Pablo Garrido; del Peso, Almudena Coloma; Arjona, Manuel Fernández

    2013-01-01

    Upper urinary tract transitional (UUTT) cell carcinoma is a relatively uncommon urologic tumor. The traditional treatment approach for them is radical nephroureterectomy. However, in recent years, less-invasive treatments, including different nephron-sparing procedures, have become increasingly popular. We report a case of laser ablation of UUTT cell carcinoma using new Olympus digital flexible ureteroscope (URF-V). PMID:24049390

  17. An Example-Based Multi-Atlas Approach to Automatic Labeling of White Matter Tracts

    PubMed Central

    Yoo, Sang Wook; Guevara, Pamela; Jeong, Yong; Yoo, Kwangsun; Shin, Joseph S.; Mangin, Jean-Francois; Seong, Joon-Kyung

    2015-01-01

    We present an example-based multi-atlas approach for classifying white matter (WM) tracts into anatomic bundles. Our approach exploits expert-provided example data to automatically classify the WM tracts of a subject. Multiple atlases are constructed to model the example data from multiple subjects in order to reflect the individual variability of bundle shapes and trajectories over subjects. For each example subject, an atlas is maintained to allow the example data of a subject to be added or deleted flexibly. A voting scheme is proposed to facilitate the multi-atlas exploitation of example data. For conceptual simplicity, we adopt the same metrics in both example data construction and WM tract labeling. Due to the huge number of WM tracts in a subject, it is time-consuming to label each WM tract individually. Thus, the WM tracts are grouped according to their shape similarity, and WM tracts within each group are labeled simultaneously. To further enhance the computational efficiency, we implemented our approach on the graphics processing unit (GPU). Through nested cross-validation we demonstrated that our approach yielded high classification performance. The average sensitivities for bundles in the left and right hemispheres were 89.5% and 91.0%, respectively, and their average false discovery rates were 14.9% and 14.2%, respectively. PMID:26225419

  18. Evidence for the Role of Mast Cells in Cystitis-Associated Lower Urinary Tract Dysfunction: A Multidisciplinary Approach to the Study of Chronic Pelvic Pain Research Network Animal Model Study

    PubMed Central

    O'Donnell, Michael; Lutgendorf, Susan; Bradley, Catherine; Schrepf, Andrew; Liu, Liwei; Kreder, Karl; Luo, Yi

    2016-01-01

    Bladder inflammation frequently causes cystitis pain and lower urinary tract dysfunction (LUTD) such as urinary frequency and urgency. Although mast cells have been identified to play a critical role in bladder inflammation and pain, the role of mast cells in cystitis-associated LUTD has not been demonstrated. Interstitial cystitis/bladder pain syndrome (IC/BPS) is a chronic and debilitating inflammatory condition of the urinary bladder characterized by the hallmark symptoms of pelvic pain and LUTD. In this study we investigated the role of mast cells in LUTD using a transgenic autoimmune cystitis model (URO-OVA) that reproduces many clinical correlates of IC/BPS. URO-OVA mice express the membrane form of the model antigen ovalbumin (OVA) as a self-antigen on the urothelium and develop bladder inflammation upon introduction of OVA-specific T cells. To investigate the role of mast cells, we crossed URO-OVA mice with mast cell-deficient KitW-sh mice to generate URO-OVA/KitW-sh mice that retained urothelial OVA expression but lacked endogenous mast cells. We compared URO-OVA mice with URO-OVA/KitW-sh mice with and without mast cell reconstitution in response to cystitis induction. URO-OVA mice developed profound bladder inflammation with increased mast cell counts and LUTD, including increased total number of voids, decreased mean volume voided per micturition, and decreased maximum volume voided per micturition, after cystitis induction. In contrast, similarly cystitis-induced URO-OVA/KitW-sh mice developed reduced bladder inflammation with no mast cells and LUTD detected. However, after mast cell reconstitution URO-OVA/KitW-sh mice restored the ability to develop bladder inflammation and LUTD following cystitis induction. We further treated URO-OVA mice with cromolyn, a mast cell membrane stabilizer, and found that cromolyn treatment reversed bladder inflammation and LUTD in the animal model. Our results provide direct evidence for the role of mast cells in cystitis

  19. Evidence for the Role of Mast Cells in Cystitis-Associated Lower Urinary Tract Dysfunction: A Multidisciplinary Approach to the Study of Chronic Pelvic Pain Research Network Animal Model Study.

    PubMed

    Wang, Xu; Liu, Wujiang; O'Donnell, Michael; Lutgendorf, Susan; Bradley, Catherine; Schrepf, Andrew; Liu, Liwei; Kreder, Karl; Luo, Yi

    2016-01-01

    Bladder inflammation frequently causes cystitis pain and lower urinary tract dysfunction (LUTD) such as urinary frequency and urgency. Although mast cells have been identified to play a critical role in bladder inflammation and pain, the role of mast cells in cystitis-associated LUTD has not been demonstrated. Interstitial cystitis/bladder pain syndrome (IC/BPS) is a chronic and debilitating inflammatory condition of the urinary bladder characterized by the hallmark symptoms of pelvic pain and LUTD. In this study we investigated the role of mast cells in LUTD using a transgenic autoimmune cystitis model (URO-OVA) that reproduces many clinical correlates of IC/BPS. URO-OVA mice express the membrane form of the model antigen ovalbumin (OVA) as a self-antigen on the urothelium and develop bladder inflammation upon introduction of OVA-specific T cells. To investigate the role of mast cells, we crossed URO-OVA mice with mast cell-deficient KitW-sh mice to generate URO-OVA/KitW-sh mice that retained urothelial OVA expression but lacked endogenous mast cells. We compared URO-OVA mice with URO-OVA/KitW-sh mice with and without mast cell reconstitution in response to cystitis induction. URO-OVA mice developed profound bladder inflammation with increased mast cell counts and LUTD, including increased total number of voids, decreased mean volume voided per micturition, and decreased maximum volume voided per micturition, after cystitis induction. In contrast, similarly cystitis-induced URO-OVA/KitW-sh mice developed reduced bladder inflammation with no mast cells and LUTD detected. However, after mast cell reconstitution URO-OVA/KitW-sh mice restored the ability to develop bladder inflammation and LUTD following cystitis induction. We further treated URO-OVA mice with cromolyn, a mast cell membrane stabilizer, and found that cromolyn treatment reversed bladder inflammation and LUTD in the animal model. Our results provide direct evidence for the role of mast cells in cystitis

  20. Therapeutic approach to the malignant tumors of the biliary tract.

    PubMed

    Mihalache, Florentina; Tantău, M; Iancu, C; Bodea, Raluca; Părău, Angela; Acalovschi, Monica

    2010-01-01

    Cholangiocarcinomas (CCA) are malignant tumors that originate in the cholangiocytes, occur at any level of the biliary tract, are very aggressive and have a 5-year survival rate of 7-8%. Their diagnosis is late and difficult, and the prognosis is very poor. The only curative treatment of these tumors is the complete surgical resection. Signs of unresectability can be detected in most patients with CCA when establishing the diagnosis. Thus, only certain palliative measures can be employed in most cases. The ideal palliative method should be minimally invasive, accompanied by few complications, should offer an increased quality of life, require reduced hospitalization and the lowest costs. The palliative treatment of the obstructive jaundice may be achieved by means of surgical bypass, endoscopic insertion of biliary stents, percutaneous stents, transhepatic stents, photodynamic therapy and/or radio-chemotherapy.

  1. Update on the approach of urinary tract infection in childhood.

    PubMed

    Simões e Silva, Ana Cristina; Oliveira, Eduardo Araújo

    2015-01-01

    Urinary tract infection (UTI) is the most common bacterial infection in childhood. UTI may be the sentinel event for underlying renal abnormality. There are still many controversies regarding proper management of UTI. In this review article, the authors discuss recent recommendations for the diagnosis, treatment, prophylaxis, and imaging of UTI in childhood based on evidence, and when this is lacking, based on expert consensus. Data were obtained after a review of the literature and a search of Pubmed, Embase, Scopus, and Scielo. In the first year of life, UTIs are more common in boys (3.7%) than in girls (2%). Signs and symptoms of UTI are very nonspecific, especially in neonates and during childhood; in many cases, fever is the only symptom. Clinical history and physical examination may suggest UTI, but confirmation should be made by urine culture, which must be performed before any antimicrobial agent is given. During childhood, the proper collection of urine is essential to avoid false-positive results. Prompt diagnosis and initiation of treatment is important to prevent long-term renal scarring. Febrile infants with UTIs should undergo renal and bladder ultrasonography. Intravenous antibacterial agents are recommended for neonates and young infants. The authors also advise exclusion of obstructive uropathies as soon as possible and later vesicoureteral reflux, if indicated. Prophylaxis should be considered for cases of high susceptibility to UTI and high risk of renal damage. Copyright © 2015 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  2. A systematic review: perivascular epithelioid cell tumor of gastrointestinal tract

    PubMed Central

    Chen, Zehong; Han, Siqi; Wu, Jialin; Xiong, Minmin; Huang, Yanqiao; Chen, Jianhui; Yuan, Yujie; Peng, Jianjun; Song, Wu

    2016-01-01

    Abstract Perivascular epithelioid cell tumor (PEComa) is a rare entity with distinctive morphology and of expressing myomelanocytic markers. Gastrointestinal tract (GI) is one of the most common anatomic sites of origin and counts for 20% to 25% of all reported cases of perivascular epithelioid cell tumors not otherwise specified (PEComas-NOS). However, the biologic behavior of perivascular epithelioid cell tumors of gastrointestinal tract (GI PEComas-NOS) is still unclear. The aim of conducting this systematic review is to sum up what is known so far of the epidemiology, natural history, management and prognosis of GI PEComas-NOS. A systematic research was performed on PubMed and EMBASE using the following terms: (“perivascular epithelioid cell tumor” or “PEComa”) and (“gastrointestinal tract” or “GI” or “oral ” or “mouth” or “esophagus” or “gullet” or “gastric” or “stomach” or “duodenum” or “jejunum” or “ileum” or “cecum” or “colon” or “colorectal” or “sigmoid” or “rectum” or “anus” or “mesentery”) up to December 1, 2015. Retrieved GI PEComas-NOS publications, which included these terms, contains case reports, case series to case characteristic researches. A total of 168 articles were reviewed, 41 GI PEComa-NOS English studies among which were retrieved for analysis. We reviewed epidemiology, natural history, management and prognosis of GI PEComa-NOS. Generally GI PEComa-NOS is believed to have women predomination. The most frequently involved location is colon with non-specific clinical signs. Pathologically, GI PEComas-NOS shows epithelioid predominance (70%), meanwhile coexpresses melanocytic and muscle markers characteristically, while immunohistochemistry is a useful tool for identify, which indicates that HMB-45 is regarded as the most sensitive reagent. Complete resection served as mainstay of treatment, while chemotherapy should be unanimously considered to apply in malignant

  3. Therapeutic approaches to the treatment of recurrent respiratory papillomatosis of the aerodigestive tract (a clinical study)

    PubMed Central

    Avramov, Toma; Vetckova, Evelina; Nikolova, Maria; Valev, Dinko; Manolova, Antoaneta; Tafradgiiska, Maya; Kostadinov, Dimitar; Tchalacov, Ivan

    2014-01-01

    Recurrent respiratory papillomatosis (RRP) is a rare disease, characterized by recurrent proliferation of benign squamous cell papillomas in the larynx as well as in the other parts of the aerodigestive tract. We have compared different treatment options for RRP of the aerodigestive tract including surgical, conservative and combined approaches. A total of 43 patients with papillomatosis that received a combined therapy were followed in the period from 2009 to 2013. The treatment included electrosurgery and CO2 laser surgery alongside with either immunotherapy with Bacillus Calmette-Guerin (BCG) (Calgevax) or α-interferon. In the control group without immunotherapy (n = 16) we used conventional microlaryngeal surgery. During the follow-up, relapse occurred in two patients for the CO2 laser surgery with Calgevax immunotherapy group (n = 16). In the group treated with α-interferon preceded by CO2 laser surgery (n = 9) and electrosurgery (n = 2), relapse had occurred in three patients. Among the control group, recurrence was observed in six patients. This required re-operation. Our data showed a three times more frequent relapses among patients who were operated with conventional surgery as compared to those operated with CO2 laser surgery and Calgevax immunotherapy, and two times more often relapses in patients operated with conventional surgery as compared to those with electrosurgery and CO2 laser surgery and application of α-interferon therapy. Conventional and laser surgeries have a palliative effect, though playing an important role in ensuring the airway patency. While specific antivirus treatment for human papilloma viruses does not exist, the immune modulation with Calgevax considerably reduces the frequency of relapses, by stimulating cellular immune effector mechanisms. The combined protocol allows rarefication of relapses and improvement of patients’ quality of life, but not complete healing. PMID:26692782

  4. Identification of genital tract markers in the human seminal plasma using an integrative genomics approach.

    PubMed

    Rolland, A D; Lavigne, R; Dauly, C; Calvel, P; Kervarrec, C; Freour, T; Evrard, B; Rioux-Leclercq, N; Auger, J; Pineau, C

    2013-01-01

    Can protein biomarkers of the male genital tract be identified in human seminal plasma? We identified potential biomarkers for each of the organs participating in the secretions of the human seminal plasma. The seminal plasma fulfills critical functions for fertility by providing spermatozoa with a protective milieu, promoting their final maturation and modulating the immune responsiveness of the female reproductive tract. It is also considered to be a promising source of biomarkers of male infertility and/or pathologies of the male genital tract. This study combines proteomic analyses of normal seminal plasma together with transcriptomic gene expression profiling of human healthy tissues. Non-liquefied seminal plasma proteins from a healthy donor were prefractionated using two sequential Proteominer™ libraries. Eight subproteome fractions were collected, trypsin digested and subjected to three successive mass spectrometry analyses for peptide characterization. The list of identified proteins was compared with and merged with other available data sets of the human seminal plasma proteome. The expression of corresponding genes was then investigated using tissue transcriptome profiles to determine where, along the male reproductive tract, these proteins were produced. Finally, tissue specificity of a selected subset of biomarker candidates was validated on human tissues. We first performed a proteomic analysis of the human seminal plasma and identified 699 proteins. By comparing our protein list with other previous proteomic data sets, we found that 2545 unique proteins have been described so far in the human seminal plasma. We then profiled their expression at the gene level and identified 83 testis, 42 epididymis, 7 seminal vesicle and 17 prostate candidate protein markers. For a subset of testis-specific candidates, i.e. TKTL1, LDHC and PGK2, we further validated their germ cell expression and demonstrated that such markers could distinguish between semen from

  5. Novel Approaches to Preventing Urinary Tract Infection in Women

    DTIC Science & Technology

    2000-09-01

    culturing VECs) as well as McCoy mouse fibroblast cells were used as positive controls in the anti-fibroblast antibody assays. Cultures of VEC cultures... fucosyltransferase was identified in Helicobacter a genomic fragment of 1295 bp derived by PCR with primer pair HCRS122 (5’-CCAGCCTTGGCTCTGGCTGATG) and HCRS126 (5...8217- pylor using a short sequence motif conserved among mamma- CCCGGTGGCAGCTCGGGCCTC) located downstream and upstream lian a3- fucosyltransferases (14

  6. Natural approaches to prevention and treatment of infections of the lower urinary tract.

    PubMed

    Head, Kathleen A

    2008-09-01

    Infections of the lower urinary tract are common occurrences in young women, during pregnancy, and in peri- and postmenopausal women. Because of the chronic nature of urinary tract infections (UTIs) and the potential for antibiotic resistance, a natural approach to prevention and treatment is desirable. Clinical research suggests the best natural options for long-term prevention include cranberry, mannose, and probiotics. Botanicals that can be effective at the first sign of an infection and for short-term prophylaxis include berberine and uva ursi. Estriol cream and vitamins A and C have also been shown to prevent UTIs, while potassium salts can alkalinize the urine and reduce dysuria.

  7. T cell immunity in the teleost digestive tract.

    PubMed

    Tafalla, Carolina; Leal, Esther; Yamaguchi, Takuya; Fischer, Uwe

    2016-11-01

    Fish (along with cyclostomes) constitute the most ancient animal group in which an acquired immune system is present. As in higher vertebrates, both B and T lymphocytes cooperate in implementing an adequate response. Although there is still a debate on whether fish possess a true gut associated lymphoid tissue (GALT), the presence of diffuse B and T lymphocytes throughout all mucosal surfaces has been demonstrated in a wide variety of fish species. The lack of antibodies against T lymphocyte markers has hampered the performance of functional assays in both systemic and mucosal compartments. However, most components associated with T lymphocyte function have been identified in fish through extensive genomic research, suggesting similar functionalities for fish and mammalian T lymphocytes. Thus, the aim of this review is to briefly summarize what is known in teleost concerning the characteristics and functionalities of the different T cell subsets, to then focus on what is known to date regarding their presence and role in the gastrointestinal tract, through either direct functional assays or indirectly by conclusions drawn from transcriptomic analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Unraveling the pathogenesis of ARX polyalanine tract variants using a clinical and molecular interfacing approach

    PubMed Central

    Marques, Isabel; Sá, Maria João; Soares, Gabriela; Mota, Maria do Céu; Pinheiro, Carla; Aguiar, Lisa; Amado, Marta; Soares, Christina; Calado, Angelina; Dias, Patrícia; Sousa, Ana Berta; Fortuna, Ana Maria; Santos, Rosário; Howell, Katherine B; Ryan, Monique M; Leventer, Richard J; Sachdev, Rani; Catford, Rachael; Friend, Kathryn; Mattiske, Tessa R; Shoubridge, Cheryl; Jorge, Paula

    2015-01-01

    The Aristaless-related homeobox (ARX) gene is implicated in intellectual disability with the most frequent pathogenic mutations leading to expansions of the first two polyalanine tracts. Here, we describe analysis of the ARX gene outlining the approaches in the Australian and Portuguese setting, using an integrated clinical and molecular strategy. We report variants in the ARX gene detected in 19 patients belonging to 17 families. Seven pathogenic variants, being expansion mutations in both polyalanine tract 1 and tract 2, were identifyed, including a novel mutation in polyalanine tract 1 that expands the first tract to 20 alanines. This precise number of alanines is sufficient to cause pathogenicity when expanded in polyalanine tract 2. Five cases presented a probably non-pathogenic variant, including the novel HGVS: c.441_455del, classified as unlikely disease causing, consistent with reports that suggest that in frame deletions in polyalanine stretches of ARX rarely cause intellectual disability. In addition, we identified five cases with a variant of unclear pathogenic significance. Owing to the inconsistent ARX variants description, publications were reviewed and ARX variant classifications were standardized and detailed unambiguously according to recommendations of the Human Genome Variation Society. In the absence of a pathognomonic clinical feature, we propose that molecular analysis of the ARX gene should be included in routine diagnostic practice in individuals with either nonsyndromic or syndromic intellectual disability. A definitive diagnosis of ARX-related disorders is crucial for an adequate clinical follow-up and accurate genetic counseling of at-risk family members. PMID:26029707

  9. Inhibition of histone deacetylase for the treatment of biliary tract cancer: A new effective pharmacological approach

    PubMed Central

    Bluethner, Thilo; Niederhagen, Manuel; Caca, Karel; Serr, Frederik; Witzigmann, Helmut; Moebius, Christian; Mossner, Joachim; Wiedmann, Marcus

    2007-01-01

    AIM: To investigate in vitro and in vivo therapeutic effects of histone deacetylase inhibitors NVP-LAQ824 and NVP-LBH589 on biliary tract cancer. METHODS: Cell growth inhibition by NVP-LAQ824 and NVP-LBH589 was studied in vitro in 7 human biliary tract cancer cell lines by MTT assay. In addition, the anti-tumoral effect of NVP-LBH589 was studied in a chimeric mouse model. Anti-tumoral drug mechanism was assessed by immunoblotting for acH4 and p21WAF-1/CIP-1, PARP assay, cell cycle analysis, TUNEL assay, and immunhistochemistry for MIB-1. RESULTS: In vitro treatment with both compounds significantly suppressed the growth of all cancer cell lines [mean IC50 (3 d) 0.11 and 0.05 μmol/L, respectively], and was associated with hyperacetylation of nucleosomal histone H4, increased expression of p21WAF-1/CIP-1, induction of apoptosis (PARP cleavage), and cell cycle arrest at G2/M checkpoint. After 28 d, NVP-LBH589 significantly reduced tumor mass by 66% (bile duct cancer) and 87% (gallbladder cancer) in vivo in comparison to placebo, and potentiated the efficacy of gemcitabine. Further analysis of the tumor specimens revealed increased apoptosis by TUNEL assay and reduced cell proliferation (MIB-1). CONCLUSION: Our findings suggest that NVP-LBH589 and NVP-LAQ824 are active against human biliary tract cancer in vitro. In addition, NVP-LBH589 demonstrated significant in vivo activity and potentiated the efficacy of gemcitabine. Therefore, further clinical evaluation of this new drug for the treatment of biliary tract cancer is recommended. PMID:17729398

  10. The Importance of Interstitial Cells of Cajal in the Gastrointestinal Tract

    PubMed Central

    Al-Shboul, Othman A.

    2013-01-01

    Gastrointestinal (GI) motility function and its regulation is a complex process involving collaboration and communication of multiple cell types such as enteric neurons, interstitial cells of Cajal (ICC), and smooth muscle cells. Recent advances in GI research made a better understanding of ICC function and their role in the GI tract, and studies based on different types of techniques have shown that ICC, as an integral part of the GI neuromuscular apparatus, transduce inputs from enteric motor neurons, generate intrinsic electrical rhythmicity in phasic smooth muscles, and have a mechanical sensation ability. Absence or improper function of these cells has been linked to some GI tract disorders. This paper provides a general overview of ICC; their discovery, subtypes, function, locations in the GI tract, and some disorders associated with their loss or disease, and highlights some controversial issues with regard to the importance of ICC in the GI tract. PMID:23319032

  11. Recent achievements in stem cell therapy for pediatric gastrointestinal tract disease.

    PubMed

    Bae, Sun Hwan

    2013-03-01

    The field of stem cell research has been rapidly expanding. Although the clinical usefulness of research remains to be ascertained through human trials, the use of stem cells as a therapeutic option for currently disabling diseases holds fascinating potential. Many pediatric gastrointestinal tract diseases have defect in enterocytes, enteric nervous system cells, smooth muscles, and interstitial cells of Cajal. Various kinds of therapeutic trials using stem cells could be applied to these diseases. This review article focuses on the recent achievements in stem cell applications for pediatric gastrointestinal tract diseases.

  12. Recent Achievements in Stem Cell Therapy for Pediatric Gastrointestinal Tract Disease

    PubMed Central

    2013-01-01

    The field of stem cell research has been rapidly expanding. Although the clinical usefulness of research remains to be ascertained through human trials, the use of stem cells as a therapeutic option for currently disabling diseases holds fascinating potential. Many pediatric gastrointestinal tract diseases have defect in enterocytes, enteric nervous system cells, smooth muscles, and interstitial cells of Cajal. Various kinds of therapeutic trials using stem cells could be applied to these diseases. This review article focuses on the recent achievements in stem cell applications for pediatric gastrointestinal tract diseases. PMID:24010100

  13. Lung dendritic cells induce migration of protective T cells to the gastrointestinal tract.

    PubMed

    Ruane, Darren; Brane, Lucas; Reis, Bernardo Sgarbi; Cheong, Cheolho; Poles, Jordan; Do, Yoonkyung; Zhu, Hongfa; Velinzon, Klara; Choi, Jae-Hoon; Studt, Natalie; Mayer, Lloyd; Lavelle, Ed C; Steinman, Ralph M; Mucida, Daniel; Mehandru, Saurabh

    2013-08-26

    Developing efficacious vaccines against enteric diseases is a global challenge that requires a better understanding of cellular recruitment dynamics at the mucosal surfaces. The current paradigm of T cell homing to the gastrointestinal (GI) tract involves the induction of α4β7 and CCR9 by Peyer's patch and mesenteric lymph node (MLN) dendritic cells (DCs) in a retinoic acid-dependent manner. This paradigm, however, cannot be reconciled with reports of GI T cell responses after intranasal (i.n.) delivery of antigens that do not directly target the GI lymphoid tissue. To explore alternative pathways of cellular migration, we have investigated the ability of DCs from mucosal and nonmucosal tissues to recruit lymphocytes to the GI tract. Unexpectedly, we found that lung DCs, like CD103(+) MLN DCs, up-regulate the gut-homing integrin α4β7 in vitro and in vivo, and induce T cell migration to the GI tract in vivo. Consistent with a role for this pathway in generating mucosal immune responses, lung DC targeting by i.n. immunization induced protective immunity against enteric challenge with a highly pathogenic strain of Salmonella. The present report demonstrates novel functional evidence of mucosal cross talk mediated by DCs, which has the potential to inform the design of novel vaccines against mucosal pathogens.

  14. An Extremely Rare Case of Advanced Metastatic Small Cell Neuroendocrine Carcinoma of Sinonasal Tract.

    PubMed

    Thar, Yu Yu; Patel, Poras; Huang, Tiangui; Guevara, Elizabeth

    2016-01-01

    Small cell neuroendocrine carcinoma (SNEC) is a rare form of malignancy. It mainly presents as bronchogenic neoplasm, and the extrapulmonary form accounts for only 0.1% to 0.4% of all cancers. These extrapulmonary tumors have been described most frequently in the urinary bladder, prostate, esophagus, stomach, colon and rectum, gall bladder, head and neck, cervix, and skin. Primary SNEC of the sinonasal tract is extremely rare with only less than 100 cases reported in the literature. Because of extreme rarity and aggressiveness of the tumor, the management for this entity varies considerably mandating multimodality approach. In this paper, we report a patient presented with left-sided facial swelling, and the histopathologic examination confirmed primary SNEC of left sinonasal tract. The tumor involved multiple paranasal sinuses with invasion into the left orbit and left infratemporal fossa and metastasized to cervical lymph nodes and bone. The patient encountered devastating outcome in spite of optimal medical management and treatment with palliative chemotherapy highlighting the necessity for further research of primary SNEC of head and neck.

  15. An Extremely Rare Case of Advanced Metastatic Small Cell Neuroendocrine Carcinoma of Sinonasal Tract

    PubMed Central

    Guevara, Elizabeth

    2016-01-01

    Small cell neuroendocrine carcinoma (SNEC) is a rare form of malignancy. It mainly presents as bronchogenic neoplasm, and the extrapulmonary form accounts for only 0.1% to 0.4% of all cancers. These extrapulmonary tumors have been described most frequently in the urinary bladder, prostate, esophagus, stomach, colon and rectum, gall bladder, head and neck, cervix, and skin. Primary SNEC of the sinonasal tract is extremely rare with only less than 100 cases reported in the literature. Because of extreme rarity and aggressiveness of the tumor, the management for this entity varies considerably mandating multimodality approach. In this paper, we report a patient presented with left-sided facial swelling, and the histopathologic examination confirmed primary SNEC of left sinonasal tract. The tumor involved multiple paranasal sinuses with invasion into the left orbit and left infratemporal fossa and metastasized to cervical lymph nodes and bone. The patient encountered devastating outcome in spite of optimal medical management and treatment with palliative chemotherapy highlighting the necessity for further research of primary SNEC of head and neck. PMID:27529044

  16. Clear cell adenocarcinoma of the renal pelvis: an extremely rare neoplasm of the upper urinary tract.

    PubMed

    Liu, K-W; Lin, V C-H; Chang, I-W

    2013-12-01

    Clear cell adenocarcinoma (CCA) in the urinary tract is a rare neoplasm morphologically identical to the Müllerian counterpart. Clear cell adenocarcinoma is extremely rare in the upper urinary tract. We present a case with CCA of the renal pelvis. Microscopically, the tumor exhibited exophytic growth with predominantly tubulocystic structures, as well as solid and papillary patterns. The neoplastic cells were cuboidal with clear to pale eosinophilic cytoplasm and abundant intracellular and extracellular eosinophilic hyaline globules. By immunohistochemically, the tumor was labeled by cytokeratins and hepatocyte nuclear factor-1β. The patient was still alive without evidence of recurrence in the follow-up period of nineteen months after diagnosis.

  17. Effectiveness of syndromic approach in management of reproductive tract infections in women.

    PubMed

    Singh, M M; Devi, R; Garg, S; Mehra, M

    2001-04-01

    Syndromic approach was used to identify reproductive tract infections (RTI) by a trained public health nurse among 130 ever-married women aged 15-45 years selected by a systematic random sampling method in a resettlement colony, Chandigarh. A lady medical officer in the dispensary examined and treated 48 (37%) referred symptomatic women as per syndromic approach guidelines. They were suffering from vaginitis (52.1%), cervicitis (20.8%), pelvic inflammatory disease (PID) (14.6%), urinary tract infections and PID (4.2%) and 4 did not have any clinical abnormality. Poor menstrual hygiene was observed among 72.7% women with RTI. Follow-up done after one month showed effectiveness in terms of symptomatic relied in 72.7% while 9.1% discontinued treatment and 4.5% did not comply with the medications. Training of nurses, health workers, dais, anganwadi workers regarding RTI identification and referral using syndromic approach and promotion of menstrual hygiene, genital hygiene and health care seeking behaviour would help in reducing the burden of RTI in the community.

  18. The role of the epithelial cell in Escherichia coli induced neutrophil migration into the urinary tract.

    PubMed

    Agace, W W

    1996-08-01

    Neutrophil influx to mucosal surfaces represents one of the earliest inflammatory responses to mucosal infection. We have been studying external interactions with urinary tract epithelial cells in an attempt to understand the molecular mechanisms behind this process. Uropathogenic Escherichia coli induced urinary tract epithelial cells to secrete the neutrophil chemoattractant interleukin-8 (IL-8). IL-8 secretion was higher in response to isogenic strains expressing type 1 or P fimbriae that adhered to the epithelial surface. Deliberate colonization of the human urinary tract with E. coli induced the local production of IL-8 and levels correlated with urinary neutrophil numbers suggesting a role for IL-8 in neutrophil migration. E. coli induced neutrophil migration across urinary tract epithelial layers in vitro, and this process was blocked with anti-IL-8 antibody. IL-8's activity was localized to the epithelial surface. Furthermore, these cells were shown to constitutively express IL-8 receptor A and B messenger ribonucleic acid (mRNA), suggesting a possible role for IL-8 on epithelial cell function. E. coli enhanced the expression of intercellular adhesion molecule-1 (ICAM-1) on urinary tract epithelial cells, and neutrophil migration across urinary tract epithelial layers in vitro was dependent on epithelial ICAM-1 and neutrophil Mac-1 (CD11b/CD18) expression. These results suggest that bacterial/epithelial cell interactions play a key role in the induction of neutrophil migration during mucosal infection, and show the necessity for host-derived chemotactic factors and cell adhesion events in E. coli induced transuroepithelial migration in vitro.

  19. Effects of androgen receptor polyglutamine tract expansion on proliferation of NG108-15 cells.

    PubMed

    Nakajima, H; Kimura, F; Nakagawa, T; Ikemoto, T; Furutama, D; Shinoda, K; Kato, S; Shimizu, A; Ohsawa, N

    1997-01-31

    Expansion of the polyglutamine tracts in the androgen receptor (AR) has been recognized as a cause of X-linked spinal and bulbar muscular atrophy (SBMA). In the present study, NG108-15 cells were stably transfected with expression vectors coding for either the wild type (WT) AR gene (CAG repeat number = 22) or a mutated (MT) AR gene (CAG repeat number = 52). Cells proliferation and cell cycle parameters were evaluated for NG108-15-WT and NG108-15-MT cells in the presence or absence of androgen. NG108-15-WT cells demonstrated an androgen-dependent increase in cell number, while NG108-15-MT cells did not. Our results demonstrate that expansion of polyglutamine tracts in the AR may affect the proliferation and differentiation of nerve cells.

  20. Visualization of Proteus mirabilis morphotypes in the urinary tract: the elongated swarmer cell is rarely observed in ascending urinary tract infection.

    PubMed

    Jansen, Angela M; Lockatell, C Virginia; Johnson, David E; Mobley, Harry L T

    2003-06-01

    Proteus mirabilis, a common cause of nosocomial and catheter-associated urinary tract infection, colonizes the bladder and ascends the ureters to the proximal tubules of the kidneys, leading to the development of acute pyelonephritis. P. mirabilis is capable of swarming, a form of multicellular behavior in which bacteria differentiate from the short rod typical of members of the family Enterobacteriaceae, termed the swimmer cell, into hyperflagellated elongated bacteria capable of rapid and coordinated population migration across surfaces, called the swarmer cell. There has been considerable debate as to which morphotype predominates during urinary tract infection. P. mirabilis(pBAC001), which expresses green fluorescent protein in both swimming and swarming morphotypes, was constructed to quantify the prevalence of each morphotype in ascending urinary tract infection. Transurethral inoculation of P. mirabilis(pBAC001) resulted in ascending urinary tract infection and kidney pathology in mice examined at both 2 and 4 days postinoculation. Using confocal microscopy, we were able to investigate the morphotypes of the bacteria in the urinary tract. Of 5,087 bacteria measured in bladders, ureters, and kidneys, only 7 (0.14%) were identified as swarmers. MR/P fimbria expression, which correlates with the swimmer phenotype, is prevalent on bacteria in the ureters and bladder. We conclude that, by far, the predominant morphotype present in the urinary tract during ascending infection is the short rod-the swimmer cell.

  1. Visualization of Proteus mirabilis Morphotypes in the Urinary Tract: the Elongated Swarmer Cell Is Rarely Observed in Ascending Urinary Tract Infection

    PubMed Central

    Jansen, Angela M.; Lockatell, C. Virginia; Johnson, David E.; Mobley, Harry L. T.

    2003-01-01

    Proteus mirabilis, a common cause of nosocomial and catheter-associated urinary tract infection, colonizes the bladder and ascends the ureters to the proximal tubules of the kidneys, leading to the development of acute pyelonephritis. P. mirabilis is capable of swarming, a form of multicellular behavior in which bacteria differentiate from the short rod typical of members of the family Enterobacteriaceae, termed the swimmer cell, into hyperflagellated elongated bacteria capable of rapid and coordinated population migration across surfaces, called the swarmer cell. There has been considerable debate as to which morphotype predominates during urinary tract infection. P. mirabilis(pBAC001), which expresses green fluorescent protein in both swimming and swarming morphotypes, was constructed to quantify the prevalence of each morphotype in ascending urinary tract infection. Transurethral inoculation of P. mirabilis(pBAC001) resulted in ascending urinary tract infection and kidney pathology in mice examined at both 2 and 4 days postinoculation. Using confocal microscopy, we were able to investigate the morphotypes of the bacteria in the urinary tract. Of 5,087 bacteria measured in bladders, ureters, and kidneys, only 7 (0.14%) were identified as swarmers. MR/P fimbria expression, which correlates with the swimmer phenotype, is prevalent on bacteria in the ureters and bladder. We conclude that, by far, the predominant morphotype present in the urinary tract during ascending infection is the short rod-the swimmer cell. PMID:12761147

  2. The mucosa of the digestive tract in Micropogonias furnieri: a light and electron microscope approach.

    PubMed

    Diaz, A O; García, A M; Figueroa, D E; Goldemberg, A L

    2008-08-01

    The histomorphological aspects as well as the histochemical content and distribution of glycoproteins (GPs) in the mucosa of the digestive tract of the white croaker Micropogonias furnieri were studied. The buccopharyngeal cavity and the esophagous showed a squamous stratified epithelium with mucous cells. The stomach presented three portions: cardias, fundus and pylorus. Tubular glands formed by a single type of gland cell were located along the cardias and fundus. Histochemical tests showed that the buccopharyngeal cavity and the esophagous presented the largest amount of the different types of mucosubstances. Both organs showed abundant secretory mucous cells that synthesize large quantities of neutral, sulphated and sialylated GPs. The surface epithelium in the cardias and fundus synthesized and secreted scarce sialylated and neutral GPs whereas the secretions of the apical surface were abundant. The pylorus secreted large amounts of neutral as well as sulphated and sialylated GPs. Gland cells secreted neutral GPs. The ultrastructural features of the gut cells were quite similar to those of other teleosts. The buccopharyngeal cavity and the esophagous surface epithelial cells, identified by their superficial localization, were characterized by cytoplasmic vesicles of different size. Abundant goblet cells with secretory mucous granules were also present. Gastric glands in the stomach contained just one form of cell with a fine structure similar to cells that secrete pepsinogen.

  3. Epithelial cell tumors of the hen reproductive tract.

    PubMed

    Harris, Elizabeth A; Fletcher, Oscar J; Anderson, Kenneth E; Petitte, James N; Kopelovich, Levy; Mozdziak, Paul E

    2014-03-01

    There is a paucity of preclinical models that simulate the development of ovarian tumors in humans. At present, the egg-laying hen appears to be the most promising model to study the spontaneous occurrence of ovarian tumors in the clinical setting. Although gross classification and histologic grade of tumors have been used prognostically in women with ovarian tumors, there is currently no single system that is universally used to classify reproductive tumors in the hen. Four hundred and one 192-wk-old egg-laying hens were necropsied to determine the incidence of reproductive tumors using both gross pathology and histologic classification. Gross pathologic classifications were designated as follows: birds presenting with ovarian tumors only (class 1), those presenting with oviductal and ovarian tumors (class 2), those with ovarian and oviductal tumors that metastasized to the gastrointestinal tract (class 3), those with ovarian and oviductal tumors that metastasized to the gastrointestinal tract and other distant organs (class 4), those with oviductal tumors only (class 5), those with oviductal tumors that metastasized to other organs with no ovarian involvement (class 6), and those with ovarian tumors that metastasized to other organs with no oviductal involvement (class 7), including birds with gastrointestinal tumors and no reproductive involvement (GI only) and those with no tumors (normal). Histopathologic classifications range from grades 1 to 3 and are based on mitotic developments and cellular differentiation. An updated gross pathology and histologic classification systems for the hen reproductive malignancies provides a method to report the range of reproductive tumors revealed in a flock of aged laying hens.

  4. Spectrum of bacterial colonization associated with urothelial cells from patients with chronic lower urinary tract symptoms.

    PubMed

    Khasriya, Rajvinder; Sathiananthamoorthy, Sanchutha; Ismail, Salim; Kelsey, Michael; Wilson, Mike; Rohn, Jennifer L; Malone-Lee, James

    2013-07-01

    Chronic lower urinary tract symptoms (LUTS), such as urgency and incontinence, are common, especially among the elderly, but their etiology is often obscure. Recent studies of acute urinary tract infections implicated invasion by Escherichia coli into the cytoplasm of urothelial cells, with persistence of long-term bacterial reservoirs, but the role of infection in chronic LUTS is unknown. We conducted a large prospective study with eligible patients with LUTS and controls over a 3-year period, comparing routine urine cultures of planktonic bacteria with cultures of shed urothelial cells concentrated in centrifuged urinary sediments. This comparison revealed large numbers of bacteria undetected by routine cultures. Next, we typed the bacterial species cultured from patient and control sediments under both aerobic and anaerobic conditions, and we found that the two groups had complex but significantly distinct profiles of bacteria associated with their shed bladder epithelial cells. Strikingly, E. coli, the organism most responsible for acute urinary tract infections, was not the only or even the main offending pathogen in this more-chronic condition. Antibiotic protection assays with shed patient cells and in vitro infection studies using patient-derived strains in cell culture suggested that LUTS-associated bacteria are within or extremely closely associated with shed epithelial cells, which explains how routine cultures might fail to detect them. These data have strong implications for the need to rethink our common diagnoses and treatments of chronic urinary tract symptoms.

  5. Innate lymphoid cells and natural killer T cells in the gastrointestinal tract immune system.

    PubMed

    Montalvillo, Enrique; Garrote, José Antonio; Bernardo, David; Arranz, Eduardo

    2014-05-01

    The gastrointestinal tract is equipped with a highly specialized intrinsic immune system. However, the intestine is exposed to a high antigenic burden that requires a fast, nonspecific response -so-called innate immunity- to maintain homeostasis and protect the body from incoming pathogens. In the last decade multiple studies helped to unravel the particular developmental requirements and specific functions of the cells that play a role in innate immunity. In this review we shall focus on innate lymphoid cells, a newly discovered, heterogeneous set of cells that derive from an Id2-dependent lymphoid progenitor cell population. These cells have been categorized on the basis of the pattern of cytokines that they secrete, and the transcription factors that regulate their development and functions. Innate lymphoid cells play a role in the early response to pathogens, the anatomical contention of the commensal flora, and the maintenance of epithelial integrity.Amongst the various innate lymphoid cells we shall lay emphasis on a subpopulation with several peculiarities, namely that of natural killer T cells, a subset of T lymphocytes that express both T-cell and NK-cell receptors. The most numerous fraction of the NKT population are the so-called invariant NKT or iNKT cells. These iNKT cells have an invariant TCR and recognize the glycolipidic structures presented by the CD1d molecule, a homolog of class-I MHC molecules. Following activation they rapidly acquire cytotoxic activity and secrete both Th1 and Th2 cytokines, including IL-17. While their specific role is not yet established, iNKT cells take part in a great variety of intestinal immune responses ranging from oral tolerance to involvement in a number of gastrointestinal conditions.

  6. LAP2 Is Widely Overexpressed in Diverse Digestive Tract Cancers and Regulates Motility of Cancer Cells

    PubMed Central

    Han, Myoung-Eun; Baek, Sungmin; Sim, Hey-Eun; Yoon, Sik; Baek, Sun-Yong; Kim, Bong-Seon; Kim, Jeong-Hwan; Kim, Seon-Young; Oh, Sae-Ock

    2012-01-01

    Background Lamina-associated polypeptides 2 (LAP2) is a nuclear protein that connects the nuclear lamina with chromatin. Although its critical roles in genetic disorders and hematopoietic malignancies have been described, its expression and roles in digestive tract cancers have been poorly characterized. Methods To examine the expression of LAP2 in patient tissues, we performed immunohistochemistry and real-time PCR. To examine motility of cancer cells, we employed Boyden chamber, wound healing and Matrigel invasion assays. To reveal its roles in metastasis in vivo, we used a liver metastasis xenograft model. To investigate the underlying mechanism, a cDNA microarray was conducted. Results Immunohistochemistry in patient tissues showed widespread expression of LAP2 in diverse digestive tract cancers including stomach, pancreas, liver, and bile duct cancers. Real-time PCR confirmed that LAP2β is over-expressed in gastric cancer tissues. Knockdown of LAP2β did not affect proliferation of most digestive tract cancer cells except pancreatic cancer cells. However, knockdown of LAP2β decreased motility of all tested cancer cells. Moreover, overexpression of LAP2β increased motility of gastric and pancreatic cancer cells. In the liver metastasis xenograft model, LAP2β increased metastatic efficacy of gastric cancer cells and mortality in tested mice. cDNA microarrays showed the possibility that myristoylated alanine-rich C kinase substrate (MARCKS) and interleukin6 (IL6) may mediate LAP2β-regulated motility of cancer cells. Conclusions From the above results, we conclude that LAP2 is widely overexpressed in diverse digestive tract cancers and LAP2β regulates motility of cancer cells and suggest that LAP2β may have utility for diagnostics and therapeutics in digestive tract cancers. PMID:22745766

  7. Distribution of CD163-positive cell and MHC class II-positive cell in the normal equine uveal tract.

    PubMed

    Sano, Yuto; Matsuda, Kazuya; Okamoto, Minoru; Takehana, Kazushige; Hirayama, Kazuko; Taniyama, Hiroyuki

    2016-02-01

    Antigen-presenting cells (APCs) in the uveal tract participate in ocular immunity including immune homeostasis and the pathogenesis of uveitis. In horses, although uveitis is the most common ocular disorder, little is known about ocular immunity, such as the distribution of APCs. In this study, we investigated the distribution of CD163-positive and MHC II-positive cells in the normal equine uveal tract using an immunofluorescence technique. Eleven eyes from 10 Thoroughbred horses aged 1 to 24 years old were used. Indirect immunofluorescence was performed using the primary antibodies CD163, MHC class II (MHC II) and CD20. To demonstrate the site of their greatest distribution, positive cells were manually counted in 3 different parts of the uveal tract (ciliary body, iris and choroid), and their average number was assessed by statistical analysis. The distribution of pleomorphic CD163- and MHC II-expressed cells was detected throughout the equine uveal tract, but no CD20-expressed cells were detected. The statistical analysis demonstrated the distribution of CD163- and MHC II-positive cells focusing on the ciliary body. These results demonstrated that the ciliary body is the largest site of their distribution in the normal equine uveal tract, and the ciliary body is considered to play important roles in uveal and/or ocular immune homeostasis. The data provided in this study will help further understanding of equine ocular immunity in the normal state and might be beneficial for understanding of mechanisms of ocular disorders, such as equine uveitis.

  8. Small cell neuroendocrine carcinoma of the urinary tract successfully managed with neoadjuvant chemotherapy.

    PubMed

    Ahsaini, Mustapha; Riyach, Omar; Tazi, Mohammed Fadl; El Fassi, Mohammed Jamal; Farih, My Hassan; Elfatmi, Hind; Amarti, Afaf

    2013-01-01

    Introduction. Small cell neuroendocrine carcinomas of the urinary tract is an extremely rare entity and very few cases have been reported in the literature. Small cell neuroendocrine carcinoma of the urinary tract (SCC-UT) is the association between bladder and urinary upper tract-small cell carcinoma (UUT-SCC). It characterized by an aggressive clinical course. The prognosis is poor due to local or distant metastases, and usually the muscle of the bladder is invaded. Case Presentation. We report a rare case of a 54-year-old Arab male native of moroccan; he is a smoker and was referred to our institution for intermittent hematuria. Following a diagnosis of small cell neuroendocrine carcinomas of the ureter and the bladder, thoracoabdominal-pelvic CT was done, and the staging of the tumor was done in the bladder (T2N0M0) and (T1N0M0) in the ureter. Neoadjuvant alternating doublet chemotherapy with ifosfamide/doxorubicin and etoposide/cisplatin was realized, and nephroureterectomy associated to a cystoprostatectomy was carried out. After 24 months of followup, no local or distant metastasis was detected. Conclusion. The purpose of this review is to present a rare case of pure small cell neuroendocrine carcinoma of the urinary tract and review the literature about the place of neoadjuvant chemotherapy in this rare tumors.

  9. Small Cell Neuroendocrine Carcinoma of the Urinary Tract Successfully Managed with Neoadjuvant Chemotherapy

    PubMed Central

    Ahsaini, Mustapha; Riyach, Omar; Tazi, Mohammed Fadl; El Fassi, Mohammed Jamal; Farih, My Hassan; Elfatmi, Hind; Amarti, Afaf

    2013-01-01

    Introduction. Small cell neuroendocrine carcinomas of the urinary tract is an extremely rare entity and very few cases have been reported in the literature. Small cell neuroendocrine carcinoma of the urinary tract (SCC-UT) is the association between bladder and urinary upper tract-small cell carcinoma (UUT-SCC). It characterized by an aggressive clinical course. The prognosis is poor due to local or distant metastases, and usually the muscle of the bladder is invaded. Case Presentation. We report a rare case of a 54-year-old Arab male native of moroccan; he is a smoker and was referred to our institution for intermittent hematuria. Following a diagnosis of small cell neuroendocrine carcinomas of the ureter and the bladder, thoracoabdominal-pelvic CT was done, and the staging of the tumor was done in the bladder (T2N0M0) and (T1N0M0) in the ureter. Neoadjuvant alternating doublet chemotherapy with ifosfamide/doxorubicin and etoposide/cisplatin was realized, and nephroureterectomy associated to a cystoprostatectomy was carried out. After 24 months of followup, no local or distant metastasis was detected. Conclusion. The purpose of this review is to present a rare case of pure small cell neuroendocrine carcinoma of the urinary tract and review the literature about the place of neoadjuvant chemotherapy in this rare tumors. PMID:24024065

  10. CD4+ T-cell survival in the GI tract requires dectin-1 during fungal infection

    PubMed Central

    Drummond, R A; Dambuza, I M; Vautier, S; Taylor, J A; Reid, D M; Bain, C C; Underhill, D M; Masopust, D; Kaplan, D H; Brown, G D

    2016-01-01

    Dectin-1 is an innate antifungal C-type lectin receptor necessary for protective antifungal immunity. We recently discovered that Dectin-1 is involved in controlling fungal infections of the gastrointestinal (GI) tract, but how this C-type lectin receptor mediates these activities is unknown. Here, we show that Dectin-1 is essential for driving fungal-specific CD4+ T-cell responses in the GI tract. Loss of Dectin-1 resulted in abrogated dendritic cell responses in the mesenteric lymph nodes (mLNs) and defective T-cell co-stimulation, causing substantial increases in CD4+ T-cell apoptosis and reductions in the cellularity of GI-associated lymphoid tissues. CD8+ T-cell responses were unaffected by Dectin-1 deficiency. These functions of Dectin-1 have significant implications for our understanding of intestinal immunity and susceptibility to fungal infections. PMID:26349660

  11. [Protocol for ureteroscopy in the diagnosis and treatment of the upper urinary tract transitional cell carcinoma].

    PubMed

    Palou, Juan; Vicente, José; Segarra, José; Huguet, Jorge; Salvador, José; Villavicencio, Humberto

    2004-04-01

    Since Pérez-Castro and Martínez-Piñeiro initiated diagnostic and therapeutic ureteroscopy this technique has gained a place in the management of upper urinary tract tumors. Improvement of the equipment (rigid and flexible), better diagnosis and knowledge of outcomes and allows to treat a group of patients with transitional cell carcinoma of the ureter and pelvis by the conservative retrograde technique. In this article, we present an overview of indications and management of the upper urinary tract tumor by ureteroscopy.

  12. Transitional cell carcinoma of the upper urinary tract: spectrum of imaging findings.

    PubMed

    Browne, Ronan F J; Meehan, Conor P; Colville, Jane; Power, Raymond; Torreggiani, William C

    2005-01-01

    Transitional cell carcinoma (TCC) accounts for up to 10% of neoplasms of the upper urinary tract and usually manifests as hematuria. Imaging plays an important role in assessment of upper tract disease, unlike in bladder TCC, diagnosis of which is usually made at cystoscopy. Traditional imaging modalities, such as excretory urography, retrograde pyelography, and ultrasonography, still play pivotal roles in diagnosis of upper tract TCC, in combination with endourologic techniques. The multicentric nature of TCC makes assessment of the entire urothelium essential before treatment. The advent of minimally invasive surgery, which allows renal preservation in selected patients, makes accurate tumor staging mandatory to determine the appropriate therapy; staging is usually performed with computed tomography (CT) or magnetic resonance (MR) imaging. Vigilant urologic and radiologic follow-up is warranted to assess for metachronous lesions and recurrence. The emerging technique of CT urography allows detection of urinary tract tumors and calculi, assessment of perirenal tissues, and staging of lesions; it may offer the opportunity for one-stop evaluation in the initial assessment of hematuria and in follow-up of TCC. Similar MR imaging protocols can be used in patients who are not candidates for CT urography, although detection of urinary tract calcifications may be suboptimal.

  13. Cerebellar cortical neuron responses evoked from the spinal border cell tract.

    PubMed

    Geborek, Pontus; Spanne, Anton; Bengtsson, Fredrik; Jörntell, Henrik

    2013-01-01

    Spinocerebellar systems are likely to be crucial for cerebellar hallmark functions such as coordination. However, in terms of cerebellar functional analyses, these are perhaps among the least explored systems. The aim of the present study is to achieve activation of a single component of the spinocerebellar systems and to explore to what extent it can influence the spike output of granule cells, Golgi cells, molecular layer (ML) interneurons (stellate and basket cells) and Purkinje cells (PCs). For this purpose, we took advantage of a unique arrangement discovered in neuroanatomical studies, in which the spinal border cell (SBC) component of the ventral spinocerebellar system was found to be the only spinocerebellar tract which ascends in the contralateral lateral funiculus (coLF) and have terminations in sublobulus C1 of the paramedian lobule in the posterior cerebellum. Using electrical stimulation of this tract, we find a subset of the cerebellar cortical neurons in this region to be moderately or powerfully activated. For example, some of our granule cells displayed high intensity responses whereas the majority of the granule cells displayed no response at all. The finding that more than half of the PCs were activated by stimulation of the SBC tract indicated that this system is capable of directly influencing cerebellar cortical output. The implications of these findings for the view of the integrative functions of the cerebellar cortex are discussed.

  14. Utilization and Outcomes of Nephroureterectomy for Upper Tract Urothelial Carcinoma by Surgical Approach.

    PubMed

    Rodriguez, Joseph F; Packiam, Vignesh T; Boysen, William R; Johnson, Scott C; Smith, Zachary L; Smith, Norm D; Shalhav, Arieh L; Steinberg, Gary D

    2017-07-01

    To compare outcomes and survival of open-, robotic-, and laparoscopic nephroureterectomy (ONU, RNU, LNU) using population-based data. Using the National Cancer Database, we identified patients who underwent nephroureterectomy for localized upper tract urothelial carcinoma between 2010 and 2013. Demographic and clinicopathologic characteristics were compared among the three operative approaches. Multivariate regression analyses were used to determine the impact of approach on performance of lymphadenectomy (LND), positive surgical margins (PSM), and overall survival (OS). In total, there were 9401 cases identified for analysis, including 3199 ONU (34%), 2098 RNU (22%), and 4104 LNU (44%). From 2010 to 2013, utilization of RNU increased from 14% to 30%. On multivariate analysis, LND was more likely in RNU (odds ratio [OR] 1.52; p < 0.01) and less likely in LNU (OR 0.77; p < 0.01) compared with ONU. RNU was associated with decreased PSM compared with ONU (OR = 0.73; p = 0.04). After adjusting for other factors, OS was not significantly associated with surgical approach. RNU utilization doubled over the study period. While RNU was associated with greater likelihood of LND performance as well as lower PSM rates when compared with ONU and LNU, surgical approach did not independently affect OS.

  15. Keratinocyte growth factor induces proliferation of hepatocytes and epithelial cells throughout the rat gastrointestinal tract.

    PubMed

    Housley, R M; Morris, C F; Boyle, W; Ring, B; Biltz, R; Tarpley, J E; Aukerman, S L; Devine, P L; Whitehead, R H; Pierce, G F

    1994-11-01

    Keratinocyte growth factor (KGF), a member of the fibroblast growth factor (FGF) family, was identified as a specific keratinocyte mitogen after isolation from a lung fibroblast line. Recently, recombinant (r)KGF was found to influence proliferation and differentiation patterns of multiple epithelial cell lineages within skin, lung, and the reproductive tract. In the present study, we designed experiments to identify additional target tissues, and focused on the rat gastrointestinal (GI) system, since a putative receptor, K-sam, was originally identified in a gastric carcinoma. Expression of KGF receptor and KGF mRNA was detected within the entire GI tract, suggesting the gut both synthesized and responded to KGF. Therefore, rKGF was administered to adult rats and was found to induce markedly increased proliferation of epithelial cells from the foregut to the colon, and of hepatocytes, one day after systemic treatment. Daily treatment resulted in the marked selective induction of mucin-producing cell lineages throughout the GI tract in a dose-dependent fashion. Other cell lineages were either unaffected (e.g., Paneth cells), or relatively decreased (e.g., parietal cells, enterocytes) in rKGF-treated rats. The direct effect of rKGF was confirmed by demonstrating markedly increased carcinoembryonic antigen production in a human colon carcinoma cell line, LIM1899. Serum levels of albumin were specifically and significantly elevated after daily treatment. These results demonstrate rKGF can induce epithelial cell activation throughout the GI tract and liver. Further, endogenous KGF may be a normal paracrine mediator of growth within the gut.

  16. [New approaches in obesity treatment: the gastrointestinal tract as an endocrine organ].

    PubMed

    Silveira Rodríguez, Manuela Belén; Gómez-Pan, Antonio; Carraro Casieri, Raffaele

    2006-09-02

    The gastrointestinal tract, besides digesting and processing nutrients, is now regarded as an endocrine organ able to modulate appetite, satiety, and carbohydrate metabolism. Several enteroendocrine cells produce numerous peptides codifying either orexigenic (ghrelin, orexins) or anorexigenic signals (pancreatic polypeptide, peptide YY, cholecystokinin, amylin, bombesin homologs, apolipoprotein A-IV, glucose-dependent insulinotropic polypeptide, glucagon-like peptide 1, oxyntomodulin), which interact in a complex network with other peripheral signals of energy balance and with different neuropeptides involved in the central control of appetite and energy homeostasis. The growing knowledge of the actions of these gastrointestinal peptides on appetite regulation and carbohydrate metabolism, and subsequent synthesis of analogs, particularly those derived from amylin and incretins, herald a new era in the therapy of 2 closely related diseases, obesity and type 2 diabetes mellitus.

  17. Dendritic cells and macrophages in the uveal tract of the normal mouse eye

    PubMed Central

    McMenamin, P.

    1999-01-01

    BACKGROUND/AIMS—Dendritic cells (DC) and macrophages are components of the immune cell populations in the uveal tract whose density, distribution, turnover, and function may play a role in the maintenance of immunological homeostasis in the eye. Little is known of these cells in the mouse eye despite this being the predominant experimental model in many studies of ocular immune responses and immunoinflammatory mediated eye diseases. The aim of the present study was to obtain further immunophenotypic data on resident tissue macrophages and DC populations in the mouse uveal tract.
METHODS—Pieces of iris, ciliary body, and choroid dissected from perfusion fixed BALB/c mice were incubated whole in a variety of anti-macrophage and DC monoclonal antibodies (mAbs). Labelled cells were visualised using either single or double immunoperoxidase techniques.
RESULTS—Quantitative analysis and double immunolabelling revealed that 80% of F4/80+ cells (a mAb that recognises both DC and macrophages) in the iris are macrophages (SER4+). The iris contained a network of Ia+ cells (412 (SD 130) cells/mm2) of which two thirds appear to be DC. A similar pattern was observed in the ciliary body and choroid. Only a few DC in the uveal tract were very weakly reactive for mAbs which recognise B7-1 (CD80), B7-2 (CD86), β2 integrin (mAb N418), and multivesicular bodies associated with antigen presentation (mAb M342).
CONCLUSIONS—The present study reveals that the mouse uveal tract, like the rat, contains rich networks of DC and resident tissue macrophages. The networks of resident tissue macrophages in the mouse uveal tract closely resemble similar networks in non-ocular tissues. The phenotype of uveal tract DC suggests they are in the "immature" phase of their life cycle, similar to Langerhans cells of the skin, thus implying their role in situ within the eye is antigen capture and not antigen presentation.

 PMID:10216062

  18. Protection of human upper respiratory tract cell lines against sulphur mustard toxicity by hexamethylenetetramine (HMT).

    PubMed

    Andrew, D J; Lindsay, C D

    1998-07-01

    1. Sulphur mustard ('mustard gas', HD) is a highly toxic chemical warfare agent which affects the skin and respiratory tract. The primary targets of inhaled HD are the epithelia of the upper respiratory tract. Hexamethylenetetramine (HMT) has been shown to protect human lung cells against HD toxicity and has also been shown to be effective in vivo against the chemical warfare agent phosgene. The ability of HMT to protect against the toxicity of HD was investigated in the human upper respiratory tract cell lines BEAS-2B and RPMI 2650. 2. HD was highly toxic to both cell lines, with LC50 values of 15-30 microM. HMT, at a concentration of 10 mM, was shown to protect the cell lines against the toxic effects of 20 microM and 40 microM HD. Results demonstrated that it was necessary for HMT to be in situ at the time of exposure to HD for effective cytoprotection. No protection was seen when cells were treated with HMT following exposure to HD, or where HMT was removed prior to HD exposure. 3. Results suggest that HMT may be effective prophylaxis for exposure to HD by inhalation.

  19. Dorsal horn cells connected to the lissauer tract and their relation to the dorsal root potential in the rat.

    PubMed

    Lidierth, M; Wall, P D

    1998-08-01

    We have examined the role of dorsal horn cells that respond to Lissauer tract stimulation in regulating primary afferent depolarization (PAD). PAD was monitored by recording the dorsal root potential (DRP) in the roots of the lumbar cord. Recordings were made of the discharges of Lissauer tract-responsive cells, and their discharges were correlated with the DRPs occurring spontaneously and those evoked by stimulation. Electrical microstimulation of the Lissauer tract (<10 microA; 200 micros) was used to activate the tract selectively and evoke a characteristic long-latency DRP. Cells that were excited by Lissauer tract stimulation were found in the superficial laminae of the dorsal horn. They exhibited low rates of ongoing discharge and responded to Lissauer tract stimulation typically with a burst of impulses with a latency to onset of 5.6 +/- 2.7 ms (mean +/- SD) and to termination of 13.6 +/- 4.1 ms (n = 105). Lissauer tract-responsive cells in L5 were shown to receive convergent inputs from cutaneous and muscle afferents as they responded to stimulation of the sural nerve (100%, n = 19) and the nerve to gastrocnemius (95%, n = 19). The latency of the response to sural nerve stimulation was 3.7 +/- 1.5 ms and to gastrocnemius nerve stimulation, 8.3 +/- 3.6 ms. Stimulation through a microelectrode at a depth of 1.5 mm in the sensorimotor cortex (100 microA, 200 micros) evoked a response in 17 of 31 Lissauer tract-responsive cells (55%) with a latency to onset of 21.9 +/- 2.8 ms (n = 17). Stimulation of the sural nerve, nerve to gastrocnemius or sensorimotor cortex was shown to depress the response of Lissauer tract-responsive cells to a subsequent Lissauer tract stimulus. The ongoing discharges of Lissauer tract-responsive cells were correlated to the spontaneous DRP using spike-triggered averaging. Of 123 cells analyzed in this way, 117 (95%) were shown to be correlated to the DRP. In addition, the peaks of spontaneous negative DRPs in spinally transected

  20. Transitional cell cancer of the urinary tract and renal cell cancer in relation to acetaminophen use (United States).

    PubMed

    Rosenberg, L; Rao, R S; Palmer, J R; Strom, B L; Zauber, A; Warshauer, M E; Stolley, P D; Shapiro, S

    1998-01-01

    Experimental and epidemiologic evidence have suggested that phenacetin use increases the risk of transitional cell cancers of the urinary tract. The drug is no longer marketed but a commonly used metabolite, acetaminophen, has been linked recently to an increased risk of renal cancer. We assessed the relation of acetaminophen use to the risk of transitional cell cancer of the urinary tract and of renal cell cancer with data from a hospital-based study of cancers and medication use conducted from 1976-96 in the eastern United States. We compared 498 cases of transitional cell cancer and 383 cases of renal cell cancer with 8,149 noncancer controls and 6,499 cancer controls and controlled confounding factors with logistic regression. For transitional cell cancer, the relative risk (RR) estimate for regular acetaminophen use that had begun at least a year before admission was 1.1 (95 percent confidence interval [CI] = 0.6-1.9) based on noncancer controls, and 0.9 (CI = 0.5-1.6) based on cancer controls. RR estimates for use that lasted at least five years, and for nonregular use, were also close to 1.0. For renal cell cancer, the corresponding estimates were again close to 1.0. Our results suggest that acetaminophen, as used in present study population, does not influence the risk of transitional cell cancer of the urinary tract or of renal cell cancer.

  1. EpCAM-dependent extracellular vesicles from intestinal epithelial cells maintain intestinal tract immune balance

    PubMed Central

    Jiang, Lingling; Shen, Yingying; Guo, Danfeng; Yang, Diya; Liu, Jiajun; Fei, Xuefeng; Yang, Yunshan; Zhang, Buyi; Lin, Zhendong; Yang, Fei; Wang, Xiaojian; Wang, Keyi; Wang, Jianli; Cai, Zhijian

    2016-01-01

    How the intestinal tract develops a tolerance to foreign antigens is still largely unknown. Here we report that extracellular vesicles (EVs) with TGF-β1-dependent immunosuppressive activity are produced by intestinal epithelial cells (IECs) under physiological conditions. Transfer of these EVs into inflammatory bowel disease (IBD) mice induced by dextran sulfate sodium salt decreases IBD severity by inducing regulatory T cells and immunosuppressive dendritic cells. In contrast, decreased endogenous EV production promotes IBD development. IECs produce EVs with increased levels of TGF-β1 upon IBD development in an ERK-dependent manner. Furthermore, these EVs tend to localize in the intestinal tract associated with epithelial cell adhesion molecule (EpCAM). Knockdown of EpCAM in vivo increases the severity of murine IBD, and the protective effect of EVs from IECs with decreased EpCAM on murine IBD is blunted. Therefore, our study indicates that EVs from IECs participate in maintaining the intestinal tract immune balance. PMID:27721471

  2. Ghrelin-immunoreactive cells in the gastrointestinal tract of hypertensive rats.

    PubMed

    Janiuk, Izabela; Kaleczyc, Jerzy; Kasacka, Irena

    2016-01-01

    Ghrelin, an appetite-stimulating hormone secreted by the endocrine cells of the gastrointestinal (GI) tract, has recently been shown to affect the function of the cardiovascular system. This study aimed to assess the number and morphology of ghrelin-immunopositive (GhrIP) cells in the gastrointestinal tract of rats at different developmental phases of experimentally evoked renovascular hypertension. The study involved 40 rats divided into two groups: control (C; n = 20) and rats with experimentally induced hypertension (EH; n = 20). The Goldblatt model of two-kidneys, one clip (2K1C) was used to induce hypertension. Renovascular hypertension was maintained for either 3 (EH1 group; n = 10) or 42 (EH2 group; n = 10) days. Paraffin sections from the cardia, corpus and pylorus of the stomach, as well as from the duodenum, jejunum, ileum and colon were processed for peroxidase immunohistochemistry. The number of GhrIP cells was significantly higher in the cardia and corpus of the stomach as well as the duodenum and jejunum of hypertensive rats compared to that found in the control animals. The increased number of GhrIP cells in the rat gastrointestinal tract after partial unilateral ligation of the renal artery suggests that renovascular hypertension may affect ghrelin secretion, which can contribute to the development of cardiovascular complications.

  3. A Novel Class of Interstitial Cells in the Mouse and Monkey Female Reproductive Tracts1

    PubMed Central

    Peri, Lauren E.; Koh, Byoung H.; Ward, Grace K.; Bayguinov, Yulia; Hwang, Sung Jin; Gould, Thomas W.; Mullan, Catrina J.; Sanders, Kenton M.; Ward, Sean M.

    2015-01-01

    ABSTRACT Growing evidence suggests important roles for specialized platelet-derived growth factor receptor alpha-positive (PDGFRalpha+) cells in regulating the behaviors of visceral smooth muscle organs. Examination of the female reproductive tracts of mice and monkeys showed that PDGFRalpha+ cells form extensive networks in ovary, oviduct, and uterus. PDGFRalpha+ cells were located in discrete locations within these organs, and their distribution and density were similar in rodents and primates. PDGFRalpha+ cells were distinct from smooth muscle cells and interstitial cells of Cajal (ICC). This was demonstrated with immunohistochemical techniques and by performing molecular expression studies on PDGFRalpha+ cells from mice with enhanced green fluorescent protein driven off of the endogenous promoter for Pdgfralpha. Significant differences in gene expression were found in PDGFRalpha+ cells from ovary, oviduct, and uterus. Differences in gene expression were also detected in cells from different tissue regions within the same organ (e.g., uterine myometrium vs. endometrium). PDGFRalpha+ cells are unlikely to provide pacemaker activity because they lack significant expression of key pacemaker genes found in ICC (Kit and Ano1). Gja1 encoding connexin 43 was expressed at relatively high levels in PDGFRalpha+ cells (except in the ovary), suggesting these cells can form gap junctions to one another and neighboring smooth muscle cells. PDGFRalpha+ cells also expressed the early response transcription factor and proto-oncogene Fos, particularly in the ovary. These data demonstrate extensive distribution of PDGFRalpha+ cells throughout the female reproductive tract. These cells are a heterogeneous population of cells that are likely to contribute to different aspects of physiological regulation in the various anatomical niches they occupy. PMID:25788664

  4. Recurrent lower respiratory tract infections in children: a practical approach to diagnosis.

    PubMed

    Patria, Maria Francesca; Esposito, Susanna

    2013-03-01

    Many children are affected by recurrent lower respiratory tract infections (LRTIs), but the majority of them do not suffer from serious lung or extrapulmonary disease. The challenge for clinicians is to distinguish the recurrent RTIs with self-limiting or minor problems from those with underlying disease. The aim of this review is to describe a practical approach to children with recurrent LRTIs that limits unnecessary, expensive and time-consuming investigations. The children can be divided into three groups on the basis of their personal and family history and clinical findings: 1) otherwise healthy children who do not need further investigations; 2) those with risk factors for respiratory infections for whom a wait-and-see approach can be recommended; and 3) those in whom further investigations are mandatory. However, regardless of the origin of the recurrent LRTIs, it is important to remember that prevention by means of vaccines against respiratory pathogens (i.e. type b Haemophilus influenzae, pertussis, pneumococcal and influenza vaccines) can play a key role. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Laser therapy for upper urinary tract transitional cell carcinoma: indications and management.

    PubMed

    Bader, Markus J; Sroka, Ronald; Gratzke, Christian; Seitz, Michael; Weidlich, Patrick; Staehler, Michael; Becker, Armin; Stief, Christian G; Reich, Oliver

    2009-07-01

    Ureteroscopically guided laser techniques are commonly used in the treatment of upper urinary tract transitional cell carcinoma (UUTT); however, there is an ongoing debate with regard to indication and management. To review the indication, feasibility, and treatment outcome of laser application for definitive endoscopic treatment of UUTT, focusing on technical aspects of different laser devices and their impact on tissue. PubMed and Medline were searched for reports on laser therapy in UUTT from 1980 to 2008, with particular focus on the technical background of various laser systems. For decades, nephroureterectomy has been considered the gold standard for treating UUTT. With the intent to preserve functioning renal parenchyma, minimally invasive approaches, initially advocated for patients requiring a nephron-sparing approach (ie, single functioning kidney, renal insufficiency or significant comorbidities), have gained widespread acceptance due to advances in ureteroscopy, percutaneous renal surgery, and laparoscopy. Ureteroscopically guided laser ablation has been used successfully, resulting in recurrence rates ranging from 31% to 65% and disease-free rates of 35% to 86%, depending on stage and grade at diagnosis. To obtain the highest treatment success, the initial staging and grading of the tumour is crucial. Because low-grade tumours rarely if ever progress in stage or grade, the success rate of ureteroscopic therapy parallels that of endoscopic resection of identical bladder tumours. In the treatment of higher grade, advanced tumours, ureteroscopic therapy is less likely to be curative, and thus, endoscopic manoeuvres can only be palliative. Due to the relatively low prevalence of this tumour and the lack of comparable randomised, multicentre trials, the indications for an endoscopic laser treatment option has to be defined based on the patient's individual situation.

  6. Distribution of CD163-positive cell and MHC class II-positive cell in the normal equine uveal tract

    PubMed Central

    SANO, Yuto; MATSUDA, Kazuya; OKAMOTO, Minoru; TAKEHANA, Kazushige; HIRAYAMA, Kazuko; TANIYAMA, Hiroyuki

    2015-01-01

    Antigen-presenting cells (APCs) in the uveal tract participate in ocular immunity including immune homeostasis and the pathogenesis of uveitis. In horses, although uveitis is the most common ocular disorder, little is known about ocular immunity, such as the distribution of APCs. In this study, we investigated the distribution of CD163-positive and MHC II-positive cells in the normal equine uveal tract using an immunofluorescence technique. Eleven eyes from 10 Thoroughbred horses aged 1 to 24 years old were used. Indirect immunofluorescence was performed using the primary antibodies CD163, MHC class II (MHC II) and CD20. To demonstrate the site of their greatest distribution, positive cells were manually counted in 3 different parts of the uveal tract (ciliary body, iris and choroid), and their average number was assessed by statistical analysis. The distribution of pleomorphic CD163- and MHC II-expressed cells was detected throughout the equine uveal tract, but no CD20-expressed cells were detected. The statistical analysis demonstrated the distribution of CD163- and MHC II-positive cells focusing on the ciliary body. These results demonstrated that the ciliary body is the largest site of their distribution in the normal equine uveal tract, and the ciliary body is considered to play important roles in uveal and/or ocular immune homeostasis. The data provided in this study will help further understanding of equine ocular immunity in the normal state and might be beneficial for understanding of mechanisms of ocular disorders, such as equine uveitis. PMID:26537548

  7. Classification and functions of enteroendocrine cells of the lower gastrointestinal tract

    PubMed Central

    Gunawardene, Ashok R; Corfe, Bernard M; Staton, Carolyn A

    2011-01-01

    With over thirty different hormones identified as being produced in the gastrointestinal (GI) tract, the gut has been described as ‘the largest endocrine organ in the body’ (Ann. Oncol., 12, 2003, S63). The classification of these hormones and the cells that produce them, the enteroendocrine cells (EECs), has provided the foundation for digestive physiology. Furthermore, alterations in the composition and function of EEC may influence digestive physiology and thereby associate with GI pathologies. Whilst there is a rapidly increasing body of data on the role and function of EEC in the upper GI tract, there is a less clear-cut understanding of the function of EEC in the lower GI. Nonetheless, their presence and diversity are indicative of a role. This review focuses on the EECs of the lower GI where new evidence also suggests a possible relationship with the development and progression of primary adenocarcinoma. PMID:21518048

  8. Classification and functions of enteroendocrine cells of the lower gastrointestinal tract.

    PubMed

    Gunawardene, Ashok R; Corfe, Bernard M; Staton, Carolyn A

    2011-08-01

    With over thirty different hormones identified as being produced in the gastrointestinal (GI) tract, the gut has been described as 'the largest endocrine organ in the body' (Ann. Oncol., 12, 2003, S63). The classification of these hormones and the cells that produce them, the enteroendocrine cells (EECs), has provided the foundation for digestive physiology. Furthermore, alterations in the composition and function of EEC may influence digestive physiology and thereby associate with GI pathologies. Whilst there is a rapidly increasing body of data on the role and function of EEC in the upper GI tract, there is a less clear-cut understanding of the function of EEC in the lower GI. Nonetheless, their presence and diversity are indicative of a role. This review focuses on the EECs of the lower GI where new evidence also suggests a possible relationship with the development and progression of primary adenocarcinoma.

  9. Laparoscopic nephroureterectomy for upper tract transitional cell carcinoma: comparison of laparoscopic and open surgery.

    PubMed

    Tsujihata, Masao; Nonomura, Norio; Tsujimura, Akira; Yoshimura, Kazuhiro; Miyagawa, Yasushi; Okuyama, Akihiko

    2006-02-01

    We made a comparative study of laparoscopic nephroureterectomy (LNU) and standard open surgery (ONU) for upper urinary tract transitional cell carcinoma. From July 2000 to February 2005, 49 patients underwent total nephroureterectomy for upper tract transitional cell carcinoma at Osaka University Medical Hospital. Of the 49 patients, twenty-five were treated with LNU, and twenty-four with ONU. Each group of cases was reviewed with respect to operative time, complications and postoperative convalescence. The average operative time of the LNU and ONU group was 305.9 min (range 190-480) and 271.2 min (range 135-480) respectively, and the average blood loss was 321.5 ml (80-1370) and 557.7 ml (range 100-1730), respectively. The average time until ambulation after LNU and ONU was 2.2 days (range 1-3) and 4.0 days (range 3-5), respectively. No major postoperative complications were observed in either group. ONU still represents the gold standard for the management of upper tract transitional cell carcinoma; however, for low stage cases, LNU offers the advantages of minimally invasive surgery.

  10. Cellular prion protein is expressed in a subset of neuroendocrine cells of the rat gastrointestinal tract.

    PubMed

    Marcos, Zuberoa; Pffeifer, Kristine; Bodegas, María E; Sesma, María P; Guembe, Laura

    2004-10-01

    Prion diseases are believed to develop from the conformational change of normal cellular prion protein (PrPc) to a pathogenic isoform (PrPsc). PrPc is present in both the central nervous system and many peripheral tissues, although protein concentration is significantly lower in non-neuronal tissues. PrPc expression is essential for internalization and replication of the infectious agent. Several works have pointed to the gastrointestinal (GI) tract as the principal site of entry of PrPsc, but how passage through the GI mucosa occurs is not yet known. Here we studied PrPc expression using Western blot, RT-PCR, and immunohistochemistry in rat GI tract. PrPc mRNA and protein were detected in corpus, antrum, duodenum, and colon. Immunoreactivity was found in scattered cells of the GI epithelium. With double immunofluorescence, these cells have been identified as neuroendocrine cells. PrPc immunostaining was found in subsets of histamine, somatostatin (Som), ghrelin, gastrin (G), and serotonin (5HT) cells in stomach. In small and large bowel, PrPc cells co-localized with subpopulations of 5HT-, Som-, G-, and peptide YY-immunolabeled cells. Our results provide evidence for a possible and important role of endocrine cells in the internalization of PrPsc from gut lumen. Copyright The Histochemical Society, Inc.

  11. Altered Function in CD8+ T Cells following Paramyxovirus Infection of the Respiratory Tract

    PubMed Central

    Gray, Peter M.; Arimilli, Subhashini; Palmer, Ellen M.; Parks, Griffith D.; Alexander-Miller, Martha A.

    2005-01-01

    For many respiratory pathogens, CD8+ T cells have been shown to play a critical role in clearance. However, there are still many unanswered questions with regard to the factors that promote the most efficacious immune response and the potential for immunoregulation of effector cells at the local site of infection. We have used infection of the respiratory tract with the model paramyxovirus simian virus 5 (SV5) to study CD8+ T-cell responses in the lung. For the present study, we report that over time a population of nonresponsive, virus-specific CD8+ T cells emerged in the lung, culminating in a lack of function in ∼85% of cells specific for the immunodominant epitope from the viral matrix (M) protein by day 40 postinfection. Concurrent with the induction of nonresponsiveness, virus-specific cells that retained function at later times postinfection exhibited an increased requirement for CD8 engagement. This change was coupled with a nearly complete loss of functional phosphoprotein-specific cells, a response previously shown to be almost exclusively CD8 independent. These studies add to the growing evidence for immune dysregulation following viral infection of the respiratory tract. PMID:15731228

  12. Generation of Human Female Reproductive Tract Epithelium from Human Embryonic Stem Cells

    PubMed Central

    Ye, Louie; Mayberry, Robyn; Lo, Camden Y.; Britt, Kara L.; Stanley, Edouard G.; Elefanty, Andrew G.; Gargett, Caroline E.

    2011-01-01

    Background Recent studies have identified stem/progenitor cells in human and mouse uterine epithelium, which are postulated to be responsible for tissue regeneration and proliferative disorders of human endometrium. These progenitor cells are thought to be derived from Müllerian duct (MD), the primordial female reproductive tract (FRT). Methodology/Principal Findings We have developed a model of human reproductive tract development in which inductive neonatal mouse uterine mesenchyme (nMUM) is recombined with green fluorescent protein (GFP)-tagged human embryonic stem cells (hESCs); GFP-hESC (ENVY). We demonstrate for the first time that hESCs can be differentiated into cells with a human FRT epithelial cell phenotype. hESC derived FRT epithelial cells emerged from cultures containing MIXL1+ mesendodermal precursors, paralleling events occurring during normal organogenesis. Following transplantation, nMUM treated embryoid bodies (EBs) generated epithelial structures with a typical MD phenotype that expressed the MD markers PAX2, HOXA10. Functionally, the hESCs derived FRT epithelium responded to exogenous estrogen by proliferating and secreting uterine-specific glycodelin A (GdA). Conclusions/Significance These data show nMUM can induce differentiation of hESC to form the FRT epithelium. This may provide a model to study early developmental events of the human FRT. PMID:21698266

  13. Dendritic Cells from the Human Female Reproductive Tract Rapidly Capture and respond to HIV

    PubMed Central

    Rodriguez-Garcia, M; Shen, Zheng; Barr, Fiona D.; Boesch, Austin W.; Ackerman, Margaret E.; Kappes, John C.; Ochsenbauer, Christina; Wira, Charles R.

    2016-01-01

    Dendritic cells (DCs) throughout the female reproductive tract (FRT) were examined for phenotype, HIV capture ability and innate anti-HIV responses. Two main CD11c+ DC subsets were identified: CD11b+ and CD11blow DCs. CD11b+CD14+ DCs were the most abundant throughout the tract.A majority of CD11c+CD14+ cells corresponded to CD1c+ myeloid DCs while the rest lacked CD1c and CD163 expression (macrophage marker) and may represent monocyte-derived cells. Additionally we identified CD103+ DCs, located exclusively in the endometrium, while DC-SIGN+ DCs were broadly distributed throughout the FRT. Following exposure to GFP-labeled HIV particles, CD14+ DC-SIGN+ as well as CD14+ DC-SIGN- cells captured virus, with approximately 30% of these cells representing CD1c+ myeloid DCs. CD103+ DCs lacked HIV capture ability. Exposure of FRT DCs to HIV induced secretion of CCL2, CCR5 ligands, IL-8, elafin and SLPI within 3h of exposure, while classical pro-inflammatory molecules did not change and IFNα2 and IL10 were undetectable. Furthermore, elafin and SLPI up-regulation, but not CCL5, were suppressed by estradiol pretreatment. Our results suggest that specific DC subsets in the FRT have the potential for capture and dissemination of HIV, exert antiviral responses and likely contribute to the recruitment of HIV-target cells through the secretion of innate immune molecules. PMID:27579858

  14. Cutaneous squamous cell carcinoma presenting as a wound with discharging sinus tracts in a wild African lion (Panthera leo).

    PubMed

    Mwase, M; Mumba, C; Square, D; Kawarai, S; Madarame, H

    2013-11-01

    A female wild African lion (Panthera leo) was presented with an 8-month history of a wound with multiple discharging sinus tracts on the left paw. Microscopical examination revealed squamous cell carcinoma (SCC). To the best of our knowledge, this is the first report of cutaneous SCC in an African lion. Cutaneous SCC presenting as discharging sinus tracts lined by neoplastic squamous cells has not been reported previously in animals.

  15. Complete urinary tract exenteration for a dialysis patient with urothelial cancer: lower midline and extraperitoneal approach in a supine position.

    PubMed

    Ou, Chien-Hui; Yang, Wen-Horng

    2011-05-01

    To report a novel technique of extraperitoneal complete urinary tract exenteration (CUTE) for dialysis patients with multifocal urothelial cancer via a lower midline approach in a supine position (the spread-eagle position [SEP]). From October 2006 to May 2009, extraperitoneal CUTE was performed in 10 dialysis patients with multifocal urothelial cancer. Patients were placed supine with both legs extended and abducted at 45 to 60 degrees and both arms stretched out to the sides (SEP). CUTE involves simultaneous bilateral hand-assisted retroperitoneoscopic nephroureterectomy (HARN) and cystectomy or cystoprostatectomy. Bilateral HARN was completed via a 7- to 8-cm lower midline incision and 4 laparoscopic ports (2 on each side). Infraumbilical incision was extended to 12 cm and then extraperitoneal cystectomy was performed under direct vision using standard open surgical techniques. All procedures were successful. The mean operation time of extraperitoneal CUTE was 328 minutes. The time to oral intake was 2.6 days and to ambulation was 4.6 days. The mean parenteral narcotic requirement (morphine) was 43.6 mg (range, 12-88.6). No patient had recurrent transitional cell carcinoma at a mean follow-up of 29.8 months. Extraperitoneal CUTE via a lower midline incision in a completely supine position is feasible and safe. This technique has the benefit of easy supine positioning, eliminates the need for interprocedural repositioning, avoids bowel interference of the visual field, and reduces the risk of possible mechanical bowel injury of a retroperitoneal approach. This approach is a rational option when CUTE is considered. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Effect of histone deacetylase inhibitor on proliferation of biliary tract cancer cell lines

    PubMed Central

    Xu, Li-Ning; Wang, Xin; Zou, Sheng-Quan

    2008-01-01

    AIM: To explore the effect of histone deacetylase inhibitor, trichostatin A (TSA) on the growth of biliary tract cancer cell lines (gallbladder carcinoma cell line and cholangiocarcinoma cell line) in vivo and in vitro, and to investigate the perspective of histone deacetylase inhibitor in its clinical application. METHODS: The survival rates of gallbladder carcinoma cell line (Mz-ChA-l cell line) and cholangiocarcinoma cell lines (QBC939, KMBC and OZ cell lines) treated with various doses of TSA were detected by methylthiazol tetrazolium (MTT) assay. A nude mouse model of transplanted gallbladder carcinoma (Mz-ChA-l cell line) was successfully established, and changes in the growth of transplanted tumor after treated with TSA were measured. RESULTS: TSA could inhibit the proliferation of gallbladder carcinoma cell line (Mz-ChA-l cell line) and cholangiocarcinoma cell lines (QBC939, KMBC and OZ cell lines) in a dose-dependent manner. After the nude mouse model of transplanted gallbladder carcinoma (Mz-ChA-l cell line) was successfully established, the growth of cancer was inhibited in the model after treated with TSA. CONCLUSION: TSA can inhibit the growth of cholangiocarcinoma and gallbladder carcinoma cell lines in vitro and in vivo. PMID:18442209

  17. An Evidence-Based Approach To the Prevention of Catheter-Associated Urinary Tract Infections.

    PubMed

    Carter, Nina M; Reitneier, Laura; Goodloe, Lauren R

    2014-01-01

    This article describes a bundle of interventions that effectively reduced the incidence of catheter-associated urinary tract infections on the Acute Care Medicine' Unit, a general medicine/telemetry unit. A series of evidence-based interventions were implemented in October 2011, and since the implementation of these interventions, the 28-bed unit has seen a significant reduction in catheter-associated urinary tract infections.

  18. TRAIL mediates apoptosis in cancerous but not normal primary cultured cells of the human reproductive tract.

    PubMed

    Sadarangani, Anil; Kato, Sumie; Espinoza, Natalia; Lange, Soledad; Llados, Carmen; Espinosa, Marisol; Villalón, Manuel; Lipkowitz, Stanley; Cuello, Mauricio; Owen, Gareth I

    2007-01-01

    Cancer of the reproductive tract encompasses malignancies of the uterine corpus, cervix, ovary, Fallopian tube, among others and accounts for 15% of female cancer mortalities. Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) mediates apoptosis by binding to death receptors and offers a promising cancer treatment. The goal of this study was to investigate and characterize the effect of TRAIL in endometrial cancer cell lines and normal (non-cancerous) epithelial cells of endometrial origin. We also examined the effect of TRAIL in other primary cultured cancers and normal cells of the human female reproductive tract and evaluated if TRAIL mediated apoptosis correlated with death receptors and decoy receptors 1 and 2.Herein, we demonstrate that TRAIL at concentrations which kill cancerous cells, does not mediate apoptosis or alter cell viability in normal human endometrium, ovary, cervix or Fallopian tube. The partial inhibition by a caspase 9 inhibitor and the total inhibition by a caspase 8 inhibitor demonstrates the dependency on the extrinsic apoptotic pathway. The selective mortality does not correlate with the presence of death or decoy receptors. These results suggest that TRAIL may be an effective treatment for endometrial cancer and other female reproductive cancers, with minimal secondary effects on healthy tissue.

  19. Cell Aging of Mouse Gastrointestinal Tract Observed by Light and Electron Microscopic Radioautography

    PubMed Central

    Nagata, Tetsuji

    2014-01-01

    The term “cell aging” initially means how the cells change due to their aging. There are two meanings, i.e. how a cell changes when it is isolated from original animals such as in vitro cells in cell culture, otherwise how all the cells of an animal change in vivo due to the aging of the individual animal. We have been studying the latter changes from the viewpoint of the cell nutrients, the precursors for the macromolecular synthesis such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA), proteins, glucides and lipids, which are incorporated and synthesized into various cells of individual animals. Therefore, this article deals with only the cell aging of animal cells in vivo, how the metabolism, i.e. incorporations and syntheses of respective nutrient precursors in various kinds of cells change due to the aging of individual experimental animals such as mice by means of microscopic radioautography to localize the RI-labeled precursors. The incorporations and syntheses of various precursors for macromolecules such as DNA, RNA, proteins, glucides, lipids and others in various kinds of cells of various organs in the gastrointestinal tract such as the mouth, esophagus, stomach and intestines are reviewed referring many original papers already published from our laboratory during these 60 years since the late 20th century. PMID:27785275

  20. Upper gastrointestinal tract cancers as double-cancers in elderly patients with oral squamous cell carcinoma.

    PubMed

    Ikawa, Hiroaki; Tonogi, Morio; Yamane, Gen-Yuki; Yamauchi, Tomohiro; Tanaka, Yoichi; Sato, Michio; Matsui, Junichi; Ando, Nobutoshi; Katakura, Akira

    2012-01-01

    Against a background of a rapidly aging society, the number of patients with oral cancers in Japan is increasing yearly. The number of double-cancers with oral cancer as the first malignancy is also reportedly on the rise. Esophageal and gastric cancers are the most common second malignancies. At our institution, our policy is to proactively perform upper gastrointestinal (GI) fiberscopy (GIF) in patients with oral cancer. In anticipation of a probable further increase in the number of patients with double-cancers consisting of oral and GI tract malignancies, we retrospectively analyzed the occurrence of upper GI tract cancers in patients with oral squamous cell carcinoma (OSCC). The cohort consisted of 171 patients in whom OSCC had been diagnosed and who had undergone upper GIF between March 1996 and August 2008. Multivariate analysis was performed. Upper GIF identified 8 patients (7 men, 1 woman, totaling 4.7% of 171 patients) with double-cancer in the upper GI tract. One patient had a triple malignancy consisting of oral, esophageal and gastric cancers. Seven patients had esophageal cancer, while two had gastric cancer. An age of over 65 years was significantly higher in patients with double-cancers including esophageal cancer than in patients without esophageal cancer (OR=10.454, 95% CI=1.143-95.621). None of the other analyzed patient factors (sex, smoking habit, drinking habit, site of OSCC, TNM classification, staging results) showed a significant difference. These results indicate that, when treating elderly patients with oral cancers, physicians need to devise suitable treatment plans which take into account the possibility of upper GI tract cancer, particularly esophageal cancer, as a double-cancer.

  1. Clinical relevance of cell-free DNA in gastrointestinal tract malignancy.

    PubMed

    Lan, Yuan-Tzu; Chen, Ming-Huang; Fang, Wen-Liang; Hsieh, Chih-Cheng; Lin, Chien-Hsing; Jhang, Fang-Yu; Yang, Shung-Haur; Lin, Jen-Kou; Chen, Wei-Shone; Jiang, Jeng-Kai; Lin, Pei-Ching; Chang, Shih-Ching

    2017-01-10

    Cell-free DNA (cfDNA) extracted from blood has become a clinically feasible biomarker in various types of cancer. However, the clinical significance of cfDNA in gastrointestinal (GI) tract cancer among Asian populations requires further investigation. The median cfDNA copy number was highest in esophageal cancer, followed by colorectal cancer and gastric cancer, which were all significantly higher than those of healthy individuals. The cfDNA levels were higher in GI tract cancer, followed by those in carcinoma in situ and then healthy individuals (P = 0.019). During the postoperative surveillance, the cfDNA level tended to be more sensitive than the carcinoembryonic antigen level in predicting recurrence. For recurrent gastric cancer, a persistently high cfDNA level and an increasing trend was observed after surgery. For stage IV colorectal cancer, dynamic changes in the cfDNA level were correlated with the responses to chemotherapy and surgery. Blood samples were collected from 95 healthy individuals and from 855 patients diagnosed with GI tract malignancy, including 98 with esophageal cancer, 428 with stomach cancer, 329 with colorectal cancer and 30 with carcinoma in situ. The copy numbers of extracted cfDNA were analyzed and compared among the different types of GI cancers. The cfDNA level can serve as a feasible biomarker for detecting tumors in GI tract cancer. The cfDNA level may play a role in predicting tumor responses to chemotherapy and surgery in colorectal cancer; tumor recurrence should be considered in gastric cancer with a persistently high cfDNA level after surgery.

  2. Characterization of PrPc-immunoreactive cells in monkey (Macaca fascicularis) gastrointestinal tract.

    PubMed

    Marcos, Z; Bodegas, M E; Sesma, M P; Guembe, L

    2005-04-01

    The gastrointestinal tract (GIT) is one of the most likely entry sites for the pathological isoform of prions (PrP(sc)). To understand how PrP(sc) crosses the digestive mucosa, it is crucial to characterize the cells expressing normal prion protein (PrP(c)). By means of double immunofluorescence applied to sections of the monkey GIT, we demonstrated that, in the stomach, PrP(c) immunostaining occurs in subsets of histamine, somatostatin (Som), ghrelin (Ghr), gastrin (G), and serotonin (5HT) cells. In the small and large bowels, PrP(c) cells were found in subpopulations of cells immunolabeled for 5HT, Som, G, and peptide YY (PYY).

  3. Regulation of immunologic homeostasis in peripheral tissues by dendritic cells: the respiratory tract as a paradigm.

    PubMed

    Holt, P G; Stumbles, P A

    2000-03-01

    Dendritic cells are now recognized as the gatekeepers of the immune response, possessing a unique potential for acquisition of antigens at extremely low exposure levels and for efficient presentation of these in an immunogenic form to the naive T-cell system. Dendritic cell populations throughout the body exhibit a wide range of features in common that are associated with their primary functions, and these are considered in the initial section of this review. In addition, it is becoming evident that the properties and functions of these cells are refined by microenvironmental factors unique to their tissues of residence, a prime example being mucosal microenvironments such as those in respiratory tract tissues, and the latter represents the focus of the second section of this review.

  4. Rapidly Growing Right Ventricular Outflow Tract Mass in Patient with Sarcomatoid Renal Cell Carcinoma

    PubMed Central

    Hwang, Jongmin; Choi, Kyung Un; Kim, Jeong Su; Hwang, Ki Won; Lee, Sang Hyun; Chon, Min Ku; Lee, Soo Yong; Lee, Dae Sung

    2016-01-01

    Cardiac metastasis from renal cell carcinoma (RCC) without inferior vena cava (IVC) involvements is extremely rare with few reported cases. Sarcomatoid RCC with rhabdoid feature is a rare pathologic type of RCC having aggressive behavior due to great metastatic potential. Here, we report a case of rapidly growing cardiac metastasis of RCC which brought on right ventricular outflow tract (RVOT) obstruction without IVC and right atrial involvement in a 61-year-old woman. Cardiac arrest occurred during radical nephrectomy and echocardiography revealed mass nearly obstructing the RVOT which was not recognized by preoperative echocardiography 1 month ago. Postoperative immunohistochemical evaluation of renal mass revealed sarcomatoid RCC with rhabdoid feature. PMID:28090262

  5. The FGF-BMP signaling axis regulates outflow tract valve primordium formation by promoting cushion neural crest cell differentiation

    PubMed Central

    Zhang, Jue; Chang, Julia Y. F.; Huang, Yanqing; Lin, Xiang; Luo, Yongde; Schwartz, Robert J.; Martin, James F.; Wang, Fen

    2011-01-01

    Rationale Heart valves develop from precursor structures called cardiac cushions, an endothelial-lined cardiac jelly that resides in the inner side of the heart tube. The cushions are then invaded by cells from different sources, undergo a series of complicated and poorly understood remodeling processes, and give rise to valves. Disruption of the fibroblast growth factor (FGF) signaling axis impairs morphogenesis of the outflow tract (OFT). Yet, whether FGF signaling regulates OFT valve formation is unknown. Objective To study how OFT valve formation is regulated and how aberrant cell signaling causes valve defects. Methods and results By employing mouse genetic manipulation, cell lineage tracing, ex vivo heart culture, and molecular biology approaches, we demonstrated that FGF signaling in the OFT myocardium upregulated Bmp4 expression, which then enhanced smooth muscle differentiation of neural crest cells (NCCs) in the cushion. FGF signaling also promoted OFT myocardial cell invasion to the cushion. Disrupting FGF signaling interrupted cushion remodeling with reduced NCCs differentiation into smooth muscle and less cardiomyocyte invasion, and resulted in malformed OFT valves. Conclusions The results demonstrate a novel mechanism by which the FGF-BMP signaling axis regulates formation of OFT valve primordia by controlling smooth muscle differentiation of cushion NCCs. PMID:20847311

  6. The FGF-BMP signaling axis regulates outflow tract valve primordium formation by promoting cushion neural crest cell differentiation.

    PubMed

    Zhang, Jue; Chang, Julia Y F; Huang, Yanqing; Lin, Xiang; Luo, Yongde; Schwartz, Robert J; Martin, James F; Wang, Fen

    2010-11-12

    Heart valves develop from precursor structures called cardiac cushions, an endothelial-lined cardiac jelly that resides in the inner side of the heart tube. The cushions are then invaded by cells from different sources, undergo a series of complicated and poorly understood remodeling processes, and give rise to valves. Disruption of the fibroblast growth factor (FGF) signaling axis impairs morphogenesis of the outflow tract (OFT). Yet, whether FGF signaling regulates OFT valve formation is unknown. To study how OFT valve formation is regulated and how aberrant cell signaling causes valve defects. By using mouse genetic manipulation, cell lineage tracing, ex vivo heart culture, and molecular biology approaches, we demonstrated that FGF signaling in the OFT myocardium upregulated Bmp4 expression, which then enhanced smooth muscle differentiation of neural crest cells (NCCs) in the cushion. FGF signaling also promoted OFT myocardial cell invasion to the cushion. Disrupting FGF signaling interrupted cushion remodeling with reduced NCCs differentiation into smooth muscle and less cardiomyocyte invasion and resulted in malformed OFT valves. The results demonstrate a novel mechanism by which the FGF-BMP signaling axis regulates formation of OFT valve primordia by controlling smooth muscle differentiation of cushion NCCs.

  7. Mechanosensitive ion channels in interstitial cells of Cajal and smooth muscle of the gastrointestinal tract.

    PubMed

    Kraichely, R E; Farrugia, G

    2007-04-01

    Normal gastrointestinal (GI) motility is required to mix digestive enzymes and food and to move content along the GI tract. Underlying the complex motor patterns of the gut are electrical events that reflect ion flux across cell membranes. Smooth muscle electrical activity is directly influenced by GI interstitial cells of Cajal, whose rhythmic oscillations in membrane potential in part determine the excitability of GI smooth muscle and its response to neuronal input. Coordinated activity of the ion channels responsible for the conductances that underlie ion flux in both smooth muscle and interstitial cells is a requisite for normal motility. These conductances are regulated by many factors, including mechanical stress. Recent studies have revealed mechanosensitivity at the level of the ion channels, and the mechanosensor within the channel has been identified in many cases. This has led to better comprehension of the role of mechanosensitive conductances in normal physiology and will undoubtedly lead to understanding of the consequences of disturbances in these conductances.

  8. Flexible Vesiculovasoscopy Using a Microoptical System in a Human Cadaver Model: An Experimental Approach for Atraumatic Endoscopy of the Seminal Tract.

    PubMed

    Schlager, Daniel; Maas, Moritz; Hein, Simon; Adams, Fabian; Schoenthaler, Martin; Wetterauer, Ulrich; Diemer, Thorsten; Weidner, Wolfgang; Miernik, Arkadiusz

    2016-08-01

    The most common pathologies of the seminal tract are persistent hematospermia, seminal vesicle stones, and seminal duct obstruction. Endoscopic diagnostic work-up of the seminal tract is impeded by complex anatomy and lack of technical equipment. To date, there is no standardized endoscopic approach. The purpose of this study was to investigate the applicability and feasibility of a flexible microoptical device for atraumatic endoscopy of the seminal tract in a male human cadaver. The transurethral endoscopic examination was performed on a male cadaver. No premortal interventions or diseases of the genitourinary tract had been reported. The seminal orifice was identified via cystoscopy and accessed by the Seldinger technique using a hydrophilic guidewire and ureteral catheter. Retrograde endoscopic inspection of the distal seminal tract was performed using a miniaturized flexible endoscope. An antegrade endoscopic inspection of the seminal tract was carried out via high scrotal access to the vas deferens. Structures of the seminal tract, such as the ejaculatory duct, seminal vesicles, and distal portion of the ductus deferentes, were visualized using the miniaturized endoscope. Image quality allowed identification of anatomical structures and characterization of tissue properties. The technical limitations we observed involved the system's maneuverability. Initial results of this novel endoscopic approach to the seminal tract using a flexible microoptical system are encouraging. However, considerable anatomical limitations of the targeted organs necessitate further refinements of the technical equipment. This approach might improve diagnostics and treatment of genitourinary diseases. Future surgical techniques may include intraseminal laser therapy or endoocclusion to monitor fertility in men.

  9. Protective Mechanisms of Respiratory Tract Streptococci against Streptococcus pyogenes Biofilm Formation and Epithelial Cell Infection

    PubMed Central

    Fiedler, Tomas; Riani, Catur; Koczan, Dirk; Standar, Kerstin

    2013-01-01

    Streptococcus pyogenes (group A streptococci [GAS]) encounter many streptococcal species of the physiological microbial biome when entering the upper respiratory tract of humans, leading to the question how GAS interact with these bacteria in order to establish themselves at this anatomic site and initiate infection. Here we show that S. oralis and S. salivarius in direct contact assays inhibit growth of GAS in a strain-specific manner and that S. salivarius, most likely via bacteriocin secretion, also exerts this effect in transwell experiments. Utilizing scanning electron microscopy documentation, we identified the tested strains as potent biofilm producers except for GAS M49. In mixed-species biofilms, S. salivarius dominated the GAS strains, while S. oralis acted as initial colonizer, building the bottom layer in mixed biofilms and thereby allowing even GAS M49 to form substantial biofilms on top. With the exception of S. oralis, artificial saliva reduced single-species biofilms and allowed GAS to dominate in mixed biofilms, although the overall two-layer structure was unchanged. When covered by S. oralis and S. salivarius biofilms, epithelial cells were protected from GAS adherence, internalization, and cytotoxic effects. Apparently, these species can have probiotic effects. The use of Affymetrix array technology to assess HEp-2 cell transcription levels revealed modest changes after exposure to S. oralis and S. salivarius biofilms which could explain some of the protective effects against GAS attack. In summary, our study revealed a protection effect of respiratory tract bacteria against an important airway pathogen and allowed a first in vitro insight into local environmental processes after GAS enter the respiratory tract. PMID:23241973

  10. Monte Carlo approaches to sampling forested tracts with lines or points

    Treesearch

    Harry T. Valentine; Jeffrey H. Gove; Timothy G. Gregoire

    2001-01-01

    Several line- and point-based sampling methods can be employed to estimate the aggregate dimensions of trees standing on a forested tract or pieces of coarse woody debris lying on the forest floor. Line methods include line intersect sampling, horizontal line sampling, and transect relascope sampling; point methods include variable- and fixed-radius plot sampling, and...

  11. Influence of Mesenchymal Stem Cells Conditioned Media on Proliferation of Urinary Tract Cancer Cell Lines and Their Sensitivity to Ciprofloxacin.

    PubMed

    Maj, Malgorzata; Bajek, Anna; Nalejska, Ewelina; Porowinska, Dorota; Kloskowski, Tomasz; Gackowska, Lidia; Drewa, Tomasz

    2017-06-01

    Mesenchymal stem cells (MSCs) are known to interact with cancer cells through direct cell-to-cell contact and secretion of paracrine factors, although their exact influence on tumor progression in vivo remains unclear. To better understand how fetal and adult stem cells affect tumors, we analyzed viability of human renal (786-0) and bladder (T24) carcinoma cell lines cultured in conditioned media harvested from amniotic fluid-derived stem cells (AFSCs) and adipose-derived stem cells (ASCs). Both media reduced metabolic activity of 786-0 cells, however, decreased viability of T24 cells was noted only after incubation with conditioned medium from ASCs. To test the hypothesis that MSCs-secreted factors might be involved in chemoresistance acquisition, we further analyzed influence of mesenchymal stem cell conditioned media (MSC-CM) on cancer cells sensitivity to ciprofloxacin, that is considered as potential candidate agent for urinary tract cancers treatment. Significantly increased resistance to tested drug indicates that MSCs may protect cancer cells from chemotherapy. J. Cell. Biochem. 118: 1361-1368, 2017. © 2016 Wiley Periodicals, Inc.

  12. Neurogenic Lower Urinary Tract Dysfunction in Adults with Cerebral Palsy: Outcomes following a Conservative Management Approach.

    PubMed

    Goldfarb, Robert A; Pisansky, Andrew; Fleck, Joseph; Hoversten, Patrick; Cotter, Katherine J; Katorski, Jenna; Liberman, Daniel; Elliott, Sean P

    2016-04-01

    Cerebral palsy is characterized by motor impairment following injury to the developing brain. Neurogenic lower urinary tract dysfunction is estimated to affect at least a third of children with cerebral palsy. However there are limited data as patients transition to adulthood. We sought to describe the symptoms, sequelae and management of neurogenic lower urinary tract dysfunction in adults with cerebral palsy. We retrospectively reviewed the charts of adult patients with cerebral palsy between 2011 and 2014. Patients with prior bladder reconstruction or catheterization based bladder drainage were excluded from study. Cerebral palsy severity was determined using GMFCS (Gross Motor Function Classification System). A conservative evaluation and treatment paradigm was used. Noninvasive treatments were encouraged. Specifically clean intermittent catheterization, which is often not feasible, is avoided unless urinary retention, hydronephrosis or refractory lower urinary tract symptoms develop. There were 121 patients included in final analysis. Median age was 25 and 61 patients (50%) had GMFCS level V. Noninvasive management failed in 28 of 121 patients (23%) as defined by hydronephrosis in 9, persistent urinary retention in 10 and refractory lower urinary tract symptoms/incontinence in 9. Urethral clean intermittent catheterization was poorly tolerated. Of all patients 25% showed evidence of urolithiasis during the study period. Surgical intervention was rare and associated with significant morbidity. Adults with cerebral palsy may present with variable signs and symptoms of neurogenic lower urinary tract dysfunction. Conservative treatment was successful in more than 75% of patients. Clean intermittent catheterization was poorly tolerated in patients in whom conservative treatment failed. Surgical intervention was rarely indicated and it should be reserved for select individuals. Copyright © 2016 American Urological Association Education and Research, Inc

  13. Distribution of endocrine cells in the digestive tract of Alligator sinensis during the active and hibernating period.

    PubMed

    Wang, Huan; Zhang, Shengzhou; Zhou, Naizhen; Wang, Chaolin; Wu, Xiaobing

    2014-10-01

    The digestive tract is the largest endocrine organ in the body; the distribution pattern of endocrine cells varies with different pathological and physiological states. The aim of the present study was to investigate the distributed density of 5-hydroxytryptamine (5-HT), gastrin (GAS), somatostatin (SS) and vasoactive intestinal peptide (VIP) immunoreactive (IR) cells in the digestive tract of Alligator sinensis during the active and hibernating period by immunohistochemical (IHC) method. The results indicated that 5-HT-IR cells were distributed throughout the entire digestive tract, which were most predominant in duodenum and jejunum. The density increased significantly in stomach and duodenum during hibernation. GAS-IR cells were limited in small stomach and small intestine. The density decreased significantly in small stomach during hibernation, while increased in duodenum. What's more, most of the endocrine cells in duodenum were generally spindle shaped with long cytoplasmic processes ending in the lumen during hibernation. SS-IR cells were limited in stomach and small stomach. The density increased in stomach while decreased in small stomach during hibernation, meanwhile, fewer IR cells occurred in small intestine. VIP-IR cells occurred in stomach and small stomach. The density decreased in small stomach, while increased in stomach during hibernation. These results indicated that the endocrine cells in different parts of digestive tract varied differently during hibernation, their changes were adaptive response to the hibernation.

  14. Chemical coding and chemosensory properties of cholinergic brush cells in the mouse gastrointestinal and biliary tract

    PubMed Central

    Schütz, Burkhard; Jurastow, Innokentij; Bader, Sandra; Ringer, Cornelia; von Engelhardt, Jakob; Chubanov, Vladimir; Gudermann, Thomas; Diener, Martin; Kummer, Wolfgang; Krasteva-Christ, Gabriela; Weihe, Eberhard

    2015-01-01

    The mouse gastro-intestinal and biliary tract mucosal epithelia harbor choline acetyltransferase (ChAT)-positive brush cells with taste cell-like traits. With the aid of two transgenic mouse lines that express green fluorescent protein (EGFP) under the control of the ChAT promoter (EGFPChAT) and by using in situ hybridization and immunohistochemistry we found that EGFPChAT cells were clustered in the epithelium lining the gastric groove. EGFPChAT cells were numerous in the gall bladder and bile duct, and found scattered as solitary cells along the small and large intestine. While all EGFPChAT cells were also ChAT-positive, expression of the high-affinity choline transporter (ChT1) was never detected. Except for the proximal colon, EGFPChAT cells also lacked detectable expression of the vesicular acetylcholine transporter (VAChT). EGFPChAT cells were found to be separate from enteroendocrine cells, however they were all immunoreactive for cytokeratin 18 (CK18), transient receptor potential melastatin-like subtype 5 channel (TRPM5), and for cyclooxygenases 1 (COX1) and 2 (COX2). The ex vivo stimulation of colonic EGFPChAT cells with the bitter substance denatonium resulted in a strong increase in intracellular calcium, while in other epithelial cells such an increase was significantly weaker and also timely delayed. Subsequent stimulation with cycloheximide was ineffective in both cell populations. Given their chemical coding and chemosensory properties, EGFPChAT brush cells thus may have integrative functions and participate in induction of protective reflexes and inflammatory events by utilizing ACh and prostaglandins for paracrine signaling. PMID:25852573

  15. Immunofluorescent localization of enteroglucagon cells in the gastrointestinal tract of the dog

    PubMed Central

    Polak, Julia M.; Bloom, S.; Coulling, I.; Pearse, A. G. E.

    1971-01-01

    Localization of the endocrine polypeptide cells responsible for `glucagon-like immunoreactivity' in the gastrointestinal tract of the dog has been achieved with an immunofluorescent technique using antibodies raised against porcine pancreatic glucagon. The cells, for which we prefer the term `enteroglucagon', could only be demonstrated by this technique in tissues fixed in carbodiimide. The enteroglucagon cells possess cytological, cytochemical, and ultrastructural characteristics in common with those of the pancreatic α2 cell and they are equivalent in the stomach to the A cell and in the intestine to the L cell of the Wiesbaden terminology. Their distribution, predominantly in fundus and jejunum, correlates precisely with the distribution of glucagon-like immunoreactivity by radioimmunoassay and bioassay. The storage form of enteroglucagon differs in many respects from that of pancreatic glucagon although there are some close resemblances between the two forms of specific hormone-containing granule. Elucidation of the role of enteroglucagon should be assisted by the ability to demonstrate enteroglucagon cells. ImagesFig. 1Fig. 2Fig. 3Fig. 4Fig. 5Fig. 6Fig. 7 PMID:4930155

  16. Escherichia coli pili as possible mediators of attachment to human urinary tract epithelial cells.

    PubMed Central

    Edén, C S; Hansson, H A

    1978-01-01

    Presence of pili of fimbriae on Escherichia coli bacteria isolated from the urine of patients with urinary tract infection was related to the ability of the bacteria to attach to human uroepithelial cells. Piliated E. coli strains agglutinated guinea pig erythrocytes. D-Mannose and alpha-methyl-D-mannopyranoside inhibited this agglutination with all but one of the 12 strains tested. D-Mannose, D-galactose, alpha-methyl-D-mannopyranoside, and L-fucose did not afect attachment of piliated strains to uroepithelial cells. Heating as well as washing of piliated strains caused a parallel decrease of piliation and adhesive ability. Growth in glucose-enriched medium increased capsule formation but decreased piliation and adhesion. Capsulated strains retained their adhesive ability provided that pili extended outside the capsule. Images PMID:361565

  17. Long-term results of retroperitoneoscopic nephroureterectomy for upper urinary tract transitional cell carcinoma in China.

    PubMed

    Wang, Xiao-Qing; Jiang, Feng-Ming; Chen, Qi-Hui; Hou, Yu-Chuan; Zhang, Hai-Feng; Hao, Yuan-Yuan; Zhang, Long; Wang, Chun-Xi

    2013-01-01

    We compared long-term clinical outcomes of upper urinary tract transitional cell carcinoma (TCC) patients treated by retroperitoneoscopic nephroureterectomy (RNU) or open radical nephroureterectomy (ONU). Upper urinary tract TCC patients were treated with RNU (n = 86) or ONU (n = 72) and followed-up for more than three years. Demographic and clinical data, including preoperative indexes, intraoperative indexes and long-term clinical outcomes, were retrospectively compared to determine long-term efficacy of the two procedures. The RNU and ONU groups were statistically similar in age, gender, previous bladder cancer history, tumour location, pathologic tumour stage, pathologic node metastasis or tumour pathologic grade. The original surgery time required for both RNU and ONU was statistically similar, but RNU was associated with a significantly smaller volume of intraoperative estimated blood loss and shorter length of postoperative hospital stay. Follow-up (average: 42.4 months, range: 3-57) revealed that the RNU 3-year recurrence-free survival rate was 62.8% and the 3-year cancer specific survival rate was 80.7%. In the ONU group, the 3-year recurrence-free survival and the three-year cancer-specific survival rates were 59.2% and 80.3%, respectively. Neither of the survival rates were statistically different between the two groups. T stage, grade, lymph node metastasis and bladder tumour history were risk factors for tumour recurrence; the operation mode and the bladder cuff incision mode had no correlation with the recurrence-free survival. The open surgery strategy and the retroperitoneoscopic nephroureterectomy strategy are equally effective for treating upper urinary tract TCC. However, the RNU procedure is less invasive, and requires a shorter duration of postoperative hospitalized care; thus, RNU is recommended as the preferred strategy.

  18. Long-term results of retroperitoneoscopic nephroureterectomy for upper urinary tract transitional cell carcinoma in China

    PubMed Central

    Wang, Xiao-Qing; Jiang, Feng-Ming; Chen, Qi-Hui; Hou, Yu-Chuan; Zhang, Hai-Feng; Hao, Yuan-Yuan; Zhang, Long; Wang, Chun-Xi

    2013-01-01

    Objective: We compared long-term clinical outcomes of upper urinary tract transitional cell carcinoma (TCC) patients treated by retroperitoneoscopic nephroureterectomy (RNU) or open radical nephroureterectomy (ONU). Methods: Upper urinary tract TCC patients were treated with RNU (n = 86) or ONU (n = 72) and followed-up for more than three years. Demographic and clinical data, including preoperative indexes, intraoperative indexes and long-term clinical outcomes, were retrospectively compared to determine long-term efficacy of the two procedures. Results: The RNU and ONU groups were statistically similar in age, gender, previous bladder cancer history, tumour location, pathologic tumour stage, pathologic node metastasis or tumour pathologic grade. The original surgery time required for both RNU and ONU was statistically similar, but RNU was associated with a significantly smaller volume of intraoperative estimated blood loss and shorter length of postoperative hospital stay. Follow-up (average: 42.4 months, range: 3–57) revealed that the RNU 3-year recurrence-free survival rate was 62.8% and the 3-year cancer specific survival rate was 80.7%. In the ONU group, the 3-year recurrence-free survival and the three-year cancer-specific survival rates were 59.2% and 80.3%, respectively. Neither of the survival rates were statistically different between the two groups. T stage, grade, lymph node metastasis and bladder tumour history were risk factors for tumour recurrence; the operation mode and the bladder cuff incision mode had no correlation with the recurrence-free survival. Conclusion: The open surgery strategy and the retroperitoneoscopic nephroureterectomy strategy are equally effective for treating upper urinary tract TCC. However, the RNU procedure is less invasive, and requires a shorter duration of postoperative hospitalized care; thus, RNU is recommended as the preferred strategy. PMID:22630340

  19. Deletion of Dicer in Somatic Cells of the Female Reproductive Tract Causes Sterility

    PubMed Central

    Nagaraja, Ankur K.; Andreu-Vieyra, Claudia; Franco, Heather L.; Ma, Lang; Chen, Ruihong; Han, Derek Y.; Zhu, Huifeng; Agno, Julio E.; Gunaratne, Preethi H.; DeMayo, Francesco J.; Matzuk, Martin M.

    2008-01-01

    Dicer is an evolutionarily conserved ribonuclease III that is necessary for microRNA (miRNA) processing and the synthesis of small interfering RNAs from long double-stranded RNA. Although it has been shown that Dicer plays important roles in the mammalian germline and early embryogenesis, the functions of Dicer-dependent pathways in the somatic cells of the female reproductive tract are unknown. Using a transgenic line in which Cre recombinase is driven by the anti-Müllerian hormone receptor type 2 promoter, we conditionally inactivated Dicer1 in the mesenchyme of the developing Müllerian ducts and postnatally in ovarian granulosa cells and mesenchyme-derived cells of the oviducts and uterus. Deletion of Dicer in these cell types results in female sterility and multiple reproductive defects including decreased ovulation rates, compromised oocyte and embryo integrity, prominent bilateral paratubal (oviductal) cysts, and shorter uterine horns. The paratubal cysts act as a reservoir for spermatozoa and oocytes and prevent embryos from transiting the oviductal isthmus and passing the uterotubal junction to enter the uterus for implantation. Deep sequencing of small RNAs in oviduct revealed down-regulation of specific miRNAs in Dicer conditional knockout females compared with wild type. The majority of these differentially expressed miRNAs are predicted to regulate genes important for Müllerian duct differentiation and mesenchyme-derived structures, and several of these putative target genes were significantly up-regulated upon conditional deletion of Dicer1. Thus, our findings reveal diverse and critical roles for Dicer and its miRNA products in the development and function of the female reproductive tract. PMID:18687735

  20. Very long haplotype tracts characterized at high resolution from HLA homozygous cell lines

    PubMed Central

    Norman, Paul J.; Norberg, Steve; Nemat-Gorgani, Neda; Royce, Thomas; Hollenbach, Jill A.; Won, Melissa Shults; Guethlein, Lisbeth A.; Gunderson, Kevin L.; Ronaghi, Mostafa; Parham, Peter

    2015-01-01

    The HLA region of chromosome 6 contains the most polymorphic genes in humans. Spanning ~5Mbp the densely packed region encompasses approximately 175 expressed genes including the highly polymorphic HLA class I and II loci. Most of the other genes and functional elements are also polymorphic, and many of them are directly implicated in immune function or immune-related disease. For these reasons this complex genomic region is subject to intense scrutiny by researchers with the common goal of aiding further understanding and diagnoses of multiple immune-related diseases and syndromes. To aid assay development and characterization of the classical loci, a panel of cell lines partially or fully homozygous for HLA class I and II was assembled over time by the International Histocompatibility Working Group (IHWG). Containing a minimum of 88 unique HLA haplotypes, we show this panel represents a significant proportion of European HLA allelic and haplotype diversity (60–95%). Using a high-density whole genome array that includes 13,331 HLA region SNPs, we analyzed 99 IHWG cells to map the coordinates of the homozygous tracts at a fine scale. The mean homozygous tract length within chromosome 6 from these individuals is 21Mbp. Within HLA the mean haplotype length is 4.3Mbp, and 65% of the cell lines were shown to be homozygous throughout the entire region. In addition, four cell lines are homozygous throughout the complex KIR region of chromosome 19 (~250kbp). The data we describe will provide a valuable resource for characterizing haplotypes, designing and refining imputation algorithms and developing assay controls. PMID:26198775

  1. Very long haplotype tracts characterized at high resolution from HLA homozygous cell lines.

    PubMed

    Norman, Paul J; Norberg, Steve J; Nemat-Gorgani, Neda; Royce, Thomas; Hollenbach, Jill A; Shults Won, Melissa; Guethlein, Lisbeth A; Gunderson, Kevin L; Ronaghi, Mostafa; Parham, Peter

    2015-09-01

    The HLA region of chromosome 6 contains the most polymorphic genes in humans. Spanning ~5 Mbp the densely packed region encompasses approximately 175 expressed genes including the highly polymorphic HLA class I and II loci. Most of the other genes and functional elements are also polymorphic, and many of them are directly implicated in immune function or immune-related disease. For these reasons, this complex genomic region is subject to intense scrutiny by researchers with the common goal of aiding further understanding and diagnoses of multiple immune-related diseases and syndromes. To aid assay development and characterization of the classical loci, a panel of cell lines partially or fully homozygous for HLA class I and II was assembled over time by the International Histocompatibility Working Group (IHWG). Containing a minimum of 88 unique HLA haplotypes, we show that this panel represents a significant proportion of European HLA allelic and haplotype diversity (60-95 %). Using a high-density whole genome array that includes 13,331 HLA region SNPs, we analyzed 99 IHWG cells to map the coordinates of the homozygous tracts at a fine scale. The mean homozygous tract length within chromosome 6 from these individuals is 21 Mbp. Within HLA, the mean haplotype length is 4.3 Mbp, and 65 % of the cell lines were shown to be homozygous throughout the entire region. In addition, four cell lines are homozygous throughout the complex KIR region of chromosome 19 (~250 kbp). The data we describe will provide a valuable resource for characterizing haplotypes, designing and refining imputation algorithms and developing assay controls.

  2. Surgical management for upper urinary tract transitional cell carcinoma (UUT-TCC): a systematic review.

    PubMed

    Rai, Bhavan Prasad; Shelley, Mike; Coles, Bernadette; Somani, Bhaskar; Nabi, Ghulam

    2012-11-01

    Surgical management of upper urinary tract transitional cell carcinoma (UUT-TCC) has significantly changed over the past two decades. Data for several new surgical techniques, including nephron-sparing surgery (NSS), is emerging. The study systematically reviewed the literature comparing (randomised and observational studies) surgical and oncological outcomes for various surgical techniques MEDLINE, EMBASE, Cochrane Library, CINAHL, British Nursing Index, AMED, LILACS, Web of Science, Scopus, Biosis, TRIP, Biomed Central, Dissertation Abstracts, ISI proceedings, and PubMed were searched to identify suitable studies. Data were extracted from each identified paper independently by two reviewers (B.R. and B.S.) and cross checked by a senior member of the team. The data analysis was performed using the Cochrane software Review manager version 5. Comparable data from each study was combined in a meta-analysis where possible. For dichotomous data, odds ratios with 95% confidence intervals (CIs) were estimated based on the fixed-effects model and according to an intention-to-treat analysis. If the data available were deemed not suitable for a meta-analysis it was described in a narrative fashion. One randomised control trial (RCT) and 19 observational studies comparing open nephroureterectomy (ONU) and laparoscopic NU (LNU) were identified. The RCT reported the LNU group to have statistically significantly less blood loss (104 vs 430 mL, P < 0.001) and mean time to discharge (2.30 vs 3.65 days, P < 0.001) than the ONU group. At a median follow-up of 44 months, the overall 5-year cancer-specific survival (CSS; 89.9 vs 79.8%) and 5-year metastasis-free survival rates (77.4 vs 72.5%) for the ONU were better than for LNU, respectively, although not statistically significant. A meta-analysis of the observational studies favoured LNU group for lower urinary recurrence (P < 0.001) and distant metastasis. The meta-analyses for local recurrence for the two groups were comparable

  3. Statistical-based approach in potential diagnostic application of urinary nucleosides in urogenital tract cancer.

    PubMed

    Daghir-Wojtkowiak, Emilia; Struck-Lewicka, Wiktoria; Waszczuk-Jankowska, Malgorzata; Markuszewski, Marcin; Kaliszan, Roman; Markuszewski, Michal Jan

    2015-01-01

    We aimed at evaluation the potential diagnostic role of urinary nucleosides in urogenital tract cancer. Concentrations of 12 nucleosides determined by LC-MS/MS were subjected to correlation, association and interaction analyses. We identified six pairs of nucleosides differently correlated in the group of patients and controls (p < 0.05). N-2-methylguanosine (odds ratio: 4.82; 95% CI: 1.78-12.93; p = 0.002) and N,N-dimethylguanosine (odds ratio: 5.45; 95% CI: 1.78-16.44; p = 0.003), were significantly associated with the disease risk (p-corrected = 0.004). Interaction between N-2-methylguanosine and adenosine (p-interaction = 0.019) suggested their multiplicative effect on the outcome. Urinary nucleosides, namely N,N-dimethylguanosine and N-2-methylguanosine may have the potential to serve as prognostic biomarkers. Gender-specific differences in urogenital tract cancer are likely to occur.

  4. Interstitial cells of Cajal mediate nitrergic inhibitory neurotransmission in the murine gastrointestinal tract.

    PubMed

    Lies, Barbara; Gil, Víctor; Groneberg, Dieter; Seidler, Barbara; Saur, Dieter; Wischmeyer, Erhard; Jiménez, Marcel; Friebe, Andreas

    2014-07-01

    Nitric oxide (NO) is a major inhibitory neurotransmitter in the gastrointestinal (GI) tract. Its main effector, NO-sensitive guanylyl cyclase (NO-GC), is expressed in several GI cell types, including smooth muscle cells (SMC), interstitial cells of Cajal (ICC), and fibroblast-like cells. Up to date, the interplay between neurons and these cells to initiate a nitrergic inhibitory junction potential (IJP) is unclear. Here, we investigate the origin of the nitrergic IJP in murine fundus and colon. IJPs were determined in fundus and colon SMC of mice lacking NO-GC globally (GCKO) and specifically in SMC (SM-GCKO), ICC (ICC-GCKO), and both SMC/ICC (SM/ICC-GCKO). Nitrergic IJP was abolished in ICC-GCKO fundus and reduced in SM-GCKO fundus. In the colon, the amplitude of nitrergic IJP was reduced in ICC-GCKO, whereas nitrergic IJP in SM-GCKO was reduced in duration. These results were corroborated by loss of the nitrergic IJP in global GCKO. In conclusion, our results prove the obligatory role of NO-GC in ICC for the initiation of an IJP. NO-GC in SMC appears to enhance the nitrergic IJP, resulting in a stronger and prolonged hyperpolarization in fundus and colon SMC, respectively. Thus NO-GC in both cell types is mandatory to induce a full nitrergic IJP. Our data from the colon clearly reveal the nitrergic IJP to be biphasic, resulting from individual inputs of ICC and SMC.

  5. [Insular-opercular associative tracts: Review of their anatomy and relevance for the trans-opercular approach to the insula].

    PubMed

    Bucheli, Carlos; Mato, David; Marco de Lucas, Enrique; García-Porrero, Juan A; Vázquez-Barquero, Alfonso; Martino, Juan

    2014-01-01

    The insula is a highly connected area, as an intricate network of afferent and efferent projections connect it with adjacent and distant cortical regions. To perform an extensive review of recent literature to analyse the anatomy of the associative tracts related to the insula. The frontal aslant tract, arcuate fasciculus, horizontal portion of the superior longitudinal fasciculus and the middle longitudinal fasciculus are associative tracts connected to the opercula. The inferior fronto-occipital fasciculus (IFOF) and uncinate fasciculus run under the anterior and inferior portion of the insula. the pars triangularis and orbicularis of the inferior frontal gyrus, as well as the middle and anterior part of the superior temporal gyrus, have few connections with the perisylvian associative network. Consequently, in the trans-opercular approach to the insula, these 2 regions represent anatomical corridors that give access to the insula. The IFOF and the uncinate fasciculus represent the deep functional margin of resection. Copyright © 2014 Sociedad Española de Neurocirugía. Published by Elsevier España. All rights reserved.

  6. Alternative Approaches to Conventional Treatment of Acute Uncomplicated Urinary Tract Infection in Women

    PubMed Central

    Foxman, Betsy; Buxton, Miatta

    2013-01-01

    The increasing resistance of uropathogens to antibiotics, and recognition of generally self-limiting nature of uncomplicated urinary tract infection (UTI) suggests that it is time to reconsider empirical treatment of UTI using antibiotics. Identifying new and effective strategies to prevent recurrences and alterative treatment strategies are a high priority. We review the recent literature regarding the effects of functional food products, probiotics, vaccines, and alternative treatments on treating and preventing UTI. PMID:23378124

  7. Brief and prolonged effects of Lissauer tract stimulation on dorsal horn cells.

    PubMed

    Wall, P D; Lidierth, M; Hillman, P

    1999-12-01

    Increased excitability of dorsal horn neurones may play a critical role in producing some pain states and there is evidence that the excitability of neurones lying throughout the dorsal horn is subject to regulation by cells in its most superficial laminae. This paper examines the effect on dorsal horn cell receptive fields and excitability of the specific activation of Lissauer's tract, a tract containing propriospinal axons which arise from cells in the substantia gelatinosa and which project to the substantia of neighbouring spinal segments. Experiments were carried out on anaesthetised spinal rats in the L3-4 spinal segments with microelectrode stimulation on the surface of the Lissauer tract (LT) and microelectrode recording of single cells or small groups of cells that responded to gentle brushing on the skin. Single shocks or brief trains of low-level stimuli to the LT produced a characteristic long-latency dorsal root potential (DRP) on the L3 dorsal root and a brief burst of firing in superficial cells with no stimulation of primary afferents. Generally, this was accompanied by no excitation of deeper dorsal horn cells but commonly by a period of inhibition, often followed by facilitation. We then turned to the effect of long periods (30-90min) of continual LT stimulation because we had seen hints of prolonged facilitation of the deeper cells after periods of such stimulation. Trains of 5 stimuli separated by 2ms and repeated every 200ms were used with individual pulses of 200 micros duration and less than 10 microA amplitude. This resulted in a shift of the effect on deep cells from primarily inhibition to mainly facilitation. We then examined in detail the effect of these long periods of LT stimulation on the size of receptive fields (RFs) of dorsal horn cells first on single units and then by repeated mapping of the RFs of small groups of cells. Control periods of 60min with no LT stimulation produced no significant RF changes but 30, 60 or 90min of LT

  8. Characterisation of CART-containing neurons and cells in the porcine pancreas, gastro-intestinal tract, adrenal and thyroid glands

    PubMed Central

    Wierup, Nils; Gunnarsdóttir, Anna; Ekblad, Eva; Sundler, Frank

    2007-01-01

    Background The peptide CART is widely expressed in central and peripheral neurons, as well as in endocrine cells. Known peripheral sites of expression include the gastrointestinal (GI) tract, the pancreas, and the adrenal glands. In rodent pancreas CART is expressed both in islet endocrine cells and in nerve fibers, some of which innervate the islets. Recent data show that CART is a regulator of islet hormone secretion, and that CART null mutant mice have islet dysfunction. CART also effects GI motility, mainly via central routes. In addition, CART participates in the regulation of the hypothalamus-pituitary-adrenal-axis. We investigated CART expression in porcine pancreas, GI-tract, adrenal glands, and thyroid gland using immunocytochemistry. Results CART immunoreactive (IR) nerve cell bodies and fibers were numerous in pancreatic and enteric ganglia. The majority of these were also VIP IR. The finding of intrinsic CART containing neurons indicates that pancreatic and GI CART IR nerve fibers have an intrinsic origin. No CART IR endocrine cells were detected in the pancreas or in the GI tract. The adrenal medulla harboured numerous CART IR endocrine cells, most of which were adrenaline producing. In addition CART IR fibers were frequently seen in the adrenal cortex and capsule. The capsule also contained CART IR nerve cell bodies. The majority of the adrenal CART IR neuronal elements were also VIP IR. CART IR was also seen in a substantial proportion of the C-cells in the thyroid gland. The majority of these cells were also somatostatin IR, and/or 5-HT IR, and/or VIP IR. Conclusion CART is a major neuropeptide in intrinsic neurons of the porcine GI-tract and pancreas, a major constituent of adrenaline producing adrenomedullary cells, and a novel peptide of the thyroid C-cells. CART is suggested to be a regulatory peptide in the porcine pancreas, GI-tract, adrenal gland and thyroid. PMID:17625001

  9. Catenary cultures of embryonic gastrointestinal tract support organ morphogenesis, motility, neural crest cell migration, and cell differentiation.

    PubMed

    Hearn, C J; Young, H M; Ciampoli, D; Lomax, A E; Newgreen, D

    1999-03-01

    The embryonic gastrointestinal tract develops from a simple tube into a coiled, flexed, and regionalized structure. The changes in gut morphology coincide with the differentiation of multiple cell types in concentric layers, and include colonization by migratory neuron precursors, and the development of gastrointestinal motility. We describe a reliable method for growing embryonic mouse intestine in vitro by the attachment of segments of intestinal tract by their cut ends, with the intervening region suspended in the culture medium. These are termed "catenary cultures." E11-E11.5 mouse midgut, hindgut, or mid- plus hindgut segments were grown in catenary culture for up to 10 days and their growth, morphology, cell differentiation, ability to support neural precursor migration, and contractile activity were assessed. The increase in size of the cultured explants was not large, but morphogenesis proceeded, best exemplified by elongation of the caecum. Cell differentiation also proceeded. In the mucosa, goblet cells differentiated. Muscle layers, characterized by desmin expression, and kit-positive interstitial cells of Cajal differentiated in the correct positions. Where segments initially included neural precursors in a small sub-region, these migrated and proliferated to form uniform neuronal networks throughout the entire explant, and the cells expressed the neuron markers nitric oxide synthase and neuron specific enolase. Gut motility was attained 5-6 days into the culture period, and both contractile- and mixing-type movements were observed. Thus, cell types representative of all three germ layer contributions developed, and in addition, the gut, being mainly free, was able to elongate and bend (unlike on solid support cultures), while retaining its rostrocaudal identity.

  10. Vangl2-regulated polarisation of second heart field-derived cells is required for outflow tract lengthening during cardiac development.

    PubMed

    Ramsbottom, Simon A; Sharma, Vipul; Rhee, Hong Jun; Eley, Lorraine; Phillips, Helen M; Rigby, Hannah F; Dean, Charlotte; Chaudhry, Bill; Henderson, Deborah J

    2014-12-01

    Planar cell polarity (PCP) is the mechanism by which cells orient themselves in the plane of an epithelium or during directed cell migration, and is regulated by a highly conserved signalling pathway. Mutations in the PCP gene Vangl2, as well as in other key components of the pathway, cause a spectrum of cardiac outflow tract defects. However, it is unclear why cells within the mesodermal heart tissue require PCP signalling. Using a new conditionally floxed allele we show that Vangl2 is required solely within the second heart field (SHF) to direct normal outflow tract lengthening, a process that is required for septation and normal alignment of the aorta and pulmonary trunk with the ventricular chambers. Analysis of a range of markers of polarised epithelial tissues showed that in the normal heart, undifferentiated SHF cells move from the dorsal pericardial wall into the distal outflow tract where they acquire an epithelial phenotype, before moving proximally where they differentiate into cardiomyocytes. Thus there is a transition zone in the distal outflow tract where SHF cells become more polarised, turn off progenitor markers and start to differentiate to cardiomyocytes. Membrane-bound Vangl2 marks the proximal extent of this transition zone and in the absence of Vangl2, the SHF-derived cells are abnormally polarised and disorganised. The consequent thickening, rather than lengthening, of the outflow wall leads to a shortened outflow tract. Premature down regulation of the SHF-progenitor marker Isl1 in the mutants, and accompanied premature differentiation to cardiomyocytes, suggests that the organisation of the cells within the transition zone is important for maintaining the undifferentiated phenotype. Thus, Vangl2-regulated polarisation and subsequent acquisition of an epithelial phenotype is essential to lengthen the tubular outflow vessel, a process that is essential for on-going cardiac morphogenesis.

  11. Vangl2-Regulated Polarisation of Second Heart Field-Derived Cells Is Required for Outflow Tract Lengthening during Cardiac Development

    PubMed Central

    Rhee, Hong Jun; Eley, Lorraine; Phillips, Helen M.; Rigby, Hannah F.; Dean, Charlotte; Chaudhry, Bill; Henderson, Deborah J.

    2014-01-01

    Planar cell polarity (PCP) is the mechanism by which cells orient themselves in the plane of an epithelium or during directed cell migration, and is regulated by a highly conserved signalling pathway. Mutations in the PCP gene Vangl2, as well as in other key components of the pathway, cause a spectrum of cardiac outflow tract defects. However, it is unclear why cells within the mesodermal heart tissue require PCP signalling. Using a new conditionally floxed allele we show that Vangl2 is required solely within the second heart field (SHF) to direct normal outflow tract lengthening, a process that is required for septation and normal alignment of the aorta and pulmonary trunk with the ventricular chambers. Analysis of a range of markers of polarised epithelial tissues showed that in the normal heart, undifferentiated SHF cells move from the dorsal pericardial wall into the distal outflow tract where they acquire an epithelial phenotype, before moving proximally where they differentiate into cardiomyocytes. Thus there is a transition zone in the distal outflow tract where SHF cells become more polarised, turn off progenitor markers and start to differentiate to cardiomyocytes. Membrane-bound Vangl2 marks the proximal extent of this transition zone and in the absence of Vangl2, the SHF-derived cells are abnormally polarised and disorganised. The consequent thickening, rather than lengthening, of the outflow wall leads to a shortened outflow tract. Premature down regulation of the SHF-progenitor marker Isl1 in the mutants, and accompanied premature differentiation to cardiomyocytes, suggests that the organisation of the cells within the transition zone is important for maintaining the undifferentiated phenotype. Thus, Vangl2-regulated polarisation and subsequent acquisition of an epithelial phenotype is essential to lengthen the tubular outflow vessel, a process that is essential for on-going cardiac morphogenesis. PMID:25521757

  12. Impact of Chest Radiography for Children with Lower Respiratory Tract Infection: A Propensity Score Approach

    PubMed Central

    Ecochard-Dugelay, Emmanuelle; Beliah, Muriel; Boisson, Caroline; Perreaux, Francis; de Laveaucoupet, Jocelyne; Labrune, Philippe; Epaud, Ralph; Ducou-Lepointe, Hubert; Bouyer, Jean; Gajdos, Vincent

    2014-01-01

    Background Management of acute respiratory tract infection varies substantially despite this being a condition frequently encountered in pediatric emergency departments. Previous studies have suggested that the use of antibiotics was higher when chest radiography was performed. However none of these analyses had considered the inherent indication bias of observational studies. Objective The aim of this work was to assess the relationship between performing chest radiography and prescribing antibiotics using a propensity score analysis to address the indication bias due to non-random radiography assignment. Methods We conducted a prospective study of 697 children younger than 2 years of age who presented during the winter months of 2006–2007 for suspicion of respiratory tract infection at the Pediatric Emergency Department of an urban general hospital in France (Paris suburb). We first determined the individual propensity score (probability of having a chest radiography according to baseline characteristics). Then we assessed the relation between radiography and antibiotic prescription using two methods: adjustment and matching on the propensity score. Results We found that performing a chest radiography lead to more frequent antibiotic prescription that may be expressed as OR = 2.3, CI [1.3–4.1], or as an increased use of antibiotics of 18.6% [0.08–0.29] in the group undergoing chest radiography. Conclusion Chest radiography has a significant impact on the management of infants admitted for suspicion of respiratory tract infection in a pediatric emergency department and may lead to unnecessary administration of antibiotics. PMID:24788944

  13. Upper respiratory tract endoscopy in the cat: a minimally invasive approach to diagnostics and therapeutics.

    PubMed

    Sobel, David S

    2013-11-01

    Endoscopy of the feline upper respiratory tract has always taken a bit of a back seat to exploration of the canine nose and paranasal sinuses, pharynx and trachea, due to some anatomic limitations and lack of availability of appropriate-sized equipment. With proper training, however, even the inexperienced endoscopist can find that endoscopy and endoscopic surgery can be of tremendous utility in feline practice. What had previously been largely off-limits sites, in terms of direct visualization and surgical intervention, the feline rhinarium, paranasal sinuses, pharynx and trachea are now anatomic areas that can be effectively visualized in most clinical scenarios. Moreover, endoscopic surgery is now an area gaining significant appreciation for its diagnostic and therapeutic benefits. This article will not serve as a complete treatise on disease processes of the upper respiratory tract in cats, but rather is intended as a technical and instructional reference point on upper airway endoscopy for veterinary surgeons, both in first opinion as well as referral small animal practice.

  14. Effects of midbrain and medullary stimulation on spinomesencephalic tract cells in the cat.

    PubMed

    Yezierski, R P

    1990-02-01

    1. The effects of electrical stimulation at different rostrocaudal levels of the midbrain, and at sites in the rostral medulla ipsilateral and contralateral to spinal recording sites, were evaluated against the responses of 46 cells belonging to the cat spinomesencephalic tract (SMT). 2. Inhibitory and/or excitatory effects of brain stem stimulation were observed on SMT cells that responded best (26 cells) or exclusively (12 cells) to noxious mechanical or thermal stimuli, as well as on 7 cells responding only to tap and/or stimulation of deep tissues. Recording sites for 32 cells were located in laminae V-VIII (27 cells) and laminae I-III (5 cells). 3. Midbrain stimulation sites were located in the superior colliculus, central gray (CG), red nucleus, and the midbrain reticular formation. Both inhibitory-only and excitatory-only effects were observed, although the most common effect of midbrain stimulation was excitation followed by inhibition (mixed effects). The effects of stimulation at different midbrain levels were determined for each cell. Stimulation in the caudal, middle, or rostral midbrain was often found to exert different effects on the same SMT cell. 4. Stimulation in the rostral medulla at sites located in nucleus raphe magnus (NRM), nucleus reticularis gigantocellularis, and nucleus reticularis magnocellularis produced the same complement of effects observed with midbrain stimulation. Excitation followed by inhibition was the most common effect observed. 5. Stimulus intensities required to produce excitatory or inhibitory effects from midbrain were 114 +/- 85 (SD) microA and 210 +/- 91 microA, respectively. Stimulus currents required to produce excitatory or inhibitory effects from medullary stimulation sites were 124 +/- 56 microA and 70 +/- 60 microA, respectively. The mean currents required to produce mixed effects were 221 +/- 120 microA (midbrain) and 127 +/- 71 microA (medulla). Increasing the stimulus intensity used to evaluate brain stem

  15. Oncological outcome of retroperitoneoscopic nephroureterectomy for upper urinary tract transitional cell carcinoma.

    PubMed

    Okegawa, Takatsugu; Odagane, Akihiro; Ide, Hisamitsu; Horie, Shigeo; Nutahara, Kikuo; Higashihara, Eiji

    2006-05-01

    To report the oncological outcome of retroperitoneoscopic nephroureterectomy (RNU) with bladder cuff excision for upper urinary tract transitional cell carcinoma (TCC), and to compare the outcome with that of the traditional open nephroureterectomy (ONU). From January 2001, 48 patients with upper urinary tract TCC were enrolled in the study; 25 had RNU and 23 had ONU. Oncological parameters (disease-free survival and disease-specific survival) were calculated from the time of surgery to the date of last follow up and were analysed by the Kaplan-Meier method. Mean follow up was 24.3 months in the RNU group, significantly shorter than in the ONU group. Bladder recurrence was identified in two patients with grade 3 pathological stage pT3, one patient with grade 3 stage pT2 disease and two patients with grade 2 stage pT2 disease. Multiple organ metastases in the lung, liver and lymph nodes were associated with bladder recurrence in two cases (grade 2 stage pT3, and grade 3 stage pT3). The recurrence rate was 20% (5 of 25 cases) and mean time to recurrence was 9.5 months. In the ONU group, bladder recurrence and metastases developed in four and three patients, respectively. The recurrence rate was 17% (4 of 23 cases) and mean time to recurrence was 23.4 months. No significant difference was detected in the disease-free survival rate and cancer-specific survival rate between the two groups (P=0.759 and P=0.866, respectively). The oncological outcome of RNU appears to be equivalent to that of ONU. Moreover, long-term follow up is necessary to evaluate the oncological outcome in comparison to ONU.

  16. Managing uncomplicated recurrent urinary tract infections in reproductive aged women: a primary care approach.

    PubMed

    Zak, Danielle

    2014-12-01

    Uncomplicated, recurrent urinary tract infections (RUTIs) in heal-thy, premenopausal women are a common health complaint. This article discusses risk factors, diagnostic techniques, medical management, and referral information to help clinicians manage RUTIs in the primary care setting. This article cites research articles, systematic reviews, and current guidelines. The majority of RUTIs in healthy premenopausal women can be managed by using individualized plans of care. Referrals are usually not useful nor cost effective. This article discusses treatments based on increasing antimicrobial resistance and examines nonmicrobial options in RUTI prevention. This article serves as a foundation for guiding primary care providers in managing this common problem using current research and guidelines. ©2014 American Association of Nurse Practitioners.

  17. A metaproteomics approach to elucidate host and pathogen protein expression during catheter-associated urinary tract infections (CAUTIs).

    PubMed

    Lassek, Christian; Burghartz, Melanie; Chaves-Moreno, Diego; Otto, Andreas; Hentschker, Christian; Fuchs, Stephan; Bernhardt, Jörg; Jauregui, Ruy; Neubauer, Rüdiger; Becher, Dörte; Pieper, Dietmar H; Jahn, Martina; Jahn, Dieter; Riedel, Katharina

    2015-04-01

    Long-term catheterization inevitably leads to a catheter-associated bacteriuria caused by multispecies bacterial biofilms growing on and in the catheters. The overall goal of the presented study was (1) to unravel bacterial community structure and function of such a uropathogenic biofilm and (2) to elucidate the interplay between bacterial virulence and the human immune system within the urine. To this end, a metaproteomics approach combined with in vitro proteomics analyses was employed to investigate both, the pro- and eukaryotic protein inventory. Our proteome analyses demonstrated that the biofilm of the investigated catheter is dominated by three bacterial species, that is, Pseudomonas aeruginosa, Morganella morganii, and Bacteroides sp., and identified iron limitation as one of the major challenges in the bladder environment. In vitro proteome analysis of P. aeruginosa and M. morganii isolated from the biofilm revealed that these opportunistic pathogens are able to overcome iron restriction via the production of siderophores and high expression of corresponding receptors. Notably, a comparison of in vivo and in vitro protein profiles of P. aeruginosa and M. morganii also indicated that the bacteria employ different strategies to adapt to the urinary tract. Although P. aeruginosa seems to express secreted and surface-exposed proteases to escape the human innate immune system and metabolizes amino acids, M. morganii is able to take up sugars and to degrade urea. Most interestingly, a comparison of urine protein profiles of three long-term catheterized patients and three healthy control persons demonstrated the elevated level of proteins associated with neutrophils, macrophages, and the complement system in the patient's urine, which might point to a specific activation of the innate immune system in response to biofilm-associated urinary tract infections. We thus hypothesize that the often asymptomatic nature of catheter-associated urinary tract infections

  18. A Metaproteomics Approach to Elucidate Host and Pathogen Protein Expression during Catheter-Associated Urinary Tract Infections (CAUTIs)

    PubMed Central

    Lassek, Christian; Burghartz, Melanie; Chaves-Moreno, Diego; Otto, Andreas; Hentschker, Christian; Fuchs, Stephan; Bernhardt, Jörg; Jauregui, Ruy; Neubauer, Rüdiger; Becher, Dörte; Pieper, Dietmar H.; Jahn, Martina; Jahn, Dieter; Riedel, Katharina

    2015-01-01

    Long-term catheterization inevitably leads to a catheter-associated bacteriuria caused by multispecies bacterial biofilms growing on and in the catheters. The overall goal of the presented study was (1) to unravel bacterial community structure and function of such a uropathogenic biofilm and (2) to elucidate the interplay between bacterial virulence and the human immune system within the urine. To this end, a metaproteomics approach combined with in vitro proteomics analyses was employed to investigate both, the pro- and eukaryotic protein inventory. Our proteome analyses demonstrated that the biofilm of the investigated catheter is dominated by three bacterial species, that is, Pseudomonas aeruginosa, Morganella morganii, and Bacteroides sp., and identified iron limitation as one of the major challenges in the bladder environment. In vitro proteome analysis of P. aeruginosa and M. morganii isolated from the biofilm revealed that these opportunistic pathogens are able to overcome iron restriction via the production of siderophores and high expression of corresponding receptors. Notably, a comparison of in vivo and in vitro protein profiles of P. aeruginosa and M. morganii also indicated that the bacteria employ different strategies to adapt to the urinary tract. Although P. aeruginosa seems to express secreted and surface-exposed proteases to escape the human innate immune system and metabolizes amino acids, M. morganii is able to take up sugars and to degrade urea. Most interestingly, a comparison of urine protein profiles of three long-term catheterized patients and three healthy control persons demonstrated the elevated level of proteins associated with neutrophils, macrophages, and the complement system in the patient's urine, which might point to a specific activation of the innate immune system in response to biofilm-associated urinary tract infections. We thus hypothesize that the often asymptomatic nature of catheter-associated urinary tract infections

  19. Inflammatory fibroid polyps of the gastrointestinal tract: evidence for a dendritic cell origin.

    PubMed

    Pantanowitz, Liron; Antonioli, Donald A; Pinkus, Geraldine S; Shahsafaei, Ali; Odze, Robert D

    2004-01-01

    Inflammatory fibroid polyps (IFPs) are rare mesenchymal tumors of the gastrointestinal tract that consist of spindle-shaped stromal cells and an inflammatory infiltrate rich in eosinophils. Their etiology and histogenesis remain unknown. Based on previous reports of their immunoreactivity for CD34 and c-kit biomarkers, IFPs have been thought to be related to gastrointestinal stromal tumors (GISTs). After reviewing the current literature and examining IFPs at the light microscopic level, we evaluated a series of IFPs using an extensive panel of immunohistochemical and in situ hybridization markers in an effort to gain insight into their etiology and histogenesis and to determine their true relationship to GISTs. Sixteen routinely processed IFP specimens (14 gastric, 1 ileal, and 1 rectal) were immunohistochemically stained for antibodies to CD34, HMB-45, desmin, smooth muscle actin, calponin, h-caldesmon, anaplastic lymphoma kinase, S-100 protein, epithelial membrane antigen, c-kit (CD117), stem cell factor (SCF/N19 or kit ligand), p53, bcl-2, cyclin D1, and human herpesvirus-8 (HHV8). In situ hybridization for Epstein-Barr virus-encoded RNA (EBER) was also performed. Ten cases were further evaluated for the dendritic cell markers fascin, CD21, CD23, and CD35. Stromal cells were diffusely positive for CD34 and fascin in all (100%) cases, and these stromal cells were, in addition, immunoreactive for calponin and smooth muscle actin in 88% and 25% of cases, respectively. CD35 was also found to be focally reactive in the stromal cells. Cyclin-D1 was overexpressed in all (100%) IFPs. All other immunohistochemical markers and EBER were negative in the stromal cells. These findings suggest that the proliferating stromal cells in IFPs are of dendritic cell origin, with some cases also exhibiting myofibroblastic features. Absence of c-kit, SCF, and h-caldesmon immunoreactivity fails to support a relationship to GISTs. We also conclude that Epstein Barr virus and HHV8 are

  20. MicroRNAs Associated with the Efficacy of Photodynamic Therapy in Biliary Tract Cancer Cell Lines

    PubMed Central

    Wagner, Andrej; Mayr, Christian; Bach, Doris; Illig, Romana; Plaetzer, Kristjan; Berr, Frieder; Pichler, Martin; Neureiter, Daniel; Kiesslich, Tobias

    2014-01-01

    Photodynamic therapy (PDT) is a palliative treatment option for unresectable hilar biliary tract cancer (BTC) showing a considerable benefit for survival and quality of life with few side effects. Currently, factors determining the cellular response of BTC cells towards PDT are unknown. Due to their multifaceted nature, microRNAs (miRs) are a promising analyte to investigate the cellular mechanisms following PDT. For two photosensitizers, Photofrin® and Foscan®, the phototoxicity was investigated in eight BTC cell lines. Each cell line (untreated) was profiled for expression of n = 754 miRs using TaqMan® Array Human MicroRNA Cards. Statistical analysis and bioinformatic tools were used to identify miRs associated with PDT efficiency and their putative targets, respectively. Twenty miRs correlated significantly with either high or low PDT efficiency. PDT was particularly effective in cells with high levels of clustered miRs 25-93*-106b and (in case of miR-106b) a phenotype characterized by high expression of the mesenchymal marker vimentin and high proliferation (cyclinD1 and Ki67 expression). Insensitivity towards PDT was associated with high miR-200 family expression and (for miR-cluster 200a/b-429) expression of differentiation markers Ck19 and Ck8/18. Predicted and validated downstream targets indicate plausible involvement of miRs 20a*, 25, 93*, 130a, 141, 200a, 200c and 203 in response mechanisms to PDT, suggesting that targeting these miRs could improve susceptibility to PDT in insensitive cell lines. Taken together, the miRNome pattern may provide a novel tool for predicting the efficiency of PDT and—following appropriate functional verification—may subsequently allow for optimization of the PDT protocol. PMID:25380521

  1. Effects of activity in single sensory fibres on the discharge patterns of dorsal spinocerebellar tract cells.

    PubMed

    Muñoz-Martínez, E J

    1975-02-01

    1. Electrical activity of dorsal spinocerebellar tract (DSCT) was recorded extracellularly and intracellularly in Clarke's column nucleus. 2.Trains of impluses were elicited in DSCT cells by static stretch of the hind limb muscles, and the distributions of intervals between the impulses were computed. These distributions were essentially similar before and after impalement of the cells with the micropipette, suggesting that cell injury caused by penetration was insignificant. 3. Patterns of synaptic activity revealed that the DSCT cells examined were innervated by a limited number of muscle afferents. 4. In some DSCT neurons, all excitatory post-synaptic potentials (e.p.s.p.s) elicited by a single fibre were suprathreshold, and e.p.s.p.s elicited by other afferents were usually subthreshold. These neurons discharge very regularly during muscle stretch, and the spike initiation followed nearly one-to-one relation in response to activity of the sensory fibre eliciting suprathreshold e.p.s.p.s. 5. The discharge pattern was irregular in other DSCT cells. In these cases, single sensory fibres evoked e.p.s.p.s. which did not always reach the firing threshold because of random fluctuation in their amplitude. 6. DSCT neurons often show low frequency discharges (about 10/sec) in the absence of sensory activation. In these conditions only small e.p.s.p.s. were detected (average, 0.53 mV) suggesting that the average membrane potential is very close (1-i mV) to the firing threshold. 7. It is concluded that the statistical properties of firing patterns in DSCT neurons activated by muscle afferents depend on (a) the large amplitude of e.p.s.p.s., (b) their firing threshold and (c) random fluctuations in the e.p.s.p.s. amplitude.

  2. Human papillomavirus-related basaloid squamous cell carcinoma of the bladder associated with genital tract human papillomavirus infection.

    PubMed

    Ginori, Alessandro; Barone, Aurora; Santopietro, Rosa; Barbanti, Gabriele; Cecconi, Filippo; Tripodi, Sergio Antonio

    2015-02-01

    Basaloid squamous cell carcinoma is a biologically aggressive neoplasm mainly found in the head and neck region. Recently, four cases of basaloid squamous cell carcinoma of the bladder have been reported, and three of them occurred in patients with neurogenic bladder, repeated catheterizations and human papillomavirus infection of the urinary tract. To the best of our knowledge, none of the patients affected by basaloid squamous cell carcinoma of the bladder described in the literature had documented genital involvement by human papillomavirus. Herein, we describe the case of a woman with neurogenic bladder affected by basaloid squamous cell carcinoma of the bladder and by a concomitant genital tract human papillomavirus infection. © 2014 The Japanese Urological Association.

  3. The effects of intestinal tract bacterial diversity on mortality following allogeneic hematopoietic stem cell transplantation

    PubMed Central

    Jenq, Robert R.; Perales, Miguel-Angel; Littmann, Eric R.; Morjaria, Sejal; Ling, Lilan; No, Daniel; Gobourne, Asia; Viale, Agnes; Dahi, Parastoo B.; Ponce, Doris M.; Barker, Juliet N.; Giralt, Sergio; van den Brink, Marcel; Pamer, Eric G.

    2014-01-01

    Highly diverse bacterial populations inhabit the gastrointestinal tract and modulate host inflammation and promote immune tolerance. In allogeneic hematopoietic stem cell transplantation (allo-HSCT), the gastrointestinal mucosa is damaged, and colonizing bacteria are impacted, leading to an impaired intestinal microbiota with reduced diversity. We examined the impact of intestinal diversity on subsequent mortality outcomes following transplantation. Fecal specimens were collected from 80 recipients of allo-HSCT at the time of stem cell engraftment. Bacterial 16S rRNA gene sequences were characterized, and microbial diversity was estimated using the inverse Simpson index. Subjects were classified into high, intermediate, and low diversity groups and assessed for differences in outcomes. Mortality outcomes were significantly worse in patients with lower intestinal diversity; overall survival at 3 years was 36%, 60%, and 67% for low, intermediate, and high diversity groups, respectively (P = .019, log-rank test). Low diversity showed a strong effect on mortality after multivariate adjustment for other clinical predictors (transplant related mortality: adjusted hazard ratio, 5.25; P = .014). In conclusion, the diversity of the intestinal microbiota at engraftment is an independent predictor of mortality in allo-HSCT recipients. These results indicate that the intestinal microbiota may be an important factor in the success or failure in allo-HSCT. PMID:24939656

  4. TERT promoter mutations in renal cell carcinomas and upper tract urothelial carcinomas

    PubMed Central

    Liu, Jikai; Liu, Cheng; Wang, Chang; Ge, Nan; Ren, Hongbo; Yan, Keqiang; Hu, Sanyuan; Björkholm, Magnus; Fan, Yidong; Xu, Dawei

    2014-01-01

    TERT promoter mutations are identified in many malignancies including bladder cancer (BC) and upper tract urothelial carcinoma (UTUC). In contrast, no mutations were found in renal cell carcinoma (RCC) as reported in a recent study. Because the mutant TERT promoter in urine DNA was recently tested as a marker for BC, it is important to ascertain whether these mutations are truly absent in RCCs. Here we determined TERT promoter mutations in 109 patients with RCC and 14 patients with UTUC. The mutations were found in 9/96 (9.3%) clear cell RCC (ccRCC) tumors and 1/8 (13%) chromophobe RCC tumors. Among ccRCC patients, the mutation was correlated with the advanced stages and metastasis, and higher TERT expression. Among UTUCs, the mutation was detected in tumors from 3/5 (60%) patients with renal pelvic cancer and 1/9 (11%) patients with ureter cancer. The mutation was also detected in 1 of 4 urine samples from patients with mutation+ UTUC. Collectively, TERT promoter mutations do occur in RCCs and are associated with aggressive disease. The mutation is more frequent in renal pelvic cancer. Thus, the mutant TERT promoter found in urine may come from not only BC, but also RCC or UTUC. PMID:24742867

  5. Human immunodeficiency virus type 1 infection of cells and tissues from the upper and lower human female reproductive tract.

    PubMed Central

    Howell, A L; Edkins, R D; Rier, S E; Yeaman, G R; Stern, J E; Fanger, M W; Wira, C R

    1997-01-01

    Viable tissue sections and isolated cell cultures from the human fallopian tube, uterus, cervix, and vaginal mucosa were examined for susceptibility to infection with human immunodeficiency virus type 1 (HIV-1). We examined infectivity by using the monocytotropic strain HIV-1(JR-FL) and several primary isolates of HIV-1 obtained from infected neonates. HIV-1 infection was measured by p24 production in short-term culture and by immunofluorescence detection of HIV-1 Nef and p24 proteins by laser scanning confocal microscopy. Three-color immunofluorescence was used to phenotype HIV-infected cells within tissue sections from each site. Our findings indicate that epithelial, stromal, and dendritic cells and cells with CD14+ CD4+, CD14-CD4-, and CD4+ CD14- phenotypes from the female reproductive tract are infectable with HIV-1. Of importance is the finding that tissues from the upper reproductive tract are susceptible to infection with HIV-1. Moreover, tissue samples from women in all stages of the menstrual cycle, including postmenopausal women (inactive), could be infected with HIV-1. Female reproductive tract cells required a minimum of 60 min of exposure to HIV-1 in order for infection to occur, in contrast to peripheral blood lymphocytes, which became infected after being exposed to HIV-1 for only 1 min. These findings demonstrate that HIV-1 can infect cells and tissues from different sites within the female reproductive tract and suggest that multiple cell types, including epithelial cells, may be targets for the initial infection by HIV-1. PMID:9094621

  6. Detection of invariant natural killer T cells in ejaculates from infertile patients with chronic inflammation of genital tract.

    PubMed

    Duan, Yong-Gang; Chen, Shujian; Haidl, Gerhard; Allam, Jean-Pierre

    2017-04-03

    Chronic inflammation of genital tract is thought to play a major role in male fertility disorder. Natural killer (NK) T cells are a heterogeneous group of T cells that share properties of both T cells and NK cells which display immunoregulatory properties. However, little is known regarding the presence and function of NK T cells in ejaculates from patients with chronic inflammation of genital tract. Invariant NK T (iNK T) cells were detected by invariant (Vα24-JαQ) TCR chain in ejaculates from patients suffering from chronic inflammation of genital tract (CIGT) using flow cytometry and immunofluorescence of double staining (n=40). Inflammatory cytokines interleukin (IL)-6, IL-17, and IFN-γ were detected in cell-free seminal plasma using an enzyme-linked immunosorbent assay (ELISA). The correlation between the percentage of iNK T cells and spermatozoa count, motility, vitality, seminal IL-6, IL-17, and IFN-γ was investigated. Significant percentages of iNK T cells above 10% were detected in 50% (CIGT-NKT(+) group). A negative correlation was detected between the percentage of iNK T cells and spermatozoa count (r=-.5957, P=.0056), motility (r=-.6163, P=.0038), and vitality (r=-.8032, P=.0019) in CIGT-NKT(+) group (n=20). Interestingly, a significant correlation of iNK T cells to seminal IL-6 (r=.7083, P=.0005), IFN-γ (r=.9578, P<.0001) was detected whereas lack of correlation between iNK T cells and IL-17 (r=-.1557, P=.5122) in CIGT-NKT(+) group. The proliferative response of iNK T cells could accompany an inflammatory response to spermatozoa and consequently influence sperm quality through secretion of IFN-γ but not IL-17 under chronic inflammatory condition.

  7. Practical approach to screen vesicoureteral reflux after a first urinary tract infection

    PubMed Central

    Fuente, María Álvarez; Costa, Talía Sainz; García, Begoña Santiago; Serrano, Marcelina Algar; Alonso, Manuel Sosa; Luján, Esther Aleo

    2014-01-01

    Introduction: Vesicoureteral reflux (VUR) is a common pediatric urologic disorder. After the first urinary tract infection (UTI), imaging studies are recommended, starting with a renal ultrasound (RUS). Voiding cystourethrography (VCUG) and dimercaptosuccinic acid (DMSA) scan are the other main radiologic studies used to detect VUR. We evaluated the use of RUS as a screening method for VUR in children below 2 years of age, in order to avoid unnecessary VCUG. Materials and Methods: Medical records and imaging studies of infants (<2 years) who had their first UTI in a 6 year period were retrospectively reviewed. We evaluated the sensitivity, specificity, and negative predictive values of RUS and DMSA for diagnosing VUR. Results: Among 155 children (51% males) with their first UTI, 148 RUS were performed, 128 VCUG and 29 DMSA. VUR was detected in 21% patients; 14.5% low grade and 6.5% high grade. One hundred and twenty-one patients underwent both RUS and VCUG, 101 RUS were normal and 20 abnormal. Of the normal RUS 98% had no or low grade VUR. Among those with an abnormality on RUS 30% had high grade VUR (P < 0.001). Conclusions: After the first UTI in infants (<2 years) RUS is a good screening method for VUR. Among such shildren with a normal RUS, we do not recommend VCUG or DMSA. In our opinion, VCUG should be performed only in patients with abnormal findings in RUS or in recurrent UTI. PMID:25378818

  8. Human and Avian Influenza Viruses Target Different Cells in the Lower Respiratory Tract of Humans and Other Mammals

    PubMed Central

    van Riel, Debby; Munster, Vincent J.; de Wit, Emmie; Rimmelzwaan, Guus F.; Fouchier, Ron A.M.; Osterhaus, Albert D.M.E.; Kuiken, Thijs

    2007-01-01

    Viral attachment to the host cell is critical for tissue and species specificity of virus infections. Recently, pattern of viral attachment (PVA) in human respiratory tract was determined for highly pathogenic avian influenza virus of subtype H5N1. However, PVA of human influenza viruses and other avian influenza viruses in either humans or experimental animals is unknown. Therefore, we compared PVA of two human influenza viruses (H1N1 and H3N2) and two low pathogenic avian influenza viruses (H5N9 and H6N1) with that of H5N1 virus in respiratory tract tissues of humans, mice, ferrets, cynomolgus macaques, cats, and pigs by virus histochemistry. We found that human influenza viruses attached more strongly to human trachea and bronchi than H5N1 virus and attached to different cell types than H5N1 virus. These differences correspond to primary diagnoses of tracheobronchitis for human influenza viruses and diffuse alveolar damage for H5N1 virus. The PVA of low pathogenic avian influenza viruses in human respiratory tract resembled that of H5N1 virus, demonstrating that other properties determine its pathogenicity for humans. The PVA in human respiratory tract most closely mirrored that in ferrets and pigs for human influenza viruses and that in ferrets, pigs, and cats for avian influenza viruses. PMID:17717141

  9. Human and avian influenza viruses target different cells in the lower respiratory tract of humans and other mammals.

    PubMed

    van Riel, Debby; Munster, Vincent J; de Wit, Emmie; Rimmelzwaan, Guus F; Fouchier, Ron A M; Osterhaus, Albert D M E; Kuiken, Thijs

    2007-10-01

    Viral attachment to the host cell is critical for tissue and species specificity of virus infections. Recently, pattern of viral attachment (PVA) in human respiratory tract was determined for highly pathogenic avian influenza virus of subtype H5N1. However, PVA of human influenza viruses and other avian influenza viruses in either humans or experimental animals is unknown. Therefore, we compared PVA of two human influenza viruses (H1N1 and H3N2) and two low pathogenic avian influenza viruses (H5N9 and H6N1) with that of H5N1 virus in respiratory tract tissues of humans, mice, ferrets, cynomolgus macaques, cats, and pigs by virus histochemistry. We found that human influenza viruses attached more strongly to human trachea and bronchi than H5N1 virus and attached to different cell types than H5N1 virus. These differences correspond to primary diagnoses of tracheobronchitis for human influenza viruses and diffuse alveolar damage for H5N1 virus. The PVA of low pathogenic avian influenza viruses in human respiratory tract resembled that of H5N1 virus, demonstrating that other properties determine its pathogenicity for humans. The PVA in human respiratory tract most closely mirrored that in ferrets and pigs for human influenza viruses and that in ferrets, pigs, and cats for avian influenza viruses.

  10. Non-metastatic upper tract transitional cell carcinoma: single center experience.

    PubMed

    Demirci, Umut; Canda, Abdullah Erdem; Dede, Didem Sener; Cakici, Ozer Ural; Akinci, Muhammed Bulent; Yalcin, Bulent

    2013-01-01

    Upper tract transitional cell carcinomas (UTCC) are relatively uncommon but prognosis is generally worse than TCC of bladder. Between March 2004 and June 2012, patients with initial non- metastatic UTCC were assessed in the Medical Oncology and Urology Departments of Ataturk Training and Research Hospital. A total of 11 patients with initially non-metastatic UTCC were detected in the 8 year period, all males. Median age of was 62 (range, 38-74). Six lesions were located in the renal pelvis and 5 in the ureter. Nephroureterectomy was performed in 9 patients, and distal ureterectomy and cuff excision of the bladder in the remaining 2. The majority (n= 9) had high grade tumors. Median primary tumor diameter was 3.5 cm (range, 0.7-10). Five patients (45.5%) were stage I, 2 (18.2%) were stage II, and 4 (36.4%) were stage III. While adjuvant chemotherapy was not applied for stage I and II disease (n= 7), 4 to 6 courses were applied for 3 of the stage III patients. Also one stage III case received adjuvant radiotherapy. Up to 100 months follow-up, median overall survival was 13 months (range, 5-100 months). While stage I and II patients are following-up without muscle-invasive progression, 2 of stage III patients demonstrated progression. We need more collaborative studies to determine management of especially pT3-pT4 patients with UTCC.

  11. Total retroperitoneal laparoscopic nephroureterectomy with bladder-cuff resection for upper urinary tract transitional cell carcinoma.

    PubMed

    Fang, Zhenqiang; Li, Longkun; Wang, Xiangwei; Chen, Wei; Jia, Weisheng; He, Fan; Shen, Chongxing; Ye, Gang

    2014-12-01

    Open nephroureterectomy (ONU) and bladder cuff resection (ONU-BCR) has been the gold standard of surgical treatment for upper urinary tract transitional cell carcinoma (UUT-TCC). The aim of this study is to introduce a modified total retroperitoneal laparoscopic nephroureterectomy (LNU) with bladder-cuff resection (LNU-BCR) method for treating UUT-TCC and compare its clinical efficacy with ONU-BCR. Sixty-five patients with UUT-TCC, who underwent ONU-BCR (n = 36) or LNU-BCR (n = 29) between January 2008 and June 2012, were analyzed in this retrospective study. Perioperative data as well as incidence of disease recurrence at the primary site or distant metastasis was compared in patients with at least 6 months follow-up. As compared with patients with ONU-BCR, the patients with LNU-BCR had significantly shorter operative time, lower estimated blood loss, shorter time to oral intake, lower analgesic dose, shorter duration of analgesic use, shorter duration of incision drainage tube, shorter time to ambulation out of bed and reduced postoperative hospital stay (all, p < .05). No significant difference in postoperative complications or incidence of bladder carcinoma recurrence and distant metastasis during the follow-up period was observed. The modified LNU-BCR represents an effective and safe alternative technique to ONU-BCR with the advantages of reduced invasiveness, bleeding and hospitalization.

  12. Matched-pair analysis of open versus laparoscopic nephroureterectomy for upper urinary tract urothelial cell carcinoma.

    PubMed

    Blackmur, James P; Stewart, Grant D; Egong, Eric A; Cutress, Mark L; Tolley, David A; Riddick, Anthony C P; McNeill, S Alan

    2015-01-01

    Laparoscopic nephroureterectomy (LNU) offers a superior morbidity profile compared with open nephroureterectomy (ONU) in treating upper urinary tract urothelial cell carcinoma. Evidence of oncological equivalence between LNU and ONU is limited. We compare operative and oncological outcomes for LNU and ONU using matched-pair analysis. Of 159 patients who underwent a nephroureterectomy at a single institution between April 1992 and April 2010, 13 pairs of ONU and LNU patients were matched for gender, age, tumour location, tumour grade and stage. Operative details, post-operative characteristics and recurrences were collated and survival rates analysed using the Kaplan-Meier method. There was no significant difference in mean operation time between LNU (191 min) and ONU (194 min, p=0.92). There was no significant difference in the 5-year survival rate between LNU and ONU (overall survival 59.1% vs. 73.5%, p=0.18; progression-free survival 24.0% vs. 56.0%, p=0.14; cancer-specific survival 60.9% vs. 73.5%, p=0.56; bladder cancer recurrence-free survival 8.7% vs. 0.0%, p=0.09). Amidst limited RCT and comparative studies, this study presents further evidence of oncological equivalence between LNU and ONU. There was a trend towards poorer outcomes following LNU though, which merits further study. © 2014 S. Karger AG, Basel.

  13. Neisseria gonorrhoeae induced disruption of cell junction complexes in epithelial cells of the human genital tract.

    PubMed

    Rodríguez-Tirado, Carolina; Maisey, Kevin; Rodríguez, Felipe E; Reyes-Cerpa, Sebastián; Reyes-López, Felipe E; Imarai, Mónica

    2012-03-01

    Pathogenic microorganisms, such as Neisseria gonorrhoeae, have developed mechanisms to alter epithelial barriers in order to reach subepithelial tissues for host colonization. The aim of this study was to examine the effects of gonococci on cell junction complexes of genital epithelial cells of women. Polarized Ishikawa cells, a cell line derived from endometrial epithelium, were used for experimental infection. Infected cells displayed a spindle-like shape with an irregular distribution, indicating potential alteration of cell-cell contacts. Accordingly, analysis by confocal microscopy and cellular fractionation revealed that gonococci induced redistribution of the adherens junction proteins E-cadherin and its adapter protein β-catenin from the membrane to a cytoplasmic pool, with no significant differences in protein levels. In contrast, gonococcal infection did not induce modification of either expression or distribution of the tight junction proteins Occludin and ZO-1. Similar results were observed for Fallopian tube epithelia. Interestingly, infected Ishikawa cells also showed an altered pattern of actin cytoskeleton, observed in the form of stress fibers across the cytoplasm, which in turn matched a strong alteration on the expression of fibronectin, an adhesive glycoprotein component of extracellular matrix. Interestingly, using western blotting, activation of the ERK pathway was detected after gonococcal infection while p38 pathway was not activated. All effects were pili and Opa independent. Altogether, results indicated that gonococcus, as a mechanism of pathogenesis, induced disruption of junction complexes with early detaching of E-cadherin and β-catenin from the adherens junction complex, followed by a redistribution and reorganization of actin cytoskeleton and fibronectin within the extracellular matrix. Copyright © 2011. Published by Elsevier Masson SAS.

  14. Targeted deletion of Hand2 in cardiac neural crest-derived cells influences cardiac gene expression and outflow tract development

    PubMed Central

    Holler, Kristen L.; Hendershot, Tyler J.; Troy, Sophia E.; Vincentz, Joshua W.; Firulli, Anthony B.; Howard, Marthe J.

    2010-01-01

    The basic helix-loop-helix DNA binding protein Hand2 has critical functions in cardiac development both in neural crest-derived and mesoderm-derived structures. Targeted deletion of Hand2 in the neural crest has allowed us to genetically dissect Hand2-dependent defects specifically in outflow tract and cardiac cushion independent of Hand2 functions in mesoderm-derived structures. Targeted deletion of Hand2 in the neural crest results in misalignment of the aortic arch arteries and outflow tract, contributing to development of double outlet right ventricle (DORV) and ventricular septal defects (VSD). These neural crest-derived developmental anomalies are associated with altered expression of Hand2-target genes we have identified by gene profiling. A number of Hand2 direct target genes have been identified using ChIP and ChIP-on-chip analyses. We have identified and validated a number of genes related to cell migration, proliferation/cell cycle and intracellular signaling whose expression is affected by Hand2 deletion in the neural crest and which are associated with development of VSD and DORV. Our data suggest that Hand2 is a multifunctional DNA binding protein affecting expression of target genes associated with a number of functional interactions in neural crest-derived cells required for proper patterning of the outflow tract, generation of the appropriate number of neural crest-derived cells for elongation of the conotruncus and cardiac cushion organization. Our genetic model has made it possible to investigate the molecular genetics of neural crest contributions to outflow tract morphogenesis and cell differentiation. PMID:20144608

  15. Proteus mirabilis uroepithelial cell adhesin (UCA) fimbria plays a role in the colonization of the urinary tract.

    PubMed

    Pellegrino, Rafael; Scavone, Paola; Umpiérrez, Ana; Maskell, Duncan J; Zunino, Pablo

    2013-03-01

    Urinary tract infections (UTIs) are among the most common bacterial infections in humans. Proteus mirabilis is an opportunistic pathogen, capable of causing severe UTIs, with serious kidney damage that may even lead to death. Several virulence factors are involved in the pathogenicity of this bacterium. Among these, adherence to the uroepithelium mediated by fimbriae appears to be a significant bacterial attribute related to urovirulence. Proteus mirabilis expresses several types of fimbriae that could be involved in the pathogenesis of UTI, including uroepithelial cell adhesin (UCA). In this report, we used an uropathogenic P. mirabilis wild-type strain and an isogenic ucaA mutant unable to express UCA to study the pathogenic role of this fimbria in UTI. Ability of the mutant to adhere to desquamated uroepithelial cells and to infect mice using different experimental UTI models was significantly impaired. These results allow us to conclude that P. mirabilis UCA plays an important role in the colonization of the urinary tract.

  16. Downregulation of programmed cell death 4 (PDCD4) in tumorigenesis and progression of human digestive tract cancers.

    PubMed

    Ma, Gang; Zhang, Hao; Dong, Ming; Zheng, Xinyu; Ozaki, Iwata; Matsuhashi, Sachiko; Guo, Kejian

    2013-12-01

    Nowadays, digestive tract cancers become the commonest neoplasia and one of the leading causes of cancer deaths worldwide. The development of diagnosis and therapy is urgently required. Programmed cell death 4 (PDCD4), a new tumor suppressor, has been documented to be a potential diagnostic tool and treatment target for neoplasia due to the inhabitation of tumor promotion/progression and metastasis. However, its role in human digestive tract cancers is few available up to now. In this study, we examined the expression of PDCD4 in human digestive tract cancers (61 gastric cancer, 65 colorectal cancer, and 69 pancreatic cancer patients) by Western blot analysis, reverse transcription (RT)-PCR, and immunohistochemistry. Western blot, RT-PCR, and immunohistochemistry examination showed that expressions of PDCD4 were significantly lower in cancers specimens than in noncancerous tissues. Among the different differentiated cancer tissues, PDCD4 expression was significantly lower in moderately or poorly differentiated cancers than in well-differentiated cancers (p < 0.05). Our findings suggested that PDCD4 might be a potentially valuable molecular target in diagnosis and therapy for human digestive tract cancers.

  17. A Novel Approach for Characterizing Microsatellite Instability in Cancer Cells

    PubMed Central

    Lu, Yuheng; Soong, T. David; Elemento, Olivier

    2013-01-01

    Microsatellite instability (MSI) is characterized by the expansion or contraction of DNA repeat tracts as a consequence of DNA mismatch repair deficiency (MMRD). Accurate detection of MSI in cancer cells is important since MSI is associated with several cancer subtypes and can help inform therapeutic decisions. Although experimental assays have been developed to detect MSI, they typically depend on a small number of known microsatellite loci or mismatch repair genes and have limited reliability. Here, we report a novel genome-wide approach for MSI detection based on the global detection of insertions and deletions (indels) in microsatellites found in expressed genes. Our large-scale analyses of 20 cancer cell lines and 123 normal individuals revealed striking indel features associated with MSI: there is a significant increase of short microsatellite deletions in MSI samples compared to microsatellite stable (MSS) ones, suggesting a mechanistic bias of repair efficiency between insertions and deletions in normal human cells. By incorporating this observation into our MSI scoring metric, we show that our approach can correctly distinguish between MSI and MSS cancer cell lines. Moreover, when we applied this approach to primal tumor samples, our metric is also well consistent with diagnosed MSI status. Thus, our study offers new insight into DNA mismatch repair system, and also provides a novel MSI diagnosis method for clinical oncology with better reliability. PMID:23671654

  18. Modeling the transcriptome of genital tract epithelial cells and macrophages in healthy mucosa versus mucosa inflamed by Chlamydia muridarum infection

    PubMed Central

    Johnson, Raymond M.; Kerr, Micah S.

    2015-01-01

    Chlamydia trachomatis urogenital serovars are intracellular bacteria that parasitize human reproductive tract epithelium. As the principal cell type supporting bacterial replication, epithelial cells are central to Chlamydia immunobiology initially as sentries and innate defenders, and subsequently as collaborators in adaptive immunity-mediated bacterial clearance. In asymptomatic individuals who do not seek medical care a decisive struggle between C. trachomatis and host defenses occurs at the epithelial interface. For this study, we modeled the immunobiology of epithelial cells and macrophages lining healthy genital mucosa and inflamed/infected mucosa during the transition from innate to adaptive immunity. Upper reproductive tract epithelial cell line responses were compared to bone marrow-derived macrophages utilizing gene expression microarray technology. Those comparisons showed minor differences in the intrinsic innate defenses of macrophages and epithelial cells. Major lineage-specific differences in immunobiology relate to epithelial collaboration with adaptive immunity including an epithelial requirement for inflammatory cytokines to express MHC class II molecules, and a paucity and imbalance between costimulatory and coinhibitory ligands on epithelial cells that potentially limits sterilizing immunity (replication termination) to Chlamydia-specific T cells activated with limited or unconventional second signals. PMID:26519447

  19. Epithelial Cell Secretions from the Human Female Reproductive Tract Inhibit Sexually Transmitted Pathogens and Candida albicans but not Lactobacillus

    PubMed Central

    Wira, CR; Ghosh, M; Smith, JM; Shen, L; Connor, RI; Sundstrom, P; Frechette, Gregory M.; Hill, EM; Fahey, JV

    2011-01-01

    Female reproductive tract (FRT) epithelial cells protect against potential pathogens and sexually transmitted infections. The purpose of this study was to determine if epithelial cells from the upper FRT secrete antimicrobials that inhibit reproductive tract pathogens which threaten women's health. Apical secretions from primary cultures of Fallopian tube, uterine, cervical and ectocervical epithelial cells were incubated with Neisseria gonorrhoeae, Candida albicans (yeast and hyphal forms), HIV-1, and Lactobacillus crispatus, prior to being tested for their ability to grow and/or infect target cells. Epithelial cell secretions from the upper FRT inhibit N. gonorrhoeae and both forms of Candida, as well as reduce HIV-1 (R5) infection of target cells. In contrast, none had an inhibitory effect on L. crispatus. Cytokines and chemokines analysis in uterine secretions revealed several molecules that could account for pathogen inhibition. These findings provide definitive evidence for the critical role of epithelial cells in protecting the FRT from infections, without comprising the beneficial presence of L. crispatus, which is part of the normal vaginal microflora of humans. PMID:21048705

  20. Relative distribution of gastrin-, CCK-8-, NPY- and CGRP-immunoreactive cells in the digestive tract of dorado (Salminus brasiliensis).

    PubMed

    Pereira, R T; Costa, L S; Oliveira, I R C; Araújo, J C; Aerts, M; Vigliano, F A; Rosa, P V

    2015-04-01

    The endocrine cells (ECs) of the gastrointestinal mucosa form the largest endocrine system in the body, not only in terms of cell numbers but also in terms of the different produced substances. Data describing the association between the relative distributions of the peptide-specific ECs in relation to feeding habits can be useful tools that enable the creation of a general expected pattern of EC distribution. We aimed to investigate the distribution of ECs immunoreactive for the peptides gastrin (GAS), cholecystokinin (CCK-8), neuropeptide Y (NPY), and calcitonin gene-related peptide (CGRP) in different segments of the digestive tract of carnivorous fish dorado (Salminus brasiliensis) by using immunohistochemistry procedures. The distribution of endocrine cells immunoreactive for gastrin (GAS), cholecystokinin (CCK-8), neuropeptide Y (NPY), and calcitonin gene-related peptide (CGRP) in digestive tract of dorado S. brasiliensis was examined by immunohistochemistry. The results describe the association between the distribution of the peptide-specific endocrine cells and feeding habits in different carnivorous fish. The largest number of endocrine cells immunoreactive for GAS, CCK-8, and CGRP were found in the pyloric stomach region and the pyloric caeca. However, NPY-immunoreactive endocrine cells were markedly restricted to the midgut. The distribution pattern of endocrine cells identified in S. brasiliensis is similar to that found in other carnivorous fishes.

  1. Clinical effects of p53 overexpression in squamous cell carcinoma of the sinonasal tract

    PubMed Central

    Wang, Xiaowei; Lv, Wei; Qi, Fang; Gao, Zhiqiang; Yang, Hua; Wang, Weiqing; Gao, Yali

    2017-01-01

    Abstract Background: The level of p53 protein expression in sinonasal squamous cell carcinoma (SNSCC) has been estimated, but the results remain inconsistent and the point of consensus has not been reached. This study was first determined to evaluate the clinical effects of p53 expression in SCC of the sinonasal tract. Methods: According to the preferred reporting items for systematic reviews and meta-analyses (PRISMA) statement criteria, the potential literature was searched from diverse databases. The pooled odds ratios (ORs) with corresponding 95% confidence intervals (CIs) were calculated to assess the strength of association between p53 expression and SNSCC. Results: Final 17 eligible studies were included in a total of 258 cases and 748 controls. The result of p53 expression was shown to be notably higher in SNSCC than in benign sinonasal papillomas and normal sinonasal mucosa (OR = 26.93, P < 0.001; OR = 39.79, P < 0.001; respectively). Subgroup analyses of ethnicity revealed that p53 expression had significant association with SNSCC in Asian and Caucasian populations in cancer versus benign sinonasal papillomas or normal sinonasal mucosa. The expression of p53 was notably higher in moderately or poorly differentiated SNSCC than in well-differentiated SNSCC (OR = 3.51, P = 0.021), while p53 expression was not associated with histological type. Conclusion: The results suggested that p53 overexpression may be correlated with the carcinogenesis and progression of SNSCC. The p53 gene may become a novel drug target of SNSCC. Additional studies on the correlation of p53 expression with clinicopathological features are needed. PMID:28328848

  2. [Systemic lymphoma cells with T precursor condition of extreme female genital tract. A case report and literature review].

    PubMed

    Butrón Valdez, Karla; Ramírez Galves, Miguel; Germes Piña, Fernando; Ramos Martínez, Ernesto; Zamora Perea, Arturo

    2009-06-01

    Primary female genital tract non Hodgkin's lymphoma is a rare presentation for a common disease in the childhood, and its classification as primary extranodal lymphoma is still controversial. There are a few cases reported as a primary precursor B-cell lymphoblastic lymphoma of the female genital tract, but there is not any case reported as primary precursor T-cell lymphoblastic lymphoma of the ovary in childhood. Herein we describe a 16 years old young woman with bilateral ovarian tumors, paraaortic lymphoadenophaty and disseminate disease to the female genital tract including extension of the tumor to neighboring organs like the omentum and the appendix. Exploratory laparatomy were performed with bilateral salpingo-oophorectomy, hysterectomy, omentectomy, appendectomy, pelvic and para-aortic lymphadenectomy, pelvic washings and with biopsy of vaginal vault. The chemotherapy regimen comprised of CHOP (Cyclophosphamide, Hydroxydaunorubicin, Oncovin, Prednisone/Prednisolone) and methotrexate, 3 months later presents left facial hemiparesia follow by right facial hemiparesia, 7 months later presents more Central Nervous System (CNS) complications and apparently was complicated with acute lymphocitic leukemia and after 16 months from the diagnosis, following by a torpid evolution, the pacient finally died.

  3. The oncological results of laparoscopic nephroureterectomy for upper urinary tract transitional cell cancer are equal to those of open nephroureterectomy.

    PubMed

    Waldert, Matthias; Remzi, Mesut; Klingler, Hans Christoph; Mueller, Lukas; Marberger, Michael

    2009-01-01

    To compare the overall, tumour-specific, recurrence-free, and progression- free survival of patients with upper urinary tract transitional cell carcinoma (UUT-TCC) treated with laparoscopic nephroureterectomy (LNU) or standard open NU (ONU). Clinical, pathological and follow-up data were analysed for 43 LNUs and 59 ONUs performed at our institution from 1999 to 2006. In LNU the kidney was removed laparoscopically as in radical nephrectomy, but without transecting the ureter. The specimen was then removed intact with the entire ureter and a bladder cuff through a nonmuscle-splitting supra-inguinal incision. ONU was performed through separate intercostal and supra-inguinal incisions with the entire specimen being removed intact with a bladder cuff through the latter. The mean (SD) follow-up was 41 (20) months for LNU and 41 (29) for ONU. Pathological staging was: pTa 26% vs 20%, pT1 21% vs 27%, pT2 12% vs 17%, pT3 42% vs 34% for LNU and ONU, respectively. In all, seven vs six patients had positive nodes on final histology. Recurrent tumours in the bladder were detected in 26% of patients after LNU and in 27% after ONU after the mean follow-up. There were no local recurrences after LNU but there was local recurrence in six patients after ONU. There were no port-site metastases during the follow-up. Five LNU patients and seven ONU patients developed distant or lymph node metastasis. The actuarial 5-year tumour free-survival rate was 79% in the LNU group vs 76% in the ONU group (P = 0.82). The actuarial disease-specific survival at 5-years was 85% for LNU and 80% for ONU patients (P = 0.62). The surgical approach did not influence recurrence or survival. Oncological results of LNU and ONU are comparable. The lower morbidity of LNU offers advantages for the patient.

  4. Cytokine expression pattern in the genital tract of Chlamydia trachomatis positive infertile women - implication for T-cell responses.

    PubMed

    Reddy, B S; Rastogi, S; Das, B; Salhan, S; Verma, S; Mittal, A

    2004-09-01

    Human genital infection caused by Chlamydia trachomatis is thought to be immunologically mediated, resulting in local recruitment of lymphocyte subsets and inducing the production of cytokines. Little information is available about the role of lymphocyte recruitment and the regulation of cytokine production in the genital tract of C. trachomatis positive infertile women. We have evaluated the recruitment of lymphocyte subsets in the genital tract and production of Th1/Th2 cytokines in cervical secretions and laparoscopic specimens from the fallopian tubes of C. trachomatis positive infertile women (n = 17) and compared them with controls, viz. C. trachomatis negative infertile women (n = 20) using ELISA and flow cytometry. None of these patients were found to be infected either with Candida sps., bacterial vaginosis, Trichomonas vaginalis, Neisseria gonorrhoeae, Mycoplasma hominis or Ureaplasma urealyticum in the cervix. Flow cytometric analysis of cervical secretions in Chlamydia positive women revealed recruitment of both CD4 and CD8 lymphocytes to the genital tract was up-regulated and a variation in the production rates of different cytokines in cervical secretions and fallopian tube was observed. We found that the immune responses in cervical secretions were of Th0 type, since all the analysed cytokines, viz. IFN-gamma, TNF-alpha, IL-10 and IL-12 were up-regulated. As, both CD4 and CD8 cells contribute to the production of IFN-gamma and IL-10, these results suggest that along with CD4 cells, CD8 lymphocytes also may be important for local regulation of Th1/Th2 responses in the genital tract during C. trachomatis infection.

  5. Distribution of obestatin and ghrelin in human tissues: immunoreactive cells in the gastrointestinal tract, pancreas, and mammary glands.

    PubMed

    Grönberg, Malin; Tsolakis, Apostolos V; Magnusson, Linda; Janson, Eva T; Saras, Jan

    2008-09-01

    Obestatin and ghrelin are two peptides derived from the same prohormone. It is well established that ghrelin is produced by endocrine cells in the gastric mucosa. However, the distribution of human obestatin immunoreactive cells is not thoroughly characterized. A polyclonal antibody that specifically recognizes human obestatin was produced. Using this antibody and a commercial antibody vs ghrelin, the distribution of obestatin and ghrelin immunoreactive cells was determined in a panel of human tissues using immunohistochemistry. The two peptides were detected in the mucosa of the gastrointestinal tract, from cardia to ileum, and in the pancreatic islets. Interestingly, epithelial cells in the ducts of mammary glands showed distinct immunoreactivity for both ghrelin and obestatin. By double immunofluorescence microscopy, it was shown that all detected cells were immunoreactive for both peptides. Furthermore, the subcellular localization of obestatin and ghrelin was essentially identical, indicating that obestatin and ghrelin are stored in the same secretory vesicles.

  6. Identification of orexin A- and orexin type 2 receptor-positive cells in the gastrointestinal tract of neonatal dogs.

    PubMed

    Dall'Aglio, C; Pascucci, L; Mercati, F; Giontella, A; Pedini, V; Scocco, P; Ceccarelli, P

    2008-01-01

    The presence and distribution of cells positive to orexin A (OXA) and to orexin type 2 receptor (OX2R) were investigated in the gastrointestinal tract of neonatal dogs by means of immunohistochemical techniques. The orexin A-positive cells were identified with some of the endocrine cells in the stomach and in the duodenum; they were both of the open and closed type and were lacking in the large intestine. In the stomach, a large subset of orexin A-positive cells also showed gastrin-like immunoreactivity while, in the duodenum, many of them seemed to store serotonin. The orexin type 2 receptor-positive cells were evidenced all along the gastrointestinal tract examined, also in the large intestine, and they showed the same morphological characteristics as those positive to orexin A. Moreover, the immunohistochemical techniques revealed intense positivity for both orexin A and orexin type 2 receptor in the neurons and fibers of the enteric nervous system. A large subset of orexin A-positive neurons seemed to store substance P.

  7. Efficacy of an Anatomical Approach in Radiofrequency Catheter Ablation of Idiopathic Ventricular Arrhythmias Originating From the Left Ventricular Outflow Tract.

    PubMed

    Yamada, Takumi; Yoshida, Naoki; Doppalapudi, Harish; Litovsky, Silvio H; McElderry, H Thomas; Kay, G Neal

    2017-05-01

    When anatomic obstacles preclude radiofrequency catheter ablation of idiopathic ventricular arrhythmias (VAs) originating from the left ventricular outflow tract (LVOT), an alternative approach from the anatomically opposite side (endocardial versus epicardial or above versus below the aortic valve) may be considered (anatomic ablation). The purpose of this study was to investigate the efficacy of an anatomic ablation in idiopathic LVOT VAs. We studied 229 consecutive patients with idiopathic LVOT VAs. Radiofrequency ablation from the first suitable site was successful in 190 patients, and in the remaining 39 patients, it was unsuccessful or had to be abandoned because of anatomic obstacles. In 22 of these 39 patients, an anatomic ablation was successful, and the VA origins were located in the intramural LVOT in 17 patients, basal left ventricular summit in 4, and LVOT septum near the His bundle in 1. The anatomic ablation was highly successful for idiopathic VAs originating from the intramural LVOT (>75%) and lateral LVOT, whereas it was unlikely to be successful for idiopathic VAs originating from the basal left ventricular summit (25%) and sepal LVOT. When a standard catheter ablation targeting the best electrophysiological measure of idiopathic LVOT VAs was unsuccessful or had to be abandoned because of anatomic obstacles, an anatomic ablation was moderately successful. These idiopathic LVOT VAs with a successful anatomic ablation commonly arose from the intramural LVOT among the left coronary cusp, aortomitral continuity, and epicardium, occasionally the basal left ventricular summit, and rarely the LVOT septum near the His bundle. © 2017 American Heart Association, Inc.

  8. Morphology of epithelial cells lining the digestive tract of the giant keyhole limpet, Megathura crenulata (Mollusca; Vetigastropoda).

    PubMed

    Martin, Gary G; Bessette, Tracy; Martin, Alanna; Cotero, Renae; Vumbaco, Kathryn; Oakes, Christopher

    2010-09-01

    To understand the digestive functions in the giant keyhole limpet, it is important to know the types of cells present in each region of the gut and their roles in the secretion of digestive enzymes and absorption of nutrients. This study describes the morphology of cells lining the entire gut and identifies sites that may be secreting materials to aid digestion. Previous studies involving electron microscopy and enzyme analysis have focused on the salivary and digestive glands of several gastropods. Studies on the rest of the gut tract typically include only histological descriptions of the epithelia and although several types of cells have been described, they appear very similar. The purpose of this study is to determine if electron microscopy can provide better insights into the functions of cells in these poorly studied regions of the gut. Our ultrastructural observations suggest that only two types of cells, mucus secreting cells and apocrine secretory cells make up the epithelium in the esophagus, style sac, and intestine. These regions account for 85% of the length of the entire digestive tract. Apocrine secretory cells contain pigment granules, bear cilia, and/or microvilli at their apices, and release product into the gut lumen via apocrine secretion. This suggests that the secretory processes involved with digestion are occurring in most regions of the gut and that apocrine secretion is the primary mode by which materials are introduced into the gut lumen. The lips, salivary glands, stomach, and digestive gland lack apocrine secretory cells and the epithelial cells are similar to those described in other gastropods. J. Morphol. 271:1134-1151, 2010. (c) 2010 Wiley-Liss, Inc.

  9. Characterization of a gastrointestinal tract microscale cell culture analog used to predict drug toxicity

    USDA-ARS?s Scientific Manuscript database

    The lining of the gastrointestinal (GI) tract is the largest surface exposed to the external environment in the human body. One of the main functions of the small intestine is absorption, and intestinal absorption is a route used by essential nutrients, chemicals, and pharmaceuticals to enter the sy...

  10. Cell adhesion molecules P-cadherin and CD24 are markers for carcinoma and dysplasia in the biliary tract.

    PubMed

    Riener, Marc-Oliver; Vogetseder, Alexander; Pestalozzi, Bernhard C; Clavien, Pierre-Alain; Probst-Hensch, Nicole; Kristiansen, Glen; Jochum, Wolfram

    2010-11-01

    P-cadherin (CDH3) and CD24 are cell adhesion molecules that control morphogenic processes, cell motility, and invasive growth of tumor cells. The aim of our study was to investigate P-cadherin and CD24 expression in carcinomas and dysplastic lesions of the biliary tract and to evaluate the potential diagnostic usefulness of these cell adhesion molecules. Using immunohistochemistry on tissue microarrays, we analyzed P-cadherin, CD24, and p53 expression in 117 carcinomas of the biliary tract (19 intrahepatic cholangiocarcinomas, 59 extrahepatic cholangiocarcinomas, and 39 gallbladder carcinomas) and correlated our findings with clinicopathologic parameters. We found P-cadherin positivity in 37% of intrahepatic cholangiocarcinomas, 73% of extrahepatic cholangiocarcinomas, and 64% of gallbladder carcinomas, respectively. CD24 reactivity was observed in 21% of intrahepatic cholangiocarcinomas, 58% of extrahepatic cholangiocarcinomas, and 42% of gallbladder carcinomas. Nuclear p53 expression was found in 37% of intrahepatic cholangiocarcinomas, 46% of extrahepatic cholangiocarcinomas, and 45% of gallbladder carcinomas. We also studied P-cadherin, CD24, and p53 expression in normal (n = 30), inflamed (n = 22), and dysplastic (n = 21) biliary epithelium of extrahepatic bile ducts. Dysplastic biliary epithelium was positive for P-cadherin in 91%, for CD24 in 71%, and for p53 in 24% of lesions, respectively. In contrast, normal and inflamed epithelia were negative for all 3 proteins. We conclude that P-cadherin and CD24 are expressed in carcinomas of the biliary tract with high frequency and at an early stage of carcinogenesis. Therefore, they may be useful markers for early detection and as targets for therapy of cholangiocarcinoma.

  11. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique Tilapia (Oreochromis mossambicus) by polymerase chain reaction.

    PubMed

    Nol, P; Williamson, J L; Rocke, T E; Yuill, T M

    2004-10-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5 x 104 cells per 0.25 g material or 1.9 x 103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  12. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

    USGS Publications Warehouse

    Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

    2004-01-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  13. Sublingual immunization with an HIV subunit vaccine induces antibodies and cytotoxic T cells in the mouse female genital tract.

    PubMed

    Hervouet, Catherine; Luci, Carmelo; Cuburu, Nicolas; Cremel, Magali; Bekri, Selma; Vimeux, Lene; Marañon, Concepcion; Czerkinsky, Cecil; Hosmalin, Anne; Anjuère, Fabienne

    2010-08-02

    A vaccine against heterosexual transmission by human immunodeficiency virus (HIV) should generate cytotoxic and antibody responses in the female genital tract and in extra-genital organs. We report that sublingual immunization with HIV-1 gp41 and a reverse transcriptase polypeptide coupled to the cholera toxin B subunit (CTB) induced gp41-specific IgA antibodies and antibody-secreting cells, as well as reverse transcriptase-specific CD8 T cells in the genital mucosa, contrary to intradermal immunization. Conjugation of the reverse transcriptase peptide to CTB favored its cross-presentation by human dendritic cells to a T cell line from an HIV(+) patient. Sublingual vaccination could represent a promising vaccine strategy against heterosexual transmission of HIV-1.

  14. Phenotype and susceptibility to HIV infection of CD4+ Th17 cells in the human female reproductive tract.

    PubMed

    Rodriguez-Garcia, M; Barr, F D; Crist, S G; Fahey, J V; Wira, C R

    2014-11-01

    Prevention of sexual acquisition of HIV in women requires a substantial increase in our knowledge about HIV-target cell availability and regulation in the female reproductive tract (FRT). In this study, we analyzed the phenotype and susceptibility to HIV infection of CD4(+) T cell in the endometrium (EM), endocervix (END), and ectocervix (ECT) of the FRT. We found that T helper type 17 (Th17) cells represent a major subset in FRT tissues analyzed and that Th17 cells were the main CD4(+) T-cell population expressing C-C motif chemokine receptor 5 (CCR5) and CD90. In premenopausal women, CD4(+) T cells and Th17 cells, in particular, were significantly lower in EM relative to END and ECT. Th17 cells were elevated in EM from postmenopausal women relative to premenopausal tissues but not changed in END and ECT. Susceptibility of CD4(+) T cells to HIV infection measured as intracellular p24 was lowest in the EM and highest in the ECT. Additionally, we found that Th17 cells co-expressing CCR5 and CD90 were the most susceptible to HIV infection. Our results provide valuable information for designing preventive strategies directed at targeting highly susceptible target cells in the FRT.

  15. Oncologic control after open or laparoscopic nephroureterectomy for upper urinary tract transitional cell carcinoma: a single center experience.

    PubMed

    Rouprêt, Morgan; Hupertan, Vincent; Sanderson, Kristin M; Harmon, Justin D; Cathelineau, Xavier; Barret, Eric; Vallancien, Guy; Rozet, François

    2007-04-01

    To determine the surgical and oncologic outcomes in patients who underwent either open nephroureterectomy (ONU) or laparoscopic nephroureterectomy (LNU) for upper urinary tract transitional cell carcinoma. We performed a retrospective review of data for patients who underwent ONU or LNU for upper urinary tract transitional cell carcinoma from 1994 to 2004 at one institution. The recorded data included sex, age, mode of diagnosis, smoking, history of bladder cancer, type of surgery, complications, tumor site, tumor size, tumor stage, tumor grade, length of hospital stay, recurrence, and progression. We also determined the recurrence and survival rates. We reviewed the data for 46 patients. The median age was 70 years. Seven patients had a history of bladder cancer. Overall, 26 patients underwent ONU and 20 LNU. No differences in the complication rate (15% versus 15%) were observed. The median hospital stay was 4 days (range 3 to 6) after LNU and 9 (range 7 to 12) after ONU (P <0.001). The tumor stage and grade were independent prognostic factors for survival on multivariate analysis (P <0.05). The 5-year disease-specific survival rate was 89.4% for low-grade tumors and 63.1% for high-grade tumors (P = 0.04). ONU was associated with high-grade (P = 0.02) or invasive (P = 0.001) tumors. The 5-year tumor-free survival rate after ONU and LNU was 51.2% and 71.6%, respectively (P = 0.59). LNU does not affect the mid-term oncologic control and enables a shorter hospital stay. It can be recommended as an alternative to ONU in the management of low-risk upper urinary tract transitional cell carcinoma (Stage T1-T2 and/or low-grade disease). However, long-term follow-up is necessary to recommend it for highly invasive tumors (Stage T3-T4 or N+).

  16. Comparative study of oncologic outcome of laparoscopic nephroureterectomy and standard nephroureterectomy for upper urinary tract transitional cell carcinoma.

    PubMed

    Manabe, Daisuke; Saika, Takashi; Ebara, Shin; Uehara, Shinya; Nagai, Atsushi; Fujita, Ryuji; Irie, Shin; Yamada, Daisuke; Tsushima, Tomoyasu; Nasu, Yasutomo; Kumon, Hiromi

    2007-03-01

    To determine the oncologic safety of laparoscopic nephroureterectomy (LNU), we compared the long-term oncologic outcome of LNU versus open nephroureterectomy (ONU) in patients with upper tract transitional cell carcinoma. A total of 367 nephroureterectomy procedures were performed at our institutes for upper tract transitional cell carcinoma without distant metastases. Of 224 patients without concomitant or previous bladder cancer, 58 underwent LNU with open intact specimen retrieval plus open distal ureter and bladder cuff removal and 166 underwent ONU. Their data were reviewed and analyzed retrospectively. The mean follow-up was 13.6 months (range 14 to 34) for the LNU group and 28.0 months (range 14 to 36) for the ONU group. Bladder recurrence was recognized in 19 patients (32.8%) after LNU at a median follow-up of 5.6 months compared with 63 patients (38.0%) after ONU. Local recurrence only developed in 2 patients (1.1%) after ONU. One port site metastasis occurred in a patient who had undergone LNU. Distant metastases developed in 10 patients (17.2 %) after LNU and 33 patients (19.9%) after ONU. The frequency of bladder recurrence, local recurrence, and distant metastases did not differ significantly between the two groups. The actual disease-free 2-year survival rates were similar (75.6% versus 81.7%). In all patients, the risk of metastases and death increased with advanced tumor stage and grade, but not by surgical procedure. In the surgical management of upper tract transitional cell carcinoma, LNU does not negatively affect long-term oncologic control and can be considered an alternative modality. Tumor stage and grade are, however, important prognostic factors in the incidence of metastases and cancer-specific mortality.

  17. The BMI1 inhibitor PTC-209 is a potential compound to halt cellular growth in biliary tract cancer cells

    PubMed Central

    Mayr, Christian; Wagner, Andrej; Loeffelberger, Magdalena; Bruckner, Daniela; Jakab, Martin; Berr, Frieder; Di Fazio, Pietro; Ocker, Matthias; Neureiter, Daniel; Pichler, Martin; Kiesslich, Tobias

    2016-01-01

    BMI1 is a core component of the polycomb repressive complex 1 (PRC1) and is up-regulated in biliary tract cancer (BTC), contributing to aggressive clinical features. In this study we investigated the cytotoxic effects of PTC-209, a recently developed inhibitor of BMI1, in BTC cells. PTC-209 reduced overall viability in BTC cell lines in a dose-dependent fashion (0.04 - 20 μM). Treatment with PTC-209 led to slightly enhanced caspase activity and stop of cell proliferation. Cell cycle analysis revealed that PTC-209 caused cell cycle arrest at the G1/S checkpoint. A comprehensive investigation of expression changes of cell cycle-related genes showed that PTC-209 caused significant down-regulation of cell cycle-promoting genes as well as of genes that contribute to DNA synthesis initiation and DNA repair, respectively. This was accompanied by significantly elevated mRNA levels of cell cycle inhibitors. In addition, PTC-209 reduced sphere formation and, in a cell line-dependent manner, aldehyde dehydrogease-1 positive cells. We conclude that PTC-209 might be a promising drug for future in vitro and in vivo studies in BTC. PMID:26623561

  18. Anaplastic lymphoma kinase (ALK) gene alteration in signet ring cell carcinoma of the gastrointestinal tract.

    PubMed

    Alese, Olatunji B; El-Rayes, Bassel F; Sica, Gabriel; Zhang, Guojing; Alexis, Dianne; La Rosa, Francisco G; Varella-Garcia, Marileila; Chen, Zhengjia; Rossi, Michael R; Adsay, Nazim V; Khuri, Fadlo R; Owonikoko, Taofeek K

    2015-03-01

    ALK-EML4 translocation is an established driver aberration in non-small cell lung cancer (NSCLC), with reported predilection for cases with signet ring histology. We assessed the presence of anaplastic lymphoma kinase (ALK) gene rearrangements in signet ring cancers arising in the stomach and colon. Histologically confirmed cases of signet ring adenocarcinoma of the stomach or the colon were identified. The presence of the classic ALK and EML4 fusion gene was initially determined by fluorescence in-situ hybridization (FISH) technique. Immunohistochemistry (IHC) was performed using two previously validated antibodies, ALK1 clone (1:100; DAKO) and 5A4 (Novocastra, Leica Biosystems) along with positive controls of ALK-translocated lung cancer. We employed 42 cases of signet ring carcinoma diagnosed between 2001 and 2011; 25 gastric and 17 colon cancer. Median age 63.3 years; male/female 17/25; race, black 47.5%, white 47.5%, others, 5%; stage I, 21.4%; stage II, 31%; stage III, 26.2%; stage IV, 21.4%. One of 42 cases (2.3%) was positive for ALK translocation by FISH using the standard criteria of at least 15% positive cells for the break-apart signal (50-70 cells enumerated per case). Using a less restrictive cut-off of 10% positive cells, 7 cases (16%) were considered possibly positive. None of the 'possibly positive' cases was found to harbor ALK translocation by another molecular testing approach (IHC). IHC with two previously validated monoclonal antibodies showed 0 of 42 (0%) cases positive. ALK gene rearrangement is very rare in gastrointestinal cancers and enrichment strategy focusing on signet ring cell histology did not significantly improve the detection rate.

  19. [Neoplasms of the disseminated neuroendocrine cell system of the gastrointestinal tract].

    PubMed

    Klöppel, G

    2015-05-01

    The classification of neuroendocrine neoplasms (NEN) of the gastrointestinal tract and also the pancreas is based on the World Health Organization (WHO) classification from 2010, the site-related TNM stage classification and the clinicopathological characterization. This allows a classification of NEN that is adapted to the individual patient, is of high prognostic relevance and serves the needs of an adequate treatment. This article summarizes the current knowledge on the clinical pathology of gastrointestinal NEN, in order to enable a rapid diagnostic orientation.

  20. Differential cellular expression of galectin family mRNAs in the epithelial cells of the mouse digestive tract.

    PubMed

    Nio, Junko; Kon, Yasuhiro; Iwanaga, Toshihiko

    2005-11-01

    Galectin is an animal lectin that recognizes beta-galactosides of glycoconjugates and is abundant in the gut. This study revealed the cellular expression of galectin subtypes throughout the mouse digestive tract by in situ hybridization. Signals for five subtypes (galectin-2, -3, -4/6, and -7) were detected exclusively in the epithelia. In the glandular stomach, galectin-2 and -4/6 were predominantly expressed from gastric pits to neck of gastric glands, where mucous cells were the main cellular sources. The small intestine exhibited intense, maturation-associated expressions of galectin-2, -3, and -4/6 mRNAs. Galectin-2 was intensely expressed from crypts to the base of villi, whereas transcripts of galectin-3 gathered at villous tips. Signals for galectin-4/6 were most intense at the lower half of villi. Galectin-2 was also expressed in goblet cells of the small intestine but not in those of the large intestine. In the large intestine, galectin-4/6 predominated, and the upper half of crypts simultaneously contained transcripts of galectin-3. Stratified epithelium from the lip to forestomach and anus intensely expressed galectin-7 with weak expressions of galectin-3. Because galectins in the digestive tract may be multi-functional, information on their cell/stage-specific expression contributes to a better understanding of the functions and pathological involvements of galectins.

  1. The gastrointestinal tract: properties and role in allogeneic hematopoietic stem cell transplantation.

    PubMed

    Pessach, Ilias; Tsirigotis, Panagiotis; Nagler, Arnon

    2017-04-01

    The GI-tract is a major target for both the intensive chemo and/or radiotherapy conditioning as well as for GVHD and therefore is closely associated with transplant outcome. Apart from being a target, the GI-tract is also a mediator and therefore is also a key player of the pathogenetic process following allogeneic transplantation. Areas covered: The intestinal homeostasis is regulated through complicated interactions between the key players of this process which are the intestinal epithelium, the intestinal immune system, and the intestinal microbiota. A brief description of these elements, based on published english-language articles in PubMed, as well as their role during the process of allo-HSCT is discussed in this review. Expert commentary: Data on GI-tract properties suggest a central role for the intestine in regulation of immunity, both in healthy - steady state conditions and in pathological states such as during allo-HSCT. Given the fact that in the allogeneic transplant setting severe complications such as infections and GVHD are limiting this treatment modality, understanding the mechanisms that mediate intestinal homeostasis could lead to new preventive methods and improved outcomes.

  2. [Therapeutic approaches using genetically modified cells].

    PubMed

    Anliker, Brigitte; Renner, Matthias; Schweizer, Matthias

    2015-11-01

    Medicinal products containing genetically modified cells are, in most cases, classified as gene therapy and cell therapy medicinal products. Although no medicinal product containing genetically modified cells has been licensed in Europe yet, a variety of therapeutic strategies using genetically modified cells are in different stages of clinical development for the treatment of acquired and inherited diseases. In this chapter, several examples of promising approaches are presented, with an emphasis on gene therapy for inherited immunodeficiencies and on tumour immunotherapy with genetically modified T-cells expressing a chimeric antigen receptor or a recombinant T-cell receptor.

  3. Approaches to encapsulation of flexible CIGS cells

    NASA Astrophysics Data System (ADS)

    Olsen, L. C.; Gross, M. E.; Graff, G. L.; Kundu, S. N.; Chu, Xi; Lin, Steve

    2008-08-01

    Thin-film solar cells based on CIGS are being considered for large scale power plants as well as building integrated photovoltaic (BIPV) applications. Past studies indicate that CIGS cells degrade rapidly when exposed to moisture. As a result, an effective approach to encapsulation is required for CIGS cells to satisfy the international standard IEC 61646. CIGS modules fabricated for use in large power plants can be encapsulated with glass sheets on the top and bottom surfaces and can be effectively sealed around the edges. In the case of BIPV applications, however, it is desirable to utilize CIGS cells grown on flexible substrates, both for purposes of achieving reduced weight and for cases involving non-flat surfaces. For these cases, approaches to encapsulation must be compatible with the flexible substrate requirement. Even in the case of large power plants, the glass-to-glass approach to encapsulation may eventually be considered too costly. We are investigating encapsulation of flexible CIGS cells by lamination. Sheets of PET or PEN coated with multilayer barrier coatings are used to laminate the flexible cells. Results are discussed for laminated cells from two CIGS manufacturers. In both cases, the cell efficiency decreases less than 10% after 1000 hours of exposure to an environment of 85°C/85%RH. This paper discusses these two approaches, and reviews results for uncoated cells and mini-modules fabricated by the former Shell Solar Industries (SSI).

  4. Lower Respiratory Tract Diseases Caused by Common Respiratory Viruses among Stem Cell Transplantation Recipients: A Single Center Experience in Korea

    PubMed Central

    Hong, Kyung-Wook; Choi, Su-Mi; Cho, Sung-Yeon; Lee, Hyo-Jin; Choi, Jae-Ki; Kim, Si-Hyun; Park, Sun Hee; Choi, Jung-Hyun; Yoo, Jin-Hong; Lee, Jong-Wook

    2017-01-01

    Purpose To describe the incidence, clinical courses, and risk factors for mortality of lower respiratory tract diseases (LRDs) caused by common respiratory viruses (CRVs) in stem cell transplantation (SCT) recipients. Materials and Methods We retrospectively reviewed the medical records of 1038 patients who received SCT between January 2007 and August 2011 at a single center in Korea. Results Seventy-one CRV-LRDs were identified in 67 (6.5%) patients. The human parainfluenza virus (HPIV) was the most common causative pathogen of CRV-LRDs at 100 days [cumulative incidence estimate, 23.5%; 95% confidence interval (CI), 3.3–43.7] and 1 year (cumulative incidence estimate, 69.2%; 95% CI, 45.9–92.5) following SCT. The 30-day overall mortality rates due to influenza-LRDs, respiratory syncytial virus-LRDs, HPIV-LRDs, and human rhinovirus-LRDs were 35.7, 25.8, 31.6, and 42.8%, respectively. Co-pathogens in respiratory specimens were detected in 23 (33.8%) patients. The overall mortality at day 30 after CRV-LRD diagnosis was 32.8% (22/67). High-dose steroid usage (p=0.025), a severe state of immunodeficiency (p=0.033), and lymphopenia (p=0.006) were significantly associated with death within 30 days following CRV-LRD diagnosis in a univariate analysis. Multivariate logistic regression analysis revealed that high-dose steroid usage [odds ratio (OR), 4.05; 95% CI, 1.12–14.61; p=0.033] and lymphopenia (OR, 6.57; 95% CI, 1.80–24.03; p=0.004) were independent risk factors for mortality within 30 days of CRV-LRDs. Conclusion CRV-LRDs among SCT recipients showed substantially high morbidity and mortality rates. Therefore, the implement of an active diagnostic approaches for CRV infections is required for SCT recipients with respiratory symptoms, especially those receiving high-dose steroids or with lymphopenia. PMID:28120567

  5. A genital tract peptide epitope vaccine targeting TLR-2 efficiently induces local and systemic CD8 + T cells and protects against herpes simplex virus type 2 challenge

    PubMed Central

    Dasgupta, G; Nesburn, AB; Wu, M; Zhu, X; Carpenter, D; Wechsler, SL; You, S; BenMohamed, L

    2015-01-01

    The next generation of needle-free mucosal vaccines is being rationally designed according to rules that govern the way in which the epitopes are recognized by and stimulate the genital mucosal immune system. We hypothesized that synthetic peptide epitopes extended with an agonist of Toll-like receptor 2 (TLR-2), that are abundantly expressed by dendritic and epithelial cells of the vaginal mucosa, would lead to induction of protective immunity against genital herpes. To test this hypothesis, we intravaginally (IVAG) immunized wild-type B6, TLR-2 (TLR2 −/−) or myeloid differentiation factor 88 deficient (MyD88 −/−) mice with a herpes simplex virus type 2 (HSV-2) CD8 + T-cell peptide epitope extended by a palmitic acid moiety (a TLR-2 agonist). IVAG delivery of the lipopeptide generated HSV-2-specific memory CD8 + cytotoxic T cells both locally in the genital tract draining lymph nodes and systemically in the spleen. Moreover, lipopeptide-immunized TLR2 −/− and MyD88 −/− mice developed significantly less HSV-specific CD8 + T-cell response, earlier death, faster disease progression, and higher vaginal HSV-2 titers compared to lipopeptide-immunized wild-type B6 mice. IVAG immunization with self-adjuvanting lipid-tailed peptides appears to be a novel mucosal vaccine approach, which has attractive practical and immunological features. PMID:19129756

  6. Synthetic biology approaches to engineer T cells.

    PubMed

    Wu, Chia-Yung; Rupp, Levi J; Roybal, Kole T; Lim, Wendell A

    2015-08-01

    There is rapidly growing interest in learning how to engineer immune cells, such as T lymphocytes, because of the potential of these engineered cells to be used for therapeutic applications such as the recognition and killing of cancer cells. At the same time, our knowhow and capability to logically engineer cellular behavior is growing rapidly with the development of synthetic biology. Here we describe how synthetic biology approaches are being used to rationally alter the behavior of T cells to optimize them for therapeutic functions. We also describe future developments that will be important in order to construct safe and precise T cell therapeutics.

  7. Contrast-enhanced ultrasonography in the diagnosis of upper urinary tract urothelial cell carcinoma: a preliminary study.

    PubMed

    Drudi, F M; Di Candio, G; Di Leo, N; Malpassini, F; Gnecchi, M; Cantisani, V; Iori, F; Liberatore, M

    2013-02-01

    The main objective was to assess the effectiveness of contrast-enhanced ultrasonography (CEUS) in the diagnosis of upper urinary tract malignancies by comparing with multidetector computed tomographic urography (MDCTU) and magnetic resonance urography (MRU). Secondary objectives were to compare the tumor size measured with CEUS, MDCTU and MRU and to assess the usefulness of CEUS in distinguishing high-grade tumors from low-grade ones. In connection with this prospective study carried out from January 2009 to September 2011, 18 patients underwent MDCTU or MRU, grayscale ultrasonography (US), color Doppler ultrasonography and CEUS followed by surgery and histological examination of the specimen. Quantitative analysis was performed using perfusion software. Time intensity curves were extracted and the following parameters were considered: wash-in time, time-to-peak, maximum signal intensity and wash-out time. Grayscale US identified 15/18 lesions; color Doppler showed no flow signal in 8 lesions, low color signal in 9 lesions and an intense color signal in 1 lesion; CEUS identified 17/18 lesions with the undetected lesion being the smallest one (1.2 cm) located in the upper pelvicalyceal system. Semi-quantitative analysis produced different data for high-grade and low-grade urothelial cell carcinoma (UCC). All detected upper urinary tract masses were UCCs. MRU, MDCTU and grayscale US overestimated the tumor size, while CEUS was the most accurate. CEUS is useful for evaluating upper urinary tract masses as this method permits differentiation between high-grade and low-grade tumors as well as distinction of the tumor from the adjacent structures and accurate mass measurements. © Georg Thieme Verlag KG Stuttgart · New York.

  8. TREATMENT EFFECTS OF WST11 VASCULAR TARGETED PHOTODYNAMIC THERAPY IN UROTHELIAL CELL CARCINOMA AND FEASIBILITY, SAFETY, AND LONG TERM OUTCOMES IN THE UPPER URINARY TRACT OF SWINE

    PubMed Central

    Murray, Katie S; Winter, Ashley G; Corradi, Renato Beluco; LaRosa, Stephen; Jebiwott, Sylvia; Somma, Alexander; Takaki, Haruyuki; Srimathveeravalli, Govindarajan; Lepherd, Michelle; Monette, Sebastien; Kim, Kwanghee; Scherz, Avigdor; Coleman, Jonathan A

    2016-01-01

    Purpose Surgical management of upper tract urothelial carcinoma requires removal of kidney and ureter, compromising renal function. Non-surgical alternatives have potentially prohibitive safety concerns. We examine the feasibility and safety of ablation of the ureter and renal pelvis using endoluminal vascular-targeted photodynamic therapy in a porcine model and report efficacy of WST11 vascular-targeted photodynamic therapy in a murine model. Materials and Methods Following approval, we performed 28 endoluminal ablations in the ureters and renal pelvis of 18 swine. Intravenous infusion of WST11 (4mg/kg) followed by laser illumination (10 minutes) was performed via percutaneous access or retrograde ureteroscopic approach. Animals were followed clinically with laboratory testing, imaging and histology was evaluated at several post-ablation time points. A murine xenograft was created with the 5637 human urothelial cell carcinoma line to determine sensitivity to this therapy. Results At 24 hours, 50 mW/cm laser fluence produced superficial necrosis of the ureter and deeper necrosis (penetrating the muscularis propria or adventitia) was produced by treatment with 200 mW/cm in the ureter and renal pelvis. At 4 weeks, superficial urothelium had regenerated over the treatment site. No symptomatic obstruction, clinically relevant hydronephrosis, or abnormality of lab testing was noted up to 4 weeks. In mice, 80% had no evidence of tumor at 19 days after WST11 vascular-targeted photodynamic therapy. Conclusions Urothelial cell carcinoma appears to be sensitive to WST11 vascular-targeted photodynamic therapy. Depth of WST11 vascular-targeted photodynamic therapy treatment effects can be modulated in a dose-dependent manner by titration of light intensity. Moreover, this treatment modality, applied to the porcine upper urinary tract, is feasible via antegrade and retrograde access. PMID:26860792

  9. Distribution of alpha-vascular smooth muscle actin in the smooth muscle cells of the gastrointestinal tract of the chicken.

    PubMed Central

    Yamamoto, Y; Kubota, T; Atoji, Y; Suzuki, Y

    1996-01-01

    Immunoreactivity specific for alpha-vascular smooth muscle actin (ASMA) was examined in the enteric smooth muscle cells along the entire length of the gastrointestinal tract of the chicken. Specificity for gamma-smooth muscle actin (GSMA) and desmin was also examined. All smooth muscle layers, i.e. the muscularis mucosae, and the circular and longitudinal muscle layers, showed immunoreactivity specific for GSMA and desmin throughout the gastrointestinal tract whereas immunoreactivity for ASMA differed between regions and muscle layers. In the oesophagus and crop, immunoreactivity for ASMA was observed in the muscularis mucosae and the inner and outer muscle layers, together with staining for GSMA and desmin. In the proventriculus, immunoreactivity for ASMA was observed in all smooth muscle cells in the inner layer of the muscularis mucosae and the longitudinal muscle layer. In the outer layer of the muscularis mucosae, immunoreactivity for ASMA on smooth muscle cells was observed on the luminal side and decreased in the serosal direction. In the intermediate muscles, immunoreactivity for ASMA was observed in the luminal portion, the intensity of staining decreasing gradually in the serosal direction. In contrast to the intermediate muscles, the latter muscles were negative for ASMA. In the pyloric region, the outer part was weakly immunopositive, while the inner part was intensely positive. In the small and large intestines, the muscularis mucosae and the longitudinal muscle layer were positive for ASMA. The outer part of the circular muscle layer was immunonegative for ASMA whereas the inner part was positive. The complex structure and contractile functions of each organ and muscle layers may be related to the difference patterns of expression of ASMA molecules in the smooth muscle cells. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8982838

  10. Activation of delta-opioid receptors reduces excitatory input to putative gustatory cells within the nucleus of the solitary tract.

    PubMed

    Zhu, Mingyan; Cho, Young K; Li, Cheng-Shu

    2009-01-01

    The rostral nucleus of the solitary tract (NST) is the first central relay in the gustatory pathway and plays a key role in processing and modulation of gustatory information. Here, we investigated the effects of opioid receptor agonists and antagonists on synaptic responses of the gustatory parabrachial nuclei (PbN)-projecting neurons in the rostral NST to electrical stimulation of the solitary tract (ST) using whole cell recordings in the hamster brain stem slices. ST-evoked excitatory postsynaptic currents (EPSCs) were significantly reduced by met-enkephalin (MetE) in a concentration-dependent fashion and this effect was eliminated by naltrexone hydrochloride, a nonselective opioid receptor antagonist. Bath application of naltrindole hydrochloride, a selective delta-opioid receptor antagonist, eliminated MetE-induced reduction of EPSCs, whereas CTOP, a selective mu-opioid receptor antagonist had no effect, indicating that delta-opioid receptors are involved in the reduction of ST-evoked EPSCs induced by MetE. SNC80, a selective delta-opioid receptor agonist, mimicked the effect of MetE. The SNC80-induced reduction of ST-evoked EPSCs was eliminated by 7-benzylidenenaltrexone, a selective delta1-opioid receptor antagonist but not by naltriben mesylate, a selective delta2-opioid receptor antagonist, indicating that delta1-opioid receptors mediate the reduction of ST-evoked EPSCs induced by SNC80. Single-cell reverse transcriptase-polymerase chain reaction analysis revealed the presence of delta1-opioid receptor mRNA in cells that responded to SNC80 with a reduction in ST-evoked EPSCs. Moreover, Western blot analysis demonstrated the presence of 40-kDa delta-opioid receptor proteins in the rostral NST tissue. These results suggest that postsynaptic delta1-opioid receptors are involved in opioid-induced reduction of ST-evoked EPSCs of PbN-projecting rostral NST cells.

  11. Cell delivery in regenerative medicine: the cell sheet engineering approach.

    PubMed

    Yang, Joseph; Yamato, Masayuki; Nishida, Kohji; Ohki, Takeshi; Kanzaki, Masato; Sekine, Hidekazu; Shimizu, Tatsuya; Okano, Teruo

    2006-11-28

    Recently, cell-based therapies have developed as a foundation for regenerative medicine. General approaches for cell delivery have thus far involved the use of direct injection of single cell suspensions into the target tissues. Additionally, tissue engineering with the general paradigm of seeding cells into biodegradable scaffolds has also evolved as a method for the reconstruction of various tissues and organs. With success in clinical trials, regenerative therapies using these approaches have therefore garnered significant interest and attention. As a novel alternative, we have developed cell sheet engineering using temperature-responsive culture dishes, which allows for the non-invasive harvest of cultured cells as intact sheets along with their deposited extracellular matrix. Using this approach, cell sheets can be directly transplanted to host tissues without the use of scaffolding or carrier materials, or used to create in vitro tissue constructs via the layering of individual cell sheets. In addition to simple transplantation, cell sheet engineered constructs have also been applied for alternative therapies such as endoscopic transplantation, combinatorial tissue reconstruction, and polysurgery to overcome limitations of regenerative therapies and cell delivery using conventional approaches.

  12. Approaches to Encapsulation of Flexible CIGS Cells

    SciTech Connect

    Olsen, Larry C.; Gross, Mark E.; Graff, Gordon L.; Kundu, Sambhu N.; Chu, Xi; Lin, Steve

    2008-07-16

    Thin-film solar cells based on CIGS are being considered for large scale power plants as well as building integrated photovoltaic (BIPV) applications. Past studies indicate that CIGS cells degrade rapidly when exposed to moisture. As a result, an effective approach to encapsulation is required for CIGS cells to satisfy the international standard IEC 61646. CIGS modules fabricated for use in large power plants can be encapsulated with glass sheets on the top and bottom surfaces and can be effectively sealed around the edges. In the case of BIPV applications, however, it is desirable to utilize CIGS cells grown on flexible substrates, both for purposes of achieving reduced weight and for cases involving non-flat surfaces. For these cases, approaches to encapsulation must be compatible with the flexible substrate requirement. Even in the case of large power plants, the glass-to-glass approach to encapsulation may eventually be considered too costly. We are investigating encapsulation of flexible CIGS cells by lamination. Sheets of PET or PEN coated with multilayer barrier coatings are used to laminate the flexible cells. Results are discussed for laminated cells from two CIGS manufacturers. In both cases, the cell efficiency decreases less than 10% after 1000 hours of exposure to an environment of 85C/85%RH. This paper discusses these two approaches, reviews results achieved with cells and mini-modules fabricated by the former Shell Solar, Industries (SSI) stressed at 60C/90%RH (60/90), and recent studies of encapsulated IEC cells subjected to an environment of 85ºC/85%RH (85/85).

  13. In vitro growth of human urinary tract smooth muscle cells on laminin and collagen type I-coated membranes under static and dynamic conditions.

    PubMed

    Hubschmid, Ulrich; Leong-Morgenthaler, Phaik-Mooi; Basset-Dardare, Aurelia; Ruault, Sylvie; Frey, Peter

    2005-01-01

    This study investigates in vitro growth of human urinary tract smooth muscle cells under static conditions and mechanical stimulation. The cells were cultured on collagen type I- and laminin-coated silicon membranes. Using a Flexcell device for mechanical stimulation, a cyclic strain of 0-20% was applied in a strain-stress-time model (stretch, 104 min relaxation, 15 s), imitating physiological bladder filling and voiding. Cell proliferation and alpha-actin, calponin, and caldesmon phenotype marker expression were analyzed. Nonstretched cells showed significant better growth on laminin during the first 8 days, thereafter becoming comparable to cells grown on collagen type I. Cyclic strain significantly reduced cell growth on both surfaces; however, better growth was observed on laminin. Neither the type of surface nor mechanical stimulation influenced the expression pattern of phenotype markers; alpha-actin was predominantly expressed. Coating with the extracellular matrix protein laminin improved in vitro growth of human urinary tract smooth muscle cells.

  14. Gastrointestinal tract spindle cell lesions--just like real estate, it's all about location.

    PubMed

    Voltaggio, Lysandra; Montgomery, Elizabeth A

    2015-01-01

    Interpretation of gastrointestinal tract mesenchymal lesions is simplified merely by knowing in which anatomic layer they are usually found. For example, Kaposi sarcoma is detected on mucosal biopsies, whereas inflammatory fibroid polyp is nearly always in the submucosa. Gastrointestinal stromal tumors (GISTs) are generally centered in the muscularis propria. Schwannomas are essentially always in the muscularis propria. Mesenteric lesions are usually found in the small bowel mesentery. Knowledge of the favored layer is even most important in interpreting colon biopsies, as many mesenschymal polyps are encountered in the colon. Although GISTs are among the most common mesenchymal lesions, we will concentrate our discussion on other mesenchymal lesions, some of which are in the differential diagnosis of GIST, and point out some diagnostic pitfalls, particularly in immunolabeling.

  15. Comparison of acid mucin goblet cell distribution and Hox13 expression patterns in the developing vertebrate digestive tract.

    PubMed

    Theodosiou, Nicole A; Hall, Daniel A; Jowdry, Andrea L

    2007-07-15

    The digestive tract of vertebrates is a complex organ system required for the digestion of food and the absorption of nutrients. The colon evolved as a water absorption organ essential for vertebrates to survive on land. In contrast to land vertebrates, the Chondrichthyes (sharks, skates and rays) are nearly iso-osmotic with their ocean environment and do not reabsorb water from food waste. To understand the origin of the vertebrate colon, we examined the distribution of sulfated and sialyated mucus-producing cells in the little skate, Raja erinacea, as an indication of water absorption function in the chondrichthian digestive tract. The percentage of acid mucin producing goblet cells was analyzed in the spiral valve and hindgut of little skate and the small intestine and colon of mouse embryos. Levels of acid mucins in the hindgut of the little skate was comparable to that of the small intestines of terrestrial vertebrates, whereas the distal region of the spiral valve contained high levels of acid mucin producing cells similar to the colon of mouse and chick. The low numbers of acid mucins in the little skate hindgut confirms that a functional colon for water absorption is absent in the Chondrichthyes. Interestingly, the presence of high levels of acid mucins in the posterior spiral valve provides evidence for a possible primordial water-absorbing organ in the elasmobranchs. Hoxd13 patterns acid mucins in the colons of terrestrial vertebrates. Expression of Hoxd13 and Hoxa13 in R. erinacea suggests conserved roles for Hox genes in patterning the early hindgut.

  16. Iron Levels in Hepatocytes and Portal Tract Cells Predict Progression and Outcome of Patients with Advanced Chronic Hepatitis C1

    PubMed Central

    Lambrecht, Richard W.; Sterling, Richard K.; Naishadham, Deepa; Stoddard, Anne M.; Rogers, Thomas; Morishima, Chihiro; Morgan, Timothy R.; Bonkovsky, Herbert L.

    2011-01-01

    Background & Aims Iron might influence severity and progression of non-hemochromatotic liver diseases. We assessed the relationships between iron, variants in HFE, and progression and outcomes using data from the HALT-C Trial. We determined whether therapy with pegylated interferon (PegIFN) affects iron variables. Methods Participants were randomly assigned to groups given long-term therapy with PegIFN (n=400) or no therapy (n=413) for 3.5 y and followed for up to 8.7 y (median 6.0 y). Associations between patient characteristics and iron variables, at baseline and over time, were made using Kaplan-Meier analyses, Cox regression models, and repeated measures analysis of covariance. Iron was detected by Prussian blue staining. Results Patients with poor outcomes (increase in Child-Turcotte-Pugh score to ≥ 7, development of ascites, encephalopathy, variceal bleeding, spontaneous bacterial peritonitis, hepatocellular carcinoma, death) had significantly higher baseline scores for stainable iron in hepatocytes and cells in portal tracts than those without outcomes. Staining for iron in portal triads correlated with lobular and total Ishak inflammatory and fibrosis scores (P<0.0001). High baseline levels of iron in triads increased the risk for poor outcome (hazard ratio=1.35, P=0.02). Iron staining decreased in hepatocytes but increased in portal stromal cells over time (P<0.0001). Serum levels of iron and total iron binding capacity decreased significantly over time (P <0.0001), as did serum ferritin (P=0.0003). Long-term therapy with PegIFN did not affect levels of iron staining. Common variants in HFE did not correlate with outcomes, including development of hepatocellular carcinoma. Conclusions Degree of stainable iron in hepatocytes and portal tract cells predicts progression and clinical and histological outcomes of patients with advanced chronic hepatitis C. Long-term therapy with low-dose PegIFN did not improve outcomes or iron variables. PMID:21335007

  17. Tenofovir Inhibits Wound Healing of Epithelial Cells and Fibroblasts from the Upper and Lower Human Female Reproductive Tract

    PubMed Central

    Rodriguez-Garcia, Marta; Patel, Mickey V.; Shen, Zheng; Bodwell, Jack; Rossoll, Richard M.; Wira, Charles R.

    2017-01-01

    Disruption of the epithelium in the female reproductive tract (FRT) is hypothesized to increase HIV infection risk by interfering with barrier protection and facilitating HIV-target cell recruitment. Here we determined whether Tenofovir (TFV), used vaginally in HIV prevention trials, and Tenofovir alafenamide (TAF), an improved prodrug of TFV, interfere with wound healing in the human FRT. TFV treatment of primary epithelial cells and fibroblasts from the endometrium (EM), endocervix (CX) and ectocervix (ECX) significantly delayed wound closure. Reestablishment of tight junctions was compromised in EM and CX epithelial cells even after wound closure occurred. In contrast, TAF had no inhibitory effect on wound closure or tight junction formation following injury. TAF accumulated inside genital epithelial cells as TFV-DP, the active drug form. At elevated levels of TAF treatment to match TFV intracellular TFV-DP concentrations, both equally impaired barrier function, while wound closure was more sensitive to TFV. Furthermore, TFV but not TAF increased elafin and MIP3a secretion following injury, molecules known to be chemotactic for HIV-target cells. Our results highlight the need of evaluating antiretroviral effects on genital wound healing in future clinical trials. A possible link between delayed wound healing and increased risk of HIV acquisition deserves further investigation. PMID:28368028

  18. A Defective Interfering Influenza RNA Inhibits Infectious Influenza Virus Replication in Human Respiratory Tract Cells: A Potential New Human Antiviral

    PubMed Central

    Smith, Claire M.; Scott, Paul D.; O’Callaghan, Christopher; Easton, Andrew J.; Dimmock, Nigel J.

    2016-01-01

    Defective interfering (DI) viruses arise during the replication of influenza A virus and contain a non-infective version of the genome that is able to interfere with the production of infectious virus. In this study we hypothesise that a cloned DI influenza A virus RNA may prevent infection of human respiratory epithelial cells with infection by influenza A. The DI RNA (244/PR8) was derived by a natural deletion process from segment 1 of influenza A/PR/8/34 (H1N1); it comprises 395 nucleotides and is packaged in the DI virion in place of a full-length genome segment 1. Given intranasally, 244/PR8 DI virus protects mice and ferrets from clinical influenza caused by a number of different influenza A subtypes and interferes with production of infectious influenza A virus in cells in culture. However, evidence that DI influenza viruses are active in cells of the human respiratory tract is lacking. Here we show that 244/PR8 DI RNA is replicated by an influenza A challenge virus in human lung diploid fibroblasts, bronchial epithelial cells, and primary nasal basal cells, and that the yield of challenge virus is significantly reduced in a dose-dependent manner indicating that DI influenza virus has potential as a human antiviral. PMID:27556481

  19. A Defective Interfering Influenza RNA Inhibits Infectious Influenza Virus Replication in Human Respiratory Tract Cells: A Potential New Human Antiviral.

    PubMed

    Smith, Claire M; Scott, Paul D; O'Callaghan, Christopher; Easton, Andrew J; Dimmock, Nigel J

    2016-08-22

    Defective interfering (DI) viruses arise during the replication of influenza A virus and contain a non-infective version of the genome that is able to interfere with the production of infectious virus. In this study we hypothesise that a cloned DI influenza A virus RNA may prevent infection of human respiratory epithelial cells with infection by influenza A. The DI RNA (244/PR8) was derived by a natural deletion process from segment 1 of influenza A/PR/8/34 (H1N1); it comprises 395 nucleotides and is packaged in the DI virion in place of a full-length genome segment 1. Given intranasally, 244/PR8 DI virus protects mice and ferrets from clinical influenza caused by a number of different influenza A subtypes and interferes with production of infectious influenza A virus in cells in culture. However, evidence that DI influenza viruses are active in cells of the human respiratory tract is lacking. Here we show that 244/PR8 DI RNA is replicated by an influenza A challenge virus in human lung diploid fibroblasts, bronchial epithelial cells, and primary nasal basal cells, and that the yield of challenge virus is significantly reduced in a dose-dependent manner indicating that DI influenza virus has potential as a human antiviral.

  20. The distribution of mucous secreting cells in the gastrointestinal tracts of three small rodents from Saudi Arabia: Acomys dimidiatus, Meriones rex and Meriones libycus.

    PubMed

    Johnson, Olga; Marais, Sumine; Walters, Jacklynn; van der Merwe, Elizabeth L; Alagaili, Abdulaziz N; Mohammed, Osama B; Bennett, Nigel C; Kotzé, Sanet H

    2016-03-01

    The proportion of mucin phenotypes (which form the protective biofilm of the gastrointestinal tract) differs between intestinal regions. This study examines the distribution of mucin secreting cells in the gastrointestinal tracts of the Eastern spiny mouse (Acomys dimidiatus), King jird (Meriones rex) and Libyan jird (Meriones libycus), which inhabit the dry and hot deserts of Saudi Arabia. Intestinal tract samples were processed to wax and tissue sections stained with Alcian Blue-Periodic Acid Schiff (AB-PAS) and High Iron Diamine-Alcian Blue (HID-AB) in order to determine different mucin phenotypes by quantitative analysis. Mixed mucin secreting cells (combined neutral and acid) was the predominant mucin secreting cell type observed throughout the gastrointestinal tract in all species. Acid mucin secreting goblet cells were mainly located in the colon. A. dimidiatus presented with significantly more total sialo than sulfomucin secreting cells while the opposite was true for both Meriones species. The distribution of mucin secreting cells is therefore similar to previously reported results for small mammals not living under arid conditions.

  1. Dictyostelium discoideum: Molecular approaches to cell biology

    SciTech Connect

    Spudich, J.A.

    1987-01-01

    The central point of this book is to present Dictyostelium as a valuable eukaryotic organism for those interested in molecular studies that require a combined biochemical, structural, and genetic approach. The book is not meant to be a comprehensive compilation of all methods involving Dictyostelium, but instead is a selective set of chapters that demonstrates the utility of the organism for molecular approaches to interesting cell biological problems.

  2. Loss of interstitial cells of Cajal after pulsating electromagnetic field (PEMF) in gastrointestinal tract of the rats.

    PubMed

    Kaszuba-Zwoińska, J; Gil, K; Ziomber, A; Zaraska, W; Pawlicki, R; Królczyk, G; Matyja, A; Thor, P J

    2005-09-01

    Exposure to the magnetic field has remarkably increased lately due to fast urbanization and widely available magnetic field in diagnosis and treatment. However, biological effects of the magnetic field are not well recognized. The myoelectric activity recorded from the gastrointestinal and urinary systems is generated by specialized electrically active cells called interstitial cells of Cajal (ICCs). Thus it seems rational that ICC have significant vulnerability to physical factors like an electromagnetic field. The aim of this study was to evaluate the influence of pulsating electromagnetic field (PEMF) (frequency 10 kHz, 30ms, 300 muT burst, with frequency 1Hz) on ICCs density in the rat gastrointestinal tract. Rats were divided into two groups (n=32). The first group was exposed to PEMF continuously for 1, 2, 3, and 4 weeks (n = 16), and the second group (n=16) served as a control. Tissue samples of the rat stomach, duodenum and proximal colon were fixed and paraffin embedded. The tangential sections of 5 microm thickness were stained immunohistochemically with anti-c-Kit (sc-168) antibody and visualized finally by DAB as chromogen (brown end product). C-Kit positive branched ICC-like cells were detected under the light microscope, distinguished from the c-kit-negative non-branched smooth muscle cells and from the c-kit positive but non-branched mast cells and quantitatively analyzed by MultiScan computer program. Apoptosis detection was performed with rabbit anti-Bax polyclonal antibody (Calbiochem, Germany) and LSAB 2 visualization system. The surface of c-Kit immunopositive cells decreased after exposure to PEMF in each part of the gastrointestinal tract. Reduced density of ICCs was related to exposure time. The most sensitive to PEMF were ICCs in the fundus of the stomach and in the duodenum, less sensitive were ICCs in the colon and pacemaker areas of the stomach. No marked changes in ICC density in the pyloric part of the stomach were observed. We

  3. The Effects of Endothelial Cells-Preserving Technique on Microsurgical Vascular Reconstruction in Biliary Tract Malignancy: Report of Twenty Cases

    PubMed Central

    Miyagi, Shigehito; Nakanishi, Wataru; Kawagishi, Naoki; Yoshida, Hiroshi; Unno, Michiaki; Ohuchi, Noriaki

    2014-01-01

    We describe our experience of resectional surgery with microsurgical reconstruction of the hepatic arteries in 20 cases with biliary tract malignancy. Hepatic artery thrombosis (HAT) is a lethal complication; therefore, it is important to perform microsurgical reconstruction safely. Recently, we adopted the back wall support suture technique with double needle sutures that does not require the damaged short arteries to be turned over. In this technique, each stitch is placed from the inner side to the outer side to keep endothelial cells. The purpose of this study was to develop safety methods. From 2003 to 2012, 20 patients with biliary tract malignancy with possible involvement of the hepatic arteries underwent resectional surgery with microvascular reconstruction (cholangiocarcinoma: n = 15; others: n = 5). For this cohort study, patients were divided into two groups: group I (n = 5) included patients who underwent the conventional ‘twist technique’ and group II (n = 15) included patients who underwent the microsurgical back wall support suture technique with double needle sutures and received gabexate mesilate, a strong serine protease inhibitor (40 mg/kg/day) for 7 days. We investigated HAT using Doppler ultrasonography for 10 days. No postoperative mortality was observed. The incidence of HAT was only one case in group I, and there was no significant difference between the two groups. However, the value of the pulsatile index and acceleration time were significantly improved in group II. In conclusion, the back wall support suture technique with gabexate mesilate administration during microvascular reconstruction was found to be safe. It is important to keep endothelial cells healthy for microvascular reconstruction. PMID:24574945

  4. The effects of endothelial cells-preserving technique on microsurgical vascular reconstruction in biliary tract malignancy: report of twenty cases.

    PubMed

    Miyagi, Shigehito; Nakanishi, Wataru; Kawagishi, Naoki; Yoshida, Hiroshi; Unno, Michiaki; Ohuchi, Noriaki

    2014-01-01

    We describe our experience of resectional surgery with microsurgical reconstruction of the hepatic arteries in 20 cases with biliary tract malignancy. Hepatic artery thrombosis (HAT) is a lethal complication; therefore, it is important to perform microsurgical reconstruction safely. Recently, we adopted the back wall support suture technique with double needle sutures that does not require the damaged short arteries to be turned over. In this technique, each stitch is placed from the inner side to the outer side to keep endothelial cells. The purpose of this study was to develop safety methods. From 2003 to 2012, 20 patients with biliary tract malignancy with possible involvement of the hepatic arteries underwent resectional surgery with microvascular reconstruction (cholangiocarcinoma: n = 15; others: n = 5). For this cohort study, patients were divided into two groups: group I (n = 5) included patients who underwent the conventional 'twist technique' and group II (n = 15) included patients who underwent the microsurgical back wall support suture technique with double needle sutures and received gabexate mesilate, a strong serine protease inhibitor (40 mg/kg/day) for 7 days. We investigated HAT using Doppler ultrasonography for 10 days. No postoperative mortality was observed. The incidence of HAT was only one case in group I, and there was no significant difference between the two groups. However, the value of the pulsatile index and acceleration time were significantly improved in group II. In conclusion, the back wall support suture technique with gabexate mesilate administration during microvascular reconstruction was found to be safe. It is important to keep endothelial cells healthy for microvascular reconstruction.

  5. Mammalian Cell-Derived Respiratory Syncytial Virus-Like Particles Protect the Lower as well as the Upper Respiratory Tract.

    PubMed

    Walpita, Pramila; Johns, Lisa M; Tandon, Ravi; Moore, Martin L

    2015-01-01

    Globally, Respiratory Syncytial Virus (RSV) is a leading cause of bronchiolitis and pneumonia in children less than one year of age and in USA alone, between 85,000 and 144,000 infants are hospitalized every year. To date, there is no licensed vaccine. We have evaluated vaccine potential of mammalian cell-derived native RSV virus-like particles (RSV VLPs) composed of the two surface glycoproteins G and F, and the matrix protein M. Results of in vitro testing showed that the VLPs were functionally assembled and immunoreactive, and that the recombinantly expressed F protein was cleaved intracellularly similarly to the virus-synthesized F protein to produce the F1 and F2 subunits; the presence of the F1 fragment is critical for vaccine development since all the neutralizing epitopes present in the F protein are embedded in this fragment. Additional in vitro testing in human macrophage cell line THP-1 showed that both virus and the VLPs were sensed by TLR-4 and induced a Th1-biased cytokine response. Cotton rats vaccinated with RSV VLPs adjuvanted with alum and monophosphoryl lipid A induced potent neutralizing antibody response, and conferred protection in the lower as well as the upper respiratory tract based on substantial virus clearance from these sites. To the best of our knowledge, this is the first VLP/virosome vaccine study reporting protection of the lower as well as the upper respiratory tract: Prevention from replication in the nose is an important consideration if the target population is infants < 6 months of age. This is because continued virus replication in the nose results in nasal congestion and babies at this age are obligate nose breathers. In conclusion, these results taken together suggest that our VLPs show promise to be a safe and effective vaccine for RSV.

  6. Adhesion of type A Pasteurella mulocida to rabbit pharyngeal cells and its possible role in rabbit respiratory tract infections.

    PubMed Central

    Glorioso, J C; Jones, G W; Rush, H G; Pentler, L J; Darif, C A; Coward, J E

    1982-01-01

    Pasteurella multocida serotype A was found in association with the mucosal epithelium of the nasopharynges of rabbits with respiratory tract infections. The bacteria specifically attached to squamous epithelial cells of the pharyngeal mucosa both in vivo and in vitro and to some tissue culture cell lines such as HeLa. All strains with serotype A capsules were adhesive. With the exception of one serotype D strain, strains with capsular serotypes B, D, and E were at least 10-fold less adhesive. Bacterial adhesiveness was much reduced after pronase digestion, heat treatment, and homogenization, but removal of the hyaluronic acid capsule increased adhesion. Electron microscopy revealed that fimbriae were produced by an adhesive pasteurella strain, but not by two nonadherent strains. The attachment of the former strain to pharyngeal and HeLa cells was inhibited by N-acetyl-D-glucosamine. Together, these findings suggest that this amino sugar may be a component of the receptor on both animal cell surfaces and that the fimbriae may be the adhesions. It is proposed that bacterial attachment has a role in colonization and infection of rabbit upper respiratory mucosae. Images PMID:7068213

  7. Phenylethyl isothiocyanate reverses cisplatin resistance in biliary tract cancer cells via glutathionylation-dependent degradation of Mcl-1

    PubMed Central

    Li, Qiwei; Zhan, Ming; Chen, Wei; Zhao, Benpeng; Yang, Kai; Yang, Jie; Yi, Jing; Huang, Qihong; Mohan, Man; Hou, Zhaoyuan; Wang, Jian

    2016-01-01

    Biliary tract cancer (BTC) is a highly malignant cancer. BTC exhibits a low response rate to cisplatin (CDDP) treatment, and therefore, an understanding of the mechanism of CDDP resistance is urgently needed. Here, we show that BTC cells develop CDDP resistance due, in part, to upregulation of myeloid cell leukemia 1 (Mcl-1). Phenylethyl isothiocyanate (PEITC), a natural compound found in watercress, could enhance the efficacy of CDDP by degrading Mcl-1. PEITC-CDDP co-treatment also increased the rate of apoptosis of cancer stem-like side population (SP) cells and inhibited xenograft tumor growth without obvious toxic effects. In vitro, PEITC decreased reduced glutathione (GSH), which resulted in decreased GSH/oxidized glutathione (GSSG) ratio and increased glutathionylation of Mcl-1, leading to rapid proteasomal degradation of Mcl-1. Furthermore, we identified Cys16 and Cys286 as Mcl-1 glutathionylation sites, and mutating them resulted in PEITC-mediated degradation resistant Mcl-1 protein. In conclusion, we demonstrate for the first time that CDDP resistance is partially associated with Mcl-1 in BTC cells and we identify a novel mechanism that PEITC can enhance CDDP-induced apoptosis via glutathionylation-dependent degradation of Mcl-1. Hence, our results provide support that dietary intake of watercress may help reverse CDDP resistance in BTC patients. PMID:26848531

  8. Phenylethyl isothiocyanate reverses cisplatin resistance in biliary tract cancer cells via glutathionylation-dependent degradation of Mcl-1.

    PubMed

    Li, Qiwei; Zhan, Ming; Chen, Wei; Zhao, Benpeng; Yang, Kai; Yang, Jie; Yi, Jing; Huang, Qihong; Mohan, Man; Hou, Zhaoyuan; Wang, Jian

    2016-03-01

    Biliary tract cancer (BTC) is a highly malignant cancer. BTC exhibits a low response rate to cisplatin (CDDP) treatment, and therefore, an understanding of the mechanism of CDDP resistance is urgently needed. Here, we show that BTC cells develop CDDP resistance due, in part, to upregulation of myeloid cell leukemia 1 (Mcl-1). Phenylethyl isothiocyanate (PEITC), a natural compound found in watercress, could enhance the efficacy of CDDP by degrading Mcl-1. PEITC-CDDP co-treatment also increased the rate of apoptosis of cancer stem-like side population (SP) cells and inhibited xenograft tumor growth without obvious toxic effects. In vitro, PEITC decreased reduced glutathione (GSH), which resulted in decreased GSH/oxidized glutathione (GSSG) ratio and increased glutathionylation of Mcl-1, leading to rapid proteasomal degradation of Mcl-1. Furthermore, we identified Cys16 and Cys286 as Mcl-1 glutathionylation sites, and mutating them resulted in PEITC-mediated degradation resistant Mcl-1 protein. In conclusion, we demonstrate for the first time that CDDP resistance is partially associated with Mcl-1 in BTC cells and we identify a novel mechanism that PEITC can enhance CDDP-induced apoptosis via glutathionylation-dependent degradation of Mcl-1. Hence, our results provide support that dietary intake of watercress may help reverse CDDP resistance in BTC patients.

  9. Primary human epithelial cell culture system for studying interactions between female upper genital tract and sexually transmitted viruses, HSV-2 and HIV-1.

    PubMed

    Kaushic, Charu; Nazli, Aisha; Ferreira, Victor H; Kafka, Jessica K

    2011-10-01

    Evidence from clinical and epidemiological studies indicates that women are disproportionately susceptible to sexually transmitted viral infections. To understand the underlying biological basis for this increased susceptibility, more studies are needed to examine the acute events in the female reproductive tract following exposure to viruses during sexual transmission. The epithelial lining of the female reproductive tract is the primary barrier that sexually transmitted viruses, such as HIV-1 and HSV-2 need to infect or traverse, in order to initiate and establish productive infection. We have established an ex-vivo primary culture system to grow genital epithelial cells from upper reproductive tract tissues of women. Using these cultures, we have extensively examined the interactions between epithelial cells of the female genital tract and HSV-2 and HIV-1. In this review, we describe in detail the experimental protocol to grow these cultures, monitor their differentiation and inoculate with HSV-2 and HIV-1. Prospective use of these cultures to re-create the microenvironment in the reproductive tract is discussed.

  10. Mast cell tryptase and carboxypeptidase A expression in body fluid and gastrointestinal tract associated with drug-related fatal anaphylaxis

    PubMed Central

    Guo, Xiang-Jie; Wang, Ying-Yuan; Zhang, Hao-Yue; Jin, Qian-Qian; Gao, Cai-Rong

    2015-01-01

    AIM: To investigate the expression of mast cell tryptase and carboxypeptidase A in drug-related fatal anaphylaxis. METHODS: The expression of mast cell tryptase and carboxypeptidase A in 15 autopsy cases of drug-related fatal anaphylaxis and 20 normal autopsy cases were detected. First, the expression of mast cell tryptase was determined in stomach, jejunum, lung, heart, and larynx by immunofluorescence. Different tissues were removed and fixed in paraformaldehyde solution, then paraffin sections were prepared for immunofluorescence. Using specific mast cell tryptase and carboxypeptidase A antibodies, the expression of tryptase and carboxypeptidase A in gastroenterology tract and other tissues were observed using fluorescent microscopy. The postmortem serum and pericardial fluid were collected from drug-related fatal anaphylaxis and normal autopsy cases. The level of mast cell tryptase and carboxypeptidase A in postmortem serum and pericardial fluid were measured using fluor enzyme linked immunosorbent assay (FEIA) and enzyme linked immunosorbent assay (ELISA) assay. The expression of mast cell tryptase and carboxypeptidase A was analyzed in drug-related fatal anaphylaxis cases and compared to normal autopsy cases. RESULTS: The expression of carboxypeptidase A was less in the gastroenterology tract and other tissues from anaphylaxis-related death cadavers than normal controls. Immunofluorescence revealed that tryptase expression was significantly increased in multiple organs, especially the gastrointestinal tract, from anaphylaxis-related death cadavers compared to normal autopsy cases (46.67 ± 11.11 vs 4.88 ± 1.56 in stomach, 48.89 ± 11.02 vs 5.21 ± 1.34 in jejunum, 33.72 ± 5.76 vs 1.30 ± 1.02 in lung, 40.08 ± 7.56 vs 1.67 ± 1.03 in larynx, 7.11 ± 5.67 vs 1.10 ± 0.77 in heart, P < 0.05). Tryptase levels, as measured with FEIA, were significantly increased in both sera (43.50 ± 0.48 μg/L vs 5.40 ± 0.36 μg/L, P < 0.05) and pericardial fluid (28.64 ± 0

  11. Mast cell tryptase and carboxypeptidase A expression in body fluid and gastrointestinal tract associated with drug-related fatal anaphylaxis.

    PubMed

    Guo, Xiang-Jie; Wang, Ying-Yuan; Zhang, Hao-Yue; Jin, Qian-Qian; Gao, Cai-Rong

    2015-12-21

    To investigate the expression of mast cell tryptase and carboxypeptidase A in drug-related fatal anaphylaxis. The expression of mast cell tryptase and carboxypeptidase A in 15 autopsy cases of drug-related fatal anaphylaxis and 20 normal autopsy cases were detected. First, the expression of mast cell tryptase was determined in stomach, jejunum, lung, heart, and larynx by immunofluorescence. Different tissues were removed and fixed in paraformaldehyde solution, then paraffin sections were prepared for immunofluorescence. Using specific mast cell tryptase and carboxypeptidase A antibodies, the expression of tryptase and carboxypeptidase A in gastroenterology tract and other tissues were observed using fluorescent microscopy. The postmortem serum and pericardial fluid were collected from drug-related fatal anaphylaxis and normal autopsy cases. The level of mast cell tryptase and carboxypeptidase A in postmortem serum and pericardial fluid were measured using fluor enzyme linked immunosorbent assay (FEIA) and enzyme linked immunosorbent assay (ELISA) assay. The expression of mast cell tryptase and carboxypeptidase A was analyzed in drug-related fatal anaphylaxis cases and compared to normal autopsy cases. The expression of carboxypeptidase A was less in the gastroenterology tract and other tissues from anaphylaxis-related death cadavers than normal controls. Immunofluorescence revealed that tryptase expression was significantly increased in multiple organs, especially the gastrointestinal tract, from anaphylaxis-related death cadavers compared to normal autopsy cases (46.67 ± 11.11 vs 4.88 ± 1.56 in stomach, 48.89 ± 11.02 vs 5.21 ± 1.34 in jejunum, 33.72 ± 5.76 vs 1.30 ± 1.02 in lung, 40.08 ± 7.56 vs 1.67 ± 1.03 in larynx, 7.11 ± 5.67 vs 1.10 ± 0.77 in heart, P < 0.05). Tryptase levels, as measured with FEIA, were significantly increased in both sera (43.50 ± 0.48 μg/L vs 5.40 ± 0.36 μg/L, P < 0.05) and pericardial fluid (28.64 ± 0.32 μg/L vs 4.60 ± 0

  12. DNA isolation protocols affect the detection limit of PCR approaches of bacteria in samples from the human gastrointestinal tract.

    PubMed

    Zoetendal, E G; Ben-Amor, K; Akkermans, A D; Abee, T; de Vos, W M

    2001-11-01

    A major concern in molecular ecological studies is the lysis efficiency of different bacteria in a complex ecosystem. We used a PCR-based 16S rDNA approach to determine the effect of two DNA isolation protocols (i.e. the bead beating and Triton-X100 method) on the detection limit of seven feces-associated bacterial species of different genera. Glycogen was used in these protocols to improve the precipitation of small concentrations of DNA in ethanol without affecting the sequential procedures. The PCR detection limit of 16S rDNA amplicons on agarose gel from the seven strains tested varied between 8.0 (+/- 1.3) x 10(4) and 4.3 (+/- 1.6) x 10(6) cells for the bead beating method, and between 8.0 (+/- 1.3) x 10(4) and 5.4 (+/- 0.7) x 10(8) cells for the Triton X-100 method. These large differences are most like due to the difference in cell lysis efficiency, since a competitive PCR experiment did not indicate any preference for gram negative, low G+C gram positive or high G+C gram positive bacteria. Denaturing gradient gel electrophoresis (DGGE) analysis was performed to investigate the effect of both DNA isolation protocols on the lysis efficiency of bacteria in fecal samples. A higher diversity in fecal samples was observed with the bead beating method than with the Triton-X100 method. Bands in the bead beating method-derived DGGE profiles corresponding to bands of cloned sequences of the Clostridium coccoides-Eubacterium rectale group and uncultured Fusobacterium prausnitzii were absent or had low intensity in the Triton X-100 method-derived profiles. The applicability of the bead beating method was further investigated by analyzing biopsy samples from the human colon which contain approximately 10(6) cells.

  13. Superficial leiomyomas of the gastrointestinal tract with interstitial cells of Cajal

    PubMed Central

    Janevska, Vesna; Qerimi, Adelina; Basheska, Neli; Stojkova, Elena; Janevski, Vlado; Jovanovic, Rubens; Zhivadinovik, Julija; Spasevska, Liljana

    2015-01-01

    Objective: Some authors suggest common origin of gastrointestinal stromal tumors from stem cells, which may show diverse differentiation. There are reports in which cells morphologically identical to the interstitial cells of Cajal are found in deep leiomyomas. The aim of this study was to demonstrate CD117 positive cells in superficial gastrointestinal (GI) leiomyomas and to find other cells that would suggest diverse differentiation in histologically typical leiomyoma. Materials and methods: We analyzed 8 cases of superficial leiomyomas and one deep leiomyoma, received in our institutions as endoscopically or surgically obtained material. The tumor sections were immunohistochemicaly stained with CD117, CD34, NF, S100, αSMA, desmin, caldesmon and mast cell antigen. Results: All leiomyomas showed diffuse positivity for αSMA, caldesmon and desmin. All of them had CD117 and CD34 positive cells morphologically identical to the interstitial cells of Cajal between smooth muscle fibers, 5 had S-100 and NF positive cells and 2 showed positivity for GFAP. The cells were found in different quantity; they were usually diffusely scattered through the tumors without predilection site, forming small groups in some areas. Conclusion: CD177, CD34, S-100 and NF positive cells are present in superficial leiomyomas and they may suggest common origin of GI stromal tumors. PMID:26884872

  14. The antibody approach of labeling blood cells

    SciTech Connect

    Srivastava, S.C.

    1992-12-31

    Although the science of blood cell labeling using monoclonal antibodies directed against specific cellular antigens is still in its early stages, considerable progress has recently been accomplished in this area. The monoclonal antibody approach offers the promise of greater selectivity and enhanced convenience since specific cell types can be labeled in vivo, thus eliminating the need for complex and damaging cell separation procedures. This article focuses on these developments with primary emphasis on antibody labeling of platelets and leukocytes. The advantages and the shortcomings of the recently reported techniques are critically assessed and evaluated.

  15. The antibody approach of labeling blood cells

    SciTech Connect

    Srivastava, S.C.

    1991-12-31

    Although the science of blood cell labeling using monoclonal antibodies directed against specific cellular antigens is still in its early stages, considerable progress has recently been accomplished in this area. The monoclonal antibody approach offers the promise of greater selectivity and enhanced convenience since specific cell types can be labeled in vivo, thus eliminating the need for complex and damaging cell separation procedures. This article focuses on these developments with primary emphasis on antibody labeling of platelets and leukocytes. The advantages and the shortcomings of the recently reported techniques are criticality assessed and evaluated.

  16. The antibody approach of labeling blood cells

    SciTech Connect

    Srivastava, S.C.

    1991-01-01

    Although the science of blood cell labeling using monoclonal antibodies directed against specific cellular antigens is still in its early stages, considerable progress has recently been accomplished in this area. The monoclonal antibody approach offers the promise of greater selectivity and enhanced convenience since specific cell types can be labeled in vivo, thus eliminating the need for complex and damaging cell separation procedures. This article focuses on these developments with primary emphasis on antibody labeling of platelets and leukocytes. The advantages and the shortcomings of the recently reported techniques are criticality assessed and evaluated.

  17. Polypyrimidine tract-binding protein induces p19(Ink4d) expression and inhibits the proliferation of H1299 cells.

    PubMed

    Lin, Shankung; Wang, Ming Jen; Tseng, Kuo-Yun

    2013-01-01

    The expression of polypyrimidine tract-binding protein (PTB) is up-regulated in many types of cancer. Here, we studied the role of PTB in the growth of non small cell lung cancer cells. Data showed that PTB overexpression inhibited the growth of H1299 cells at least by inhibiting DNA synthesis. Quantitative real-time PCR and Western blot analyses showed that PTB overexpression in H1299 cells specifically induced the expression of p19(Ink4d), an inhibitor of cyclin-dependent kinase 4. Repression of p19(Ink4d) expression partially rescued PTB-caused proliferation inhibition. PTB overexpression also inhibited the growth and induced the expression of p19(Ink4d) mRNA in A549 cells. However, Western blot analyses failed to detect the presence of p19(Ink4d) protein in A549 cells. To address how PTB induced p19(Ink4d) in H1299 cells, we showed that PTB might up-regulate the activity of p19(Ink4d) gene (CDKN2D) promoter. Besides, PTB lacking the RNA recognition motif 3 (RRM3) was less effective in growth inhibition and p19(Ink4d) induction, suggesting that RNA-binding activity of PTB plays an important role in p19(Ink4d) induction. However, immunoprecipitation of ribonuclearprotein complexes plus quantitative real-time PCR analyses showed that PTB might not bind p19(Ink4d) mRNA, suggesting that PTB overexpression might trigger the other RNA-binding protein(s) to bind p19(Ink4d) mRNA. Subsequently, RNA electrophoretic mobility-shift assays revealed a 300-base segment (designated as B2) within the 3'UTR of p19(Ink4d) mRNA, with which the cytoplasmic lysates of PTB-overexpressing cells formed more prominent complexes than did control cell lysates. Insertion of B2 into a reporter construct increased the expression of the chimeric luciferase transcripts in transfected PTB-overexpressing cells but not in control cells; conversely, overexpression of B2-containing reporter construct in PTB-overexpressing cells abolished the induction of p19(Ink4d) mRNA. In sum, we have shown that

  18. Testin interacts with Vangl2 genetically to regulate inner ear sensory cell orientation and the normal development of the female reproductive tract in mice

    PubMed Central

    Ren, Dong-Dong; Kelly, Michael; Kim, Sun Myoung; Grimsley-Myers, Cynthia Mary; Chi, Fang-Lu; Chen, Ping

    2014-01-01

    Background Planar cell polarity (PCP) signaling regulates the coordinated polarization of cells and is required for the normal development and function of many tissues. Previous studies have identified conserved PCP genes, such as Van gogh-like 2 (Vangl2) and Prickle (Pk), in the regulation of coordinated orientation of inner ear hair cells and female reproductive tract development. Testin shares a PET-LIM homology with Pk. It is not clear whether Testin acts in PCP processes in mammals. Results We identified Testin as a Vangl2-interacting protein through a 2-hybrid screen with a cochlea cDNA library. Testin is enriched to cell-cell boundaries in the presence of Vangl2 in cultured cells. Genetic inactivation of Testin leads to abnormal hair cell orientation in the vestibule and cellular patterning defects in the cochlea. In addition, Testin genetically interacts with Vangl2 to regulate hair cell orientation in the cochlea and the opening of the vaginal tract. Conclusions Our findings suggested Testin as a gene involved in coordinated hair cell orientation in the inner ear and in female reproductive tract development. Furthermore, its genetic interaction with Vangl2 implicated it as a potential molecular link, responsible for mediating the role of Vangl2-containing membranous PCP complexes in directing morphologic polarization. PMID:23996638

  19. Prickle1 mutation causes planar cell polarity and directional cell migration defects associated with cardiac outflow tract anomalies and other structural birth defects.

    PubMed

    Gibbs, Brian C; Damerla, Rama Rao; Vladar, Eszter K; Chatterjee, Bishwanath; Wan, Yong; Liu, Xiaoqin; Cui, Cheng; Gabriel, George C; Zahid, Maliha; Yagi, Hisato; Szabo-Rogers, Heather L; Suyama, Kaye L; Axelrod, Jeffrey D; Lo, Cecilia W

    2016-02-16

    Planar cell polarity (PCP) is controlled by a conserved pathway that regulates directional cell behavior. Here, we show that mutant mice harboring a newly described mutation termed Beetlejuice (Bj) in Prickle1 (Pk1), a PCP component, exhibit developmental phenotypes involving cell polarity defects, including skeletal, cochlear and congenital cardiac anomalies. Bj mutants die neonatally with cardiac outflow tract (OFT) malalignment. This is associated with OFT shortening due to loss of polarized cell orientation and failure of second heart field cell intercalation mediating OFT lengthening. OFT myocardialization was disrupted with cardiomyocytes failing to align with the direction of cell invasion into the outflow cushions. The expression of genes mediating Wnt signaling was altered. Also noted were shortened but widened bile ducts and disruption in canonical Wnt signaling. Using an in vitro wound closure assay, we showed Bj mutant fibroblasts cannot establish polarized cell morphology or engage in directional cell migration, and their actin cytoskeleton failed to align with the direction of wound closure. Unexpectedly, Pk1 mutants exhibited primary and motile cilia defects. Given Bj mutant phenotypes are reminiscent of ciliopathies, these findings suggest Pk1 may also regulate ciliogenesis. Together these findings show Pk1 plays an essential role in regulating cell polarity and directional cell migration during development.

  20. Prickle1 mutation causes planar cell polarity and directional cell migration defects associated with cardiac outflow tract anomalies and other structural birth defects

    PubMed Central

    Gibbs, Brian C.; Damerla, Rama Rao; Vladar, Eszter K.; Chatterjee, Bishwanath; Wan, Yong; Liu, Xiaoqin; Cui, Cheng; Gabriel, George C.; Zahid, Maliha; Yagi, Hisato; Szabo-Rogers, Heather L.; Suyama, Kaye L.; Axelrod, Jeffrey D.; Lo, Cecilia W.

    2016-01-01

    ABSTRACT Planar cell polarity (PCP) is controlled by a conserved pathway that regulates directional cell behavior. Here, we show that mutant mice harboring a newly described mutation termed Beetlejuice (Bj) in Prickle1 (Pk1), a PCP component, exhibit developmental phenotypes involving cell polarity defects, including skeletal, cochlear and congenital cardiac anomalies. Bj mutants die neonatally with cardiac outflow tract (OFT) malalignment. This is associated with OFT shortening due to loss of polarized cell orientation and failure of second heart field cell intercalation mediating OFT lengthening. OFT myocardialization was disrupted with cardiomyocytes failing to align with the direction of cell invasion into the outflow cushions. The expression of genes mediating Wnt signaling was altered. Also noted were shortened but widened bile ducts and disruption in canonical Wnt signaling. Using an in vitro wound closure assay, we showed Bj mutant fibroblasts cannot establish polarized cell morphology or engage in directional cell migration, and their actin cytoskeleton failed to align with the direction of wound closure. Unexpectedly, Pk1 mutants exhibited primary and motile cilia defects. Given Bj mutant phenotypes are reminiscent of ciliopathies, these findings suggest Pk1 may also regulate ciliogenesis. Together these findings show Pk1 plays an essential role in regulating cell polarity and directional cell migration during development. PMID:26883626

  1. Distribution and ultrastructural characteristics of dark cells in squamous metaplasias of the respiratory tract epithelium. [Rats

    SciTech Connect

    Klein-Szanto, A.J.P.; Nettesheim, P.; Pine, A.; Martin, D.

    1981-05-01

    Dark epithelial basal cells were found in both carcinogen-induced and non-carcinogen-induced squamous metaplasias of the tracheal epithelium. Formaldehyde-induced squamous metaplasias exhibited 4% dark cells in the basal layer. Metaplasias induced by vitamin A deficiency and those induced by dimethylbenz(a)anthracene (DMBA) without atypia showed 18-20% basal dark cells. DMBA-induced metaplasias with moderate to severe atypia exhibited 50% basal dark cells. The labeling index of basal cells in metaplastic epithelia, regardless of the inducing agent, was 16-18%, ie, the same as that of the normal esophageal stratified squamous epithelium. The percentage of labeled dark basal cells per total dark cell population was approximately 19% in the non-carcinogen-induced metaplasias and in the DMBA-induced metaplasias without atypia. In the atypical metaplasias induced by DMA this percentage increased to 26. On the basis of ultrastructural observations, five types of dark epithelial cells could be distinguished in the metaplastic epithelia. Each type of squamous metaplasia could thus be recognized by a determined numerical distribution of dark cells in the basal layer and a specific pattern of distribution of the ultrastructurally defined dark cell categories.

  2. Photochemical approaches to T-cell activation

    PubMed Central

    Huse, Morgan

    2010-01-01

    Despite decades of intensive research, T-cell activation has remained mysterious because of both the dizzying diversity of antigen recognition and the speed and comprehensiveness of the T-cell-receptor signalling network. Further progress will require new approaches and reagents that provide added levels of control. Photochemistry allows specific biochemical processes to be controlled with light and is well suited to mechanistic studies in complex cellular environments. In recent years, several laboratories have adopted approaches based on photoreactive peptide-major histocompatibility complex reagents in order to study T-cell activation and function with high precision. Here, I review these efforts and outline future directions for this exciting area of research. PMID:20406301

  3. A role for stem cell factor (SCF): c-kit interaction(s) in the intestinal tract response to Salmonella typhimurium infection

    PubMed Central

    1996-01-01

    Cholera toxin (CT) has been shown to induce stem cell factor (SCF) production in mouse ligated intestinal loops. Further, SCF interaction(s) with its receptor (c-kit) was shown to be important for the intestinal tract secretory response after CT exposure. In this study, we have investigated whether SCF production is induced in the intestinal tract after exposure to Salmonella typhimurium and whether this production could be an important intestinal tract response to Salmonella infection. Using a mouse ligated intestinal loop model, increased levels of SCF mRNA were detected at 2-4 h post-Salmonella challenge. Intestinal fluid obtained from Salmonella-challenged loops contained high levels of SCF by ELISA. Human and murine intestinal epithelial cell lines were also shown to have increased levels of SCF mRNA after exposure to Salmonella. Inhibition of Salmonella invasion of epithelial cells was shown to be one potentially important role for SCF:c-kit interactions in host defense to Salmonella infection. Pretreatment of human or murine intestinal cell lines with SCF resulted in a cellular state that was resistant to Salmonella invasion. Finally, mice having mutations in the white spotting (W) locus, which encodes the SCF-receptor (c-kit), were significantly more susceptible to oral Salmonella challenge than their control littermates. Taken together, the above results suggest that an important intestinal tract response to Salmonella infection is an enhanced production of SCF and its subsequent interactions with c-kit. PMID:8691142

  4. Biological effects of diesel exhaust particles (DEP) on tissues and cells isolated from respiratory tracts of guinea pigs.

    PubMed

    Hirafuji, M; Sakakibara, M; Endo, T; Murakami, S; Mori, Y; Sagai, M; Minami, M

    1995-11-01

    Diesel engine-powered vehicles emit some 30 to 100 times more particles than do gasoline engine cars. We previously reported that diesel exhaust particles (DEP) instilled intratracheally into mouse caused lung edema accompanying endothelial cell damage. In order to clarify further the biological effects of DEP on the respiratory system, the primary target of DEP instillation, we examined the direct action of DEP on isolated tissues and the cytotoxicity of DEP on cultured cells of respiratory tracts in guinea pigs. DEP were collected on glass fiber filters from a light-duty (2730 cc), four cylinder diesel engine. DEP induced a dose-dependent relaxation in tracheal smooth muscle and lung parenchymal preparations from guinea pigs. Neither propranolol nor ranitidine inhibited the relaxing effect of DEP on tracheal preparations. DEP also exhibited concentration- and time-dependent cytotoxicity on cultured tracheal smooth muscle cells and lung fibroblasts from guinea pigs, as assessed by specific [51Cr] release. These cytotoxicities induced by DEP were significantly inhibited by catalase, deferoxamine and MK-447, whereas SOD and mannitol had little effect. These inhibitory effects were blunted by the higher concentration of DEP. These results suggest that the cytotoxicity of DEP may cause dysfunction of respiratory tissues, which are mediated via oxygen radicals, probably hydroxyl radicals or hydrogen peroxides.

  5. Non-canonical Wnt signaling regulates cell polarity in female reproductive tract development via van gogh-like 2

    PubMed Central

    vandenBerg, Alysia L.; Sassoon, David A.

    2009-01-01

    Summary Wnt signaling effectors direct the development and adult remodeling of the female reproductive tract (FRT); however, the role of non-canonical Wnt signaling has not been explored in this tissue. The non-canonical Wnt signaling protein van gogh-like 2 is mutated in loop-tail (Lp) mutant mice (Vangl2Lp), which display defects in multiple tissues. We find that Vangl2Lp mutant uterine epithelium displays altered cell polarity, concommitant with changes in cytoskeletal actin and scribble (scribbled, Scrb1) localization. The postnatal mutant phenotype is an exacerbation of that seen at birth, exhibiting more smooth muscle and reduced stromal mesenchyme. These data suggest that early changes in cell polarity have lasting consequences for FRT development. Furthermore, Vangl2 is required to restrict Scrb1 protein to the basolateral epithelial membrane in the neonatal uterus, and an accumulation of fibrillar-like structures observed by electron microscopy in Vangl2Lp mutant epithelium suggests that mislocalization of Scrb1 in mutants alters the composition of the apical face of the epithelium. Heterozygous and homozygous Vangl2Lp mutant postnatal tissues exhibit similar phenotypes and polarity defects and display a 50% reduction in Wnt7a levels, suggesting that the Vangl2Lp mutation acts dominantly in the FRT. These studies demonstrate that the establishment and maintenance of cell polarity through non-canonical Wnt signaling are required for FRT development. PMID:19363157

  6. TRPV4 channels in the human urogenital tract play a role in cell junction formation and epithelial barrier.

    PubMed

    Janssen, D A W; Jansen, C J F; Hafmans, T G; Verhaegh, G W; Hoenderop, J G; Heesakkers, J P F A; Schalken, J A

    2016-09-01

    The molecular interactions between transient receptor potential vanilloid subtype 4 channels (TRPV4) and cell junction formation were investigated in the human and mouse urogenital tract. A qualitative study was performed to investigate TRPV4 channels, adherence junctions (AJs) and tight junctions (TJs) in kidney, ureter and bladder tissues from humans and wild-type and transgenic TRPV4 knockout (-/-) mice with immunohistochemistry, Western blotting, immunoprecipitation and reverse trasnscription-PCR. Cell junction formation in the wild-type and TRPV4 knockout (-/-) mouse was evaluated with immunohistochemistry and transmission electron microscope (TEM) techniques. TRPV4 channels are predominantly located in membranes of epithelial cells of the bladder, ureter and the collecting ducts of the kidney. There is a molecular interaction between the TRPV4 channel and the AJ. TEM evaluation showed that AJ formation is disrupted in the TRPV4 -/- mouse resulting in deficient intercellular connections and integrity of the epithelium. TRPV4 is believed to be a mechanoreceptor in the bladder. This study demonstrates that TRPV4 is also involved in intercellular connectivity and structural integrity of the epithelium. © 2016 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

  7. Non-canonical Wnt signaling regulates cell polarity in female reproductive tract development via van gogh-like 2.

    PubMed

    Vandenberg, Alysia L; Sassoon, David A

    2009-05-01

    Wnt signaling effectors direct the development and adult remodeling of the female reproductive tract (FRT); however, the role of non-canonical Wnt signaling has not been explored in this tissue. The non-canonical Wnt signaling protein van gogh-like 2 is mutated in loop-tail (Lp) mutant mice (Vangl2(Lp)), which display defects in multiple tissues. We find that Vangl2(Lp) mutant uterine epithelium displays altered cell polarity, concommitant with changes in cytoskeletal actin and scribble (scribbled, Scrb1) localization. The postnatal mutant phenotype is an exacerbation of that seen at birth, exhibiting more smooth muscle and reduced stromal mesenchyme. These data suggest that early changes in cell polarity have lasting consequences for FRT development. Furthermore, Vangl2 is required to restrict Scrb1 protein to the basolateral epithelial membrane in the neonatal uterus, and an accumulation of fibrillar-like structures observed by electron microscopy in Vangl2(Lp) mutant epithelium suggests that mislocalization of Scrb1 in mutants alters the composition of the apical face of the epithelium. Heterozygous and homozygous Vangl2(Lp) mutant postnatal tissues exhibit similar phenotypes and polarity defects and display a 50% reduction in Wnt7a levels, suggesting that the Vangl2(Lp) mutation acts dominantly in the FRT. These studies demonstrate that the establishment and maintenance of cell polarity through non-canonical Wnt signaling are required for FRT development.

  8. Outcomes of surgical treatment for upper urinary tract transitional cell carcinoma: Comparison of retroperitoneoscopic and open nephroureterectomy

    PubMed Central

    Taweemonkongsap, Tawatchai; Nualyong, Chaiyong; Amornvesukit, Teerapon; Leewansangtong, Sunai; Srinualnad, Sittiporn; Chaiyaprasithi, Bansithi; Sujijantararat, Phichaya; Tantiwong, Anupan; Soontrapa, Suchai

    2008-01-01

    Objectives To determine the surgical and oncologic outcomes in patients who underwent retroperitoneoscopic nephroureterectomy (RNU) in comparison to standard open nephroureterectomy (ONU) for upper urinary tract transitional cell carcinoma (TCC). Patients and methods From April 2001 to January 2007, 60 total nephroureterectomy were performed for upper tract TCC at Siriraj Hospital. Of the 60 patients, thirty-one were treated with RNU and open bladder cuff excision, and twenty-nine with ONU. Our data were reviewed and analyzed retrospectively. The recorded data included sex, age, history of bladder cancer, type of surgery, tumor characteristics, postoperative course, disease recurrence and progression. Results The mean operative time was longer in the RNU group than in the ONU group (258.8 versus 190.6 min; p = 0. < 001). On the other hand, the mean blood loss and the dose of parenteral analgesia (morphine sulphate) were lower in the RNU group (289.3 versus 313.7 ml and 2.05 versus 6.72 mg; p = 0.868 and p = 0.018, respectively). There were two complications in each group. No significant difference in p stage and grade in both-groups (p = 0.951, p = 0.077). One patient with RNU had lymph node involvement, three in ONU. Mean follow up was 26.4 months (range 3–72) for RNU and 27.9 months (range 3–63) for ONU. No port metastasis occurred during follow up in RNU group. Tumor recurrence developed in 11 patients (bladder recurrence in 9 patients, local recurrence in 2 patients) in the RNU group and 14 patients (bladder recurrence in 13 patients, local recurrence in 1 patient) in the ONU group. No significant difference was detected in the tumor recurrence rate between the two procedures (p = 0.2716). Distant metastases developed in 3 patients (9.7%) after RNU and 2 patients (6.9%) after ONU. The 2 year disease specific survival rate after RNU and ONU was 86.3% and 92.5%, respectively (p = 0.8227). Conclusion Retroperitoneoscopic nephroureterectomy is less invasive

  9. Outcomes of surgical treatment for upper urinary tract transitional cell carcinoma: comparison of retroperitoneoscopic and open nephroureterectomy.

    PubMed

    Taweemonkongsap, Tawatchai; Nualyong, Chaiyong; Amornvesukit, Teerapon; Leewansangtong, Sunai; Srinualnad, Sittiporn; Chaiyaprasithi, Bansithi; Sujijantararat, Phichaya; Tantiwong, Anupan; Soontrapa, Suchai

    2008-01-15

    To determine the surgical and oncologic outcomes in patients who underwent retroperitoneoscopic nephroureterectomy (RNU) in comparison to standard open nephroureterectomy (ONU) for upper urinary tract transitional cell carcinoma (TCC). From April 2001 to January 2007, 60 total nephroureterectomy were performed for upper tract TCC at Siriraj Hospital. Of the 60 patients, thirty-one were treated with RNU and open bladder cuff excision, and twenty-nine with ONU. Our data were reviewed and analyzed retrospectively. The recorded data included sex, age, history of bladder cancer, type of surgery, tumor characteristics, postoperative course, disease recurrence and progression. The mean operative time was longer in the RNU group than in the ONU group (258.8 versus 190.6 min; p = 0. < 001). On the other hand, the mean blood loss and the dose of parenteral analgesia (morphine sulphate) were lower in the RNU group (289.3 versus 313.7 ml and 2.05 versus 6.72 mg; p = 0.868 and p = 0.018, respectively). There were two complications in each group. No significant difference in p stage and grade in both-groups (p = 0.951, p = 0.077). One patient with RNU had lymph node involvement, three in ONU. Mean follow up was 26.4 months (range 3-72) for RNU and 27.9 months (range 3-63) for ONU. No port metastasis occurred during follow up in RNU group. Tumor recurrence developed in 11 patients (bladder recurrence in 9 patients, local recurrence in 2 patients) in the RNU group and 14 patients (bladder recurrence in 13 patients, local recurrence in 1 patient) in the ONU group. No significant difference was detected in the tumor recurrence rate between the two procedures (p = 0.2716). Distant metastases developed in 3 patients (9.7%) after RNU and 2 patients (6.9%) after ONU. The 2 year disease specific survival rate after RNU and ONU was 86.3% and 92.5%, respectively (p = 0.8227). Retroperitoneoscopic nephroureterectomy is less invasive than open surgery and is an oncological feasible operation

  10. Development of a gastrointestinal tract microscale cell culture analog to predict drug transport

    USDA-ARS?s Scientific Manuscript database

    Microscale cell culture analogs (uCCAs) are used to study the metabolism and toxicity of a chemical or drug. These in vitro devices are physical replicas of physiologically based pharmacokinetic models that combine microfabrication and cell culture. The goal of this project is to add an independent ...

  11. Challenges in structural approaches to cell modeling

    PubMed Central

    Im, Wonpil; Liang, Jie; Olson, Arthur; Zhou, Huan-Xiang; Vajda, Sandor; Vakser, Ilya A.

    2016-01-01

    Computational modeling is essential for structural characterization of biomolecular mechanisms across the broad spectrum of scales. Adequate understanding of biomolecular mechanisms inherently involves our ability to model them. Structural modeling of individual biomolecules and their interactions has been rapidly progressing. However, in terms of the broader picture, the focus is shifting toward larger systems, up to the level of a cell. Such modeling involves a more dynamic and realistic representation of the interactomes in vivo, in a crowded cellular environment, as well as membranes and membrane proteins, and other cellular components. Structural modeling of a cell complements computational approaches to cellular mechanisms based on differential equations, graph models, and other techniques to model biological networks, imaging data, etc. Structural modeling along with other computational and experimental approaches will provide a fundamental understanding of life at the molecular level and lead to important applications to biology and medicine. A cross section of diverse approaches presented in this review illustrates the developing shift from the structural modeling of individual molecules to that of cell biology. Studies in several related areas are covered: biological networks; automated construction of three-dimensional cell models using experimental data; modeling of protein complexes; prediction of non-specific and transient protein interactions; thermodynamic and kinetic effects of crowding; cellular membrane modeling; and modeling of chromosomes. The review presents an expert opinion on the current state-of-the-art in these various aspects of structural modeling in cellular biology, and the prospects of future developments in this emerging field. PMID:27255863

  12. [Influence of human gastrointestinal tract bacterial pathogens on host cell apoptosis].

    PubMed

    Wronowska, Weronika; Godlewska, Renata; Jagusztyn-Krynicka, Elzbieta Katarzyna

    2005-01-01

    Several pathogenic bacteria are able to trigger apoptosis in the host cell, but the mechanisms by which it occurs differ, and the resulting pathology can take different courses. Induction and/or blockage of programmed cell death upon infection is a result of complex interaction of bacterial proteins with cellular proteins involved in signal transduction and apoptosis. In this review we focus on pro/anti-apoptotic activities exhibited by two enteric pathogens Salmonella enterica, Yersinia spp. and gastric pathogen Helicobacter pylori. We present current knowledge on how interaction between mammalian and bacterial cell relates to the molecular pathways of apoptosis, and what is the role of apoptosis in pathogenesis.

  13. Association of perceived neighborhood problems and census tract income with poor self-rated health in adults: a multilevel approach.

    PubMed

    Höfelmann, Doroteia Aparecida; Diez Roux, Ana V; Antunes, José Leopoldo Ferreira; Peres, Marco Aurélio

    2015-11-01

    Neighborhood problems constitute sources of chronic stress that may increase the risk of poor self-rated health. The associations of census tract level income and perceived neighborhood problems with self-rated health were examined in Florianópolis, Santa Catarina State, Brazil (1,720 adults). Odds ratios (OR) and their 95% confidence intervals (95%CI) of poor self-rated health were estimated through multilevel models. Residents in census tracts in the lower and intermediate tertiles of income reported poorer health than those in the highest tertile. OR of reporting poorer health was 2.44 (95%CI: 2.35- 2.54) in the higher tertile of social disorder (adjusting for mental health). The chances of reporting the poorer health with neighborhood problems ranged from 1.07 (95%CI: 1.03-1.11) to 2.02 (95%CI: 1.95-2.10) for the higher tertile of social disorder (physical health) and physical problem (health-related variables). Perceived neighborhood problems were independently associated with poor health. The perception of a neighborhood among its residents should be considered by health policymakers.

  14. Impact of cell regeneration in human respiratory tract on simultaneous viral infections

    NASA Astrophysics Data System (ADS)

    Pinky, Lubna Jahan Rashid; Dobrovolny, Hana

    2015-03-01

    Studies have found that ~ 40% of patients hospitalized with influenza-like illness are infected with at least two different viruses. In these longer infections, we need to consider the role of cell regeneration. Several mathematical models have been used to describe cell regeneration in infection models, though the effect of model choice on the predicted time course of simultaneous viral infections is not clear. We investigate a series of mathematical models of cell regeneration during simultaneous respiratory virus infections to determine the effect of cell regeneration on infection dynamics. We perform a nonlinear stability analysis for each model. The analysis suggests that coexistence of two viral species is not possible for any form of regeneration. We find that chronic illness is possible, but with only one viral species.

  15. Characterization of the Molecular Interplay between Moraxella catarrhalis and Human Respiratory Tract Epithelial Cells

    PubMed Central

    de Vries, Stefan P. W.; Eleveld, Marc J.; Hermans, Peter W. M.; Bootsma, Hester J.

    2013-01-01

    Moraxella catarrhalis is a mucosal pathogen that causes childhood otitis media and exacerbations of chronic obstructive pulmonary disease in adults. During the course of infection, M. catarrhalis needs to adhere to epithelial cells of different host niches such as the nasopharynx and lungs, and consequently, efficient adhesion to epithelial cells is considered an important virulence trait of M. catarrhalis. By using Tn-seq, a genome-wide negative selection screenings technology, we identified 15 genes potentially required for adherence of M. catarrhalis BBH18 to pharyngeal epithelial Detroit 562 and lung epithelial A549 cells. Validation with directed deletion mutants confirmed the importance of aroA (3-phosphoshikimate 1-carboxyvinyl-transferase), ecnAB (entericidin EcnAB), lgt1 (glucosyltransferase), and MCR_1483 (outer membrane lipoprotein) for cellular adherence, with ΔMCR_1483 being most severely attenuated in adherence to both cell lines. Expression profiling of M. catarrhalis BBH18 during adherence to Detroit 562 cells showed increased expression of 34 genes in cell-attached versus planktonic bacteria, among which ABC transporters for molybdate and sulfate, while reduced expression of 16 genes was observed. Notably, neither the newly identified genes affecting adhesion nor known adhesion genes were differentially expressed during adhesion, but appeared to be constitutively expressed at a high level. Profiling of the transcriptional response of Detroit 562 cells upon adherence of M. catarrhalis BBH18 showed induction of a panel of pro-inflammatory genes as well as genes involved in the prevention of damage of the epithelial barrier. In conclusion, this study provides new insight into the molecular interplay between M. catarrhalis and host epithelial cells during the process of adherence. PMID:23936538

  16. [Recommendation for guidelines in the treatment of squamous cell cancer of the upper aerodigestive tract].

    PubMed

    Burian, Martin

    2008-01-01

    If we look at the historical development of the treatment of head and neck cancer, we can see that initially, decisions about therapy lay solely in the hands of the surgeons (Otorhinolaryngologists, oral and maxilla-facial surgeons) This was also true of the decision as to whether an operation was feasible or whether primary radio therapy was to be carried out. At the end of the last century, after chemotherapy had become an integral part of curative therapy, inter-disciplinary conferences (tumour boards) were set up so that the surgeons could make joint decisions about therapy together with radio oncologists and medical oncologists. In addition, the increasingly important role of chemotherapy in curative therapy in the last fifteen years has led to a marked increase in the number of clinical studies in head and neck cancer. Inter-disciplinary treatment decisions can be based only on current scientific knowledge and are geared towards a standard treatment as recommended for an individual tumour stage. It is precisely in the upper aerodigestive tract that there are various therapeutical procedures, due to the different site of primaries (oral cavity, oro-, hypoparynx and larynx) and the different grade of locoregional metastasis. One possible way to assure a high degree of transparency of these various therapies and making them available to a high number of colleagues is the development guidelines [1]. Many medical associations and organisations in Austria are currently engaged in the formulation and definition of guidelines, in order to provide the highest possible quality of medical treatment and care for each individual patient. By guidelines are meant recommendations for treatments which allow a certain amount of flexibility in the treatment and provide a medical consensus in line with current scientific knowledge. In principle, they are binding, but in exceptional but reasonable cases, they may (and even must) be departed from. The following proposal is

  17. [Vaginal Follicular dendritic cell sarcoma in patient with previous urinary tract carcinoma. Case Report].

    PubMed

    Zaya, Alejandro Martin; González, Ana Carolina; Sandrone, Silvana S; Sambuelli, Ruben Horacio

    2016-01-01

    follicular dendritic cell sarcoma (FDC sarcoma) is an uncommon neoplasm derived from FDC present in lymphoid follicles. It usually presents in lymph nodes, being extranodal location a very unusual event. A 78 year old female, with prior left nephrectomy for invasive urothelial carcinoma, consulted for genitorragia. At examination, a polypoid vaginal lesion, measuring 3.5 cm in diameter was discovered. It was reported as squamous cell carcinoma in incisional biopsy. A polipectomy was performed. Examination of resected specimen showed a tumor having pushing edges, arranged in a solid pattern with spindle and epithelioid cells, having a syncytial appearance, diffusely sprinkled with numerous lymphocytes and granulocytes. At immunohistochemistry neoplastic cells were positive for vimentin, CD 68, CD 21 and fascine, and focally positive for S-100 and CD45. Occasional scattered neoplastic cells expressed CD30 and CD 23. They were negative for CD3, CD20, myeloperoxidase, AE1 / AE3, EMA, HMB45, Melan A, desmin, Chromogranin, CD1a and CD35. Infiltrating lymphocites were mainly of T cell lineage (CD3 +). We report a case of FDC sarcoma in an unusual location, being to our knowledge, the first one at this site. The fact of having a prior neoplasia posed additional difficulties in differential diagnosis. Histological findings with expression of a specific marker of FDC (in this case CD21) allowed us to establish an accurate diagnosis.

  18. Cell sorting using efficient light shaping approaches

    NASA Astrophysics Data System (ADS)

    Bañas, Andrew; Palima, Darwin; Villangca, Mark; Glückstad, Jesper

    2016-03-01

    Early detection of diseases can save lives. Hence, there is emphasis in sorting rare disease-indicating cells within small dilute quantities such as in the confines of lab-on-a-chip devices. In our work, we use optical forces to isolate red blood cells detected by machine vision. This approach is gentler, less invasive and more economical compared to conventional FACS systems. As cells are less responsive to plastic or glass beads commonly used in the optical manipulation literature, and since laser safety would be an issue in clinical use, we develop efficient approaches in utilizing lasers and light modulation devices. The Generalized Phase Contrast (GPC) method that can be used for efficiently illuminating spatial light modulators or creating well-defined contiguous optical traps is supplemented by diffractive techniques capable of integrating the available light and creating 2D or 3D beam distributions aimed at the positions of the detected cells. Furthermore, the beam shaping freedom provided by GPC can allow optimizations in the beam's propagation and its interaction with the catapulted cells.

  19. Cell-specific Expression of CYP2A5 in the Mouse Respiratory Tract: Effects of Olfactory Toxicants

    PubMed Central

    Piras, Elena; Franzén, Anna; Fernández, Estíbaliz L.; Bergström, Ulrika; Raffalli-Mathieu, Françoise; Lang, Matti; Brittebo, Eva B.

    2003-01-01

    We performed a detailed analysis of mouse cytochrome P450 2A5 (CYP2A5) expression by in situ hybridization (ISH) and immunohistochemistry (IHC) in the respiratory tissues of mice. The CYP2A5 mRNA and the corresponding protein co-localized at most sites and were predominantly detected in the olfactory region, with an expression in sustentacular cells, Bowman's gland, and duct cells. In the respiratory and transitional epithelium there was no or only weak expression. The nasolacrimal duct and the excretory ducts of nasal and salivary glands displayed expression, whereas no expression occurred in the acini. There was decreasing expression along the epithelial linings of the trachea and lower respiratory tract, whereas no expression occurred in the alveoli. The hepatic CYP2A5 inducers pyrazole and phenobarbital neither changed the CYP2A5 expression pattern nor damaged the olfactory mucosa. In contrast, the olfactory toxicants dichlobenil and methimazole induced characteristic changes. The damaged Bowman's glands displayed no expression, whereas the damaged epithelium expressed the enzyme. The CYP2A5 expression pattern is in accordance with previously reported localization of protein and DNA adducts and the toxicity of some CYP2A5 substrates. This suggests that CYP2A5 is an important determinant for the susceptibility of the nasal and respiratory epithelia to protoxicants and procarcinogens. PMID:14566026

  20. Clinical management of small-cell carcinoma of the urinary tract: a 10-year single-center's experience.

    PubMed

    Carranza, Omar E; Castañón, Eduardo; Abella, Luis E; Zudaire, María E; Castillo, Ainhoa; Arévalo, Estefanía; Fusco, Juan P; Zudaire, Juan J; Carías, Rafael; Cambeiro, Mauricio; Martínez-Monge, Rafael; Gil-Bazo, Ignacio

    2013-06-01

    Small-cell carcinoma (SCC) comprises 1% of primary bladder tumors and approximately 2% of prostate neoplasms. Metastatic disease at diagnosis is common, and survival outcomes are extremely poor. There is controversy about the ideal clinical management of these patients. The neuron-specific enolase (NSE) serum levels have never been studied in patients with small-cell carcinoma of the urinary tract (SCCUT). We report the clinical outcome of 12 consecutive SCCUT patients treated during the past 10 years. We also study the NSE levels at diagnosis and during treatment. Patients with limited disease (LD) experienced a non-significant longer progression-free survival (PFS) and overall survival (OS) compared with extensive disease (ED) subjects. Patients with bladder SCC showed a significantly higher median PFS compared with prostate SCCUT patients (22 vs. 6 months; P = .034), although that difference did not impact on a significant longer OS. NSE levels decreased during chemotherapy administration in all patients with ED and baseline high levels. Our patients showed a poor prognosis as described in previous studies. A better outcome for patients with bladder SCC compared with prostate SCC could be suggested. Serum NSE levels should be further evaluated to prove its potential use in early diagnosis and treatment monitoring during chemotherapy. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Combined small cell carcinoma of the sinonasal tract associated with syndrome of inappropriate secretion of antidiuretic hormone: A case report

    PubMed Central

    KAYAKABE, MIKIKO; TAKAHASHI, KATSUMASA; OKAMIYA, TOMOFUMI; SEGAWA, ATSUKI; OYAMA, TETSUNARI; CHIKAMATSU, KAZUAKI

    2014-01-01

    Combined small cell carcinoma (SmCC) and squamous cell carcinoma (SqCC) is a rare malignant neoplasm in the head and neck. This study presents the first reported case of combined SmCC and SqCC originating from the sinonasal tract accompanied by syndrome of inappropriate secretion of antidiuretic hormone (SIADH). An 80-year-old female presented with a four-week history of right nasal discharge, nasal obstruction and left neck swelling. Imaging studies revealed a tumorous lesion in the maxillary sinus encroaching upon the right nasal cavity and left cervical lymph node (LN) swelling. An incisional biopsy carried out from the right maxillary sinus and LNs resulted in a diagnosis of combined SmCC with SqCC, staged as T4aN2cM0. Clinical examination revealed a sustained increase of antidiuretic hormone, hyponatremia with urinary sodium increase, and serum hypo-osmosis, resulting in SIADH. Water restriction to <1,000 ml/day was effective in improving sodium and osmotic imbalance. Curative treatment for the tumor was not prescribed due to the poor condition of the patient. Palliative treatment was administered and the patient succumbed to cachexia five months after histological diagnosis. The presence of SIADH may have marked implications for the treatment and prognosis of this disease. PMID:24944702

  2. Recruitment of phagocytizing cells into the respiratory tract as a response to the cytotoxic action of deposited particles

    SciTech Connect

    Katsnelson, B.A.; Privalova, L.I.

    1984-01-01

    Recruitment of phagocytizing cells into the lower respiratory tract plays a very important role in the pulmonary dust clearance, depending both on the number of particles deposited therein and on their aggressiveness. The higher cytotoxicity of the particles, the greater the number of such cells recruited and the higher the contribution of the neutrophilic leukocytes (NL) into the free cellular population of airways which normally is represented chiefly by alveolar macrophages (AM). Adaptation of the alveolar dust phagocytosis to properties of inhaled particles operates through autoregulation of this process in which a key role is played by macrophage breakdown products (PMB). A series of experiments in vitro and in vivo showed that PMB stimulate AM and NL, enhance their recruitment into airways with a dose-dependent increase of the NL/AM ratio, promote recruitment of their precursors via blood and replenishment of such precursor reserves. The most active factor of the PMB appears to be lipidic by nature. The variability between individuals and between groups of alveolar phagocytosis response to particles of a given cytotoxicity may be due to differences of the host's neurohormonal status. It was shown that influencing the latter significantly shifts response to a standard dose of the PMB.

  3. Combined small cell carcinoma of the sinonasal tract associated with syndrome of inappropriate secretion of antidiuretic hormone: A case report.

    PubMed

    Kayakabe, Mikiko; Takahashi, Katsumasa; Okamiya, Tomofumi; Segawa, Atsuki; Oyama, Tetsunari; Chikamatsu, Kazuaki

    2014-04-01

    Combined small cell carcinoma (SmCC) and squamous cell carcinoma (SqCC) is a rare malignant neoplasm in the head and neck. This study presents the first reported case of combined SmCC and SqCC originating from the sinonasal tract accompanied by syndrome of inappropriate secretion of antidiuretic hormone (SIADH). An 80-year-old female presented with a four-week history of right nasal discharge, nasal obstruction and left neck swelling. Imaging studies revealed a tumorous lesion in the maxillary sinus encroaching upon the right nasal cavity and left cervical lymph node (LN) swelling. An incisional biopsy carried out from the right maxillary sinus and LNs resulted in a diagnosis of combined SmCC with SqCC, staged as T4aN2cM0. Clinical examination revealed a sustained increase of antidiuretic hormone, hyponatremia with urinary sodium increase, and serum hypo-osmosis, resulting in SIADH. Water restriction to <1,000 ml/day was effective in improving sodium and osmotic imbalance. Curative treatment for the tumor was not prescribed due to the poor condition of the patient. Palliative treatment was administered and the patient succumbed to cachexia five months after histological diagnosis. The presence of SIADH may have marked implications for the treatment and prognosis of this disease.

  4. The Role of Cell Surface Architecture of Lactobacilli in Host-Microbe Interactions in the Gastrointestinal Tract

    PubMed Central

    Altermann, Eric; Anderson, Rachel C.; McNabb, Warren C.; Moughan, Paul J.; Roy, Nicole C.

    2013-01-01

    Lactobacillus species can exert health promoting effects in the gastrointestinal tract (GIT) through many mechanisms, which include pathogen inhibition, maintenance of microbial balance, immunomodulation, and enhancement of the epithelial barrier function. Different species of the genus Lactobacillus can evoke different responses in the host, and not all strains of the same species can be considered beneficial. Strain variations may be related to diversity of the cell surface architecture of lactobacilli and the bacteria's ability to express certain surface components or secrete specific compounds in response to the host environment. Lactobacilli are known to modify their surface structures in response to stress factors such as bile and low pH, and these adaptations may help their survival in the face of harsh environmental conditions encountered in the GIT. In recent years, multiple cell surface-associated molecules have been implicated in the adherence of lactobacilli to the GIT lining, immunomodulation, and protective effects on intestinal epithelial barrier function. Identification of the relevant bacterial ligands and their host receptors is imperative for a better understanding of the mechanisms through which lactobacilli exert their beneficial effects on human health. PMID:23576850

  5. Microfluidic approach of Sickled Cell Anemia

    NASA Astrophysics Data System (ADS)

    Abkarian, Manouk; Loiseau, Etienne; Massiera, Gladys

    2012-11-01

    Sickle Cell Anemia is a disorder of the microcirculation caused by a genetic point mutation that produces an altered hemoglobin protein called HbS. HbS self-assembles reversibly into long rope like fibers inside the red blood cells. The resulting distorded sickled red blood cells are believed to block the smallest capillaries of the tissues producing anemia. Despite the large amount of work that provided a thorough understanding of HbS polymerization in bulk as well as in intact red blood cells at rest, no consequent cellular scale approaches of the study of polymerization and its link to the capillary obstruction have been proposed in microflow, although the problem of obstruction is in essence a circulatory problem. Here, we use microfluidic channels, designed to mimic physiological conditions (flow velocity, oxygen concentration, hematocrit...) of the microcirculation to carry out a biomimetic study at the cellular scale of sickled cell vaso-occlusion. We show that flow geometry, oxygen concentration, white blood cells and free hemoglobin S are essential in the formation of original cell aggregates which could play a role in the vaso-occlusion events.

  6. Effect of carbohydrates on adherence of Escherichica coli to human urinary tract epithelial cells.

    PubMed Central

    Schaeffer, A J; Amundsen, S K; Jones, J M

    1980-01-01

    Adherence of Escherichia coli cells to voided uroepithelial cells from healthy women was measured by use of [3H]uridine-labeled bacteria filtered through a polycarbonate membrane filter (5-micrometer pore size). At a concentration of 2.5% (wt/vol), D-mannose, D-mannitol, alpha-methyl-D-mannoside, and yeast mannan completely inhibited adherence of the bacteria to the epithelial cells. At this same concentration, D-fructose, D-lyxose, D-arabinose, and D-glyceraldehyde partially inhibited adherence. Reducing the concentration of D-mannose, or its derivatives, to between 1.0 and 0.1% resulted in partial inhibition in the adherence of the bacteria; a further reduction in the concentration to between 0.01 and 0.001% caused an enhancement of adherence up to 160% of the control level. Bacterial preincubation in 2.5% D-mannose for 1 min before epithelial cells were added completely inhibited adherence; similar treatment of the epithelial cells had no significant effect on subsequent adherence of the bacteria. Bacteria that were preincubated for 1 h with D-mannose at concentrations between 0.1 and 0.75% showed enhanced adherence. The inhibitory effect of D-mannose was decreased if bacterial adhesive ability, or cell receptivity, increased. A variety of other carbohydrates tested had no effect on the adherence of E. coli to the uroepithelial cells. These results suggest that adherence can be altered by interaction(s) between specific carbohydrate molecules and receptors on the bacterial surface. PMID:7002802

  7. Disheveled mediated planar cell polarity signaling is required in the second heart field lineage for outflow tract morphogenesis.

    PubMed

    Sinha, Tanvi; Wang, Bing; Evans, Sylvia; Wynshaw-Boris, Anthony; Wang, Jianbo

    2012-10-01

    Disheveled (Dvl) is a key regulator of both the canonical Wnt and the planar cell polarity (PCP) pathway. Previous genetic studies in mice indicated that outflow tract (OFT) formation requires Dvl1 and 2, but it was unclear which pathway was involved and whether Dvl1/2-mediated signaling was required in the second heart field (SHF) or the cardiac neural crest (CNC) lineage, both of which are critical for OFT development. In this study, we used Dvl1/2 null mice and a set of Dvl2 BAC transgenes that function in a pathway-specific fashion to demonstrate that Dvl1/2-mediated PCP signaling is essential for OFT formation. Lineage-specific gene-ablation further indicated that Dvl1/2 function is dispensable in the CNC, but required in the SHF for OFT lengthening to promote cardiac looping. Mutating the core PCP gene Vangl2 and non-canonical Wnt gene Wnt5a recapitulated the OFT morphogenesis defects observed in Dvl1/2 mutants. Consistent with genetic interaction studies suggesting that Wnt5a signals through the PCP pathway, Dvl1/2 and Wnt5a mutants display aberrant cell packing and defective actin polymerization and filopodia formation specifically in SHF cells in the caudal splanchnic mesoderm (SpM), where Wnt5a and Dvl2 are co-expressed specifically. Our results reveal a critical role of PCP signaling in the SHF during early OFT lengthening and cardiac looping and suggest that a Wnt5a→ Dvl PCP signaling cascade may regulate actin polymerization and protrusive cell behavior in the caudal SpM to promote SHF deployment, OFT lengthening and cardiac looping.

  8. Disheveled Mediated Planar Cell Polarity Signaling is Required in the Second Heart Field Lineage for Outflow Tract Morphogenesis

    PubMed Central

    Sinha, Tanvi; Wang, Bing; Evans, Sylvia; Wynshaw-Boris, Anthony; Wang, Jianbo

    2012-01-01

    Disheveled (Dvl) is a key regulator of both the canonical Wnt and the planar cell polarity (PCP) pathway. Previous genetic studies in mice indicated that outflow tract (OFT) formation requires Dvl1 and 2, but it was unclear which pathway was involved and whether Dvl1/2-mediated signaling was required in the second heart field (SHF) or the cardiac neural crest (CNC) lineage, both of which are critical for OFT development. In this study, we used Dvl1/2 null mice and a set of Dvl2 BAC transgenes that function in a pathway-specific fashion to demonstrate that Dvl1/2-mediated PCP signaling is essential for OFT formation. Lineage-specific gene ablation further indicated that Dvl1/2 function is dispensable in the CNC, but required in the SHF for OFT lengthening to promote cardiac looping. Mutating the core PCP gene Vangl2 and non-canonical Wnt gene Wnt5a recapitulated the OFT morphogenesis defects observed in Dvl1/2 mutants. Consistent with genetic interaction studies suggesting that Wnt5a signals through the PCP pathway, Dvl1/2 and Wnt5a mutants display aberrant cell packing and defective actin polymerization and filopodia formation specifically in SHF cells in the caudal splanchnic mesoderm (SpM), where Wnt5a and Dvl2 are co-expressed specifically. Our results reveal a critical role of PCP signaling in the SHF during early OFT lengthening and cardiac looping and suggest that a Wnt5a→ Dvl PCP signaling cascade may regulate actin polymerization and protrusive cell behavior in the caudal SpM to promote SHF deployment, OFT lengthening and cardiac looping. PMID:22841628

  9. CD4+ T cell expression of MyD88 is essential for normal resolution of Chlamydia muridarum genital tract infection1

    PubMed Central

    Frazer, Lauren C.; Sullivan, Jeanne E.; Zurenski, Matthew A.; Mintus, Margaret; Tomasak, Tammy E.; Prantner, Daniel; Nagarajan, Uma M.; Darville, Toni

    2013-01-01

    Resolution of Chlamydia genital tract infection is delayed in the absence of MyD88. In these studies, we first used bone marrow chimeras to demonstrate a requirement for MyD88 expression by hematopoietic cells in the presence of a wild-type epithelium. Using mixed bone marrow chimeras we then determined that MyD88 expression was specifically required in the adaptive immune compartment. Furthermore, adoptive transfer experiments revealed that CD4+ T cell expression of MyD88 was necessary for normal resolution of genital tract infection. This requirement was associated with a reduced ability of MyD88−/− CD4+ T cells to accumulate in the draining lymph nodes and genital tract when exposed to the same inflammatory milieu as wild-type CD4+ T cells. We also demonstrated that the impaired infection control we observed in the absence of MyD88 could not be recapitulated by deficiencies in TLR or IL-1R signaling. In vitro, we detected an increased frequency of apoptotic MyD88−/− CD4+ T cells upon activation in the absence of exogenous ligands for receptors upstream of MyD88. These data reveal an intrinsic requirement for MyD88 in CD4+ T cells during Chlamydia infection and indicate that the importance of MyD88 extends beyond innate immune responses by directly influencing adaptive immunity. PMID:24038087

  10. CD4+ T cell expression of MyD88 is essential for normal resolution of Chlamydia muridarum genital tract infection.

    PubMed

    Frazer, Lauren C; Sullivan, Jeanne E; Zurenski, Matthew A; Mintus, Margaret; Tomasak, Tammy E; Prantner, Daniel; Nagarajan, Uma M; Darville, Toni

    2013-10-15

    Resolution of Chlamydia genital tract infection is delayed in the absence of MyD88. In these studies, we first used bone marrow chimeras to demonstrate a requirement for MyD88 expression by hematopoietic cells in the presence of a wild-type epithelium. Using mixed bone marrow chimeras we then determined that MyD88 expression was specifically required in the adaptive immune compartment. Furthermore, adoptive transfer experiments revealed that CD4(+) T cell expression of MyD88 was necessary for normal resolution of genital tract infection. This requirement was associated with a reduced ability of MyD88(-/-)CD4(+) T cells to accumulate in the draining lymph nodes and genital tract when exposed to the same inflammatory milieu as wild-type CD4(+) T cells. We also demonstrated that the impaired infection control we observed in the absence of MyD88 could not be recapitulated by deficiencies in TLR or IL-1R signaling. In vitro, we detected an increased frequency of apoptotic MyD88(-/-)CD4(+) T cells upon activation in the absence of exogenous ligands for receptors upstream of MyD88. These data reveal an intrinsic requirement for MyD88 in CD4(+) T cells during Chlamydia infection and indicate that the importance of MyD88 extends beyond innate immune responses by directly influencing adaptive immunity.

  11. Memory B cell compartment constitution and susceptibility to recurrent lower respiratory tract infections in young children.

    PubMed

    Siebert, Johan N; L'huillier, Arnaud G; Grillet, Stéphane; Delhumeau, Cécile; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2013-06-01

    A proportion of children have recurrent LRTIs, mostly as a result of Spn, which persist after 2 years of age. Here, we investigate, by flow cytofluorometry, the constitution of the memory B cell compartment in 90 healthy children and 49 children with recurrent LRTIs to determine if an increased susceptibility to recurrent LRTIs results from a delayed or abnormal ontogeny with poor antibody-mediated protection. Total IgA, IgM, IgG, and IgG subclasses were measured by nephelometry, as well as antipneumococcal antibodies by ELISA. Pneumococcal vaccination status was obtained. We show that the memory B cells increase between birth and 2 years of age (1.6% vs. 21.1%, P<0.001) without further significant increase noted per additional years (3-4 years old: 23.3%; 4-5 years old: 22.2%, P>0.40) to reach adult-like values (31.8±11.8%, P=0.08). Proportions of switched and IgM memory B cells were similar in children and adults. Comparatively, LRTI children had no delay in the constitution of their memory B cell compartment (2-3 years old: 26.9%; 3-4 years old: 18.2%; 4-5 years old: 26.8%, P>0.05). Their switched and IgM memory B cells were similar among age categories, and the distribution was overall similar to that of healthy controls. LRTI children had normal total and pneumococcal serotype-specific antibody values but showed a rapid waning of antipneumococcal antibody levels after vaccination. In summary, our results show that the memory B cell compartment is already similarly constituted at 2 years of age in healthy and LRTI children and thus, cannot explain the increased susceptibility to bacterial pneumonia. However, the waning of antibodies might predispose children to recurrent infections in the absence of revaccination.

  12. Characteristics and Quantities of HIV Host Cells in Human Genital Tract Secretions

    PubMed Central

    Politch, Joseph A.; Marathe, Jai; Anderson, Deborah J.

    2014-01-01

    Human immunodeficiency virus (HIV)–infected leukocytes have been detected in genital secretions from HIV-infected men and women and may play an important role in the sexual transmission of HIV. However, they have been largely overlooked in studies on mechanisms of HIV transmission and in the design and testing of HIV vaccine and microbicide candidates. This article describes the characteristics and quantities of leukocytes in male and female genital secretions under various conditions and also reviews evidence for the involvement of HIV-infected cells in both horizontal and vertical cell-associated HIV transmission. Additional research is needed in this area to better target HIV prevention strategies. PMID:25414414

  13. Model for assessing radiation dose to epithelial cells of the human respiratory tract from radon progeny

    SciTech Connect

    Fisher, D.R.; Hui, T.E.; James, A.C.

    1990-07-01

    A computational model was developed to evaluate radiation doses to sensitive cells from exposure to radon progeny throughout human bronchial epithelium. The model incorporated current information on nasal and oral filtration efficiencies for unattached radon progeny, characteristics of bronchial deposition by diffusive and inertial processes, mucous clearance and possible transfer of radon progeny to the airway epithelium, locations of target nuclei of secretory and basal cells in different regions of the bronchial tree epithelium, and other features. The model is useful for evaluating absorbed doses to various populations of target cell nuclei, the associated microdosimetric probability densities in specific energy, and the likelihood that target nuclei are hit one or more times by alpha-particle tracks. The model was applied to extrapolating lung cancer risks observed in underground miners to the general population exposed to low-level radon progeny in indoor home environments. The effect of increasing exposure rates by one and two orders of magnitude in both environments was modeled to determine the frequency of radiation events in target cell nuclei. The implications of dosimetric modeling for lung cancer risk analysis were also examined. 28 refs., 5 figs., 5 tabs.

  14. Quantitative analysis of disturbed cell maturation in dysplastic lesions of the respiratory tract epithelium

    SciTech Connect

    Klein-Szanto, A.J.P.; Nettesheim, P.; Topping, D.C.; Olson, A.C.

    1980-01-01

    Autoradiographic patterns of (/sup 3/H)thymidine incorporation, nuclear/cytoplasmic ratios (N/C), and the percentage of dark epithelial cells were analyzed in a group of epithelial lesions induced by 7,12-dimethylbenz(a)anthracene (DMBA) in rat tracheal transplants. It was found that similar lesions of different age exhibit the same labeling indices (LIs), therefore the lesions of different age were subsequently pooled in the following groups and studied by high resolution light microscopic autoradiography: squamous metaplasia without or with only mild atypia, squamous metaplasia with moderate atypia, squamous metaplasia with severe atypia, carcinoma in situ, and microinvasive carcinoma. Normal tracheal and esophageal epithelia were also analyzed. Gradients of increasing N/C (nucleus-cytoplasm ratios) values could be observed as the lesions increased in severity, especially in the middle and surface layers (e.g., in the surface layer regular metaplasia N/C = 0.08, squamous metaplasia with moderate atypia N/C = 0.26, and carcinoma in situ N/C = 0.50). Dark cells were absent in the normal esophageal epithelium, were present in moderate numbers in the basal layer of regular squamous metaplasia (18%), and increased markedly in the atypical epithelial lesions (approximately 50% in the atypical squamous metaplasias and 70% in carcinoma in situ). In the suprabasal layer dark cells increased from 3% in squamous metaplasia with moderate atypia to 28% in metaplasia with severe atypia and 56% in carcinoma in situ. The results confirm in a quantitative fashion that disturbances of cell maturation and cell proliferation are key features of dysplastic lesions induced by chemical carcinogens, and suggest the use of objective parameters for evaluation and classification of preneoplastic alterations.

  15. Reserve stem cells: Differentiated cells reprogram to fuel repair, metaplasia, and neoplasia in the adult gastrointestinal tract.

    PubMed

    Mills, Jason C; Sansom, Owen J

    2015-07-14

    It has long been known that differentiated cells can switch fates, especially in vitro, but only recently has there been a critical mass of publications describing the mechanisms adult, postmitotic cells use in vivo to reverse their differentiation state. We propose that this sort of cellular reprogramming is a fundamental cellular process akin to apoptosis or mitosis. Because reprogramming can invoke regenerative cells from mature cells, it is critical to the long-term maintenance of tissues like the pancreas, which encounter large insults during adulthood but lack constitutively active adult stem cells to repair the damage. However, even in tissues with adult stem cells, like the stomach and intestine, reprogramming may allow mature cells to serve as reserve ("quiescent") stem cells when normal stem cells are compromised. We propose that the potential downside to reprogramming is that it increases risk for cancers that occur late in adulthood. Mature, long-lived cells may have years of exposure to mutagens. Mutations that affect the physiological function of differentiated, postmitotic cells may lead to apoptosis, but mutations in genes that govern proliferation might not be selected against. Hence, reprogramming with reentry into the cell cycle might unmask those mutations, causing an irreversible progenitor-like, proliferative state. We review recent evidence showing that reprogramming fuels irreversible metaplastic and precancerous proliferation in the stomach and pancreas. Finally, we illustrate how we think reprogrammed differentiated cells are likely candidates as cells of origin for cancers of the intestine.

  16. Reserve stem cells: Reprogramming of differentiated cells fuels repair, metaplasia, and neoplasia in the adult gastrointestinal tract

    PubMed Central

    Mills, Jason C.; Sansom, Owen J.

    2016-01-01

    It has long been known that differentiated cells can switch fates, especially in vitro, but only recently has there been a critical mass of publications describing the mechanisms adult, post-mitotic cells use in vivo to reverse their differentiation state. We propose that this sort of cellular reprogramming is a fundamental cellular process akin to apoptosis or mitosis. Because reprogramming can invoke regenerative cells from mature cells, it is critical to the longterm maintenance of tissues like the pancreas, which encounter large insults during adulthood but lack constitutively active adult stem cells to repair the damage. However, even in tissues with adult stem cells, like stomach and intestine, reprogramming may allow mature cells to serve as reserve (“quiescent”) stem cells when normal stem cells are compromised. We propose that the potential downside to reprogramming is that it increases risk for cancers that occur late in adulthood. Mature, long-lived cells may have years of exposure to mutagens. Mutations that affect the physiological function of differentiated, post-mitotic cells may lead to apoptosis, but mutations in genes that govern proliferation might not be selected against. Hence, reprogramming with reentry into the cell cycle might unmask those mutations, causing an irreversible progenitor-like, proliferative state. We review recent evidence showing that reprogramming fuels irreversible metaplastic and precancerous proliferations in stomach and pancreas. Finally, we illustrate how we think reprogrammed differentiated cells are likely candidates as cells of origin for cancers of the intestine. PMID:26175494

  17. Non-transitional cell carcinoma of the upper urinary tract: A case series among 305 cases at a tertiary urology institute

    PubMed Central

    Elawdy, Mohamed Mohamed; Taha, Diaa-Eldin; Osman, Yasser; El-Hamid, Mohamed Abd; El-Mekresh, Mohsen

    2017-01-01

    Non-transitional cell carcinomas (non-TCC) of the upper urinary tract as squamous cell carcinoma (SCC), adenocarcinoma, and small cell carcinoma (SmCC) are rare with few case reports in the literature. We retrospectively reviewed our patients who surgically treated for upper tract urothelial carcinoma from 1983 to 2013 for non-TCC pathological cancer characteristics and survival. Among 305 patients, only 5 (1.6%) cases were found: One case of SmCC, another had adenocarcinoma, and 3 SCC cases. None of them had intravesical recurrence and the cancer-specific survival for non-TCC cohort is markedly decreased (log-rank = 0.01) compared to TCC patients. PMID:28216943

  18. Effect of oral N-acetylcysteine (NAC) on volume and albumin content of respiratory tract fluid but not on epithelial secretory cell number in "smoking" rats.

    PubMed

    Robinson, N; Brattsand, R; Dahlbäck, M

    1990-03-01

    This study was designed to look at the effect of N-acetylcysteine (NAC) on epithelial secretory cells and the respiratory tract fluid volume and albumin content from the lower airways of "bronchitic" rats. Rats were exposed either to tobacco smoke (TS), TS and NAC, or NAC alone. TS caused a significant increase in epithelial secretory cell number which was not reduced by concomitant NAC administration; NAC alone had no effect on cell numbers. TS increased respiratory tract fluid volume and albumin content by a small but non-significant amount, whereas TS and NAC increased the volume and albumin content by a greater and significant amount; NAC alone was also shown to significantly increase both fluid volume and albumin content.

  19. Challenges in structural approaches to cell modeling.

    PubMed

    Im, Wonpil; Liang, Jie; Olson, Arthur; Zhou, Huan-Xiang; Vajda, Sandor; Vakser, Ilya A

    2016-07-31

    Computational modeling is essential for structural characterization of biomolecular mechanisms across the broad spectrum of scales. Adequate understanding of biomolecular mechanisms inherently involves our ability to model them. Structural modeling of individual biomolecules and their interactions has been rapidly progressing. However, in terms of the broader picture, the focus is shifting toward larger systems, up to the level of a cell. Such modeling involves a more dynamic and realistic representation of the interactomes in vivo, in a crowded cellular environment, as well as membranes and membrane proteins, and other cellular components. Structural modeling of a cell complements computational approaches to cellular mechanisms based on differential equations, graph models, and other techniques to model biological networks, imaging data, etc. Structural modeling along with other computational and experimental approaches will provide a fundamental understanding of life at the molecular level and lead to important applications to biology and medicine. A cross section of diverse approaches presented in this review illustrates the developing shift from the structural modeling of individual molecules to that of cell biology. Studies in several related areas are covered: biological networks; automated construction of three-dimensional cell models using experimental data; modeling of protein complexes; prediction of non-specific and transient protein interactions; thermodynamic and kinetic effects of crowding; cellular membrane modeling; and modeling of chromosomes. The review presents an expert opinion on the current state-of-the-art in these various aspects of structural modeling in cellular biology, and the prospects of future developments in this emerging field. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. β-glucan Exposure on the Fungal Cell Wall Tightly Correlates with Competitive Fitness of Candida Species in the Mouse Gastrointestinal Tract.

    PubMed

    Sem, XiaoHui; Le, Giang T T; Tan, Alrina S M; Tso, Gloria; Yurieva, Marina; Liao, Webber W P; Lum, Josephine; Srinivasan, Kandhadayar G; Poidinger, Michael; Zolezzi, Francesca; Pavelka, Norman

    2016-01-01

    Candida albicans is responsible for ~400,000 systemic fungal infections annually, with an associated mortality rate of 46-75%. The human gastrointestinal (GI) tract represents the largest natural reservoir of Candida species and is a major source of systemic fungal infections. However, the factors that control GI colonization by Candida species are not completely understood. We hypothesized that the fungal cell wall would play an important role in determining the competitive fitness of Candida species in the mammalian GI tract. To test this hypothesis, we generated a systematic collection of isogenic C. albicans cell wall mutants and measured their fitness in the mouse GI tract via quantitative competition assays. Whereas a large variation in competitive fitness was found among mutants, no correlation was observed between GI fitness and total levels of individual cell wall components. Similar results were obtained in a set of distantly-related Candida species, suggesting that total amounts of individual cell wall components do not determine the ability of fungi to colonize the GI tract. We then subjected this collection of Candida strains and species to an extensive quantitative phenotypic profiling in search for features that might be responsible for their differences in GI fitness, but found no association with the ability to grow in GI-mimicking and stressful environments or with in vitro and in vivo virulence. The most significant association with GI fitness was found to be the strength of signaling through the Dectin-1 receptor. Using a quantitative assay to measure the amount of exposed β-glucan on the surface of fungal cells, we found this parameter, unlike total β-glucan levels, to be strongly predictive of competitive fitness in the mouse GI tract. These data suggest that fungal cell wall architecture, more so than its crude composition, critically determines the ability of fungi to colonize the mammalian GI tract. In particular, recognition of exposed

  1. β-glucan Exposure on the Fungal Cell Wall Tightly Correlates with Competitive Fitness of Candida Species in the Mouse Gastrointestinal Tract

    PubMed Central

    Sem, XiaoHui; Le, Giang T. T.; Tan, Alrina S. M.; Tso, Gloria; Yurieva, Marina; Liao, Webber W. P.; Lum, Josephine; Srinivasan, Kandhadayar G.; Poidinger, Michael; Zolezzi, Francesca; Pavelka, Norman

    2016-01-01

    Candida albicans is responsible for ~400,000 systemic fungal infections annually, with an associated mortality rate of 46–75%. The human gastrointestinal (GI) tract represents the largest natural reservoir of Candida species and is a major source of systemic fungal infections. However, the factors that control GI colonization by Candida species are not completely understood. We hypothesized that the fungal cell wall would play an important role in determining the competitive fitness of Candida species in the mammalian GI tract. To test this hypothesis, we generated a systematic collection of isogenic C. albicans cell wall mutants and measured their fitness in the mouse GI tract via quantitative competition assays. Whereas a large variation in competitive fitness was found among mutants, no correlation was observed between GI fitness and total levels of individual cell wall components. Similar results were obtained in a set of distantly-related Candida species, suggesting that total amounts of individual cell wall components do not determine the ability of fungi to colonize the GI tract. We then subjected this collection of Candida strains and species to an extensive quantitative phenotypic profiling in search for features that might be responsible for their differences in GI fitness, but found no association with the ability to grow in GI-mimicking and stressful environments or with in vitro and in vivo virulence. The most significant association with GI fitness was found to be the strength of signaling through the Dectin-1 receptor. Using a quantitative assay to measure the amount of exposed β-glucan on the surface of fungal cells, we found this parameter, unlike total β-glucan levels, to be strongly predictive of competitive fitness in the mouse GI tract. These data suggest that fungal cell wall architecture, more so than its crude composition, critically determines the ability of fungi to colonize the mammalian GI tract. In particular, recognition of exposed

  2. [Sporadic upper urinary tract urothelial cell carcinomas: identification of interaction between toxic carcinogens and individuals genetic susceptibility].

    PubMed

    Colin, P; Koenig, P; Ballereau, C; Phé, V; Berthon, N; Villers, A; Biserte, J; Rouprêt, M

    2010-01-01

    Upper urinary tract urothelial cell carcinomas (UUT UCC) are rare sporadic tumors. Recent epidemiologic and molecular data have shown a singular susceptibility of UUT UCCs for specific risk factors. The main exogenic factors involved in UUT UCCs carcinogenesis remain tobacco and occupational exposure (aromatic amines, polycyclic hydrocarbures and chlored solvents). Enzymatic variants of detoxification system may be responsible of carcinogenesis with these toxics. Tumors induced by phenacetine consumption are decreasing since it was banned in the 1970s. Also, acid aristolochic exposure (Balkan nephropathy, Chinese Herb nephropathy) has been demonstrated to specifically induce UUT UCCs. Familial genic polymorphism of detoxification system would explain geographic distribution in endemic areas. In Taiwan, chronic arsenic exposition would constitute the main risk factor of UUT UCC. However, theses mechanisms of carcinogenesis remain unclear. The knowledge of UUT UCC development mechanisms implying toxic detoxification systems is still incomplete. To date, there is a growing body of evidence supporting that the interaction between individual genetic susceptibilities and environmental toxic exposure is a key to explain carcinogenesis in the majority of sporadic UUT UCC occurrence.

  3. Recombinant adeno-associated virus-mediated global anterograde delivery of glial cell line-derived neurotrophic factor to the spinal cord: comparison of rubrospinal and corticospinal tracts in the rat.

    PubMed

    Foust, Kevin D; Flotte, Terence R; Reier, Paul J; Mandel, Ronald J

    2008-01-01

    Amyotrophic lateral sclerosis (ALS) is characterized by progressive loss of spinal lower motoneurons. Gene delivery is a promising strategy to deliver therapeutic molecules to these vulnerable cells. However, definition of an optimal route of delivery capable of accessing neurons over a considerable extent of the neuraxis represents a significant logistical problem. Intramuscular vector injections are not ideal as this approach would involve hundreds of injections to completely treat an ALS patient and also would be dependent on retrograde transport of the viral platform of choice. Alternatively, upper motoneurons could deliver trophic factors over considerable distances by anterograde transport after a relatively localized intracerebral injection. To test this approach, the present study was designed to compare the corticospinal (CST) and rubrospinal (RST) tracts for their ability to transport recombinant adeno-associated virus serotype 5 (rAAV5)-derived green fluorescent protein (GFP) or glial cell line-derived neurotrophic factor (GDNF) to the spinal cord. Unilateral injections of rAAV5-GFP into the red nucleus (RN) or motor cortex of normal rats produced GFP-positive fibers in the appropriate descending tracts extending to the lumbar spinal cord. For both tracts, GFP-positive axonal projections into the spinal gray matter were consistently observed. GDNF immunohistochemistry demonstrated that confirmed RN injections resulted in GDNF-positive fibers projecting into spinal gray matter as seen in the GFP group. In contrast, confirmed cortical rAAV5-GDNF injections resulted in less evident staining in spinal cord. Spinal cord GDNF levels were elevated at distances up to 72 mm from the injection sites, and confirmed that RST-related GDNF transport to spinal cord surpassed CST-associated delivery.

  4. Polypyrimidine Tract-Binding Protein 1 promotes proliferation, migration and invasion in clear-cell renal cell carcinoma by regulating alternative splicing of PKM

    PubMed Central

    Jiang, Junyi; Chen, Xu; Liu, Hao; Shao, Jing; Xie, Ruihui; Gu, Peng; Duan, Chaohui

    2017-01-01

    Polypyrimidine Tract-Binding Protein 1 (PTBP1) is an essential RNA-binding protein that regulates diverse biological events through regulating alternative splice of mRNA. PTBP1 induces cancer-promoting splice variants and is related to tumorigenesis in several cancers. However, both the expression patterns and biological mechanisms of PTBP1 in clear-cell renal cell carcinoma (ccRCC) are unclear. We investigated PTBP1 expression in 533 ccRCC patients from TCGA and 30 ccRCC patients by immunohistochemistry, and found that PTBP1 expression levels were significantly increased in ccRCC tissues and that high PTBP1 expression was closely correlated with advanced tumor stage, AJCC stage and poor prognosis. Cell biological assays with siRNA-mediated knockdown and lentivirus vector-mediated over-expression demonstrated that PTBP1 promoted proliferation, migration and invasion in ccRCC cells in vitro. Furthermore, PTBP1 increased the transformation from pyruvate kinase muscle 1 (PKM1) to PKM2. Knockdown of PKM2 mainly abolished PTBP1-induced proliferation, migration and invasion in ccRCC cells in vitro. In conclusion, our study indicates that PTBP1 plays a tumorigenic role in ccRCC by mediating PKM2 alternative splicing and it may be a potential prognostic marker and a promising target for treatment of ccRCC. PMID:28337374

  5. Cell and tissue polarity in the intestinal tract during tumourigenesis: cells still know the right way up, but tissue organization is lost.

    PubMed

    Fatehullah, Aliya; Appleton, Paul L; Näthke, Inke S

    2013-01-01

    Cell and tissue polarity are tightly coupled and are vital for normal tissue homeostasis. Changes in cellular and tissue organization are common to even early stages of disease, particularly cancer. The digestive tract is the site of the second most common cause of cancer deaths in the developed world. Tumours in this tissue arise in an epithelium that has a number of axes of cell and tissue polarity. Changes in cell and tissue polarity in response to genetic changes that are known to underpin disease progression provide clues about the link between molecular-, cellular- and tissue-based mechanisms that accompany cancer. Mutations in adenomatous polyposis coli (APC) are common to most colorectal cancers in humans and are sufficient to cause tumours in mouse intestine. Tissue organoids mimic many features of whole tissue and permit identifying changes at different times after inactivation of APC. Using gut organoids, we show that tissue polarity is lost very early during cancer progression, whereas cell polarity, at least apical-basal polarity, is maintained and changes only at later stages. These observations reflect the situation in tumours and validate tissue organoids as a useful system to investigate the relationship between cell polarity and tissue organization.

  6. Inflammatory cells and cellular activation in the lower respiratory tract in Churg-Strauss syndrome

    PubMed Central

    Schnabel, A.; Csernok, E.; Braun, J.; Gross, W.

    1999-01-01

    BACKGROUND—To obtain insight into the mechanisms of tissue injury in lung disease due to Churg-Strauss syndrome (CSS), the bronchoalveolar lavage (BAL) cell profile and the levels in the BAL fluid of cell products released by activated eosinophils and neutrophils were assessed.
METHODS—Thirteen patients with active progressive CSS (n = 7) or CSS in partial remission (n = 6) underwent clinical staging and bronchoalveolar lavage. The levels of eosinophil cationic protein (ECP), myeloperoxidase (MPO), and peroxidase activity in the BAL fluid were determined and the results were compared with those of 19 patients with pulmonary active Wegener's granulomatosis (WG) and nine control subjects.
RESULTS—In patients with progressive CSS the BAL cell profile was dominated by eosinophils, neutrophil elevation being the exception. The eosinophilia was associated with high ECP levels (4.39 ng/ml and 0.40 ng/ml in the two CSS groups compared with unmeasurable values in the controls). Individual patients with highly active CSS also had raised MPO levels, comparable to the levels in the most active WG patients. Peroxidase activity in the BAL fluid was 1.26 U/ml and 0.10 U/ml in the two groups of patients with CSS and 0.20 U/ml in the controls. Pulmonary disease in patients with WG was characterised by an extensive increase in MPO (0.30ng/ml versus 0.13 ng/ml in the controls) together with high peroxidase activity in the BAL fluid (4.37 U/ml), but only a small increase in ECP levels was seen. No correlation was found between the ECP and MPO levels in patients with CSS which suggests that eosinophil and neutrophil activation vary independently of each other.
CONCLUSIONS—These findings suggest that, in addition to eosinophil activation, neutrophil activation is an important feature in some patients with highly active CSS. The balance of neutrophil and eosinophil involvement appears to be variable and this may be one explanation for the individually variable treatment

  7. Mouse strain-dependent chemokine regulation of the genital tract T helper cell type 1 immune response.

    PubMed

    Darville, T; Andrews, C W; Sikes, J D; Fraley, P L; Braswell, L; Rank, R G

    2001-12-01

    Vaginal infection with the mouse pneumonitis agent of Chlamydia trachomatis (MoPn) produces shorter courses of infection in C57BL/6 and BALB/c mice than in C3H/HeN mice, while C57BL/6 mice are more resistant to oviduct pathology. A robust Th1 response is extremely important in host defense against chlamydia. In this study we examined gamma interferon (IFN-gamma), interleukin 10 (IL-10), and the T-cell-regulatory chemokines macrophage inflammatory protein-1alpha (MIP-1alpha) and monocyte chemoattractant protein-1 (MCP-1) to determine if differences in these responses were associated with the differential courses of infection seen in these three strains of mice. Increased and prolonged IFN-gamma responses and lower IL-10 responses were observed in the C57BL/6 strain compared to BALB/c and C3H. Examination of genital tract chemokines revealed a marked predominance of MIP-1alpha over MCP-1 only in the C57 strain. Thus, a pattern of high MIP-1alpha and low MCP-1 levels during the first week of infection is associated with an increased Th1 response and a shorter, more benign chlamydial infection. Inhibition of the MCP-1 response in C3H mice increased their later T-cell production of IFN-gamma but decreased their early IFN-gamma response and had no effect on the course or outcome of infection. Inhibition of MCP-1 is not beneficial in chlamydial infection because of its pleiotropic effects.

  8. Confocal Laser Endomicroscopy in the Management of Endoscopically Treated Upper Urinary Tract Transitional Cell Carcinoma: Preliminary Data.

    PubMed

    Villa, Luca; Cloutier, Jonathan; Cotè, Jean-Francois; Salonia, Andrea; Montorsi, Francesco; Traxer, Olivier

    2016-02-01

    To describe our initial experience with confocal laser endomicroscopy (CLE) for the evaluation and treatment of patients with upper urinary tract transitional cell carcinoma (UUT-TCC). Preliminary data were analyzed from 11 patients with suspicion of UUT-TCC scheduled for flexible ureteroscopy (f-URS) and consensual holmium-YAG laser tumor ablation. CLE was performed before endoscopic biopsy and laser photoablation of the suspected lesion using a 3F-diameter flexible probe UroFlex™ B (Cellvizio® system; Mauna Kea Technologies, Paris, France), which allows to obtain microscopic resolution imaging (3.5 μm), with a field of view of 325 μm and a depth of tissue imaging of 40 to 70 μm. Video sequences were analyzed offline and thereafter compared with histopathologic findings. CLE technique was feasible and showed good quality imaging in all patients. Overall, the Cellvizio system provided reliable images of healthy urothelium when the probe was pointed toward normal tissue, showing umbrella cells on the surface and vessels in the lamina propria. Moreover, CLE displayed the characteristic features of high-density cellular aggregates and fibrovascular stalks in four patients with pathologically confirmed low-grade UUT-TCC. In the patient with pathologically confirmed high-grade UUT-TCC, more distorted microarchitecture and tortuous vessels were clearly recognized with CLE. These preliminary data showed the feasibility of CLE technique when applied to the diagnosis of UUT-TCC. Further clinical studies are required to confirm CLE accuracy in distinguishing healthy urothelial tissue from malignant lesions, thus helping clinicians in targeting ureteroscopic biopsy and improving the conservative management of UUT-TCC patients.

  9. Urinary tract infection in older adults.

    PubMed

    Rowe, Theresa A; Juthani-Mehta, Manisha

    2013-10-01

    Urinary tract infection and asymptomatic bacteriuria are common in older adults. Unlike in younger adults, distinguishing symptomatic urinary tract infection from asymptomatic bacteriuria is problematic, as older adults, particularly those living in long-term care facilities, are less likely to present with localized genitourinary symptoms. Consensus guidelines have been published to assist clinicians with diagnosis and treatment of urinary tract infection; however, a single evidence-based approach to diagnosis of urinary tract infection does not exist. In the absence of a gold standard definition of urinary tract infection that clinicians agree upon, overtreatment with antibiotics for suspected urinary tract infection remains a significant problem, and leads to a variety of negative consequences including the development of multidrug-resistant organisms. Future studies improving the diagnostic accuracy of urinary tract infections are needed. This review will cover the prevalence, diagnosis and diagnostic challenges, management, and prevention of urinary tract infection and asymptomatic bacteriuria in older adults.

  10. Urinary tract infection in older adults

    PubMed Central

    Rowe, Theresa A; Juthani-Mehta, Manisha

    2013-01-01

    Urinary tract infection and asymptomatic bacteriuria are common in older adults. Unlike in younger adults, distinguishing symptomatic urinary tract infection from asymptomatic bacteriuria is problematic, as older adults, particularly those living in long-term care facilities, are less likely to present with localized genitourinary symptoms. Consensus guidelines have been published to assist clinicians with diagnosis and treatment of urinary tract infection; however, a single evidence-based approach to diagnosis of urinary tract infection does not exist. In the absence of a gold standard definition of urinary tract infection that clinicians agree upon, overtreatment with antibiotics for suspected urinary tract infection remains a significant problem, and leads to a variety of negative consequences including the development of multidrug-resistant organisms. Future studies improving the diagnostic accuracy of urinary tract infections are needed. This review will cover the prevalence, diagnosis and diagnostic challenges, management, and prevention of urinary tract infection and asymptomatic bacteriuria in older adults. PMID:24391677

  11. Detection of KI WU and Merkel cell polyomavirus in respiratory tract of cystic fibrosis patients.

    PubMed

    Iaria, M; Caccuri, F; Apostoli, P; Giagulli, C; Pelucchi, F; Padoan, R F; Caruso, A; Fiorentini, S

    2015-06-01

    In the last few years, many reports have confirmed the presence of WU, KI and Merkel cell (MC) polyomaviruses (PyV) in respiratory samples wordwide, but their pathogenic role in patients with underlying conditions such as cystic fibrosis is still debated. To determine the prevalence of MCPyV, WUPyV and KIPyV, we conducted a 1-year-long microbiological testing of respiratory specimens from 93 patients with cystic fibrosis in Brescia, Italy. We detected PyV DNA in 94 out of 337 analysed specimens. KIPyV was the most common virus detected (12.1%), followed by WUPyV (8.9%) and MCPyV (6.8%). We found an intriguing association between the presence of MCPyV and the concurrent isolation of Pseudomonas aeruginosa, as well as with the patient status, classified as chronically colonized with P. aeruginosa. Our study adds perspective on the prevalence and the potential pathogenic role of PyV infections.

  12. Squamous cell carcinoma arising in a chronic osteomyelitic sinus tract in the peri-anal region involving pelvis: a rare occurrence.

    PubMed

    Karumbaiah, K P; Shruthi, M S; Ragavendran, V; Kariappa, T M

    2014-01-01

    Squamous cell carcinoma is a rare, but well documented complication of chronic osteomyelitis. Squamous cell carcinoma arising in a sinus tract following chronic osteomyelitis of the pelvic bone is a very rare occurrence. The patient presented with multiple draining sinuses and an ulcerative growth at the mouth of one of the sinuses in the peri-anal region. X-ray findings and sinogram showed de- struction of part of pubic bone. Biopsy from the growth confirmed a well differentiated squamous cell carcinoma. Therefore it is imperative that these lesions be biopsied for accurate diagnosis, adequate therapy and follow-up.

  13. Sublingual immunization with nonreplicating antigens induces antibody-forming cells and cytotoxic T cells in the female genital tract mucosa and protects against genital papillomavirus infection.

    PubMed

    Cuburu, Nicolas; Kweon, Mi-Na; Hervouet, Catherine; Cha, Hye-Ran; Pang, Yuk-Ying S; Holmgren, Jan; Stadler, Konrad; Schiller, John T; Anjuère, Fabienne; Czerkinsky, Cecil

    2009-12-15

    We have recently reported that the sublingual (s.l.) mucosa is an efficient site for inducing systemic and mucosal immune responses. In this study, the potential of s.l. immunization to induce remote Ab responses and CD8(+) cytotoxic responses in the female genital tract was examined in mice by using a nonreplicating Ag, OVA, and cholera toxin (CT) as an adjuvant. Sublingual administration of OVA and CT induced Ag-specific IgA and IgG Abs in blood and in cervicovaginal secretions. These responses were associated with large numbers of IgA Ab-secreting cells (ASCs) in the genital mucosa. Genital ASC responses were similar in magnitude and isotype distribution after s.l., intranasal, or vaginal immunization and were superior to those seen after intragastric immunization. Genital, but not blood or spleen, IgA ASC responses were inhibited by treatment with anti-CCL28 Abs, suggesting that the chemokine CCL28 plays a major role in the migration of IgA ASC progenitors to the reproductive tract mucosa. Furthermore, s.l. immunization with OVA induced OVA-specific effector CD8(+) cytolytic T cells in the genital mucosa, and these responses required coadministration of the CT adjuvant. Furthermore, s.l. administration of human papillomavirus virus-like particles with or without the CT adjuvant conferred protection against genital challenge with human papillomavirus pseudovirions. Taken together, these findings underscore the potential of s.l. immunization as an efficient vaccination strategy for inducing genital immune responses and should impact on the development of vaccines against sexually transmitted diseases.

  14. Fecal transplantation – the new, inexpensive, safe, and rapidly effective approach in the treatment of gastrointestinal tract diseases

    PubMed Central

    Oprita, R; Bratu, M; Oprita, B; Diaconescu, B

    2016-01-01

    Introduction. Fecal transplantation was shown to effectively reduce the reoccurrence in patients with refractory Clostridium difficile infection. New data suggest that fecal transplantation could also be efficient in other gastrointestinal diseases, for instance in inflammatory bowel disease, irritable bowel syndrome, but, there are also some data that could imply the efficacy outside the gastrointestinal tract. Fecal transplantation should be considered a unique agent, capable of treating severe diseases, with essentially no adverse reactions, presenting a cure rate of over 90%. Materials and methods. This prospective study included 33 patients, of whom 28 patients with recurrent or resistant Clostridium difficile infection, who failed to be treated with conventional therapy, which presupposed vancomycin administration and 5 patients with inflammatory bowel disease, more precisely with ulcerative colitis, refractory on biologic agents (infliximab and adalimumab). In most of the cases, fecal transplant was realized with the infusion of stool through colonoscopy. Results. Most of the patients from both groups (Clostridium difficile infection and Ulcerative Colitis) responded (31 patients) with a total relief of the symptoms, after 1 FMT for Clostridium difficile group and after more than one for the ulcerative colitis group. The so-called primary cure rate was 96.42% for Clostridium group. For ulcerative colitis, group 3 of the patients needed 3 or 4 infusions for symptom relief. One patient was categorized as non-responsive (patient with UC) and needed surgery. Due to non-fecal transplant related causes, one death was reported. Conclusions. Fecal transplant is highly effective, safe, with practically no adverse effects, inexpensive, a procedure easy to be done that could be introduced in Clostridium difficile treatment protocols. As for ulcerative colitis treatment with FMT, future randomized controlled trials are needed to prove its efficiency. PMID:27453747

  15. Trans-cinnamaldehyde decreases attachment and invasion of uropathogenic Escherichia coli in urinary tract epithelial cells by modulating virulence gene expression.

    PubMed

    Amalaradjou, Mary Anne Roshni; Narayanan, Amoolya; Venkitanarayanan, Kumar

    2011-04-01

    Uropathogenic Escherichia coli is the primary bacterium causing urinary tract infection in humans. Attachment and invasion of urinary tract epithelial cells by UPEC is the first critical step in establishing a successful urinary tract infection. We investigated the efficacy of subinhibitory concentrations of trans-cinnamaldehyde to inhibit uropathogenic E. coli attachment and invasion of human uroepithelial cells. We also determined the trans-cinnamaldehyde effect on uropathogenic E. coli genes encoding virulence factors critical for uroepithelial cell bacterial attachment and invasion. Polystyrene 24-well plates seeded with uroepithelial cells were inoculated with uropathogenic E. coli (about 6.0 log cfu) and subinhibitory concentrations of trans-cinnamaldehyde (0, 325, 560 and 750 μM), and incubated for 60 minutes at 37C. Uroepithelial cells were washed and lysed to enumerate adhered uropathogenic E. coli populations. For the invasion assay uroepithelial cells were treated with gentamicin after incubation and lysed to enumerate invaded uropathogenic E. coli. Also, the trans-cinnamaldehyde effect on uropathogenic E. coli genes encoding attachment and invasion associated virulence factors was determined by real-time quantitative polymerase chain reaction. Trans-cinnamaldehyde significantly decreased uroepithelial cell attachment and invasion by uropathogenic E. coli (p <0.05). Real-time quantitative polymerase chain reaction revealed that trans-cinnamaldehyde significantly decreased the expression of major genes involved in uropathogenic E. coli attachment and invasion of host tissue (p <0.05). The down-regulating effect of trans-cinnamaldehyde on these genes potentially translated into decreased ability of uropathogenic E. coli to attach and invade bladder cells. Trans-cinnamaldehyde may potentially be used as a safe, effective antimicrobial to control uropathogenic E. coli infection. Followup studies in animal models are warranted. Copyright © 2011 American

  16. Toll like receptor agonist imiquimod facilitates antigen-specific CD8+ T cell accumulation in the genital tract leading to tumor control through interferon-γ

    PubMed Central

    Soong, Ruey-Shyang; Song, Liwen; Trieu, Janson; Knoff, Jayne; He, Liangmei; Tsai, Ya-Chea; Huh, Warner; Chang, Yung-Nien; Cheng, Wen-Fang; Roden, Richard B.S.; Wu, T.-C.; Hung, Chien-Fu

    2014-01-01

    Purpose Imiquimod is a toll-like receptor 7 agonist utilized topically to manage genital warts and basal cell carcinoma. We examine the combination of topical imiquimod with intramuscular administration of CRT/E7, a therapeutic HPV vaccination that comprises a naked DNA vector expressing calreticulin fused to HPV16 E7. Experimental Design Using an orthotopic HPV16 E6/E7+ syngeneic tumor, TC-1, as a model of high-grade cervical/vaginal/vulvar intraepithelial neoplasia, we show that combining CRT/E7 vaccination with cervicovaginal deposition of imiquimod results in synergistic immune-mediated tumor clearance. Results Imiquimod induces cervicovaginal accumulation of activated E7-specific CD8+ T cells elicited by CRT/E7 vaccination. Recruitment was not dependent upon the specificity of the activated CD8+ T cells, but was significantly reduced in mice lacking the IFNγ receptor. Intravaginal imiquimod deposition induced upregulation of CXCL9 and CXCL10 mRNA expression in the genital tract. These chemokines are expressed upon IFNγ receptor activation and attract cells expressing their receptor, CXCR3. In this study, T cells attracted by imiquimod to the cervicovaginal tract expressed CXCR3 as well as the tissue resident memory T cell (Trm) marker CD49a, a mucosal homing integrin. Our results indicate that intramuscular CRT/E7 vaccination in conjunction with intravaginal imiquimod deposition recruits antigen-specific CXCR3+CD8+ T cells to the genital tract. Conclusions Our study has potential clinical relevance because imiquimod is FDA approved for condyloma accuminata and basal cell carcinoma and intramuscular vaccination with pNGVL4a-CRT/E7(detox) is currently undergoing clinical testing, suggesting potential for their synergistic action to induce strong antigen-specific Trm-mediated immune responses and antitumor effects in genital mucosa. PMID:24893628

  17. Primary Squamous Cell Carcinoma of the Upper Genital Tract: Utility of p16INK4a Expression and HPV DNA Status in its Differential Diagnosis from Extended Cervical Squamous Cell Carcinoma

    PubMed Central

    Yoo, Su Hyun; Son, Eun-Mi; Sung, Chang Okh

    2013-01-01

    Background Primary squamous cell carcinoma (SCC) of the upper genital tract, including the endometrium, fallopian tubes, and ovaries, is extremely rare. It must be distinguished from the mucosal extension of primary cervical SCC because determination of the primary tumor site is important for tumor staging. However, patients with SCC of the fallopian tubes or ovarian surface have often undergone prior hysterectomy with inadequate examination of the cervix, making it difficult to determine the primary site. Methods We compared histologic findings, p16INK4a expression, and human papillomavirus (HPV) DNA status in four patients with primary SCC of the upper genital tract and five patients with primary cervical SCC extending to the mucosa of the upper genital tract. Results All five SCCs of cervical origin showed strong expression of p16INK4a, whereas all four SCCs of the upper genital tract were negative, although one showed weak focal staining. Three of the five cervical SCCs were positive for HPV16 DNA, whereas all four primary SCCs of the upper genital tract were negative for HPV DNA. Conclusions Although a thorough histological examination is important, immunonegativity for p16INK4a and negative for HPV DNA may be useful adjuncts in determining primary SCCs of the upper genital tract. PMID:24421848

  18. The expression status and prognostic significance of programmed cell death 1 ligand 1 in gastrointestinal tract cancer: a systematic review and meta-analysis.

    PubMed

    Huang, Baohua; Chen, Lei; Bao, Cuixia; Sun, Chengming; Li, Jie; Wang, Lipeng; Zhang, Xia

    2015-01-01

    Programmed cell death 1 ligand 1 (PD-L1) expression has been observed in various malignancies. However, the association between PD-L1 expression and the survival of patients with gastrointestinal tract cancer remains controversial. Besides, the rate of PD-L1 positivity on tumor cells of digestive tract cancer is not clear. Thus, we performed a meta-analysis by incorporating all available evidence to evaluate the rate of PD-L1 positivity and the overall survival (OS) according to PD-L1 status in patients with gastrointestinal tract cancer. Electronic databases were searched for eligible literature. Hazard ratios (HRs) for OS with 95% confidence intervals (CIs) according to the expression status of PD-L1 evaluated by immunohistochemistry were extracted. The outcomes were synthesized based on a random-effects model. Fifteen studies (only nine reported OS) that involved 2,993 gastrointestinal tract cancer patients stratified by PD-L1 status were eligible for inclusion in our study. We found the PD-L1-positive expression rate was 0.495 (95% CI 0.415-0.576) if 10% was taken as the cut-off value. When the H-score method was used to evaluate PD-L1 expression, it showed that the PD-L1 positive rate was 0.639 (95% CI 0.490-0.765) if the cut-off value was <50, which was higher than when using >50 as the cut-off point (0.449, 95% CI 0.417-0.483). Additionally, PD-L1-positive gastrointestinal tract cancer patients were associated with significantly poorer OS when compared to negative ones (HR 1.61, 95% CI 1.10-2.35, P=0.014). Subgroup analysis presented similar significant results in patients with esophageal cancer (HR 2.56, 95% CI 1.55-4.21, P<0.001). The positive expression rate of PD-L1 was nearly 50% no matter which method for immunohistochemistry evaluation we chose. Additionally, positive PD-L1 expression status in tumor cells is a risk factor for prognosis of gastrointestinal tract cancer, especially esophageal cancer.

  19. Integrated meta-omic analyses of the gastrointestinal tract microbiome in patients undergoing allogeneic hematopoietic stem cell transplantation.

    PubMed

    Kaysen, Anne; Heintz-Buschart, Anna; Muller, Emilie E L; Narayanasamy, Shaman; Wampach, Linda; Laczny, Cédric C; Graf, Norbert; Simon, Arne; Franke, Katharina; Bittenbring, Jörg; Wilmes, Paul; Schneider, Jochen G

    2017-08-01

    In patients undergoing allogeneic hematopoietic stem cell transplantation (allo-HSCT), treatment-induced changes to the gastrointestinal tract (GIT) microbiome have been linked to adverse outcomes, most notably graft-versus-host disease (GvHD). However, it is presently unknown whether this relationship is causal or consequential. Here, we performed an integrated meta-omic analysis to probe deeper into the GIT microbiome changes during allo-HSCT and its accompanying treatments. We used 16S and 18S rRNA gene amplicon sequencing to resolve archaea, bacteria, and eukaryotes within the GIT microbiomes of 16 patients undergoing allo-HSCT for the treatment of hematologic malignancies. These results revealed a major shift in the GIT microbiome after allo-HSCT including a marked reduction in bacterial diversity, accompanied by only limited changes in eukaryotes and archaea. An integrated analysis of metagenomic and metatranscriptomic data was performed on samples collected from a patient before and after allo-HSCT for acute myeloid leukemia. This patient developed severe GvHD, leading to death 9 months after allo-HSCT. In addition to drastically decreased bacterial diversity, the post-treatment microbiome showed a higher overall number and higher expression levels of antibiotic resistance genes (ARGs). One specific Escherichia coli strain causing a paravertebral abscess was linked to GIT dysbiosis, suggesting loss of intestinal barrier integrity. The apparent selection for bacteria expressing ARGs suggests that prophylactic antibiotic administration may adversely affect the overall treatment outcome. We therefore assert that such analyses including information about the selection of pathogenic bacteria expressing ARGs may assist clinicians in "personalizing" regimens for individual patients to improve overall outcomes. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Immunophenotypic and Clinical Differences Between the Nasal and Extranasal Subtypes of Upper Aerodigestive Tract Natural Killer/T-Cell Lymphoma

    SciTech Connect

    Liu, Qing-Feng; Wang, Wei-Hu; Wang, Shu-Lian; Liu, Yue-Ping; Huang, Wen-Ting; Lu, Ning; Zhou, Li-Qiang; Ouyang, Han; Jin, Jing; Li, Ye-Xiong

    2014-03-15

    Purpose: To investigate, in a large cohort of patients, the immunophenotypic and clinical differences of nasal and extranasal extranodal nasal-type natural killer/T-cell lymphoma of the upper aerodigestive tract (UADT-NKTCL) and examine the relevance of the immunophenotype on the clinical behavior, prognosis, and treatment. Methods and Materials: A total of 231 patients with UADT-NKTCL were recruited. One hundred eighty-one patients had primary location in the nasal cavity (nasal UADT-NKTCL), and 50 patients had primary extranasal UADT-NKTCL. Results: Patients with extranasal UADT-NKTCL had more adverse clinical features, including advanced-stage disease, regional lymph node involvement, B symptoms, and poor performance status, than patients with nasal UADT-NKTCL. In addition, CD56 and granzyme B were less frequently expressed in extranasal UADT-NKTCL. The 5-year overall survival rate was 74.1% for the entire group and 76.0% for early-stage disease. The 5-year overall survival rate for extranasal UADT-NKTCL was similar or superior to that of nasal UADT-NKTCL for all disease stages (76.9% vs 73.4%, P=.465), stage I disease (75.9% vs 79.2%, P=.786), and stage II disease (83.3% vs 50.3%, P=.018). CD56 expression and a Ki-67 proliferation rate ≥50% predicted poorer survival for extranasal UADT-NKTCL but not for nasal UADT-NKTCL. Conclusions: Patients with nasal and extranasal UADT-NKTCL have significantly different clinical features, immunophenotypes, and prognosis. Extranasal UADT-NKTCL should be considered as a distinct subgroup apart from the most commonly diagnosed prototype of nasal UADT-NKTCL.

  1. Independent levels of cell-free and cell-associated human immunodeficiency virus-1 in genital-tract secretions of clinically asymptomatic, treatment-naive African women.

    PubMed

    Andréoletti, Laurent; Chomont, Nicolas; Grésenguet, Gérard; Matta, Mathieu; de Dieu Longo, Jean; Carreno, Marie-Paule; Si-Mohamed, Ali; Legoff, Jérôme; Kazatchkine, Michel D; Bélec, Laurent

    2003-08-15

    Using ultrasensitive polymerase chain reaction-based techniques, we assessed levels of cell-free and cell-associated human immunodeficiency virus (HIV)-1 in paired blood and genital samples of 30 clinically asymptomatic, treatment-naive women. Levels of HIV-1 RNA in cervicovaginal-lavage samples were positively correlated with those in plasma samples (r=.50; P=.008), whereas levels of HIV-1 DNA in genital samples were loosely correlated with those in blood samples (r=.31; P=.041). In plasma of peripheral blood, levels of HIV-1 DNA were positively correlated with those of HIV-1 RNA (r=.64; P<.001), whereas no correlation between HIV-1 DNA and HIV-1 RNA was evident in genital secretions. Our results indicate that levels of HIV-1 RNA and HIV-1 DNA are unrelated in the genital tracts of treatment-naive women and suggest that the level of genital HIV-1 RNA is influenced by systemic viral replication-in contrast to genital HIV-1 provirus, which may be influenced as well by local cofactors triggering the migration of HIV-infected cells originating from the cervicovaginal submucosa. These features may be relevant for an understanding of HIV-1 transmission in heterosexual individuals.

  2. Bombesin receptor subtype-3 is expressed by the enteric nervous system and by interstitial cells of Cajal in the rat gastrointestinal tract.

    PubMed

    Porcher, Christophe; Juhem, Aurélie; Peinnequin, André; Bonaz, Bruno

    2005-04-01

    Bombesin receptor subtype-3 (BRS-3), a G-protein-coupled orphan receptor, shares 47% and 55% homology with other known mammalian bombesin receptors. Despite the molecular characterization of BRS-3, its function remains unclear as a consequence of its low affinity for bombesin and the absence of an identified natural ligand. Although the other mammalian bombesin receptors are widely distributed in the gut and central nervous system, expression of BRS-3 in the gastrointestinal tract has not been previously described. We report the expression of BRS-3 mRNA and protein in the tunica muscularis of the rat gastrointestinal tract. The mRNA expression pattern was studied by reverse transcription followed by quantitative polymerase chain reaction. To identify the cellular sites of expression of BRS-3, we performed immunocytochemistry by using a N-terminus-specific affinity-purified antiserum. BRS-3 was found to be widely expressed in the rat gastrointestinal tract at both the mRNA and protein levels. BRS-3-like immunoreactivity (BRS-3-LI) was localized in neurons of the myenteric and submucosal ganglia, being primarily concentrated near the neuronal plasma membrane, and in fibers distributed in the longitudinal and circular muscle layers. In addition, BRS-3-LI was observed in the cell bodies and processes of c-kit+ interstitial cells of Cajal. These data have functional applications for the effects mediated by the activation of BRS-3 on gut motility through distinct neuronal and non-neuronal pathways.

  3. Pancreatic Cancer Stem Cells and Therapeutic Approaches.

    PubMed

    Ercan, Gulinnaz; Karlitepe, Ayfer; Ozpolat, Bulent

    2017-06-01

    Pancreatic ductal adenocarcinoma (PDAC) is considered one of the deadliest human cancers, with 1-5% 5-year survival rates (~6-month median survival duration) despite therapy; thus, PDAC represents an unmet therapeutic challenge. PDAC is the major histological subtype, comprising 90% of all pancreatic cancers. It is a highly complex and aggressive malignancy, presenting with early local invasion and metastasis, and is resistant to most therapies, all of which are believed to contribute to its extremely poor prognosis. PDAC is characterized by molecular alterations, including mutations of K-RAS (~90% of cases), TP53, transforming growth factor-β, Hedgehog, WNT and NOTCH signaling pathways. Given that cancer stem cells have a crucial role not only in tumor initiation and progression, but also in drug resistance and relapse or recurrence of various cancer types, they may be excellent targets for effective novel therapeutic approaches. Here, we reviewed recent therapeutic strategies targeting pancreatic cancer stem cells using chemotherapeutics and targeted drugs, non-coding RNAs (i.e., siRNA and miRNAs), immunotherapy, and natural compounds. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  4. Molecular Cloning of Ghrelin and Characteristics of Ghrelin-Producing Cells in the Gastrointestinal Tract of the Common Marmoset (Callithrix jacchus).

    PubMed

    Takemi, Shota; Sakata, Ichiro; Apu, Auvijit Saha; Tsukahara, Shinji; Yahashi, Satowa; Katsuura, Goro; Iwashige, Fumihiro; Akune, Atsushi; Inui, Akio; Sakai, Takafumi

    2016-10-01

    Ghrelin was first isolated from human and rat as an endogenous ligand for the growth hormone secretagogue receptor (GHS-R). In the present study, we determined the ghrelin cDNA sequence of the common marmoset (Callithrix jacchus), a small-bodied New World monkey, and investigated the distribution of ghrelin-producing cells in the gastrointestinal tract and localization profiles with somatostatin-producing cells. The marmoset ghrelin cDNA coding region was 354 base pairs, and showed high homology to that in human, rhesus monkey, and mouse. Marmoset ghrelin consists of 28 amino acids, and the N-terminal region is highly conserved as found in other mammalian species. Marmoset preproghrelin and mature ghrelin have 86.3% and 92.9% homology, respectively, to their human counterparts. Quantitative RT-PCR analysis showed that marmoset ghrelin mRNA is highly expressed in the stomach, but it is not detected in other tissues of the gastrointestinal tract. In addition, a large number of ghrelin mRNA-expressing cells and ghrelin-immunopositive cells were detected in the mucosal layer of the stomach, but not in the myenteric plexus. Moreover, all the ghrelin cells examined in the stomach were observed to be closed-type. Double staining showed that somatostatin-immunopositive cells were not co-localized with ghrelin-producing cells; however, a subset of somatostatin-immunopositive cells is directly adjacent to ghrelin-immunopositive cells. These findings suggest that the distribution of ghrelin cells in marmoset differs from that in rodents, and thus the marmoset may be a more useful model for the translational study of ghrelin in primates. In conclusion, we have clarified the expression and cell distribution of ghrelin in marmoset, which may represent a useful model in translational study.

  5. Resting Respiratory Tract Dendritic Cells Preferentially Stimulate T Helper Cell Type 2 (Th2) Responses and Require Obligatory Cytokine Signals for Induction of  Th1 Immunity

    PubMed Central

    Stumbles, Philip A.; Thomas, Jennifer A.; Pimm, Carolyn L.; Lee, Peter T.; Venaille, Thierry J.; Proksch, Stephen; Holt, Patrick G.

    1998-01-01

    Consistent with their role in host defense, mature dendritic cells (DCs) from central lymphoid organs preferentially prime for T helper cell type 1 (Th1)-polarized immunity. However, the “default” T helper response at mucosal surfaces demonstrates Th2 polarity, which is reflected in the cytokine profiles of activated T cells from mucosal lymph nodes. This study on rat respiratory tract DCs (RTDCs) provides an explanation for this paradox. We demonstrate that freshly isolated RTDCs are functionally immature as defined in vitro, being surface major histocompatibility complex (MHC) II lo, endocytosishi, and mixed lymphocyte reactionlo, and these cells produce mRNA encoding interleukin (IL)-10. After ovalbumin (OVA)-pulsing and adoptive transfer, freshly isolated RTDCs preferentially stimulated Th2-dependent OVA-specific immunoglobulin (Ig)G1 responses, and antigen-stimulated splenocytes from recipient animals produced IL-4 in vitro. However, preculture with granulocyte/macrophage colony stimulating factor increased their in vivo IgG priming capacity by 2–3 logs, inducing production of both Th1- and Th2-dependent IgG subclasses and high levels of IFN-γ by antigen-stimulated splenocytes. Associated phenotypic changes included upregulation of surface MHC II and B7 expression and IL-12 p35 mRNA, and downregulation of endocytosis, MHC II processing– associated genes, and IL-10 mRNA expression. Full expression of IL-12 p40 required additional signals, such as tumor necrosis factor α or CD40 ligand. These results suggest that the observed Th2 polarity of the resting mucosal immune system may be an inherent property of the resident DC population, and furthermore that mobilization of Th1 immunity relies absolutely on the provision of appropriate microenvironmental costimuli. PMID:9841916

  6. Interval Biliary Stent Placement Via Percutaneous Ultrasound Guided Cholecystostomy: Another Approach to Palliative Treatment in Malignant Biliary Tract Obstruction

    SciTech Connect

    Harding, James Mortimer, Alex; Kelly, Michael; Loveday, Eric

    2010-12-15

    Percutaneous cholecystostomy is a minimally invasive procedure for providing gallbladder decompression, often in critically ill patients. It can be used in malignant biliary obstruction following failed endoscopic retrograde cholangiopancreatography when the intrahepatic ducts are not dilated or when stent insertion is not possible via the bile ducts. In properly selected patients, percutaneous cholecystostomy in obstructive jaundice is a simple, safe, and rapid option for biliary decompression, thus avoiding the morbidity and mortality involved with percutaneous transhepatic biliary stenting. Subsequent use of a percutaneous cholecystostomy for definitive biliary stent placement is an attractive concept and leaves patients with no external drain. To the best of our knowledge, it has only been described on three previous occasions in the published literature, on each occasion forced by surgical or technical considerations. Traditionally, anatomic/technical considerations and the risk of bile leak have precluded such an approach, but improvements in catheter design and manufacture may now make it more feasible. We report a case of successful interval metal stent placement via percutaneous cholecystostomy which was preplanned and achieved excellent palliation for the patient. The pros and cons of the procedure and approach are discussed.

  7. Nanomedicine Approaches to Modulate Neural Stem Cells in Brain Repair.

    PubMed

    Santos, Tiago; Boto, Carlos; Saraiva, Cláudia M; Bernardino, Liliana; Ferreira, Lino

    2016-06-01

    We explore the concept of modulating neural stem cells and their niches for brain repair using nanotechnology-based approaches. These approaches include stimulating cell proliferation, recruitment, and differentiation to functionally recover damaged areas. Nanoscale-engineered materials potentially overcome limited crossing of the blood-brain barrier, deficient drug delivery, and cell targeting. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. My Treatment Approach to Hairy Cell Leukemia

    PubMed Central

    Naik, Rahul R.; Saven, Alan

    2012-01-01

    Hairy cell leukemia (HCL) is a rare chronic lymphoproliferative disorder characterized by circulating B cells with cytoplasmic projections, pancytopenia, splenomegaly, and a typical flow cytometry pattern. Recently, the BRAF V600E mutation was uniformly identified in one HCL series, which may provide insights into the pathogenic mechanisms. The disease course is usually indolent but inexorably progressive. Patients require treatment when they have significant cytopenia or occasionally recurrent infections from immunocompromise. In the mid-1980s, interferon replaced splenectomy as the initial treatment. A few years later, 2 purine nucleoside analogs, cladribine and pentostatin, showed promising activity in HCL. Complete response rates approached 95% with cladribine given as a single 7-day intravenous infusion. Newer methods of cladribine administration and modified dosing schedules have since been studied. Pentostatin response rates are comparable. We generally prefer cladribine because of its ease of administration, single infusion schema, and favorable toxicity profile. Since the introduction of these drugs, which have never been randomly compared, long-term follow-up studies have confirmed impressive and durable response durations. However, roughly 40% of patients with HCL eventually relapse. In this setting, patients can be re-treated with purine analogs. Rituximab also has a reasonable response rate in relapsed HCL; it can be given as a single agent sequentially after purine nucleosides or concurrently. Immunotoxins have robust responses but remain in development. Targeting the BRAF pathway will be an exciting future area of research. Many patients have minimal residual disease after initial treatment, but the clinical significance of this remains unknown. PMID:22212971

  9. Imaging for approach selection of TAVI: assessment of the aorto-iliac tract diameter by computed tomography-angiography versus projection angiography.

    PubMed

    Wiegerinck, E M A; Marquering, H A; Oldenburger, N Y; Elattar, M A; Planken, R N; De Mol, B A J M; Piek, J J; Baan, J

    2014-02-01

    The choice of preferred access route for transcatheter aortic valve implantation (TAVI) is mainly guided by the minimal aorto-femoral tract diameter. Currently, projection angiography (XA) and CT-angiography (CTA) are used interchangeably to assess this diameter in the TAVI work-up. We aimed to assess the agreement of XA and CTA diameter measurements in TAVI candidates. Diameters of 700 aorta-iliac segments of 102 TAVI candidates were analyzed on both XA and CTA. The diameters on XA were measured manually, for the CTA-based analysis semi-automated segmentation software was used. Paired sample T test was used to evaluate differences in diameter measurements between the modalities. Disagreement on the suitability for a transfemoral (TF)-TAVI approach was identified. The interobserver agreement for both measurements was assessed by calculating the intraclass correlation coefficient (ICC). The average diameters were 10.1 ± 1.8 mm and 8.4 ± 1.7 for XA and CTA respectively. The mean paired difference was 1.73 mm (p < 0.001). For 18 patients (17.6 %) diameters measured on CTA images, were bilaterally less than 6 mm, whilst XA indicated a minimum diameter exceeding 6 mm. For both modalities, the interobserver agreement was excellent (ICC 0.95). Diameters measured semi-automatically on CTA were statistically significantly smaller compared to XA. This should be acknowledged in the work-up for selecting the most appropriate approach for TAVI. In our population 17.6 % of patients would have been denied a transfemoral TAVI based on CTA measurements, whilst XA suggested diameters sufficient for a TF approach.

  10. A chicken influenza virus recognizes fucosylated α2,3 sialoglycan receptors on the epithelial cells lining upper respiratory tracts of chickens.

    PubMed

    Hiono, Takahiro; Okamatsu, Masatoshi; Nishihara, Shoko; Takase-Yoden, Sayaka; Sakoda, Yoshihiro; Kida, Hiroshi

    2014-05-01

    Influenza viruses recognize sialoglycans as receptors. Although viruses isolated form chickens preferentially bind to sialic acid α2,3 galactose (SAα2,3Gal) glycans as do those of ducks, chickens were not experimentally infected with viruses isolated from ducks. A chicken influenza virus, A/chicken/Ibaraki/1/2005 (H5N2) (Ck/IBR) bound to fucose-branched SAα2,3Gal glycans, whereas the binding towards linear SAα2,3Gal glycans was weak. On the epithelial cells of the upper respiratory tracts of chickens, fucose-branched SAα2,3Gal glycans were detected, but not linear SAα2,3Gal glycans. The growth of Ck/IBR in MDCK-FUT cells, which were genetically prepared to express fucose-branched SAα2,3Gal glycans, was significantly higher than that in the parental MDCK cells. The present results indicate that fucose-branched SAα2,3Gal glycans existing on the epithelial cells lining the upper respiratory tracts of chickens are critical for recognition by Ck/IBR.

  11. Emerging molecular approaches in stem cell biology.

    PubMed

    Jaishankar, Amritha; Vrana, Kent

    2009-04-01

    Stem cells are characterized by their ability to self-renew and differentiate into multiple adult cell types. Although substantial progress has been made over the last decade in understanding stem cell biology, recent technological advances in molecular and systems biology may hold the key to unraveling the mystery behind stem cell self-renewal and plasticity. The most notable of these advances is the ability to generate induced pluripotent cells from somatic cells. In this review, we discuss our current understanding of molecular similarities and differences among various stem cell types. Moreover, we survey the current state of systems biology and forecast future needs and direction in the stem cell field.

  12. B cell and T cell immunity in the female genital tract: potential of distinct mucosal routes of vaccination and role of tissue-associated dendritic cells and natural killer cells.

    PubMed

    Anjuère, F; Bekri, S; Bihl, F; Braud, V M; Cuburu, N; Czerkinsky, C; Hervouet, C; Luci, C

    2012-10-01

    The female genital mucosa constitutes the major port of entry of sexually transmitted infections. Most genital microbial pathogens represent an enormous challenge for developing vaccines that can induce genital immunity that will prevent their transmission. It is now established that long-lasting protective immunity at mucosal surfaces has to involve local B-cell and T-cell effectors as well as local memory cells. Mucosal immunization constitutes an attractive way to generate systemic and genital B-cell and T-cell immune responses that can control early infection by sexually transmitted pathogens. Nevertheless, no mucosal vaccines against sexually transmitted infections are approved for human use. The mucosa-associated immune system is highly compartmentalized and the selection of any particular route or combinations of routes of immunization is critical when defining vaccine strategies against genital infections. Furthermore, mucosal surfaces are complex immunocompetent tissues that comprise antigen-presenting cells and also innate immune effectors and non-immune cells that can act as 'natural adjuvants' or negative immune modulators. The functions of these cells have to be taken into account when designing tissue-specific antigen-delivery systems and adjuvants. Here, we will discuss data that compare different mucosal routes of immunization to generate B-cell and T-cell responses in the genital tract, with a special emphasis on the newly described sublingual route of immunization. We will also summarize data on the understanding of the effector and induction mechanisms of genital immunity that may influence the development of vaccine strategies against genital infections. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

  13. Multiscale white matter fiber tract coregistration: a new feature-based approach to align diffusion tensor data.

    PubMed

    Leemans, A; Sijbers, J; De Backer, S; Vandervliet, E; Parizel, P

    2006-06-01

    In this paper an automatic multiscale feature-based rigid-body coregistration technique for diffusion tensor imaging (DTI) based on the local curvature kappa and torsion tau of the white matter (WM) fiber pathways is presented. As a similarity measure, the mean squared difference (MSD) of corresponding fiber pathways in (kappa, tau)-space is chosen. After the MSD is minimized along the arc length of the curve, principal component analysis is applied to calculate the transformation parameters. In addition, a scale-space representation of the space curves is incorporated, resulting in a multiscale robust coregistration technique. This fully automatic technique inherently allows one to apply region of interest (ROI) coregistration, and is adequate for performing both global and local transformations. Simulations were performed on synthetic DT data to evaluate the coregistration accuracy and precision. An in vivo coregistration example is presented and compared with a voxel-based coregistration approach, demonstrating the feasibility and advantages of the proposed technique to align DT data of the human brain.

  14. Behaviour of lactic acid bacteria populations in Pecorino di Carmasciano cheese samples submitted to environmental conditions prevailing in the gastrointestinal tract: evaluation by means of a polyphasic approach.

    PubMed

    Ricciardi, Annamaria; Blaiotta, Giuseppe; Di Cerbo, Alessandro; Succi, Mariantonietta; Aponte, Maria

    2014-06-02

    The survival of the autochthonous microflora, of samples collected during Pecorino di Carmasciano cheese manufacturing, was evaluated along the passage through a model mimicking the gastro-intestinal tract. The aim was the selection of lactic acid bacteria potentially able to arrive alive and metabolically active to the colon. The dynamics of lactic microbiota, throughout simulated digestion of cheese samples, were evaluated by means of an approach PCR-DGGE-based. Dominant species after cheese digestion could be related to the Lactobacillus plantarum and Lactobacillus casei groups. Sixty-three strains, which survived to simulated gastro-intestinal transit, were further evaluated for technological features and tolerance to human digestion in several experimental conditions, according to routinely used protocols. Bacterial survival appeared to be, more than strain-specific, strongly affected by experimental conditions, i.e. some strains showed an acceptable survival when resuspended in skim milk but not in ewe milk and vice versa. Nevertheless according to data, one gram of fresh Pecorino di Carmasciano cheese may convey to human colon about the same amount of viable LAB of a probiotic drink. Although it cannot be assumed that lactobacilli introduced with Pecorino have beneficial effects on the host, the healthy impact of autochthonous lactic acid bacteria of naturally fermented food has a broad consensus in the current literature. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. 3D-SSF: A bio-inspired approach for dynamic multi-subject clustering of white matter tracts.

    PubMed

    Chekir, A; Hassas, S; Descoteaux, M; Côté, M; Garyfallidis, E; Oulebsir-Boumghar, F

    2017-01-27

    There is growing interest in the study of white matter (WM) variation across subjects, and in particular the analysis of specific WM bundles, to better understand brain development and aging, as well as to improve early detection of some diseases. Several WM multi-subject clustering methods have been proposed to study WM bundles. These methods aim to overcome the complexity of the problem, which includes the huge size of the WM tractography datasets generated from multiple subjects, the existence of various streamlines with different positions, lengths and geometric forms, as well as the presence of outliers. However, the current methods are not sufficiently flexible to address all of these constraints. Here we introduce a novel dynamic multi-subject clustering framework based on a distributed multiagent implementation of the Multiple Species Flocking model, that we name 3D-Streamlines Stream Flocking (3D-SSF). Specifically, we consider streamlines from different subjects as data streams, and each streamline is assigned to a mobile agent. Agents work together following flocking rules in order to form a flock. Thanks to a similarity function, the agents that are associated with similar streamlines form a flock, whereas the agents that are associated with dissimilar streamlines are considered outliers. We use various experiments performed on noisy synthetic and real human brain data to validate 3D-SSF and demonstrate that it is more efficient and robust to outliers compared to other classical approaches. 3D-SSF is able to extract WM bundles at a population level, while considering WM variation across subjects and eliminating outlier streamlines.

  16. Diminished CD103 (αEβ7) Expression on Resident T Cells from the Female Genital Tract of HIV-Positive Women

    PubMed Central

    Moylan, David C.; Goepfert, Paul A.; Kempf, Mirjam-Colette; Saag, Michael S.; Richter, Holly E.; Mestecky, Jiri; Sabbaj, Steffanie

    2017-01-01

    Background Tissue resident memory T cells (TrM) provide an enhanced response against infection at mucosal surfaces, yet their function has not been extensively studied in humans, including the female genital tract (FGT). Methods Using polychromatic flow cytometry, we studied TrM cells, defined as CD62L−CCR7−CD103+CD69+ CD4+ and CD8+ T cells in mucosa-derived T cells from healthy and HIV-positive women. Results We demonstrate that TrM are present in the FGT of healthy and HIV-positive women. The expression of the mucosal retention receptor, CD103, from HIV-positive women was reduced compared to healthy women and was lowest in women with CD4 counts < 500 cells/mm3. Furthermore, CD103 expression on mucosa-derived CD8+ T cells correlated with antigen-specific IFN-γ production by mucosal CD4+ T cells and was inversely correlated with T-bet from CD8+CD103+ mucosa-derived T cells. Conclusions These data suggest that CD4+ T cells, known to be impaired during HIV-1 infection and necessary for the expression of CD103 in murine models, may play a role in the expression of CD103 on resident T cells from the human FGT. PMID:28164171

  17. Distribution, parabrachial region projection, and coexistence of neuropeptide and catecholamine cells of the nucleus of the solitary tract in the pigeon.

    PubMed

    Berk, M L; Smith, S E; Mullins, L A

    1993-01-15

    The chemical nature of the cells of the nucleus of the solitary tract (NTS) that project to the parabrachial nucleus (PB) was investigated in the pigeon by the use of fluorescent bead retrograde tracer and immunofluorescence for the detection of substance P (SP), leucine-enkephalin (LENK), cholecystokinin (CCK), neurotensin (NT), somatostatin (SS), and tyrosine hydroxylase (TH). Cells immunoreactive for CCK were located in subnuclei lateralis dorsalis pars anterior (LDa) and medialis superficialis pars posterior, and caudal NTS (cNTS); 22-26.5% of these cells were double-labeled bilaterally. Immunoreactive SP cells were found in ventral NTS subnuclei; 24-25% of these cells were double-labeled bilaterally. Cells immunoreactive for LENK and NT were concentrated in the anterior NTS; 5.5-7.5% of the LENK cells were double-labeled bilaterally, while 11% (ipsilateral) and 21% (contralateral) of the NT immunoreactive cells were double-labeled. Many SS immunoreactive cells were found in peripherally located subnuclei; 5.5-6.5% of these cells were double-labeled bilaterally. Catecholamine cells were distributed in LDa, peripheral subnuclei, and cNTS; 23% of these cells were double-labeled ipsilaterally and 8.5% contralaterally. A two-color double-labeling immunofluorescence technique revealed many cells immunoreactive for both NT and LENK, only a rare cell immunoreactive for both SS and SP, and no cells immunoreactive for both TH and SP. Cells immunoreactive for SP, CCK, NT, and TH are major contributors to NTS projections to PB. The confinement of these substances to specific NTS subnuclei, which receive visceral sensory information from specific organs, may contribute to the chemical encoding of ascending visceral information.

  18. Implementation of fiber tract navigation.

    PubMed

    Nimsky, Christopher; Ganslandt, Oliver; Fahlbusch, Rudolf

    2007-07-01

    To implement fiber tracking in a common neuronavigation environment for routine clinical use to visualize major white matter tracts intraoperatively. A single-shot, spin-echo diffusion weighted echo planar imaging sequence with six diffusion directions on a 1.5 T magnetic resonance scanner was used for diffusion tensor imaging. For three-dimensional (3-D) tractography, we applied a knowledge-based multiple volume of interest approach. Tracking was initiated in each voxel of the initial seed volume in retrograde and orthograde directions according to the direction of the major eigenvector by applying a tensor deflection algorithm. Tractography results were displayed as streamlines assigned direction encoding color. After selecting the fiber tract bundle of interest by defining inclusion and exclusion volumes, a 3-D object was generated automatically by wrapping the whole fiber tract bundle. This 3-D object was displayed along with other contours representing tumor outline and further functional data with the microscope heads-up display. In 16 patients (three cavernomas, 13 gliomas), major white matter tracts (pyramidal tract, n = 14; optic radiation, n = 2) were visualized intraoperatively with a standard navigation system. Three patients developed a postoperative paresis, which resolved in two in the postoperative course. Additional planning time for tractography amounted to up to 10 minutes. Comparing the tractography results with a fiber bundle generated on a different platform by applying a distortion-free sequence revealed a good congruency of the defined 3-D outlines in the area of interest. Fiber tract data can be reliably integrated into a standard neuronavigation system, allowing for intraoperative visualization and localization of major white matter tracts such as the pyramidal tract or optic radiation.

  19. Implementation of fiber tract navigation.

    PubMed

    Nimsky, Christopher; Ganslandt, Oliver; Fahlbusch, Rudolf

    2006-04-01

    To implement fiber tracking in a common neuronavigation environment for routine clinical use to visualize major white matter tracts intraoperatively. A single-shot, spin-echo diffusion weighted echo planar imaging sequence with six diffusion directions on a 1.5 T magnetic resonance scanner was used for diffusion tensor imaging. For three-dimensional (3-D) tractography, we applied a knowledge-based multiple volume of interest approach. Tracking was initiated in each voxel of the initial seed volume in retrograde and orthograde directions according to the direction of the major eigenvector by applying a tensor deflection algorithm. Tractography results were displayed as streamlines assigned direction encoding color. After selecting the fiber tract bundle of interest by defining inclusion and exclusion volumes, a 3-D object was generated automatically by wrapping the whole fiber tract bundle. This 3-D object was displayed along with other contours representing tumor outline and further functional data with the microscope heads-up display. In 16 patients (three cavernomas, 13 gliomas), major white matter tracts (pyramidal tract, n = 14; optic radiation, n = 2) were visualized intraoperatively with a standard navigation system. Three patients developed a postoperative paresis, which resolved in two in the postoperative course. Additional planning time for tractography amounted to up to 10 minutes. Comparing the tractography results with a fiber bundle generated on a different platform by applying a distortion-free sequence revealed a good congruency of the defined 3-D outlines in the area of interest. Fiber tract data can be reliably integrated into a standard neuronavigation system, allowing for intraoperative visualization and localization of major white matter tracts such as the pyramidal tract or optic radiation.

  20. Increases in Endogenous or Exogenous Progestins Promote Virus-Target Cell Interactions within the Non-human Primate Female Reproductive Tract

    PubMed Central

    Carias, Ann M.; Fought, Angela J.; Kotnik Halavaty, Katarina; Anderson, Meegan R.; Jimenez, Maria L.; McRaven, Michael D.; Gioia, Casey J.; Henning, Tara R.; Smith, James M.; Pereira, Lara E.; Butler, Katherine; McNicholl, S. Janet M.; Hendry, R. Michael; Hope, Thomas J.

    2016-01-01

    Currently, there are mounting data suggesting that HIV-1 acquisition in women can be affected by the use of certain hormonal contraceptives. However, in non-human primate models, endogenous or exogenous progestin-dominant states are shown to increase acquisition. To gain mechanistic insights into this increased acquisition, we studied how mucosal barrier function and CD4+ T-cell and CD68+ macrophage density and localization changed in the presence of natural progestins or after injection with high-dose DMPA. The presence of natural or injected progestins increased virus penetration of the columnar epithelium and the infiltration of susceptible cells into a thinned squamous epithelium of the vaginal vault, increasing the likelihood of potential virus interactions with target cells. These data suggest that increasing either endogenous or exogenous progestin can alter female reproductive tract barrier properties and provide plausible mechanisms for increased HIV-1 acquisition risk in the presence of increased progestin levels. PMID:27658293

  1. Characterization of obestatin- and ghrelin-producing cells in the gastrointestinal tract and pancreas of rats: an immunohistochemical and electron-microscopic study.

    PubMed

    Zhao, Chun-Mei; Furnes, Marianne W; Stenström, Björn; Kulseng, Bård; Chen, Duan

    2008-03-01

    Both ghrelin and obestatin are derived from preproghrelin by post-translational processing. We have morphologically characterized the cells that produce obestatin and ghrelin in new-born and adult Sprague-Dawley rats that were freely fed, fasted, or subjected to gastric bypass surgery or reserpine treatment. Tissue samples collected from the gastrointestinal tract and pancreas were examined by double-immunofluorescence staining, immunoelectron microscopy, and conventional electron microscopy. Obestatin was present in the stomach, duodenum, jejunum, colon, and pancreas. In the stomach, differences were noted in the development of obestatin- and preproghrelin-immunreactive (IR) cells on the one hand and ghrelin-IR cells on the other, particularly 2 weeks after birth. Preproghrelin- and obestatin-IR cells were more numerous than ghrelin-IR cells in the stomach, suggesting the lack of ghrelin in some A-like cells. Most obestatin-producing cells in the stomach were distributed in the basal part of the oxyntic mucosa; these cells co-localized with chromogranin A (pancreastatin) and vesicle monoamine transporters type 1 and 2, but not with serotonin or histidine decarboxylase. Immunoelectron microscopy revealed the obestatin- and ghrelin-producing cells to be A-like cells, characterized by numerous highly electron-dense granules containing ghrelin and obestatin. Some granules exhibited an even electron density with thin electron-lucent halos, suggestive of monoamines. Feeding status, gastric bypass surgery, and reserpine treatment had no obvious effect on the A-like cells. In the pancreas, obestatin was present in the peripheral part of the islets, with a distribution distinct from that of glucagon-producing A cells, insulin-producing beta cells, and cells producing pancreatic polypeptide Y. Thus, obestatin and ghrelin co-localize with an anticipated monoamine in A-like cells in the stomach, and obestatin is found in pancreatic islets.

  2. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system.

    PubMed

    Pelaseyed, Thaher; Bergström, Joakim H; Gustafsson, Jenny K; Ermund, Anna; Birchenough, George M H; Schütte, André; van der Post, Sjoerd; Svensson, Frida; Rodríguez-Piñeiro, Ana M; Nyström, Elisabeth E L; Wising, Catharina; Johansson, Malin E V; Hansson, Gunnar C

    2014-07-01

    The gastrointestinal tract is covered by mucus that has different properties in the stomach, small intestine, and colon. The large highly glycosylated gel-forming mucins MUC2 and MUC5AC are the major components of the mucus in the intestine and stomach, respectively. In the small intestine, mucus limits the number of bacteria that can reach the epithelium and the Peyer's patches. In the large intestine, the inner mucus layer separates the commensal bacteria from the host epithelium. The outer colonic mucus layer is the natural habitat for the commensal bacteria. The intestinal goblet cells secrete not only the MUC2 mucin but also a number of typical mucus components: CLCA1, FCGBP, AGR2, ZG16, and TFF3. The goblet cells have recently been shown to have a novel gate-keeping role for the presentation of oral antigens to the immune system. Goblet cells deliver small intestinal luminal material to the lamina propria dendritic cells of the tolerogenic CD103(+) type. In addition to the gel-forming mucins, the transmembrane mucins MUC3, MUC12, and MUC17 form the enterocyte glycocalyx that can reach about a micrometer out from the brush border. The MUC17 mucin can shuttle from a surface to an intracellular vesicle localization, suggesting that enterocytes might control and report epithelial microbial challenge. There is communication not only from the epithelial cells to the immune system but also in the opposite direction. One example of this is IL10 that can affect and improve the properties of the inner colonic mucus layer. The mucus and epithelial cells of the gastrointestinal tract are the primary gate keepers and controllers of bacterial interactions with the host immune system, but our understanding of this relationship is still in its infancy.

  3. [Teratozoospermia and karyopathological abnormalities in epithelial urogenital tract cells in male shift workers with varicocele in oil fields of the north of Siberia].

    PubMed

    Ilyinskikh, N N; Ilyinskikh, E N; Saushkin, S A

    2016-08-01

    The aim of this work was to study associations between varicocele and the various types of karyopathologic abnormalities in epithelial urogenital tract cells or teratozoospermia in oil field shift workers of the north of Siberia. We examined 139 male individuals in several oil field of the north of Tomsk and Tyumen regions. The examined individuals were divided in 4 groups: 1) driller-workers with varicocele; 2) driller-workers without varicocele; 3) oil field administrative staff with varicocele, and 4) oil field administrative staff without varicocele. Samples of both the sperm ejaculate and the epithelial urogenital tract cells were obtained from all the individuals for microscopic assay. It was found that the frequencies of both the teratozoospermia and the various karyopathologic abnormalities in epithelial urogenital cells were significantly higher in the workers with varicocele compared to all the other groups. There were correlations between karyopathologic abnormalities in epithelial urogenital cells and teratozoospermia in both the driller-workers with varicocele and the oil field administrative staff with varicocele. However, the frequencies of damaged cells in this workers group were significantly higher than the ones in the administrative staff with varicocele, which can be associated with the genotoxic effects of work conditions at oil fields of the north of Siberia. From the data it was concluded that the increased frequencies of the abnormalities in the epithelial urogenital cells and the sperm in the driller-workers with varicocele may be associated with both the diseases endogenous factor and the genotoxic effects of work conditions at the oil fields.

  4. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system

    PubMed Central

    Pelaseyed, Thaher; Bergström, Joakim H.; Gustafsson, Jenny K.; Ermund, Anna; Birchenough, George M. H.; Schütte, André; van der Post, Sjoerd; Svensson, Frida; Rodríguez-Piñeiro, Ana M.; Nyström, Elisabeth E.L.; Wising, Catharina; Johansson, Malin E.V.; Hansson, Gunnar C.

    2014-01-01

    Summary The gastrointestinal tract is covered by mucus that has different properties in the stomach, small intestine and colon. The large highly glycosylated gel-forming mucins MUC2 and MUC5AC are the major components of the mucus in the intestine and stomach, respectively. In the small intestine mucus limits the number of bacteria that can reach the epithelium and the Peyer’s patches. In the large intestine the inner mucus layer separates the commensal bacteria from the host epithelium. The outer colonic mucus layer is the natural habitat for the commensal bacteria. The intestinal goblet cells not only secrete the MUC2 mucin, but also a number of typical mucus components: CLCA1, FCGBP, AGR2, ZG16, and TFF3. The goblet cells have recently been shown to have a novel gate-keeping role for the presentation of oral antigens to the immune system. Goblet cells deliver small intestinal luminal material to the lamina propria dendritic cells of the tolerogenic CD103+-type. In addition to the gel forming mucins, the transmembrane mucins MUC3, MUC12 and MUC17 form the enterocyte glycocalyx that can reach about a micrometer out from the brush border. The MUC17 mucin can shuttle from a surface to an intracellular vesicle localization suggesting that enterocytes might control and report epithelial microbial challenge. There is not only communication from the epithelial cells to the immune system, but also in the opposite direction. One example of this is IL10 that can affect and improve the properties of the inner colonic mucus layer. The mucus and epithelial cells of the gastrointestinal tract are the primary gate keepers and controllers of bacterial interactions with the host immune system, but our understanding of this relationship is still in its infancy. PMID:24942678

  5. Activation of the aryl hydrocarbon receptor pathway enhances cancer cell invasion by upregulating the MMP expression and is associated with poor prognosis in upper urinary tract urothelial cancer.

    PubMed

    Ishida, Masaru; Mikami, Shuji; Kikuchi, Eiji; Kosaka, Takeo; Miyajima, Akira; Nakagawa, Ken; Mukai, Makio; Okada, Yasunori; Oya, Mototsugu

    2010-02-01

    Aryl hydrocarbon receptor (AhR) and the activation of the AhR pathway are involved in xenobiotic-induced toxicity and carcinogenesis. Although xenobiotics, such as cigarette smoke, contribute to the development of urothelial carcinoma (UC), the relationship between AhR and UC is unclear. In the present study, we investigated AhR expression in 209 patients with upper urinary tract UC. The nuclear expression of AhR was significantly associated with histological grade, pathological T stage, lymphovascular invasion and lymph node involvement. A multivariate Cox analysis revealed that nuclear AhR expression was a significant and independent predictor for disease-specific survival (hazard ratio = 2.469, P = 0.013). To determine whether the AhR pathway can be activated in the T24 UC cell line, we examined the expression of cytochrome P450 (CYP) 1A1 and CYP1B1, which are target genes of the AhR pathway, following exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), a ligand of AhR. TCDD treatment upregulated the expression levels of AhR, CYP1A1 and CYP1B1. TCDD enhanced T24 cell invasion associated with the upregulation of matrix metalloproteinase (MMP)-1 and MMP-9. Furthermore, targeting AhR messenger RNA (mRNA) expression in T24 cells with small interfering RNA (siRNA) downregulated the mRNA expression of AhR, CYP1A1, CYP1B1, MMP-1, MMP-2 and MMP-9; furthermore, the cells transfected with siRNA for AhR showed decreased invasion activity in comparison with the cells transfected with a non-targeting siRNA. Our results therefore suggest that AhR plays a role in the invasiveness of UC cells and can serve as a marker for the prognosis of upper urinary tract UC.

  6. Herpes simplex virus type 2 glycoprotein H interacts with integrin αvβ3 to facilitate viral entry and calcium signaling in human genital tract epithelial cells.

    PubMed

    Cheshenko, Natalia; Trepanier, Janie B; González, Pablo A; Eugenin, Eliseo A; Jacobs, William R; Herold, Betsy C

    2014-09-01

    Herpes simplex virus (HSV) entry requires multiple interactions at the cell surface and activation of a complex calcium signaling cascade. Previous studies demonstrated that integrins participate in this process, but their precise role has not been determined. These studies were designed to test the hypothesis that integrin αvβ3 signaling promotes the release of intracellular calcium (Ca2+) stores and contributes to viral entry and cell-to-cell spread. Transfection of cells with small interfering RNA (siRNA) targeting integrin αvβ3, but not other integrin subunits, or treatment with cilengitide, an Arg-Gly-Asp (RGD) mimetic, impaired HSV-induced Ca2+ release, viral entry, plaque formation, and cell-to-cell spread of HSV-1 and HSV-2 in human cervical and primary genital tract epithelial cells. Coimmunoprecipitation studies and proximity ligation assays indicated that integrin αvβ3 interacts with glycoprotein H (gH). An HSV-2 gH-null virus was engineered to further assess the role of gH in the virus-induced signaling cascade. The gH-2-null virus bound to cells and activated Akt to induce a small Ca2+ response at the plasma membrane, but it failed to trigger the release of cytoplasmic Ca2+ stores and was impaired for entry and cell-to-cell spread. Silencing of integrin αvβ3 and deletion of gH prevented phosphorylation of focal adhesion kinase (FAK) and the transport of viral capsids to the nuclear pore. Together, these findings demonstrate that integrin signaling is activated downstream of virus-induced Akt signaling and facilitates viral entry through interactions with gH by activating the release of intracellular Ca2+ and FAK phosphorylation. These findings suggest a new target for HSV treatment and suppression. Herpes simplex viruses are the leading cause of genital disease worldwide, the most common infection associated with neonatal encephalitis, and a major cofactor for HIV acquisition and transmission. There is no effective vaccine. These

  7. Herpes Simplex Virus Type 2 Glycoprotein H Interacts with Integrin αvβ3 To Facilitate Viral Entry and Calcium Signaling in Human Genital Tract Epithelial Cells

    PubMed Central

    Cheshenko, Natalia; Trepanier, Janie B.; González, Pablo A.; Eugenin, Eliseo A.; Jacobs, William R.

    2014-01-01

    ABSTRACT Herpes simplex virus (HSV) entry requires multiple interactions at the cell surface and activation of a complex calcium signaling cascade. Previous studies demonstrated that integrins participate in this process, but their precise role has not been determined. These studies were designed to test the hypothesis that integrin αvβ3 signaling promotes the release of intracellular calcium (Ca2+) stores and contributes to viral entry and cell-to-cell spread. Transfection of cells with small interfering RNA (siRNA) targeting integrin αvβ3, but not other integrin subunits, or treatment with cilengitide, an Arg-Gly-Asp (RGD) mimetic, impaired HSV-induced Ca2+ release, viral entry, plaque formation, and cell-to-cell spread of HSV-1 and HSV-2 in human cervical and primary genital tract epithelial cells. Coimmunoprecipitation studies and proximity ligation assays indicated that integrin αvβ3 interacts with glycoprotein H (gH). An HSV-2 gH-null virus was engineered to further assess the role of gH in the virus-induced signaling cascade. The gH-2-null virus bound to cells and activated Akt to induce a small Ca2+ response at the plasma membrane, but it failed to trigger the release of cytoplasmic Ca2+ stores and was impaired for entry and cell-to-cell spread. Silencing of integrin αvβ3 and deletion of gH prevented phosphorylation of focal adhesion kinase (FAK) and the transport of viral capsids to the nuclear pore. Together, these findings demonstrate that integrin signaling is activated downstream of virus-induced Akt signaling and facilitates viral entry through interactions with gH by activating the release of intracellular Ca2+ and FAK phosphorylation. These findings suggest a new target for HSV treatment and suppression. IMPORTANCE Herpes simplex viruses are the leading cause of genital disease worldwide, the most common infection associated with neonatal encephalitis, and a major cofactor for HIV acquisition and transmission. There is no effective vaccine

  8. Novel bacteriochlorine for high tissue-penetration: photodynamic properties in human biliary tract cancer cells in vitro and in a mouse tumour model.

    PubMed

    Oertel, Michael; Schastak, Stanislaw I; Tannapfel, Andrea; Hermann, Ralf; Sack, Ulrich; Mössner, Joachim; Berr, Frieder

    2003-10-15

    Photodynamic therapy of bile duct cancer using hematoporphyrin derivative (HPD) and laser light of 630 nm wavelength is confined to a tumouricidal tissue penetration of 4 mm, which might be doubled with laser light between 700 and 800 nm. Therefore, we investigated the photosensitising properties of a novel bacteriochlorine, tetrakis-pyridyl-tetrahydroporphyrin tosylat (THP) with high absorption at 763 nm. Two biliary cancer cell lines (BDC, GBC) were incubated with HPD or THP to assess cellular uptake kinetics, dark cytotoxicity, and photodynamic cytotoxicity (laser light exposure 1-20 J/cm2). Tumours grown from BDC cells in subcutaneous tissue of severe combined immunodeficient mice were treated with laser light of 30 J/cm2 after injection of THP. The concentrations that killed 50% of cells in the dark were 680 microg/ml of HPD, but > 6400 microg/ml of THP in BDC cells, and 220 microg/ml of HPD, but 6400 microg/ml of THP in GBC cells. Both cell lines exhibited uptake and retention of THP and photodynamic cytotoxicity (up to 86% cells killed). THP induced tumour-selective phototoxicity in the cholangiocarcinoma model. The novel bacteriochlorine THP exhibits photosensitiser properties in biliary tract cancer cells in vitro and in vivo and could achieve deep tumouricidal tissue penetration due to photoactivation at 763 nm.

  9. [A case of spindle cell carcinoma of the stomach presenting with hematochezia and weight loss due to fistulous tract formation with colon].

    PubMed

    An, Ji Won; Cheung, Dae Young; Seo, Min Woo; Lee, Hyun Jung; Lee, In Kyu; Kim, Tae Jung; Kim, Jin Il; Kim, Jae Kwang

    2013-08-25

    Spindle cell carcinoma (SpCC) is a rare tumor consisting of spindle cells which express cytokeratin. Despite recent advances in immunohistochemical and genetic studies, precise histogenesis of SpCC is still controversial and this tumor had been referred to with a wide range of names (in the past): carcinosarcoma, pseudosarcoma, sarcomatoid carcinoma, pseudosarcomatous carcinoma, and collision tumor. Recently, the authors experienced an extremely rare case of SpCC arising from the stomach. A 64-year-old male presented with unintended weight loss and hematochezia. Endoscopic examination revealed a fistulous tract between the stomach and the transverse colon which was made by direct invasion of SpCC of the stomach to the colon. Histologically, the tumor was positive for both vimentin and cytokeratin but negative for CD117, CD34, actin, and desmin. Herein, we report a case of SpCC arising from the stomach that formed a fistulous tract with the colon which was diagnosed during evaluation of hematochezia and weight loss.

  10. Modified laparoscopic nephroureterectomy for treatment of upper urinary tract transitional cell cancer is not associated with an increased risk of tumour recurrence.

    PubMed

    Klingler, H C; Lodde, M; Pycha, A; Remzi, M; Janetschek, G; Marberger, M

    2003-10-01

    Laparoscopic nephroureterectomy reduces the morbidity of surgical management of urinary tract transitional cell carcinoma (TCC), but a potentially increased risk for local tumour spreading was reported. We evaluated results obtained from patients undergoing a modified laparoscopic approach and open procedures in this respect. Between January 2000 and March 2002 we performed 19 modified laparoscopic nephroureterectomies (LNU) with open intact specimen retrieval in conjunction with open distal ureter and bladder cuff removal and 15 open standard nephroureterectomies (ONU). Staging lymphadenectomy was performed in 14/19 (73.7%) patients with LNU and in 6/15 (40.0%) with ONU. In all patients operating time, blood loss, complications, pain score (VAS) and data in respect to tumour recurrence were analysed. Mean follow-up was 22.1+/-9.2 (range 14-34) months for LNU and 23.1+/-8.8 (14-36) for ONU respectively. In LNU and ONU pathological features were 12 pT1 vs. 10 pT1, 2 pT2 vs. 2 pT2 and 5 pT3 vs. 3 pT3, respectively. All patients had TCC and were R0 at final histology. Four patients with LNU had lymph node involvement, one in ONU. LNU had decreased operating times (p=0.057), blood loss (p=0.018), complications (p=0.001) and VAS scores (p=0.001). One tumour recurrence occurred in LNU, associated with a pT3b pN2 G3 TCC at final histology. One patient with ONU had local tumour recurrence at the site of the bladder cuff. No port-site metastasis occurred during follow-up with LNU. Improved peri-operative results and same cancer control as compared to open surgery by this modified LNU was not associated with an increased risk for tumour recurrence, since strict "non-touch" preparation, avoiding of urine spillage and intact specimen retrieval prevents tumour seeding. However, results from long term studies are still warranted to clarify this issue.

  11. Identification of homing receptors that mediate the recruitment of CD4 T cells to the genital tract following intravaginal infection with Chlamydia trachomatis.

    PubMed Central

    Kelly, K A; Rank, R G

    1997-01-01

    Murine genital infection induced with the mouse pneumonitis biovar of Chlamydia trachomatis (MoPn) elicits a short-lived protective immunity mediated primarily by Th1 CD4 cells. To understand the development of local cell-mediated immunity against C. trachomatis infection, we investigated the mechanism(s) which mediates CD4 lymphocyte migration to the genital mucosa by identifying molecules that could support this process. We found that primarily CD4 cells were recruited to the genital tract (GT) during primary and challenge MoPn infection. Peak levels were found 21 days after primary inoculation (15.4% +/- 2.7%) and 7 days (31.3% +/- 8.5%) after challenge but diminished after resolution of infection. The CD4 cells appeared to be recruited to the GT in response to infection since these cells expressed the profile of activated, or memory, cells. We also observed up-regulation of homing receptors containing LFA-1 (CD11a) and alpha4 (CD49d) on GT CD4 cells over the course of infection. Furthermore, the mucosal homing receptor chain, beta7, but not the peripheral homing receptor chain beta1 (CD29), was detected on GT CD4 cells. MoPn-infected GT tissue expressed the endothelial cell ligands vascular cell adhesion molecule 1 (VCAM-1), intracellular adhesion molecule 1 (ICAM-1), and mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1), which correspond to the homing receptors on GT CD4 cells. Interestingly, VCAM-1 and MAdCAM-1 were not expressed in the GTs of uninfected mice but were temporarily induced following infection, indicating that expression of endothelial ligands in the GT are regulated by chlamydial infection. These data suggest that recruitment of CD4 cells to the GT is mediated through LFA-1:ICAM-1 and alpha4beta7:MAdCAM-1-VCAM-1 interactions. PMID:9393816

  12. A prognostic model based on pretreatment platelet lymphocyte ratio for stage IE/IIE upper aerodigestive tract extranodal NK/T cell lymphoma, nasal type.

    PubMed

    Wang, Ke-feng; Chang, Bo-yang; Chen, Xiao-qin; Liu, Pan-pan; Wuxiao, Zhi-jun; Wang, Zhi-hui; Li, Su; Jiang, Wen-qi; Xia, Zhong-jun

    2014-12-01

    Patients with stage IE/IIE natural killer T (NK/T) cell lymphomas have discrepant survival outcome. This study aims to establish a prognostic model based on the pretreatment platelet lymphocyte ratio (PLR) specifically for localized extranodal NK/T cell lymphoma to guide the therapy. We retrospectively analyzed the data of 252 patients with early-stage upper aerodigestive tract NK/T cell lymphoma. The 5-year overall survival rate in 252 patients was 67.1%. Prognostic factors for survival were female (P = 0.025; relative risk, 0.51; 95% CI 0.28-0.92), older age (P = 0.000; relative risk, 3.34; 95% CI 1.94-5.75), stage II(P = 0.020; relative risk, 1.79; 95% CI 1.10-2.91), lactate dehydrogenase (LDH) level (P = 0.009; relative risk, 2.00; 95% CI 1.19-3.35), and PLR (P = 0.020; relative risk, 1.77; 95% CI 1.10-2.87). Based on these five parameters, we identified three different risk groups: group 1(106 cases, 43.4%), no or one adverse factor; group 2(85 cases, 34.8%), two factors; group 3(53 cases, 21.7%), three to five factors. Five-year overall survival was 83.3% for group 1, 62.2% for group 2, and 43.1% for group 3 (P = 0.000). Compared with International Prognostic Index and Korean Prognostic Index, the new model has a better prognostic discrimination for the patients of stage IE/IIE upper aerodigestive tract NK/T cell lymphoma. The PLR-based prognosis model is useful to stratify patients with localized extranodal NK/T cell lymphoma into different risk groups and guide the treatment modalities selection.

  13. Small molecule-based approaches to adult stem cell therapies.

    PubMed

    Lairson, Luke L; Lyssiotis, Costas A; Zhu, Shoutian; Schultz, Peter G

    2013-01-01

    There is considerable interest in the development of stem cell-based strategies for the treatment of a broad range of human diseases, including neurodegenerative, autoimmune, cardiovascular, and musculoskeletal diseases. To date, such regenerative approaches have focused largely on the development of cell transplantation therapies using cells derived from pluripotent embryonic stem cells (ESCs). Although there have been exciting preliminary reports describing the efficacy of ESC-derived replacement therapies, approaches involving ex vivo manipulated ESCs are hindered by issues of mutation, immune rejection, and ethical controversy. An alternative approach involves direct in vivo modulation or ex vivo expansion of endogenous adult stem cell populations using drug-like small molecules. Here we describe chemical approaches to the regulation of somatic stem cell biology that are yielding new biological insights and that may ultimately lead to innovative new medicines.

  14. Oncologic outcomes following three different approaches to the distal ureter and bladder cuff in nephroureterectomy for primary upper urinary tract urothelial carcinoma.

    PubMed

    Li, Wei-Ming; Shen, Jung-Tsung; Li, Ching-Chia; Ke, Hung-Lung; Wei, Yu-Ching; Wu, Wen-Jeng; Chou, Yii-Her; Huang, Chun-Hsiung

    2010-06-01

    There is a lack of consensus regarding the prognostic significance of different approaches to the bladder cuff at surgery for primary upper urinary tract urothelial carcinoma (UUT-UC). To compare the oncologic outcomes following radical nephroureterectomy using three different methods of managing the bladder cuff. From January 1990 to December 2007, 414 patients with primary UUT-UC underwent radical nephroureterectomy at our institution. Of these, 301 were included in our study. Three methods of bladder cuff excision-intravesical incision, extravesical incision, and transurethral incision (TUI)-were performed. Patients' medical records were reviewed retrospectively. The clinicopathologic data and oncologic outcomes were compared among groups. Of the 301 patients, 81 (26.9%) underwent the intravesical method, 129 (42.9%) underwent the extravesical technique, and 91 (30.2%) underwent TUI. There were no differences in clinical and histopathologic data among the three groups. When comparing the intravesical, extravesical, and TUI techniques, bladder recurrence developed in, respectively, 23.5%, 24.0%, and 17.6% cases (p=0.485); local retroperitoneal recurrence in 7.4%, 7.8%, and 5.5% (p=0.798); contralateral recurrence in 4.9%, 3.9%, and 2.2% (p=0.632); and distant metastasis in 7.4%, 10.4%, and 5.5% (p=0.564). There were no differences in recurrence-free and cancer-specific survival among the three groups (p=0.680 and 0.502, respectively). The three techniques had comparable oncologic outcomes. Our data validate the TUI method of bladder cuff control in patients with primary UUT-UC without coexistent bladder tumors. Copyright © 2010 European Association of Urology. Published by Elsevier B.V. All rights reserved.

  15. A Multifaceted Approach to Reduction of Catheter-Associated Urinary Tract Infections in the Intensive Care Unit With an Emphasis on "Stewardship of Culturing".

    PubMed

    Mullin, Katherine M; Kovacs, Christopher S; Fatica, Cynthia; Einloth, Colette; Neuner, Elizabeth A; Guzman, Jorge A; Kaiser, Eric; Menon, Venu; Castillo, Leticia; Popovich, Marc J; Manno, Edward M; Gordon, Steven M; Fraser, Thomas G

    2017-02-01

    BACKGROUND Catheter-associated urinary tract infections (CAUTIs) are among the most common hospital-acquired infections (HAIs). Reducing CAUTI rates has become a major focus of attention due to increasing public health concerns and reimbursement implications. OBJECTIVE To implement and describe a multifaceted intervention to decrease CAUTIs in our ICUs with an emphasis on indications for obtaining a urine culture. METHODS A project team composed of all critical care disciplines was assembled to address an institutional goal of decreasing CAUTIs. Interventions implemented between year 1 and year 2 included protocols recommended by the Centers for Disease Control and Prevention for placement, maintenance, and removal of catheters. Leaders from all critical care disciplines agreed to align routine culturing practice with American College of Critical Care Medicine (ACCCM) and Infectious Disease Society of America (IDSA) guidelines for evaluating a fever in a critically ill patient. Surveillance data for CAUTI and hospital-acquired bloodstream infection (HABSI) were recorded prospectively according to National Healthcare Safety Network (NHSN) protocols. Device utilization ratios (DURs), rates of CAUTI, HABSI, and urine cultures were calculated and compared. RESULTS The CAUTI rate decreased from 3.0 per 1,000 catheter days in 2013 to 1.9 in 2014. The DUR was 0.7 in 2013 and 0.68 in 2014. The HABSI rates per 1,000 patient days decreased from 2.8 in 2013 to 2.4 in 2014. CONCLUSIONS Effectively reducing ICU CAUTI rates requires a multifaceted and collaborative approach; stewardship of culturing was a key and safe component of our successful reduction efforts. Infect Control Hosp Epidemiol 2017;38:186-188.

  16. Identification of C-kit-positive interstitial cells in the dog lower urinary tract and relationship with smooth muscle and nerves. Hypotheses for a likely pacemaker role.

    PubMed

    Arrighi, Silvana; Bosi, Giampaolo; Groppetti, Debora; Cremonesi, Fausto

    2010-01-01

    The aim of this work was to give an evidence of the likely presence of interstitial cells in the canine lower urinary tract and to study their possible interactions with the musculature and the intramural innervation. Cryosections of normal canine bladder and urethra were immunofluorescently labelled with c-kit, a transmembrane, tyrosine kinase growth factor receptor, known to be expressed on the interstitial cells of Cajal (ICCs) of the gut. The relationship with antiactin positive smooth muscle cells and PGP9.5-positive intramural innervation was also investigated by confocal microscopy. Anti-c-kit labelling demonstrated a network of elongated and branched c-kit positive cells, which were located in interstitial spaces, oriented in parallel to the smooth muscle bundles that form the bladder muscular layer, irrespective of dog sex. Cells with a similar localization were also PAS- and NADPH-diaphorase-positive. A contact between c-kit immunofluorescent cells and intramural innervation was demonstrated, too. The roles of interstitial cells might include regulation of smooth muscle activity of the bladder detrusor, integrating neuronal signals during urine storage and voiding.

  17. Characteristics of HIV target CD4 T cells collected using different sampling methods from the genital tract of HIV seronegative women.

    PubMed

    Iyer, Smita S; Sabula, Michael J; Mehta, C Christina; Haddad, Lisa B; Brown, Nakita L; Amara, Rama R; Ofotokun, Igho; Sheth, Anandi N

    2017-01-01

    Understanding the immune profile of CD4 T cells, the primary targets for HIV, in the female genital tract (FGT) is critical for evaluating and developing effective biomedical HIV prevention strategies in women. However, longitudinal investigation of HIV susceptibility markers expressed by FGT CD4 T cells has been hindered by low cellular yield and risk of sampling-associated trauma. We investigated three minimally invasive FGT sampling methods to characterize and compare CD4 T cell yield and phenotype with the goal of establishing feasible sampling strategies for immune profiling of mucosal CD4 T cells. FGT samples were collected bimonthly from 12 healthy HIV negative women of reproductive age in the following order: 1) Cervicovaginal lavage (CVL), 2) two sequential endocervical flocked swabs (FS), and 3) two sequential endocervical cytobrushes (CB1, CB2). Cells were isolated and phentoyped via flow cytometry. CD4 T cell recovery was highest from each individual CB compared to either CVL or FS (p < 0.0001). The majority of CD4 T cells within the FGT, regardless of sampling method, expressed CCR5 relative to peripheral blood (p < 0.01). Within the CB, CCR5+ CD4 T cells expressed significantly higher levels of α4β7, CD69, and low levels of CD27 relative to CCR5- CD4 T cells (all p < 0.001). We also identified CD4 Treg lineage cells expressing CCR5 among CB samples. Using three different mucosal sampling methods collected longitudinally we demonstrate that CD4 T cells within the FGT express CCR5 and α4β7 and are highly activated, attributes which could act in concert to facilitate HIV acquisition. FS and CB sampling methods can allow for investigation of strategies to reduce HIV target cells in the FGT and could inform the design and interpretation microbicide and vaccine studies in women.

  18. Targeting cancer stem cells using immunologic approaches

    PubMed Central

    Pan, Qin; Li, Qiao; Liu, Shuang; Ning, Ning; Zhang, Xiaolian; Xu, Yingxin; Chang, Alfred E.; Wicha, Max S.

    2015-01-01

    Cancer stem cells (CSCs) represent a small subset of tumor cells which have the ability to self-renew and generate the diverse cells that comprise the tumor bulk. They are responsible for local tumor recurrence and distant metastasis. However, they are resistant to conventional radiotherapy and chemotherapy. Novel immunotherapeutic strategies which specifically target CSCs may improve the efficacy of cancer therapy. To immunologically target CSC phenotypes, innate immune responses to CSCs have been reported using NK cells and γδT cells. To target CSC specifically, in vitro CSC-primed T cells have been successfully generated and shown targeting of CSCs in vivo after adoptive transfer. Recently, CSC-based dendritic cell vaccine has demonstrated significant induction of anti-CSC immunity both in vivo in immunocommpetent hosts and in vitro as evident by CSC reactivity of CSC vaccine-primed antibodies and T cells. In addition, identification of specific antigens or genetic alterations in CSCs may provide more specific targets for immunotherapy. ALDH, CD44, CD133 and HER2 have served as markers to isolate CSCs from a number of tumor types in animal models and human tumors. They might serve as useful targets for CSC immunotherapy. Finally, since CSCs are regulated by interactions with the CSC niche, these interactions may serve as additional targets for CSC immunotherapy. Targeting the tumor microenvironment, such as interrupting the immune cell e.g. myeloid derived suppressor cells, and cytokines e.g. IL-6 and IL-8, as well as the immune checkpoint (PD1/PDL1, et.al) may provide additional novel strategies to enhance the immunological targeting of CSCs. PMID:25873269

  19. Nano Approaches to Modulate Host Cell Response

    Cancer.gov

    The Carolina Center of Cancer Nanotechnology Excellence (CCNE) is an NCI-funded multidisciplinary collaboration among a range of disciplines using nano approaches for cancer disease management and treatment.

  20. Uvangoletin induces mitochondria-mediated apoptosis in HL-60 cells in vitro and in vivo without adverse reactions of myelosuppression, leucopenia and gastrointestinal tract disturbances.

    PubMed

    Zheng, Zhuanzhen; Qiao, Zhenhua; Gong, Rong; Wang, Yalin; Zhang, Yiqun; Ma, Yanping; Zhang, Li; Lu, Yujin; Jiang, Bo; Li, Guoxia; Dong, Chunxia; Chen, Wenliang

    2016-02-01

    This study investigated the cytotoxic effect of uvangoletin on HL-60 cells, and the effects of uvangoletin on myelosuppression, leucopenia, gastrointestinal tract disturbances and the possible cytotoxic mechanisms by using CCK-8, flow cytometry, western blot, xenograft, cyclophosphamide-induced leucopenia, copper sulfate-induced emesis and ethanol-induced gastric mucosal lesions assays. The results of CCK-8, flow cytometry and western blot assays indicated that uvangoletin showed the cytotoxic effect on HL-60 cells and induced the apoptosis of HL-60 cells by downregulating the expression levels of anti-apoptotic proteins (Survivin, Bcl-xl and Bcl-2), upregulating the expression levels of pro-apoptotic proteins (Smac, Bax, Bad, c-caspase-3 and c-caspase-9), and promoting the release of cytochrome c from mitochondria to cytoplasm. Further, the results of xenograft assay suggested that uvangoletin inhibited the HL-60-induced tumor growth without adverse effect on body weight of nude mice in vivo by regulating the expression levels of above apoptotic proteins. The results indicated that the reductions of WBCs count and thighbone marrow granulocytes percentage in cyclophosphamide-induced leucopenia assay, the incubation period and number of emesis in copper sulfate-induced emesis assay and the gastric mucosal lesions in ethanol-induced gastric mucosal lesions assay were not exacerbated or reversed by uvangoletin. In conclusion, the research preliminarily indicated that uvangoletin induced apoptosis of HL-60 cells in vitro and in vivo without adverse reactions of myelosuppression, leucopenia and gastrointestinal tract disturbances, and the pro-apoptotic mechanisms may be related to mitochondria-mediated apoptotic pathway.

  1. VASA mRNA (DDX4) detection is more specific than immunohistochemistry using poly- or monoclonal antibodies for germ cells in the male urogenital tract.

    PubMed

    Boellaard, Willem P A; Stoop, Hans; Gillis, Ad J M; Oosterhuis, J Wolter; Looijenga, Leendert H J

    2017-07-01

    VASA, also known as DDX4, is reported to be specifically expressed in cells belonging to the germ cell lineage, both in males and females. Therefore, it could be an informative protein biomarker to be applied on semen to differentiate between obstructive and nonobstructive azoospermia (OA and NOA, respectively). In addition, it could be of value to predict sperm retrieval based on testicular sperm extraction. Immunocytochemistry of proven OA semen using both polyclonal and monoclonal antibodies against VASA showed positive staining of both cells and cell sized particles. This is spite of being the absolute negative controls, completely lacking germ lineage derived cells and material. In order to identify the source of the VASA-positive material, a detailed screen of different anatomical parts of the whole male urogenital tract was performed of multiple cases using immunohistochemistry.The polyclonal antibody stained, besides the expected germ cells in the testis, epithelium of the bladder and the seminal vesicles. The monoclonal antibody only stained the latter. To investigate whether the immunohistochemical staining is associated with the presence of the corresponding VASA mRNA, samples of seminal vesicles, bladder, testis, and semen (with and without germ cells) were investigated using the specific quantitative reverse transcription-polymerase chain reaction (qRT-PCR) on 42 samples. A positive result was detected in testis and semen containing germ cells (n = 10 and 8), being negative in semen without germ cells (n = 11), bladder (n = 3), and seminal vesicles (n = 10).Two commercially available VASA antibodies (mono- and polyclonal) are not specific. In contrast, VASA-mRNA evaluation, using qRT-PCR, is specific for the presence of germ cells, therefore, is an interesting molecular biomarker for germ cell detection in semen.

  2. Neurons derived from human embryonic stem cells extend long-distance axonal projections through growth along host white matter tracts after intra-cerebral transplantation

    PubMed Central

    Denham, Mark; Parish, Clare L.; Leaw, Bryan; Wright, Jordan; Reid, Christopher A.; Petrou, Steven; Dottori, Mirella; Thompson, Lachlan H.

    2012-01-01

    Human pluripotent stem cells have the capacity for directed differentiation into a wide variety of neuronal subtypes that may be useful for brain repair. While a substantial body of research has lead to a detailed understanding of the ability of neurons in fetal tissue grafts to structurally and functionally integrate after intra-cerebral transplantation, we are only just beginning to understand the in vivo properties of neurons derived from human pluripotent stem cells. Here we have utilized the human embryonic stem (ES) cell line Envy, which constitutively expresses green fluorescent protein (GFP), in order to study the in vivo properties of neurons derived from human ES cells. Rapid and efficient neural induction, followed by differentiation as neurospheres resulted in a GFP+ neural precursor population with traits of neuroepithelial and dorsal forebrain identity. Ten weeks after transplantation into neonatal rats, GFP+ fiber patterns revealed extensive axonal growth in the host brain, particularly along host white matter tracts, although innervation of adjacent nuclei was limited. The grafts were composed of a mix of neural cell types including differentiated neurons and glia, but also dividing neural progenitors and migrating neuroblasts, indicating an incomplete state of maturation at 10 weeks. This was reflected in patch-clamp recordings showing stereotypical properties appropriate for mature functional neurons, including the ability to generate action potentials, as well profiles consistent for more immature neurons. These findings illustrate the intrinsic capacity for neurons derived from human ES cells to integrate at a structural and functional level following transplantation. PMID:22470319

  3. Neurons derived from human embryonic stem cells extend long-distance axonal projections through growth along host white matter tracts after intra-cerebral transplantation.

    PubMed

    Denham, Mark; Parish, Clare L; Leaw, Bryan; Wright, Jordan; Reid, Christopher A; Petrou, Steven; Dottori, Mirella; Thompson, Lachlan H

    2012-01-01

    Human pluripotent stem cells have the capacity for directed differentiation into a wide variety of neuronal subtypes that may be useful for brain repair. While a substantial body of research has lead to a detailed understanding of the ability of neurons in fetal tissue grafts to structurally and functionally integrate after intra-cerebral transplantation, we are only just beginning to understand the in vivo properties of neurons derived from human pluripotent stem cells. Here we have utilized the human embryonic stem (ES) cell line Envy, which constitutively expresses green fluorescent protein (GFP), in order to study the in vivo properties of neurons derived from human ES cells. Rapid and efficient neural induction, followed by differentiation as neurospheres resulted in a GFP+ neural precursor population with traits of neuroepithelial and dorsal forebrain identity. Ten weeks after transplantation into neonatal rats, GFP+ fiber patterns revealed extensive axonal growth in the host brain, particularly along host white matter tracts, although innervation of adjacent nuclei was limited. The grafts were composed of a mix of neural cell types including differentiated neurons and glia, but also dividing neural progenitors and migrating neuroblasts, indicating an incomplete state of maturation at 10 weeks. This was reflected in patch-clamp recordings showing stereotypical properties appropriate for mature functional neurons, including the ability to generate action potentials, as well profiles consistent for more immature neurons. These findings illustrate the intrinsic capacity for neurons derived from human ES cells to integrate at a structural and functional level following transplantation.

  4. Transient detection of Chlamydial-specific Th1 memory cells in the peripheral circulation of women with history of Chlamydia trachomatis genital tract infection.

    PubMed

    Vicetti Miguel, Rodolfo D; Reighard, Seth D; Chavez, Jean M; Rabe, Lorna K; Maryak, Samantha A; Wiesenfeld, Harold C; Cherpes, Thomas L

    2012-12-01

    Development of safe and effective Chlamydia trachomatis vaccines requires better understanding of the host immune responses elicited by natural infection. Peripheral blood mononuclear cells isolated from women with or without history of genital tract chlamydial infection were stimulated with inactivated C. trachomatis elementary bodies (EB) in ELISPOT assays that enumerated frequencies of cells producing interferon (IFN)-γ or interleukin (IL)-17. IFN-γ-positive cells were highest among women sampled 30-60 days after diagnosis of C. trachomatis infection and treatment initiation, while the numbers of IFN-γ-positive cells were equally low among uninfected women and women sampled <30 or >60 days after diagnosis of infection. Conversely, IL-17-positive cell numbers were uniformly low among all participants. Dramatically reduced numbers of Chlamydia-specific Th1 memory cells in the peripheral circulation of study participants sampled more than 2 months after diagnosis, and initiation of treatment provides new insight into the results from C. trachomatis vaccine trials, in which immunization with EB provided only short-lived protection. Our results also suggest that an effective vaccine against this weakly antigenic intracellular pathogen will need to generate immunological memory more durable than that elicited by natural infection. © 2012 John Wiley & Sons A/S.

  5. Histochemical and immunohistochemical study on endocrine cells (5HT, GAS, and SST) of the gastrointestinal tract of a teleost, the characin Astyanax bimaculatus.

    PubMed

    Cardoso, Nathália das Neves; Firmiano, Enely Maris da Silveira; Gomes, Iracema D; do Nascimento, Aparecida A; Sales, Armando; Araújo, Francisco G

    2015-09-01

    Endocrine cells secrete hormones through the mucosa of the gastrointestinal tract (GIT) and act on the overall regulation of digestive processes such as nutrient absorption, gut motility and intestinal blood flow. This study aimed to determine regional distribution and frequency of endocrine cells secretory of serotonin (5-HT), somatostatin (SST) and gastrin (GAS) in the GIT of a small-bodied widespread characin Astyanax bimaculatus using histological, histochemical and immunohistochemical techniques. Fragments of the stomach and gut fixed for 8h in Bouin liquid were subjected to histological processing and immunohistochemical routine. For the histological analyses, the technique of staining with hematoxylin and eosin (HE) was used, whereas for the histochemical analyses Gomori's trichrome, periodic acid+Schiff (PAS) and Alcian blue pH 2.5 (AB) were used to further immunohistochemical processing. The stomach has a mucosa lined with a simple columnar epithelium with mucus-secreting cells; the glandular region (proximal and distal portions) has folds and pits, whereas the non-glandular region has pits only. The intestinal epithelium is simple with plain cylindrical grooved and goblet cells. The anterior region has thin folds with few goblet cells, and the posterior region with thick folds and many goblet cells. The regional distribution and frequency of endocrine cells varied across regions of the GIT with the stomach showing the highest amount of immunoreactive (IR) cells. Only the 5-HT was found in the stomach (epithelia and glands) and gut regions, with comparatively higher frequency in the stomach. SST-IR cells were found in the stomach (epithelia and gastric glands) with higher frequency in the glandular region, whereas GAS-IR were found in the gastric glands only. The stomach was the only organ to have all the three types of endocrine cells, indicating that this organ is the main site of digestion of food in this species. Copyright © 2015 Elsevier GmbH. All

  6. Giant Cell Arteritis of the Female Genital Tract With Occult Temporal Arteritis and Marginal Zone Lymphoma Harboring Novel 20q Deletion: A Case Report and Literature Review.

    PubMed

    Pradhan, Dinesh; Amin, Rajnikant M; Jones, Miroslawa W; Surti, Urvashi; Parwani, Anil V

    2016-02-01

    Giant cell arteritis (GCA) is an immunologically mediated vasculitis of large and medium-sized vessels, typically affecting the cranial arteries and usually occurring in the elderly. GCA of the female genital tract is extremely rare with only 31 cases reported in the English literature. An 83-year-old white female with postmenopausal vaginal bleeding revealed an endometrial polyp on pelvic ultrasonography following which polypectomy and subsequently hysterectomy with bilateral salpingo-oophorectomy was done. Microscopy revealed a well-differentiated endometrioid adenocarcinoma. Interestingly, classic GCA involving numerous small to medium-sized arteries of the cervix, myometrium, bilateral fallopian tubes, and ovaries was also identified. Hematologic evaluation revealed marginal zone lymphoma with an exceptionally rare 20q deletion. Bilateral temporal artery biopsy was done subsequently, which exhibited GCA on microscopy. Corticosteroid was started that improved her polymyalgia rheumatica symptoms. The patient is on follow-up for 3 years and is doing well. To our knowledge, this is the first case of GCA of the female genital tract associated with a lymphoma and the second case of marginal zone lymphoma with the novel 20q deletion. © The Author(s) 2015.

  7. Fungal Colonization of the Respiratory Tract in Allogeneic and Autologous Hematopoietic Stem Cell Transplant Recipients: A Study of 573 Transplanted Patients

    PubMed Central

    Markowski, Jarosław; Helbig, Grzegorz; Widziszowska, Agnieszka; Likus, Wirginia; Kyrcz-Krzemień, Sławomira; Jarosz, Urszula; Dziubdziela, Włodzimierz; Markiewicz, Mirosław

    2015-01-01

    Background Fungal colonization and infections remain a major cause of infection morbidity and mortality following hematopoietic stem cell transplantation (HSCT) in patients with hematological malignancies. The aim of this study was to analyze the spectrum of fungal microflora of the respiratory tract (oral cavity, pharynx, epiglottis, and sputum) in patients undergoing HSCT and to evaluate the relationship between HSCT type and incidence of mycotic colonization and infections. Material/Methods Retrospective analysis of fungal isolates collected from the respiratory tract (oral cavity, pharynx, epiglottis, and sputum) of 573 patients undergoing HSCT was performed. Results The overall rate of fungal colonization in patients undergoing HSCT was 8.7%. Patients undergoing allogeneic HSCT were statistically significantly more often colonized (12.95%) compared to autologous HSCT recipients (4.7%). Colonizing cultures were mainly C. albicans and C. krusei, and sporadically C. glabrata, C. famata, Aspergillus spp. and Saccharomyces cerevisiae. C. albicans was the most frequent species found in isolates from the pharynx, sputum, and oral cavity collected from patients undergoing HSCT. Aspergillosis was more common after allogeneic than after autologous HSCT. The pharynx was the most frequently colonized site. Conclusions Allogeneic HSCT recipients are more susceptible to fungal infections compared to the autologous group. Selection of species during prophylaxis and antifungal therapy requires developing more effective prevention and treatment strategies based on new antifungal drugs and microbe-specific diagnoses. PMID:25907308

  8. [Specific features of centriole formation and ciliogenesis in ciliary epithelium cells of respiratory tracts in patients with Kartagener syndrome].

    PubMed

    Domaratskiĭ, K E; Uvakina, E V; Volkov, I K; Onishchenko, G E

    2005-01-01

    An electron microscopic study of the ciliary epithelium of respiratory tracts was carried out in children (members of the same family) with Kartagener syndrome, which is a variant of ciliary dyskinesia. It was shown that in the case of both mobile cilia and ciliary dyskinesia in man, centrioles are formed during formation of the ciliary basal bodies predominantly de novo, involving deuterosomes. A wide spectrum of pathological changes was described in literature, such as the absence of dynein arms in the axoneme and disorganization of axoneme structure. In addition to these changes in the ciliary system, we found integration of several ciliary axonemes by the same plasma membrane, running of microtubules from the plasma membrane as bundles, different orientation of basal legs, etc.

  9. White matter tracts for the trafficking of neural progenitor cells characterized by cellular MRI and immunohistology: the role of CXCL12/CXCR4 signaling.

    PubMed

    Chen, Chiao-Chi V; Hsu, Yi-Hua; Jayaseema, D M; Chen, Jeou-Yuan Joanne; Hueng, Dueng-Yuan; Chang, Chen

    2015-07-01

    White matter tracts are important for the trafficking of neural progenitor cells (NPCs) in both normal and pathological conditions, but the underlying mechanism is not clear. The directionality of white matter is advantageous for molecules or cells to distribute over a long distance, but this feature is unlikely solely responsible for efficient migration. The present study hypothesizes that the efficient migration of NPCs into white matter is under the influences of neurochemical attraction—CXCL12/CXCR4 signaling, a major mechanism underlying the targeted migration of NPCs. To test this view, the present study investigated the effects of CXCL12 administration into the corpus callosum (CC) on the migratory behavior of transplanted NPCs. A living animal tracking platform based on MRI and a magnetic cell labeling technique was employed. The NPCs were magnetically labeled and then transplanted at the right end of the CC. CXCL12 was infused continuously at the left end. Migration of NPCs was monitored repeatedly over a 7-day course using 3D gradient echo T2*-weighted imaging. It was found that, CXCL12 induced NPCs to migrate up to 1,881 μm from the graft whereas the spontaneous migration was mere 200 μm. CXCL12 induced migration that was nine times as efficient in the speed. The results indicate that the CXCL12/CXCR4 signaling may be a mechanism via which NPCs efficiently migrate along the white matter tracts. The study also presents a potential strategy for facilitating the targeted migration in NPC therapy for brain disorders.

  10. Electrical stimulation of the medullary pyramid promotes proliferation and differentiation of oligodendrocyte progenitor cells in the corticospinal tract of the adult rat

    PubMed Central

    Li, Qun; Brus-Ramer, Marcel; Martin, John H.; McDonald, John W.

    2010-01-01

    Endogenous tri-potential neural stem cells (eNSCs) exist in the adult spinal cord and differentiate primarily into oligodendrocytes (OLs) and astrocytes. Previous in vivo and in vitro studies have shown that during development proliferation and differentiation of oligodendrocyte progenitor cells (OPCs) depend on activity in neighboring axons. However, this activity-dependent development of OPCs has not been examined in the adult CNS. In the present study, we stimulated unilateral corticospinal (CS) axons of the adult rat and investigated proliferation and differentiation of OPCs in dorsal corticospinal tract (dCST). eNSCs were labeled with the mitotic indicator 5-Bromo-2′-deoxyuridine (BrdU). Phenotypes of proliferating cells were identified by double-immunolabeling of BrdU with a panel of antibodies to cell markers: NG2, Nkx2.2, APC, GFAP, and Glut-1. Electrical stimulation of CS axons increased BrdU labeled eNSCs and promoted the proliferation and differentiation of OPCs, but not astrocytes and endothelial cells. Our findings demonstrate the importance of neural activity in regulating OPC proliferation/differentiation in the mature CNS. Selective pathway electrical stimulation could be used to promote remyelination and recovery of function in CNS injury and disease. PMID:20493923

  11. A 3-way collision tumor of the upper respiratory tract: a composite of 2 immunophenotypically distinct mantle cell lymphomas and a plasmacytoma.

    PubMed

    Wang, Huan-You; Karandikar, Nitin; Payne, Deborah; Maleki, Atousa; Schultz, Barbara A; Collins, Robert; McKenna, Robert W

    2008-05-01

    Composite lymphoma (CL) is composed of 2 or more morphologically and immunophenotypically distinct lymphomas in a single anatomical site. Here we report a unique CL of the upper respiratory tract in an elderly male patient. Morphologically, the lymphoma was composed of 2 distinct and well-demarcated areas consisting of monotonous small to medium-sized lymphocytes and sheets of mature-appearing plasma cells. Immunophenotyping by both flow cytometry and immunohistochemistry revealed that the small to medium-sized lymphocytes were composed of 2 distinct subpopulations sharing a CD5(+)/CD19(+)/CD20(+)/CD22(+)/CD23(-)/FMC-7(+)/cyclin D1(+) immunophenotype but with different immunoglobulin (Ig) light and heavy chain expression, consistent with 2 immunophenotypically distinct mantle cell lymphomas (MCLs); the plasma cells were composed of CD38(bright +)/CD138(+)/IgG kappa-restricted plasma cells, consistent with a plasmacytoma. Fluorescence in situ hybridization showed the t(11;14) translocation present in the lymphocyte region but absent in the plasma cell area. Ig heavy chain gene rearrangement studies on manually dissected populations showed 2 distinct patterns for the MCL and plasmacytoma. To our knowledge, this is the first report of a 3-way CL consisting of 2 immunophenotypically distinct MCLs and a plasmacytoma.

  12. Stem Cell-Based Approaches to Treating HIV Infection

    PubMed Central

    Kitchen, Scott G.; Zack, Jerome A.

    2012-01-01

    Purpose of Review Stem cell based strategies for treating HIV infected individuals represent a novel approach toward reconstituting the ravaged immune system with the ultimate aim of clearing the virus from the body. Genetic modification of human hematopoietic stem cells to produce cells that are either resistant to infection, cells that produce lower amounts of infectious virus, or cells that specifically target the immune response against the virus are currently the dominant strategies under development. This review focuses on the understanding of stem cell based approaches that are under investigation and the rationale behind such approaches. Recent Findings Significant progress has recently been made utilizing stem cell based approaches to treat HIV infection. Ideally, a successful strategy would result in immune clearance of the virus from the body as well long-term restoration of overall immune responses to successfully combat everyday environmental antigens. Two recent clinical trails illustrate how new advances in stem cell based approaches may propel this field forward to clinical reality: one that demonstrates that large-scale gene therapy trials can be performed in a conventional, reproducible manner; and one that demonstrates the utilization of a multi-pronged approach using lentiviral-based gene therapy vectors. These clinical trails serve as the foundation for the development of other technologies, discussed here, that are currently in preclinical development. Summary Recent advances using stem cell based approaches to treat HIV infection have provided the impetus for a renewed and expanded interest in the development of new cell-based strategies to treat HIV infection as well as a variety of other diseases. PMID:21242896

  13. A different approach to solar cell simulation

    SciTech Connect

    Kavasoglu, Nese; Kavasoglu, A. Sertap; Metin, Bengul

    2015-10-15

    Highlights: • A new simulation program has been developed and operated for the Au/n-GaN device. • Device inhomogeneity is introduced to program via fluctuation factor term. • The barrier height fluctuation factor strongly affects the device characteristics. - Abstract: Zero barrier height inhomogeneity in the device is generally assumed to conform to Gaussian distribution in the literature. In this study, zero barrier height inhomogeneity has been adopted to obey random distribution. Cell was divided into elementary diodes, which were connected in parallel to each other. The current–voltage characteristics of the cell were obtained by developed device modeling program for various zero barrier height inhomogeneity levels at room temperature in dark and under light conditions. The cell parameters were then calculated by using simulated current–voltage data. It is displayed that increase in zero barrier height inhomogeneity results in Schottky barrier height enhancement and decrease in the diode factor of the cell. Fill factor and V{sub oc} values showed a decreasing trend with increasing zero barrier height inhomogeneity. Also, random distribution of zero barrier height effect on interface state density was examined. Interface state density increases with increasing zero barrier height inhomogeneity.

  14. A synergistic approach for neural repair: cell transplantation and induction of endogenous precursor cell activity.

    PubMed

    Madhavan, Lalitha; Collier, Timothy J

    2010-05-01

    Stem cell research offers enormous potential for treating many diseases of the nervous system. At present, therapeutic strategies in stem cell research segregate into two approaches: cell transplantation or endogenous cell stimulation. Realistically, future cell therapies will most likely involve a combination of these two approaches, a theme of our current research. Here, we propose that there exists a 'synergy' between exogenous (transplanted) and endogenous stem cell actions that can be utilized to achieve therapeutic ends. Elucidating mechanisms underlying this exogenous-endogenous stem cell synergism may lead to the development of optimal cell therapies for neural disorders. Copyright 2009 Elsevier Ltd. All rights reserved.

  15. Super-resolution Microscopy Approaches for Live Cell Imaging

    PubMed Central

    Godin, Antoine G.; Lounis, Brahim; Cognet, Laurent

    2014-01-01

    By delivering optical images with spatial resolutions below the diffraction limit, several super-resolution fluorescence microscopy techniques opened new opportunities to study biological structures with details approaching molecular structure sizes. They have now become methods of choice for imaging proteins and their nanoscale dynamic organizations in live cells. In this mini-review, we describe and compare the main far-field super-resolution approaches that allow studying endogenous or overexpressed proteins in live cells. PMID:25418158

  16. A microfluidic approach to parallelized transcriptional profiling of single cells.

    PubMed

    Sun, Hao; Olsen, Timothy; Zhu, Jing; Tao, Jianguo; Ponnaiya, Brian; Amundson, Sally A; Brenner, David J; Lin, Qiao

    2015-12-01

    The ability to correlate single-cell genetic information with cellular phenotypes is of great importance to biology and medicine, as it holds the potential to gain insight into disease pathways that is unavailable from ensemble measurements. We present a microfluidic approach to parallelized, rapid, quantitative analysis of messenger RNA from single cells via RT-qPCR. The approach leverages an array of single-cell RT-qPCR analysis units formed by a set of parallel microchannels concurrently controlled by elastomeric pneumatic valves, thereby enabling parallelized handling and processing of single cells in a drastically simplified operation procedure using a relatively small number of microvalves. All steps for single-cell RT-qPCR, including cell isolation and immobilization, cell lysis, mRNA purification, reverse transcription and qPCR, are integrated on a single chip, eliminating the need for off-chip manual cell and reagent transfer and qPCR amplification as commonly used in existing approaches. Additionally, the approach incorporates optically transparent microfluidic components to allow monitoring of single-cell trapping without the need for molecular labeling that can potentially alter the targeted gene expression and utilizes a polycarbonate film as a barrier against evaporation to minimize the loss of reagents at elevated temperatures during the analysis. We demonstrate the utility of the approach by the transcriptional profiling for the induction of the cyclin-dependent kinase inhibitor 1a and the glyceraldehyde 3-phosphate dehydrogenase in single cells from the MCF-7 breast cancer cell line. Furthermore, the methyl methanesulfonate is employed to allow measurement of the expression of the genes in individual cells responding to a genotoxic stress.

  17. A Case Report of NK-Cell Lymphoproliferative Disease With a Wide Involvement of Digestive Tract Develop Into Epstein–Barr Virus Associated NK/T Cell Lymphoma in an Immunocompetent Patient

    PubMed Central

    Chen, Haotian; Zhang, Yu; Jiang, Zhinong; Zhou, Wei; Cao, Qian

    2016-01-01

    Abstract Epstein–Barr virus (EBV) plays an important role in various diseases. EBV-associated lymphoproliferative disease (LPD) is a rare disease with a canceration tendency. It is difficult to differentiate LPD with involvement of digestive tract from Crohn disease due to similar clinical and endoscopic manifestations. We present a case report of multiple ulcers with esophagus, small bowel and the entire colon involved, proved to be NK-Cell LPD, developed into EBV-associated NK/T Cell lymphoma, in an immunocompetent man who was initially misdiagnosed as Crohn disease. This report underscores that intestinal ulcers should be cautiously diagnosed, for it sometimes could be a precancerous lesion. PMID:27015206

  18. Malignant gastrointestinal neuroectodermal tumor: clinicopathologic, immunohistochemical, ultrastructural, and molecular analysis of 16 cases with a reappraisal of clear cell sarcoma-like tumors of the gastrointestinal tract.

    PubMed

    Stockman, David L; Miettinen, Markku; Suster, Saul; Spagnolo, Dominic; Dominguez-Malagon, Hugo; Hornick, Jason L; Adsay, Volkan; Chou, Pauline M; Amanuel, Benhur; Vantuinen, Peter; Zambrano, Eduardo V

    2012-06-01

    patients were alive with regional, lymph node, and liver metastases, and 2 patients were alive with no evidence of disease. The tumor described here is an aggressive form of neuroectodermal tumor that should be separated from other primitive epithelioid and spindle cell tumors of the gastrointestinal tract. The distinctive ultrastructural features and absence of melanocytic differentiation serve to separate them from soft tissue clear cell sarcomas involving the gastrointestinal tract. The designation "malignant gastrointestinal neuroectodermal tumor" is proposed for this tumor type.

  19. The protective effects of total phenols in magnolia officinalix rehd. et wils on gastrointestinal tract dysmotility is mainly based on its influence on interstitial cells of cajal

    PubMed Central

    Tian, Hui; Huang, Dazhi; Li, Tao; Huang, Lihua; Zheng, Xingguang; Tang, Danxia; Zhang, Lu; Wang, Jian

    2015-01-01

    Magnolia officinalix Rehd. et Wils is a kind of herb which is widely used for gastrointestinal tract mobility disorder in Asian countries. In this study, we investigated whether the total phenols of Magnolia officinalix Rehd. et Wils (TPM) treatment improves gastrointestinal tract dysmobility induced by intraperitoneal injection of atropine (5 mg/kg) in rats. Rats were randomly grouped into three units: TPM-pretreated/atropine-treated group, atropinetreated group and control group. TPM were administrated for 7 days. Gastric residual rate and intestinal transit were measured 20 min after atropine injected, and gastrointestinal hormones (including: gastrin (GAS), motilin (MTL), somatostatin (SS) and p substance (PS) levels in serum were also measured by ELISA kits. The number and distribution of interstitial cells of Cajal (ICCs) in stomach were detected by immunohistochemistry analysis, while c-kit and stem cell factor (SCF) expressions in stomach were also measured by western blotting. We found that TPM pretreatment significantly improved atropine-induced gastric residual rate increase, while had no significantly effects on intestinal transit; it also significantly normalized GAS, MTL and PS serum levels. Atropine-induced ICCs numbers decreased in both sinuses ventriculi and body of stomach, which is improved by TPM pretreatment. Western blotting results showed the expressions of c-kit and SCF were down-regulated after atropine injection, which can be reversed with TPM pretreatment. These results above indicates that TPM treatment can significantly protected atropine-induced gastric dysmoblility, which may owed to its regulation on c-kit/SCF signing pathway. PMID:26884941

  20. The Antiproliferative Effect of Chakasaponins I and II, Floratheasaponin A, and Epigallocatechin 3-O-Gallate Isolated from Camellia sinensis on Human Digestive Tract Carcinoma Cell Lines

    PubMed Central

    Kitagawa, Niichiro; Morikawa, Toshio; Motai, Chiaki; Ninomiya, Kiyofumi; Okugawa, Shuhei; Nishida, Ayaka; Yoshikawa, Masayuki; Muraoka, Osamu

    2016-01-01

    Acylated oleanane-type triterpene saponins, namely chakasaponins I (1) and II (2), floratheasaponin A (3), and their analogs, together with catechins—including (–)-epigallocatechin 3-O-gallate (4), flavonoids, and caffeine—have been isolated as characteristic functional constituents from the extracts of “tea flower”, the flower buds of Camellia sinensis (Theaceae), which have common components with that of the leaf part. These isolates exhibited antiproliferative activities against human digestive tract carcinoma HSC-2, HSC-4, MKN-45, and Caco-2 cells. The antiproliferative activities of the saponins (1–3, IC50 = 4.4–14.1, 6.2–18.2, 4.5–17.3, and 19.3–40.6 µM, respectively) were more potent than those of catechins, flavonoids, and caffeine. To characterize the mechanisms of action of principal saponin constituents 1–3, a flow cytometric analysis using annexin-V/7-aminoactinomycin D (7-AAD) double staining in HSC-2 cells was performed. The percentage of apoptotic cells increased in a concentration-dependent manner. DNA fragmentation and caspase-3/7 activation were also detected after 48 h. These results suggested that antiproliferative activities of 1–3 induce apoptotic cell death via activation of caspase-3/7. PMID:27898032

  1. Effects of cranberry extract on prevention of urinary tract infection in dogs and on adhesion of Escherichia coli to Madin-Darby canine kidney cells.

    PubMed

    Chou, Hsin-I; Chen, Kuan-Sheng; Wang, Hsien-Chi; Lee, Wei-Ming

    2016-04-01

    To determine effects of cranberry extract on development of urinary tract infection (UTI) in dogs and on adherence of Escherichia coli to Madin-Darby canine kidney (MDCK) cells. 12 client-owned dogs (in vivo experiment) and 6 client-owned dogs (in vitro experiment). 12 dogs with a history of recurrent UTI received an antimicrobial (n = 6) or cranberry extract (6) orally for 6 months. Dogs were monitored for a UTI. For the in vitro experiment, cranberry extract was orally administered to 6 dogs for 60 days. Voided urine samples were collected from each dog before and 30 and 60 days after onset of extract administration. Urine was evaluated by use of a bacteriostasis assay. An antiadhesion assay and microscopic examination were used to determine inhibition of bacterial adherence to MDCK cells. None of the 12 dogs developed a UTI. The bacteriostasis assay revealed no zone of inhibition for any urine samples. Bacterial adhesion was significantly reduced after culture with urine samples obtained at 30 and 60 days, compared with results for urine samples obtained before extract administration. Microscopic examination revealed that bacterial adherence to MDCK cells was significantly reduced after culture with urine samples obtained at 30 and 60 days, compared with results after culture with urine samples obtained before extract administration. Oral administration of cranberry extract prevented development of a UTI and prevented E coli adherence to MDCK cells, which may indicate it has benefit for preventing UTIs in dogs.

  2. Phase II Trial Of PS-341 (Bortezomib) In Patients With Previously Treated Advanced Urothelial Tract Transitional Cell Carcinoma

    ClinicalTrials.gov

    2013-06-04

    Metastatic Transitional Cell Cancer of the Renal Pelvis and Ureter; Recurrent Bladder Cancer; Recurrent Transitional Cell Cancer of the Renal Pelvis and Ureter; Recurrent Urethral Cancer; Stage III Bladder Cancer; Stage III Urethral Cancer; Stage IV Bladder Cancer; Stage IV Urethral Cancer; Transitional Cell Carcinoma of the Bladder; Ureter Cancer

  3. Statistical approaches and software for clustering islet cell functional heterogeneity

    PubMed Central

    Wills, Quin F.; Boothe, Tobias; Asadi, Ali; Ao, Ziliang; Warnock, Garth L.; Kieffer, Timothy J.

    2016-01-01

    ABSTRACT Worldwide efforts are underway to replace or repair lost or dysfunctional pancreatic β-cells to cure diabetes. However, it is unclear what the final product of these efforts should be, as β-cells are thought to be heterogeneous. To enable the analysis of β-cell heterogeneity in an unbiased and quantitative way, we developed model-free and model-based statistical clustering approaches, and created new software called TraceCluster. Using an example data set, we illustrate the utility of these approaches by clustering dynamic intracellular Ca2+ responses to high glucose in ∼300 simultaneously imaged single islet cells. Using feature extraction from the Ca2+ traces on this reference data set, we identified 2 distinct populations of cells with β-like responses to glucose. To the best of our knowledge, this report represents the first unbiased cluster-based analysis of human β-cell functional heterogeneity of simultaneous recordings. We hope that the approaches and tools described here will be helpful for those studying heterogeneity in primary islet cells, as well as excitable cells derived from embryonic stem cells or induced pluripotent cells. PMID:26909740

  4. Electromagnetic waves and living cells: A kinetic thermodynamic approach

    NASA Astrophysics Data System (ADS)

    Lucia, Umberto

    2016-11-01

    Cells are complex thermodynamic systems. Their energy transfer, thermo-electro-chemical processes and transports phenomena can occur across the cells membranes, the border of the complex system. Moreover, cells can also actively modify their behaviours in relation to any change of their environment. All the living systems waste heat, which is no more than the result of their internal irreversibility. This heat is dissipated into their environment. But, this wasted heat represents also a sort of information, which outflows from the cell towards its environment, completely accessible to any observer. The analysis of irreversibility related to this wasted heat can represent a new useful approach to the study of the cells behaviour. This approach allows us to consider the living systems as black boxes and analyse only the inflows and outflows and their changes in relation to any environmental change. This analysis allows also the explanation of the effects of electromagnetic fields on the cell behaviour.

  5. Perspectives for Cell-homing Approaches to Engineer Dental Pulp.

    PubMed

    Galler, Kerstin M; Widbiller, Matthias

    2017-09-01

    Sufficient proof is available today to demonstrate that dental pulp tissue engineering is possible. The body of evidence was generated mainly on cell transplantation; however, because of several severe problems afflicted with this approach, it might not be feasible for a clinical setting in the near future. More recently, cell homing has been proposed as a viable alternative. We suggest a modification of the tissue engineering paradigm, where resident cells are attracted by endogenous, dentin-derived growth factors that further induce cell proliferation and differentiation and a bioactive scaffold material laden with these growth factors that serves as a template for tissue formation. This article highlights the latest developments regarding scaffold materials, stem cells, and dentin-derived growth factors specifically for a cell-homing approach to engineer dental pulp and summarizes new ideas. Copyright © 2017 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  6. Algal Cell Factories: Approaches, Applications, and Potentials.

    PubMed

    Fu, Weiqi; Chaiboonchoe, Amphun; Khraiwesh, Basel; Nelson, David R; Al-Khairy, Dina; Mystikou, Alexandra; Alzahmi, Amnah; Salehi-Ashtiani, Kourosh

    2016-12-13

    With the advent of modern biotechnology, microorganisms from diverse lineages have been used to produce bio-based feedstocks and bioactive compounds. Many of these compounds are currently commodities of interest, in a variety of markets and their utility warrants investigation into improving their production through strain development. In this review, we address the issue of strain improvement in a group of organisms with strong potential to be productive "cell factories": the photosynthetic microalgae. Microalgae are a diverse group of phytoplankton, involving polyphyletic lineage such as green algae and diatoms that are commonly used in the industry. The photosynthetic microalgae have been under intense investigation recently for their ability to produce commercial compounds using only light, CO₂, and basic nutrients. However, their strain improvement is still a relatively recent area of work that is under development. Importantly, it is only through appropriate engineering methods that we may see the full biotechnological potential of microalgae come to fruition. Thus, in this review, we address past and present endeavors towards the aim of creating productive algal cell factories and describe possible advantageous future directions for the field.

  7. Algal Cell Factories: Approaches, Applications, and Potentials

    PubMed Central

    Fu, Weiqi; Chaiboonchoe, Amphun; Khraiwesh, Basel; Nelson, David R.; Al-Khairy, Dina; Mystikou, Alexandra; Alzahmi, Amnah; Salehi-Ashtiani, Kourosh

    2016-01-01

    With the advent of modern biotechnology, microorganisms from diverse lineages have been used to produce bio-based feedstocks and bioactive compounds. Many of these compounds are currently commodities of interest, in a variety of markets and their utility warrants investigation into improving their production through strain development. In this review, we address the issue of strain improvement in a group of organisms with strong potential to be productive “cell factories”: the photosynthetic microalgae. Microalgae are a diverse group of phytoplankton, involving polyphyletic lineage such as green algae and diatoms that are commonly used in the industry. The photosynthetic microalgae have been under intense investigation recently for their ability to produce commercial compounds using only light, CO2, and basic nutrients. However, their strain improvement is still a relatively recent area of work that is under development. Importantly, it is only through appropriate engineering methods that we may see the full biotechnological potential of microalgae come to fruition. Thus, in this review, we address past and present endeavors towards the aim of creating productive algal cell factories and describe possible advantageous future directions for the field. PMID:27983586

  8. Enrichment of herpes simplex virus type 2 (HSV-2) reactive mucosal T cells in the human female genital tract

    PubMed Central

    Posavad, Christine M.; Zhao, Lin; Dong, Lichun; Jin, Lei; Stevens, Claire E.; Magaret, Amalia S.; Johnston, Christine; Wald, Anna; Zhu, Jia; Corey, Lawrence; Koelle, David M.

    2016-01-01

    Local mucosal cellular immunity is critical in providing protection from HSV-2. To characterize and quantitate HSV-2-reactive mucosal T cells, lymphocytes were isolated from endocervical cytobrush and biopsy specimens from 17 HSV-2-infected women and examined ex vivo for the expression of markers associated with maturation and tissue residency and for functional T cell responses to HSV-2. Compared to their circulating counterparts, cervix-derived CD4+ and CD8+ T cells were predominantly effector memory T cells (CCR7−/CD45RA−) and the majority expressed CD69, a marker of tissue residency. Co-expression of CD103, another marker of tissue residency, was highest on cervix-derived CD8+ T cells. Functional HSV-2 reactive CD4+ and CD8+ T cells responses were detected in cervical samples and a median of 17% co-expressed CD103. HSV-2 reactive CD4+ T cells co-expressed IL-2 and were significantly enriched in the cervix compared to blood. This first direct ex vivo documentation of local enrichment of HSV-2 reactive T cells in the human female genital mucosa is consistent with the presence of antigen-specific tissue-resident memory T cells. Ex vivo analysis of these T cells may uncover tissue-specific mechanisms of local control of HSV-2 to assist the development of vaccine strategies that target protective T cells to sites of HSV-2 infection. PMID:28051084

  9. Enrichment of herpes simplex virus type 2 (HSV-2) reactive mucosal T cells in the human female genital tract.

    PubMed

    Posavad, C M; Zhao, L; Dong, L; Jin, L; Stevens, C E; Magaret, A S; Johnston, C; Wald, A; Zhu, J; Corey, L; Koelle, D M

    2017-09-01

    Local mucosal cellular immunity is critical in providing protection from HSV-2. To characterize and quantify HSV-2-reactive mucosal T cells, lymphocytes were isolated from endocervical cytobrush and biopsy specimens from 17 HSV-2-infected women and examined ex vivo for the expression of markers associated with maturation and tissue residency and for functional T-cell responses to HSV-2. Compared with their circulating counterparts, cervix-derived CD4+ and CD8+ T cells were predominantly effector memory T cells (CCR7-/CD45RA-) and the majority expressed CD69, a marker of tissue residency. Co-expression of CD103, another marker of tissue residency, was highest on cervix-derived CD8+ T cells. Functional HSV-2 reactive CD4+ and CD8+ T-cell responses were detected in cervical samples and a median of 17% co-expressed CD103. HSV-2-reactive CD4+ T cells co-expressed IL-2 and were significantly enriched in the cervix compared with blood. This first direct ex vivo documentation of local enrichment of HSV-2-reactive T cells in the human female genital mucosa is consistent with the presence of antigen-specific tissue-resident memory T cells. Ex vivo analysis of these T cells may uncover tissue-specific mechanisms of local control of HSV-2 to assist the development of vaccine strategies that target protective T cells to sites of HSV-2 infection.

  10. Orthogonal cross-seeding: an approach to explore protein aggregates in living cells.

    PubMed

    Hinz, Justyna; Gierasch, Lila M; Ignatova, Zoya

    2008-04-08

    Protein aggregation is associated with the pathology of many diseases, especially neurodegenerative diseases. A variety of structurally polymorphic aggregates or preaggregates including amyloid fibrils is accessible to any aggregating protein. Preaggregates are now believed to be the toxic culprits in pathologies rather than mature aggregates. Although clearly valuable, understanding the mechanism of formation and the structural characteristics of these prefibrillar species is currently lacking. We report here a simple new approach to map the nature of the aggregate core of transient aggregated species directly in the cell. The method is conceptually based on the highly discriminating ability of aggregates to recruit new monomeric species with equivalent molecular structure. Different soluble segments comprising parts of an amyloidogenic protein were transiently pulse-expressed in a tightly controlled, time-dependent manner along with the parent aggregating full-length protein, and their recruitment into the insoluble aggregate was monitored immunochemically. We used this approach to determine the nature of the aggregate core of the metastable aggregate species formed during the course of aggregation of a chimera containing a long polyglutamine repeat tract in a bacterial host. Strikingly, we found that different segments of the full-length protein dominated the aggregate core at different times during the course of aggregation. In its simplicity, the approach is also potentially amenable to screen also for compounds that can reshape the aggregate core and induce the formation of alternative nonamyloidogenic species.

  11. Integrating cell biology and proteomic approaches in plants.

    PubMed

    Takáč, Tomáš; Šamajová, Olga; Šamaj, Jozef

    2017-04-22

    Significant improvements of protein extraction, separation, mass spectrometry and bioinformatics nurtured advancements of proteomics during the past years. The usefulness of proteomics in the investigation of biological problems can be enhanced by integration with other experimental methods from cell biology, genetics, biochemistry, pharmacology, molecular biology and other omics approaches including transcriptomics and metabolomics. This review aims to summarize current trends integrating cell biology and proteomics in plant science. Cell biology approaches are most frequently used in proteomic studies investigating subcellular and developmental proteomes, however, they were also employed in proteomic studies exploring abiotic and biotic stress responses, vesicular transport, cytoskeleton and protein posttranslational modifications. They are used either for detailed cellular or ultrastructural characterization of the object subjected to proteomic study, validation of proteomic results or to expand proteomic data. In this respect, a broad spectrum of methods is employed to support proteomic studies including ultrastructural electron microscopy studies, histochemical staining, immunochemical localization, in vivo imaging of fluorescently tagged proteins and visualization of protein-protein interactions. Thus, cell biological observations on fixed or living cell compartments, cells, tissues and organs are feasible, and in some cases fundamental for the validation and complementation of proteomic data. Validation of proteomic data by independent experimental methods requires development of new complementary approaches. Benefits of cell biology methods and techniques are not sufficiently highlighted in current proteomic studies. This encouraged us to review most popular cell biology methods used in proteomic studies and to evaluate their relevance and potential for proteomic data validation and enrichment of purely proteomic analyses. We also provide examples of

  12. New Array Approaches to Explore Single Cells Genomes

    PubMed Central

    Vanneste, Evelyne; Bittman, Lilach; Van der Aa, Niels; Voet, Thierry; Vermeesch, Joris Robert

    2011-01-01

    Microarray analysis enables the genome-wide detection of copy number variations and the investigation of chromosomal instability. Whereas array techniques have been well established for the analysis of unamplified DNA derived from many cells, it has been more challenging to enable the accurate analysis of single cell genomes. In this review, we provide an overview of single cell DNA amplification techniques, the different array approaches, and discuss their potential applications to study human embryos. PMID:22509179

  13. Giant cell tumor of bone: Multimodal approach

    PubMed Central

    Gupta, AK; Nath, R; Mishra, MP

    2007-01-01

    Background: The clinical behavior and treatment of giant cell tumor of bone is still perplexing. The aim of this study is to clarify the clinico-pathological correlation of tumor and its relevance in treatment and prognosis. Materials and Methods: Ninety -three cases of giant cell tumor were treated during 1980-1990 by different methods. The age of the patients varied from 18-58 yrs with male and female ratio as 5:4. The upper end of the tibia was most commonly involved (n=31), followed by the lower end of the femur(n=21), distal end of radius(n=14), upper end of fibula (n=9), proximal end of femur(n=5), upper end of the humerus(n=3), iliac bone(n=2), phalanx (n=2) and spine(n=1). The tumors were also encountered on uncommon sites like metacarpals (n=4) and metatarsal(n=1). Fifty four cases were treated by curettage and bone grafting. Wide excision and reconstruction was performed in twenty two cases. Nine cases were treated by wide excision while primary amputation was performed in four cases. One case required only curettage. Three inaccessible lesions of ilium and spine were treated by radiotherapy. Results: 19 of 54 treated by curettage and bone grafting showed a recurrence. The repeat curettage and bone grafting was performed in 18 cases while amputation was done in one. One each out of the cases treated by wide excision and reconstruction and wide excision alone recurred. In this study we observed that though curettage and bone grafting is still the most commonly adopted treatment, wide excision of tumor with reconstruction has shown lesser recurrence. Conclusion: For radiologically well-contained and histologically typical tumor, curettage and autogenous bone grafting is the treatment of choice. The typical tumors with radiologically deficient cortex, clinically aggressive tumors and tumors with histological Grade III should be treated by wide excision and reconstruction. PMID:21139762

  14. Estimation of influence of high doses of cholecalciferol on thyroid parafollicular and respiratory tract neuroendocrine cells; preliminary investigations.

    PubMed

    Sawicki, B; Zbucki, R L; Winnicka, M M; Kasacka, I; Nowosielski, C; Hukałowicz, K

    2004-01-01

    The aim of this study was to compare what changes are caused by high doses of cholecalciferol (100,000 UI vD3) and CaCl2 on thyroid parafollicular (C) cells and airways neuroendocrine (NE) cells in rat. Overdosage of vD3 and CaCl2 causes hypocalcaemia and strong hypercalcitoninemia in blood; C cells showed mainly signs of hypertrophy; simultaneously, the number of strong calcitoninpositive cells decreased significantly (statistically significant changes). Immunohistochemical reactions, detecting CGRP, somatostatin, synaptophysin and neuronspecific enolase did not fall under statistic analysis. Airways NE cells re-acted to hypercalcemia differently than C cells--they probably respond to different regulatory mechanisms.

  15. [Effect of Nocardia rubra cell wall skeleton (Nr-CWS) on oncogenicity of TC-1 cells and anti-human papillomavirus effect of Nr-CWS in lower genital tract of women].

    PubMed

    Zhao, Jian; Zhan, Shao-bing; Li, Xue-qian; Zhou, Ling; Yang, Ying-jie; Liao, Qin-ping

    2007-12-01

    To detect the effect of Nocardia rubra cell wall skeleton (Nr-CWS) on tumorigenicity induced by TC-1 cells and to clinically study anti-human papillomavirus effect of Nr-CWS in lower genital tract of women. Tumor model was established by injecting TC-1 cells subcutaneously in SCID mice, then divided them into 3 groups randomly and injected with isovolumetric physiological saline, 60 micrograms/ml Nr-CWS and 120 micrograms/ml Nr-CWS respectively, the growth of tumors was measured one week later. Nr-CWS was applied on 45 HPV positive women whose TCT test was normal and without cervical erosion 2-3 days after menstruation. HPV was detected again 3 months later to explore the effect of Nr-CWS on HPV infection in female lower genital tract. The animal experiment showed the weight of transplanted tumors in treated group was less than that of control group (chi2=12.5, P= 0.002). The tumor inhibition rate was 59.1 percent and 84.2 percent in the groups treated with Nr-CWS 60 and 120 micrograms/ml Nr-CWS; the results of HPV detection in 23 out of the 45 cases (51.1 percent) became negative after the 3-month treatment; the viral load was reduced in 9, and there was no change in viral load in 13 cases. Significant difference was found between the rates of undetectable viral load and the natural viral disappearance rate (P less than 0.05). Nr-CWS has an inhibitory effect to TC-1 cell tumorigenesis and clinical application of Nr-CWS may eliminate the HPV infection in lower genital tract of a considerable proportion of women with HPV infection.

  16. Conditional Deletion of the Relaxin Receptor Gene in Cells of Smooth Muscle Lineage Affects Lower Reproductive Tract in Pregnant Mice1

    PubMed Central

    Kaftanovskaya, Elena M.; Huang, Zaohua; Lopez, Carolina; Conrad, Kirk; Agoulnik, Alexander I.

    2015-01-01

    ABSTRACT Relaxin hormone secreted into the circulation during pregnancy was discovered through its effects on pubic symphysis relaxation and parturition. Genetic inactivation of the relaxin gene or its cognate relaxin family peptide receptor 1 (RXFP1) in mice caused failure of parturition and mammary nipple enlargement, as well as increased collagen fiber density in the cervix and vagina. However, the relaxin effect on discrete cells and tissues has yet to be determined. Using transgenic mice with a knockin LacZ reporter in the Rxfp1 allele, we showed strong expression of this gene in vaginal and cervical stromal cells, as well as pubic ligament cells. We produced a floxed Rxfp1 allele that was used in combination with the Tagln-cre transgene to generate mice with a smooth muscle-specific gene knockout. In pregnant females, the ROSA26 reporter activated by Tagln-cre was detected in smooth muscle cells of the cervix, vagina, uterine artery, and in cells of the pubic symphysis. In late pregnant females with conditional gene ablation, the length of pubic symphysis was significantly reduced compared with wild-type or heterozygous Rxfp1+/− females. Denser collagen content was revealed by Masson trichrome staining in reproductive tract organs, uterine artery, and pubic symphysis. The cervical and vaginal epithelium was less developed than in heterozygous or wild-type females, although nipple size was normal and the dams were able to nurse their pups. In summary, our data indicate that relaxin/RXFP1 signaling in smooth muscle cells is important for normal collagen turnover and relaxation of the pubic symphysis during pregnancy. PMID:25715795

  17. [Inhibition of carbohydrate metabilsm enzymes by pentachlorophenol in cells of pectinolytic bacteria from gastrointestinal tract of animals and effect of clinoptilolite adsorbents on this process].

    PubMed

    Kalachniuk, L H; Rusnak, N I; Kalachniuk, H I; Marounek, M; Savka, O H; Mel'nychuk, D O

    2006-01-01

    Changes in functional activity of specific enzyme reactions in the cells of pectinolytic bacteria from the gastrointestinal tract of animals in vitro cultivated in the medium containing pectin or glucose were studied against a background of the low dose effect of the wide spread biocide pentachlorophenol alone as well as in combination with the natural sorbents clinoptilolites. Regardless of the absence of transketolase reaction in the cells of all studied strains, they metabolized highly the above substrates that are dissimilar in chemical structure and produced different products of their degradation. It has been shown that the high metabolic level in the cells is provided by the function of the unique enzymatic reaction catalyzed by 2-keto-3-desoxy-6-phosphogluconate aldolase (EC 4.1.2.14) that permits to use effectively the metabolic pathway of Entner-Doudoroff. Cells could also utilize the same substrates via the Embden-Meyerhof-Parnas pathway, therefore they possess the other key reaction that is catalyzed by fructosobiphosphate aldolase (EC 4.1.2.13). Even a low dose of PCP (20 microM) decreased sharply activity of the mentioned key enzymes and intermediates' production in the cells of the studied strains with the use of both substrates. However, presence of clinoptilolites in the medium reduced significantly the biocide inhibition effect. Furthermore, in the medium with glucose, protection of intracellular metabolism with the help of sorbents was registered more clearly than with pectin. This can evidence for more mobile and simpler possibilities of accelerated production of necessary intermediates from glucose that are capable to induce activation of the key enzymatic reactions in cells utilizing selectively the substrates (which are different in accessibility and other characteristics) under the toxic agent effect.

  18. Effects of Electroacupuncture on Interstitial Cells of Cajal (ICC) Ultrastructure and Connexin 43 Protein Expression in the Gastrointestinal Tract of Functional Dyspepsia (FD) Rats

    PubMed Central

    Zhang, Guoshan; Xie, Shen; Hu, Wei; Liu, Yuer; Liu, Mailan; Liu, Mi; Chang, Xiaorong

    2016-01-01

    Background Gastrointestinal motility disorder is the main clinical manifestation in functional dyspepsia (FD) patients. Electroacupuncture is effective in improving gastrointestinal motility disorder in FD; however, the underlying mechanism remains unclear. It has been demonstrated that interstitial cells of Cajal (ICC) are pacemaker cells in the gastrointestinal tract, and the pacemaker potential is transmitted to nearby cells through gap junctions between ICC or ICC and the smooth muscle. Therefore, this study aimed to assess the effects of electroacupuncture on ICC ultrastructure and expression of the gap junction protein connexin 43 (Cx43) in FD rats. Material/Methods The animals were randomized into 3 groups: control, model, and electroacupuncture. Electroacupuncture was applied at Zusanli (ST36) in the electroacupuncture group daily for 10 days, while no electroacupuncture was applied to model group animals. Results Ultrastructure of ICC recovered normally in gastric antrum and small intestine specimens was improved, with Cx43 expression levels in these tissues significantly increased in the electroacupuncture group compared with the model group. Conclusions These findings indicated that electroacupuncture is effective in alleviating ICC damage and reduces Cx43 levels in FD rats, and suggest that ICC and Cx43 are involved in electroacupuncture treatment in rats with FD to improve gastrointestinal motility disorders. PMID:27297942

  19. Systemic Foot-and-Mouth Disease Vaccination in Cattle Promotes Specific Antibody-Secreting Cells at the Respiratory Tract and Triggers Local Anamnestic Responses upon Aerosol Infection.

    PubMed

    Pega, J; Di Giacomo, S; Bucafusco, D; Schammas, J M; Malacari, D; Barrionuevo, F; Capozzo, A V; Rodríguez, L L; Borca, M V; Pérez-Filgueira, M

    2015-09-01

    Foot-and-mouth disease (FMD) is a highly contagious viral disease affecting biungulate species. Commercial vaccines, formulated with inactivated FMD virus (FMDV), are regularly used worldwide to control the disease. Here, we studied the generation of antibody responses in local lymphoid tissues along the respiratory system in vaccinated and further aerosol-infected cattle. Animals immunized with a high-payload monovalent FMD vaccine developed high titers of neutralizing antibodies at 7 days postvaccination (dpv), reaching a plateau at 29 dpv. FMDV-specific antibody-secreting cells (ASC), predominantly IgM, were evident at 7 dpv in the prescapular lymph node (LN) draining the vaccination site and in distal LN draining the respiratory mucosa, although in lower numbers. At 29 dpv, a significant switch to IgG1 was clear in prescapular LN, while FMDV-specific ASC were detected in all lymphoid tissues draining the respiratory tract, mostly as IgM-secreting cells. None of the animals (n = 10) exhibited FMD symptoms after oronasal challenge at 30 dpv. Three days postinfection, a large increase in ASC numbers and rapid isotype switches to IgG1 were observed, particularly in LN-draining virus replication sites already described. These results indicate for the first time that systemic FMD vaccination in cattle effectively promotes the presence of anti-FMDV ASC in lymphoid tissues associated with the respiratory system. Oronasal infection triggered an immune reaction compatible with a local anamnestic response upon contact with the replicating FMDV, suggesting that FMD vaccination induces the circulation of virus-specific B lymphocytes, including memory B cells that differentiate into ASC soon after contact with the infective virus. Over recent decades, world animal health organizations as well as national sanitary authorities have supported the use of vaccination as an essential component of the official FMD control programs in both endemic and disease-free settings. Very few

  20. Systemic Foot-and-Mouth Disease Vaccination in Cattle Promotes Specific Antibody-Secreting Cells at the Respiratory Tract and Triggers Local Anamnestic Responses upon Aerosol Infection

    PubMed Central

    Pega, J.; Di Giacomo, S.; Bucafusco, D.; Schammas, J. M.; Malacari, D.; Barrionuevo, F.; Capozzo, A. V.; Rodríguez, L. L.; Borca, M. V.

    2015-01-01

    ABSTRACT Foot-and-mouth disease (FMD) is a highly contagious viral disease affecting biungulate species. Commercial vaccines, formulated with inactivated FMD virus (FMDV), are regularly used worldwide to control the disease. Here, we studied the generation of antibody responses in local lymphoid tissues along the respiratory system in vaccinated and further aerosol-infected cattle. Animals immunized with a high-payload monovalent FMD vaccine developed high titers of neutralizing antibodies at 7 days postvaccination (dpv), reaching a plateau at 29 dpv. FMDV-specific antibody-secreting cells (ASC), predominantly IgM, were evident at 7 dpv in the prescapular lymph node (LN) draining the vaccination site and in distal LN draining the respiratory mucosa, although in lower numbers. At 29 dpv, a significant switch to IgG1 was clear in prescapular LN, while FMDV-specific ASC were detected in all lymphoid tissues draining the respiratory tract, mostly as IgM-secreting cells. None of the animals (n = 10) exhibited FMD symptoms after oronasal challenge at 30 dpv. Three days postinfection, a large increase in ASC numbers and rapid isotype switches to IgG1 were observed, particularly in LN-draining virus replication sites already described. These results indicate for the first time that systemic FMD vaccination in cattle effectively promotes the presence of anti-FMDV ASC in lymphoid tissues associated with the respiratory system. Oronasal infection triggered an immune reaction compatible with a local anamnestic response upon contact with the replicating FMDV, suggesting that FMD vaccination induces the circulation of virus-specific B lymphocytes, including memory B cells that differentiate into ASC soon after contact with the infective virus. IMPORTANCE Over recent decades, world animal health organizations as well as national sanitary authorities have supported the use of vaccination as an essential component of the official FMD control programs in both endemic and disease

  1. Concomitantly elevated serum matrix metalloproteinases 3 and 9 can predict survival of synchronous squamous cell carcinoma of the upper aero-digestive tract.

    PubMed

    Wang, Wen-Lun; Chang, Wei-Lun; Yeh, Yi-Chun; Lee, Ching-Tai; Chang, Chi-Yang; Lin, Jaw-Town; Sheu, Bor-Shyang

    2013-06-01

    Matrix metalloproteinases (MMPs) are elevated in patients with squamous cell carcinoma (SCC) over either the head and neck (HNSCC) or the esophagus (ESCC). Synchronous SCC with both HNSCC and ESCC predispose to worse survival. This study tested if serum MMP levels correlate with clinical features and predict survival for HNSCC, ESCC, and synchronous SCC. One hundred and thirty patients with SCCs in upper aero-digestive tract (70 ESCC, 20 HNSCC, and 40 synchronous SCC) and 74 healthy controls were assessed for serum MMP-3, -7, and -9 titers by enzyme-linked immunosorbent assay. The titers were validated to their correlations to clinical features and survival rates of the different SCC groups. Patients with SCCs had significantly higher serum MMP-3, -7, and -9 titers than the controls (P < 0.001) but there was no difference among the three SCC groups. Based on the optimal MMP cut-off values by ROC curve, elevated MMP-3 and MMP-9, but not MMP-7, correlated with distant metastasis and poor survival (P < 0.05). Concomitantly elevated MMP-3 (>14 ng/mL) and MMP-9 (>329.3 ng/mL) independently correlated with poor two-year survival (P = 0.002, by log rank test). Cox regression confirmed that such concomitant elevation was superior to the tumor stage of either ESCC or HNSCC in predicting survival for synchronous SCC. Serum MMPs are elevated in SCC of the upper aero-digestive tract. Especially for synchronous SCC, concomitantly elevated MMP-3 and MMP-9 levels serve as better biomarkers to predict prognosis than TNM staging of ESCC or HNSCC.

  2. A comparison of the clinical outcome between open and hand-assisted laparoscopic nephroureterectomy for upper urinary tract transitional cell carcinoma.

    PubMed

    Hsueh, Thomas Y; Huang, Yi-Hsiu; Chiu, Allen W; Shen, Kun-Hung; Lee, Ying-Huei

    2004-10-01

    To report the surgical outcome of retroperitoneoscopic hand-assisted laparoscopic nephroureterectomy (LNU) with bladder cuff excision for upper urinary tract transitional cell carcinoma (TCC), and to compare the outcome with that of the open procedure (ONU). From January 1998 to January 2003, 145 patients with upper urinary tract TCC were enrolled in the study; 87 had ONU and 58 retroperitoneoscopic hand-assisted LNU. The specimens were reviewed by experienced pathologists to confirm the pathological stage. Operative duration, intraoperative blood loss, bowel recovery, analgesic use, hospital stay and time to convalescence were compared for both groups. The Mann-Whitney U-test and Fisher's exact test were used for statistical analysis. RESULTS The mean follow-up for ONU and LNU was 35.1 and 16.0 months, the mean operative duration 230.2 and 259.1 min (P = 0.006), the mean blood loss 747.3 and 408.9 mL (P < 0.001), the mean duration of Foley catheterization 6.8 and 5.1 days (P < 0.001), and the hospital stay 12.6 and 9.3 days (P < 0.001). The bladder recurrence rate 2 years after surgery was 9.1% for ONU and 8.6% for LNU (P = 0.23); the local recurrence rate during the follow-up was 3.4% and none, respectively (P = 0.35). Although LNU took longer than ONU the intraoperative bleeding and hospital stay were better than for ONU. Both procedures have statistically comparable bladder recurrence and local recurrence rates.

  3. The European Union approach to fuel cell development

    NASA Astrophysics Data System (ADS)

    Borthwick, William K. D.

    The European Union (EU) approach to fuel cell development should be viewed within the wider context of energy and environment policy. The energy policy is built on four main pillars — ensuring security of supply including the long term substitution of fossil fuels, improving competitiveness, achieving greater sustainability, and developing clean, efficient energy technologies. The prospect of fuel cells, as well as other technologies, to contribute positively to all these aspects of energy policy is widely recognised. Fuel cells can exploit diversified primary energy sources including renewable, and offer intrinsically clean, highly efficient energy conversion. Over successive Framework Programmes for Research, the European Commission has increased its financial support to fuel cell RTD&D. The recently launched Fifth Framework Programme introduces a problem-solving approach in which fuel cells will have to compete for funding support by demonstrating their ability to achieve ambitious cost and performance targets.

  4. Alternative approach of cell encapsulation by Volvox spheres.

    PubMed

    Teong, Benjamin; Manousakas, Ioannis; Chang, Shwu Jen; Huang, Han Hsiang; Ju, Kuen-Cheng; Kuo, Shyh Ming

    2015-10-01

    Volvox sphere is a bio-mimicking concept of a biomaterial structure design able to encapsulate chemicals, drugs and/or cells. The aim of this study was to prepare Volvox spheres encapsulating AML12 liver cells and mesenchymal stem cells (MSCs) via a high voltage electrostatic field system. The results demonstrated that AML12 liver cells and MSCs could be successfully encapsulated into the inner spheres and the outer sphere of the Volvox spheres. The improved cell viability of MSCs was achieved by the addition of collagen and polyethylene glycol into the preparation components of the Volvox spheres. Collagen material potentially provides extracellular matrix-like structure for cell adhesion while polyethylene glycol provides a void/loose space for permeability of metabolites. The encapsulated MSCs were able to differentiate into hepatocytes or hepatocyte-like cells and express liver cell markers including albumin, alpha feto-protein and cytokeratin 18. The encapsulated cells secreted albumin to about 140 ng on day 14. Based on these observations, we conclude that Volvox spheres can be used as an alternative approach to encapsulate multiple types of cells, here AML12 hepatocyte cell line and MSCs. Nevertheless, efforts are still needed to improve the viability of the encapsulated cells and increase the differentiation of MSCs into functional liver cells. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Various contact approaches for the finite cell method

    NASA Astrophysics Data System (ADS)

    Konyukhov, Alexander; Lorenz, Christian; Schweizerhof, Karl

    2015-08-01

    The finite cell method (FCM) provides a method for the computation of structures which can be described as a mixture of high-order FEM and a special integration technique. The method is one of the novel computational methods and is highly developed within the last decade. One of the major problems of FCM is the description of boundary conditions inside cells as well as in sub-cells. And a completely open problem is the description of contact. Therefore, the motivation of the current work is to develop a set of computational contact mechanics approaches which will be effective for the finite element cell method. Thus, for the FCM method we are developing and testing hereby focusing on the Hertz problem the following algorithms: direct integration in the cell method, allowing the fastest implementation, but suffering from numerical artifacts such as the "stamp effect"; the most efficient scheme concerning approximation properties the cell-surface-to-analytical-surface contact element designed for contact with rigid bodies leading to cell-wisely contact elements; and finally the discrete-cell-to-cell contact approach based on the finite discrete method. All developed methods are carefully verified with the analytical Hertz solution. The cell subdivisions, the order of the shape functions as well as the selection of the classes for shape functions are investigated for all developed contact approaches. This analysis allows to choose the most robust approach depending on the needs of the user such as correct representation of the stresses, or only satisfaction of geometrical non-penetration conditions.

  6. Computational approaches to substrate-based cell motility

    NASA Astrophysics Data System (ADS)

    Ziebert, Falko; Aranson, Igor S.

    2016-07-01

    Substrate-based crawling motility of eukaryotic cells is essential for many biological functions, both in developing and mature organisms. Motility dysfunctions are involved in several life-threatening pathologies such as cancer and metastasis. Motile cells are also a natural realisation of active, self-propelled 'particles', a popular research topic in nonequilibrium physics. Finally, from the materials perspective, assemblies of motile cells and evolving tissues constitute a class of adaptive self-healing materials that respond to the topography, elasticity and surface chemistry of the environment and react to external stimuli. Although a comprehensive understanding of substrate-based cell motility remains elusive, progress has been achieved recently in its modelling on the whole-cell level. Here we survey the most recent advances in computational approaches to cell movement and demonstrate how these models improve our understanding of complex self-organised systems such as living cells.

  7. Tracking cell proliferation using a nanotechnology-based approach.

    PubMed

    Altea-Manzano, Patricia; Unciti-Broceta, Juan Diego; Cano-Cortes, Victoria; Ruiz-Blas, María Paz; Valero-Griñan, Teresa; Diaz-Mochon, Juan Jose; Sanchez-Martin, Rosario

    2017-07-01

    To develop an efficient nanotechnology fluorescence-based method to track cell proliferation to avoid the limitations of current cell-labeling dyes. Synthesis, PEGylation, bifunctionalization and labeling with a fluorophore (Cy5) of 200 nm polystyrene nanoparticles (NPs) were performed. These NPs were characterized and assessed for in vitro long-term monitoring of cell proliferation. The optimization and validation of this method to track long-term cell proliferation assays have been achieved with high reproducibility, without cell cycle disruption. This method has been successfully applied in several adherent and suspension cells including hard-to-transfect cells and isolated human primary lymphocytes. A novel approach to track efficiently cellular proliferation by flow cytometry using fluorescence labeled NPs has been successfully developed. [Formula: see text].

  8. Computational approaches to substrate-based cell motility

    DOE PAGES

    Ziebert, Falko; Aranson, Igor S.

    2016-07-15

    Substrate-based crawling motility of eukaryotic cells is essential for many biological functions, both in developing and mature organisms. Motility dysfunctions are involved in several life-threatening pathologies such as cancer and metastasis. Motile cells are also a natural realization of active, self-propelled ‘particles’, a popular research topic in nonequilibrium physics. Finally, from the materials perspective, assemblies of motile cells and evolving tissues constitute a class of adaptive self-healing materials that respond to the topography, elasticity, and surface chemistry of the environment and react to external stimuli. Although a comprehensive understanding of substrate-based cell motility remains elusive, progress has been achieved recentlymore » in its modeling on the whole cell level. Furthermore we survey the most recent advances in computational approaches to cell movement and demonstrate how these models improve our understanding of complex self-organized systems such as living cells.« less

  9. Computational approaches to substrate-based cell motility

    SciTech Connect

    Ziebert, Falko; Aranson, Igor S.

    2016-07-15

    Substrate-based crawling motility of eukaryotic cells is essential for many biological functions, both in developing and mature organisms. Motility dysfunctions are involved in several life-threatening pathologies such as cancer and metastasis. Motile cells are also a natural realization of active, self-propelled ‘particles’, a popular research topic in nonequilibrium physics. Finally, from the materials perspective, assemblies of motile cells and evolving tissues constitute a class of adaptive self-healing materials that respond to the topography, elasticity, and surface chemistry of the environment and react to external stimuli. Although a comprehensive understanding of substrate-based cell motility remains elusive, progress has been achieved recently in its modeling on the whole cell level. Furthermore we survey the most recent advances in computational approaches to cell movement and demonstrate how these models improve our understanding of complex self-organized systems such as living cells.

  10. Mucoadhesion and the gastrointestinal tract.

    PubMed

    Varum, Felipe J O; McConnell, Emma L; Sousa, Joao J S; Veiga, Francisco; Basit, Abdul W

    2008-01-01

    The concept of mucoadhesion is one that has the potential to improve the highly variable residence times experienced by drugs and dosage forms at various sites in the gastrointestinal tract, and consequently, to reduce variability and improve efficacy. Intimate contact with the mucosa should enhance absorption or improve topical therapy. A variety of approaches have been investigated for mucoadhesion in the gastrointestinal tract, particularly for the stomach and small intestine. Despite interesting results in these sites, mucoadhesive approaches have not yet shown success in humans. The potential of the lower gut for these applications has been largely neglected, although the large intestine in particular may benefit, and the colon has several factors that suggest mucoadhesion could be successful there, including lower motility and the possibility of a lower mucus turnover and thicker mucus layer. In vitro studies on colonic mucoadhesion show promise, and rectal administration has shown some positive results in vivo. This review considers the background to mucoadhesion with respect to the physiological conditions of the gastrointestinal tract as well as the principles that underlie this concept. Mucoadhesive approaches to gastrointestinal drug delivery will be examined, with particular attention given to the lower gut.

  11. A Voronoi Interface approach to cell aggregate electropermeabilization

    NASA Astrophysics Data System (ADS)

    Guittet, Arthur; Poignard, Clair; Gibou, Frederic

    2017-03-01

    We present a Voronoi Interface approach to the study of cell electropermeabilization. We consider the nonlinear electropermeabilization model of Poignard et al. [20], which takes into account the jump in the voltage potential across cells' membrane. The jump condition is imposed in a sharp manner, using the Voronoi Interface Method of Guittet et al. [14], while adaptive Quad/Oc-tree grids are employed to automatically refine near the cells boundary for increased accuracy. Numerical results are provided to illustrate the accuracy of the methods. We also carry out simulations in three spatial dimensions to investigate the influence of shadowing and of the cells shape on the degree of permeabilization.

  12. Anti-viral activity of water extract of Paeonia lactiflora pallas against human respiratory syncytial virus in human respiratory tract cell lines.

    PubMed

    Lin, Tzeng-Jih; Wang, Kuo-Chih; Lin, Chun-Ching; Chiang, Lien-Chai; Chang, Jung-San

    2013-01-01

    Paeonia lactiflora Pallas (P. lactiflora, Ranunculaceae) is a common ingredient of Sheng-Ma-Ge-Gen-Tang (SMGGT; Shoma-kakkon-to) and Ge-Gen-Tang (GGT; kakkon-to). SMGGT and GGT are different prescriptions of traditional Chinese medicine with different ingredients designed for airway symptoms. Both SMGGT and GGT have anti-viral activity against human respiratory syncytial virus (HRSV). Therefore, P. lactiflora was hypothesized to be the effective ingredient of both SMGGT and GGT against HRSV. However, P. lactiflora does not have any proven antiviral activity. This study used both human upper (Human larynx epidermoid carcinoma cell line, HEp-2) and lower (human lung carcinoma cell line, A549) respiratory tract cells to test the hypothesis that a hot water extract of P. lactiflora could effectively inhibit plaque formation induced by HRSV infection. The ability of P. lactiflora to stimulate anti-viral cytokines was evaluated by enzyme-linked immunosorbent assay (ELISA). The results showed that P. lactiflora was time-dependently and dose-dependently effective against HRSV in HEp-2 and A549 cells, particularly supplemented before viral inoculation (p < 0.0001). 10 μg/ml P. lactiflora had a comparable anti-HRSV activity with 10 μg/ml ribavirin, a broad-spectrum antiviral agent. P. lactiflora was dose-dependently effective against viral attachment (p < 0.0001), with a better effect on A549 cells (p < 0.0001). P. lactiflora was time-dependently (p < 0.0001) and dose-dependently (p < 0.0001) effective against viral penetration. Moreover, P. lactiflora stimulated IFN-β secretion without any effect on TNF-α secretion. Therefore, P. lactiflora could be beneficial at preventing HRSV infection by inhibiting viral attachment, internalization, and stimulating IFN secretion.

  13. A chemical genetics approach for specific differentiation of stem cells to somatic cells: a new promising therapeutical approach.

    PubMed

    Sachinidis, Agapios; Sotiriadou, Isaia; Seelig, Bianca; Berkessel, Albrecht; Hescheler, Jürgen

    2008-01-01

    Cell replacement therapy of severe degenerative diseases such as diabetes, myocardial infarction and Parkinson's disease through transplantation of somatic cells generated from embryonic stem (ES) cells is currently receiving considerable attention for the therapeutic applications. ES cells harvested from the inner cell mass (ICM) of the early embryo, can proliferate indefinitely in vitro while retaining the ability to differentiate into all somatic cells thereby providing an unlimited renewable source of somatic cells. In this context, identifying soluble factors, in particular chemically synthesized small molecules, and signal cascades involved in specific differentiation processes toward a defined tissue specific cell type are crucial for optimizing the generation of somatic cells in vitro for therapeutic approaches. However, experimental models are required allowing rapid and "easy-to-handle" parallel screening of chemical libraries to achieve this goal. Recently, the forward chemical genetic screening strategy has been postulated to screen small molecules in cellular systems for a specific desired phenotypic effect. The current review is focused on the progress of ES cell research in the context of the chemical genetics to identify small molecules promoting specific differentiation of ES cells to desired cell phenotype. Chemical genetics in the context of the cell ES-based cell replacement therapy remains a challenge for the near future for several scientific fields including chemistry, molecular biology, medicinal physics and robotic technologies.

  14. Indolent T-cell lymphoproliferative disease of the gastrointestinal tract after treatment with adalimumab in resistant Crohn's colitis.

    PubMed

    Edison, Natalia; Belhanes-Peled, Hila; Eitan, Yuval; Guthmann, Yifat; Yeremenko, Yelena; Raffeld, Mark; Elmalah, Irit; Trougouboff, Philippe

    2016-11-01

    We report a case of intestinal indolent T-cell lymphoproliferative disease (TCLPD) occurring after the initiation of tumor necrosis factor-α (TNF-α) inhibitor therapy for resistant Crohn's disease. A prominent T-cell infiltrate positive for CD8, TIA-1, and T-cell receptor-βF1 was associated with the foci of active inflammation. T-cell receptor gene clonality studies (BIOMED-2) demonstrated monoclonality. After the TNF-α inhibitor treatment was withdrawn, the T-cell infiltrates regressed, but 2 years later, the same monoclonal T-cell infiltrate reappeared at the only site of active inflammation. To the best of our knowledge, this report is the first to show a link between active inflammation and the TCLPD. In addition, it suggests a possible influence of the TNF-α inhibitor treatment on the evolution of the TCLPD. A high degree of suspicion is required in the presence of any unusual lymphoid infiltrate in inflammatory bowel disease to avoid overlooking an indolent TCLPD or misdiagnose an aggressive lymphoma.

  15. Microfluidic approaches for epithelial cell layer culture and characterisation

    PubMed Central

    Thuenauer, Roland; Rodriguez-Boulan, Enrique; Römer, Winfried

    2014-01-01

    In higher eukaryotes, epithelial cell layers line most body cavities and form selective barriers that regulate the exchange of solutes between compartments. In order to fulfil these functions, the cells assume a polarised architecture and maintain two distinct plasma membrane domains, the apical domain facing the lumen and the basolateral domain facing other cells and the extracellular matrix. Microfluidic biochips offer the unique opportunity to establish novel in vitro models of epithelia in which the in vivo microenvironment of epithelial cells is precisely reconstituted. In addition, analytical tools to monitor biologically relevant parameters can be directly integrated on-chip. In this review we summarise recently developed biochip designs for culturing epithelial cell layers. Since endothelial cell layers, which line blood vessels, have similar barrier functions and polar organisation as epithelial cell layers, we also discuss biochips for culturing endothelial cell layers. Furthermore, we review approaches to integrate tools to analyse and manipulate epithelia and endothelia in microfluidic biochips, including methods to perform electrical impedance spectroscopy, methods to detect substances undergoing trans-epithelial transport via fluorescence, spectrophotometry, and mass spectrometry, techniques to mechanically stimulate cells via stretching and fluid flow-induced shear stress, and methods to carry out high-resolution imaging of vesicular trafficking with light microscopy. Taken together, this versatile microfluidic toolbox enables novel experimental approaches to characterise epithelial monolayers. PMID:24668405

  16. Some new approaches to the detection of programmed cell death

    NASA Astrophysics Data System (ADS)

    Bilyy, Rostyslav O.; Bilyi, Alexander I.; Getman, Vasyl B.; Kit, Yuriy Ya.; Mayor, Christina Ya.; Antonyuk, Volodmyr O.; Stoika, Rostyslav S.

    2006-08-01

    Apoptosis, or programmed cell death, is a form of cell death occurring during normal physiological processes and is used by the multicellular organism for elimination of "old" and impaired cells. Apoptosis is characterized by specific morphological changes such as plasma membrane blebbing, nucleus condensation, and cell wrinkling with further destruction into apoptotic bodies. Apoptosis detection is in focus of instrumental methods used in modern biomedical sciences. The available methods for such purpose are either very expensive, or require time-consuming operations. Their specificity and sensitivity are frequently not sufficient for biomedical diagnostics. We propose to use light scattering analysis for evaluation of apoptosis in cell population, especially for the detection of physical changes of cells, such as cell condensation and degradation into apoptotic bodies. The method proved to be very effective, providing quantitative estimation and high precision, simplicity and low costs of analysis (UA Patent No.64090). Another approach for the detection of apoptosis is based on the recently discovered fact (Bilyy, Stoika 2003; Bilyy et al, 2004; 2005) that apoptotic cells are characterized by increased expression levels of specific glycoproteins in the plasma membrane, which were proved to be selective and specific markers of apoptotic cells. Specific carbohydrate-binding proteins - lectins - were used for identification of mentioned glycoproteins; fluorescent conjugates of lectins were proved to be another novel tool for apoptosis identification using approaches of biophotonics.

  17. Systems biology approaches to understanding stem cell fate choice.

    PubMed

    Peltier, J; Schaffer, D V

    2010-01-01

    Stem cells have the capability to self-renew and maintain their undifferentiated state or to differentiate into one or more specialised cell types. Stem cell expansion and manipulation ex vivo is a promising approach for engineering cell replacement therapies, and endogenous stem cells represent potential drugable targets for tissue repair. Before we can harness stem cells' therapeutic potential, we must first understand the intracellular mechanisms controlling their fate choices. These mechanisms involve complex signal transduction and gene regulation networks that feature, for example, intricate feed-forward loops, feedback loops and cross-talk between multiple signalling pathways. Systems biology applies computational and experimental approaches to investigate the emergent behaviour of collections of molecules and strives to explain how these numerous components interact to regulate molecular, cellular and organismal behaviour. Here we review systems biology, and in particular computational, efforts to understand the intracellular mechanisms of stem cell fate choice. We first discuss deterministic and stochastic models that synthesise molecular knowledge into mathematical formalism, enable simulation of important system behaviours and stimulate further experimentation. In addition, statistical analyses such as Bayesian networks and principal components analysis (PCA)/partial least squares (PLS) regression can distill large datasets into more readily managed networks and principal components that provide insights into the critical aspects and components of regulatory networks. Collectively, integrating modelling with experimentation has strong potential for enabling a deeper understanding of stem cell fate choice and thereby aiding the development of therapies to harness stem cells' therapeutic potential.

  18. Treating breast cancer with cell-based approaches: an overview.

    PubMed

    Gallo, Susanna; Sangiolo, Dario; Carnevale Schianca, Fabrizio; Aglietta, Massimo; Montemurro, Filippo

    2017-10-01

    Breast cancer is the most common malignancy in women. Despite there being considerable progress in the treatment of this disease, metastatic dissemination is still considered an incurable condition at the present time, causing 500,000 deaths worldwide every year. Although most of the research efforts have been focused on pharmacological approaches, over the last three decades, the use of bone marrow and peripheral blood-derived cell therapy approaches have been attempted and developed. Areas covered: This review will briefly address cell therapy for breast cancer, including autologous stem cell transplantations for overcoming the myelosuppressive effects of high-dose chemotherapy, allogeneic stem cell transplants and adoptive immunotherapy using bone-marrow derived T-cells. Expert opinion: The treatment of breast cancer using bone marrow or peripheral-blood derived cells has evolved from a supportive care approach to allow dose escalation of conventional chemotherapy to a therapeutic strategy aimed at eliciting immune cell mediated anticancer immunity. This latter principle has led to the development of adoptive immunotherapies, either with 'natural' or genetically engineered effectors, which are being intensively investigated for their great potential against several solid tumors, including breast cancer.

  19. FXR agonists enhance the sensitivity of biliary tract cancer cells to cisplatin via SHP dependent inhibition of Bcl-xL expression

    PubMed Central

    Wang, Wei; Zhan, Ming; Li, Qi; Chen, Wei; Chu, Huiling; Huang, Qihong; Hou, Zhaoyuan; Man, Mohan; Wang, Jian

    2016-01-01

    Chemoresistance is common in patients with biliary tract cancer (BTC) including gallbladder cancer (GBC) and cholangiocarcinoma (CC). Therefore, it is necessary to identify effective chemotherapeutic agents for BTC. In the present study, we for the first time tested the effect of farnesoid X receptor (FXR) agonists GW4064 and CDCA (chenodeoxycholic acid) in combination with cisplatin (CDDP) on increasing the chemosensitivity in BTC. Our results show that co-treatment of CDDP with FXR agonists remarkably enhance chemosensitivity of BTC cells. Mechanistically, we found that activation of FXR induced expression of small heterodimer partner (SHP), which in turn inhibited signal transducer and activator of transcription 3 (STAT3) phosphorylation and resulted in down-regulation of Bcl-xL expression in BTC cells, leading to increased susceptibility to CDDP. Moreover, the experiments on tumor-bearing mice showed that GW4064/CDDP co-treatment inhibited the tumor growth in vivo by up-regulating SHP expression and down-regulating STAT3 phosphorylation. These results suggest CDDP in combination with FXR agonists could be a potential new therapeutic strategy for BTC. PMID:27127878

  20. In Vitro Passage Selects for Chlamydia muridarum with Enhanced Infectivity in Cultured Cells but Attenuated Pathogenicity in Mouse Upper Genital Tract

    PubMed Central

    Chen, Chaoqun; Zhou, Zhou; Conrad, Turner; Yang, Zhangsheng; Dai, Jin; Li, Zhongyu

    2015-01-01

    Although modern Chlamydia muridarum has been passaged for decades, there are no reports on the consequences of serial passage with strong selection pressure on its fitness. In order to explore the potential for Pasteurian selection to induce genomic and phenotypic perturbations to C. muridarum, a starter population was passaged in cultured cells for 28 generations without standard infection assistance. The resultant population, designated CMG28, displays markedly reduced in vitro dependence on centrifugation for infection and low incidence and severity of upper genital tract pathology following intravaginal inoculation into mice compared to the parental C. muridarum population, CMG0. Deep sequencing of CMG0 and CMG28 revealed novel protein variants in the hypothetical genes TC0237 (Q117E) and TC0668 (G322R). In vitro attachment assays of isogenic plaque clone pairs with mutations in either TC0237 and TC0668 or only TC0237 reveal that TC0237(Q117E) is solely responsible for enhanced adherence to host cells. Paradoxically, double mutants, but not TC0237(Q117E) single mutants, display severely attenuated in vivo pathogenicity. These findings implicate TC0237 and TC0668 as novel genetic factors involved in chlamydial attachment and pathogenicity, respectively, and show that serial passage under selection pressure remains an effective tool for studying Chlamydia pathogenicity. PMID:25712926

  1. Hydrogen Fuel Cell on a Helicopter: A System Engineering Approach

    NASA Astrophysics Data System (ADS)

    Nesheiwat, Rod

    Hydrogen fuel cells have been previously investigated as a viable replacement to traditional gas turbine auxiliary power unit onboard fixed wing commercial jets. However, so far no study has attempted to extend their applicability to rotary wing aircrafts. To aid in the advancement of such innovative technologies, a holistic technical approach is required to ensure risk reduction and cost effectiveness throughout the product lifecycle. This paper will evaluate the feasibility of replacing a gas turbine auxiliary power unit on a helicopter with a direct hydrogen, air breathing, proton exchange membrane fuel cell, all while emphasizing a system engineering approach that utilize a specialized set of tools and artifacts.

  2. Monte Carlo approach to tissue-cell populations

    NASA Astrophysics Data System (ADS)

    Drasdo, D.; Kree, R.; McCaskill, J. S.

    1995-12-01

    We describe a stochastic dynamics of tissue cells with special emphasis on epithelial cells and fibro- blasts and fibrocytes of the connective tissue. Pattern formation and growth characteristics of such cell populations in culture are investigated numerically by Monte Carlo simulations for quasi-two-dimensional systems of cells. A number of quantitative predictions are obtained which may be confronted with experimental results. Furthermore we introduce several biologically motivated variants of our basic model and briefly discuss the simulation of two dimensional analogs of two complex processes in tissues: the growth of a sarcoma across an epithelial boundary and the wound healing of a skin cut. As compared to other approaches, we find the Monte Carlo approach to tissue growth and structure to be particularly simple and flexible. It allows for a hierarchy of models reaching from global description of birth-death processes to very specific features of intracellular dynamics. (c) 1995 The American Physical Society

  3. Cardiac outflow tract anomalies

    PubMed Central

    Neeb, Zachary; Lajiness, Jacquelyn D.; Bolanis, Esther; Conway, Simon J

    2014-01-01

    The mature outflow tract (OFT) is, in basic terms, a short conduit. It is a simple, although vital, connection situated between contracting muscular heart chambers and a vast embryonic vascular network. Unfortunately, it is also a focal point underlying many multifactorial congenital heart defects (CHDs). Through the use of various animal models combined with human genetic investigations, we are beginning to comprehend the molecular and cellular framework that controls OFT morphogenesis. Clear roles of neural crest cells (NCC) and second heart field (SHF) derivatives have been established during OFT formation and remodeling. The challenge now is to determine how the SHF and cardiac NCC interact, the complex reciprocal signaling that appears to be occurring at various stages of OFT morphogenesis, and finally how endocardial progenitors and primary heart field (PHF) communicate with both these colonizing extra-cardiac lineages. Although we are beginning to understand that this dance of progenitor populations is wonderfully intricate, the underlying pathogenesis and the spatiotemporal cell lineage interactions remain to be fully elucidated. What is now clear is that OFT alignment and septation are independent processes, invested via separate SHF and cardiac neural crest (CNC) lineages. This review will focus on our current understanding of the respective contributions of the SHF and CNC lineage during OFT development and pathogenesis. PMID:24014420

  4. Vertebrate mRNAs with a 5'-terminal pyrimidine tract are candidates for translational repression in quiescent cells: characterization of the translational cis-regulatory element.

    PubMed Central

    Avni, D; Shama, S; Loreni, F; Meyuhas, O

    1994-01-01

    The translation of mammalian ribosomal protein (rp) mRNAs is selectively repressed in nongrowing cells. This response is mediated through a regulatory element residing in the 5' untranslated region of these mRNAs and includes a 5' terminal oligopyrimidine tract (5' TOP). To further characterize the translational cis-regulatory element, we monitored the translational behavior of various endogenous and heterologous mRNAs or hybrid transcripts derived from transfected chimeric genes. The translational efficiency of these mRNAs was assessed in cells that either were growing normally or were growth arrested under various physiological conditions. Our experiments have yielded the following results: (i) the translation of mammalian rp mRNAs is properly regulated in amphibian cells, and likewise, amphibian rp mRNA is regulated in mammalian cells, indicating that all of the elements required for translation control of rp mRNAs are conserved among vertebrate classes; (ii) selective translational control is not confined to rp mRNAs, as mRNAs encoding the naturally occurring ubiquitin-rp fusion protein and elongation factor 1 alpha, which contain a 5' TOP, also conform this mode of regulation; (iii) rat rpP2 mRNA contains only five pyrimidines in its 5' TOP, yet this mRNA is translationally controlled in the same fashion as other rp mRNAs with a 5' TOP of eight or more pyrimidines; (iv) full manifestation of this mode of regulation seems to require both the 5' TOP and sequences immediately downstream; and (v) an intact translational regulatory element from rpL32 mRNA fails to exert its regulatory properties even when preceded by a single A residue. Images PMID:8196625

  5. Site-specific prevalence and cell densities of selected microbes in the lower reproductive tract of menstruating tampon users.

    PubMed Central

    Hochwalt, Anne E; Berg, Ronald W; Meyer, Sandy J; Eusebio, Rachelle

    2002-01-01

    OBJECTIVE: To assess differences in prevalence and cell densities of enterococci, Gram negative enterics (GNEs), yeast and Staphylococcus aureus among four genital sites and to examine whether the presence of organisms at one site affected the presence of organisms at other sites. METHODS: Swab samples from the perineum, below and above the hymen, and the posterior fornix obtained from 52 tampon users on menstrual cycle day 3 were analyzed for site-specific prevalence and cell densities of microorganisms. RESULTS: Enterococci and GNEs were the most prevalent study organisms at all sites and decreased in prevalence from the perineum to the posterior fornix. Cell densities similarly decreased from below the hymen to the posterior fornix. Yeast were detected at the hymen only; S. aureus frequency was similarly low at all sites. Yeast and S. aureus site-specific cell densities were similar. The above- and below-hymen sites were similar in prevalence and cell density of organisms. An above-chance association existed between the presence of any study organism below the hymen and above the hymen and was strongest for GNEs. CONCLUSIONS: The pattern of genital colonization with enterococci and GNEs reflects their likely gastrointestinal source. The absence of significant differences in the prevalence and cell densities of study microflora above and below the hymen combined with an above-chance association of the presence of microorganisms at these regions suggests that the regions above and below the hymen are not different with respect to the presence of the organisms evaluated in this study. PMID:12625970

  6. Approaches to semi-synthetic minimal cells: a review

    NASA Astrophysics Data System (ADS)

    Luisi, Pier Luigi; Ferri, Francesca; Stano, Pasquale

    2006-01-01

    Following is a synthetic review on the minimal living cell, defined as an artificial or a semi-artificial cell having the minimal and sufficient number of components to be considered alive. We describe concepts and experiments based on these constructions, and we point out that an operational definition of minimal cell does not define a single species, but rather a broad family of interrelated cell-like structures. The relevance of these researches, considering that the minimal cell should also correspond to the early simple cell in the origin of life and early evolution, is also explained. In addition, we present detailed data in relation to minimal genome, with observations cited by several authors who agree on setting the theoretical full-fledged minimal genome to a figure between 200 and 300 genes. However, further theoretical assumptions may significantly reduce this number (i.e. by eliminating ribosomal proteins and by limiting DNA and RNA polymerases to only a few, less specific molecular species). Generally, the experimental approach to minimal cells consists in utilizing liposomes as cell models and in filling them with genes/enzymes corresponding to minimal cellular functions. To date, a few research groups have successfully induced the expression of single proteins, such as the green fluorescence protein, inside liposomes. Here, different approaches are described and compared. Present constructs are still rather far from the minimal cell, and experimental as well as theoretical difficulties opposing further reduction of complexity are discussed. While most of these minimal cell constructions may represent relatively poor imitations of a modern full-fledged cell, further studies will begin precisely from these constructs. In conclusion, we give a brief outline of the next possible steps on the road map to the minimal cell.

  7. Bacterial Vaginosis Is Associated with Loss of Gamma Delta T Cells in the Female Reproductive Tract in Women in the Miami Women Interagency HIV Study (WIHS): A Cross Sectional Study

    PubMed Central

    Romero, Laura; Jones, Deborah L.; Rodriguez, Violeta J.; Arheart, Kristopher; Martinez, Octavio; Bolivar, Hector; Podack, Eckhard R.; Fischl, Margaret A.

    2016-01-01

    Bacterial vaginosis (BV) is the most common female reproductive tract infection and is associated with an increased risk of acquiring and transmitting HIV by a mechanism that is not well understood. Gamma delta (GD) T cells are essential components of the adaptive and innate immune system, are present in the female reproductive tract, and play an important role in epithelial barrier protection. GD1 cells predominate in the mucosal tissue and are important in maintaining mucosal integrity. GD2 cells predominate in peripheral blood and play a role in humoral immunity and in the immune response to pathogens. HIV infection is associated with changes in GD T cells frequencies in the periphery and in the female reproductive tract. The objective of this study is to evaluate if changes in vaginal flora occurring with BV are associated with changes in endocervical GD T cell responses, which could account for increased susceptibility to HIV. Seventeen HIV-infected (HIV+) and 17 HIV-uninfected (HIV-) pre-menopausal women underwent collection of vaginal swabs and endocervical cytobrushes. Vaginal flora was assessed using the Nugent score. GD T cells were assessed in cytobrush samples by flow cytometry. Median Nugent score was 5.0 and 41% of women had abnormal vaginal flora. In HIV uninfected women there was a negative correlation between Nugent score and cervical GD1 T cells (b for interaction = - 0.176, p<0.01); cervical GD1 T cells were higher in women with normal vaginal flora than in those with abnormal flora (45.00% vs 9.95%, p = 0.005); and cervical GD2 T cells were higher in women with abnormal flora than in those with normal flora (1.70% vs 0.35%, p = 0.023). GD T cells in the genital tract are protective (GD1) and are targets for HIV entry (GD2). The decrease in cervical GD1 and increase in GD2 T cells among women with abnormal vaginal flora predisposes women with BV to HIV acquisition. We propose to use GD T cell as markers of female genital tract vulnerability to

  8. Bacterial Vaginosis Is Associated with Loss of Gamma Delta T Cells in the Female Reproductive Tract in Women in the Miami Women Interagency HIV Study (WIHS): A Cross Sectional Study.

    PubMed

    Alcaide, Maria L; Strbo, Natasa; Romero, Laura; Jones, Deborah L; Rodriguez, Violeta J; Arheart, Kristopher; Martinez, Octavio; Bolivar, Hector; Podack, Eckhard R; Fischl, Margaret A

    2016-01-01

    Bacterial vaginosis (BV) is the most common female reproductive tract infection and is associated with an increased risk of acquiring and transmitting HIV by a mechanism that is not well understood. Gamma delta (GD) T cells are essential components of the adaptive and innate immune system, are present in the female reproductive tract, and play an important role in epithelial barrier protection. GD1 cells predominate in the mucosal tissue and are important in maintaining mucosal integrity. GD2 cells predominate in peripheral blood and play a role in humoral immunity and in the immune response to pathogens. HIV infection is associated with changes in GD T cells frequencies in the periphery and in the female reproductive tract. The objective of this study is to evaluate if changes in vaginal flora occurring with BV are associated with changes in endocervical GD T cell responses, which could account for increased susceptibility to HIV. Seventeen HIV-infected (HIV+) and 17 HIV-uninfected (HIV-) pre-menopausal women underwent collection of vaginal swabs and endocervical cytobrushes. Vaginal flora was assessed using the Nugent score. GD T cells were assessed in cytobrush samples by flow cytometry. Median Nugent score was 5.0 and 41% of women had abnormal vaginal flora. In HIV uninfected women there was a negative correlation between Nugent score and cervical GD1 T cells (b for interaction = - 0.176, p<0.01); cervical GD1 T cells were higher in women with normal vaginal flora than in those with abnormal flora (45.00% vs 9.95%, p = 0.005); and cervical GD2 T cells were higher in women with abnormal flora than in those with normal flora (1.70% vs 0.35%, p = 0.023). GD T cells in the genital tract are protective (GD1) and are targets for HIV entry (GD2). The decrease in cervical GD1 and increase in GD2 T cells among women with abnormal vaginal flora predisposes women with BV to HIV acquisition. We propose to use GD T cell as markers of female genital tract vulnerability to

  9. Congenital optic tract hypoplasia.

    PubMed

    Hatsukawa, Yoshikazu; Fujio, Takahiro; Nishikawa, Masanori; Taylor, David

    2015-08-01

    We report a case of isolated unilateral optic tract hypoplasia, described only twice previously. Bilateral optic disk hypoplasia was seen ophthalmoscopically and visual field studies showed an incongruous right homonymous hemianopia. Magnetic resonance imaging showed bilateral hypoplasia of both optic nerves and the left optic tract. Spectral domain optical coherence tomography mapping correlated well with the visual field studies.

  10. Urinary tract infection.

    PubMed

    Nicolle, Lindsay E

    2013-07-01

    The urinary tract is a common source for life-threatening infections. Most patients with sepsis or septic shock from a urinary source have complicated urinary tract infection. This article explains the epidemiology, risk factors, and treatment. Effective management, appropriate collection of microbiology specimens, prompt initiation of antimicrobial therapy, source control, and supportive therapy are described. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Pediatric Urinary Tract Infection

    MedlinePlus

    SBA National Resource Center: 800-621-3141 Pediatric Urinary Tract Infections and Catheterization in Children with Neurogenic Bladder and ... To protect the kidneys from damage – By preventing urinary tract infections (UTI) – By identifying and treating vesicoureteral remux (VUR). ...

  12. A quality risk management model approach for cell therapy manufacturing.

    PubMed

    Lopez, Fabio; Di Bartolo, Chiara; Piazza, Tommaso; Passannanti, Antonino; Gerlach, Jörg C; Gridelli, Bruno; Triolo, Fabio

    2010-12-01

    International regulatory authorities view risk management as an essential production need for the development of innovative, somatic cell-based therapies in regenerative medicine. The available risk management guidelines, however, provide little guidance on specific risk analysis approaches and procedures applicable in clinical cell therapy manufacturing. This raises a number of problems. Cell manufacturing is a poorly automated process, prone to operator-introduced variations, and affected by heterogeneity of the processed organs/tissues and lot-dependent variability of reagent (e.g., collagenase) efficiency. In this study, the principal challenges faced in a cell-based product manufacturing context (i.e., high dependence on human intervention and absence of reference standards for acceptable risk levels) are identified and addressed, and a risk management model approach applicable to manufacturing of cells for clinical use is described for the first time. The use of the heuristic and pseudo-quantitative failure mode and effect analysis/failure mode and critical effect analysis risk analysis technique associated with direct estimation of severity, occurrence, and detection is, in this specific context, as effective as, but more efficient than, the analytic hierarchy process. Moreover, a severity/occurrence matrix and Pareto analysis can be successfully adopted to identify priority failure modes on which to act to mitigate risks. The application of this approach to clinical cell therapy manufacturing in regenerative medicine is also discussed.

  13. Nicotine interferes with purinergic signaling in smooth muscle cells isolated from urinary bladders of patients with lower urinary tract symptoms.

    PubMed

    Jenes, Agnes; Szigeti, Gyula P; Ruzsnavszky, Ferenc; Varga, Attila; Lorincz, Laszlo; Csernoch, Laszlo

    2013-09-01

    In patients with outlet obstruction, the contraction of the base is reduced compared to that of healthy individuals, while the contraction of the dome is not affected. Here, we investigated the cellular mechanisms that might be responsible for cholinergic effects blocking non-adrenergic non-cholinergic contractions in the base of the urinary bladder. Smooth muscle cells either from the base or from the dome of human urinary bladders were cultured to determine the contribution of cholinergic and purinergic mechanisms to their Ca2+ homeostasis. While ATP evoked Ca2+ transients in all the cells, nicotine and carbachol induced Ca2+ transients only in 56% and 44% of the cells, respectively. When ATP was administered together with nicotine or carbachol, the amplitudes of the Ca2+ transients recorded from cells prepared from the base of bladders were significantly smaller (42 ± 6% with nicotine and 56 ± 9% with carbachol) than those evoked by ATP alone. This inhibition was much less apparent in the dome of bladders. The inhibition between the cholinergic and purinergic signaling pathways reported in this work may decrease the strength of the contraction of the base of the urinary bladder in patients with outlet obstruction during voiding.

  14. MyD88 deficiency leads to decreased NK cell gamma interferon production and T cell recruitment during Chlamydia muridarum genital tract infection, but a predominant Th1 response and enhanced monocytic inflammation are associated with infection resolution.

    PubMed

    Nagarajan, Uma M; Sikes, James; Prantner, Daniel; Andrews, Charles W; Frazer, Lauren; Goodwin, Anna; Snowden, Jessica N; Darville, Toni

    2011-01-01

    We have previously shown that MyD88 knockout (KO) mice exhibit delayed clearance of Chlamydia muridarum genital infection compared to wild-type (WT) mice. A blunted Th1 response and ineffective suppression of the Th2 response were also observed in MyD88 KO mice. The goal of the present study was to investigate specific mechanisms whereby absence of MyD88 leads to these effects and address the compensatory mechanisms in the genital tract that ultimately clear infection in the absence of MyD88. It was observed that NK cells recruited to the genital tract in MyD88 KO mice failed to produce gamma interferon (IFN-γ) mRNA and protein. This defect was associated with decreased local production of interleukin-17 (IL-17), IL-18, and tumor necrosis factor alpha (TNF-α) but normal levels of IL-12p70. Additionally, recruitment of CD4 T cells to the genital tract was reduced in MyD88 KO mice compared to that in WT mice. Although chronic infection in MyD88 KO mice resulted in oviduct pathology comparable to that of WT mice, increased histiocytic inflammation was observed in the uterine horns. This was associated with increased CCL2 levels and recruitment of macrophages as a potential compensatory mechanism. Further deletion of TLR4-TRIF signaling in MyD88 KO mice, using TLR4/MyD88 double-KO mice, did not further compromise host defense against chlamydiae, suggesting that compensatory mechanisms are Toll-like receptor (TLR) independent. Despite some polarization toward a Th2 response, a Th1 response remained predominant in the absence of MyD88, and it provided equivalent protection against a secondary infection as observed in WT mice.

  15. Bioinformatics approaches to single-cell analysis in developmental biology.

    PubMed

    Yalcin, Dicle; Hakguder, Zeynep M; Otu, Hasan H

    2016-03-01

    Individual cells within the same population show various degrees of heterogeneity, which may be better handled with single-cell analysis to address biological and clinical questions. Single-cell analysis is especially important in developmental biology as subtle spatial and temporal differences in cells have significant associations with cell fate decisions during differentiation and with the description of a particular state of a cell exhibiting an aberrant phenotype. Biotechnological advances, especially in the area of microfluidics, have led to a robust, massively parallel and multi-dimensional capturing, sorting, and lysis of single-cells and amplification of related macromolecules, which have enabled the use of imaging and omics techniques on single cells. There have been improvements in computational single-cell image analysis in developmental biology regarding feature extraction, segmentation, image enhancement and machine learning, handling limitations of optical resolution to gain new perspectives from the raw microscopy images. Omics approaches, such as transcriptomics, genomics and epigenomics, targeting gene and small RNA expression, single nucleotide and structural variations and methylation and histone modifications, rely heavily on high-throughput sequencing technologies. Although there are well-established bioinformatics methods for analysis of sequence data, there are limited bioinformatics approaches which address experimental design, sample size considerations, amplification bias, normalization, differential expression, coverage, clustering and classification issues, specifically applied at the single-cell level. In this review, we summarize biological and technological advancements, discuss challenges faced in the aforementioned data acquisition and analysis issues and present future prospects for application of single-cell analyses to developmental biology. © The Author 2015. Published by Oxford University Press on behalf of the European

  16. Phenotypical characterization, distribution and quantification of different mast cell subtypes in transmural biopsies from the gastrointestinal tract of cats with inflammatory bowel disease.

    PubMed

    Kleinschmidt, Sven; Harder, Jasmine; Nolte, Ingo; Marsilio, Sina; Hewicker-Trautwein, Marion

    2010-10-15

    In this study subtypes, distribution and number of mast cells were investigated within mucosa and submucosa of the gastrointestinal tract of 24 cats with inflammatory bowel disease (IBD) in comparison to 11 control cats. Paraffin sections of formalin-fixed transmural gastrointestinal biopsies from stomach, duodenum, jejunum, ileum and colon were examined. Mast cells were phenotyped and quantified based on their chymase and tryptase content, by applying a combined enzyme-histochemical and immunohistochemical double-labeling technique and on their heparin content by a metachromatic staining method (kresylecht-violet, MC(KEV)). Mast cells containing both chymase and tryptase were not found in any of the samples examined. Furthermore, in the stomach neither chymase (MC(C)) nor tryptase (MC(T)) bearing mast cells were detected. In cats with lymphocytic-plasmacytic enteritis or enterocolitis elevated numbers of MC(T) or MC(C) were identified in comparison to controls mainly located in the inflamed segments. The highest quantity of MC(C) was found in cats with eosinophilic gastroenterocolitis or enterocolitis in comparison to other IBD forms, but only minor numbers of MC(T) were detected in these cases. In cats with fibrosing enteropathy (FE) a decrease of MC(C) and mast cells containing heparin was detected in affected segments, while increased numbers of MC(T) were detected in all locations. The elevation in the number of MC(T) was higher in unaffected areas than in fibrotic regions. Regarding all IBD cases higher counts of MC(C) were found especially in the inflamed locations, whereas in unaffected segments increased numbers of MC(T) were detected. The clear predominance of MC(C) and MC(T) within the mucosa and of MC(KEV) within the submucosa of all cats examined possibly represents differences of the cytokine milieu within the intestinal layers. In FE, mast cells are possibly pivotal for the containment of the inflammatory process because of their antiinflammatory

  17. Cell viability of microencapsulated Bifidobacterium animalis subsp. lactis under freeze-drying, storage and gastrointestinal tract simulation conditions.

    PubMed

    Shamekhi, Fatemeh; Shuhaimi, Mustafa; Ariff, Arbakariya; Manap, Yazid A

    2013-03-01

    The purpose of this study was to improve the survival of Bifidobacterium animalis subsp. lactis 10140 during freeze-drying process by microencapsulation, using a special pediatric prebiotics mixture (galactooligosaccharides and fructooligosaccharides). Probiotic microorganisms were encapsulated with a coat combination of prebiotics-calcium-alginate prior to freeze-drying. Both encapsulated and free cells were then freeze-dried in their optimized combinations of skim milk and prebiotics. Response surface methodology (RSM) was used to produce a coating combination as well as drying medium with the highest cell viability during freeze-drying. The optimum encapsulation composition was found to be 2.1 % Na-alginate, 2.9 % prebiotic, and 21.7 % glycerol. Maximum survival predicted by the model was 81.2 %. No significant (p > 0.05) difference between the predicted and experimental values verified the adequacy of final reduced models. The protection ability of encapsulation was then examined over 120 days of storage at 4 and 25 °C and exposure to a sequential model of infantile GIT conditions including both gastric conditions (pH 3.0 and 4.0, 90 min, 37 °C) and intestinal conditions (pH 7.5, 5 h, 37 °C). Significantly improved cell viability showed that microencapsulation of B. lactis 10140 with the prebiotics was successful in producing a stable symbiotic powdery nutraceutical.

  18. Campylobacter protein oxidation influences epithelial cell invasion or intracellular survival as well as intestinal tract colonization in chickens.

    PubMed

    Lasica, A M; Wyszynska, A; Szymanek, K; Majewski, P; Jagusztyn-Krynicka, E K

    2010-01-01

    The Dsb family of redox proteins catalyzes disulfide bond formation and isomerization. Since mutations in dsb genes change the conformation and stability of many extracytoplasmic proteins, and since many virulence factors of pathogenic bacteria are extracytoplasmic, inactivation of dsb genes often results in pathogen attenuation. This study investigated the role of 2 membrane-bound oxidoreductases, DsbB and DsbI, in the Campylobacter jejuni oxidative Dsb pathway. Campylobacter mutants, lacking DsbB or DsbI or both, were constructed by allelic replacement and used in the human intestinal epithelial T84 cell line for the gentamicin protection assay (invasion assay) and chicken colonization experiments. In C. coli strain 23/1, the inactivation of the dsbB or dsbI gene separately did not significantly affect the colonization process. However, simultaneous disruption of both membrane-bound oxidoreductase genes significantly decreased the strain’s ability to colonize chicken intestines. Moreover, C. jejuni strain 81-176 with mutated dsbB or dsbI genes showed reduced invasion/intracellular survival abilities. No cells of the double mutants (dsbB⁻ dsbI⁻) of C. jejuni 81-176 were recovered from human cells after 3 h of invasion.

  19. Fibrous Hydrogels for Cell Encapsulation: A Modular and Supramolecular Approach

    PubMed Central

    Włodarczyk-Biegun, Małgorzata K.; Farbod, Kambiz; Werten, Marc W. T.; Slingerland, Cornelis J.; de Wolf, Frits A.; van den Beucken, Jeroen J. J. P.; Leeuwenburgh, Sander C. G.; Cohen Stuart, Martien A.; Kamperman, Marleen

    2016-01-01

    Artificial 3-dimensional (3D) cell culture systems, which mimic the extracellular matrix (ECM), hold great potential as models to study cellular processes under controlled conditions. The natural ECM is a 3D structure composed of a fibrous hydrogel that provides both mechanical and biochemical cues to instruct cell behavior. Here we present an ECM-mimicking genetically engineered protein-based hydrogel as a 3D cell culture system that combines several key features: (1) Mild and straightforward encapsulation meters (1) ease of ut I am not so sure.encapsulation of the cells, without the need of an external crosslinker. (2) Supramolecular assembly resulting in a fibrous architecture that recapitulates some of the unique mechanical characteristics of the ECM, i.e. strain-stiffening and self-healing behavior. (3) A modular approach allowing controlled incorporation of the biochemical cue density (integrin binding RGD domains). We tested the gels by encapsulating MG-63 osteoblastic cells and found that encapsulated cells not only respond to higher RGD density, but also to overall gel concentration. Cells in 1% and 2% (weight fraction) protein gels showed spreading and proliferation, provided a relative RGD density of at least 50%. In contrast, in 4% gels very little spreading and proliferation occurred, even for a relative RGD density of 100%. The independent control over both mechanical and biochemical cues obtained in this modular approach renders our hydrogels suitable to study cellular responses under highly defined conditions. PMID:27223105

  20. Polypyrimidine tract-binding protein is critical for the turnover and subcellular distribution of CD40 ligand mRNA in CD4+ T cells.

    PubMed

    Matus-Nicodemos, Rodrigo; Vavassori, Stefano; Castro-Faix, Moraima; Valentin-Acevedo, Anibal; Singh, Karnail; Marcelli, Valentina; Covey, Lori R

    2011-02-15

    CD40L (CD154) is regulated at the posttranscriptional level by an activation-induced process that results in a highly stable transcript at extended times of T cell activation. Transcript stability is mediated by polypyrimidine tract-binding protein (PTB)-containing complexes (complex I and II) that bind to three adjacent CU-rich sequences within the 3' untranslated region. To assess the role of PTB in the expression and distribution of CD40L mRNA, PTB was targeted using short hairpin RNA in both primary T cells and a T cell line that recapitulates the stability phase of regulated CD40L mRNA decay. PTB knockdown resulted in a marked decrease in the mRNA stability that resulted in lowered CD40L surface expression. PTB was also critical for appropriate distribution of CD40L mRNA between the nucleus and cytoplasm and in the cytoplasm between the cytosol and the translating polysomes. The activation-induced formation of PTB-specific ribonucleoprotein complexes was observed only with cytoplasmic and not nuclear PTB indicating functional differences in the protein defined by cellular localization. Finally, we observed that cytoplasmic and nuclear PTB isoforms were differentially modified relative to each other and that the changes in cytoplasmic PTB were consistent with activation-induced phosphorylation. Together this work suggests that differentially modified PTB regulates CD40L expression at multiple steps by 1) retaining CD40L mRNA in the nucleus, 2) directly regulating mRNA stability at late times of activation, and 3) forming a ribonuclear complex that preferentially associates with translating ribosomes thus leading to an enhanced level of CD40L protein.

  1. Novel Immunotherapeutic Approaches for Head and Neck Squamous Cell Carcinoma

    PubMed Central

    Bann, Darrin V.; Deschler, Daniel G.; Goyal, Neerav

    2016-01-01

    The immune system plays a key role in preventing tumor formation by recognizing and destroying malignant cells. For over a century, researchers have attempted to harness the immune response as a cancer treatment, although this approach has only recently achieved clinical success. Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer worldwide and is associated with cigarette smoking, alcohol consumption, betel nut use, and human papillomavirus infection. Unfortunately, worldwide mortality from HNSCC remains high, partially due to limits on therapy secondary to the significant morbidity associated with current treatments. Therefore, immunotherapeutic approaches to HNSCC treatment are attractive for their potential to reduce morbidity while improving survival. However, the application of immunotherapies to this disease has been challenging because HNSCC is profoundly immunosuppressive, resulting in decreased absolute lymphocyte counts, impaired natural killer cell function, reduced antigen-presenting cell function, and a tumor-permissive cytokine profile. Despite these challenges, numerous clinical trials testing the safety and efficacy of immunotherapeutic approaches to HNSCC treatment are currently underway, many of which have produced promising results. This review will summarize immunotherapeutic approaches to HNSCC that are currently undergoing clinical trials. PMID:27669306

  2. Outgrowing endothelial and smooth muscle cells for tissue engineering approaches.

    PubMed

    Kolster, Moritz; Wilhelmi, Mathias; Schrimpf, Claudia; Hilfiker, Andres; Haverich, Axel; Aper, Thomas

    2017-01-01

    % in cultures cultivated with smooth muscle cell growth medium-2, respectively. Functional analyses revealed significantly higher levels of nitric oxide secretion, endothelialization capacity, and capillary formation in not expanded cultures cultivated with endothelial cell growth medium-2 in comparison to later stages of cultivation and mature aortic cells. Blood seems to be a reliable and feasible source for the isolation of both endothelial and smooth muscle cells for application in tissue engineering approaches. Whereas, early co-cultures of early and late outgrowth cells provide functional advantages, the differentiation of cells can be directed selectively by the used culture medium for the expansion of highly proliferative late outgrowth endothelial cells and late outgrowth smooth muscle cells, respectively.

  3. Chronic knockdown of the nucleus of the solitary tract AT1 receptors increases blood inflammatory-endothelial progenitor cell ratio and exacerbates hypertension in the spontaneously hypertensive rat.

    PubMed

    Shan, Zhiying; Zubcevic, Jasenka; Shi, Peng; Jun, Joo Y; Dong, Ying; Murça, Tatiane M; Lamont, Gwyneth J; Cuadra, Adolfo; Yuan, Wei; Qi, Yanfei; Li, Qiuhong; Paton, Julian F R; Katovich, Michael J; Sumners, Colin; Raizada, Mohan K

    2013-06-01

    AT1 receptor subtype a (AT1Ra) expression is increased in the nucleus of the solitary tract (NTS) in spontaneously hypertensive rat (SHR) compared with Wistar Kyoto controls. However, the chronic role of AT1Ra in the NTS for cardiovascular control is not well understood. In this study, we investigated the hypothesis that the NTS AT1Ra is involved in the neural regulation of the peripheral inflammatory status and linked with hypertension. Transduction of brain neuronal cultures with recombinant adeno-associated virus type 2 (AAV2)-AT1R-small hairpin RNA (shRNA) resulted in a 72% decrease in AT1Ra mRNA and attenuated angiotensin II-induced increase in extracellular signal-regulated kinase 1/2 phosphorylation and neuronal firing. Specific NTS microinjection of AAV2-AT1R-shRNA vector in the SHR resulted in a ≈30 mm Hg increase in the mean arterial pressure compared with control vector-injected animals (Sc-shRNA: 154±4 mm Hg; AT1R-shRNA: 183±10 mm Hg) and induced a resetting of the baroreflex control of heart rate to higher mean arterial pressure. In addition, AAV2-AT1R-shRNA-treated SHRs exhibited a 74% decrease in circulating endothelial progenitor cells (CD90+, CD4- / CD5- / CD8-) and a 300% increase in the circulating inflammatory cells, including CD4+ + CD8+, CD45+ / 3+ T lymphocytes, and macrophages (CD68+). As a result, the endothelial progenitor cell/inflammatory cells ratio was decreased by 8- to 15-fold in the AT1R-shRNA-treated SHR. However, identical injection of AAV2-AT1R-shRNA into the NTS of Wistar Kyoto rats had no effect on mean arterial pressure and inflammatory cells. These observations suggest that increased expression of the AT1Ra in SHR NTS may present a counterhypertensive mechanism involving inflammatory/angiogenic cells.

  4. High-risk human papilloma virus infection decreases the frequency of dendritic Langerhans' cells in the human female genital tract

    PubMed Central

    Jimenez-Flores, Rafael; Mendez-Cruz, Rene; Ojeda-Ortiz, Jorge; Muñoz-Molina, Rebeca; Balderas-Carrillo, Oscar; de la Luz Diaz-Soberanes, Maria; Lebecque, Serge; Saeland, Sem; Daneri-Navarro, Adrian; Garcia-Carranca, Alejandro; Ullrich, Stephen E; Flores-Romo, Leopoldo

    2006-01-01

    Dendritic cells (DC) are often arranged in planar layers in tissues with high antigenic exposure, such as skin and mucosae. Providing an en face view, this arrangement optimizes in situ analysis regarding morphology (even of individual dendrites), topographic distribution (regular/clustered) and quantification. The few reports on human genital DC usually utilize single markers and conventional sections, restricting immunolabelling only to cell parts sectioned by the cut. To better assess DC in situ, we labelled epithelial sheets, prepared from fresh cervix biopsies, with antibodies to major histocompatibility complex (MHC)-CII, CD1a and Langerin, revealing (with each of these markers) a dense DC network in a planar-like, regular distribution. Using the hybrid capture system to detect the high-risk mucotropic human papilloma virus (HPV) group, 16 positive and five negative women were studied and the results were compared between these groups. DC frequency per area was substantially reduced (to ≈ 50% for the three markers) in samples from all HPV-infected patients compared with samples from controls. Unlike HPV– samples, Langerin+ DC in HPV+ cervix exhibited a highly accentuated dendritic appearance. We believe this to be the first study using these three DC-restricted markers (Langerin, CD1a and MHC-CII) in cervical epithelial sheets from high-risk HPV+ donors and also the first study to demonstrate the morphological and quantitative changes triggered by high-risk HPV infection. Cervical DC reduction in early, premalignant high-risk HPV infection might represent viral subversion strategies interfering with efficient antigen handling by the immune system's peripheral sentinels, the DC, perhaps hampering appropriate recruitment and subsequent development of effector (cytotoxic) T cells. PMID:16423058

  5. Potential Beneficial Effects of Si-Wu-Tang on White Blood Cell Numbers and the Gastrointestinal Tract of γ-Ray Irradiated Mice

    PubMed Central

    Ni, Jin; Romero-Weaver, Ana L.; Kennedy, Ann R.

    2014-01-01

    Si-Wu-Tang (SWT) is a decoction consisting of a mixture of ingredients of Rehmanniae Radix, Angelica Radix, Chuanxiong Rhizoma and Paeoniae Radix. As a traditional Chinese herbal decoction, SWT has been widely used for the treatment of diseases characterized as blood and/or energy deficit. The present study was performed to evaluate the effects of SWT on the different populations of circulating white blood cells (WBCs) and gastrointestinal changes in γ-ray irradiated mice. Female mice were treated daily with orally administered SWT seven days before irradiation, until one day before irradiation or until one day before sample collection. WBC counts were determined from peripheral blood samples taken from the mice at different times post-irradiation. Hematoxylin and eosin (H&E) staining, as well as immunohistochemical analysis of fibrinogen, were utilized to evaluate the effects of SWT in the intestines of mice after radiation exposure. The results of the present studies demonstrate that SWT has protective effects against radiation damage to circulating WBCs, specifically to lymphocytes, and to the gastrointestinal tract of the irradiated animals. PMID:25324699

  6. Survival analysis in patients with upper urinary tract transitional cell carcinoma: a comparison between open and hand-assisted laparoscopic nephroureterectomy.

    PubMed

    Hsueh, Thomas Y; Huang, Yi-Hsiu; Chiu, Allen W; Huan, Steven K; Lee, Ying-Huei

    2007-03-01

    To evaluate the stage- and grade-specific survival rate in patients with upper urinary tract (UUT) transitional cell carcinoma (TCC) after open (ONU) or hand-assisted laparoscopic nephroureterectomy (LNU) with bladder-cuff excision. From January 1998 to April 2005, 143 patients with UUT-TCC were treated with either ONU or LNU and enrolled in the study. The peri-operative data were collected by retrospective chart review. The recurrence, metastasis and survival rate were calculated. The 5-year disease-specific survival of patients with pT1 disease was 88.1% after ONU and 92.0% after LNU (P = 0.745); the respective values for patients with pT2 were 11/17 and 12/15 (P = 0.874), and for pT3 were six/11 and 12/15 (P = 0.476). The incidence of bladder recurrence within 2 years after surgery was 24.7% for ONU and 19.7% for LNU (P = 0.475). The results were similar after ONU or LNU with bladder-cuff excision; bladder-cuff excision using a hand-assisted device is effective and serves as a treatment option for patients with UUT-TCC.

  7. Effect of dietary supplementation with live-cell yeast at two dosages on lactation performance, ruminal fermentation, and total-tract nutrient digestibility in dairy cows.

    PubMed

    Ferraretto, L F; Shaver, R D; Bertics, S J

    2012-07-01

    The experimental objective was to determine the effect of dietary supplementation with live-cell yeast (LCY; Procreatin-7, Lesaffre Feed Additives, Milwaukee, WI) at 2 dosages in high-starch (HS) diets [30% starch in dry matter (DM)] on lactation performance, ruminal fermentation, and total-tract nutrient digestibility in dairy cows compared with HS or low-starch (LS; 20% starch in DM) non-LCY diets. Sixty-four multiparous Holstein cows (114 ± 37 d in milk and 726 ± 74 kg of body weight at trial initiation) were randomly assigned to 32 electronic gate feeders (2 cows per feeder), which were randomly assigned to 1 of 4 treatments in a completely randomized design. A 2-wk covariate adjustment period with cows fed a 50:50 mixture of the HS and LS diets was followed by a 12-wk treatment period with cows fed their assigned treatment diets. The HS diets were fed without (HS0) and with 2 (HS2) or 4 (HS4) g/cow per day of LCY. The LS diet did not contain LCY (LS0) and was formulated by partially replacing dry ground shelled corn with soy hulls. Cows fed LS0 consumed more DM than cows fed HS diets during wk 3, 10, 11, and 12. Yields of actual (44.5 kg/d, on average), fat-, energy-, and solids-corrected milk were unaffected by treatment. Milk fat content tended to be greater for LS0 than for HS0 and HS2 but not different from HS4. Milk urea nitrogen contents were greater for cows fed LS0 than for cows fed the HS diets. Feed conversion (kg of milk/kg of DM intake) was numerically greater for HS diets than for LS0. Ruminal pH was unaffected by treatment. Ruminal molar proportion of acetate was greater, whereas that of propionate was lower, for LS0 compared with HS diets. Dry matter and organic matter digestibilities were greater for HS2 and HS4 than for HS0. Digestibility of neutral detergent fiber was greater for HS4 than for HS0 and HS2. Dry matter, organic matter, and neutral detergent fiber digestibilities were greater for LS0 than for HS diets; starch digestibility was

  8. [Recurrent urinary tract infections].

    PubMed

    Pigrau-Serrallach, Carlos

    2005-12-01

    Recurrent urinary tract infections (RUTI) are a frequent clinical problem in sexually active young women, pregnant or postmenopausal women and in patients with underlying urological abnormalities. The present chapter reviews RUTI based on their classification: relapses, which usually occur early (< 1 month), are caused by the same microorganism and are associated with underlying urological abnormalities, and reinfections, which usually occur later and are caused by a new distinct microorganism (or by the same microorganism usually located in the rectum or uroepithelial cells). The pathogenesis of RUTI is reviewed and the risk factors associated with RUTI in premenopausal women (usually related to sexual activity), postmenopausal women (in whom estrogen deficiency has a significant effect on the vaginal Lactobacillus flora), and in pregnant women are discussed. Likewise, an extensive review of the distinct therapeutic strategies to prevent RUTI is provided: self-treatment of cystitis, continuous antibiotic prophylaxis, postcoital antibiotic prophylaxis, topical vaginal estrogens, Lactobacillus, cranberry juice, intravesical administration of non-virulent E. coli strains and vaccines, among others. Several diagnostic-therapeutic algorithms are included. These algorithms are based on the type of urinary infection (relapse-reinfection), on the type of patient (young, postmenopausal, or pregnant women) and on the number of episodes of RUTI.

  9. Novel approaches in function-driven single-cell genomics

    DOE PAGES

    Doud, Devin F. R.; Woyke, Tanja

    2017-06-07

    Deeper sequencing and improved bioinformatics in conjunction with single-cell and metagenomic approaches continue to illuminate undercharacterized environmental microbial communities. This has propelled the 'who is there, and what might they be doing' paradigm to the uncultivated and has already radically changed the topology of the tree of life and provided key insights into the microbial contribution to biogeochemistry. While characterization of 'who' based on marker genes can describe a large fraction of the community, answering 'what are they doing' remains the elusive pinnacle for microbiology. Function-driven single-cell genomics provides a solution by using a function-based screen to subsample complex microbialmore » communities in a targeted manner for the isolation and genome sequencing of single cells. This enables single-cell sequencing to be focused on cells with specific phenotypic or metabolic characteristics of interest. Recovered genomes are conclusively implicated for both encoding and exhibiting the feature of interest, improving downstream annotation and revealing activity levels within that environment. This emerging approach has already improved our understanding of microbial community functioning and facilitated the experimental analysis of uncharacterized gene product space. Here we provide a comprehensive review of strategies that have been applied for function-driven single-cell genomics and the future directions we envision.« less

  10. Simultaneous determination of creatinine and acetate by capillary electrophoresis with contactless conductivity detector as a feasible approach for urinary tract infection diagnosis.

    PubMed

    Grochocki, Wojciech; Markuszewski, Michał J; Quirino, Joselito P

    2017-04-15

    Urinary tract infection (UTI) is one of the most common bacterial infection in human but its diagnosis is difficult. Metabolomic studies with nuclear magnetic resonance of urine have shown that acetic acid/creatinine ratio may be used for early UTI diagnosis. Here, a method for simultaneous determination of acetate and creatinine by capillary zone electrophoresis with contactless conductivity detector was developed for the first time. The separation was with 40mM MES and 20mM l-histidine as a background solution. The total time of a single run, including capillary conditioning, was less than 12min. The method was successfully demonstrated for analysis of actual and fortified human urine samples after methanol dilution. Analytical figures of merit such as linearity, LOQ, and repeatability (intraday and interday) were studied.

  11. Quantitative microscopy of the lung: a problem-based approach. Part 2: stereological parameters and study designs in various diseases of the respiratory tract.

    PubMed

    Mühlfeld, Christian; Ochs, Matthias

    2013-08-01

    Design-based stereology provides efficient methods to obtain valuable quantitative information of the respiratory tract in various diseases. However, the choice of the most relevant parameters in a specific disease setting has to be deduced from the present pathobiological knowledge. Often it is difficult to express the pathological alterations by interpretable parameters in terms of volume, surface area, length, or number. In the second part of this companion review article, we analyze the present pathophysiological knowledge about acute lung injury, diffuse parenchymal lung diseases, emphysema, pulmonary hypertension, and asthma to come up with recommendations for the disease-specific application of stereological principles for obtaining relevant parameters. Worked examples with illustrative images are used to demonstrate the work flow, estimation procedure, and calculation and to facilitate the practical performance of equivalent analyses.

  12. A probabilistic gastrointestinal tract dosimetry model

    NASA Astrophysics Data System (ADS)

    Huh, Chulhaeng

    In internal dosimetry, the tissues of the gastrointestinal (GI) tract represent one of the most radiosensitive organs of the body with the hematopoietic bone marrow. Endoscopic ultrasound is a unique tool to acquire in-vivo data on GI tract wall thicknesses of sufficient resolution needed in radiation dosimetry studies. Through their different echo texture and intensity, five layers of differing echo patterns for superficial mucosa, deep mucosa, submucosa, muscularis propria and serosa exist within the walls of organs composing the alimentary tract. Thicknesses for stomach mucosa ranged from 620 +/- 150 mum to 1320 +/- 80 mum (total stomach wall thicknesses from 2.56 +/- 0.12 to 4.12 +/- 0.11 mm). Measurements made for the rectal images revealed rectal mucosal thicknesses from 150 +/- 90 mum to 670 +/- 110 mum (total rectal wall thicknesses from 2.01 +/- 0.06 to 3.35 +/- 0.46 mm). The mucosa thus accounted for 28 +/- 3% and 16 +/- 6% of the total thickness of the stomach and rectal wall, respectively. Radiation transport simulations were then performed using the Monte Carlo N-particle transport code (MCNP) 4C transport code to calculate S values (Gy/Bq-s) for penetrating and nonpenetrating radiations such as photons, beta particles, conversion electrons and auger electrons of selected nuclides, I123, I131, Tc 99m and Y90 under two source conditions: content and mucosa sources, respectively. The results of this study demonstrate generally good agreement with published data for the stomach mucosa wall. The rectal mucosa data are consistently higher than published data compared with the large intestine due to different radiosensitive cell thicknesses (350 mum vs. a range spanning from 149 mum to 729 mum) and different geometry when a rectal content source is considered. Generally, the ICRP models have been designed to predict the amount of radiation dose in the human body from a "typical" or "reference" individual in a given population. The study has been performed to

  13. Single-cell approaches for molecular classification of endocrine tumors

    PubMed Central

    Koh, James; Allbritton, Nancy L.; Sosa, Julie A.

    2015-01-01

    Purpose of review In this review, we summarize recent developments in single-cell technologies that can be employed for the functional and molecular classification of endocrine cells in normal and neoplastic tissue. Recent findings The emergence of new platforms for the isolation, analysis, and dynamic assessment of individual cell identity and reactive behavior enables experimental deconstruction of intratumoral heterogeneity and other contexts, where variability in cell signaling and biochemical responsiveness inform biological function and clinical presentation. These tools are particularly appropriate for examining and classifying endocrine neoplasias, as the clinical sequelae of these tumors are often driven by disrupted hormonal responsiveness secondary to compromised cell signaling. Single-cell methods allow for multidimensional experimental designs incorporating both spatial and temporal parameters with the capacity to probe dynamic cell signaling behaviors and kinetic response patterns dependent upon sequential agonist challenge. Summary Intratumoral heterogeneity in the provenance, composition, and biological activity of different forms of endocrine neoplasia presents a significant challenge for prognostic assessment. Single-cell technologies provide an array of powerful new approaches uniquely well suited for dissecting complex endocrine tumors. Studies examining the relationship between clinical behavior and tumor compositional variations in cellular activity are now possible, providing new opportunities to deconstruct the underlying mechanisms of endocrine neoplasia. PMID:26632769

  14. A visual analytics approach for models of heterogeneous cell populations

    PubMed Central

    2012-01-01

    In recent years, cell population models have become increasingly common. In contrast to classic single cell models, population models allow for the study of cell-to-cell variability, a crucial phenomenon in most populations of primary cells, cancer cells, and stem cells. Unfortunately, tools for in-depth analysis of population models are still missing. This problem originates from the complexity of population models. Particularly important are methods to determine the source of heterogeneity (e.g., genetics or epigenetic differences) and to select potential (bio-)markers. We propose an analysis based on visual analytics to tackle this problem. Our approach combines parallel-coordinates plots, used for a visual assessment of the high-dimensional dependencies, and nonlinear support vector machines, for the quantification of effects. The method can be employed to study qualitative and quantitative differences among cells. To illustrate the different components, we perform a case study using the proapoptotic signal transduction pathway involved in cellular apoptosis. PMID:22651376

  15. Differentiated cell behavior: a multiscale approach using measure theory.

    PubMed

    Colombi, Annachiara; Scianna, Marco; Tosin, Andrea

    2015-11-01

    This paper deals with the derivation of a collective model of cell populations out of an individual-based description of the underlying physical particle system. By looking at the spatial distribution of cells in terms of time-evolving measures, rather than at individual cell paths, we obtain an ensemble representation stemming from the phenomenological behavior of the single component cells. In particular, as a key advantage of our approach, the scale of representation of the system, i.e., microscopic/discrete vs. macroscopic/continuous, can be chosen a posteriori according only to the spatial structure given to the aforesaid measures. The paper focuses in particular on the use of different scales based on the specific functions performed by cells. A two-population hybrid system is considered, where cells with a specialized/differentiated phenotype are treated as a discrete population of point masses while unspecialized/undifferentiated cell aggregates are represented by a continuous approximation. Numerical simulations and analytical investigations emphasize the role of some biologically relevant parameters in determining the specific evolution of such a hybrid cell system.

  16. Towards a whole-cell modeling approach for synthetic biology

    NASA Astrophysics Data System (ADS)

    Purcell, Oliver; Jain, Bonny; Karr, Jonathan R.; Covert, Markus W.; Lu, Timothy K.

    2013-06-01

    Despite rapid advances over the last decade, synthetic biology lacks the predictive tools needed to enable rational design. Unlike established engineering disciplines, the engineering of synthetic gene circuits still relies heavily on experimental trial-and-error, a time-consuming and inefficient process that slows down the biological design cycle. This reliance on experimental tuning is because current modeling approaches are unable to make reliable predictions about the in vivo behavior of synthetic circuits. A major reason for this lack of predictability is that current models view circuits in isolation, ignoring the vast number of complex cellular processes that impinge on the dynamics of the synthetic circuit and vice versa. To address this problem, we present a modeling approach for the design of synthetic circuits in the context of cellular networks. Using the recently published whole-cell model of Mycoplasma genitalium, we examined the effect of adding genes into the host genome. We also investigated how codon usage correlates with gene expression and find agreement with existing experimental results. Finally, we successfully implemented a synthetic Goodwin oscillator in the whole-cell model. We provide an updated software framework for the whole-cell model that lays the foundation for the integration of whole-cell models with synthetic gene circuit models. This software framework is made freely available to the community to enable future extensions. We envision that this approach will be critical to transforming the field of synthetic biology into a rational and predictive engineering discipline.

  17. Two novel cultured cell lines, A3/Kawakami and A4/Fukuda, derived from malignant lymphoma of B(non-T)-cell nature of the gastrointestinal tract.

    PubMed

    Hirose, M; Minato, K; Tobinai, K; Shimoyama, M; Watanabe, S; Abe, T; Deura, K

    1983-02-01

    A3/Kawakami was derived from ascitic lymphoma cells of a 68-year-old female patient with malignant lymphoma (non-Hodgkin's lymphoma, diffuse, large cell type) of the stomach and A4/Fukuda was derived from ascitic lymphoma cells of a 52-year-old female patient with double cancer of the colon (well-differentiated papillary adenocarcinoma and non-Hodgkin's lymphoma, diffuse, large cell type). The fresh ascitic lymphoma cells in the case of A3/Kawakami were surface immunoglobulin-positive, but the cultured A3/Kawakami cells no longer expressed any distinct markers. In the case of A4/Fukuda, the fresh ascitic lymphoma cells and cultured cells did not express any specific surface markers. Only 20% of A4/Fukuda cells were reactive with OKI1. However, a small amount of IgM could be detected in the cell extract and concentrated culture supernate of A4/Fukuda. In addition, A4/Fukuda cells heterotransplanted into anti-thymocyte sera-treated newborn hamster or athymic nude mice with a BALB/c genetic background were found to have weak surface immunoglobulin and distinct cytoplasmic immunoglobulin (gamma, mu). These data suggest that A4/Fukuda cells share the characteristics of the late differentiation stage of B-cell lineage (intermediate between mature B-cells and plasma cells). It was found that monoclonal antibodies, OKT4 and anti-Leu 3a, which are known to react specifically with inducer/helper T-cells, reacted to both A3/Kawakami and A4/Fukuda cells. The karyotypes of both A3/Kawakami and A4/Fukuda cells were very complicated but included some marker chromosomes such as 14q+.

  18. Imaging approaches for the study of cell based cardiac therapies

    PubMed Central

    Lau, Joe F.; Anderson, Stasia A.; Adler, Eric; Frank, Joseph A.

    2009-01-01

    Despite promising preclinical data, the treatment of cardiovascular diseases using embryonic, bone-marrow-derived, and skeletal myoblast stem cells has not yet come to fruition within mainstream clinical practice. Major obstacles in cardiac stem cell investigations include the ability to monitor cell engraftment and survival following implantation within the myocardium. Several cellular imaging modalities, including reporter gene and MRI-based tracking approaches, have emerged that provide the means to identify, localize and monitor stem cells longitudinally in vivo following implantation. This Review will examine the various cardiac cellular tracking modalities, including the combinatorial use of several probes in multimodality imaging, with a focus on data from the last five years. PMID:20027188

  19. [International approaches to the regulation of cell therapy products].

    PubMed

    Piatigorskaia, N V; Tulina, M A; Aladysheva, Zh I; Beregovykh, V V

    2013-01-01

    This article is a review of the main methods and approaches used in regulation of cell therapy products in the United States of America, Canada, European Union, Australia, Japan and South Korea. Intensive developments ofscientific and technological aspects in stem cell and tissue engineering have led to the wide use of human cells and tissues for the treatment of various diseases and injuries of organs and tissues. Drug regulatory agencies of different countries are working on implementation of a risk-based legal framework with some common features. In many countries there is a multilevel control system that assures quality and safety of used cell products. Competent authorities establish strict requirements both to safety of the products and to the implemented standards of good laboratory, manufacturing, clinical and tissue practices.

  20. Stem cells and targeted approaches to melanoma cure.

    PubMed

    Murphy, George F; Wilson, Brian J; Girouard, Sasha D; Frank, Natasha Y; Frank, Markus H

    2014-10-01

    Melanoma stem cells, also known as malignant melanoma-initiating cells, are identifiable through expression of specific biomarkers such as ABCB5 (ATP-binding cassette, sub-family B (MDR/TAP), member 5), NGFR (nerve growth factor receptor, CD271) and ALDH (aldehyde dehydrogenase), and drive melanoma initiation and progression based on prolonged self-renewal capacity, vasculogenic differentiation and immune evasion. As we will review here, specific roles of these aggressive subpopulations have been documented in tumorigenic growth, metastatic dissemination, therapeutic resistance, and malignant recurrence. Moreover, recent findings have provided pre-clinical proof-of-concept for the potential therapeutic utility of the melanoma stem cell concept. Therefore, melanoma stem cell-directed therapeutic approaches represent promising novel strategies to improve therapy of this arguably most virulent human cancer. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Stem Cells and Targeted Approaches to Melanoma Cure

    PubMed Central

    Murphy, George F.; Wilson, Brian J.; Girouard, Sasha D.; Frank, Natasha Y.; Frank, Markus H.

    2013-01-01

    Melanoma stem cells, also known as malignant melanoma-initiating cells, are identifiable through expression of specific biomarkers such as ABCB5 (ATP-binding cassette, sub-family B (MDR/TAP), member 5), NGFR (nerve growth factor receptor, CD271) and ALDH (aldehyde dehydrogenase), and drive melanoma initiation and progression based on prolonged self-renewal capacity, vasculogenic differentiation and immune evasion. As we will review here, specific roles of these aggressive subpopulations have been documented in tumorigenic growth, metastatic dissemination, therapeutic resistance, and malignant recurrence. Moreover, recent findings have provided pre-clinical proof-of-concept for the potential therapeutic utility of the melanoma stem cell concept. Therefore, melanoma stem cell-directed therapeutic approaches represent promising novel strategies to improve therapy of this arguably most virulent human cancer. PMID:24145241

  2. Stem cell approaches in psychiatry--challenges and opportunities.

    PubMed

    Benninghoff, Jens

    2009-01-01

    Exploring stem cells is a fascinating task, especially in a discipline where the use of stem cells seems far-fetched at first glance, as is the case in psychiatry. In this article we would like to provide a brief overview of the current situation in relation to the treatment of mental diseases. For reasons that we will explain, this review will focus on affective disorders. The following section will give a more detailed account of stem-cell biology including current basic science approaches presenting in-vivo and in-vitro techniques. The final part will then look into future perspectives of using these stem cells to cure mental illnesses, and discuss the related challenges and opportunities.

  3. Serum total hCGβ level is an independent prognostic factor in transitional cell carcinoma of the urothelial tract

    PubMed Central

    Douglas, J; Sharp, A; Chau, C; Head, J; Drake, T; Wheater, M; Geldart, T; Mead, G; Crabb, S J

    2014-01-01

    Background: Serum total human chorionic gonadotrophin β subunit (hCGβ) level might have prognostic value in urothelial transitional cell carcinoma (TCC) but has not been investigated for independence from other prognostic variables. Methods: We utilised a clinical database of patients receiving chemotherapy between 2005 and 2011 for urothelial TCC and an independent cohort of radical cystectomy patients for validation purposes. Prognostic variables were tested by univariate Kaplan–Meier analyses and log-rank tests. Statistically significant variables were then assessed by multivariate Cox regression. Total hCGβ level was dichotomised at < vs ⩾2 IU l−1. Results: A total of 235 chemotherapy patients were eligible. For neoadjuvant chemotherapy, established prognostic factors including low ECOG performance status, normal haemoglobin, lower T stage and suitability for cisplatin-based chemotherapy were associated with favourable survival in univariate analyses. In addition, low hCGβ level was favourable when assessed either before (median survival not reached vs 1.86 years, P=0.001) or on completion of chemotherapy (4.27 vs 0.42 years, P=0.000002). This was confirmed in multivariate analyses and in patients receiving first- and second-line palliative chemotherapy, and in a radical cystectomy validation set. Conclusions: Serum total hCGβ level is an independent prognostic factor in patients receiving chemotherapy for urothelial TCC in both curative and palliative settings. PMID:24556622

  4. A Facile Approach to Functionalize Cell Membrane-Coated Nanoparticles

    PubMed Central

    Zhou, Hao; Fan, Zhiyuan; Lemons, Pelin K.; Cheng, Hao

    2016-01-01

    Convenient strategies to provide cell membrane-coated nanoparticles (CM-NPs) with multi-functionalities beyond the natural function of cell membranes would dramatically expand the application of this emerging class of nanomaterials. We have developed a facile approach to functionalize CM-NPs by chemically modifying live cell membranes prior to CM-NP fabrication using a bifunctional linker, succinimidyl-[(N-maleimidopropionamido)-polyethyleneglycol] ester (NHS-PEG-Maleimide). This method is particularly suitable to conjugate large bioactive molecules such as proteins on cell membranes as it establishes a strong anchorage and enable the control of linker length, a critical parameter for maximizing the function of anchored proteins. As a proof of concept, we show the conjugation of human recombinant hyaluronidase, PH20 (rHuPH20) on red blood cell (RBC) membranes and demonstrate that long linker (MW: 3400) is superior to short linker (MW: 425) for maintaining enzyme activity, while minimizing the changes to cell membranes. When the modified membranes were fabricated into RBC membrane-coated nanoparticles (RBCM-NPs), the conjugated rHuPH20 can assist NP diffusion more efficiently than free rHuPH20 in matrix-mimicking gels and the pericellular hyaluronic acid matrix of PC3 prostate cancer cells. After quenching the unreacted chemical groups with polyethylene glycol, we demonstrated that the rHuPH20 modification does not reduce the ultra-long blood circulation time of RBCM-NPs. Therefore, this surface engineering approach provides a platform to functionlize CM-NPs without sacrificing the natural function of cell membranes. PMID:27217834

  5. Gallbladder and Biliary Tract

    MedlinePlus

    ... switch to the Professional version Home Digestive Disorders Biology of the Digestive System Gallbladder and Biliary Tract ... Version. DOCTORS: Click here for the Professional Version Biology of the Digestive System Overview of the Digestive ...

  6. The adaptive, cut-cell Cartesian approach (warts and all)

    NASA Astrophysics Data System (ADS)

    Powell, Kenneth G.

    1995-10-01

    Solution-adaptive methods based on cutting bodies out of Cartesian grids are gaining popularity now that the ways of circumventing the accuracy problems associated with small cut cells have been developed. Researchers are applying Cartesian-based schemes to a broad class of problems now, and, although there is still development work to be done, it is becoming clearer which problems are best suited to the approach (and which are not). The purpose of this paper is to give a candid assessment, based on applying Cartesian schemes to a variety of problems, of the strengths and weaknesses of the approach as it is currently implemented.

  7. The adaptive, cut-cell Cartesian approach (warts and all)

    NASA Technical Reports Server (NTRS)

    Powell, Kenneth G.

    1995-01-01

    Solution-adaptive methods based on cutting bodies out of Cartesian grids are gaining popularity now that the ways of circumventing the accuracy problems associated with small cut cells have been developed. Researchers are applying Cartesian-based schemes to a broad class of problems now, and, although there is still development work to be done, it is becoming clearer which problems are best suited to the approach (and which are not). The purpose of this paper is to give a candid assessment, based on applying Cartesian schemes to a variety of problems, of the strengths and weaknesses of the approach as it is currently implemented.

  8. Cellular uptake and cell-to-cell transfer of polyelectrolyte microcapsules within a triple co-culture system representing parts of the respiratory tract

    NASA Astrophysics Data System (ADS)

    Kuhn, Dagmar A.; Hartmann, Raimo; Fytianos, Kleanthis; Petri-Fink, Alke; Rothen-Rutishauser, Barbara; Parak, Wolfgang J.

    2015-06-01

    Polyelectrolyte multilayer microcapsules around 3.4 micrometers in diameter were added to epithelial cells, monocyte-derived macrophages, and dendritic cells in vitro and their uptake kinetics were quantified. All three cell types were combined in a triple co-culture model, mimicking the human epithelial alveolar barrier. Hereby, macrophages were separated in a three-dimensional model from dendritic cells by a monolayer of epithelial cells. While passing of small nanoparticles has been demonstrated from macrophages to dendritic cells across the epithelial barrier in previous studies, for the micrometer-sized capsules, this process could not be observed in a significant amount. Thus, this barrier is a limiting factor for cell-to-cell transfer of micrometer-sized particles.

  9. Diffusion-based population statistics using tract probability maps.

    PubMed

    Wassermann, Demian; Kanterakis, Efstathios; Gur, Ruben C; Deriche, Rachid; Verma, Ragini

    2010-01-01

    We present a novel technique for the tract-based statistical analysis of diffusion imaging data. In our technique, we represent each white matter (WM) tract as a tract probability map (TPM): a function mapping a point to its probability of belonging to the tract. We start by automatically clustering the tracts identified in the brain via tractography into TPMs using a novel Gaussian process framework. Then, each tract is modeled by the skeleton of its TPM, a medial representation with a tubular or sheet-like geometry. The appropriate geometry for each tract is implicitly inferred from the data instead of being selected a priori, as is done by current tract-specific approaches. The TPM representation makes it possible to average diffusion imaging based features along directions locally perpendicular to the skeleton of each WM tract, increasing the sensitivity and specificity of statistical analyses on the WM. Our framework therefore facilitates the automated analysis of WM tract bundles, and enables the quantification and visualization of tract-based statistical differences between groups. We have demonstrated the applicability of our framework by studying WM differences between 34 schizophrenia patients and 24 healthy controls.

  10. Association between injectable progestin-only contraceptives and HIV acquisition and HIV target cell frequency in the female genital tract in South African women: a prospective cohort study

    PubMed Central

    Byrne, Elizabeth H; Anahtar, Melis N; Cohen, Kathleen E; Moodley, Amber; Padavattan, Nikita; Ismail, Nasreen; Bowman, Brittany A; Olson, Gregory S; Mabhula, Amanda; Leslie, Alasdair; Ndung’u, Thumbi; Walker, Bruce D; Ghebremichael, Musie S; Dong, Krista L; Kwon, Douglas S

    2017-01-01

    Summary Background The use of injectable progestin-only contraceptives has been associated with increased risk of HIV acquisition in observational studies, but the biological mechanisms of this risk remain poorly understood. We aimed to assess the effects of progestins on HIV acquisition risk and the immune environment in the female genital tract. Methods In this prospective cohort, we enrolled HIV-negative South African women aged 18–23 years who were not pregnant and were living in Umlazi, South Africa from the Females Rising through Education, Support, and Health (FRESH) study. We tested for HIV-1 twice per week to monitor incident infection. Every 3 months, we collected demographic and behavioural data in addition to blood and cervical samples. The study objective was to characterise host immune determinants of HIV acquisition risk, including those associated with injectable progestin-only contraceptive use. Hazard ratios (HRs) were estimated using Cox proportional hazards methods. Findings Between Nov 19, 2012, and May 31, 2015, we characterised 432 HIV-uninfected South African women from the FRESH study. In this cohort, 152 women used injectable progestin-only contraceptives, 43 used other forms of contraception, and 222 women used no method of long-term contraception. Women using injectable progestin-only contraceptives were at substantially higher risk of acquiring HIV (12·06 per 100 person-years, 95% CI 6·41–20·63) than women using no long-term contraception (3·71 per 100 person-years, 1·36–8·07; adjusted hazard ratio [aHR] 2·93, 95% CI 1·09–7·868, p=0·0326). HIV-negative injectable progestin-only contraceptive users had 3·92 times the frequency of cervical HIV target cells (CCR5+ CD4 T cells) compared with women using no long-term contraceptive (p=0·0241). Women using no long-term contraceptive in the luteal phase of the menstrual cycle also had a 3·25 times higher frequency of cervical target cells compared with those in the

  11. Electrocatalyst approaches and challenges for automotive fuel cells.

    PubMed

    Debe, Mark K

    2012-06-06

    Fuel cells powered by hydrogen from secure and renewable sources are the ideal solution for non-polluting vehicles, and extensive research and development on all aspects of this technology over the past fifteen years has delivered prototype cars with impressive performances. But taking the step towards successful commercialization requires oxygen reduction electrocatalysts--crucial components at the heart of fuel cells--that meet exacting performance targets. In addition, these catalyst systems will need to be highly durable, fault-tolerant and amenable to high-volume production with high yields and exceptional quality. Not all the catalyst approaches currently being pursued will meet those demands.

  12. [Urinary tract infections].

    PubMed

    Hörl, W H

    2011-09-01

    Urinary tract infections occur very frequently in the community and in hospitalized patients and are mainly caused by Escherichia (E.) coli. Depending on virulence determinants of uropathogenic microorganisms and host-specific defense mechanisms, urinary tract infections can manifest as cystitis, pyelonephritis (bacterial interstitial nephritis), bacteremia or urosepsis. Uncomplicated urinary tract infections in otherwise healthy women should be treated for 3-7 days depending on the antibiotic therapy chosen, even if spontaneous remission rates of up to 40% have been reported. Antibiotics of the first choice for empirical treatment of uncomplicated urinary tract infection are fluoroquinolones, pivmecillinam and fosfomycin. A huge problem is the increasing antimicrobial resistance of uropathogenic microorganisms. Complicated urinary tract infections associated with anatomical and/or functional abnormalities of the urinary tract and/or comorbidities such as diabetes or immunosuppressive therapy, need longer antibiotic treatment (e.g. 10-14 days) as well as interdisciplinary diagnostic procedures. Treatment of community acquired urosepsis includes cephalosporins of the third generation, piperacillin/tazobactam or ciprofloxacin. For nosocomial urosepsis the combination with an aminoglycoside or a carbapenem is recommended.

  13. Hyperammonemia in Urinary Tract Infections

    PubMed Central

    Kenzaka, Tsuneaki; Kato, Ken; Kitao, Akihito; Kosami, Koki; Minami, Kensuke; Yahata, Shinsuke; Fukui, Miho; Okayama, Masanobu

    2015-01-01

    Objectives The present study investigated the incidence of hyperammonemia in urinary tract infections and explored the utility of urinary obstruction relief and antimicrobial administration to improve hyperammonemia. Methods This was an observational study. Subjects were patients who were diagnosed with urinary tract infection and hospitalized between June 2008 and June 2009. We measured plasma ammonia levels on admission in patients who were clinically diagnosed with urinary tract infection and hospitalized. We assessed each patient's level of consciousness on admission using the Glasgow Coma Scale (GCS) and performed urine and blood cultures. We also assessed hearing prior to hospitalization using the Eastern Cooperative Oncology Group performance status (ECOG-PS). In cases with high ammonia levels on admission, plasma ammonia and GCS were measured 24 hours and 5–7 days later. Results Sixty-seven candidates were enrolled; of these, 60 cases (89.6%) with bacterial cell counts ≥104 CFU/mL were studied. Five cases (8.3%) presented with high plasma ammonia levels. Cases with hyperammonemia were significantly more likely to present with low GCS scores and urinary retention rate. All five cases received antimicrobial therapy with an indwelling bladder catheter to relieve urinary retention. The case 5 patient died shortly after admission due to complicated aspiration pneumonia; in the remaining cases, plasma ammonia levels were rapidly normalized and the level of consciousness improved. Conclusions The occurrence of hyperammonemia in urinary tract infections is not rare. The cause of hyperammonemia is urinary retention obstruction. Therefore, along with antimicrobial administration, relief of obstruction is important for the treatment of hyperammonemia caused by this mechanism. PMID:26292215

  14. Noninfectious Generalized Bronchiolitis in the Setting of Allogeneic Stem Cell Transplantation: A Potential Mimic of Lower Respiratory Tract Infection.

    PubMed

    Kloth, C; Grosse, U; Wirths, S; Gatidis, S; Bethge, W; Nikolaou, K; Horger, M

    2015-12-01

    To describe a little-known therapy-related small-airway phenomenon presumably caused by mucosal irritation in patients undergoing allogeneic stem cell transplantation (allo-SCT). Retrospective database search at our institution identified 739 hematologic patients who underwent chemotherapy + allo-SCT between September 2004 and March 2014. After infectious pulmonary complications were excluded, 75 patients (female = 24; male = 51; median age = 47 years) with signs of generalized bronchiolitis (GB) on chest high-resolution computed tomography were identified. Computed tomography (CT) was performed proximate to chemotherapy onset; 92% had follow-up CT (mean, 1.9 weeks). The presence of centrilobular nodules, bronchial wall thickening (BWT), tree-in-bud (distributed diffuse vs. focal), ground-glass opacity, airspace opacification, luminal impactions, and air trapping was correlated with occurrence and duration of oral mucositis and therapy characteristics. Intensity of tree-in-bud and centrilobular nodules was graded absent (grade = 0), moderate (grade = 1), or marked (grade = 2). Overall incidence of GB among allo-SCT patients was 10.14%. GB was diagnosed at the time point of transplantation with a mean duration of CT findings of 4 weeks (±2.7). Tree-in-bud (17% [grade 2] and 83% [grade 1]) and BWT were present in 100% of the patients. Centrilobular nodules diffusely distributed were found in 45.5% of patients (20% [grade 2], 24% [grade 1], and 56% [none]). Air trapping and mosaic pattern were found in 13% and 16% of the patients, respectively. Resolution of GB was spontaneous. GB and its severity correlated with the temporal course and grade of oral mucositis; frequency and degree were not significantly influenced by the chemotherapy regimen. The incidence of GB in high-resolution computed tomography was statistically and significantly higher in patients with oral mucositis (P < 0.035). GB is frequent during chemotherapy for allo

  15. Mobile Applications in Cell Biology Present New Approaches for Cell Modelling

    ERIC Educational Resources Information Center

    de Oliveira, Mayara Lustosa; Galembeck, Eduardo

    2016-01-01

    Cell biology apps were surveyed in order to identify whether there are new approaches for modelling cells allowed by the new technologies implemented in tablets and smartphones. A total of 97 apps were identified in 3 stores surveyed (Apple, Google Play and Amazon), they are presented as: education 48.4%, games 26.8% and medicine 15.4%. The apps…

  16. Mobile Applications in Cell Biology Present New Approaches for Cell Modelling

    ERIC Educational Resources Information Center

    de Oliveira, Mayara Lustosa; Galembeck, Eduardo

    2016-01-01

    Cell biology apps were surveyed in order to identify whether there are new approaches for modelling cells allowed by the new technologies implemented in tablets and smartphones. A total of 97 apps were identified in 3 stores surveyed (Apple, Google Play and Amazon), they are presented as: education 48.4%, games 26.8% and medicine 15.4%. The apps…

  17. Insights into nuclear dynamics using live-cell imaging approaches.

    PubMed

    Bigley, Rachel B; Payumo, Alexander Y; Alexander, Jeffrey M; Huang, Guo N

    2017-03-01

    The nucleus contains the genetic blueprint of the cell and myriad interactions within this subcellular structure are required for gene regulation. In the current scientific era, characterization of these gene regulatory networks through biochemical techniques coupled with systems-wide 'omic' approaches has become commonplace. However, these strategies are limited because they represent a mere snapshot of the cellular state. To obtain a holistic understanding of nuclear dynamics, relevant molecules must be studied in their native contexts in living systems. Live-cell imaging approaches are capable of providing quantitative assessment of the dynamics of gene regulatory interactions within the nucleus. We survey recent insights into what live-cell imaging approaches have provided the field of nuclear dynamics. In this review, we focus on interactions of DNA with other DNA loci, proteins, RNA, and the nuclear envelope. WIREs Syst Biol Med 2017, 9:e1372. doi: 10.1002/wsbm.1372 For further resources related to this article, please visit the WIREs website.

  18. Virus Integration and Genome Influence in Approaches to Stem Cell Based Therapy for Andro-Urology

    PubMed Central

    Li, Longkun; Zhang, Deying; Li, Peng; Damaser, Margot; Zhang, Yuanyuan

    2014-01-01

    Despite the potential of stem cells in cell-based therapy, major limitations such as cell retention, ingrowth, and trans-differentiation after implantation remain. One technique for genetic modification of cells for tissue repair is the introduction of specific genes using molecular biology techniques, such as virus integration, to provide a gene that adds new functions to enhance cellular function, and to secrete trophic factors for recruiting resident cells to participate in tissue repair. Stem cells can be labelled to track cell survival, migration, and lineage. Increasing evidence demonstrates that cell therapy and gene therapy in combination remarkably improve myogenic differentiation of implanted mesenchymal stromal cells (MSCs), revascularization, and innervation in genitourinary tissues, especially to treat urinary incontinence, erectile dysfunction, lower urinary tract reconstruction, and renal failure. This review discusses the benefits, safety, side effects, and alternatives for using genetically modified MSCs in tissue regeneration in andro-urology. PMID:25453258

  19. Virus integration and genome influence in approaches to stem cell based therapy for andro-urology.

    PubMed

    Li, Longkun; Zhang, Deying; Li, Peng; Damaser, Margot; Zhang, Yuanyuan

    2015-03-01

    Despite the potential of stem cells in cell-based therapy, major limitations such as cell retention, ingrowth, and trans-differentiation after implantation remain. One technique for genetic modification of cells for tissue repair is the introduction of specific genes using molecular biology techniques, such as virus integration, to provide a gene that adds new functions to enhance cellular function, and to secrete trophic factors for recruiting resident cells to participate in tissue repair. Stem cells can be labeled to track cell survival, migration, and lineage. Increasing evidence demonstrates that cell therapy and gene therapy in combination remarkably improve differentiation of implanted mesenchymal stromal cells (MSCs), revascularization, and innervation in genitourinary tissues, especially to treat urinary incontinence, erectile dysfunction, lower urinary tract reconstruction, and renal failure. This review discusses the benefits, safety, side effects, and alternatives for using genetically modified MSCs in tissue regeneration in andro-urology.

  20. Targeting the genital tract mucosa with a lipopeptide/recombinant adenovirus prime/boost vaccine induces potent and long-lasting CD8+ T cell immunity against herpes: importance of MyD88.

    PubMed

    Zhang, Xiuli; Dervillez, Xavier; Chentoufi, Aziz Alami; Badakhshan, Tina; Bettahi, Ilham; Benmohamed, Lbachir

    2012-11-01

    Targeting of the mucosal immune system of the genital tract with subunit vaccines has failed to induce potent and durable local CD8(+) T cell immunity, which is crucial for protection against many sexually transmitted viral pathogens, including HSV type 2 (HSV-2), which causes genital herpes. In this study, we aimed to investigate the potential of a novel lipopeptide/adenovirus type 5 (Lipo/rAdv5) prime/boost mucosal vaccine for induction of CD8(+) T cell immunity to protect the female genital tract from herpes. The lipopeptide vaccine and the rAdv5 vaccine express the immunodominant HSV-2 CD8(+) T cell epitope (gB(498-505)), and both were delivered intravaginally in the progesterone-induced B6 mouse model of genital herpes. Compared with mice immunized with the homologous lipopeptide/lipopeptide (Lipo/Lipo) vaccine, the Lipo/rAdv5 prime/boost immunized mice 1) developed potent and sustained HSV-specific CD8(+) T cells, detected in both the genital tract draining nodes and in the vaginal mucosa; 2) had significantly lower virus titers; 3) had decreased overt signs of genital herpes disease; and 4) did not succumb to lethal infection (p < 0.005) after intravaginal HSV-2 challenge. Polyfunctional CD8(+) T cells, producing IFN-γ, TNF-α, and IL-2 and exhibiting cytotoxic activity, were associated with protection (p < 0.005). The protective CD8(+) T cell response was significantly compromised in the absence of the adapter MyD88 (p = 0.0001). Taken together, these findings indicate that targeting of the vaginal mucosa with a Lipo/rAdv5 prime/boost vaccine elicits a potent, MyD88-dependent, and long-lasting mucosal CD8(+) T cell protective immunity against sexually transmitted herpes infection and disease.

  1. Krüppel-like factor 4 is widely expressed in the mouse male and female reproductive tract and responds as an immediate early gene to activation of the protein kinase A in TM4 Sertoli cells.

    PubMed

    Godmann, M; Kosan, C; Behr, R

    2010-04-01

    Krüppel-like factor 4 (KLF4) is a zinc finger transcription factor critically involved in cell proliferation, differentiation, and carcinogenesis. Recently, KLF4 has also been used for the generation of induced pluripotent stem cells. In this study, we analyzed Klf4 expression in different mouse tissues using northern blot analysis and immunohistochemistry. Focusing on the male and female reproductive tract, we showed for the first time that KLF4 is expressed in the epithelia of the murine uterus and the vagina. In the male reproductive tract, we detected KLF4 in the epithelia of the epididymis, ductus deferens, coagulating gland, and the penis. As KLF4 is strongly inducible by FSH signaling in Sertoli cells and as this transcription factor is also involved in Sertoli cell development, we employed the mouse Sertoli cell line TM4 as a model system to investigate i) the induction kinetics of Klf4 upon activation of the cAMP/protein kinase A pathway by forskolin and ii) the effects of Klf4 induction on TM4 cell cycle progression. Interestingly, Klf4 mRNA and protein were rapidly but transiently induced, reaching peak levels after 90-120 min and declining to basal levels within 4 h. Compared with the inducible cAMP early repressor, an immediate early response gene, the induction kinetics of Klf4 is much faster. In conclusion, Klf4 is an immediate early gene in TM4 cells and its expression in several epithelia of the male and female reproductive tract suggests an important role of Klf4 in mouse reproductive functions.

  2. Cell hierarchy, metabolic flexibility and systems approaches to cancer treatment.

    PubMed

    Herst, Patries M; Berridge, Michael V

    2013-01-01

    The proliferative cancer cell paradigm that has driven cancer drug development for the past 50 years has failed to generate treatments that cure most metastatic adult cancers. This view is supported not only by cumulative experience with conventional cytotoxic anticancer drugs, but also by the application of highly-targeted anticancer compounds against, for example, BCR-ABL in CML and mutant BRAF in metastatic melanoma. Such drugs often send their respective cancers into complete molecular remission but fail to effect cures because a small population of quiescent or slowly selfrenewing cancer cells that are drug and radiation resistant survive treatment indefinitely. This review explores the grounds for an emerging cancer paradigm that views cancer as a disorganized tissue with hierarchical cellular compartments in which the boudaries are less well-defined than in normal tissues with plasticity controlled by epigenetic changes mediated by the local microenvironment. Increased metabolic flexibility and adaptability give cancer cells an additional survival advantage that may be able to be targeted with drugs like metformin. Combining approaches that target the increased metabolic flexibility of cancer cells as well as ablating rapidly-proliferating cells and self-renewing cancer stem cells in individual cancers are needed to address the holy grail of cancer cure.

  3. An analytical approach for solid oxide cell electrode geometric design

    NASA Astrophysics Data System (ADS)

    Nelson, George J.

    2015-12-01

    An analytical model for gas distributions in porous solid oxide cell electrodes is applied to develop dimensionless metrics that describe electrode performance. These metrics include two forms of a dimensionless reactant depletion current density and a geometry sensitive Damköhler number used to assess electrode catalytic effectiveness. The first dimensionless depletion current density defines when reducing electrode thickness no longer benefits mass transfer performance for a given cell geometry. The second dimensionless depletion current density provides a gage of deviation from the limiting current behavior predicted using button-cell experimental and modeling approaches. The Damköhler number and related catalytic effectiveness quantify two-dimensional transport effects under non-depleted operating conditions, providing a means of generalizing insights from reactant depletion behavior for typical cell operating conditions. A finite element solution for gas transport based on the dusty-gas model is used as a benchmark for the analytical model and dimensionless metrics. Estimates of concentration polarization based on analytical and numerical models compare well to published experimental data. Analytical performance predictions provide clear demonstration of the influence of two-dimensional electrode geometry on solid oxide cell performance. These results agree with finite element predictions and suggest that reduction of electrode thickness does not exclusively benefit cell performance.

  4. From DNA radiation damage to cell death: theoretical approaches.

    PubMed

    Ballarini, Francesca

    2010-10-05

    Some representative models of radiation-induced cell death, which is a crucial endpoint in radiobiology, were reviewed. The basic assumptions were identified, their consequences on predicted cell survival were analyzed, and the advantages and drawbacks of each approach were outlined. In addition to "historical" approaches such as the Target Theory, the Linear-Quadratic model, the Theory of Dual Radiation Action and Katz' model, the more recent Local Effect Model was discussed, focusing on its application in Carbon-ion hadrontherapy. Furthermore, a mechanistic model developed at the University of Pavia and based on the relationship between cell inactivation and chromosome aberrations was presented, together with recent results; the good agreement between model predictions and literature experimental data on different radiation types (photons, protons, alpha particles, and Carbon ions) supported the idea that asymmetric chromosome aberrations like dicentrics and rings play a fundamental role for cell death. Basing on these results, a reinterpretation of the TDRA was also proposed, identifying the TDRA "sublesions" and "lesions" as clustered DNA double-strand breaks and (lethal) chromosome aberrations, respectively.

  5. From DNA Radiation Damage to Cell Death: Theoretical Approaches

    PubMed Central

    Ballarini, Francesca

    2010-01-01

    Some representative models of radiation-induced cell death, which is a crucial endpoint in radiobiology, were reviewed. The basic assumptions were identified, their consequences on predicted cell survival were analyzed, and the advantages and drawbacks of each approach were outlined. In addition to “historical” approaches such as the Target Theory, the Linear-Quadratic model, the Theory of Dual Radiation Action and Katz' model, the more recent Local Effect Model was discussed, focusing on its application in Carbon-ion hadrontherapy. Furthermore, a mechanistic model developed at the University of Pavia and based on the relationship between cell inactivation and chromosome aberrations was presented, together with recent results; the good agreement between model predictions and literature experimental data on different radiation types (photons, protons, alpha particles, and Carbon ions) supported the idea that asymmetric chromosome aberrations like dicentrics and rings play a fundamental role for cell death. Basing on these results, a reinterpretation of the TDRA was also proposed, identifying the TDRA “sublesions” and “lesions” as clustered DNA double-strand breaks and (lethal) chromosome aberrations, respectively. PMID:20976308

  6. Protein-Coated Nanoparticles Are Internalized by the Epithelial Cells of the Female Reproductive Tract and Induce Systemic and Mucosal Immune Responses

    PubMed Central

    Howe, Savannah E.; Konjufca, Vjollca H.

    2014-01-01

    The female reproductive tract (FRT) includes the oviducts (fallopian tubes), uterus, cervix and vagina. A layer of columnar epithelium separates the endocervix and uterus from the outside environment, while the vagina is lined with stratified squamous epithelium. The mucosa of the FRT is exposed to antigens originating from microflora, and occasionally from infectious microorganisms. Whether epithelial cells (ECs) of the FRT take up (sample) the lumen antigens is not known. To address this question, we examined the uptake of 20–40 nm nanoparticles (NPs) applied vaginally to mice which were not treated with hormones, epithelial disruptors, or adjuvants. We found that 20 and 40 nm NPs are quickly internalized by ECs of the upper FRT and within one hour could be observed in the lymphatic ducts that drain the FRT, as well as in the ileac lymph nodes (ILNs) and the mesenteric lymph nodes (MLNs). Chicken ovalbumin (Ova) conjugated to 20 nm NPs (NP-Ova) when administered vaginally reaches the internal milieu in an immunologically relevant form; thus vaginal immunization of mice with NP-Ova induces systemic IgG to Ova antigen. Most importantly, vaginal immunization primes the intestinal mucosa for secretion of sIgA. Sub-cutaneous (s.c) boosting immunization with Ova in complete Freund's adjuvant (CFA) further elevates the systemic (IgG1 and IgG2c) as well as mucosal (IgG1 and sIgA) antibody titers. These findings suggest that the modes of antigen uptake at mucosal surfaces and pathways of antigen transport are more complex than previously appreciated. PMID:25490456

  7. Long-term comparative outcomes of open versus laparoscopic nephroureterectomy for upper urinary tract urothelial-cell carcinoma after a median follow-up of 13 years*.

    PubMed

    Stewart, Grant D; Humphries, Katie J; Cutress, Mark L; Riddick, Antony C P; McNeill, S Alan; Tolley, David A

    2011-08-01

    Open nephroureterectomy (ONU) rather than laparoscopic nephroureterectomy (LNU) is still regarded as the standard of care for extirpative surgical management of upper urinary tract urothelial-cell carcinoma (UUT-UCC). The longest published follow-up of LNU is 7 years. We report outcomes for patients having surgery ≥10 years ago. Consecutive patients with UUT-UCC who were treated with ONU (n=39) or LNU (n=23) between April 1992 to September 2000 were included. Preoperative, tumor, operative and postoperative characteristics, recurrence, and outcomes were collated. Survival was estimated using the Kaplan-Meier method. Median follow-up of censored patients was 163 months (13.6 y). Estimated mean overall survival (OS) was 111 months for ONU and 103 months for LNU. Mean progression free survival (PFS) was 175 months for ONU and 143 months for LNU. Probability of PFS at 10 years was 79% for ONU and 76% for LNU and was unchanged at 15 years. There was no significant difference between ONU and LNU in terms of OS (P=0.51, log-rank test), PFS (P=0.70) or cancer-specific survival (CSS; P=0.43). There were no prognostic differences between ONU and LNU after correcting for confounding variables. There was no increase in the probability of a bladder cancer recurrence from 10 to 15 years postoperation. Long-term follow-up of patients who were operated on more than 10 years ago suggests that LNU has oncologic equivalence to ONU because there were no significant differences in OS, PFS, or CSS between ONU and LNU patients followed for a median of 13 years.

  8. Water extract of Pueraria lobata Ohwi has anti-viral activity against human respiratory syncytial virus in human respiratory tract cell lines.

    PubMed

    Lin, Tzeng-Jih; Yeh, Chia-Feng; Wang, Kuo-Chih; Chiang, Lien-Chai; Tsai, Jih-Jin; Chang, Jung-San

    2013-12-01

    Human respiratory syncytial virus (HRSV) infects all age groups and causes bronchiolitis, pneumonia, and acute respiratory distress syndrome with a significant mortality rate. To date, only ribavirin has been used to manage HRSV infection. However, ribavirin is expensive with an only modest effect. Furthermore, ribavirin has several side effects, which means it has limited clinical benefit. Pueraria lobata Ohwi (P. lobata) is a common ingredient of Ge-Gen-Tang (Kakkon-to) and Sheng-Ma-Ge-Gen-Tang (Shoma-kakkon-to), which are prescriptions of Chinese traditional medicine proven to have antiviral activity against HRSV. Therefore, it was hypothesized that P. lobata might be effective against HRSV. To find a cost-effective therapeutic modality, both human upper (HEp-2) and lower (A549) respiratory tract cell lines were used to test the hypothesis that P. lobata could inhibit HRSV-induced plaque formation. Results showed that the water extract of P. lobata was effective (p < 0.0001) against HRSV-induced plaque formation. P. lobata was more effective when given prior to viral inoculation (p < 0.0001) by inhibiting viral attachment (p < 0.0001) and penetration (p < 0.0001). However, supplementation with P. lobata could not stimulate interferon secretion after HRSV infection. In conclusion, P. lobata has antiviral activity against HRSV-induced plaque formation in airway mucosa mainly by inhibiting viral attachment and internalization. Further identification of effective constituents could contribute to the prevention of HRSV infection.

  9. Neuronal Nogo-A in New-born Retinal Ganglion Cells: Implication for the Formation of the Age-related Fiber Order in the Optic Tract.

    PubMed

    Su, Dongqiang; Liu, Huaicun; Chan, Sun-On; Wang, Jun

    2016-08-01

    Nogo-A is highly expressed in oligodendrocytes in the adult central nervous system (CNS). Recently it was found that Nogo-A is also expressed in some neuronal types during development. Here, we examined the expression pattern of Nogo-A in both the retina and optic tract (OT) of mouse embryos from E12 to E15. After perturbation of its function in the OT for 5 hr in the brain slice culture system using a Nogo-A specific antibody or antagonist of its receptor (NEP1-40), the optic nerve fibers and growth cones were traced with DiI. We showed that most Tuj-1 positive new-born neurons at E12 were Nogo-A positive. At E15, retinal neurons reduced the Nogo-A expression. It was worth noting that some projecting axons expressed Nogo-A along the retinofugal pathway. On the basis of their specific locations within the superficial half of the OT and the colocalization with GAP-43 (a marker for the newly born growth cones and axons), we concluded that those Nogo-A positive axons were the newly arrived retinal fibers. Blocking the function of Nogo-A with Nogo-A antibody or NEP1-40 resulted in the shift of DiI labeled axons and growth cones from the superficial half to the whole depth of the OT. These results indicate that Nogo-A in the newly born retinal ganglion cells (RGCs) and their axons are involved in sorting out the newly arrived axons to the subpial region of the OT. Anat Rec, 299:1027-1036, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. [Urinary tract infections in children].

    PubMed

    Lellig, E; Apfelbeck, M; Straub, J; Karl, A; Tritschler, S; Stief, C G; Riccabona, M

    2017-02-01

    Urinary tract infections (UTI) are the most common bacterial infections in children. The symptoms are not very specific and range from abdominal pain, poor feeding to nocturnal urinary incontinence. The technique of collecting urine plays an important role for securing the diagnosis. The best way to obtain urine in non-toilet-trained children is catheterization or suprapubic bladder aspiration. In toilet-trained children midstream urine is an acceptable alternative after cleaning the foreskin or labia. In the case of an infection a prompt empirical antibiotic therapy is necessary to reduce the risk of parenchymal scarring of the kidneys. There are different approaches to diagnose vesicoureteral reflux in different countries. The commonly used standard approach in Germany is voiding cystourethrography. In the case of reflux dimercaptosuccinic acid (DMSA) scintigraphy should be performed additionally to exclude renal scarring (bottom-up approach).

  11. Biofabrication and Bone Tissue Regeneration: Cell Source, Approaches, and Challenges.

    PubMed

    Orciani, Monia; Fini, Milena; Di Primio, Roberto; Mattioli-Belmonte, Monica

    2017-01-01

    The growing occurrence of bone disorders and the increase in aging population have resulted in the need for more effective therapies to meet this request. Bone tissue engineering strategies, by combining biomaterials, cells, and signaling factors, are seen as alternatives to conventional bone grafts for repairing or rebuilding bone defects. Indeed, skeletal tissue engineering has not yet achieved full translation into clinical practice because of several challenges. Bone biofabrication by additive manufacturing techniques may represent a possible solution, with its intrinsic capability for accuracy, reproducibility, and customization of scaffolds as well as cell and signaling molecule delivery. This review examines the existing research in bone biofabrication and the appropriate cells and factors selection for successful bone regeneration as well as limitations affecting these approaches. Challenges that need to be tackled with the highest priority are the obtainment of appropriate vascularized scaffolds with an accurate spatiotemporal biochemical and mechanical stimuli release, in order to improve osseointegration as well as osteogenesis.

  12. Biofabrication and Bone Tissue Regeneration: Cell Source, Approaches, and Challenges

    PubMed Central

    Orciani, Monia; Fini, Milena; Di Primio, Roberto; Mattioli-Belmonte, Monica

    2017-01-01

    The growing occurrence of bone disorders and the increase in aging population have resulted in the need for more effective therapies to meet this request. Bone tissue engineering strategies, by combining biomaterials, cells, and signaling factors, are seen as alternatives to conventional bone grafts for repairing or rebuilding bone defects. Indeed, skeletal tissue engineering has not yet achieved full translation into clinical practice because of several challenges. Bone biofabrication by additive manufacturing techniques may represent a possible solution, with its intrinsic capability for accuracy, reproducibility, and customization of scaffolds as well as cell and signaling molecule delivery. This review examines the existing research in bone biofabrication and the appropriate cells and factors selection for successful bone regeneration as well as limitations affecting these approaches. Challenges that need to be tackled with the highest priority are the obtainment of appropriate vascularized scaffolds with an accurate spatiotemporal biochemical and mechanical stimuli release, in order to improve osseointegration as well as osteogenesis. PMID:28386538

  13. Stem cell approaches in psychiatry - challenges and opportunities

    PubMed Central

    Benninghoff, Jens

    2009-01-01

    Exploring stem ceils is a fascinating task, especially in a discipline where the use of stem cells seems far-fetched at first glance, as is the case in psychiatry. In this article we would like to provide a brief overview of the current situation in relation to the treatment of mental diseases. For reasons that we will explain, this review will focus on affective disorders. The following section will give a more detailed account of stem-cell biology, including current basic science approaches presenting in-vivo andin-vitro techniques. The final part will then look into future perspectives of using these stem cells to cure mental illnesses, and discuss the related challenges and opportunities. PMID:20135897

  14. Spindle cell lesions of the breast - An approach to diagnosis.

    PubMed

    Tay, Timothy Kwang Yong; Tan, Puay Hoon

    2017-09-01

    Spindle cell lesions of the breast are among the less common entities encountered in breast pathology. They encompass a whole spectrum of benign reactive lesions to high grade malignant neoplasms. An accurate diagnosis is important to ensure that the patient receives the appropriate management. While this group of conditions broadly share the same basic morphology of a lesion composed of spindle cells, there are often recognizable differences on histology, which coupled with ancillary studies