HAMLET (human alpha-lactalbumin made lethal to tumor cells) triggers autophagic tumor cell death.
Aits, Sonja; Gustafsson, Lotta; Hallgren, Oskar; Brest, Patrick; Gustafsson, Mattias; Trulsson, Maria; Mossberg, Ann-Kristin; Simon, Hans-Uwe; Mograbi, Baharia; Svanborg, Catharina
2009-03-01
HAMLET, a complex of partially unfolded alpha-lactalbumin and oleic acid, kills a wide range of tumor cells. Here we propose that HAMLET causes macroautophagy in tumor cells and that this contributes to their death. Cell death was accompanied by mitochondrial damage and a reduction in the level of active mTOR and HAMLET triggered extensive cytoplasmic vacuolization and the formation of double-membrane-enclosed vesicles typical of macroautophagy. In addition, HAMLET caused a change from uniform (LC3-I) to granular (LC3-II) staining in LC3-GFP-transfected cells reflecting LC3 translocation during macroautophagy, and this was blocked by the macroautophagy inhibitor 3-methyladenine. HAMLET also caused accumulation of LC3-II detected by Western blot when lysosomal degradation was inhibited suggesting that HAMLET caused an increase in autophagic flux. To determine if macroautophagy contributed to cell death, we used RNA interference against Beclin-1 and Atg5. Suppression of Beclin-1 and Atg5 improved the survival of HAMLET-treated tumor cells and inhibited the increase in granular LC3-GFP staining. The results show that HAMLET triggers macroautophagy in tumor cells and suggest that macroautophagy contributes to HAMLET-induced tumor cell death.
Tai, Kuo-Feng; Chen, Ding-Shinn; Hwang, Lih-Hwa
2004-01-01
In preclinical studies, tumor cells genetically engineered to secrete cytokines, hereafter referred to as tumor cell vaccines, can often generate systemic antitumor immunity. This study investigated the therapeutic effects of live or irradiated tumor cell vaccines that secrete granulocyte-macrophage colony-stimulating factor (GM-CSF) on established orthotopic liver tumors. Experimental results indicated that two doses (3 x 10(7) cells per dose) of irradiated tumor cell vaccines were therapeutically ineffective, whereas one dose (3 x 10(6) cells) of live tumor cell vaccines caused complete tumor regression. In vivo depletion of CD8+ T cells, but not natural killer cells, restored tumor formation in the live vaccine-treated animals. Additionally, the treatment of cells with live vaccine induced markedly higher levels of cytotoxic T lymphocyte activity than the irradiated vaccines in the draining lymph nodes. The higher levels of cytokine and antigen loads could partly explain the superior antitumor activity of live tumor cell vaccines, but other unidentified mechanisms could also play a role in the early T cell activation in the lymph nodes. A protocol using multiple and higher dosages of irradiated tumor cell vaccines also caused significant regression of liver tumors. These results suggest that the GM-CSF-secreting tumor cell vaccines are highly promising for orthotopic liver tumors if higher levels of immune responses are elicited during early tumor development. Copyright 2004 National Science Council, ROC and S. Karger AG, Basel
Targeting tumor cell motility to prevent metastasis
Palmer, Trenis D.; Ashby, William J.; Lewis, John D.; Zijlstra, Andries
2011-01-01
Mortality and morbidity in patients with solid tumors invariably results from the disruption of normal biological function caused by disseminating tumor cells. Tumor cell migration is under intense investigation as the underlying cause of cancer metastasis. The need for tumor cell motility in the progression of metastasis has been established experimentally and is supported empirically by basic and clinical research implicating a large collection of migration-related genes. However, there are few clinical interventions designed to specifically target the motility of tumor cells and adjuvant therapy to specifically prevent cancer cell dissemination is severely limited. In an attempt to define motility targets suitable for treating metastasis, we have parsed the molecular determinants of tumor cell motility into five underlying principles including cell autonomous ability, soluble communication, cell-cell adhesion, cell-matrix adhesion, and integrating these determinants of migration on molecular scaffolds. The current challenge is to implement meaningful and sustainable inhibition of metastasis by developing clinically viable disruption of molecular targets that control these fundamental capabilities. PMID:21664937
Radiobiological basis of SBRT and SRS.
Song, Chang W; Kim, Mi-Sook; Cho, L Chinsoo; Dusenbery, Kathryn; Sperduto, Paul W
2014-08-01
Stereotactic body radiation therapy (SBRT) and stereotactic radiosurgery (SRS) have been demonstrated to be highly effective for a variety of tumors. However, the radiobiological principles of SBRT and SRS have not yet been clearly defined. It is well known that newly formed tumor blood vessels are fragile and extremely sensitive to ionizing radiation. Various lines of evidence indicate that irradiation of tumors with high dose per fraction, i.e. >10 Gy per fraction, not only kills tumor cells but also causes significant damage in tumor vasculatures. Such vascular damage and ensuing deterioration of the intratumor environment then cause ischemic or indirect/secondary tumor cell death within a few days after radiation exposure, indicating that vascular damage plays an important role in the response of tumors to SBRT and SRS. Indications are that the extensive tumor cell death due to the direct effect of radiation on tumor cells and the secondary effect through vascular damage may lead to massive release of tumor-associated antigens and various pro-inflammatory cytokines, thereby triggering an anti-tumor immune response. However, the precise role of immune assault on tumor cells in SBRT and SRS has not yet been clearly defined. The "4 Rs" for conventional fractionated radiotherapy do not include indirect cell death and thus 4 Rs cannot account for the effective tumor control by SBRT and SRS. The linear-quadratic model is for cell death caused by DNA breaks and thus the usefulness of this model for ablative high-dose SBRT and SRS is limited.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ourique, Fabiana; Kviecinski, Maicon R.; Zirbel, Guilherme
The purpose of the study was to obtain further in vivo data of antitumor effects and mechanisms triggered by juglone and Q7 in combination with ascorbate. The study was done using Ehrlich ascites tumor-bearing mice. Treatments were intraperitoneal every 24 h for 9 days. Control group was treated with excipient. Previous tests selected the doses of juglone and Q7 plus ascorbate (1 and 100 mg/kg, respectively). Samples of ascitic fluid were collected to evaluate carbonyl proteins, GSH and activity of antioxidant enzymes such as catalase, superoxide dismutase, glutathione peroxidase and glutathione reductase. Hypoxia inducible factor HIF-1α, GLUT1, proteins driving cell cycle (p53, p16more » and cyclin A) and apoptosis (poly-ADP-polymerase PARP, Bax and Bcl-xL) were assessed by western blot. Tumor cells were categorized by the phase of cell cycle using flow cytometry and type of cell death using acridine orange/ethidium bromide. A glucose uptake assessment was performed by liquid scintillation using Ehrlich tumor cells cultured with {sup 14}C-deoxyglucose. Treatments caused increased protein carbonylation and activity of antioxidant enzymes and decreased levels of GSH, HIF-1α, GLUT1 and glucose uptake in tumor cells. They also caused increased number of tumor cells in G1, p53 and p16 activation and decreased cyclin A, but only when combined with ascorbate. Apoptosis was induced mostly when treatments were done with ascorbate, causing PARP and Bax cleavage, and increased Bax/Bcl-xL ratio. Juglone and Q7 in combination with ascorbate caused inhibition of tumor progress in vivo by triggering apoptosis and cell cycle arrest associated with oxidative stress, suppression of HIF-1 and uncoupling of glycolytic metabolism. - Highlights: • Ascorbate potentiates the inhibition caused by juglone and Q7on tumor progress in vivo. • Juglone and Q7 with ascorbate caused widespread oxidative stress in tumor tissue. • Treatments inhibited HIF-1 and GLUT1 expression causing reduced glucose uptake. • Treatments induced cell cycle arrest and apoptosis in tumor in vivo.« less
Stromal cells in breast cancer as a potential therapeutic target
Dykes, Samantha S.; Hughes, Veronica S.; Wiggins, Jennifer M.; Fasanya, Henrietta O.; Tanaka, Mai; Siemann, Dietmar
2018-01-01
Breast cancer in the United States is the second most commonly diagnosed cancer in women. About 1 in 8 women will develop invasive breast cancer over the course of her lifetime and breast cancer remains the second leading cause of cancer-related death. In pursuit of novel therapeutic strategies, researchers have examined the tumor microenvironment as a potential anti-cancer target. In addition to neoplastic cells, the tumor microenvironment is composed of several critical normal cell types, including fibroblasts, vascular and lymph endothelial cells, osteoclasts, adipocytes, and immune cells. These cells have important roles in healthy tissue stasis, which frequently are altered in tumors. Indeed, tumor-associated stromal cells often contribute to tumorigenesis, tumor progression, and metastasis. Consequently, these host cells may serve as a possible target in anti-tumor and anti-metastatic therapeutic strategies. Targeting the tumor associated host cells offers the benefit that such cells do not mutate and develop resistance in response to treatment, a major cause of failure in cancer therapeutics targeting neoplastic cells. This review discusses the role of host cells in the tumor microenvironment during tumorigenesis, progression, and metastasis, and provides an overview of recent developments in targeting these cell populations to enhance cancer therapy efficacy.
Granulomatous inflammation of pulmonary squamous cell carcinoma: a rare phenomenon.
Tajima, Shogo; Koda, Kenji
2015-01-01
Some neoplasms are associated with granulomatous inflammation. Granuloma formation in tumor tissue is caused by the cytokines derived from either the main tumor or other cells surrounding the tumor. In other instances, granulomatous inflammation is observed in the lymph nodes draining a tumor. This has been recognized as a sarcoid-like reaction. Herein, we report of a 75-year-old man with pulmonary squamous cell carcinoma (SCC), where granulomatous inflammation was observed extensively at the primary site. The carcinoma seemed to partly regress. In the regressing area, tumor cell debris was surrounded by granuloma. In contrast, no granuloma was identified in the dissected regional lymph nodes. To the best of our knowledge, such a case of SCC had not been described thus far. More case studies are required to determine whether tumor-related granuloma is the main cause of regression or whether it is just a secondary phenomenon caused by the attack and destruction of the tumor by lymphocytes.
Klein, Andreas; Guhl, Eva; Zollinger, Raphael; Tzeng, Yin-Jeh; Wessel, Ralf; Hummel, Michael; Graessmann, Monika; Graessmann, Adolf
2005-05-01
Microarray studies revealed that as a first hit the SV40 T/t antigen causes deregulation of 462 genes in mammary gland cells (ME cells) of WAP-SVT/t transgenic animals. The majority of deregulated genes are cell proliferation specific and Rb-E2F dependent, causing ME cell proliferation and gland hyperplasia but not breast cancer formation. In the breast tumor cells a further 207 genes are differentially expressed, most of them belonging to the cell communication category. In tissue culture breast tumor cells frequently switch off WAP-SVT/t transgene expression and regain the morphology and growth characteristics of normal ME cells, although the tumor-revertant cells are aneuploid and only 114 genes regain the expression level of normal ME cells. The profile of retransformants shows that only 38 deregulated genes are tumor-specific, and that none of them is considered to be a typical breast cancer gene.
Lee, Dongjin R.; Yoo, Jeong-Eun; Lee, Jae Souk; Park, Sanghyun; Lee, Junwon; Park, Chul-Yong; Ji, Eunhyun; Kim, Han-Soo; Hwang, Dong-Youn; Kim, Dae-Sung; Kim, Dong-Wook
2015-01-01
Summary Tumorigenic potential of human pluripotent stem cells (hPSCs) is an important issue in clinical applications. Despite many efforts, PSC-derived neural precursor cells (NPCs) have repeatedly induced tumors in animal models even though pluripotent cells were not detected. We found that polysialic acid-neural cell adhesion molecule (PSA-NCAM)− cells among the early NPCs caused tumors, whereas PSA-NCAM+ cells were nontumorigenic. Molecular profiling, global gene analysis, and multilineage differentiation of PSA-NCAM− cells confirm that they are multipotent neural crest stem cells (NCSCs) that could differentiate into both ectodermal and mesodermal lineages. Transplantation of PSA-NCAM− cells in a gradient manner mixed with PSA-NCAM+ cells proportionally increased mesodermal tumor formation and unwanted grafts such as PERIPHERIN+ cells or pigmented cells in the rat brain. Therefore, we suggest that NCSCs are a critical target for tumor prevention in hPSC-derived NPCs, and removal of PSA-NCAM− cells eliminates the tumorigenic potential originating from NCSCs after transplantation. PMID:25937368
... by a flaw in one gene, the VHL gene, which regulates cell growth causing patients to battle a series of tumors ... by a flaw in one gene, the VHL gene, which regulates cell growth causing patients to battle a series of tumors ...
The leading cause of death from cancer is not a primary tumor but is the metastases, or invasion of tumor cells into other locations in the body, that result from it. A complex and incompletely understood process, metastatic tumor formation is thought to require several steps in which tumor cells invade the tissue surrounding the primary tumor, enter local blood vessels,
Verrotti, Alberto; Penta, Laura; Zenzeri, Letizia; Lucchetti, Laura; Giovenali, Paolo; De Feo, Pierpaolo
2015-01-01
Leydig cell testicular tumors are a rare cause of precocious pseudopuberty in boys. Surgery is the main therapy and shows good overall prognosis. The physical signs of precocious puberty are expected to disappear shortly after surgical removal of the mass. We report two children, 7.5 and 7.7 year-old boys, who underwent testis-sparing surgery for a Leydig cell testicular tumor causing precocious pseudopuberty. During follow-up, after an immediate clinical and laboratory regression, both boys presented signs of precocious puberty and ultimately developed central precocious puberty. They were successfully treated with gonadotropin-releasing hormone (GnRH) analogs. Only six other cases have been described regarding the development of central precocious puberty after successful treatment of a Leydig cell tumor causing precocious pseudopuberty. Gonadotropin-dependent precocious puberty should be considered in children treated for a Leydig cell tumor presenting persistent or recurrent physical signs of puberty activation. In such cases, therapy with GnRH analogs appears to be the most effective medical treatment.
Curcumin targets fibroblast–tumor cell interactions in oral squamous cell carcinoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dudás, József, E-mail: jozsef.dudas@i-med.ac.at; Fullár, Alexandra, E-mail: fullarsz@gmail.com; 1st Department of Pathology and Experimental Cancer Research, Semmelweis University, Üllői út 26, 1085 Budapest
Co-culture of periodontal ligament fibroblasts (PDLs) and SCC-25 oral squamous carcinoma cells (OSCC) results in conversion of PDLs into carcinoma-associated fibroblasts (CAFs) and induces epithelial-to mesenchymal transition (EMT) of OSCC tumor cells. We hypothesized that Curcumin targets this dynamic mutual interaction between CAFs and tumor cells. Normal and 2 μM Curcumin-treated co-culture were performed for 4 days, followed by analysis of tumor cell invasivity, mRNA/protein expression of EMT-markers and mediators, activity measure of matrix metalloproteinase 9 (MMP-9), and western blot analysis of signal transduction in tumor cells and fibroblasts. In Curcumin-treated co-culture, in tumor cells, the levels of nuclear factormore » κB (NFκBα) and early response kinase (ERK)—decreased, in fibroblasts, integrin αv protein synthesis decreased compared to corresponding cells in normal co-culture. The signal modulatory changes induced by Curcumin caused decreased release of EMT-mediators in CAFs and reversal of EMT in tumor cells, which was associated with decreased invasion. These data confirm the palliative potential of Curcumin in clinical application. - Graphical abstract: Co-culture of periodontal ligament fibroblasts (PDLs) and SCC-25 oral squamous carcinoma cells (OSCC) results in conversion of PDLs into carcinoma-associated fibroblasts (CAFs) and induces epithelial-to mesenchymal transition (EMT) of tumor cells. Curcumin targets this dynamic mutual interaction between CAFs and tumor cells by inhibiting the production of EMT mediators in CAFs and by modification of intracellular signaling in tumor cells. This causes less invasivity and reversal of EMT in tumor cells. Highlights: ► Curcumin targets tumor–fibroblast interaction in head and neck cancer. ► Curcumin suppresses mediators of epithelial–mesenchymal transition. ► Curcumin decreases the invasivity of tumor cells.« less
[Solitary Fibrous Tumor: a Rare Cause of Recurrent Severe Hypoglycemia].
Kühn-Velten, Ute; Hohmann, Christian; Strauss, Tim; Heizmann, Oleg; Klöppel, Günter
2018-06-01
A 73-year-old woman was admitted to hospital early in the morning by an emergency doctor in initially unclear comatose conditions with a blood glucose of 24 mg/dl. There were no important previous diseases requiring any medication. She was in good physical state. Except for a lowered breath sound on the right side of the chest the physical findings were normal. Endocrinologic tests, diagnostic imaging (Chest-x-ray, ultrasonography of abdomen and pleura, abdominal and thoracic CT) and fine needle biopsy suggested a non-islet-cell-tumor on the right side of the pleura as cause of hypoglycemia. Resection of the tumor resulted in normoglycemia and the pathologic examination of the tumor specimen revealed a solid fibrous tumor. A solid fibrous tumor is a relatively common cause of the rare syndrome of non-islet-cell-tumor hypoglycemia. It shows typical endocrinologic findings, which immediately help to clarify the differential diagnosis with other causes of severe hypoglycemia. Early thorough endocrinologic testing is therefore paramount for the recognition of this distinct hypoglycemic disease which is related to the release of IGF-2, respectively Big-IGF-2, from the tumor cells. © Georg Thieme Verlag KG Stuttgart · New York.
Tumor induced hepatic myeloid derived suppressor cells can cause moderate liver damage.
Eggert, Tobias; Medina-Echeverz, José; Kapanadze, Tamar; Kruhlak, Michael J; Korangy, Firouzeh; Greten, Tim F
2014-01-01
Subcutaneous tumors induce the accumulation of myeloid derived suppressor cells (MDSC) not only in blood and spleens, but also in livers of these animals. Unexpectedly, we observed a moderate increase in serum transaminases in mice with EL4 subcutaneous tumors, which prompted us to study the relationship of hepatic MDSC accumulation and liver injury. MDSC were the predominant immune cell population expanding in livers of all subcutaneous tumor models investigated (RIL175, B16, EL4, CT26 and BNL), while liver injury was only observed in EL4 and B16 tumor-bearing mice. Elimination of hepatic MDSC in EL4 tumor-bearing mice using low dose 5-fluorouracil (5-FU) treatment reversed transaminase elevation and adoptive transfer of hepatic MDSC from B16 tumor-bearing mice caused transaminase elevation indicating a direct MDSC mediated effect. Surprisingly, hepatic MDSC from B16 tumor-bearing mice partially lost their damage-inducing potency when transferred into mice bearing non damage-inducing RIL175 tumors. Furthermore, MDSC expansion and MDSC-mediated liver injury further increased with growing tumor burden and was associated with different cytokines including GM-CSF, VEGF, interleukin-6, CCL2 and KC, depending on the tumor model used. In contrast to previous findings, which have implicated MDSC only in protection from T cell-mediated hepatitis, we show that tumor-induced hepatic MDSC themselves can cause moderate liver damage.
Tumor Induced Hepatic Myeloid Derived Suppressor Cells Can Cause Moderate Liver Damage
Eggert, Tobias; Medina-Echeverz, José; Kapanadze, Tamar; Kruhlak, Michael J.; Korangy, Firouzeh; Greten, Tim F.
2014-01-01
Subcutaneous tumors induce the accumulation of myeloid derived suppressor cells (MDSC) not only in blood and spleens, but also in livers of these animals. Unexpectedly, we observed a moderate increase in serum transaminases in mice with EL4 subcutaneous tumors, which prompted us to study the relationship of hepatic MDSC accumulation and liver injury. MDSC were the predominant immune cell population expanding in livers of all subcutaneous tumor models investigated (RIL175, B16, EL4, CT26 and BNL), while liver injury was only observed in EL4 and B16 tumor-bearing mice. Elimination of hepatic MDSC in EL4 tumor-bearing mice using low dose 5-fluorouracil (5-FU) treatment reversed transaminase elevation and adoptive transfer of hepatic MDSC from B16 tumor-bearing mice caused transaminase elevation indicating a direct MDSC mediated effect. Surprisingly, hepatic MDSC from B16 tumor-bearing mice partially lost their damage-inducing potency when transferred into mice bearing non damage-inducing RIL175 tumors. Furthermore, MDSC expansion and MDSC-mediated liver injury further increased with growing tumor burden and was associated with different cytokines including GM-CSF, VEGF, interleukin-6, CCL2 and KC, depending on the tumor model used. In contrast to previous findings, which have implicated MDSC only in protection from T cell-mediated hepatitis, we show that tumor-induced hepatic MDSC themselves can cause moderate liver damage. PMID:25401795
Gap junction coupling is required for tumor cell migration through lymphatic endothelium.
Karpinich, Natalie O; Caron, Kathleen M
2015-05-01
The lymphatic vasculature is a well-established conduit for metastasis, but the mechanisms by which tumor cells interact with lymphatic endothelial cells (LECs) to facilitate escape remain poorly understood. Elevated levels of the lymphangiogenic peptide adrenomedullin are found in many tumors, and we previously characterized that its expression is necessary for lymphatic vessel growth within both tumors and sentinel lymph nodes and for distant metastasis. This study used a tumor cell-LEC coculture system to identify a series of adrenomedullin-induced events that facilitated transendothelial migration of the tumor cells through a lymphatic monolayer. High levels of adrenomedullin expression enhanced adhesion of tumor cells to LECs, and further analysis revealed that adrenomedullin promoted gap junction coupling between LECs as evidenced by spread of Lucifer yellow dye. Adrenomedullin also enhanced heterocellular gap junction coupling as demonstrated by Calcein dye transfer from tumor cells into LECs. This connexin-mediated gap junction intercellular communication was necessary for tumor cells to undergo transendothelial migration because pharmacological blockade of this heterocellular communication prevented the ability of tumor cells to transmigrate through the lymphatic monolayer. In addition, treatment of LECs with adrenomedullin caused nuclear translocation of β-catenin, a component of endothelial cell junctions, causing an increase in transcription of the downstream target gene C-MYC. Importantly, blockade of gap junction intercellular communication prevented β-catenin nuclear translocation. Our findings indicate that maintenance of cell-cell communication is necessary to facilitate a cascade of events that lead to tumor cell migration through the lymphatic endothelium. © 2015 American Heart Association, Inc.
NASA Astrophysics Data System (ADS)
Duan, Xiaopin; Xiao, Jisheng; Yin, Qi; Zhang, Zhiwen; Yu, Haijun; Mao, Shirui; Li, Yaping
2014-03-01
Metastasis, the main cause of cancer related deaths, remains the greatest challenge in cancer treatment. Disulfiram (DSF), which has multi-targeted anti-tumor activity, was encapsulated into redox-sensitive shell crosslinked micelles to achieve intracellular targeted delivery and finally inhibit tumor growth and metastasis. The crosslinked micelles demonstrated good stability in circulation and specifically released DSF under a reductive environment that mimicked the intracellular conditions of tumor cells. As a result, the DSF-loaded redox-sensitive shell crosslinked micelles (DCMs) dramatically inhibited cell proliferation, induced cell apoptosis and suppressed cell invasion, as well as impairing tube formation of HMEC-1 cells. In addition, the DCMs could accumulate in tumor tissue and stay there for a long time, thereby causing significant inhibition of 4T1 tumor growth and marked prevention in lung metastasis of 4T1 tumors. These results suggested that DCMs could be a promising delivery system in inhibiting the growth and metastasis of breast cancer.
Oncogenes in retroviruses and cells
NASA Astrophysics Data System (ADS)
Kurth, Reinhard
1983-09-01
Oncogenes are genes that cause cancer. Retroviruses contain oncogenes and cause cancer in animals and, perhaps, in man. The viruses have appropriated their oncogenes from normal cellular DNA by genetic recombination. Correspondingly, uninfected vertebrate cells contain a family of evolutionary conserved cellular oncogenes. Retrovirus infection, introducing additional viral oncogenes into the cells, as well as carcinogen-mediated activation of cellular oncogenes may both lead to increased synthesis of oncogene encoded transforming proteins which convert normal cells to tumor cells. Unique retroviruses of human origin have recently been identified. They may, on occasion, directly cause tumors in man. However, the general significance of retroviruses may better be illustrated by their remarkable genetic composition which allows them to promote tumor growth by a variety of genetic mechanisms.
Pu-erh Tea Inhibits Tumor Cell Growth by Down-Regulating Mutant p53
Zhao, Lanjun; Jia, Shuting; Tang, Wenru; Sheng, Jun; Luo, Ying
2011-01-01
Pu-erh tea is a kind of fermented tea with the incorporation of microorganisms’ metabolites. Unlike green tea, the chemical characteristics and bioactivities of Pu-erh tea are still not well understood. Using water extracts of Pu-erh tea, we analyzed the tumor cell growth inhibition activities on several genetically engineered mouse tumor cell lines. We found that at the concentration that did not affect wild type mouse embryo fibroblasts (MEFs) growth, Pu-erh tea extracts could inhibit tumor cell growth by down-regulated S phase and cause G1 or G2 arrest. Further study showed that Pu-erh tea extracts down-regulated the expression of mutant p53 in tumor cells at the protein level as well as mRNA level. The same concentration of Pu-erh tea solution did not cause p53 stabilization or activation of its downstream pathways in wild type cells. We also found that Pu-erh tea treatment could slightly down-regulate both HSP70 and HSP90 protein levels in tumor cells. These data revealed the action of Pu-erh tea on tumor cells and provided the possible mechanism for Pu-erh tea action, which explained its selectivity in inhibiting tumor cells without affecting wild type cells. Our data sheds light on the application of Pu-erh tea as an anti-tumor agent with low side effects. PMID:22174618
Shurin, Michael R.; Potapovich, Alla I.; Tyurina, Yulia Y.; Tourkova, Irina L.; Shurin, Galina V.; Kagan, Valerian E.
2014-01-01
Dendritic cells (DC) loaded with tumor antigens from apoptotic/necrotic tumor cells are commonly used as vaccines for cancer therapy. However, the use of dead tumor cells may cause both tolerance and immunity, making the effect of vaccination unpredictable. To deliver live tumor “cargoes” into DC, we developed a new approach based on the “labeling” of tumors with a phospholipid “eat-me” signal, phosphatidylserine. Expression of phosphatidylserine on live tumor cells mediated their recognition and endocytosis by DC resulting in the presentation of tumor antigens to antigen-specific T cells. In mice, topical application of phosphatidylserine-containing ointment over melanoma induced tumor-specific CTL, local and systemic antitumor immunity, and inhibited tumor growth. Thus, labeling of tumors with phosphatidylserine is a promising strategy for cancer immunotherapy. PMID:19276376
Deronic, Adnan; Tahvili, Sahar; Leanderson, Tomas; Ivars, Fredrik
2016-07-11
Previous work has demonstrated immunomodulatory, anti-tumor, anti-metastatic and anti-angiogenic effects of the small molecule quinoline-3-carboxamide tasquinimod in pre-clinical cancer models. To better understand the anti-tumor effects of tasquinimod in transplantable tumor models, we have evaluated the impact of the compound both on recruitment of myeloid cells to tumor tissue and on tumor-induced myeloid cell expansion as these cells are known to promote tumor development. Mice bearing subcutaneous 4 T1 mammary carcinoma tumors were treated with tasquinimod in the drinking water. A BrdU-based flow cytometry assay was utilized to assess the impact of short-term tasquinimod treatment on myeloid cell recruitment to tumors. Additionally, long-term treatment was performed to study the anti-tumor effect of tasquinimod as well as its effects on splenic myeloid cells and their progenitors. Myeloid cell populations were also immune-depleted by in vivo antibody treatment. Short-term tasquinimod treatment did not influence the proliferation of splenic Ly6C(hi) and Ly6G(hi) cells, but instead reduced the influx of Ly6C(hi) cells to the tumor. Treatment with tasquinimod for various periods of time after tumor inoculation revealed that the anti-tumor effect of this compound mainly operated during the first few days of tumor growth. Similar to tasquinimod treatment, antibody-mediated depletion of Ly6C(hi) cells within that same time frame, caused reduced tumor growth, thereby confirming a significant role for these cells in tumor development. Additionally, long-term tasquinimod treatment reduced the splenomegaly and expansion of splenic myeloid cells during a later phase of tumor development. In this phase, tasquinimod normalized the tumor-induced alterations in myeloerythroid progenitor cells in the spleen but had only limited impact on the same populations in the bone marrow. Our results indicate that tasquinimod treatment reduces tumor growth by operating early after tumor inoculation and that this effect is at least partially caused by reduced recruitment of Ly6C(hi) cells to tumor tissue. Long-term treatment also reduces the number of splenic myeloid cells and myeloerythroid progenitors, but these effects did not influence established rapidly growing tumors.
Canine parvovirus NS1 protein exhibits anti-tumor activity in a mouse mammary tumor model.
Gupta, Shishir Kumar; Yadav, Pavan Kumar; Gandham, Ravi Kumar; Sahoo, A P; Harish, D R; Singh, Arvind Kumar; Tiwari, A K
2016-02-02
Many viral proteins have the ability to kill tumor cells specifically without harming the normal cells. These proteins, on ectopic expression, cause lysis or induction of apoptosis in the target tumor cells. Parvovirus NS1 is one of such proteins, which is known to kill high proliferating tumor cells. In the present study, we assessed the apoptosis inducing ability of canine parvovirus type 2 NS1 protein (CPV2.NS1) in vitro in 4T1 cells, and found it to cause significant cell death due to induction of apoptosis through intrinsic or mitochondrial pathway. Further, we also evaluated the oncolytic activity of CPV2.NS1 protein in a mouse mammary tumor model. The results suggested that CPV2.NS1 was able to inhibit the growth of 4T1 induced mouse mammary tumor as indicated by significantly reduced tumor volume, mitotic, AgNOR and PCNA indices. Further, inhibition of tumor growth was found to be because of induction of apoptosis in the tumor cells, which was evident by a significant increase in the number of TUNEL positive cells. Further, CPV2.NS1 was also able to stimulate the immune cells against the tumor antigens as indicated by the increased CD4+ and CD8+ counts in the blood of CVP2.NS1 treated mice. Further optimization of the delivery of NS1 protein and use of an adjuvant may further enhance its anti-tumor activity. Copyright © 2015 Elsevier B.V. All rights reserved.
IMMU-22. ADOPTIVE CELL THERAPY AGAINST DIPG USING DEVELOPMENTALLY REGULATED ANTIGENS
Flores, Catherine; Gil, Jorge; Abraham, Rebecca; Pham, Christina; Wildes, Tyler; Moore, Ginger; Drake, Jeffrey; Dyson, Kyle; Mitchell, Duane
2017-01-01
Abstract INTRODUCTION: Diffuse intrinsic pontine glioma (DIPG) survival has remained static over decades and DIPG is now the main cause of brain tumor-related deaths in children. Immunotherapy has emerged as a treatment modality with the highest curative potential in patients with refractory malignancies. Our group has pioneered an adoptive cell therapy platform employing total tumor RNA pulsed dendritic cells to generate large amounts of polyclonal antigen-specific T cells in both human and murine systems. As DIPGs are embryonal tumors, our objective in this proposal is to identify a set of developmentally regulated antigens that are overexpressed during oncogenesis of DIPG in order to cause immunological rejection of this tumor without the need for tumor tissue. METHODS: We employ RNA-pulsed bone marrow-derived dendritic cells to ex vivo activate tumor-reactive T cells for use in adoptive cell therapy. Here we use either total RNA isolated from tumor tissue, (TTRNA) or developmental antigens (DevAg) RNA isolated from postnatal day 4 murine brain stem. Either TTRNA-T cells or DevAg-T cells were used in adoptive cell therapy against a preclinical model of DIPG. RESULTS: Pediatric brain tumors are bland relative to peripheral tumors in terms of high expression of immunogenic antigens. Since DIPG antigens remain largely uncharacterized, we used total RNA isolated from tumor cells to generate tumor-specific T cells to use for our therapeutic approach to first demonstrate that immune responses can be generated against this tumor. We also successfully generated immunity against DIPG in a preclinical model using DevAg-T cells for adoptive cell therapy. CONCLUSION: The region- and age- specific nature of DIPG suggests that the underlying pathophysiology likely involves dysregulation of a postnatal neurodevelopmental process which occurs in embryonal tumors. Here we leverage this and demonstrate that DIPG can be effectively treated using adoptive cell therapy against overexpressed developmentally regulated antigens.
The leading cause of death from cancer is not a primary tumor but is the metastases, or invasion of tumor cells into other locations in the body, that result from it. A complex and incompletely understood process, metastatic tumor formation is thought to require several steps in which tumor cells invade the tissue surrounding the primary tumor, enter local blood vessels, navigate the circulation, exit the vasculature, and colonize a new site. Tumor cells do not, however, operate independently, and the role that the immune system plays in this metastatic process is beginning to be appreciated.
Markovsky, Ela; Vax, Einav; Ben-Shushan, Dikla; Eldar-Boock, Anat; Shukrun, Rachel; Yeini, Eilam; Barshack, Iris; Caspi, Revital; Harari-Steinberg, Orit; Pode-Shakked, Naomi; Dekel, Benjamin; Satchi-Fainaro, Ronit
2017-11-01
Cancer stem cells (CSC) form a specific population within the tumor that has been shown to have self-renewal and differentiation properties, increased ability to migrate and form metastases, and increased resistance to chemotherapy. Consequently, even a small number of cells remaining after therapy can repopulate the tumor and cause recurrence of the disease. CSCs in Wilms tumor, a pediatric renal cancer, were previously shown to be characterized by neural cell adhesion molecule (NCAM) expression. Therefore, NCAM provides a specific biomarker through which the CSC population in this tumor can be targeted. We have recently developed an NCAM-targeted nanosized conjugate of paclitaxel bound to a biodegradable polyglutamic acid polymer. In this work, we examined the ability of the conjugate to inhibit Wilms tumor by targeting the NCAM-expressing CSCs. Results show that the conjugate selectively depleted the CSC population of the tumors and effectively inhibited tumor growth without causing toxicity. We propose that the NCAM-targeted conjugate could be an effective therapeutic for Wilms tumor. Mol Cancer Ther; 16(11); 2462-72. ©2017 AACR . ©2017 American Association for Cancer Research.
Hallgren, Oskar; Aits, Sonja; Brest, Patrick; Gustafsson, Lotta; Mossberg, Ann-Kristin; Wullt, Björn; Svanborg, Catharina
2008-01-01
HAMLET (human alpha-lactalbumin made lethal to tumor cells) is a molecular complex derived from human milk that kills tumor cells by a process resembling programmed cell death. The complex consists of partially unfolded alpha-lactalbumin and oleic acid, and both the protein and the fatty acid are required for cell death. HAMLET has broad antitumor activity in vitro, and its therapeutic effect has been confirmed in vivo in a human glioblastoma rat xenograft model, in patients with skin papillomas and in patients with bladder cancer. The mechanisms of tumor cell death remain unclear, however. Immediately after the encounter with tumor cells, HAMLET invades the cells and causes mitochondrial membrane depolarization, cytochrome c release, phosphatidyl serine exposure, and a low caspase response. A fraction of the cells undergoes morphological changes characteristic of apoptosis, but caspase inhibition does not rescue the cells and Bcl-2 overexpression or altered p53 status does not influence the sensitivity of tumor cells to HAMLET. HAMLET also creates a state of unfolded protein overload and activates 20S proteasomes, which contributes to cell death. In parallel, HAMLET translocates to tumor cell nuclei, where high-affinity interactions with histones cause chromatin disruption, loss of transcription, and nuclear condensation. The dying cells also show morphological changes compatible with macroautophagy, and recent studies indicate that macroautophagy is involved in the cell death response to HAMLET. The results suggest that HAMLET, like a hydra with many heads, may interact with several crucial cellular organelles, thereby activating several forms of cell death, in parallel. This complexity might underlie the rapid death response of tumor cells and the broad antitumor activity of HAMLET.
NASA Astrophysics Data System (ADS)
Kobayashi, Hisataka
2017-02-01
Near infrared photoimmunotherapy (NIR-PIT) is a new type of molecularly-targeted photo-therapy based on conjugating a near infrared silica-phthalocyanine dye, IR700, to a monoclonal antibody (MAb) targeting target-specific cell-surface molecules. When exposed to NIR light, the conjugate rapidly induces a highly-selective cell death only in receptor-positive, MAb-IR700-bound cells. Current immunotherapies for cancer seek to modulate the balance among different immune cell populations, thereby promoting anti-tumor immune responses. However, because these are systemic therapies, they often cause treatment-limiting autoimmune adverse effects. It would be ideal to manipulate the balance between suppressor and effector cells within the tumor without disturbing homeostasis elsewhere in the body. CD4+CD25+Foxp3+ regulatory T cells (Tregs) are well-known immune-suppressor cells that play a key role in tumor immuno-evasion and have been the target of systemic immunotherapies. We used CD25-targeted NIR-PIT to selectively deplete Tregs, thus activating CD8+ T and NK cells and restoring local anti-tumor immunity. This not only resulted in regression of the treated tumor but also induced responses in separate untreated tumors of the same cell-line derivation. We conclude that CD25-targeted NIR-PIT causes spatially selective depletion of Tregs, thereby providing an alternative approach to cancer immunotherapy that can treat not only local tumors but also distant metastatic tumors.
Coagulation activation by MC28 fibrosarcoma cells facilitates lung tumor formation.
Amirkhosravi, M; Francis, J L
1995-01-01
Tumor cells interact with the hemostatic system in various ways and may thus influence malignant growth and spread. MC28 fibrosarcoma cells possess a potent procoagulant activity (PCA) and form lung tumors following intravenous injection. The aim of this work was to study the relationship between PCA, intravascular coagulation and lung seeding in the MC28 model. MC28 cells were injected into control, warfarinized and heparinized hooded Lister rats. Coagulation changes were monitored by thromboelastography (TEG) and Sonoclot analysis (SA), lung fibrin formation by light and electron microscopy, tumor seeding by macroscopic counting and tumor cell and platelet deposition in the lungs by radiolabelling. PCA was measured by chromogenic assay. MC28 PCA was characterized as a tissue factor-factor VIIa complex that probably arose during cell culture or disaggregation of solid tumors. Injection of tumor cells caused marked coagulopathy and was rapidly (within 30 min) followed by fibrin deposition in the lungs and accumulation of radiolabelled platelets. Heparin and warfarin significantly reduced lung seeding (p < 0.001) and reduced retention of radiolabelled tumor cells in the pulmonary circulation (p < 0.01). Inhibition of cellular PCA by prior treatment with concanavalin A markedly reduced intravascular coagulation and lung seeding. We conclude that MC28 cells cause intravascular coagulation as a direct result of their procoagulant activity. The data suggest that tumor cells form complexes with platelets and fibrin which are retained in the lungs long enough for extravasation and seeding to occur.(ABSTRACT TRUNCATED AT 250 WORDS)
Zhang, Dejun; Zhao, Lei; Shen, Qiong; Lv, Qing; Jin, Min; Ma, Hong; Nie, Xiu; Zheng, Xiumei; Huang, Shaoyi; Zhou, Pengfei; Wu, Gang; Zhang, Tao
2017-05-15
Colorectal cancer is one of the major causes of death from cancer. Metastasis is the leading cause of treatment failure, in which cancer stem cells and circulating tumor cells play crucial roles. Identifying the involved metastatic biomarkers and clarifying the regulation mechanisms are of great importance for targeting tumor metastasis. In the current research, we discovered that KIAA1199, a cell-migration inducing protein, showed higher expression in CD44+ cancer cells from metastatic compared with the paired primary tissues, and was upregulated in colorectal cancer and positively correlated with numbers and mesenchymal phenotype of circulating tumor cells, and predicted shorter progress-free survival. Moreover, we indicated that down-regulation of KIAA1199 suppressed migration and invasion of colorectal cancer cells in vitro, and inhibited metastasis in vivo. Furthermore, we demonstrated that KIAA1199 was one of the direct and functional targets of miR-216a, and miR-216a overexpression led to decreased migration and invasion of colorectal cancer cells in vitro, and inhibited metastasis in vivo. Collectively, KIAA1199 plays a critical role in maintaining an aggressive phenotype of tumor cells, and suppression of KIAA1199-related motilities of tumor cells contributes to reduced tumor metastasis in colorectal cancer. © 2017 UICC.
Arina, Ainhoa; Schreiber, Karin; Binder, David C.; Karrison, Theodore; Liu, Rebecca B.; Schreiber, Hans
2014-01-01
Myeloid-derived CD11b+Gr1+ suppressor cells (MDSC) and tumor-associated macrophages (TAM) are considered a major obstacle for effective adoptive T cell therapy. Myeloid cells suppress naive T cell proliferation ex vivo and can prevent the generation of T cell responses in vivo. We find, however, that immune T cells adoptively transferred eradicate well-established tumors in the presence of MDSC and TAM which are strongly immunosuppressive ex vivo. These MDSC and TAM were comparable in levels and immunosuppression among different tumor models. Longitudinal microscopy of tumors in vivo revealed that after T cell transfer tumor vasculature and cancer cells disappeared simultaneously. During T-cell mediated tumor destruction, the tumor stroma contained abundant myeloid cells (mainly TAM) that retained their suppressive properties. Preimmunized but not naive mice resisted immune suppression caused by an unrelated tumor-burden supporting the idea that in vivo, myeloid immunosuppressive cells can suppress naive but not memory T cell responses. PMID:24367029
[Clinical characteristics of central diabetes insipidus: a retrospective analysis of 230 cases].
Zhang, J P; Guo, Q H; Mu, Y M; Lyu, Z H; Gu, W J; Yang, G Q; Du, J; Ba, J M; Lu, J M
2018-03-01
Objective: To evaluate the clinical characteristics and etiologies of central diabetes insipidus (CDI). Methods: The clinical data of 230 patients with CDI in the Department of Endocrinology of Chinese PLA General Hospital from 2008 June to 2014 December were collected and analyzed retrospectively. Results: The three most common causes of CDI were idiopathic CDI, lymphocytic hypophysitis and intracranial germ cell tumors. Among all the CDI, the idiopathic CDI accounted for 37.48%. There were significant differences in age onset and gender distribution among the different causes of CDI. The patients with intracranial germ cell tumors [age of onset(19.2±10.2) years] were younger than the other types of CDI. Germ cell tumors patients were more common in male, and lymphocytic hypophysitis patients were more common in female. The most frequent abnormality of anterior pituitary in patients with CDI was growth hormone deficiency, followed by hypogonadism, adrenal insufficiency and hypothyroidism. The dysfunction of thyroid axis and adrenal axis in patients with germ cell tumor was more common than those in patients with idiopathic and lymphocytic hypophysitis. Conclusions: The most common causes of central diabetes insipidus were idiopathic CDI, lymphocytic hypophysitis and intracranial germ cell tumors. There were differences in age of onset, gender distribution and abnormal production of anterior pituitary hormones among all causes of CDI patients.
One approach to cancer immunotherapy, as opposed to therapeutic vaccination, is the transfusion of large numbers of tumor-specific killer T cells (cytotoxic T cells or CTLs) into patients. The body’s own defense killer T cells are a subgroup of T lymphocytes (a type of white blood cells) that are capable of inducing death in tumor cells. CTLs can cause the death of target
Basel, Matthew T; Balivada, Sivasai; Wang, Hongwang; Shrestha, Tej B; Seo, Gwi Moon; Pyle, Marla; Abayaweera, Gayani; Dani, Raj; Koper, Olga B; Tamura, Masaaki; Chikan, Viktor; Bossmann, Stefan H; Troyer, Deryl L
2012-01-01
Using magnetic nanoparticles to absorb alternating magnetic field energy as a method of generating localized hyperthermia has been shown to be a potential cancer treatment. This report demonstrates a system that uses tumor homing cells to actively carry iron/iron oxide nanoparticles into tumor tissue for alternating magnetic field treatment. Paramagnetic iron/ iron oxide nanoparticles were synthesized and loaded into RAW264.7 cells (mouse monocyte/ macrophage-like cells), which have been shown to be tumor homing cells. A murine model of disseminated peritoneal pancreatic cancer was then generated by intraperitoneal injection of Pan02 cells. After tumor development, monocyte/macrophage-like cells loaded with iron/ iron oxide nanoparticles were injected intraperitoneally and allowed to migrate into the tumor. Three days after injection, mice were exposed to an alternating magnetic field for 20 minutes to cause the cell-delivered nanoparticles to generate heat. This treatment regimen was repeated three times. A survival study demonstrated that this system can significantly increase survival in a murine pancreatic cancer model, with an average post-tumor insertion life expectancy increase of 31%. This system has the potential to become a useful method for specifically and actively delivering nanoparticles for local hyperthermia treatment of cancer.
Adipose tissue immunity and cancer
Catalán, Victoria; Gómez-Ambrosi, Javier; Rodríguez, Amaia; Frühbeck, Gema
2013-01-01
Inflammation and altered immune response are important components of obesity and contribute greatly to the promotion of obesity-related metabolic complications, especially cancer development. Adipose tissue expansion is associated with increased infiltration of various types of immune cells from both the innate and adaptive immune systems. Thus, adipocytes and infiltrating immune cells secrete pro-inflammatory adipokines and cytokines providing a microenvironment favorable for tumor growth. Accumulation of B and T cells in adipose tissue precedes macrophage infiltration causing a chronic low-grade inflammation. Phenotypic switching toward M1 macrophages and Th1 T cells constitutes an important mechanism described in the obese state correlating with increased tumor growth risk. Other possible synergic mechanisms causing a dysfunctional adipose tissue include fatty acid-induced inflammation, oxidative stress, endoplasmic reticulum stress, and hypoxia. Recent investigations have started to unravel the intricacy of the cross-talk between tumor cell/immune cell/adipocyte. In this sense, future therapies should take into account the combination of anti-inflammatory approaches that target the tumor microenvironment with more sophisticated and selective anti-tumoral drugs. PMID:24106481
Cancer cell redirection biomarker discovery using a mutual information approach.
Roche, Kimberly; Feltus, F Alex; Park, Jang Pyo; Coissieux, Marie-May; Chang, Chenyan; Chan, Vera B S; Bentires-Alj, Mohamed; Booth, Brian W
2017-01-01
Introducing tumor-derived cells into normal mammary stem cell niches at a sufficiently high ratio of normal to tumorous cells causes those tumor cells to undergo a change to normal mammary phenotype and yield normal mammary progeny. This phenomenon has been termed cancer cell redirection. We have developed an in vitro model that mimics in vivo redirection of cancer cells by the normal mammary microenvironment. Using the RNA profiling data from this cellular model, we examined high-level characteristics of the normal, redirected, and tumor transcriptomes and found the global expression profiles clearly distinguish the three expression states. To identify potential redirection biomarkers that cause the redirected state to shift toward the normal expression pattern, we used mutual information relationships between normal, redirected, and tumor cell groups. Mutual information relationship analysis reduced a dataset of over 35,000 gene expression measurements spread over 13,000 curated gene sets to a set of 20 significant molecular signatures totaling 906 unique loci. Several of these molecular signatures are hallmark drivers of the tumor state. Using differential expression as a guide, we further refined the gene set to 120 core redirection biomarker genes. The expression levels of these core biomarkers are sufficient to make the normal and redirected gene expression states indistinguishable from each other but radically different from the tumor state.
Cancer cell redirection biomarker discovery using a mutual information approach
Roche, Kimberly; Feltus, F. Alex; Park, Jang Pyo; Coissieux, Marie-May; Chang, Chenyan; Chan, Vera B. S.; Bentires-Alj, Mohamed
2017-01-01
Introducing tumor-derived cells into normal mammary stem cell niches at a sufficiently high ratio of normal to tumorous cells causes those tumor cells to undergo a change to normal mammary phenotype and yield normal mammary progeny. This phenomenon has been termed cancer cell redirection. We have developed an in vitro model that mimics in vivo redirection of cancer cells by the normal mammary microenvironment. Using the RNA profiling data from this cellular model, we examined high-level characteristics of the normal, redirected, and tumor transcriptomes and found the global expression profiles clearly distinguish the three expression states. To identify potential redirection biomarkers that cause the redirected state to shift toward the normal expression pattern, we used mutual information relationships between normal, redirected, and tumor cell groups. Mutual information relationship analysis reduced a dataset of over 35,000 gene expression measurements spread over 13,000 curated gene sets to a set of 20 significant molecular signatures totaling 906 unique loci. Several of these molecular signatures are hallmark drivers of the tumor state. Using differential expression as a guide, we further refined the gene set to 120 core redirection biomarker genes. The expression levels of these core biomarkers are sufficient to make the normal and redirected gene expression states indistinguishable from each other but radically different from the tumor state. PMID:28594912
Fujisawa, Hiroshi; Nakajima, Nakako Izumi; Sunada, Shigeaki; Lee, Younghyun; Hirakawa, Hirokazu; Yajima, Hirohiko; Fujimori, Akira; Uesaka, Mitsuru; Okayasu, Ryuichi
2015-08-19
High linear energy transfer (LET) radiation such as carbon ion particles is successfully used for treatment of solid tumors. The reason why high LET radiation accomplishes greater tumor-killing than X-rays is still not completely understood. One factor would be the clustered or complex-type DNA damages. We previously reported that complex DNA double-strand breaks produced by high LET radiation enhanced DNA end resection, and this could lead to higher kinase activity of ATR protein recruited to RPA-coated single-stranded DNA. Although the effect of ATR inhibition on cells exposed to low LET gamma-rays has recently been reported, little is known regarding the effect of ATR inhibitor on cells treated with high LET radiation. The purpose of this study is to investigate the effects of the ATR inhibitor VE-821 in human tumor and normal cells irradiated with high LET carbon ions. HeLa, U2OS, and 1BR-hTERT (normal) cells were pre-treated with 1 μM VE-821 for 1 hour and irradiated with either high LET carbon ions or X-rays. Cell survival, cell cycle distribution, cell growth, and micronuclei formation were evaluated. VE-821 caused abrogation of G2/M checkpoint and forced irradiated cells to divide into daughter cells. We also found that carbon ions caused a higher number of multiple micronuclei than X-rays, leading to decreased cell survival in tumor cells when treated with VE-821, while the survival of irradiated normal cells were not significantly affected by this inhibitor. ATR inhibitor would be an effective tumor radiosensitizer with carbon ion irradiation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vishvakarma, Naveen Kumar; Kumar, Anjani; Singh, Sukh Mahendra, E-mail: sukhmahendrasingh@yahoo.com
2011-05-01
Using a murine model of a T cell lymphoma, in the present study, we report that tumor growth retarding action of curcumin involves modulation of some crucial parameters of tumor microenvironment regulating tumor progression. Curcumin-administration to tumor-bearing host caused an altered pH regulation in tumor cells associated with alteration in expression of cell survival and apoptosis regulatory proteins and genes. Nevertheless, an alteration was also observed in biophysical parameters of tumor microenvironment responsible for modulation of tumor growth pertaining to hypoxia, tumor acidosis, and glucose metabolism. The study thus sheds new light with respect to the antineoplastic action of curcuminmore » against a tumor-bearing host with progressively growing tumor of hematological origin. This will help in optimizing application of the drug and anticancer research and therapy. - Graphical Abstract: Display Omitted« less
One approach to cancer immunotherapy, as opposed to therapeutic vaccination, is the transfusion of large numbers of tumor-specific killer T cells (cytotoxic T cells or CTLs) into patients. The body’s own defense killer T cells are a subgroup of T lymphocytes (a type of white blood cells) that are capable of inducing death in tumor cells. CTLs can cause the death of target cells either by releasing granules containing toxic molecules including perforin, or by producing a membrane protein called Fas ligand (FasL) which on interaction with the tumor cell results in cell death.
Hurd-Brown, Tasia; Udoji, Felicia; Martin, Tamara; Whalen, Margaret M.
2012-01-01
1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) and triclosan (TCS) are organochlorine (OC) compounds that contaminate the environment, are found in human blood, and have been shown to decrease the tumor-cell killing (lytic) function of human natural killer (NK) cells. NK cells defend against tumor cells and virally infected cells. They bind to these targets, utilizing a variety of cell surface proteins. This study examined concentrations of DDT and TCS that decrease lytic function for alteration of NK binding to tumor targets. Levels of either compound that caused loss of binding function were then examined for effects on expression of cell-surface proteins needed for binding. NK cells exposed to 2.5 μM DDT for 24 h (which caused a greater than 55% loss of lytic function) showed a decrease in NK binding function of about 22%, and a decrease in CD16 cell-surface protein of 20%. NK cells exposed to 5 μM TCS for 24 h showed a decrease in ability to bind tumor cells of 37% and a decrease in expression of CD56 of about 34%. This same treatment caused a decrease in lytic function of greater than 87%. These results indicated that only a portion of the loss of NK lytic function seen with exposures to these compounds could be accounted for by loss of binding function. They also showed that loss of binding function is accompanied by a loss cell-surface proteins important in binding function. PMID:22729613
Taglia, Lauren; Matusiak, Damien; Benya, Richard V
2008-01-01
Gastrin-releasing peptide (GRP) and its receptor (GRPR) are not normally expressed by epithelial cells lining the adult human colon. However post malignant transformation both GRP and its receptor are aberrantly expressed in the colon where we have previously shown they act to retard metastasis by enhancing tumor cell attachment to the extracellular matrix. In the present study, we show that GRP signaling via its cognate receptor when both are aberrantly expressed in human colon cancer cells causes heat shock protein 72 (Hsp72) to be expressed. We show that GRP/GRPR induces expression of Hsp72 by signaling via focal adhesion kinase. When expressed, Hsp72 promotes the binding of CD16+ and CD94+ natural killer cells, resulting in tumor cell cytolysis. These findings demonstrate the presence of a novel mechanism whereby aberrantly expressed GRP/GRPR in human colorectal cancer attenuates tumor progression and may promote a favorable outcome.
Rottiers, P; Verfaillie, T; Contreras, R; Revets, H; Desmedt, M; Dooms, H; Fiers, W; Grooten, J
1998-11-09
Progression to malignancy of transformed cells involves complex genetic alterations and aberrant gene expression patterns. While aberrant gene expression is often caused by alterations in individual genes, the contribution of the tumoral environment to the triggering of this gene expression is less well established. The stable but heterogeneous expression in cultured EL4/13 cells of a novel tumor-associated antigen, designated as HTgp-175, was chosen for the investigation of gene expression during tumor formation. Homogeneously HTgp-175-negative EL4/13 cells, isolated by cell sorting or obtained by subcloning, acquired HTgp-175 expression as a result of tumor formation. The tumorigenicity of HTgp-175-negative vs. HTgp-175-positive EL4 variants was identical, indicating that induction but not selection accounted for the phenotypic switch from HTgp-175-negative to HTgp-175-positive. Although mutagenesis experiments showed that the protein was not essential for tumor establishment, tumor-derived cells showed increased malignancy, linking HTgp-175 expression with genetic changes accompanying tumor progression. This novel gene expression was not an isolated event, since it was accompanied by ectopic expression of the large chondroitin sulfate proteoglycan PG-M and of normal differentiation antigens. We conclude that signals derived from the tumoral microenvironment contribute significantly to the aberrant gene expression pattern of malignant cells, apparently by fortuitous activation of differentiation processes and cause expression of novel differentiation antigens as well as of inappropriate tumor-associated and ectopic antigens.
Chang, Chun-Jung; Tai, Kuo-Feng; Roffler, Steve; Hwang, Lih-Hwa
2004-11-15
Tumor cells engineered to secrete cytokines, referred to as tumor cell vaccines, can often generate systemic antitumor immunity and, in many cases, cause tumor regression. We compared the efficacy of s.c. immunization or intrahepatic immunization of GM-CSF-expressing tumor cell vaccines on the growth of s.c. or orthotopic liver tumors. A chemically transformed hepatic epithelial cell line, GP7TB, derived from Fischer 344 rats, was used to generate tumor models and tumor cell vaccines. Our results demonstrated that two s.c. injections of an irradiated tumor cell vaccine significantly controlled the growth of s.c. tumors, but was completely ineffective against orthotopic liver tumors. Effector cell infiltration in liver tumors was markedly reduced compared with s.c. tumors. Enhanced apoptosis of some effector cells was observed in the liver tumors compared with the s.c. tumors. Furthermore, the T cells induced by s.c. immunization preferentially migrated to s.c. tumor sites, as demonstrated by adoptive transfer experiments. In contrast, intrahepatic immunization, using parental tumor cells admixed with adenoviruses carrying the GM-CSF gene, yielded significantly better therapeutic effects on the liver tumors than on the s.c. tumors. Adoptive transfer experiments further confirmed that the T cells induced by liver immunization preferentially migrated to the liver tumor sites. Our results demonstrate that distinct T cell populations are induced by different immunization routes. Thus, the homing behavior of T cells depends on the route of immunization and is an important factor determining the efficacy of immunotherapy for regional tumors.
Mertens, Barbara; Nogueira, Tatiane; Stranska, Ruzena; Naesens, Lieve; Andrei, Graciela; Snoeck, Robert
2016-07-26
Human papillomavirus (HPV) causes cervical cancer and a large fraction of head and neck squamous cell carcinomas (HNSCC). Cidofovir (CDV) proved efficacious in the treatment of several HPV-induced benign and malignant hyper proliferations. To provide a better insight into how CDV selectively eradicates transformed cells, HPV+ and HPV- cervical carcinoma and HNSCC cell lines were compared to normal cells for antiproliferative effects, CDV metabolism, drug incorporation into cellular DNA, and DNA damage. Incorporation of CDV into cellular DNA was higher in tumor cells than in normal cells and correlated with CDV antiproliferative effects, which were independent of HPV status. Increase in phospho-ATM levels was detected following CDV exposure and higher levels of γ-H2AX (a quantitative marker of double-strand breaks) were measured in tumor cells compared to normal cells. A correlation between DNA damage and CDV incorporation into DNA was found but not between DNA damage and CDV antiproliferative effects. These data indicate that CDV antiproliferative effects result from incorporation of the drug into DNA causing DNA damage. However, the anti-tumor effects of CDV cannot be exclusively ascribed to DNA damage. Furthermore, CDV can be considered a promising broad spectrum anti-cancer agent, not restricted to HPV+ lesions.
Microfluidic cell isolation technology for drug testing of single tumor cells and their clusters.
Bithi, Swastika S; Vanapalli, Siva A
2017-02-02
Drug assays with patient-derived cells such as circulating tumor cells requires manipulating small sample volumes without loss of rare disease-causing cells. Here, we report an effective technology for isolating and analyzing individual tumor cells and their clusters from minute sample volumes using an optimized microfluidic device integrated with pipettes. The method involves using hand pipetting to create an array of cell-laden nanoliter-sized droplets immobilized in a microfluidic device without loss of tumor cells during the pipetting process. Using this technology, we demonstrate single-cell analysis of tumor cell response to the chemotherapy drug doxorubicin. We find that even though individual tumor cells display diverse uptake profiles of the drug, the onset of apoptosis is determined by accumulation of a critical intracellular concentration of doxorubicin. Experiments with clusters of tumor cells compartmentalized in microfluidic drops reveal that cells within a cluster have higher viability than their single-cell counterparts when exposed to doxorubicin. This result suggests that circulating tumor cell clusters might be able to better survive chemotherapy drug treatment. Our technology is a promising tool for understanding tumor cell-drug interactions in patient-derived samples including rare cells.
Basel, Matthew T; Balivada, Sivasai; Wang, Hongwang; Shrestha, Tej B; Seo, Gwi Moon; Pyle, Marla; Abayaweera, Gayani; Dani, Raj; Koper, Olga B; Tamura, Masaaki; Chikan, Viktor; Bossmann, Stefan H; Troyer, Deryl L
2012-01-01
Using magnetic nanoparticles to absorb alternating magnetic field energy as a method of generating localized hyperthermia has been shown to be a potential cancer treatment. This report demonstrates a system that uses tumor homing cells to actively carry iron/iron oxide nanoparticles into tumor tissue for alternating magnetic field treatment. Paramagnetic iron/ iron oxide nanoparticles were synthesized and loaded into RAW264.7 cells (mouse monocyte/ macrophage-like cells), which have been shown to be tumor homing cells. A murine model of disseminated peritoneal pancreatic cancer was then generated by intraperitoneal injection of Pan02 cells. After tumor development, monocyte/macrophage-like cells loaded with iron/ iron oxide nanoparticles were injected intraperitoneally and allowed to migrate into the tumor. Three days after injection, mice were exposed to an alternating magnetic field for 20 minutes to cause the cell-delivered nanoparticles to generate heat. This treatment regimen was repeated three times. A survival study demonstrated that this system can significantly increase survival in a murine pancreatic cancer model, with an average post-tumor insertion life expectancy increase of 31%. This system has the potential to become a useful method for specifically and actively delivering nanoparticles for local hyperthermia treatment of cancer. PMID:22287840
Fox, K A; Wootton, S; Marolf, A; Rouse, N; LeVan, I; Spraker, T; Miller, M; Quackenbush, S
2016-11-01
Bighorn sheep sinus tumors are a recently described disease affecting the paranasal sinuses of Rocky Mountain bighorn sheep (Ovis canadensis canadensis). Several features of this disease suggest an infectious cause, although a specific etiologic agent has not been identified. To test the hypothesis that bighorn sheep sinus tumors are caused by an infectious agent, we inoculated 4 bighorn sheep lambs and 4 domestic sheep lambs intranasally with a cell-free filtrate derived from a naturally occurring bighorn sheep sinus tumor; we held 1 individual of each species as a control. Within 18 months after inoculation, all 4 inoculated domestic sheep (100%) and 1 of the 4 inoculated bighorn sheep (25%) developed tumors within the ethmoid sinuses or nasal conchae, with features similar to naturally occurring bighorn sheep sinus tumors. Neither of the uninoculated sheep developed tumors. Histologically, the experimentally transmitted tumors were composed of stellate to spindle cells embedded within a myxoid matrix, with marked bone production. Tumor cells stained positively with vimentin, S100, alpha smooth muscle actin, and osteocalcin, suggesting origin from a multipotent mesenchymal cell. A periosteal origin for these tumors is suspected. Immunohistochemical staining for the envelope protein of JSRV (with cross-reactivity to ENTV) was equivocal, and PCR assays specific for these agents were negative. © The Author(s) 2016.
Crommentuijn, Matheus H W; Maguire, Casey A; Niers, Johanna M; Vandertop, W Peter; Badr, Christian E; Würdinger, Thomas; Tannous, Bakhos A
2016-04-01
Glioblastoma (GBM) is the most common malignant brain tumor in adults. We designed an adeno-associated virus (AAV) vector for intracranial delivery of secreted, soluble tumor necrosis factor-related apoptosis-inducing ligand (sTRAIL) to GBM tumors in mice and combined it with the TRAIL-sensitizing cardiac glycoside, lanatoside C (lan C). We applied this combined therapy to two different GBM models using human U87 glioma cells and primary patient-derived GBM neural spheres in culture and in orthotopic GBM xenograft models in mice. In U87 cells, conditioned medium from AAV2-sTRAIL expressing cells combined with lan C induced 80% cell death. Similarly, lan C sensitized primary GBM spheres to sTRAIL causing over 90% cell death. In mice bearing intracranial U87 tumors treated with AAVrh.8-sTRAIL, administration of lan C caused a decrease in tumor-associated Fluc signal, while tumor size increased within days of stopping the treatment. Another round of lan C treatment re-sensitized GBM tumor to sTRAIL-induced cell death. AAVrh.8-sTRAIL treatment alone and combined with lanatoside C resulted in a significant decrease in tumor growth and longer survival of mice bearing orthotopic invasive GBM brain tumors. In summary, AAV-sTRAIL combined with lanatoside C induced cell death in U87 glioma cells and patient-derived GBM neural spheres in culture and in vivo leading to an increased in overall mice survival. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
A Rare Cause of Prepubertal Gynecomastia: Sertoli Cell Tumor
Dursun, Fatma; Su Dur, Şeyma Meliha; Şahin, Ceyhan; Kırmızıbekmez, Heves; Karabulut, Murat Hakan; Yörük, Asım
2015-01-01
Prepubertal gynecomastia due to testis tumors is a very rare condition. Nearly 5% of the patients with testicular mass present with gynecomastia. Sertoli cell tumors are sporadic in 60% of the reported cases, while the remaining is a component of multiple neoplasia syndromes such as Peutz-Jeghers syndrome and Carney complex. We present a 4-year-old boy with gynecomastia due to Sertoli cell tumor with no evidence of Peutz-Jeghers syndrome or Carney complex. PMID:26366315
Curiel, Tyler J; Coukos, George; Zou, Linhua; Alvarez, Xavier; Cheng, Pui; Mottram, Peter; Evdemon-Hogan, Melina; Conejo-Garcia, Jose R; Zhang, Lin; Burow, Matthew; Zhu, Yun; Wei, Shuang; Kryczek, Ilona; Daniel, Ben; Gordon, Alan; Myers, Leann; Lackner, Andrew; Disis, Mary L; Knutson, Keith L; Chen, Lieping; Zou, Weiping
2004-09-01
Regulatory T (T(reg)) cells mediate homeostatic peripheral tolerance by suppressing autoreactive T cells. Failure of host antitumor immunity may be caused by exaggerated suppression of tumor-associated antigen-reactive lymphocytes mediated by T(reg) cells; however, definitive evidence that T(reg) cells have an immunopathological role in human cancer is lacking. Here we show, in detailed studies of CD4(+)CD25(+)FOXP3(+) T(reg) cells in 104 individuals affected with ovarian carcinoma, that human tumor T(reg) cells suppress tumor-specific T cell immunity and contribute to growth of human tumors in vivo. We also show that tumor T(reg) cells are associated with a high death hazard and reduced survival. Human T(reg) cells preferentially move to and accumulate in tumors and ascites, but rarely enter draining lymph nodes in later cancer stages. Tumor cells and microenvironmental macrophages produce the chemokine CCL22, which mediates trafficking of T(reg) cells to the tumor. This specific recruitment of T(reg) cells represents a mechanism by which tumors may foster immune privilege. Thus, blocking T(reg) cell migration or function may help to defeat human cancer.
Crittenden, Marka R.; Savage, Talicia; Cottam, Benjamin; Bahjat, Keith S.; Redmond, William L.; Bambina, Shelly; Kasiewicz, Melissa; Newell, Pippa; Jackson, Andrew M.; Gough, Michael J.
2013-01-01
Expansion of myeloid-lineage leukocytes in tumor-bearing mice has been proposed as a cause of systemic immunosuppression. We demonstrate that radiation therapy of tumors leads to a decline in myeloid cell numbers in the blood and a decrease in spleen size. The frequency of myeloid cells does not decline to the level seen in tumor-free mice: we demonstrate that metastatic disease can prevent myeloid cell numbers from returning to baseline, and that tumor recurrence from residual disease correlates with re-expansion of myeloid lineage cells. Radiation therapy results in increased proliferation of T cells in the spleen and while T cell responses to foreign antigens are not altered by tumor burden or myeloid cell expansion, responses to tumor-associated antigens are increased after radiation therapy. These data demonstrate that myeloid cell numbers are directly linked to primary tumor burden, that this population contracts following radiation therapy, and that radiation therapy may open a therapeutic window for immunotherapy of residual disease. PMID:23936036
Loja, Tomas; Stehlikova, Olga; Palko, Lukas; Vrba, Kamil; Rampl, Ivan; Klabusay, Martin
2014-09-01
Tumor diseases cause 20% of deaths in Europe and they are the second most common cause of death and morbidity after cardiovascular diseases. Thus, tumor cells are target of many therapeutic strategies and tumor research is focused on searching more efficient and specific drugs as well as new therapeutic approaches. One of the areas of tumor research is an issue of external fields. In our work, we tested influence of a pulsed electromagnetic field (PEMF) and a hypothetic field of the pulsed vector magnetic potential (PVMP) on the growth of tumor cells; and further the possible growth inhibition effect of the PVMP. Both unipolar and bipolar PEMF fields of 5 mT and PVMP fields of 0 mT at frequencies of 15 Hz, 125 Hz and 625 Hz were tested on cancer cell lines derived from various types of tumors: CEM/C2 (acute lymphoblastic leukemia), SU-DHL-4 (B-cell lymphoma), COLO-320DM (colorectal adenocarcinoma), MDA-BM-468 (breast adenocarcinoma), and ZR-75-1 (ductal carcinoma). Cell morphology was observed, proliferation activity using WST assay was measured and simultaneous proportion of live, early apoptotic and dead cells was detected using flow cytometry. A PEMF of 125 Hz and 625 Hz for 24 h-48 h increased proliferation activity in the 2 types of cancer cell lines used, i.e. COLO-320DM and ZR-75-1. In contrast, any of employed methods did not confirm a significant inhibitory effect of hypothetic PVMP field on tumor cells.
Tumor Heterogeneity, Single-Cell Sequencing, and Drug Resistance.
Schmidt, Felix; Efferth, Thomas
2016-06-16
Tumor heterogeneity has been compared with Darwinian evolution and survival of the fittest. The evolutionary ecosystem of tumors consisting of heterogeneous tumor cell populations represents a considerable challenge to tumor therapy, since all genetically and phenotypically different subpopulations have to be efficiently killed by therapy. Otherwise, even small surviving subpopulations may cause repopulation and refractory tumors. Single-cell sequencing allows for a better understanding of the genomic principles of tumor heterogeneity and represents the basis for more successful tumor treatments. The isolation and sequencing of single tumor cells still represents a considerable technical challenge and consists of three major steps: (1) single cell isolation (e.g., by laser-capture microdissection), fluorescence-activated cell sorting, micromanipulation, whole genome amplification (e.g., with the help of Phi29 DNA polymerase), and transcriptome-wide next generation sequencing technologies (e.g., 454 pyrosequencing, Illumina sequencing, and other systems). Data demonstrating the feasibility of single-cell sequencing for monitoring the emergence of drug-resistant cell clones in patient samples are discussed herein. It is envisioned that single-cell sequencing will be a valuable asset to assist the design of regimens for personalized tumor therapies based on tumor subpopulation-specific genetic alterations in individual patients.
Different responses of tumor and normal cells to low-dose radiation
Liu, Ning; Wang, Hao; Shang, Qingjun; Jiang, Peng; Zhang, Yuanmei
2013-01-01
Aim of the study We demonstrated stimulation of both erythrocyte immune function and superoxide dismutase activity in tumor-bearing mice in response to whole-body 75 mGy X-rays. In addition, we enhanced the chemotherapeutic effect by exposing tumor-bearing mice to low-dose radiation (LDR). This study aims to investigate the different responses of tumor cells and normal cells to LDR. Material and methods Survival fraction, micronucleus frequency, and cell cycle of Lewis cells and primary human fibroblast AG01522 cells were measured. S180 sarcoma cells were implanted in mice, and tumor sizes were measured in vivo. Results In response to LDR exposure in vitro, a stimulating effect was observed in AG01522 cells but not in Lewis cells. Low-dose radiation did not cause an adaptive response in the Lewis cell cycle. Lack of an LDR-induced radioadaptive response in tumor cells was observed in tumor-bearing mouse models. Furthermore, a higher apoptotic effect and lower expression of the anti-apoptosis gene Bcl-2 were found in tumor cells of tumor-bearing mice exposed to D1 + D2 than those in tumor cells of tumor-bearing mice exposed to D2 alone. Conclusions Different responses of tumor cells and normal cells to LDR were found. Low-dose radiation was found to stimulate the growth of normal cells but not of tumor cells in vitro and in vivo, which is a very important and clinically relevant phenomenon. PMID:24592123
Acromegaly and Cushing's syndrome associated with a foregut carcinoid tumor.
Leveston, S A; McKeel, D W; Buckley, P J; Deschryver, K; Greider, M H; Jaffe, B M; Daughaday, W H
1981-10-01
We report an 18-yr-old youth with a metastatic foregut carcinoid tumor, Cushing's syndrome, and hypersomatotropic gigantism. Administration of cyproheptadine caused a dramatic fall in urinary cortisol excretion and plasma ACTH levels associated with clinical remission of the Cushing's syndrome. GH secretion was not affected by cyproheptadine administration. Ectopic ACTH secretion was confirmed by RIA of tumor extracts and immunohistochemical demonstration of ACTH-containing cells in hepatic metastases. There were two sources of GH production demonstrated in this patient. Ectopic secretion of GH by the carcinoid hepatic metastases was documented by both RIA and immunohistochemical techniques. A somatotrophic pituitary tumor was also present. The histological characteristics of this tumor suggest adenomatous hyperplasia rather than de novo neoplastic change as the likely mechanism of its pathogenesis. GH releasing factor-like activity was demonstrated in extracts of plasma and in extracts of the carcinoid tumor. We conclude that cyproheptadine exerted an effect on the ectopic ACTH-producing cells but not on the ectopic GH-producing cells or on adenohypophyseal GH secretion. Production of a GH releasing factor-like activity by the carcinoid tumor may have caused the pituitary somatotrophic tumor.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Yoo-Shin; Lee, Tae Hoon; O'Neill, Brian E., E-mail: BEOneill@houstonmethodist.org
Non-lethal hyperthermia is used clinically as adjuvant treatment to radiation, with mixed results. Denaturation of protein during hyperthermia treatment is expected to synergize with radiation damage to cause cell cycle arrest and apoptosis. Alternatively, hyperthermia is known to cause tissue level changes in blood flow, increasing the oxygenation and radiosensitivity of often hypoxic tumors. In this study, we elucidate a third possibility, that hyperthermia alters cellular adhesion and mechanotransduction, with particular impact on the cancer stem cell population. We demonstrate that cell heating results in a robust but temporary loss of cancer cell aggressiveness and metastatic potential in mouse models.more » In vitro, this heating results in a temporary loss in cell mobility, adhesion, and proliferation. Our hypothesis is that the loss of cellular adhesion results in suppression of cancer stem cells and loss of tumor virulence and metastatic potential. Our study suggests that the metastatic potential of cancer is particularly reduced by the effects of heat on cellular adhesion and mechanotransduction. If true, this could help explain both the successes and failures of clinical hyperthermia, and suggest ways to target treatments to those who would most benefit. - Highlights: • Non-lethal hyperthermia treatment of cancer cells is shown to cause a reduction in rates of tumor initiation and metastasis. • Dynamic imaging of cells during heat treatment shows temporary changes in cell shape, cell migration, and cell proliferation. • Loss of adhesion may lead to the observed effect, which may disproportionately impact the tumor initiating cell fraction. • Loss or suppression of the tumor initiating cell fraction results in the observed loss of metastatic potential in vivo. • This result may lead to new approaches to synergizing hyperthermia with surgery, radiation, and chemotherapy.« less
Patsialou, Antonia; Bravo-Cordero, Jose Javier; Wang, Yarong; Entenberg, David; Liu, Huiping; Clarke, Michael; Condeelis, John S.
2014-01-01
Metastasis is the main cause of death in breast cancer patients. Cell migration is an essential component of almost every step of the metastatic cascade, especially the early step of invasion inside the primary tumor. In this report, we have used intravital multiphoton microscopy to visualize the different migration patterns of human breast tumor cells in live primary tumors. We used xenograft tumors of MDA-MB-231 cells as well as a low passage xenograft tumor from orthotopically injected patient-derived breast tumor cells. Direct visualization of human tumor cells in vivo shows two patterns of high-speed migration inside primary tumors: a. single cells and b. multicellular streams (i.e., cells following each other in a single file but without cohesive cell junctions). Critically, we found that only streaming and not random migration of single cells was significantly correlated with proximity to vessels, with intravasation and with numbers of elevated circulating tumor cells in the bloodstream. Finally, although the two human tumors were derived from diverse genetic backgrounds, we found that their migratory tumor cells exhibited coordinated gene expression changes that led to the same end-phenotype of enhanced migration involving activating actin polymerization and myosin contraction. Our data are the first direct visualization and assessment of in vivo migration within a live patient-derived breast xenograft tumor. PMID:25013744
mTOR at the Transmitting and Receiving Ends in Tumor Immunity
Guri, Yakir; Nordmann, Thierry M.; Roszik, Jason
2018-01-01
Cancer is a complex disease and a leading cause of death worldwide. Immunity is critical for cancer control. Cancer cells exhibit high mutational rates and therefore altered self or neo-antigens, eliciting an immune response to promote tumor eradication. Failure to mount a proper immune response leads to cancer progression. mTOR signaling controls cellular metabolism, immune cell differentiation, and effector function. Deregulated mTOR signaling in cancer cells modulates the tumor microenvironment, thereby affecting tumor immunity and possibly promoting carcinogenesis. PMID:29662490
mTOR at the Transmitting and Receiving Ends in Tumor Immunity.
Guri, Yakir; Nordmann, Thierry M; Roszik, Jason
2018-01-01
Cancer is a complex disease and a leading cause of death worldwide. Immunity is critical for cancer control. Cancer cells exhibit high mutational rates and therefore altered self or neo-antigens, eliciting an immune response to promote tumor eradication. Failure to mount a proper immune response leads to cancer progression. mTOR signaling controls cellular metabolism, immune cell differentiation, and effector function. Deregulated mTOR signaling in cancer cells modulates the tumor microenvironment, thereby affecting tumor immunity and possibly promoting carcinogenesis.
NASA Astrophysics Data System (ADS)
Koller, Manfred R.; Hanania, Elie G.; Eisfeld, Timothy; O'Neal, Robert A.; Khovananth, Kevin M.; Palsson, Bernhard O.
2001-04-01
High-dose chemotherapy, followed by autologous hematopoietic stem cell (HSC) transplantation, is widely used for the treatment of cancer. However, contaminating tumor cells within HSC harvests continue to be of major concern since re-infused tumor cells have proven to contribute to disease relapse. Many tumor purging methods have been evaluated, but all leave detectable tumor cells in the transplant and result in significant loss of HSCs. These shortcomings cause engraftment delays and compromise the therapeutic value of purging. A novel approach integrating automated scanning cytometry, image analysis, and selective laser-induced killing of labeled cells within a cell mixture is described here. Non-Hodgkin's lymphoma (NHL) cells were spiked into cell mixtures, and fluorochrome-conjugated antibodies were used to label tumor cells within the mixture. Cells were then allowed to settle on a surface, and as the surface was scanned with a fluorescence excitation source, a laser pulse was fired at every detected tumor cell using high-speed beam steering mirrors. Tumor cells were selectively killed with little effect on adjacent non-target cells, demonstrating the feasibility of this automated cell processing approach. This technology has many potential research and clinical applications, one example of which is tumor cell purging for autologous HSC transplantation.
Antibody treatment of human tumor xenografts elicits active anti-tumor immunity in nude mice
Liebman, Meredith A.; Roche, Marly I.; Williams, Brent R.; Kim, Jae; Pageau, Steven C.; Sharon, Jacqueline
2007-01-01
Athymic nude mice bearing subcutaneous tumor xenografts of the human anti-colorectal cancer cell line SW480 were used as a preclinical model to explore anti-tumor immunotherapies. Intratumor or systemic treatment of the mice with murine anti-SW480 serum, recombinant anti-SW480 polyclonal antibodies, or the anti-colorectal cancer monoclonal antibody CO17-1A, caused retardation or regression of SW480 tumor xenografts. Interestingly, when mice that had regressed their tumors were re-challenged with SW480 cells, these mice regressed the new tumors without further antibody treatment. Adoptive transfer of spleen cells from mice that had regressed their tumors conferred anti-tumor immunity to naïve nude mice. Pilot experiments suggest that the transferred anti-tumor immunity is mediated by T cells of both γδ and αβ lineages. These results demonstrate that passive anti-tumor immunotherapy can elicit active immunity and support a role for extra-thymic γδ and αβ T cells in tumor rejection. Implications for potential immunotherapies include injection of tumor nodules in cancer patients with anti-tumor antibodies to induce anti-tumor T cell immunity. PMID:17920694
Spontaneous generation of germline characteristics in mouse fibrosarcoma cells
NASA Astrophysics Data System (ADS)
Ma, Zhan; Hu, Yao; Jiang, Guoying; Hou, Jun; Liu, Ruilai; Lu, Yuan; Liu, Chunfang
2012-10-01
Germline/embryonic-specific genes have been found to be activated in somatic tumors. In this study, we further showed that cells functioning as germline could be present in mouse fibrosarcoma cells (L929 cell line). Early germline-like cells spontaneously appeared in L929 cells and further differentiated into oocyte-like cells. These germline-like cells can, in turn, develop into blastocyst-like structures in vitro and cause teratocarcinomas in vivo, which is consistent with natural germ cells in function. Generation of germline-like cells from somatic tumors might provide a novel way to understand why somatic cancer cells have strong features of embryonic/germline development. It is thought that the germline traits of tumors are associated with the central characteristics of malignancy, such as immortalization, invasion, migration and immune evasion. Therefore, germline-like cells in tumors might provide potential targets to tumor biology, diagnosis and therapy.
Imatinib mesylate inhibits Leydig cell tumor growth: evidence for in vitro and in vivo activity.
Basciani, Sabrina; Brama, Marina; Mariani, Stefania; De Luca, Gabriele; Arizzi, Mario; Vesci, Loredana; Pisano, Claudio; Dolci, Susanna; Spera, Giovanni; Gnessi, Lucio
2005-03-01
Leydig cell tumors are usually benign tumors of the male gonad. However, if the tumor is malignant, no effective treatments are currently available. Leydig cell tumors express platelet-derived growth factor (PDGF), kit ligand and their respective receptors, PDGFR and c-kit. We therefore evaluated the effects of imatinib mesylate (imatinib), a selective inhibitor of the c-kit and PDGFR tyrosine kinases, on the growth of rodent Leydig tumor cell lines in vivo and in vitro, and examined, in human Leydig cell tumor samples, the expression of activated PDGFR and c-kit and the mutations in exons of the c-kit gene commonly associated with solid tumors. Imatinib caused concentration-dependent decreases in the viability of Leydig tumor cell lines, which coincided with apoptosis and inhibition of proliferation and ligand-stimulated phosphorylation of c-kit and PDGFRs. Mice bearing s.c. allografts of a Leydig tumor cell line treated with imatinib p.o., had an almost complete inhibition of tumor growth, less tumor cell proliferation, increased apoptosis, and a lesser amount of tumor-associated mean vessel density compared with controls. No drug-resistant tumors appeared during imatinib treatment but tumors regrew after drug withdrawal. Human Leydig cell tumors showed an intense expression of the phosphorylated form of c-kit and a less intense expression of phosphorylated PDGFRs. No activating mutations in common regions of mutation of the c-kit gene were found. Our studies suggest that Leydig cell tumors might be a potential target for imatinib therapy.
Cancer terminator viruses (CTV): A better solution for viral-based therapy of cancer.
Emdad, Luni; Das, Swadesh K; Wang, Xiang-Yang; Sarkar, Devanand; Fisher, Paul B
2018-08-01
In principle, viral gene therapy holds significant potential for the therapy of solid cancers. However, this promise has not been fully realized and systemic administration of viruses has not proven as successful as envisioned in the clinical arena. Our research is focused on developing the next generation of efficacious viruses to specifically treat both primary cancers and a major cause of cancer lethality, metastatic tumors (that have spread from a primary site of origin to other areas in the body and are responsible for an estimated 90% of cancer deaths). We have generated a chimeric tropism-modified type 5 and 3 adenovirus that selectively replicates in cancer cells and simultaneously produces a secreted anti-cancer toxic cytokine, melanoma differentiation associated gene-7/Interleukin-24 (mda-7/IL-24), referred to as a Cancer Terminator Virus (CTV) (Ad.5/3-CTV). In preclinical animal models, injection into a primary tumor causes selective cell death and therapeutic activity is also observed in non-injected distant tumors, that is, "bystander anti-tumor activity." To enhance the impact and therapeutic utility of the CTV, we have pioneered an elegant approach in which viruses are encapsulated in microbubbles allowing "stealth delivery" to tumor cells that when treated with focused ultrasound causes viral release killing tumor cells through viral replication, and producing and secreting MDA-7/IL-24, which stimulates the immune system to attack distant cancers, inhibits tumor angiogenesis and directly promotes apoptosis in distant cancer cells. This strategy is called UTMD (ultrasound-targeted microbubble-destruction). This novel CTV and UTMD approach hold significant promise for the effective therapy of primary and disseminated tumors. © 2017 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Chang W., E-mail: songx001@umn.edu; Korea Institute of Radiological and Medical Sciences, Seoul; Lee, Yoon-Jin
Purpose: The purpose of this study was to reveal the biological mechanisms underlying stereotactic body radiation therapy (SBRT) and stereotactic radiation surgery (SRS). Methods and Materials: FSaII fibrosarcomas grown subcutaneously in the hind limbs of C3H mice were irradiated with 10 to 30 Gy of X rays in a single fraction, and the clonogenic cell survival was determined with in vivo–in vitro excision assay immediately or 2 to 5 days after irradiation. The effects of radiation on the intratumor microenvironment were studied using immunohistochemical methods. Results: After cells were irradiated with 15 or 20 Gy, cell survival in FSaII tumors declined for 2 to 3 daysmore » and began to recover thereafter in some but not all tumors. After irradiation with 30 Gy, cell survival declined continuously for 5 days. Cell survival in some tumors 5 days after 20 to 30 Gy irradiation was 2 to 3 logs less than that immediately after irradiation. Irradiation with 20 Gy markedly reduced blood perfusion, upregulated HIF-1α, and increased carbonic anhydrase-9 expression, indicating that irradiation increased tumor hypoxia. In addition, expression of VEGF also increased in the tumor tissue after 20 Gy irradiation, probably due to the increase in HIF-1α activity. Conclusions: Irradiation of FSaII tumors with 15 to 30 Gy in a single dose caused dose-dependent secondary cell death, most likely by causing vascular damage accompanied by deterioration of intratumor microenvironment. Such indirect tumor cell death may play a crucial role in the control of human tumors with SBRT and SRS.« less
Zheng, Huilin; Zou, Weibin; Shen, Jiaying; Xu, Liang; Wang, Shu; Fu, Yang-Xin; Fan, Weimin
2016-09-01
: Mesenchymal stem cells (MSCs) usually promote tumor growth and metastasis. By using a breast tumor 4T1 cell-based animal model, this study determined that coinjection and distant injection of allogeneic bone marrow-derived MSCs with tumor cells could exert different effects on tumor growth. Whereas the coinjection of MSCs with 4T1 cells promoted tumor growth, surprisingly, the injection of MSCs at a site distant from the 4T1 cell inoculation site suppressed tumor growth. We further observed that, in the distant injection model, MSCs decreased the accumulation of myeloid-derived suppressor cells and regulatory T cells in tumor tissues by enhancing proinflammatory factors such as interferon-γ, tumor necrosis factor-α, Toll-like receptor (TLR)-3, and TLR-4, promoting host antitumor immunity and inhibiting tumor growth. Unlike previous reports, this is the first study reporting that MSCs may exert opposite roles on tumor growth in the same animal model by modulating the host immune system, which may shed light on the potential application of MSCs as vehicles for tumor therapy and other clinical applications. Mesenchymal stem cells (MSCs) have been widely investigated for their potential roles in tissue engineering, autoimmune diseases, and tumor therapeutics. This study explored the impact of coinjection and distant injection of allogeneic bone marrow-derived MSCs on mouse 4T1 breast cancer cells. The results showed that the coinjection of MSCs and 4T1 cells promoted tumor growth. MSCs might act as the tumor stromal precursors and cause immunosuppression to protect tumor cells from immunosurveillance, which subsequently facilitated tumor metastasis. Interestingly, the distant injection of MSCs and 4T1 cells suppressed tumor growth. Together, the results of this study revealed the dual functions of MSCs in immunoregulation. ©AlphaMed Press.
A preclinical study by Center for Cancer Research investigators and colleagues shows that a drug guided by an attached target-seeking antibody can recognize cells infiltrating tumors, the tumor stroma, and cause various types of tumors to shrink, and in many cases, disappear. Their findings suggest that when stromal cells take up the ADC, they cleave the drug from the antibody
Riding the Waves: How Our Cells Send Signals | Center for Cancer Research
The ability of cells to perceive and respond to their environment is critical in order to maintain basic cellular functions such as development, tissue repair, and response to stress. This process happens through a complex system of communication, called cell signaling, which governs basic cellular activities and coordinates cell actions. Errors in cell signaling have been linked to numerous diseases, including cancer. NF-κB is a protein complex that plays a critical role in many cell signaling pathways by controlling gene activation. It is widely used by cells to regulate cell growth and survival and helps to protect the cell from conditions that would otherwise cause it to die. Many tumor cells have mutations in genes that cause NF-κB to become overactive. Blocking NF-κB could cause tumor cells to stop growing, die, or become more sensitive to therapeutics.
Takiguchi, Tomoko; Koide, Hisashi; Nagano, Hidekazu; Nakayama, Akitoshi; Fujimoto, Masanori; Tamura, Ai; Komai, Eri; Shiga, Akina; Kono, Takashi; Higuchi, Seiichiro; Sakuma, Ikki; Hashimoto, Naoko; Suzuki, Sawako; Miyabayashi, Yui; Ishiwatari, Norio; Horiguchi, Kentaro; Nakatani, Yukio; Yokote, Koutaro; Tanaka, Tomoaki
2017-09-02
A functional pituitary adenoma can produce multiple anterior-pituitary hormones, such as growth hormone (GH) -producing adenomas (GHoma) with prolactin or thyrotropin stimulating hormone production in the same lineage. However, it is very rare that acromegaly shows subclinical Cushing's disease (SCD) beyond the lineage. Here we describe the involvement of intratumoral coexistence with 2 types of hormone-producing cells associated with different lineage in acromegaly concomitant with SCD. In our study, we performed clinical evaluation of the patient showing acromegaly with SCD. To elucidate the mechanisms of this pathology, we analyzed immunohistochemistry and gene expression of anterior-pituitary hormones and transcriptional factors in the resected pituitary tumor. On immunohistochemical staining, most of the tumor cells were strongly stained for GH antibody, while some cells were strongly positive for adrenocorticotropic hormone (ACTH). Gene expression analysis of a transsphenoidal surgery sample of the pituitary gland revealed that ACTH-related genes, such as POMC, Tpit, and NeuroD1 mRNA, had higher expression in the tumor tissue than the nonfunctional adenoma but lower expression compared to an adenoma of typical Cushing's disease. Further, double-labeling detection methods with a fluorescent stain for ACTH and GH demonstrated the coexistence of ACTH-positive cells (GH-negative) among the GH-positive cells in the tumor. Additionally, Pit-1 expression was reduced in the ACTH-positive cells from tumor tissue primary culture. Here we described a case of a pituitary tumor diagnosed with acromegaly associated with SCD. We performed quantitative-expression analyses of transcriptional factors of the tumor tissue and immunohistochemistry analysis of tumor-derived primary culture cells, which suggested that the multihormonal pituitary adenoma concomitant with Pit-1 and Tpit lineage cells caused acromegaly associated with SCD.
NASA Astrophysics Data System (ADS)
Ngwa, Wilfred; Makrigiorgos, G. Mike; Berbeco, Ross I.
2010-11-01
Tumor vascular disrupting agents (VDAs) represent a promising approach to the treatment of cancer, in view of the tumor vasculature's pivotal role in tumor survival, growth and metastasis. VDAs targeting the tumor's dysmorphic endothelial cells can cause selective and rapid occlusion of the tumor vasculature, leading to tumor cell death from ischemia and extensive hemorrhagic necrosis. In this study, the potential for applying gold nanoparticles (AuNPs) as VDAs, during brachytherapy, is examined. Analytic calculations based on the electron energy loss formula of Cole were carried out to estimate the endothelial dose enhancement caused by radiation-induced photo/Auger electrons originating from AuNPs targeting the tumor endothelium. The endothelial dose enhancement factor (EDEF), representing the ratio of the dose to the endothelium with and without gold nanoparticles was calculated for different AuNP local concentrations, and endothelial cell thicknesses. Four brachytherapy sources were investigated, I-125, Pd-103, Yb-169, as well as 50 kVp x-rays. The results reveal that, even at relatively low intra-vascular AuNP concentrations, ablative dose enhancement to tumor endothelial cells due to photo/Auger electrons from the AuNPs can be achieved. Pd-103 registered the highest EDEF values of 7.4-271.5 for local AuNP concentrations ranging from 7 to 350 mg g-1, respectively. Over the same concentration range, I-125, 50 kVp and Yb-169 yielded values of 6.4-219.9, 6.3-214.5 and 4.0-99.7, respectively. Calculations of the EDEF as a function of endothelial cell thickness showed that lower energy sources like Pd-103 reach the maximum EDEF at smaller thicknesses. The results also reveal that the highest contribution to the EDEF comes from Auger electrons, apparently due to their shorter range. Overall, the data suggest that ablative dose enhancement to tumor endothelial cells can be achieved by applying tumor vasculature-targeted AuNPs as adjuvants to brachytherapy, with lower energy sources. Such ablative magnitude dose enhancement in a relatively small endothelial volume may rapidly disrupt or cause severe biological damage to tumor endothelial cells, without increased toxicity to healthy tissues not containing AuNPs. The findings provide significant impetus for considering the application of AuNPs as VDAs during brachytherapy.
Kumar, Ashutosh; Ehrenshaft, Marilyn; Tokar, Erik J; Mason, Ronald P; Sinha, Birandra K
2016-07-01
Etoposide and doxorubicin, topoisomerase II poisons, are important drugs for the treatment of tumors in the clinic. Topoisomerases contain several free sulfhydryl groups which are important for their activity and are also potential targets for nitric oxide (NO)-induced nitrosation. NO, a physiological signaling molecule nitrosates many cellular proteins, causing altered protein and cellular functions. Here, we have evaluated the roles of NO/NO-derived species in the activity/stability of topo II both in vitro and in human tumor cells, and in the cytotoxicity of topo II-poisons, etoposide and doxorubicin. Treatment of purified topo IIα with propylamine propylamine nonoate (PPNO), an NO donor, resulted in inhibition of both the catalytic and relaxation activity in vitro, and decreased etoposide-dependent cleavable complex formation in both human HT-29 colon and MCF-7 breast cancer cells. PPNO treatment also induced significant nitrosation of topo IIα protein in these human tumor cells. These events, taken together, caused a significant resistance to etoposide in both cell lines. However, PPNO had no effect on doxorubicin-induced cleavable complex formation, or doxorubicin cytotoxicity in these cell lines. Inhibition of topo II function by NO/NO-derived species induces significant resistance to etoposide, without affecting doxorubicin cytotoxicity in human tumor cells. As tumors express inducible nitric oxide synthase and generate significant amounts of NO, modulation of topo II functions by NO/NO-derived species could render tumors resistant to certain topo II-poisons in the clinic. Published by Elsevier B.V.
Skin Diseases: NIH Research to Results
... with immune system cells found in tumors could shrink skin cancer tumors and possibly prolong life, too. ... altered in the lab could cause tumors to shrink in a small number of patients. More studies ...
Mahmoudzadeh, Aziz; Mohammadpour, Hemn
2016-07-01
Tumor cells naturally live in three-dimensional (3D) microenvironments, while common laboratory tests and evaluations are done in two-dimensional (2D) plates. This study examined the impact of cultured 4T1 cancer cells in a 3D collagen-chitosan scaffold compared with 2D plate cultures. Collagen-chitosan scaffolds were provided and passed confirmatory tests. 4T1 tumor cells were cultured on scaffolds and then tumor cells growth rate, resistance to X-ray radiation, and cyclophosphamide as a chemotherapy drug were analyzed. Furthermore, 4T1 cells were extracted from the scaffold model and were injected into the mice. Tumor growth rate, survival rate, and systemic immune responses were evaluated. Our results showed that 4T1 cells infiltrated the scaffolds pores and constructed a 3D microenvironment. Furthermore, 3D cultured tumor cells showed a slower proliferation rate, increased levels of survival to the X-ray irradiation, and enhanced resistance to chemotherapy drugs in comparison with 2D plate cultures. Transfer of extracted cells to the mice caused enhanced tumor volume and decreased life span. This study indicated that collagen-chitosan nanoscaffolds provide a suitable model of tumor that would be appropriate for tumor studies. Copyright © 2016. Published by Elsevier B.V.
Riethmüller, Michaela; Burger, Nils; Bauer, Georg
2015-01-01
Intracellular singlet oxygen generation in photofrin-loaded cells caused cell death without discrimination between nonmalignant and malignant cells. In contrast, extracellular singlet oxygen generation caused apoptosis induction selectively in tumor cells through singlet oxygen-mediated inactivation of tumor cell protective catalase and subsequent reactivation of intercellular ROS-mediated apoptosis signaling through the HOCl and the NO/peroxynitrite signaling pathway. Singlet oxygen generation by extracellular photofrin alone was, however, not sufficient for optimal direct inactivation of catalase, but needed to trigger the generation of cell-derived extracellular singlet oxygen through the interaction between H2O2 and peroxynitrite. Thereby, formation of peroxynitrous acid, generation of hydroxyl radicals and formation of perhydroxyl radicals (HO2.) through hydroxyl radical/H2O2 interaction seemed to be required as intermediate steps. This amplificatory mechanism led to the formation of singlet oxygen at a sufficiently high concentration for optimal inactivation of membrane-associated catalase. At low initial concentrations of singlet oxygen, an additional amplification step needed to be activated. It depended on singlet oxygen-dependent activation of the FAS receptor and caspase-8, followed by caspase-8-mediated enhancement of NOX activity. The biochemical mechanisms described here might be considered as promising principle for the development of novel approaches in tumor therapy that specifically direct membrane-associated catalase of tumor cells and thus utilize tumor cell-specific apoptosis-inducing ROS signaling. PMID:26225731
Riethmüller, Michaela; Burger, Nils; Bauer, Georg
2015-12-01
Intracellular singlet oxygen generation in photofrin-loaded cells caused cell death without discrimination between nonmalignant and malignant cells. In contrast, extracellular singlet oxygen generation caused apoptosis induction selectively in tumor cells through singlet oxygen-mediated inactivation of tumor cell protective catalase and subsequent reactivation of intercellular ROS-mediated apoptosis signaling through the HOCl and the NO/peroxynitrite signaling pathway. Singlet oxygen generation by extracellular photofrin alone was, however, not sufficient for optimal direct inactivation of catalase, but needed to trigger the generation of cell-derived extracellular singlet oxygen through the interaction between H2O2 and peroxynitrite. Thereby, formation of peroxynitrous acid, generation of hydroxyl radicals and formation of perhydroxyl radicals (HO2(.)) through hydroxyl radical/H2O2 interaction seemed to be required as intermediate steps. This amplificatory mechanism led to the formation of singlet oxygen at a sufficiently high concentration for optimal inactivation of membrane-associated catalase. At low initial concentrations of singlet oxygen, an additional amplification step needed to be activated. It depended on singlet oxygen-dependent activation of the FAS receptor and caspase-8, followed by caspase-8-mediated enhancement of NOX activity. The biochemical mechanisms described here might be considered as promising principle for the development of novel approaches in tumor therapy that specifically direct membrane-associated catalase of tumor cells and thus utilize tumor cell-specific apoptosis-inducing ROS signaling. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Tyagi, Ruchita; Gupta, Nalini; Bhagat, Priyanka; Gainder, Shalini; Rai, Bhavna; Dhaliwal, L K; Rajwanshi, Arvind
2017-01-01
Context: Peritoneal washing is performed for staging of gynecologic tumors to detect subclinical intraperitoneal metastases. Aim: The aim of the present study was to assess the impact of SurePath™ liquid-based cytology (LBC) in peritoneal washing in various gynecological malignancies. Settings and Design: An audit of peritoneal-fluid/washing (January 2012 to July 2013) was performed with corresponding gynecologic specimens. All peritoneal washings were processed using both conventional and LBC technique. Suspicious cases on cytology were reported along with gynecologic specimens. Results: There were a total of 393 peritoneal fluids. Eighty-three (21.1%) were positive for malignancy, and the corresponding histology was available in 352 (89.6%) cases. Sixty-nine positive samples had ovarian malignancies and 5 had uterine causes. There were 9 cases of peritoneal washings in which no histopathology was available. The most common cause of positive peritoneal cytology was ovarian serous carcinoma in 55/84 (65.5%) cases. Other causes included mucinous cystadenocarcinoma, dysgerminoma, squamous cell carcinoma in teratoma, yolk sac tumor, and granulosa cell tumor. Uterine causes included 2/45 (4.4%) cases of endometrioid adenocarcinoma, ¼ (25%) cases of clear cell carcinoma, ½ (50%) cases of carcinosarcoma, and ¼ (25%) cervix carcinoma. On review of positive cases (n = 83), 10 cases were identified, which had nil (n = 4) to low cellularity (<3 tumor clusters/smear; n = 6) on conventional smears, and were confirmed malignant on LBC. Conclusions: The most common ovarian malignancy causing positive peritoneal cytology is papillary serous carcinoma. Endometrioid adenocarcinoma rarely leads to positive peritoneal cytology. LBC technique leads to concentration of tumor cells causing reduction in false negative cases, especially in hemorrhagic and low-cellular cases. PMID:28469317
Gröschl, Benedikt; Bettstetter, Marcus; Giedl, Christian; Woenckhaus, Matthias; Edmonston, Tina; Hofstädter, Ferdinand; Dietmaier, Wolfgang
2013-04-01
DUSP4 (MKP-2), a member of the mitogen-activated protein kinase phosphatase (MKP) family and potential tumor suppressor, negatively regulates the MAPKs (mitogen-activated protein kinases) ERK, p38 and JNK. MAPKs play a crucial role in cancer development and progression. Previously, using microarray analyses we found a conspicuously frequent overexpression of DUSP4 in colorectal cancer (CRC) with high frequent microsatellite instability (MSI-H) compared to microsatellite stable (MSS) CRC. Here we studied DUSP4 expression on mRNA level in 38 CRC (19 MSI-H and 19 MSS) compared to matched normal tissue as well as in CRC cell lines by RT-qPCR. DUSP4 was overexpressed in all 19 MSI-H tumors and in 14 MSS tumors. Median expression levels in MSI-H tumors were significantly higher than in MSS-tumors (p < 0.001). Consistently, MSI-H CRC cell lines showed 6.8-fold higher DUSP4 mRNA levels than MSS cell lines. DUSP4 expression was not regulated by promoter methylation since no methylation was found by quantitative methylation analysis of DUSP4 promoter in CRC cell lines neither in tumor samples. Furthermore, no DUSP4 mutation was found on genomic DNA level in four CRC cell lines. DUSP4 overexpression in CRC cell lines through DUSP4 transfection caused upregulated expression of MAPK targets CDC25A, CCND1, EGR1, FOS, MYC and CDKN1A in HCT116 as well as downregulation of mismatch repair gene MSH2 in SW480. Furthermore, DUSP4 overexpression led to increased proliferation in CRC cell lines. Our findings suggest that DUSP4 acts as an important regulator of cell growth within the MAPK pathway and causes enhanced cell growth in MSI-H CRC. Copyright © 2012 UICC.
ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling
Masuda, Tetsuro; Endo, Motoyoshi; Yamamoto, Yutaka; Odagiri, Haruki; Kadomatsu, Tsuyoshi; Nakamura, Takayuki; Tanoue, Hironori; Ito, Hitoshi; Yugami, Masaki; Miyata, Keishi; Morinaga, Jun; Horiguchi, Haruki; Motokawa, Ikuyo; Terada, Kazutoyo; Morioka, Masaki Suimye; Manabe, Ichiro; Iwase, Hirotaka; Mizuta, Hiroshi; Oike, Yuichi
2015-01-01
Bone metastasis of breast cancer cells is a major concern, as it causes increased morbidity and mortality in patients. Bone tissue-derived CXCL12 preferentially recruits breast cancer cells expressing CXCR4 to bone metastatic sites. Thus, understanding how CXCR4 expression is regulated in breast cancer cells could suggest approaches to decrease bone metastasis of breast tumor cells. Here, we show that tumor cell-derived angiopoietin-like protein 2 (ANGPTL2) increases responsiveness of breast cancer cells to CXCL12 by promoting up-regulation of CXCR4 in those cells. In addition, we used a xenograft mouse model established by intracardiac injection of tumor cells to show that ANGPTL2 knockdown in breast cancer cells attenuates tumor cell responsiveness to CXCL12 by decreasing CXCR4 expression in those cells, thereby decreasing bone metastasis. Finally, we found that ANGPTL2 and CXCR4 expression levels within primary tumor tissues from breast cancer patients are positively correlated. We conclude that tumor cell-derived ANGPTL2 may increase bone metastasis by enhancing breast tumor cell responsiveness to CXCL12 signaling through up-regulation of tumor cell CXCR4 expression. These findings may suggest novel therapeutic approaches to treat metastatic breast cancer. PMID:25773070
Bodel, P; Ralph, P; Wenc, K; Long, J C
1980-02-01
Fever not explained by infection may occur in patients with malignant lymphoma presumably caused by a release of endogenous pyrogen. Although pyrogen has been found in some tumors with a mixed cell population, production of endogenous pyrogen by the neoplastic cells has not been demonstrated. This report documents the apparently spontaneous synthesis and release of such pyrogen by two human tumor cell lines derived from patients with Hodgkin's disease and histiocytic lymphoma. The endogenous pyrogen from the two cell lines was similar and closely resembled that produced by normal human monocytes in antigenic properties as well as heat and pronase sensitivity. The Hodgkin's disease and histiocytic lymphoma cell lines do not require specific stimulation for the production of endogenous pyrogen suggesting that the mechanism of pyrogen release by neoplastic macrophage-related cells differs from that of normal phagocytic cells. The tumor-associated fever in some patients with malignant lymphoma may be caused by a release of endogenous pyrogen by proliferating neoplastic cells.
Bodel, P; Ralph, P; Wenc, K; Long, J C
1980-01-01
Fever not explained by infection may occur in patients with malignant lymphoma presumably caused by a release of endogenous pyrogen. Although pyrogen has been found in some tumors with a mixed cell population, production of endogenous pyrogen by the neoplastic cells has not been demonstrated. This report documents the apparently spontaneous synthesis and release of such pyrogen by two human tumor cell lines derived from patients with Hodgkin's disease and histiocytic lymphoma. The endogenous pyrogen from the two cell lines was similar and closely resembled that produced by normal human monocytes in antigenic properties as well as heat and pronase sensitivity. The Hodgkin's disease and histiocytic lymphoma cell lines do not require specific stimulation for the production of endogenous pyrogen suggesting that the mechanism of pyrogen release by neoplastic macrophage-related cells differs from that of normal phagocytic cells. The tumor-associated fever in some patients with malignant lymphoma may be caused by a release of endogenous pyrogen by proliferating neoplastic cells. PMID:6985918
Immune evasion mechanisms and immune checkpoint inhibition in advanced merkel cell carcinoma.
Schadendorf, Dirk; Nghiem, Paul; Bhatia, Shailender; Hauschild, Axel; Saiag, Philippe; Mahnke, Lisa; Hariharan, Subramanian; Kaufman, Howard L
2017-01-01
Merkel cell carcinoma (MCC) is a rare skin cancer caused by Merkel cell polyomavirus (MCPyV) infection and/or ultraviolet radiation-induced somatic mutations. The presence of tumor-infiltrating lymphocytes is evidence that an active immune response to MCPyV and tumor-associated neoantigens occurs in some patients. However, inhibitory immune molecules, including programmed death-1 (PD-1) and programmed death-ligand 1 (PD-L1), within the MCC tumor microenvironment aid in tumor evasion of T-cell-mediated clearance. Unlike chemotherapy, treatment with anti-PD-L1 (avelumab) or anti-PD-1 (pembrolizumab) antibodies leads to durable responses in MCC, in both virus-positive and virus-negative tumors. As many tumors are established through the evasion of infiltrating immune-cell clearance, the lessons learned in MCC may be broadly relevant to many cancers.
Enhancement of phagocytosis and cytotoxicity in macrophages by tumor-derived IL-18 stimulation
Henan, Xu; Toyota, Naoka; Yanjiang, Xing; Fujita, Yuuki; Zhijun, Huang; Touma, Maki; Qiong, Wu; Sugimoto, Kenkichi
2014-01-01
Inoculation of mice with the murine NFSA cell line caused the formation of large tumors with necrotic tumor cores. FACS analysis revealed accumulations of CD11b+ cells in the tumors. Microarray analysis indicated that the NFSA cells expressed a high level of the pro-inflammatory factor interleukin-18 (il-18), which is known to play a critical role in macrophages. However, little is known about the physiological function of IL-18-stimulated macrophages. Here, we provide direct evidence that IL-18 enhances the phagocytosis of RAW264 cells and peritoneal macrophages, accompanied by the increased expression of tumor necrosis factor (tnf-α), interleukin-6 (il-6) and inducible nitric oxide synthase (Nos2). IL-18-stimulated RAW264 cells showed an enhanced cytotoxicity to endothelial F-2 cells via direct cell-to-cell interaction and the secretion of soluble mediators. Taken together, our results demonstrate that tumor-derived IL-18 plays an important role in the phagocytosis of macrophages and that IL-18-stimulated macrophages may damage tumor endothelial cells. [BMB Reports 2014; 47(5): 286-291] PMID:24286318
Elevating the frequency of chromosome mis-segregation as a strategy to kill tumor cells
Janssen, Aniek; Kops, Geert J. P. L.; Medema, René H.
2009-01-01
The mitotic checkpoint has evolved to prevent chromosome mis-segregations by delaying mitosis when unattached chromosomes are present. Inducing severe chromosome segregation errors by ablating the mitotic checkpoint causes cell death. Here we have analyzed the consequences of gradual increases in chromosome segregation errors on the viability of tumor cells and normal human fibroblasts. Partial reduction of essential mitotic checkpoint components in four tumor cell lines caused mild chromosome mis-segregations, but no lethality. These cells were, however, remarkably more sensitive to low doses of taxol, which enhanced the amount and severity of chromosome segregation errors. Sensitization to taxol was achieved by reducing levels of Mps1 or BubR1, proteins having dual roles in checkpoint activation and chromosome alignment, but not by reducing Mad2, functioning solely in the mitotic checkpoint. Moreover, we find that untransformed human fibroblasts with reduced Mps1 levels could not be sensitized to sublethal doses of taxol. Thus, targeting the mitotic checkpoint and chromosome alignment simultaneously may selectively kill tumor cells by enhancing chromosome mis-segregations. PMID:19855003
Lugini, Luana; Federici, Cristina; Borghi, Martina; Azzarito, Tommaso; Marino, Maria Lucia; Cesolini, Albino; Spugnini, Enrico Pierluigi; Fais, Stefano
2016-08-01
Tumor acidity represents a major cause of chemoresistance. Proton pump inhibitors (PPIs) can neutralize tumor acidity, sensitizing cancer cells to chemotherapy. To compare the anti-tumor efficacy of different PPIs in vitro and in vivo. In vitro experiments PPIs anti-tumor efficacy in terms of cell proliferation and cell death/apoptosis/necrosis evaluation were performed. In vivo PPIs efficacy experiments were carried out using melanoma xenograft model in SCID mice. Lansoprazole showed higher anti-tumor effect when compared to the other PPIs. The lansoprazole effect lasted even upon drug removal from the cell culture medium and it was independent from the lipophilicity of the PPIs formulation. These PPIs have shown different anti-tumoral efficacy, and the most effective at low dose was lansoprazole. The possibility to contrast tumor acidity by off-label using PPIs opens a new field of oncology investigation.
A case of postmenopausal androgen excess.
Lambrinoudaki, Irene; Dafnios, Nikos; Kondi-Pafiti, Agathi; Triantafyllou, Nikos; Karopoulou, Evangelia; Papageorgiou, Anastasia; Augoulea, Areti; Armeni, Eleni; Creatsa, Maria; Vlahos, Nikolaos
2015-10-01
Ovarian steroid cell tumors are very rare but potentially life-threatening neoplasms. They represent less than 0.1% of all ovarian tumors, typically present in premenopausal women and frequently manifest with virilization. Signs of hyperandrogenism may appear in postmenopausal women due to tumorοus and non-tumorοus adrenal and ovarian causes as well due to the normal aging process. In any case, steroid cell tumor should be suspected in postmenopausal women who present with rapid progressive androgen excess symptoms. This report describes a case of a 67-year-old postmenopausal woman with signs of hyperandrogenism, where an ovarian steroid cell tumor was diagnosed and treated by laparoscopic bilateral salpingo-oophorectomy and synchronous hysterectomy.
Stopping Liver Cancer's Rogue COP | Center for Cancer Research
Liver cancer is the fourth most common cancer type and the third leading cause of cancer death worldwide. Many liver tumors are actually metastases, tumors seeded in the liver by cancer cells from another organ, but hepatocellular carcinomas (HCCs), the most common liver tumors, are a heterogeneous family of cancers that arise in hepatocytes, the functional cells of the liver.
Tumor induces muscle wasting in mice through releasing extracellular Hsp70 and Hsp90.
Zhang, Guohua; Liu, Zhelong; Ding, Hui; Zhou, Yong; Doan, Hoang Anh; Sin, Ka Wai Thomas; Zhu, Zhiren J; Flores, Rene; Wen, Yefei; Gong, Xing; Liu, Qingyun; Li, Yi-Ping
2017-09-19
Cachexia, characterized by muscle wasting, is a major contributor to cancer-related mortality. However, the key cachexins that mediate cancer-induced muscle wasting remain elusive. Here, we show that tumor-released extracellular Hsp70 and Hsp90 are responsible for tumor's capacity to induce muscle wasting. We detected high-level constitutive release of Hsp70 and Hsp90 associated with extracellular vesicles (EVs) from diverse cachexia-inducing tumor cells, resulting in elevated serum levels in mice. Neutralizing extracellular Hsp70/90 or silencing Hsp70/90 expression in tumor cells abrogates tumor-induced muscle catabolism and wasting in cultured myotubes and in mice. Conversely, administration of recombinant Hsp70 and Hsp90 recapitulates the catabolic effects of tumor. In addition, tumor-released Hsp70/90-expressing EVs are necessary and sufficient for tumor-induced muscle wasting. Further, Hsp70 and Hsp90 induce muscle catabolism by activating TLR4, and are responsible for elevation of circulating cytokines. These findings identify tumor-released circulating Hsp70 and Hsp90 as key cachexins causing muscle wasting in mice.Cachexia affects many cancer patients causing weight loss and increasing mortality. Here, the authors identify extracellular Hsp70 and Hsp90, either in soluble form or secreted as part of exosomes from tumor cells, to be responsible for tumor induction of cachexia.
The Role of Tumor Microenvironment in Chemoresistance: To Survive, Keep Your Enemies Closer
Senthebane, Dimakatso Alice; Rowe, Arielle; Shipanga, Hendrina; Munro, Daniella; Al Mazeedi, Mohammad A. M.; Almazyadi, Hashim A. M.; Kallmeyer, Karlien
2017-01-01
Chemoresistance is a leading cause of morbidity and mortality in cancer and it continues to be a challenge in cancer treatment. Chemoresistance is influenced by genetic and epigenetic alterations which affect drug uptake, metabolism and export of drugs at the cellular levels. While most research has focused on tumor cell autonomous mechanisms of chemoresistance, the tumor microenvironment has emerged as a key player in the development of chemoresistance and in malignant progression, thereby influencing the development of novel therapies in clinical oncology. It is not surprising that the study of the tumor microenvironment is now considered to be as important as the study of tumor cells. Recent advances in technological and analytical methods, especially ‘omics’ technologies, has made it possible to identify specific targets in tumor cells and within the tumor microenvironment to eradicate cancer. Tumors need constant support from previously ‘unsupportive’ microenvironments. Novel therapeutic strategies that inhibit such microenvironmental support to tumor cells would reduce chemoresistance and tumor relapse. Such strategies can target stromal cells, proteins released by stromal cells and non-cellular components such as the extracellular matrix (ECM) within the tumor microenvironment. Novel in vitro tumor biology models that recapitulate the in vivo tumor microenvironment such as multicellular tumor spheroids, biomimetic scaffolds and tumor organoids are being developed and are increasing our understanding of cancer cell-microenvironment interactions. This review offers an analysis of recent developments on the role of the tumor microenvironment in the development of chemoresistance and the strategies to overcome microenvironment-mediated chemoresistance. We propose a systematic analysis of the relationship between tumor cells and their respective tumor microenvironments and our data show that, to survive, cancer cells interact closely with tumor microenvironment components such as mesenchymal stem cells and the extracellular matrix. PMID:28754000
Metastatic potential of tumor-initiating cells in solid tumors.
Adhikari, Amit S; Agarwal, Neeraj; Iwakuma, Tomoo
2011-01-01
The lethality of cancer is mainly caused by its properties of metastasis, drug resistance, and subsequent recurrence. Understanding the mechanisms governing these properties and developing novel strategies to overcome them will greatly improve the survival of cancer patients. Recent findings suggest that tumors are comprised of heterogeneous cell populations, and only a small fraction of these are tumorigenic with the ability to self-renew and produce phenotypically diverse tumor cell populations. Cells in this fraction are called tumor-initiating cells (TICs) or cancer stem cells (CSCs). TICs have been identified from many types of cancer. They share several similarities with normal adult stem cells including sphere-forming ability, self-renewability, and expression of stem cell surface markers and transcription factors. TICs have also been proposed to be responsible for cancer metastasis, however, scarce evidence for their metastatic potential has been provided. In this review article, we have attempted to summarize the studies which have examined the metastatic potential of TICs in solid tumors.
2012-09-20
Bone Marrow Suppression; Fever, Sweats, and Hot Flashes; Infection; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific
Are biomechanical changes necessary for tumor progression?
NASA Astrophysics Data System (ADS)
Kas, Josef A.
2014-03-01
Already the Roman Celsus recognized rigid tissue as characteristic for solid tumors. Conversely, changes towards a weaker cytoskeleton have been described as a feature of cancer cells since the early days of tumor biology. It remains unclear if a carcinoma's rigid signature stems from more inflexible cells or is caused by the stroma. Despite that the importance of cell biomechanics for tumor progression becomes more and more evident the chicken-and-egg problem to what extent cancer cells already change their mechanical properties within the solid tumor in order to transgress its boundary or mechanical changes are induced by the microenvironment when the cell has left the tumor has been discussed highly controversial. Comprehensive clinical biomechanical measurements only exist from tumor tissue without the possibility to identify individual cells or from individual cancer cells from pleural effusions. Since the biomechanical properties of cells in carcinomas remain unknown measurements on individual cells that directly stem out of primary tumor samples are required, which we have conducted. We found in cervix and mammary carcinomas a distinctive increase of softer cells as well as contractile cells. A soft and contractile cell is like a strong elastic rope. The cell can generate a strong tensile tension to pull its self along and is soft against compression to avoid jamming.
Górski, A; Castronovo, V; Stepień-Sopniewska, B; Grieb, P; Ryba, M; Mrowiec, T; Korczak-Kowalska, G; Wierzbicki, P; Matysiak, W; Dybowska, B
1994-07-01
Although T cells infiltrate malignant tumors, the local immune response is usually inefficient and tumors escape destruction. While extracellular matrix proteins strongly costimulate T cell responses in normal individuals, our studies indicate that peripheral blood T cells from cancer patients and tumor infiltrating cells respond poorly or are resistant to stimulative signals mediated by collagen I and IV and fibronectin. Moreover, the adhesive properties of cancer T cells are markedly depressed. Those functional deficiencies are paralleled by variable deficits in integrin and non-integrin T cell receptors for extracellular matrix. Immunotherapy with BCG causes a dramatic but transient increase in T cell: ECM interactions.
Ovarian Tumor Cells Studied Aboard the International Space Station (ISS)
NASA Technical Reports Server (NTRS)
2001-01-01
In August 2001, principal investigator Jeanne Becker sent human ovarian tumor cells to the International Space Station (ISS) aboard the STS-105 mission. The tumor cells were cultured in microgravity for a 14 day growth period and were analyzed for changes in the rate of cell growth and synthesis of associated proteins. In addition, they were evaluated for the expression of several proteins that are the products of oncogenes, which cause the transformation of normal cells into cancer cells. This photo, which was taken by astronaut Frank Culbertson who conducted the experiment for Dr. Becker, shows two cell culture bags containing LN1 ovarian carcinoma cell cultures.
Olias, P; Schulz, E; Ehlers, B; Ochs, A; Mundhenk, L; Klopfleisch, R
2012-04-01
Cervical Cancer is the second most common cancer among women. Nevertheless, similar tumours have only been rarely described in Great Apes. This report characterizes the pathological and molecular features of a metastatic endocervical adenocarcinoma in a Western lowland gorilla (Gorilla g. gorilla). Necropsy and histopathology was performed to identify the cause of the disease in an cachectic 50-year-old western lowland gorilla. Immunohistochemistry for Ki67, oestrogen receptor alpha and ERBB2 was performed to characterize the tumor. In addition, Pan-herpesvirus and Pan-papillomavirus PCR were used to identify a possible viral cause. The endoccervical carcinoma showed a severe metastatic spread to the lung, brain and bone and was herpesvirus and papillomavirus-negative. Most tumor cells were ERBB2-positive, 15% of tumor cells were Ki67-positive and only few tumor cells had oestrogen receptor alpha expression. Histopathologically and immunohistochemically, the tumour had striking similarities to human endocervicial adenocarcinomas of the common type. However, PCR analysis failed to identify herpes- or papillomaviral DNA in the tumor at the time of necropsy, thus leaving the question for cause of the disease open. © 2012 John Wiley & Sons A/S.
Review: circulating tumor cells in the practice of breast cancer oncology.
Ramos-Medina, R; Moreno, F; Lopez-Tarruella, S; Del Monte-Millán, M; Márquez-Rodas, I; Durán, E; Jerez, Y; Garcia-Saenz, J A; Ocaña, I; Andrés, S; Massarrah, T; González-Rivera, M; Martin, M
2016-08-01
The primary cause of tumor-related death in breast cancer is still represented by distant metastasization. The dissemination of tumor cells from the primary tumor to distant sites through bloodstream cannot be early detected by standard imaging methods. Circulating tumor cells (CTCs) play a major role in the metastatic spread of breast cancer. Different analytical systems for CTCs isolation and detection have been developed and novel areas of research are directed towards developing assays for CTCs molecular characterization. This review describes the current state of art on CTCs detection techniques and the present and future clinical implications of CTCs enumeration and characterization.
Arina, Ainhoa; Karrison, Theodore; Galka, Eva; Schreiber, Karin; Weichselbaum, Ralph R.; Schreiber, Hans
2017-01-01
Adoptively transferred CD8+ T cells can stabilize the size of solid tumors over long periods of time by exclusively recognizing antigen cross-presented on tumor stroma. However, these tumors eventually escape T cell–mediated growth control. The aim of this study was to eradicate such persistent cancers. In our model, the SIYRYYGL antigen is expressed by cancer cells that lack the MHC-I molecule Kb needed for direct presentation, but the antigen is picked up and cross-presented by tumor stroma. A single injection of antigen-specific 2C CD8+ T cells caused long-term inhibition of tumor growth, but without further intervention, tumors started to progress after approximately 3 months. Escape was associated with reduced numbers of circulating 2C cells. Tumor-infiltrating 2C cells produced significantly less TNFα and expressed more of the “exhaustion” markers PD-1 and Tim-3 than T cells from lymphoid organs. High-dose local ionizing radiation, depletion of myeloid-derived suppressor cells, infusions of additional 2C cells, and antibodies blocking PD-L1 did not prevent tumor escape. In contrast, adoptive transfer of allogeneic CD4+ T cells restored the numbers of circulating Ag-specific CD8+ T cells and their intratumoral function, resulting in tumor eradication. These CD4+ T cells had no antitumor effects in the absence of CD8+ T cells and recognized the alloantigen cross-presented on tumor stroma. CD4+ T cells might also be effective in cancer patients when PD1/PD-L1 blockade does not rescue intratumoral CD8+ T-cell function and tumors persist. PMID:28077434
Komatsu, M; Yee, L; Carraway, K L
1999-05-01
Sialomucin complex (SMC) is a large heterodimeric glycoprotein complex composed of a mucin subunit ascites sialoglycoprotein-1 and a transmembrane subunit ascites sialoglycoprotein-2. It is a rat homologue of human mucin gene MUC4 and is abundantly expressed on the cell surface of highly metastatic ascites 13762 rat mammary adenocarcinoma cells. Because of their extended and rigid structures, mucin-type glycoproteins are suggested to have suppressing effects on cell-cell and cell-matrix interactions. During the metastatic process, these effects presumably cause tumor cell detachment from the primary tumor mass and facilitate escape of the tumor cells from immunosurveillance. Analyses of human breast cancer cells in solid tumors and tumor effusions showed that the more aggressive cells in effusions are stained with polyclonal antibodies against SMC more frequently than cells in solid tumors, suggesting a role for MUC4/SMC in tumor progression and metastasis. Previously, we generated recombinant cDNAs for SMC that vary in the number of mucin repeats to study the putative functions of SMC in tumor metastasis. These cDNAs were transfected into human cancer cell lines and tested for the effect of the expression of this gene. Here, using a tetracycline-responsive inducible expression system, we demonstrate that overexpression of SMC masks the surface antigens on target tumor cells and effectively suppresses tumor cell killing by cytotoxic lymphocytes. This effect results from the ability of SMC to block killer cell binding to the tumor cells and is dependent on both overexpression of the mucin and the number of mucin repeats in the expressed SMC. These results provide an explanation for the proposed role of SMC/MUC4 in tumor progression.
Tracing the origin of disseminated tumor cells in breast cancer using single-cell sequencing.
Demeulemeester, Jonas; Kumar, Parveen; Møller, Elen K; Nord, Silje; Wedge, David C; Peterson, April; Mathiesen, Randi R; Fjelldal, Renathe; Zamani Esteki, Masoud; Theunis, Koen; Fernandez Gallardo, Elia; Grundstad, A Jason; Borgen, Elin; Baumbusch, Lars O; Børresen-Dale, Anne-Lise; White, Kevin P; Kristensen, Vessela N; Van Loo, Peter; Voet, Thierry; Naume, Bjørn
2016-12-09
Single-cell micro-metastases of solid tumors often occur in the bone marrow. These disseminated tumor cells (DTCs) may resist therapy and lay dormant or progress to cause overt bone and visceral metastases. The molecular nature of DTCs remains elusive, as well as when and from where in the tumor they originate. Here, we apply single-cell sequencing to identify and trace the origin of DTCs in breast cancer. We sequence the genomes of 63 single cells isolated from six non-metastatic breast cancer patients. By comparing the cells' DNA copy number aberration (CNA) landscapes with those of the primary tumors and lymph node metastasis, we establish that 53% of the single cells morphologically classified as tumor cells are DTCs disseminating from the observed tumor. The remaining cells represent either non-aberrant "normal" cells or "aberrant cells of unknown origin" that have CNA landscapes discordant from the tumor. Further analyses suggest that the prevalence of aberrant cells of unknown origin is age-dependent and that at least a subset is hematopoietic in origin. Evolutionary reconstruction analysis of bulk tumor and DTC genomes enables ordering of CNA events in molecular pseudo-time and traced the origin of the DTCs to either the main tumor clone, primary tumor subclones, or subclones in an axillary lymph node metastasis. Single-cell sequencing of bone marrow epithelial-like cells, in parallel with intra-tumor genetic heterogeneity profiling from bulk DNA, is a powerful approach to identify and study DTCs, yielding insight into metastatic processes. A heterogeneous population of CNA-positive cells is present in the bone marrow of non-metastatic breast cancer patients, only part of which are derived from the observed tumor lineages.
Ju, Seong-A; Park, Sang-Min; Lee, Yea-Sol; Bae, Jun-Hyeong; Yu, Rina; An, Won G; Suh, Jae-Hee; Kim, Byung-Sam
2012-06-01
Tumor-infiltrating lymphocytes (TILs) play critical roles in host antitumor immune responses. It is known that cancer patients with tumor-reactive lymphocyte infiltration in their tumors have better prognoses, while patients with tumors infiltrated by immunosuppressive cells have worse prognoses. We found that administration of 6-gingerol, which is a component of ginger, inhibited tumor growth in several types of murine tumors, such as B16F1 melanomas, Renca renal cell carcinomas and CT26 colon carcinomas, which were established by inoculating tumor cells on the flanks of mice. However, administration of 6-gingerol did not lead to complete eradication of the tumors. 6-Gingerol treatment of tumor-bearing mice caused massive infiltration of CD4 and CD8 T-cells and B220(+) B-cells, but reduced the number of CD4(+) Foxp3(+) regulatory T-cells. The CD8 tumor-infiltrating T lymphocytes in 6-gingerol-treated mice strongly expressed IFN-γ, a marker of activation of cytotoxic T lymphocytes (CTL) CD107a and chemokine receptors that are expressed on T(H) 1 cells, such as CXCR3 and CCR5. To test whether 6-gingerol could promote infiltration of tumor antigen-specific CD8 T-cells into tumors, we adoptively transferred CFSE-labeled OT-1 CD8 T-cells into EG7 tumor-bearing mice. We found that CD8 T cells isolated from 6-gingerol pretreated OT-1 mice, but not from control OT-1 mice, massively infiltrated tumors and tumor draining lymph nodes and divided several times. Our results strongly suggest that 6-gingerol can be used in tumor immunotherapy to increase the number of TILs. Copyright © 2011 UICC.
Ionizing radiation, ion transports, and radioresistance of cancer cells
Huber, Stephan M.; Butz, Lena; Stegen, Benjamin; Klumpp, Dominik; Braun, Norbert; Ruth, Peter; Eckert, Franziska
2013-01-01
The standard treatment of many tumor entities comprises fractionated radiation therapy which applies ionizing radiation to the tumor-bearing target volume. Ionizing radiation causes double-strand breaks in the DNA backbone that result in cell death if the number of DNA double-strand breaks exceeds the DNA repair capacity of the tumor cell. Ionizing radiation reportedly does not only act on the DNA in the nucleus but also on the plasma membrane. In particular, ionizing radiation-induced modifications of ion channels and transporters have been reported. Importantly, these altered transports seem to contribute to the survival of the irradiated tumor cells. The present review article summarizes our current knowledge on the underlying mechanisms and introduces strategies to radiosensitize tumor cells by targeting plasma membrane ion transports. PMID:23966948
Qiu, Hongming; Orr, F.William; Jensen, Derrek; Wang, Hui Helen; McIntosh, Alan R.; Hasinoff, Brian B.; Nance, Dwight M.; Pylypas, Susan; Qi, Ke; Song, Chun; Muschel, Ruth J.; Al-Mehdi, Abu-Bakr
2003-01-01
Metastatic cancer cells seed the lung via blood vessels. Because endothelial cells generate nitric oxide (NO) in response to shear stress, we postulated that the arrest of cancer cells in the pulmonary microcirculation causes the release of NO in the lung. After intravenous injection of B16F1 melanoma cells, pulmonary NO increased sevenfold throughout 20 minutes and approached basal levels by 4 hours. NO induction was blocked by NG-nitro-l-arginine methyl ester (L-NAME) and was not observed in endothelial nitric oxide synthase (eNOS)-deficient mice. NO production, visualized ex vivo with the fluorescent NO probe diaminofluorescein diacetate, increased rapidly at the site of tumor cell arrest, and continued to increase throughout 20 minutes. Arrested tumor cells underwent apoptosis with apoptotic counts more than threefold over baseline at 8 and 48 hours. Neither the NO signals nor increased apoptosis were seen in eNOS knockout mice or mice pretreated with L-NAME. At 48 hours, 83% of the arrested cells had cleared from the lungs of wild-type mice but only ∼55% of the cells cleared from eNOS-deficient or L-NAME pretreated mice. eNOS knockout and L-NAME-treated mice had twofold to fivefold more metastases than wild-type mice, measured by the number of surface nodules or by histomorphometry. We conclude that tumor cell arrest in the pulmonary microcirculation induces eNOS-dependent NO release by the endothelium adjacent to the arrested tumor cells and that NO is one factor that causes tumor cell apoptosis, clearance from the lung, and inhibition of metastasis. PMID:12547699
Gu, Yuan; Qi, Chunting; Sun, Xiaoxiao; Ma, Xiuquan; Zhang, Haohao; Hu, Lihong; Yuan, Junying; Yu, Qiang
2012-08-15
Selectively eradicating cancer cells with minimum adverse effects on normal cells is a major challenge in the development of anticancer therapy. We hypothesize that nutrient-limiting conditions frequently encountered by cancer cells in poorly vascularized solid tumors might provide an opportunity for developing selective therapy. In this study, we investigated the function and molecular mechanisms of a natural compound, arctigenin, in regulating tumor cell growth. We demonstrated that arctigenin selectively promoted glucose-starved A549 tumor cells to undergo necrosis by inhibiting mitochondrial respiration. In doing so, arctigenin elevated cellular level of reactive oxygen species (ROS) and blocked cellular energy metabolism in the glucose-starved tumor cells. We also demonstrated that cellular ROS generation was caused by intracellular ATP depletion and played an essential role in the arctigenin-induced tumor cell death under the glucose-limiting condition. Furthermore, we combined arctigenin with the glucose analogue 2-deoxyglucose (2DG) and examined their effects on tumor cell growth. Interestingly, this combination displayed preferential cell-death inducing activity against tumor cells compared to normal cells. Hence, we propose that the combination of arctigenin and 2DG may represent a promising new cancer therapy with minimal normal tissue toxicity. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.
TRIADIMEFON INDUCES RAT THYROID TUMORS THROUGH A NON-TSH MEDIATED MODE OF ACTION
Conazoles are a class of fungicides used as agricultural and pharmaceutical products which inhibit ergosterol biosynthesis. Members of this class are hepatotoxic and cause mouse hepatocellular tumors and/or rat thyroid follicular cell tumors. Triadimefon-induced rat thyroid tumor...
Exclusive destruction of mitotic spindles in human cancer cells.
Visochek, Leonid; Castiel, Asher; Mittelman, Leonid; Elkin, Michael; Atias, Dikla; Golan, Talia; Izraeli, Shai; Peretz, Tamar; Cohen-Armon, Malka
2017-03-28
We identified target proteins modified by phenanthrenes that cause exclusive eradication of human cancer cells. The cytotoxic activity of the phenanthrenes in a variety of human cancer cells is attributed by these findings to post translational modifications of NuMA and kinesins HSET/kifC1 and kif18A. Their activity prevented the binding of NuMA to α-tubulin and kinesins in human cancer cells, and caused aberrant spindles. The most efficient cytotoxic activity of the phenanthridine PJ34, caused significantly smaller aberrant spindles with disrupted spindle poles and scattered extra-centrosomes and chromosomes. Concomitantly, PJ34 induced tumor growth arrest of human malignant tumors developed in athymic nude mice, indicating the relevance of its activity for cancer therapy.
Primary cultures of human colon cancer as a model to study cancer stem cells.
Koshkin, Sergey; Danilova, Anna; Raskin, Grigory; Petrov, Nikolai; Bajenova, Olga; O'Brien, Stephen J; Tomilin, Alexey; Tolkunova, Elena
2016-09-01
The principal cause of death in cancer involves tumor progression and metastasis. Since only a small proportion of the primary tumor cells, cancer stem cells (CSCs), which are the most aggressive, have the capacity to metastasize and display properties of stem cells, it is imperative to characterize the gene expression of diagnostic markers and to evaluate the drug sensitivity in the CSCs themselves. Here, we have examined the key genes that are involved in the progression of colorectal cancer and are expressed in cancer stem cells. Primary cultures of colorectal cancer cells from a patient's tumors were studied using the flow cytometry and cytological methods. We have evaluated the clinical and stem cell marker expression in these cells, their resistance to 5-fluorouracil and irinotecan, and the ability of cells to form tumors in mice. The data shows the role of stem cell marker Oct4 in the resistance of primary colorectal cancer tumor cells to 5-fluorouracil.
Potential role of the glycolytic oscillator in acute hypoxia in tumors
NASA Astrophysics Data System (ADS)
Che Fru, Leonard; Adamson, Erin B.; Campos, David D.; Fain, Sean B.; Jacques, Steven L.; van der Kogel, Albert J.; Nickel, Kwang P.; Song, Chihwa; Kimple, Randall J.; Kissick, Michael W.
2015-12-01
Tumor acute hypoxia has a dynamic component that is also, at least partially, coherent. Using blood oxygen level dependent magnetic resonance imaging, we observed coherent oscillations in hemoglobin saturation dynamics in cell line xenograft models of head and neck squamous cell carcinoma. We posit a well-established biochemical nonlinear oscillatory mechanism called the glycolytic oscillator as a potential cause of the coherent oscillations in tumors. These data suggest that metabolic changes within individual tumor cells may affect the local tumor microenvironment including oxygen availability and therefore radiosensitivity. These individual cells can synchronize the oscillations in patches of similar intermediate glucose levels. These alterations have potentially important implications for radiation therapy and are a potential target for optimizing the cancer response to radiation.
Photodynamic cell-kill analysis of breast tumor cells with a tamoxifen-pyropheophorbide conjugate.
Fernandez Gacio, Ana; Fernandez-Marcos, Carlos; Swamy, Narasimha; Dunn, Darra; Ray, Rahul
2006-10-15
We hypothesized that estrogen receptor (ER) in hormone-sensitive breast cancer cells could be targeted for selective photodynamic killing of tumor cell with antiestrogen-porphyrin conjugates by combining the over-expression of ER in hormone-sensitive breast cancer cells and tumor-retention property of porphyrin photosensitizers. In this study we describe that a tamoxifen (TAM)-pyropheophorbide conjugate that specifically binds to ER alpha, caused selective cell-kill in MCF-7 breast cancer cells upon light exposure. Therefore, it is a potential candidate for ER-targeted photodynamic therapy of cancers (PDT) of tissues and organs that respond to estrogens/antiestrogens. 2006 Wiley-Liss, Inc.
Zhang, Yongli; Cui, Yuqiang; Zhu, Jiayong; Li, Hongzhi; Mao, Jianwen; Jin, Xiaobao; Wang, Xiangsheng; Du, Yifan; Lu, Jiazheng
2013-01-01
Juglans mandshurica Maxim is a traditional herbal medicines in China, and its anti-tumor bioactivities are of research interest. Bioassay-guided fractionation method was employed to isolate anti-tumor compounds from the stem barks of the Juglans mandshurica Maxim. The anti-tumor effect and biological activities of the extracted compound JMM6 were studied in BEL-7402 cells by MTT, Cell cycle analysis, Hoechst 33342 staining, Annexin V-FITC/PI assay and Detection of mitochondrial membrane potential (ΔΨm). After treatment with the JMM6, the growth of BEL-7402 cells was inhibited and cells displayed typical morphological apoptotic characteristics. Further investigations revealed that treatment with JMM6 mainly caused G2/M cell cycle arrest and induced apoptosis in BEL-7402 cells. To evaluate the alteration of mitochondria in JMM6 induced apoptosis. The data showed that JMM6 decreased significantly the ΔΨm, causing the depolarization of the mitochondrial membrane. Our results show that the JMM6 will have a potential advantage of anti-tumor, less harmful to normal cells. This paper not only summarized the JMM6 pick-up technology from Juglans mandshurica Maxim and biological characteristic, but also may provide further evidence to exploit the potential medicine compounds from the stem-barks of the Chinese Juglans mandshurica Maxim.
Bizarro, Ana; Sousa, Diana; Lima, Raquel T; Musso, Loana; Cincinelli, Raffaella; Zuco, Vantina; De Cesare, Michelandrea; Dallavalle, Sabrina; Vasconcelos, M Helena
2018-02-13
Heat shock protein 90 (HSP90) is a well-known target for cancer therapy. In a previous work, some of us have reported a series of 3-aryl-naphtho[2,3- d ]isoxazole-4,9-diones as inhibitors of HSP90. In the present work, various compounds with new chromenopyridinone and thiochromenopyridinone scaffolds were synthesized as potential HSP90 inhibitors. Their binding affinity to HSP90 was studied in vitro. Selected compounds ( 5 and 8 ) were further studied in various tumor cell lines regarding their potential to cause cell growth inhibition, alter the cell cycle profile, inhibit proliferation, and induce apoptosis. Their effect on HSP90 client protein levels was also confirmed in two cell lines. Finally, the antitumor activity of compound 8 was studied in A431 squamous cell carcinoma xenografts in nude mice. Our results indicated that treatment with compounds 5 and 8 decreased the proliferation of tumor cell lines and compound 8 induced apoptosis. In addition, these two compounds were able to downregulate selected proteins known as "clients" of HSP90. Finally, treatment of xenografted mice with compound 5 resulted in a considerable dose-dependent inhibition of tumor growth. Our results show that two new compounds with a chromenopyridinone and thiochromenopyridinone scaffold are promising putative HSP90 inhibitors causing tumor cell growth inhibition.
Yu, Guangjie; Moudgil, Tarsem; Cui, Zhihua; Mou, Yongbin; Wang, Lixin; Fox, Bernard A; Hu, Hong-Ming
2017-06-01
We have previously shown that inhibition of the proteasome causes defective ribosomal products to be shunted into autophagosomes and subsequently released from tumor cells as defective ribosomal products in Blebs (DRibbles). These DRibbles serve as an excellent source of antigens for cross-priming of tumor-specific T cells. Here, we examine the role of ubiquitinated proteins (Ub-proteins) in this pathway. Using purified Ub-proteins from tumor cells that express endogenous tumor-associated antigen or exogenous viral antigen, we tested the ability of these proteins to stimulate antigen-specific T-cell responses, by activation of monocyte-derived dendritic cells generated from human peripheral blood mononuclear cells. Compared with total cell lysates, we found that purified Ub-proteins from both a gp100-specific melanoma cell line and from a lung cancer cell line expressing cytomegalovirus pp65 antigen produced a significantly higher level of IFN-γ in gp100- or pp65-specific T cells, respectively. In addition, Ub-proteins from an allogeneic tumor cell line could be used to stimulate tumor-infiltrating lymphocytes isolated and expanded from non-small cell lung cancer patients. These results establish that Ub-proteins provide a relevant source of antigens for cross-priming of antitumor immune responses in a variety of settings, including endogenous melanoma and exogenous viral antigen presentation, as well as antigen-specific tumor-infiltrating lymphocytes. Thus, ubiquitin can be used as an affinity tag to enrich for unknown tumor-specific antigens from tumor cell lysates to stimulate tumor-specific T cells ex vivo or to be used as vaccines to target short-lived proteins.
Corvini, Michael; Koorji, Alysha; Sgroe, Erica; Nguyen, Uyen
2018-06-01
Signet ring cell carcinoma, a subtype of adenocarcinoma, is a rare cause of primary lung cancer. The authors report a case of primary lung signet ring cell carcinoma presenting as a cavitary Pancoast tumor in a 32-year-old male smoker. Beyond the rarity of primary lung signet ring cell carcinoma itself, the youth of the patient, his smoking status, the presence of cavitation, and the location of the tumor in the superior sulcus make it especially atypical.
Zhang, Fan; Stephan, Sirkka B; Ene, Chibawanye I; Smith, Tyrel T; Holland, Eric C; Stephan, Matthias T
2018-05-14
A major obstacle to the success rate of chimeric antigen receptor (CAR-) T cell therapy against solid tumors is the microenvironment antagonistic to T cells that solid tumors create. Conventional checkpoint blockade can silence lymphocyte anti-survival pathways activated by tumors, but because they are systemic, these treatments disrupt immune homeostasis and induce autoimmune side effects. Thus, new technologies are required to remodel the tumor milieu without causing systemic toxicities. Here we demonstrate that targeted nanocarriers that deliver a combination of immune-modulatory agents can remove pro-tumor cell populations and simultaneously stimulate anti-tumor effector cells. We administered repeated infusions of lipid nanoparticles coated with the tumor-targeting peptide iRGD and loaded with a combination of a PI3K inhibitor to inhibit immune-suppressive tumor cells and an alpha-GalCer agonist of therapeutic T cells to synergistically sway the tumor microenvironment of solid tumors from suppressive to stimulatory. This treatment created a therapeutic window of two weeks, enabling tumor-specific CAR-T cells to home to the lesion, undergo robust expansion, and trigger tumor regression. CAR-T cells administered outside this therapeutic window had no curative effect. The lipid nanoparticles we used are easy to manufacture in substantial amounts, and we demonstrate that repeated infusions of them are safe. Our technology may therefore provide a practical and low-cost strategy to potentiate many cancer immunotherapies used to treat solid tumors, including T cell therapy, vaccines, and BITE platforms. Copyright ©2018, American Association for Cancer Research.
Designing herpes viruses as oncolytics
Peters, Cole; Rabkin, Samuel D
2015-01-01
Oncolytic herpes simplex virus (oHSV) was one of the first genetically-engineered oncolytic viruses. Because HSV is a natural human pathogen that can cause serious disease, it is incumbent that it can be genetically-engineered or significantly attenuated for safety. Here, we present a detailed explanation of the functions of HSV-1 genes frequently mutated to endow oncolytic activity. These genes are nonessential for growth in tissue culture cells but are important for growth in postmitotic cells, interfering with intrinsic antiviral and innate immune responses or causing pathology, functions dispensable for replication in cancer cells. Understanding the function of these genes leads to informed creation of new oHSVs with better therapeutic efficacy. Virus infection and replication can also be directed to cancer cells through tumor-selective receptor binding and transcriptional- or post-transcriptional miRNA-targeting, respectively. In addition to the direct effects of oHSV on infected cancer cells and tumors, oHSV can be “armed” with transgenes that are: reporters, to track virus replication and spread; cytotoxic, to kill uninfected tumor cells; immune modulatory, to stimulate antitumor immunity; or tumor microenvironment altering, to enhance virus spread or to inhibit tumor growth. In addition to HSV-1, other alphaherpesviruses are also discussed for their oncolytic activity. PMID:26462293
NASA Astrophysics Data System (ADS)
He, Yun; Wang, Lidai; Shi, Junhui; Yao, Junjie; Li, Lei; Zhang, Ruiying; Huang, Chih-Hsien; Zou, Jun; Wang, Lihong V.
2016-12-01
Metastasis causes as many as 90% of cancer-related deaths, especially for the deadliest skin cancer, melanoma. Since hematogenous dissemination of circulating tumor cells is the major route of metastasis, detection and destruction of circulating tumor cells are vital for impeding metastasis and improving patient prognosis. Exploiting the exquisite intrinsic optical absorption contrast of circulating melanoma cells, we developed dual-wavelength photoacoustic flow cytography coupled with a nanosecond-pulsed melanoma-specific laser therapy mechanism. We have successfully achieved in vivo label-free imaging of rare single circulating melanoma cells in both arteries and veins of mice. Further, the photoacoustic signal from a circulating melanoma cell immediately hardware-triggers a lethal pinpoint laser irradiation to kill it on the spot in a thermally confined manner without causing collateral damage. A pseudo-therapy study including both in vivo and in vitro experiments demonstrated the performance and the potential clinical value of our method, which can facilitate early treatment of metastasis by clearing circulating tumor cells from vasculature.
Seifert, Lena; Werba, Gregor; Tiwari, Shaun; Giao Ly, Nancy Ngoc; Nguy, Susanna; Alothman, Sara; Alqunaibit, Dalia; Avanzi, Antonina; Daley, Donnele; Barilla, Rocky; Tippens, Daniel; Torres-Hernandez, Alejandro; Hundeyin, Mautin; Mani, Vishnu R; Hajdu, Cristina; Pellicciotta, Ilenia; Oh, Philmo; Du, Kevin; Miller, George
2016-06-01
The role of radiation therapy in the treatment of patients with pancreatic ductal adenocarcinoma (PDA) is controversial. Randomized controlled trials investigating the efficacy of radiation therapy in patients with locally advanced unresectable PDA have reported mixed results, with effects ranging from modest benefit to worse outcomes compared with control therapies. We investigated whether radiation causes inflammatory cells to acquire an immune-suppressive phenotype that limits the therapeutic effects of radiation on invasive PDAs and accelerates progression of preinvasive foci. We investigated the effects of radiation therapy in p48(Cre);LSL-Kras(G12D) (KC) and p48(Cre);LSLKras(G12D);LSL-Trp53(R172H) (KPC) mice, as well as in C57BL/6 mice with orthotopic tumors grown from FC1242 cells derived from KPC mice. Some mice were given neutralizing antibodies against macrophage colony-stimulating factor 1 (CSF1 or MCSF) or F4/80. Pancreata were exposed to doses of radiation ranging from 2 to 12 Gy and analyzed by flow cytometry. Pancreata of KC mice exposed to radiation had a higher frequency of advanced pancreatic intraepithelial lesions and more foci of invasive cancer than pancreata of unexposed mice (controls); radiation reduced survival time by more than 6 months. A greater proportion of macrophages from radiation treated invasive and preinvasive pancreatic tumors had an immune-suppressive, M2-like phenotype compared with control mice. Pancreata from mice exposed to radiation had fewer CD8(+) T cells than controls, and greater numbers of CD4(+) T cells of T-helper 2 and T-regulatory cell phenotypes. Adoptive transfer of T cells from irradiated PDA to tumors of control mice accelerated tumor growth. Radiation induced production of MCSF by PDA cells. A neutralizing antibody against MCSF prevented radiation from altering the phenotype of macrophages in tumors, increasing the anti-tumor T-cell response and slowing tumor growth. Radiation treatment causes macrophages murine PDA to acquire an immune-suppressive phenotype and disabled T-cell-mediated anti-tumor responses. MCSF blockade negates this effect, allowing radiation to have increased efficacy in slowing tumor growth. Copyright © 2016 AGA Institute. Published by Elsevier Inc. All rights reserved.
Shoae-Hassani, Alireza; Hamidieh, Amir Ali; Behfar, Maryam; Mohseni, Rashin; Mortazavi-Tabatabaei, Seyed A; Asgharzadeh, Shahab
2017-09-01
Immune cell-derived exosomes can increase immunity against tumors. In contrast, tumor-derived exosomes can reduce the immunity and can change the tumor microenvironment to further develop and provide metastasis. These effects take place by an alteration in the innate and adaptive immune cell functions. In this experiment, we studied the natural killer (NK) cells' effectiveness on tumor cells after expansion and thereafter incubated it with exosomes. The exosomes were derived from 2 populations of NK cells: (1) naive NK cells and, (2) NK cells previously exposed to neuroblastoma (NB) cells. Moreover, we have studied the NB-derived exosomes on NK cell function. The molecular load of the characterized exosomes (by means of nanoparticle-tracking analysis, flow cytometry, scanning electron microscopy, and western blot) from NK cells exposed to the NB cell revealed their expression of natural killer cell receptors in addition to CD56, NKG2D, and KIR2DL2 receptors. These exosomes were used to treat NK cells and thereafter administered to NB tumor cells both in vitro and in vivo. Our results showed some kind of NK cells' education by the exosomes. This education from NK cells previously exposed to NB cell-derived exosomes caused efficient and greater cytotoxicity against NB tumors, but NB-derived exosomes act as tumor promoters by providing a tumor supporting niche. Hence, this method of preparing the exosomes has a dramatic effect on activation of anti-NK cells against NB cells.
Jin, Xiaona; Jing, Hongli; Li, Fang; Zhuang, Hongming
2013-11-01
Most osteomalacia-causing tumors are small, benign mesenchymal neoplasms, which are commonly located in the extremities or craniofacial regions. An 18-year-old male patient with suspicion of tumor-induced osteomalacia underwent (99m)Tc-HYNIC-TOC scintigraphy to search potential culprit tumor. The images showed a large activity in the region of the left kidney. The lesion was resected and a clear cell renal cell carcinoma was found. One year after the left nephrectomy, the patient was tumor-free without symptoms of osteomalacia.
Insights into the regulation of tumor dormancy by angiogenesis in experimental tumors.
Indraccolo, Stefano
2013-01-01
While it is well established that an angiogenic switch marks escape from tumor dormancy in xenograft models, the molecular pathways involved in the control of tumor cell proliferation or survival by angiogenesis remain substantially uncharted. We recently demonstrated that signals stemming from angiogenic endothelial cells (EC) regulate the behavior of dormant cancer cells. Specifically, we observed that the Notch ligand Dll4, induced by angiogenic factors in EC, triggers Notch3 activation in neighboring tumor cells and promotes a tumorigenic phenotype. Evidence that Notch signaling is involved in tumor dormancy was further strengthened by the observation that MKP-1 levels-a broadly expressed phosphatase-are controlled by Notch3 by regulation of protein ubiquitination and stability. Notch3 and MKP-1 levels are consistently low in dormant tumors, and this is accompanied by relatively high levels of phosphorylated p38, a canonical MKP-1 target previously associated with maintenance of tumor dormancy. These results elucidate a novel angiogenesis-driven mechanism involving the Notch and MAPK pathways that controls tumor dormancy. More in general, angiogenic EC could form part of the vascular niche, a specialized microenvironment which appears to regulate metastatic outgrowth and future studies are needed to clarify the contribution of EC in the regulation of cancer stem cell behavior in the niche.The notion that EC could communicate signals to tumor cells raises questions about the possibility of achieving tumor dormancy by counteracting angiogenesis. In experimental tumors, anti-VEGF drugs typically prune the newly formed vasculature, thus reducing microvessel density, blood flow, and perfusion. These drugs eventually increase hypoxia and cause tumor necrosis but dormancy is rarely observed. Our group recently reported that anti-VEGF therapy causes a dramatic depletion of glucose and an exhaustion of ATP levels in tumors. Moreover, we found that the central metabolic checkpoint LKB1/AMPK-a cellular sensor of ATP levels that supports cell viability in response to energy stress-is activated by anti-VEGF therapy in experimental tumors and it has a key role in induction of sustained tumor regression. These functional links between activation of the LKB1/AMPK by anti-angiogenic therapy and tumor dormancy suggest a role for metabolism in the regulation of this phenomenon.
Gibbons, Don L.; Lin, Wei; Creighton, Chad J.; Rizvi, Zain H.; Gregory, Philip A.; Goodall, Gregory J.; Thilaganathan, Nishan; Du, Liqin; Zhang, Yiqun; Pertsemlidis, Alexander; Kurie, Jonathan M.
2009-01-01
Metastatic disease is a primary cause of cancer-related death, and factors governing tumor cell metastasis have not been fully elucidated. Here, we address this question by using tumor cell lines derived from mice that develop metastatic lung adenocarcinoma owing to expression of mutant K-ras and p53. Despite having widespread somatic genetic alterations, the metastasis-prone tumor cells retained a marked plasticity. They transited reversibly between epithelial and mesenchymal states, forming highly polarized epithelial spheres in three-dimensional culture that underwent epithelial-to-mesenchymal transition (EMT) following treatment with transforming growth factor-β or injection into syngeneic mice. This transition was entirely dependent on the microRNA (miR)-200 family, which decreased during EMT. Forced expression of miR-200 abrogated the capacity of these tumor cells to undergo EMT, invade, and metastasize, and conferred transcriptional features of metastasis-incompetent tumor cells. We conclude that tumor cell metastasis is regulated by miR-200 expression, which changes in response to contextual extracellular cues. PMID:19759262
Radiation-induced effects and the immune system in cancer
Kaur, Punit; Asea, Alexzander
2012-01-01
Chemotherapy and radiation therapy (RT) are standard therapeutic modalities for patients with cancers, and could induce various tumor cell death modalities, releasing tumor-derived antigens as well as danger signals that could either be captured for triggering anti-tumor immune response. Historic studies examining tissue and cellular responses to RT have predominantly focused on damage caused to proliferating malignant cells leading to their death. However, there is increasing evidence that RT also leads to significant alterations in the tumor microenvironment, particularly with respect to effects on immune cells and infiltrating tumors. This review will focus on immunologic consequences of RT and discuss the therapeutic reprogramming of immune responses in tumors and how it regulates efficacy and durability to RT. PMID:23251903
Radiation-induced effects and the immune system in cancer.
Kaur, Punit; Asea, Alexzander
2012-01-01
Chemotherapy and radiation therapy (RT) are standard therapeutic modalities for patients with cancers, and could induce various tumor cell death modalities, releasing tumor-derived antigens as well as danger signals that could either be captured for triggering anti-tumor immune response. Historic studies examining tissue and cellular responses to RT have predominantly focused on damage caused to proliferating malignant cells leading to their death. However, there is increasing evidence that RT also leads to significant alterations in the tumor microenvironment, particularly with respect to effects on immune cells and infiltrating tumors. This review will focus on immunologic consequences of RT and discuss the therapeutic reprogramming of immune responses in tumors and how it regulates efficacy and durability to RT.
Akari, Shougo; Otsuka, Kazuki; Fujita, Motomichi; Itagaki, Keisuke; Takizawa, You-ichi; Orita, Hiroaki; Owaki, Toshiyuki; Taira, Jyunichi; Hayashi, Ryo; Kodama, Hiroaki; Fukai, Fumio
2016-01-01
The acquisition of drug resistance mediated by the interaction of tumor cells with the extracellular matrix (ECM), commonly referred to as cell adhesion-mediated drug resistance (CAM-DR), has been observed not only in hematopoietic tumor cells but also in solid tumor cells. We have previously demonstrated that a 22-mer peptide derived from fibronectin, FNIII14, can inhibit cell adhesion through the inactivation of β1 integrin; when coadministered with cytarabine, FNIII14 completely eradicates acute myelogenous leukemia by suppressing CAM-DR. In this study, we show that our FNIII14 peptide also enhances chemotherapy efficacy in solid tumors. Coadministration of FNIII14 synergistically enhances the cytotoxicity of doxorubicin and aclarubicin in mammary tumor and melanoma cells, respectively. The solid tumor cell chemosensitization induced by FNIII14 is dependent upon the upregulation and activation of the pro-apoptotic protein, Bim. Furthermore, the metastasis of tumor cells derived from ventrally transplanted mammary tumor grafts is suppressed by the coadministration of FNIII14 and doxorubicin. These results suggest that the coadministration of our FNIII14 peptide with chemotherapy could achieve efficient solid tumor eradication by increasing chemosensitivity and decreasing metastasis. The major causes of tumor recurrence are the existence of chemotherapy-resistant primary tumor cells and the establishment of secondary metastatic lesions. As such, coadministering FNIII14 with anti-cancer drugs could provide a promising new approach to improve the prognosis of patients with solid tumors. PMID:27622612
Erbb2 up-regulation of ADAM12 expression accelerates skin cancer progression.
Rao, Velidi H; Vogel, Kristen; Yanagida, Jodi K; Marwaha, Nitin; Kandel, Amrit; Trempus, Carol; Repertinger, Susan K; Hansen, Laura A
2015-10-01
Solar ultraviolet (UV) radiation can cause severe damage to the skin and is the primary cause of most skin cancer. UV radiation causes DNA damage leading to mutations and also activates the Erbb2/HER2 receptor through indirect mechanisms involving reactive oxygen species. We hypothesized that Erbb2 activation accelerates the malignant progression of UV-induced skin cancer. Following the induction of benign squamous papillomas by UV exposure of v-ras(Ha) transgenic Tg.AC mice, mice were treated topically with the Erbb2 inhibitor AG825 and tumor progression monitored. AG825 treatment reduced tumor volume, increased tumor regression, and delayed the development of malignant squamous cell carcinoma (SCC). Progression to malignancy was associated with increased Erbb2 and ADAM12 (A Disintegin And Metalloproteinase 12) transcripts and protein, while inhibition of Erbb2 blocked the increase in ADAM12 message upon malignant progression. Similarly, human SCC and SCC cell lines had increased ADAM12 protein and transcripts when compared to normal controls. To determine whether Erbb2 up-regulation of ADAM12 contributed to malignant progression of skin cancer, Erbb2 expression was modulated in cultured SCC cells using forced over-expression or siRNA targeting, demonstrating up-regulation of ADAM12 by Erbb2. Furthermore, ADAM12 transfection or siRNA targeting revealed that ADAM12 increased both the migration and invasion of cutaneous SCC cells. Collectively, these results suggest Erbb2 up-regulation of ADAM12 as a novel mechanism contributing to the malignant progression of UV-induced skin cancer. Inhibition of Erbb2/HER2 reduced tumor burden, increased tumor regression, and delayed the progression of benign skin tumors to malignant SCC in UV-exposed mice. Inhibition of Erbb2 suppressed the increase in metalloproteinase ADAM12 expression in skin tumors, which in turn increased migration and tumor cell invasiveness. © 2014 Wiley Periodicals, Inc.
Pelagalli, Alessandra; Nardelli, Anna; Fontanella, Raffaela; Zannetti, Antonella
2016-07-11
The complex cross-talk between tumor cells and their surrounding stromal environment plays a key role in the pathogenesis of cancer. Among several cell types that constitute the tumor stroma, bone marrow-derived mesenchymal stem cells (BM-MSCs) selectively migrate toward the tumor microenvironment and contribute to the active formation of tumor-associated stroma. Therefore, here we elucidate the involvement of BM-MSCs to promote osteosarcoma (OS) and hepatocellular carcinoma (HCC) cells migration and invasion and deepening the role of specific pathways. We analyzed the function of aquaporin 1 (AQP1), a water channel known to promote metastasis and neoangiogenes. AQP1 protein levels were analyzed in OS (U2OS) and HCC (SNU-398) cells exposed to conditioned medium from BM-MSCs. Tumor cell migration and invasion in response to BM-MSC conditioned medium were evaluated through a wound healing assay and Boyden chamber, respectively. The results showed that the AQP1 level was increased in both tumor cell lines after treatment with BM-MSC conditioned medium. Moreover, BM-MSCs-mediated tumor cell migration and invasion were hampered after treatment with AQP1 inhibitor. These data suggest that the recruitment of human BM-MSCs into the tumor microenvironment might cause OS and HCC cell migration and invasion through involvement of AQP1.
Orth, James D; Kohler, Rainer H; Foijer, Floris; Sorger, Peter K; Weissleder, Ralph; Mitchison, Timothy J
2011-07-01
Cancer relies upon frequent or abnormal cell division, but how the tumor microenvironment affects mitotic processes in vivo remains unclear, largely due to the technical challenges of optical access, spatial resolution, and motion. We developed high-resolution in vivo microscopy methods to visualize mitosis in a murine xenograft model of human cancer. Using these methods, we determined whether the single-cell response to the antimitotic drug paclitaxel (Ptx) was the same in tumors as in cell culture, observed the impact of Ptx on the tumor response as a whole, and evaluated the single-cell pharmacodynamics (PD) of Ptx (by in vivo PD microscopy). Mitotic initiation was generally less frequent in tumors than in cell culture, but subsequently it proceeded normally. Ptx treatment caused spindle assembly defects and mitotic arrest, followed by slippage from mitotic arrest, multinucleation, and apoptosis. Compared with cell culture, the peak mitotic index in tumors exposed to Ptx was lower and the tumor cells survived longer after mitotic arrest, becoming multinucleated rather than dying directly from mitotic arrest. Thus, the tumor microenvironment was much less proapoptotic than cell culture. The morphologies associated with mitotic arrest were dose and time dependent, thereby providing a semiquantitative, single-cell measure of PD. Although many tumor cells did not progress through Ptx-induced mitotic arrest, tumor significantly regressed in the model. Our findings show that in vivo microscopy offers a useful tool to visualize mitosis during tumor progression, drug responses, and cell fate at the single-cell level. ©2011 AACR.
Oncogenic Properties of Apoptotic Tumor Cells in Aggressive B Cell Lymphoma
Ford, Catriona A.; Petrova, Sofia; Pound, John D.; Voss, Jorine J.L.P.; Melville, Lynsey; Paterson, Margaret; Farnworth, Sarah L.; Gallimore, Awen M.; Cuff, Simone; Wheadon, Helen; Dobbin, Edwina; Ogden, Carol Anne; Dumitriu, Ingrid E.; Dunbar, Donald R.; Murray, Paul G.; Ruckerl, Dominik; Allen, Judith E.; Hume, David A.; van Rooijen, Nico; Goodlad, John R.; Freeman, Tom C.; Gregory, Christopher D.
2015-01-01
Summary Background Cells undergoing apoptosis are known to modulate their tissue microenvironments. By acting on phagocytes, notably macrophages, apoptotic cells inhibit immunological and inflammatory responses and promote trophic signaling pathways. Paradoxically, because of their potential to cause death of tumor cells and thereby militate against malignant disease progression, both apoptosis and tumor-associated macrophages (TAMs) are often associated with poor prognosis in cancer. We hypothesized that, in progression of malignant disease, constitutive loss of a fraction of the tumor cell population through apoptosis could yield tumor-promoting effects. Results Here, we demonstrate that apoptotic tumor cells promote coordinated tumor growth, angiogenesis, and accumulation of TAMs in aggressive B cell lymphomas. Through unbiased “in situ transcriptomics” analysis—gene expression profiling of laser-captured TAMs to establish their activation signature in situ—we show that these cells are activated to signal via multiple tumor-promoting reparatory, trophic, angiogenic, tissue remodeling, and anti-inflammatory pathways. Our results also suggest that apoptotic lymphoma cells help drive this signature. Furthermore, we demonstrate that, upon induction of apoptosis, lymphoma cells not only activate expression of the tumor-promoting matrix metalloproteinases MMP2 and MMP12 in macrophages but also express and process these MMPs directly. Finally, using a model of malignant melanoma, we show that the oncogenic potential of apoptotic tumor cells extends beyond lymphoma. Conclusions In addition to its profound tumor-suppressive role, apoptosis can potentiate cancer progression. These results have important implications for understanding the fundamental biology of cell death, its roles in malignant disease, and the broader consequences of apoptosis-inducing anti-cancer therapy. PMID:25702581
Srivastava, Shikha; Somasagara, Ranganatha R.; Hegde, Mahesh; Nishana, Mayilaadumveettil; Tadi, Satish Kumar; Srivastava, Mrinal; Choudhary, Bibha; Raghavan, Sathees C.
2016-01-01
Naturally occurring compounds are considered as attractive candidates for cancer treatment and prevention. Quercetin and ellagic acid are naturally occurring flavonoids abundantly seen in several fruits and vegetables. In the present study, we evaluate and compare antitumor efficacies of quercetin and ellagic acid in animal models and cancer cell lines in a comprehensive manner. We found that quercetin induced cytotoxicity in leukemic cells in a dose-dependent manner, while ellagic acid showed only limited toxicity. Besides leukemic cells, quercetin also induced cytotoxicity in breast cancer cells, however, its effect on normal cells was limited or none. Further, quercetin caused S phase arrest during cell cycle progression in tested cancer cells. Quercetin induced tumor regression in mice at a concentration 3-fold lower than ellagic acid. Importantly, administration of quercetin lead to ~5 fold increase in the life span in tumor bearing mice compared to that of untreated controls. Further, we found that quercetin interacts with DNA directly, and could be one of the mechanisms for inducing apoptosis in both, cancer cell lines and tumor tissues by activating the intrinsic pathway. Thus, our data suggests that quercetin can be further explored for its potential to be used in cancer therapeutics and combination therapy. PMID:27068577
Head and Neck Cancer Stem Cells: The Side Population
Tabor, Mark H.; Clay, Matthew R.; Owen, John H.; Bradford, Carol R.; Carey, Thomas E.; Wolf, Gregory T.; Prince, Mark E.P.
2014-01-01
Background The cancer stem cell (CSC) hypothesis concludes that a subpopulation of tumor cells can self-renew, causing tumor growth, treatment failure, and recurrence. Several tumor studies have identified cells able to efflux Hoechst 33342 dye; the side population (SP). SP cells and CSCs share many characteristics, suggesting the SP isolated from malignant tumors contains CSCs. Methods The SP was isolated from a head and neck cancer cell line and analyzed for CSC-like characteristics. Results The SP demonstrated the ability to reproduce both SP and non-side population (NSP) cells from as few as one cell. The SP had lower expression of active β-catenin and more resistance to 5-Fluorouracil; the SP also demonstrated greater expression of BMI-1 (4.3-fold) and ABCG2 (1.4-fold). SPs were identified in 2 primary human tumors. Conclusions The SP in head and neck cancer cell lines may serve as a valuable in-vitro model for CSCs leading to the development of novel treatment strategies. PMID:21344428
Benevides, Luciana; da Fonseca, Denise Morais; Donate, Paula Barbim; Tiezzi, Daniel Guimarães; De Carvalho, Daniel D; de Andrade, Jurandyr M; Martins, Gislaine A; Silva, João S
2015-09-15
The aggressiveness of invasive ductal carcinoma (IDC) of the breast is associated with increased IL17 levels. Studying the role of IL17 in invasive breast tumor pathogenesis, we found that metastatic primary tumor-infiltrating T lymphocytes produced elevated levels of IL17, whereas IL17 neutralization inhibited tumor growth and prevented the migration of neutrophils and tumor cells to secondary disease sites. Tumorigenic neutrophils promote disease progression, producing CXCL1, MMP9, VEGF, and TNFα, and their depletion suppressed tumor growth. IL17A also induced IL6 and CCL20 production in metastatic tumor cells, favoring the recruitment and differentiation of Th17. In addition, IL17A changed the gene-expression profile and the behavior of nonmetastatic tumor cells, causing tumor growth in vivo, confirming the protumor role of IL17. Furthermore, high IL17 expression was associated with lower disease-free survival and worse prognosis in IDC patients. Thus, IL17 blockade represents an attractive approach for the control of invasive breast tumors. ©2015 American Association for Cancer Research.
Lee, Hsueh-Te; Xue, Jianfei; Chou, Ping-Chieh; Zhou, Aidong; Yang, Phillip; Conrad, Charles A; Aldape, Kenneth D; Priebe, Waldemar; Patterson, Cam; Sawaya, Raymond; Xie, Keping; Huang, Suyun
2015-04-30
Brain metastasis is a major cause of morbidity and mortality in patients with breast cancer. Our previous studies indicated that Stat3 plays an important role in brain metastasis. Here, we present evidence that Stat3 functions at the level of the microenvironment of brain metastases. Stat3 controlled constitutive and inducible VEGFR2 expression in tumor-associated brain endothelial cells. Furthermore, inhibition of Stat3 by WP1066 decreased the incidence of brain metastases and increased survival in a preclinical model of breast cancer brain metastasis. WP1066 inhibited Stat3 activation in tumor-associated endothelial cells, reducing their infiltration and angiogenesis. WP1066 also inhibited breast cancer cell invasion. Our results indicate that WP1066 can inhibit tumor angiogenesis and brain metastasis mediated by Stat3 in endothelial and tumor cells.
Peng, Zheng; Liang, Wentao; Li, Zexue; Xu, Yingxin; Chen, Lin
2016-02-01
Gastric cancer is the second leading cause of cancer-related mortality worldwide. Adoptive cell therapy (ACT) for gastric cancer is a novel therapy modality. However, the therapeutic effectiveness in vivo is still limited. The objective of this study was to assess the value of interleukin-15 (IL-15)-transferred cytokine-induced killer (CIK) cells in ACT for gastric cancer. IL-15-IRES-TK retroviral vector was constructed and transferred into the CIK cells. A gastric tumor-bearing nude mice model was constructed by subcutaneously injecting gastric cancer cells, BGC-823. Gastric tumor-bearing nude mice were randomly divided into three groups (five mice each group) and injected with physiological saline, CIK cells, and IL-15-IRES-TK-transfected CIK cells for 2 weeks, respectively. IL-15-IRES-TK-transferred CIK cells were prepared successfully and flow cytometry (FCM) analysis indicated that the transfection rate reached 85.7% after 5 days culture. In vivo experiment, we found that CIK cells retarded tumor growth by reducing tumor volume and tumor weight, as well as increasing tumor inhibition rate. Furthermore, IL-15-IRES-TK-transferred CIK cells showed a much stronger inhibition on tumor growth than CIK cells alone. Tumor morphology observation and growth indexes also showed that IL-15-transfected CIK cells had stronger cytotoxicity to tumor tissue than CIK cells. IL-15-IRES-TK transfection could elevate the effects of CIK cells to gastric carcinoma. The engineered CIK cells carrying IL-15-IRES-TK may be used in the ACT for gastric carcinoma, but prudent clinical trial is still indispensable. © 2015 International Federation for Cell Biology.
Radiation Therapy Induces Macrophages to Suppress Immune Responses Against Pancreatic Tumors in Mice
Seifert, Lena; Werba, Gregor; Tiwari, Shaun; Ly, Nancy Ngoc Giao; Nguy, Susanna; Alothman, Sara; Alqunaibit, Dalia; Avanzi, Antonina; Daley, Donnele; Barilla, Rocky; Tippens, Daniel; Torres-Hernandez, Alejandro; Hundeyin, Mautin; Mani, Vishnu R.; Hajdu, Cristina; Pellicciotta, Ilenia; Oh, Philmo; Du, Kevin; Miller, George
2016-01-01
Background & Aims The role of radiation therapy in the treatment of patients with pancreatic ductal adenocarcinoma (PDA) is controversial. Randomized controlled trials investigating the efficacy of radiation therapy in patients with locally advanced unresectable PDA have reported mixed results, with effects ranging from modest benefit to worse outcome, compared with control therapies. We investigated whether radiation causes inflammatory cells to acquire an immune-suppressive phenotype that limits the therapeutic effects of radiation on invasive PDAs and accelerates progression of pre-invasive foci. Methods We investigated the effects of radiation in p48Cre;LSL-KrasG12D (KC) and p48Cre;LSLKrasG12D;LSL-Trp53R172H (KPC) mice, as well as in C57BL/6 mice with orthotopic tumors grown from FC1242 cells derived from KPC mice. Some mice were given neutralizing antibodies against macrophage colony stimulating factor 1 (CSF1 or MCSF) or F4/80. Pancreata were exposed to doses of radiation ranging from 2–12 Gy and analyzed by flow cytometry. Results Pancreata of KC mice exposed to radiation had a higher frequency of advanced pancreatic intraepithelial lesions and more foci of invasive cancer than pancreata of unexposed mice (controls); radiation reduced survival time by more than 6 months. A greater proportion of macrophages from invasive and pre-invasive pancreatic tumors had an immune-suppressive, M2-like phenotype, compared with control mice. Pancreata from mice exposed to radiation had fewer CD8+ T cells than controls and greater numbers of CD4+ T cells of T-helper 2 and T-regulatory cell phenotypes. Adoptive transfer of T cells from irradiated PDA to tumors of control mice accelerated tumor growth. Radiation induced production of MCSF by PDA cells. An antibody against MCSF prevented radiation from altering the phenotype of macrophages in tumors, increasing the anti-tumor T-cell response and slowing tumor growth. Conclusions Radiation exposure causes macrophages in PDAs of mice to acquire an immune-suppressive phenotype and reduce T-cell mediated anti-tumor responses. Agents that block MCSF prevent this effect, allowing radiation to have increased efficacy in slowing tumor growth. PMID:26946344
Genetic alterations and tumor immune attack in Yo paraneoplastic cerebellar degeneration.
Small, Mathilde; Treilleux, Isabelle; Couillault, Coline; Pissaloux, Daniel; Picard, Géraldine; Paindavoine, Sandrine; Attignon, Valery; Wang, Qing; Rogemond, Véronique; Lay, Stéphanie; Ray-Coquard, Isabelle; Pfisterer, Jacobus; Joly, Florence; Du Bois, Andreas; Psimaras, Dimitri; Bendriss-Vermare, Nathalie; Caux, Christophe; Dubois, Bertrand; Honnorat, Jérôme; Desestret, Virginie
2018-04-01
Paraneoplastic cerebellar degenerations with anti-Yo antibodies (Yo-PCD) are rare syndromes caused by an auto-immune response against neuronal antigens (Ags) expressed by tumor cells. However, the mechanisms responsible for such immune tolerance breakdown are unknown. We characterized 26 ovarian carcinomas associated with Yo-PCD for their tumor immune contexture and genetic status of the 2 onconeural Yo-Ags, CDR2 and CDR2L. Yo-PCD tumors differed from the 116 control tumors by more abundant T and B cells infiltration occasionally organized in tertiary lymphoid structures harboring CDR2L protein deposits. Immune cells are mainly in the vicinity of apoptotic tumor cells, revealing tumor immune attack. Moreover, contrary to un-selected ovarian carcinomas, 65% of our Yo-PCD tumors presented at least one somatic mutation in Yo-Ags, with a predominance of missense mutations. Recurrent gains of the CDR2L gene with tumor protein overexpression were also present in 59% of Yo-PCD patients. Overall, each Yo-PCD ovarian carcinomas carried at least one genetic alteration of Yo-Ags. These data demonstrate an association between massive infiltration of Yo-PCD tumors by activated immune effector cells and recurrent gains and/or mutations in autoantigen-encoding genes, suggesting that genetic alterations in tumor cells trigger immune tolerance breakdown and initiation of the auto-immune disease.
Mechanistic studies of systemic immune responses induced by laser-nanotechnology
NASA Astrophysics Data System (ADS)
Chen, Wei R.; Zhou, Feifan; Henderson, Brock; Vasquez, Bailey; Liu, Hong; Hode, Tomas; Nordquist, Robert E.
2014-02-01
With the help of the specific absorption spectrum of carbon nanotubes, we achieved selective photothermal tumor cell destruction, particularly using a near-infrared laser to reduce potential damage to untargeted tissues. Combined with immunological stimulation, using a novel adjuvant, we also observed the anti-tumor immune responses when treating animal tumors using the laser-nano treatment. In fact, the local application of laser-nano-immunotherapy appeared to result in a systemic curative effect. In our mechanistic study, we found that the laser-nano-immuno treatment can activate antigen-presenting cells, such as dendritic cells (DCs). More importantly, the uptake and presentation of antigens by these antigen presenting cells were significantly enhanced, as shown by the strong binding of tumor cells and DCs as well as the proliferation of T cells caused by the DCs after the DCs had been incubated with laser-nano-immuno treated tumors. These cellular observations provide evidence that a systemic anti-tumor immune response was induced by the combination of laser and nanotechnology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohapatra, Purusottam; Satapathy, Shakti Ranjan; Das, Dipon
Cigarette smoking is a key factor for the development and progression of different cancers including mammary tumor in women. Resveratrol (Res) is a promising natural chemotherapeutic agent that regulates many cellular targets including p21, a cip/kip family of cyclin kinase inhibitors involved in DNA damage-induced cell cycle arrest and blocking of DNA replication and repair. We have recently shown that cigarette smoke condensate (CSC) prepared from commercially available Indian cigarette can cause neoplastic transformation of normal breast epithelial MCF-10A cell. Here we studied the mechanism of Res mediated apoptosis in CSC transformed (MCF-10A-Tr) cells in vitro and in vivo. Resmore » mediated apoptosis in MCF-10A-Tr cells was a p21 dependent event. It increased the p21 protein expression in MCF-10A-Tr cells and MCF-10A-Tr cells-mediated tumors in xenograft mice. Res treatment reduced the tumor size(s) and expression of anti-apoptotic proteins (e.g. PI3K, AKT, NFκB) in solid tumor. The expressions of cell cycle regulatory (Cyclins, CDC-2, CDC-6, etc.), BER associated (Pol-β, Pol-δ, Pol-ε, Pol-η, RPA, Fen-1, DNA-Ligase-I, etc.) proteins and LP-BER activity decreased in MCF-10A-Tr cells but remain significantly unaltered in isogenic p21 null MCF-10A-Tr cells after Res treatment. Interestingly, no significant changes were noted in SP-BER activity in both the cell lines after Res exposure. Finally, it was observed that increased p21 blocks the LP-BER in MCF-10A-Tr cells by increasing its interaction with PCNA via competing with Fen-1 after Res treatment. Thus, Res caused apoptosis in CSC-induced cancer cells by reduction of LP-BER activity and this phenomenon largely depends on p21. - Highlights: • Resveratrol (Res) caused reduction of MCF-10A-Tr cell growth by inducing apoptosis. • Res caused cell cycle arrest and DNA damage in p21 dependent manner. • Res mediated LP-BER reduction in MCF-10A-Tr cells was a p21 dependent phenomenon. • Res inhibits BER and PI3K, AKT, and NFκB protein expressions in tumor and xenografts. • Res-induced-p21 inhibited DNA repair by modulating Fen-1 binding to PCNA complex.« less
Cuprous oxide nanoparticles selectively induce apoptosis of tumor cells
Wang, Ye; Zi, Xiao-Yuan; Su, Juan; Zhang, Hong-Xia; Zhang, Xin-Rong; Zhu, Hai-Ying; Li, Jian-Xiu; Yin, Meng; Yang, Feng; Hu, Yi-Ping
2012-01-01
In the rapid development of nanoscience and nanotechnology, many researchers have discovered that metal oxide nanoparticles have very useful pharmacological effects. Cuprous oxide nanoparticles (CONPs) can selectively induce apoptosis and suppress the proliferation of tumor cells, showing great potential as a clinical cancer therapy. Treatment with CONPs caused a G1/G0 cell cycle arrest in tumor cells. Furthermore, CONPs enclosed in vesicles entered, or were taken up by mitochondria, which damaged their membranes, thereby inducing apoptosis. CONPs can also produce reactive oxygen species (ROS) and initiate lipid peroxidation of the liposomal membrane, thereby regulating many signaling pathways and influencing the vital movements of cells. Our results demonstrate that CONPs have selective cytotoxicity towards tumor cells, and indicate that CONPs might be a potential nanomedicine for cancer therapy. PMID:22679374
A significant negative correlation between testicular interstitial cell tumors and pituitary tumors in control male F344 rats has been reported associated with the number of animals per cage. Change in numbers of animals per cage may cause stress and increased serum corticosteroi...
3D view to tumor suppression: Lkb1, polarity and the arrest of oncogenic c-Myc.
Partanen, Johanna I; Nieminen, Anni I; Klefstrom, Juha
2009-03-01
Machiavelli wrote, in his famous political treatise Il Principe, about disrupting organization by planting seeds of dissension or by eliminating necessary support elements. Tumor cells do exactly that by disrupting the organized architecture of epithelial cell layers during progression from contained benign tumor to full-blown invasive cancer. However, it is still unclear whether tumor cells primarily break free by activating oncogenes powerful enough to cause chaos or by eliminating tumor suppressor genes guarding the order of the epithelial organization. Studies in Drosophila have exposed genes that encode key regulators of the epithelial apicobasal polarity and which, upon inactivation, cause disorganization of the epithelial layers and promote unscheduled cell proliferation. These polarity regulator/tumor suppressor proteins, which include products of neoplastic tumor suppressor genes (nTSGs), are carefully positioned in polarized epithelial cells to maintain the order of epithelial structures and to impose a restraint on cell proliferation. In this review, we have explored the presence and prevalence of somatic mutations in the human counterparts of Drosophila polarity regulator/tumor suppressor genes across the human cancers. The screen points out LKB1, which is a causal genetic lesion in Peutz-Jeghers cancer syndrome, a gene mutated in certain sporadic cancers and a human homologue of the fly polarity gene par-4. We review the evidence linking Lkb1 protein to polarity regulation in the scope of our recent results suggesting a coupled role for Lkb1 as an architect of organized acinar structures and a suppressor of oncogenic c-Myc. We finally present models to explain how Lkb1-dependent formation of epithelial architecture is coupled to suppression of normal and oncogene-induced proliferation.
Weber, Martin R; Zuka, Masahiko; Lorger, Mihaela; Tschan, Mario; Torbett, Bruce E; Zijlstra, Andries; Quigley, James P; Staflin, Karin; Eliceiri, Brian P; Krueger, Joseph S; Marchese, Patrizia; Ruggeri, Zaverio M; Felding, Brunhilde H
2016-04-01
Metastasis is the main cause of death in cancer patients, and understanding mechanisms that control tumor cell dissemination may lead to improved therapy. Tumor cell adhesion receptors contribute to cancer spreading. We noted earlier that tumor cells can expressing the adhesion receptor integrin αvβ3 in distinct states of activation, and found that cells which metastasize from the blood stream express it in a constitutively high affinity form. Here, we analyzed steps of the metastatic cascade in vivo and asked, when and how the affinity state of integrin αvβ3 confers a critical advantage to cancer spreading. Following tumor cells by real time PCR, non-invasive bioluminescence imaging, intravital microscopy and histology allowed us to identify tumor cell extravasation from the blood stream as a rate-limiting step supported by high affinity αvβ3. Successful transendothelial migration depended on cooperation between tumor cells and platelets involving the high affinity tumor cell integrin and release of platelet granules. Thus, this study identifies the high affinity conformer of integrin αvβ3 and its interaction with platelets as critical for early steps during hematogenous metastasis and target for prevention of metastatic disease. © 2016 Elsevier Ltd. All rights reserved.
Weber, Martin R.; Zuka, Masahiko; Lorger, Mihaela; Tschan, Mario; Torbett, Bruce E.; Zijlstra, Andries; Quigley, James P.; Staflin, Karin; Eliceiri, Brian P.; Krueger, Joseph S.; Marchese, Patricia; Ruggeri, Zaverio M.; Felding, Brunhilde H.
2016-01-01
Metastasis is the main cause of death in cancer patients, and understanding mechanisms that control tumor cell dissemination may lead to improved therapy. Tumor cell adhesion receptors contribute to cancer spreading. We noted earlier that tumor cells can expressing the adhesion receptor integrin αvβ3 in distinct states of activation, and found that cells which metastasize from the blood stream express it in a constitutively high affinity form. Here, we analyzed steps of the metastatic cascade in vivo and asked, when and how the affinity state of integrin αvβ3 confers a critical advantage to cancer spreading. Following tumor cells by real time PCR, non-invasive bioluminescence imaging, intravital microscopy and histology allowed us to identify tumor cell extravasation from the blood stream as a rate-limiting step supported by high affinity αvβ3. Successful transendothelial migration depended on cooperation between tumor cells and platelets involving the high affinity tumor cell integrin and release of platelet granules. Thus, this study identifies the high affinity conformer of integrin αvβ3 and its interaction with platelets as critical for early steps during hematogenous metastasis and target for prevention of metastatic disease. PMID:27067975
A case of desmoid tumor co-existing with recurrent squamous cell carcinoma in the larynx.
Shinohara, Shogo; Suehiro, Atsushi; Kikuchi, Masahiro; Harada, Hiroyuki; Kishimoto, Ippei; Imai, Yukihiro
2017-06-01
Extra-abdominal desmoid tumor, also known as aggressive fibromatosis, has aggressive behavior with local infiltration and tendency for recurrence. Though head and neck is reported to be one of the most common sites, a desmoid tumor in the larynx is extremely rare. A 67-year-old male visited our hospital with prolonged hoarseness and received laryngo-microsurgery with the diagnosis of laryngeal polyp. After the operation, he eventually developed a laryngeal squamous cell carcinoma with papilloma, confirmed by second laryngo-microsurgery and received radiation therapy. After the third laryngo-microsurgery to remove residual papilloma, white irregular mass appeared on the right vocal cord and grew rapidly beneath the glottis, causing dyspnea. After 2 additional laryngo-microsurgeries, he was diagnosed having the dermoid tumor co-existing with recurrent squamous cell carcinoma. He underwent near-total laryngectomy and is currently alive without disease, speaking using a vocal shunt. Only five cases of the desmoid tumors arising in the adult larynx have been reported in the English literature. In this case, repeated surgery and radiation were suspected as the causes. Also, the present report is the first to describe desmoid tumor co-existing with recurrent squamous cell carcinoma in the larynx. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Schiessel, Dalton Luiz; Yamazaki, Ricardo K; Kryczyk, Marcelo; Coelho de Castro, Isabela; Yamaguchi, Adriana A; Pequito, Danielle C T; Brito, Gleisson A P; Borghetti, Gina; Aikawa, Júlia; Nunes, Everson A; Naliwaiko, Kátia; Fernandes, Luiz C
2016-01-01
Polyunsaturated fatty acids n-3 (PUFA n-3) have shown effects in reducing tumor growth, in particular eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) abundantly present in fish oil (FO). When these fatty acids are provided in the diet, they alter the functions of the cells, particularly in tumor and immune cells. However, the effects of α-linolenic fatty acid (ALA), which is the precursor of EPA and DHA, are controversial. Thus, our objective was to test the effect of this parental fatty acid. Non-tumor-bearing and tumor-bearing Wistar rats (70 days) were supplemented with 1 g/kg body weight of FO or Oro Inca® (OI) oil (rich in ALA). Immune cells function, proliferation, cytokine production, and subpopulation profile were evaluated. We have shown that innate immune cells enhanced phagocytosis capacity, and increased processing and elimination of antigens. Moreover, there was a decrease in production of pro-inflammatory cytokines (tumor necrosis factor-alpha (TNF-α) and interleukin 6 (IL-6)) by macrophages. Lymphocytes showed decreased proliferation capacity, increased cluster of differentiation 8 (CD8 + ) subpopulation, and increased TNF-α production. Oil rich in ALA caused similar immune modulation in cancer when compared with FO.
Drug-targeting strategies in cancer therapy.
Huang, P S; Oliff, A
2001-02-01
Genetic changes in cell-cycle, apoptotic, and survival pathways cause tumorigenesis, leading to significant phenotypic changes in transformed cells. These changes in the tumor environment - elevated expression of surface proteases, increased angiogenesis and glucuronidase activity - can be taken advantage of to improve the therapeutic index of existing cancer therapies. Targeting cytotoxics to tumor cells by enzymatic activation is a promising strategy for improving chemotherapeutics.
Mps1 kinase regulates tumor cell viability via its novel role in mitochondria
Zhang, X; Ling, Y; Guo, Y; Bai, Y; Shi, X; Gong, F; Tan, P; Zhang, Y; Wei, C; He, X; Ramirez, A; Liu, X; Cao, C; Zhong, H; Xu, Q; Ma, R Z
2016-01-01
Targeting mitotic kinase monopolar spindle 1 (Mps1) for tumor therapy has been investigated for many years. Although it was suggested that Mps1 regulates cell viability through its role in spindle assembly checkpoint (SAC), the underlying mechanism remains less defined. In an endeavor to reveal the role of high levels of mitotic kinase Mps1 in the development of colon cancer, we unexpectedly found the amount of Mps1 required for cell survival far exceeds that of maintaining SAC in aneuploid cell lines. This suggests that other functions of Mps1 besides SAC are also employed to maintain cell viability. Mps1 regulates cell viability independent of its role in cytokinesis as the genetic depletion of Mps1 spanning from metaphase to cytokinesis affects neither cytokinesis nor cell viability. Furthermore, we developed a single-cycle inhibition strategy that allows disruption of Mps1 function only in mitosis. Using this strategy, we found the functions of Mps1 in mitosis are vital for cell viability as short-term treatment of mitotic colon cancer cell lines with Mps1 inhibitors is sufficient to cause cell death. Interestingly, Mps1 inhibitors synergize with microtubule depolymerizing drug in promoting polyploidization but not in tumor cell growth inhibition. Finally, we found that Mps1 can be recruited to mitochondria by binding to voltage-dependent anion channel 1 (VDAC1) via its C-terminal fragment. This interaction is essential for cell viability as Mps1 mutant defective for interaction fails to main cell viability, causing the release of cytochrome c. Meanwhile, deprivation of VDAC1 can make tumor cells refractory to loss of Mps1-induced cell death. Collectively, we conclude that inhibition of the novel mitochondrial function Mps1 is sufficient to kill tumor cells. PMID:27383047
Mps1 kinase regulates tumor cell viability via its novel role in mitochondria.
Zhang, X; Ling, Y; Guo, Y; Bai, Y; Shi, X; Gong, F; Tan, P; Zhang, Y; Wei, C; He, X; Ramirez, A; Liu, X; Cao, C; Zhong, H; Xu, Q; Ma, R Z
2016-07-07
Targeting mitotic kinase monopolar spindle 1 (Mps1) for tumor therapy has been investigated for many years. Although it was suggested that Mps1 regulates cell viability through its role in spindle assembly checkpoint (SAC), the underlying mechanism remains less defined. In an endeavor to reveal the role of high levels of mitotic kinase Mps1 in the development of colon cancer, we unexpectedly found the amount of Mps1 required for cell survival far exceeds that of maintaining SAC in aneuploid cell lines. This suggests that other functions of Mps1 besides SAC are also employed to maintain cell viability. Mps1 regulates cell viability independent of its role in cytokinesis as the genetic depletion of Mps1 spanning from metaphase to cytokinesis affects neither cytokinesis nor cell viability. Furthermore, we developed a single-cycle inhibition strategy that allows disruption of Mps1 function only in mitosis. Using this strategy, we found the functions of Mps1 in mitosis are vital for cell viability as short-term treatment of mitotic colon cancer cell lines with Mps1 inhibitors is sufficient to cause cell death. Interestingly, Mps1 inhibitors synergize with microtubule depolymerizing drug in promoting polyploidization but not in tumor cell growth inhibition. Finally, we found that Mps1 can be recruited to mitochondria by binding to voltage-dependent anion channel 1 (VDAC1) via its C-terminal fragment. This interaction is essential for cell viability as Mps1 mutant defective for interaction fails to main cell viability, causing the release of cytochrome c. Meanwhile, deprivation of VDAC1 can make tumor cells refractory to loss of Mps1-induced cell death. Collectively, we conclude that inhibition of the novel mitochondrial function Mps1 is sufficient to kill tumor cells.
Carbon Ion Irradiation Inhibits Glioma Cell Migration Through Downregulation of Integrin Expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rieken, Stefan, E-mail: Stefan.Rieken@med.uni-heidelberg.de; Habermehl, Daniel; Wuerth, Lena
2012-05-01
Purpose: To investigate the effect of carbon ion irradiation on glioma cell migration. Methods and Materials: U87 and Ln229 glioma cells were irradiated with photons and carbon ions. Migration was analyzed 24 h after irradiation. Fluorescence-activated cell sorting analysis was performed in order to quantify surface expression of integrins. Results: Single photon doses of 2 Gy and 10 Gy enhanced {alpha}{sub {nu}}{beta}{sub 3} and {alpha}{sub {nu}}{beta}{sub 5} integrin expression and caused tumor cell hypermigration on both vitronectin (Vn) and fibronectin (Fn). Compared to integrin expression in unirradiated cells, carbon ion irradiation caused decreased integrin expression and inhibited cell migration onmore » both Vn and Fn. Conclusion: Photon radiotherapy (RT) enhances the risk of tumor cell migration and subsequently promotes locoregional spread via photon induction of integrin expression. In contrast to photon RT, carbon ion RT causes decreased integrin expression and suppresses glioma cell migration on both Vn and Fn, thus promising improved local control.« less
Lang, Patrick Y; Gershon, Timothy R
2018-05-01
New targets for brain tumor therapies may be identified by mutations that cause hereditary microcephaly. Brain growth depends on the repeated proliferation of stem and progenitor cells. Microcephaly syndromes result from mutations that specifically impair the ability of brain progenitor or stem cells to proliferate, by inducing either premature differentiation or apoptosis. Brain tumors that derive from brain progenitor or stem cells may share many of the specific requirements of their cells of origin. These tumors may therefore be susceptible to disruptions of the protein products of genes that are mutated in microcephaly. The potential for the products of microcephaly genes to be therapeutic targets in brain tumors are highlighted hereby reviewing research on EG5, KIF14, ASPM, CDK6, and ATR. Treatments that disrupt these proteins may open new avenues for brain tumor therapy that have increased efficacy and decreased toxicity. © 2018 WILEY Periodicals, Inc.
Silva, Jesús G; Cárdenas, Rey A; Quiróz, Alan R; Sánchez, Virginia; Lozano, Lucila M; Pérez, Nadia M; López, Jaime; Villanueva, Cleva; González, César A
2014-06-01
Breast cancer (BC) is the leading cause of cancer death in women worldwide, with a higher mortality reported in undeveloped countries. Ideal adjuvant therapeutic strategies require the continuous monitoring of patients by regular blood tests to detect circulating cancer cells, in order to determine whether additional treatment is necessary to prevent cancer dissemination. This circumstance requires a non-complex design of tumor cell biosensor in whole blood with feasibility for use in poor regions. In this work we have evaluated an inexpensive and simple technique of relative bioimpedance measurement, assisted by magnetic nanoparticles, as a potential biosensor of BC cells in suspension. Measurements represent the relative impedance changes caused by the magnetic holding of an interphase of tumor cells versus a homogenous condition in the frequency range of 10-100 kHz. The results indicate that use of a magnet to separate tumor cells in suspension, coupled to magnetic nanoparticles, is a feasible technique to fix an interphase of tumor cells in close proximity to gold electrodes. Relative impedance changes were shown to have potential value as a biosensor method for BC cells in whole blood, at frequencies around 20 kHz. Additional studies are warranted with respect to electrode design and sensitivity at micro-scale levels, according to the proposed technique.
The effect of environmental chemicals on the tumor microenvironment
Casey, Stephanie C.; Vaccari, Monica; Al-Mulla, Fahd; Al-Temaimi, Rabeah; Amedei, Amedeo; Barcellos-Hoff, Mary Helen; Brown, Dustin G.; Chapellier, Marion; Christopher, Joseph; Curran, Colleen S.; Forte, Stefano; Hamid, Roslida A.; Heneberg, Petr; Koch, Daniel C.; Krishnakumar, P.K.; Laconi, Ezio; Maguer-Satta, Veronique; Marongiu, Fabio; Memeo, Lorenzo; Mondello, Chiara; Raju, Jayadev; Roman, Jesse; Roy, Rabindra; Ryan, Elizabeth P.; Ryeom, Sandra; Salem, Hosni K.; Scovassi, A.Ivana; Singh, Neetu; Soucek, Laura; Vermeulen, Louis; Whitfield, Jonathan R.; Woodrick, Jordan; Colacci, Anna Maria; Bisson, William H.; Felsher, Dean W.
2015-01-01
Potentially carcinogenic compounds may cause cancer through direct DNA damage or through indirect cellular or physiological effects. To study possible carcinogens, the fields of endocrinology, genetics, epigenetics, medicine, environmental health, toxicology, pharmacology and oncology must be considered. Disruptive chemicals may also contribute to multiple stages of tumor development through effects on the tumor microenvironment. In turn, the tumor microenvironment consists of a complex interaction among blood vessels that feed the tumor, the extracellular matrix that provides structural and biochemical support, signaling molecules that send messages and soluble factors such as cytokines. The tumor microenvironment also consists of many host cellular effectors including multipotent stromal cells/mesenchymal stem cells, fibroblasts, endothelial cell precursors, antigen-presenting cells, lymphocytes and innate immune cells. Carcinogens can influence the tumor microenvironment through effects on epithelial cells, the most common origin of cancer, as well as on stromal cells, extracellular matrix components and immune cells. Here, we review how environmental exposures can perturb the tumor microenvironment. We suggest a role for disrupting chemicals such as nickel chloride, Bisphenol A, butyltins, methylmercury and paraquat as well as more traditional carcinogens, such as radiation, and pharmaceuticals, such as diabetes medications, in the disruption of the tumor microenvironment. Further studies interrogating the role of chemicals and their mixtures in dose-dependent effects on the tumor microenvironment could have important general mechanistic implications for the etiology and prevention of tumorigenesis. PMID:26106136
Cancer Stem Cells and Molecular Biology Test in Colorectal Cancer: Therapeutic Implications.
Effendi-Ys, Rustam
2017-10-01
Colorectal cancer (CRC) is the third most frequent cancer in males, the second in females, and is the second leading cause of cancer related death worldwide. Within Indonesia's 250 million population, the incidence rates for CRC per 100,000 population were 15.2 for males and 10.2 for females, and estimated 63,500 cases per year. More than 50% of colorectal cancer patients will develop metastasis. CRC is still the main cause of tumor-related death, and although most CRC patients are treated with surgery to remove the tumor tissue, some of the CRC patients recurred. Chemotherapy used as adjuvant or neoadjuvant therapy also has several problems, in which these treatments are useless in tumor cells with chemo-resistance. Molecular testing of CRC from tumor tissues has important implications for the selection of treatment. Biomarkers can be used as prognostic value, molecular predictive factors, and targeted therapy. Recent research reported that, cancer stem cells (CSCs) are considered as the origin of tumorigenesis, development, metastasis and recurrence. At present, it has been shown that CSCs existed in many tumors including CRC. This review aims to summarize the issue on CSCs, and the future development of drugs that target colorectal cancer stem cells.
Targeting MDM2 for Treatment of Adenoid Cystic Carcinoma
Warner, Kristy A.; Nör, Felipe; Acasigua, Gerson A.; Martins, Manoela D.; Zhang, Zhaocheng; McLean, Scott A.; Spector, Matthew E.; Chepeha, Douglas B.; Helman, Joseph; Wick, Michael J.; Moskaluk, Christopher A.; Castilho, Rogerio M.; Pearson, Alexander T.; Wang, Shaomeng; Nör, Jacques E.
2016-01-01
Purpose There are no effective treatment options for patients with advanced adenoid cystic carcinoma (ACC). Here, we evaluated the effect of a new small molecule inhibitor of the MDM2-p53 interaction (MI-773) in preclinical models of ACC. Experimental Design To evaluate the anti-tumor effect of MI-773, we administered it to mice harboring 3 different patient-derived xenograft (PDX) models of ACC expressing functional p53. The effect of MI-773 on MDM2, p53, phospho-p53 and p21 was examined by Western blots in 5 low passage primary human ACC cell lines and in MI-773-treated PDX tumors. Results Single agent MI-773 caused tumor regression in the 3 PDX models of ACC studied here. For example, we observed a tumor growth inhibition (TGI) index of 127% in UM-PDX-HACC-5 tumors that was associated with an increase in the fraction of apoptotic cells (p=0.015). The number of p53-positive cells was increased in MI-773-treated PDX tumors (p<0.001), with a correspondent shift in p53 localization from the nucleus to the cytoplasm. Western blots demonstrated that MI-773 potently induced expression of p53 and its downstream targets p21, MDM2 and induced phosphorylation of p53 (serine 392) in low passage primary human ACC cells. Notably, MI-773 induced a dose-dependent increase in the fraction of apoptotic ACC cells and in the fraction of cells in the G1 phase of cell cycle (p<0.05). Conclusions Collectively, these data demonstrate that therapeutic inhibition of the MDM2-p53 interaction with MI-773 activates downstream effectors of apoptosis and causes robust tumor regression in preclinical models of adenoid cystic carcinoma. PMID:26936915
Casey, Ruth T; Warren, Anne Y; Martin, Jose Ezequiel; Challis, Benjamin G; Rattenberry, Eleanor; Whitworth, James; Andrews, Katrina A; Roberts, Thomas; Clark, Graeme R; West, Hannah; Smith, Philip S; Docquier, France M; Rodger, Fay; Murray, Vicki; Simpson, Helen L; Wallis, Yvonne; Giger, Olivier; Tran, Maxine; Tomkins, Susan; Stewart, Grant D; Park, Soo-Mi; Woodward, Emma R; Maher, Eamonn R
2017-11-01
The co-occurrence of pheochromocytoma (PC) and renal tumors was linked to the inherited familial cancer syndrome von Hippel-Lindau (VHL) disease more than six decades ago. Subsequently, other shared genetic causes of predisposition to renal tumors and to PC, paraganglioma (PGL), or head and neck paraganglioma (HNPGL) have been described, but case series of non-VHL-related cases of renal tumor and pheochromocytoma/paraganglioma tumor association syndrome (RAPTAS) are rare. To determine the clinical and molecular features of non-VHL RAPTAS by literature review and characterization of a case series. A review of the literature was performed and a retrospective study of referrals for investigation of genetic causes of RAPTAS. Literature review revealed evidence of an association, in addition to VHL disease, between germline mutations in SDHB, SDHC, SDHD, TMEM127, and MAX genes and RAPTAS [defined here as the co-occurrence of tumors from both classes (PC/PGL/HNPGL and renal tumors) in the same individual or in first-degree relatives]. In both the literature review and our case series of 22 probands with non-VHL RAPTAS, SDHB mutations were the most frequent cause of non-VHL RAPTAS. A genetic cause was identified in 36.3% (8/22) of kindreds. Renal tumors and PC/PGL/HNPGL tumors share common molecular features and their co-occurrence in an individual or family should prompt genetic investigations. We report a case of MAX-associated renal cell carcinoma and confirm the role of TMEM127 mutations with renal cell carcinoma predisposition. Copyright © 2017 Endocrine Society
Podolsky, Michael A; Bailey, Jacob T; Gunderson, Andrew J; Oakes, Carrie J; Breech, Kyle; Glick, Adam B
2017-03-01
Heterogeneity in tumor immune responses is a poorly understood yet critical parameter for successful immunotherapy. In two doxycycline-inducible models where oncogenic H-Ras G12V is targeted either to the epidermal basal/stem cell layer with a Keratin14-rtTA transgene (K14Ras), or committed progenitor/suprabasal cells with an Involucrin-tTA transgene (InvRas), we observed strikingly distinct tumor immune responses. On threshold doxycycline levels yielding similar Ras expression, tumor latency, and numbers, tumors from K14Ras mice had an immunosuppressed microenvironment, whereas InvRas tumors had a proinflammatory microenvironment. On a Rag1 -/- background, InvRas mice developed fewer and smaller tumors that regressed over time, whereas K14Ras mice developed more tumors with shorter latency than Rag1 +/+ controls. Adoptive transfer and depletion studies revealed that B-cell and CD4 T-cell cooperation was critical for tumor yield, lymphocyte polarization, and tumor immune phenotype in Rag1 +/+ mice of both models. Coculture of tumor-conditioned B cells with CD4 T cells implicated direct contact for Th1 and regulatory T cell (Treg) polarization, and CD40-CD40L for Th1, Th2, and Treg generation, a response not observed from splenic B cells. Anti-CD40L caused regression of InvRas tumors but enhanced growth in K14Ras, whereas a CD40 agonist mAb had opposite effects in each tumor model. These data show that position of tumor-initiating cells within a stratified squamous epithelial tissue provokes distinct B- and CD4 T-cell interactions, which establish unique tumor microenvironments that regulate tumor development and response to immunotherapy. Cancer Immunol Res; 5(3); 198-210. ©2017 AACR . ©2017 American Association for Cancer Research.
Neuroglian stabilizes epithelial structure during Drosophila oogenesis.
Wei, Jun; Hortsch, Michael; Goode, Scott
2004-08-01
The vertebrate L1 family of cell adhesion molecules (CAMs) and their fly homolog, Neuroglian, are members of the immunoglobulin (Ig) superfamily of CAMs. In general, Ig CAMs have been found to play critical roles in mediating axon guidance. One Ig CAM, NCAM, has also been implicated in maintaining epithelial integrity and suppressing metastatic dissemination of tumor cells. Other Ig CAMs, such as Nrg, are also expressed in epithelia. We thus tested the hypothesis that, like NCAM, Nrg might also be required for maintaining epithelial integrity and for inhibiting tumor invasion. We used the Drosophila follicular epithelium to determine the function of Nrg in vivo in maintaining epithelial structure, and in regulating the motility of migrating border cells and invasive tumorous follicle cells. Nrg(167) is expressed on the lateral membrane of follicle cells. Loss of Nrg(167) causes border cells to delay delamination and causes other follicle cells to delaminate inappropriately. The delaminated cells have aberrant epithelial polarity manifested as severe mislocalization of apical and basal membrane proteins, and uniform localization of lateral membrane proteins. Furthermore, loss of Nrg(167) dramatically enhances the invasive phenotype associated with loss of Discs Large, a neoplastic tumor suppressor. These results indicate that Nrg(167) stabilizes epithelial polarity by regulating junctional adhesion and function in normal and tumorous epithelia. Our data also suggest that Ig superfamily members have significant functional redundancy in maintaining epithelial polarity, with individual members playing subtle, unique roles during epithelial morphogenesis. Copyright 2004 Wiley-Liss, Inc.
Stopping Liver Cancer's Rogue COP | Center for Cancer Research
Liver cancer is the fourth most common cancer type and the third leading cause of cancer death worldwide. Many liver tumors are actually metastases, tumors seeded in the liver by cancer cells from another organ, but hepatocellular carcinomas (HCCs), the most common liver tumors, are a heterogeneous family of cancers that arise in hepatocytes, the functional cells of the liver. HCCs are often associated with cirrhosis or liver scarring. Because of the variation in tumor phenotypes, the poor understanding of the molecular origins of these tumors, and the increasing number of diagnoses especially in the US, HCC is a major clinical challenge.
Gao, Yang; Vincent, David F.; Davis, Anna Jane; Sansom, Owen J.; Bartholin, Laurent; Li, Qinglei
2016-01-01
Despite the well-established tumor suppressive role of TGFβ proteins, depletion of key TGFβ signaling components in the mouse ovary does not induce a growth advantage. To define the role of TGFβ signaling in ovarian tumorigenesis, we created a mouse model expressing a constitutively active TGFβ receptor 1 (TGFBR1) in ovarian somatic cells using conditional gain-of-function approach. Remarkably, these mice developed ovarian sex cord-stromal tumors with complete penetrance, leading to reproductive failure and mortality. The tumors expressed multiple granulosa cell markers and caused elevated serum inhibin and estradiol levels, reminiscent of granulosa cell tumors. Consistent with the tumorigenic effect, overactivation of TGFBR1 altered tumor microenvironment by promoting angiogenesis and enhanced ovarian cell proliferation, accompanied by impaired cell differentiation and dysregulated expression of critical genes in ovarian function. By further exploiting complementary genetic models, we substantiated our finding that constitutively active TGFBR1 is a potent oncogenic switch in mouse granulosa cells. In summary, overactivation of TGFBR1 drives gonadal tumor development. The TGFBR1 constitutively active mouse model phenocopies a number of morphological, hormonal, and molecular features of human granulosa cell tumors and are potentially valuable for preclinical testing of targeted therapies to treat granulosa cell tumors, a class of poorly defined ovarian malignancies. PMID:27344183
Oncogenic properties of apoptotic tumor cells in aggressive B cell lymphoma.
Ford, Catriona A; Petrova, Sofia; Pound, John D; Voss, Jorine J L P; Melville, Lynsey; Paterson, Margaret; Farnworth, Sarah L; Gallimore, Awen M; Cuff, Simone; Wheadon, Helen; Dobbin, Edwina; Ogden, Carol Anne; Dumitriu, Ingrid E; Dunbar, Donald R; Murray, Paul G; Ruckerl, Dominik; Allen, Judith E; Hume, David A; van Rooijen, Nico; Goodlad, John R; Freeman, Tom C; Gregory, Christopher D
2015-03-02
Cells undergoing apoptosis are known to modulate their tissue microenvironments. By acting on phagocytes, notably macrophages, apoptotic cells inhibit immunological and inflammatory responses and promote trophic signaling pathways. Paradoxically, because of their potential to cause death of tumor cells and thereby militate against malignant disease progression, both apoptosis and tumor-associated macrophages (TAMs) are often associated with poor prognosis in cancer. We hypothesized that, in progression of malignant disease, constitutive loss of a fraction of the tumor cell population through apoptosis could yield tumor-promoting effects. Here, we demonstrate that apoptotic tumor cells promote coordinated tumor growth, angiogenesis, and accumulation of TAMs in aggressive B cell lymphomas. Through unbiased "in situ transcriptomics" analysis-gene expression profiling of laser-captured TAMs to establish their activation signature in situ-we show that these cells are activated to signal via multiple tumor-promoting reparatory, trophic, angiogenic, tissue remodeling, and anti-inflammatory pathways. Our results also suggest that apoptotic lymphoma cells help drive this signature. Furthermore, we demonstrate that, upon induction of apoptosis, lymphoma cells not only activate expression of the tumor-promoting matrix metalloproteinases MMP2 and MMP12 in macrophages but also express and process these MMPs directly. Finally, using a model of malignant melanoma, we show that the oncogenic potential of apoptotic tumor cells extends beyond lymphoma. In addition to its profound tumor-suppressive role, apoptosis can potentiate cancer progression. These results have important implications for understanding the fundamental biology of cell death, its roles in malignant disease, and the broader consequences of apoptosis-inducing anti-cancer therapy. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
APSA Awardee Submission: Tumor/cancer stem cell marker doublecortin-like kinase 1 in liver diseases.
Nguyen, Charles B; Houchen, Courtney W; Ali, Naushad
2017-02-01
Liver diseases are the fourth leading cause of mortality among adults in the United States. Patients with chronic liver diseases such as viral hepatitis, fibrosis, and cirrhosis have significantly higher risks of developing hepatocellular carcinoma (HCC). With a dismal five-year survival rate of 11%, HCC is the third most common cause of cancer-related deaths worldwide. Regardless of the underlying cause, late presentation and a lack of effective therapy are the major impediments for successful treatment of HCC. Therefore, there is a considerable interest in developing new strategies for the prevention and treatment of chronic liver diseases at the early stages. Cancer stem cells (CSCs), a small cell subpopulation in a tumor, exhibit unlimited self-renewal and differentiation capacity. These cells are believed to play pivotal roles in the initiation, growth, metastasis, and drug-resistance of tumors. In this review, we will briefly discuss pivotal roles of the CSC marker doublecortin-like kinase 1 (DCLK1) in hepatic tumorigenesis. Recent evidence suggests that anti-DCLK1 strategies hold promising clinical potential for the treatment of cancers of the liver, pancreas, and colon.
Chacon, Jessica Ann; Schutsky, Keith; Powell, Daniel J
2016-11-14
Genomic destabilizers, such as radiation and chemotherapy, and epigenetic modifiers are used for the treatment of cancer due to their apoptotic effects on the aberrant cells. However, these therapies may also induce widespread changes within the immune system and cancer cells, which may enable tumors to avoid immune surveillance and escape from host anti-tumor immunity. Genomic destabilizers can induce immunogenic death of tumor cells, but also induce upregulation of immune inhibitory ligands on drug-resistant cells, resulting in tumor progression. While administration of immunomodulatory antibodies that block the interactions between inhibitory receptors on immune cells and their ligands on tumor cells can mediate cancer regression in a subset of treated patients, it is crucial to understand how genomic destabilizers alter the immune system and malignant cells, including which inhibitory molecules, receptors and/or ligands are upregulated in response to genotoxic stress. Knowledge gained in this area will aid in the rational design of trials that combine genomic destabilizers, epigenetic modifiers and immunotherapeutic agents that may be synergized to improve clinical responses and prevent tumor escape from the immune system. Our review article describes the impact genomic destabilizers, such as radiation and chemotherapy, and epigenetic modifiers have on anti-tumor immunity and the tumor microenvironment. Although genomic destabilizers cause DNA damage on cancer cells, these therapies can also have diverse effects on the immune system, promote immunogenic cell death or survival and alter the cancer cell expression of immune inhibitor molecules.
Sim, Chan Kyu; Cho, Yeon Sook; Kim, Byung Soo; Baek, In-Jeoung; Kim, Young-Joon; Lee, Myeong Sup
2016-06-01
Type I interferon (IFN-I) plays a critical role in antiviral and antitumor defense. In our previous studies, we showed that IFN-I-inducible 2'-5' oligoadenylate synthetase-like 1 (OASL1) negatively regulates IFN-I production upon viral infection by specifically inhibiting translation of the IFN-I-regulating master transcription factor, interferon regulatory factor 7 (IRF7). In this study, we investigated whether OASL1 plays a negative role in the anti-tumor immune response by using OASL1-deficient (Oasl1 (-/-)) mice and transplantable syngeneic tumor cell models. We found that Oasl1 (-/-) mice demonstrate enhanced resistance to lung metastatic tumors and subcutaneously implanted tumors compared to wild-type (WT) mice. Additionally, we found that cytotoxic effector cells such as CD8(+) T cells (including tumor antigen-specific CD8(+) T cells) and NK cells as well as CD8α(+) DCs (the major antigen cross-presenting cells) were much more frequent (>fivefold) in the Oasl1 (-/-) mouse tumors. Furthermore, the cytotoxic effector cells in Oasl1 (-/-) mouse tumors seemed to be more functionally active. However, the proportion of immunosuppressive myeloid-derived suppressor cells within hematopoietic cells and of regulatory T cells within CD4(+) T cells in Oasl1 (-/-) mouse tumors did not differ significantly from that of WT mice. Tumor-challenged Oasl1 (-/-) mice expressed increased levels of IFN-I and IRF7 protein in the growing tumor, indicating that the enhanced antitumor immune response observed in Oasl1 (-/-) mice was caused by higher IFN-I production in Oasl1 (-/-) mice. Collectively, these results show that OASL1 deficiency promotes the antitumor immune response, and thus, OASL1 could be a good therapeutic target for treating tumors.
Agrawal, Vijayendra; Maharjan, Sony; Kim, Kyeojin; Kim, Nam-Jung; Son, Jimin; Lee, Keunho; Choi, Hyun-Jung; Rho, Seung-Sik; Ahn, Sunjoo; Won, Moo-Ho; Ha, Sang-Jun; Koh, Gou Young; Kim, Young-Myeong; Suh, Young-Ger; Kwon, Young-Guen
2014-01-01
Tumor blood vessels are leaky and immature, which causes inadequate blood supply to tumor tissues resulting in hypoxic microenvironment and promotes metastasis. Here we have explored tumor vessel modulating activity of Sac-1004, a recently developed molecule in our lab, which directly potentiates VE-cadherin-mediated endothelial cell junction. Sac-1004 could enhance vascular junction integrity in tumor vessels and thereby inhibit vascular leakage and enhance vascular perfusion. Improved perfusion enabled Sac-1004 to have synergistic anti-tumor effect on cisplatin-mediated apoptosis of tumor cells. Interestingly, characteristics of normalized blood vessels namely reduced hypoxia, improved pericyte coverage and decreased basement membrane thickness were readily observed in tumors treated with Sac-1004. Remarkably, Sac-1004 was also able to inhibit lung and lymph node metastasis in MMTV and B16BL6 tumor models. This was in correlation with a reduction in epithelial-to-mesenchymal transition of tumor cells with considerable diminution in expression of related transcription factors. Moreover, cancer stem cell population dropped substantially in Sac-1004 treated tumor tissues. Taken together, our results showed that direct restoration of vascular junction could be a significant strategy to induce normalization of tumor blood vessels and reduce metastasis. PMID:24811731
A Murine Xenograft Model for Human CD30+ Anaplastic Large Cell Lymphoma
Pfeifer, Walther; Levi, Edi; Petrogiannis-Haliotis, Tina; Lehmann, Leslie; Wang, Zhenxi; Kadin, Marshall E.
1999-01-01
To develop a model for the biology and treatment of CD30+ anaplastic large cell lymphoma (ALCL), we transplanted leukemic tumor cells from a 22-month-old girl with multiple relapsed ALCL. Tumor cells were inoculated intraperitoneally into a 4-week-old SCID/bg mouse and produced a disseminated tumor within 8 weeks; this tumor was serially transplanted by subcutaneous injections to other mice. Morphology, immunohistochemistry, and molecular genetics which demonstrated the NPM-ALK fusion protein, resulting from the t(2;5)(p23;q35), confirmed the identity of the xenograft with the original tumor. The tumor produced transcripts for interleukin-1α, tumor necrosis factor-α, and interferon-γ which could explain the patient’s B-symptoms. Treatment of mice with monoclonal antibody (HeFi-1) which activates CD30 antigen administered on day 1 after tumor transplantation prevented tumor growth. Treatment with HeFi-1 after tumors had reached a 0.2 cm3 volume caused tumor growth arrest and prevention of tumor dissemination. We conclude that transplantation of CD30+ ALCL to SCID/bg mice may provide a valuable model for the study of the biology and design of treatment modalities for CD30+ ALCL. PMID:10514417
Zika Virus Selectively Kills Aggressive Human Embryonal CNS Tumor Cells In Vitro and In Vivo.
Kaid, Carolini; Goulart, Ernesto; Caires-Júnior, Luiz C; Araujo, Bruno H S; Soares-Schanoski, Alessandra; Bueno, Heloisa M S; Telles-Silva, Kayque A; Astray, Renato M; Assoni, Amanda F; Júnior, Antônio F R; Ventini, Daniella C; Puglia, Ana L P; Gomes, Roselane P; Zatz, Mayana; Okamoto, Oswaldo K
2018-06-15
Zika virus (ZIKV) is largely known for causing brain abnormalities due to its ability to infect neural progenitor stem cells during early development. Here, we show that ZIKV is also capable of infecting and destroying stem-like cancer cells from aggressive human embryonal tumors of the central nervous system (CNS). When evaluating the oncolytic properties of Brazilian Zika virus strain (ZIKV BR ) against human breast, prostate, colorectal, and embryonal CNS tumor cell lines, we verified a selective infection of CNS tumor cells followed by massive tumor cell death. ZIKV BR was more efficient in destroying embryonal CNS tumorspheres than normal stem cell neurospheres. A single intracerebroventricular injection of ZIKV BR in BALB/c nude mice bearing orthotopic human embryonal CNS tumor xenografts resulted in a significantly longer survival, decreased tumor burden, fewer metastasis, and complete remission in some animals. Tumor cells closely resembling neural stem cells at the molecular level with activated Wnt signaling were more susceptible to the oncolytic effects of ZIKV BR Furthermore, modulation of Wnt signaling pathway significantly affected ZIKV BR -induced tumor cell death and viral shedding. Altogether, these preclinical findings indicate that ZIKV BR could be an efficient agent to treat aggressive forms of embryonal CNS tumors and could provide mechanistic insights regarding its oncolytic effects. Significance: Brazilian Zika virus strain kills aggressive metastatic forms of human CNS tumors and could be a potential oncolytic agent for cancer therapy. Cancer Res; 78(12); 3363-74. ©2018 AACR . ©2018 American Association for Cancer Research.
Thotala, Dinesh; Craft, Jeffrey M; Ferraro, Daniel J; Kotipatruni, Rama P; Bhave, Sandeep R; Jaboin, Jerry J; Hallahan, Dennis E
2013-01-01
Lung cancer remains the leading cause of cancer deaths in the United States and the rest of the world. The advent of molecularly directed therapies holds promise for improvement in therapeutic efficacy. Cytosolic phospholipase A2 (cPLA2) is associated with tumor progression and radioresistance in mouse tumor models. Utilizing the cPLA2 specific inhibitor PLA-695, we determined if cPLA2 inhibition radiosensitizes non small cell lung cancer (NSCLC) cells and tumors. Treatment with PLA-695 attenuated radiation induced increases of phospho-ERK and phospho-Akt in endothelial cells. NSCLC cells (LLC and A549) co-cultured with endothelial cells (bEND3 and HUVEC) and pre-treated with PLA-695 showed radiosensitization. PLA-695 in combination with irradiation (IR) significantly reduced migration and proliferation in endothelial cells (HUVEC & bEND3) and induced cell death and attenuated invasion by tumor cells (LLC &A549). In a heterotopic tumor model, the combination of PLA-695 and radiation delayed growth in both LLC and A549 tumors. LLC and A549 tumors treated with a combination of PLA-695 and radiation displayed reduced tumor vasculature. In a dorsal skin fold model of LLC tumors, inhibition of cPLA2 in combination with radiation led to enhanced destruction of tumor blood vessels. The anti-angiogenic effects of PLA-695 and its enhancement of the efficacy of radiotherapy in mouse models of NSCLC suggest that clinical trials for its capacity to improve radiotherapy outcomes are warranted.
Dingemans, A M; Van Ark-Otte, J; Smit, E F; Postmus, P E; Giaccone, G
This report describes the validation of a polymerase chain reaction aided transcript titration assay (PATTY) for tumor samples. The results obtained with the PATTY were compared to those of RNase protection in a set of 7 human lung cancer cell lines and in 23 non-small cell lung cancer samples derived from resected patients. Whereas between PATTY and RNase protection assay a good correlation was observed in the cell lines (r = 0.74, p = 0.057), no correlation was observed within the tumor samples (r = 0.06, p = 0.78). This was also the case when only tumors with a high percentage of tumor cells (> 90%) were selected. Although PATTY is a valuable tool to measure mRNA expression in cell lines, our results caution the use of PATTY in human tumor samples without proper validation. The possible causes of these results are discussed.
Brostoff, Terza; Dela Cruz, Florante N; Church, Molly E; Woolard, Kevin D; Pesavento, Patricia A
2014-11-01
Raccoon polyomavirus (RacPyV) is associated with 100% of neuroglial tumors in free-ranging raccoons. Other tumor-associated polyomaviruses (PyVs), including simian virus 40 (SV40), murine PyV, and Merkel cell PyV, are found integrated in the host genome in neoplastic cells, where they constitutively express splice variants of the tumor antigen (TAg) gene. We have previously reported that RacPyV exists only as an episome (nonintegrated) in neuroglial tumors. Here, we have investigated TAg transcription in primary tumor tissue by transcriptome analysis, and we identified the alternatively spliced TAg transcripts for RacPyV. We also determined that TAg was highly transcribed relative to host cellular genes. We further colocalized TAg DNA and mRNA by in situ hybridization and found that the majority of tumor cells showed positive staining. Lastly, we examined the stability of the viral genome and TAg transcription by quantitative reverse transcriptase PCR in cultured tumor cells in vitro and in a mouse xenograft model. When tumor cells were cultured in vitro, TAg transcription increased nearly 2 log-fold over that of parental tumor tissue by passage 17. Both episomal viral genome and TAg transcription were faithfully maintained in culture and in tumors arising from xenotransplantation of cultured cells in mice. This study represents a minimal criterion for RacPyV's association with neuroglial tumors and a novel mechanism of stability for a polyomavirus in cancer. The natural cycle of polyomaviruses in mammals is to persist in the host without causing disease, but they can cause cancer in humans or in other animals. Because this is an unpredictable and rare event, the oncogenic potential of polyomavirus is primarily evaluated in laboratory animal models. Recently, raccoon polyomavirus (RacPyV) was identified in neuroglial tumors of free-ranging raccoons. Viral copy number was consistently high in these tumors but was low or undetectable in nontumor tissue or in unaffected raccoons. Unlike other oncogenic polyomaviruses, RacPyV was episomal, not integrated, in these tumors. To determine the stability of the viral genome and sustained transcription of the oncogenic tumor antigen genes, we cultured primary raccoon tumor cells and passaged them in mice, confirming the nonintegrated state of the virus and the maintenance of viral gene transcription throughout. RacPyV provides a naturally occurring and tractable model for a novel mechanism of polyomavirus-mediated oncogenesis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Brostoff, Terza; Dela Cruz, Florante N.; Church, Molly E.; Woolard, Kevin D.
2014-01-01
ABSTRACT Raccoon polyomavirus (RacPyV) is associated with 100% of neuroglial tumors in free-ranging raccoons. Other tumor-associated polyomaviruses (PyVs), including simian virus 40 (SV40), murine PyV, and Merkel cell PyV, are found integrated in the host genome in neoplastic cells, where they constitutively express splice variants of the tumor antigen (TAg) gene. We have previously reported that RacPyV exists only as an episome (nonintegrated) in neuroglial tumors. Here, we have investigated TAg transcription in primary tumor tissue by transcriptome analysis, and we identified the alternatively spliced TAg transcripts for RacPyV. We also determined that TAg was highly transcribed relative to host cellular genes. We further colocalized TAg DNA and mRNA by in situ hybridization and found that the majority of tumor cells showed positive staining. Lastly, we examined the stability of the viral genome and TAg transcription by quantitative reverse transcriptase PCR in cultured tumor cells in vitro and in a mouse xenograft model. When tumor cells were cultured in vitro, TAg transcription increased nearly 2 log-fold over that of parental tumor tissue by passage 17. Both episomal viral genome and TAg transcription were faithfully maintained in culture and in tumors arising from xenotransplantation of cultured cells in mice. This study represents a minimal criterion for RacPyV's association with neuroglial tumors and a novel mechanism of stability for a polyomavirus in cancer. IMPORTANCE The natural cycle of polyomaviruses in mammals is to persist in the host without causing disease, but they can cause cancer in humans or in other animals. Because this is an unpredictable and rare event, the oncogenic potential of polyomavirus is primarily evaluated in laboratory animal models. Recently, raccoon polyomavirus (RacPyV) was identified in neuroglial tumors of free-ranging raccoons. Viral copy number was consistently high in these tumors but was low or undetectable in nontumor tissue or in unaffected raccoons. Unlike other oncogenic polyomaviruses, RacPyV was episomal, not integrated, in these tumors. To determine the stability of the viral genome and sustained transcription of the oncogenic tumor antigen genes, we cultured primary raccoon tumor cells and passaged them in mice, confirming the nonintegrated state of the virus and the maintenance of viral gene transcription throughout. RacPyV provides a naturally occurring and tractable model for a novel mechanism of polyomavirus-mediated oncogenesis. PMID:25165109
Chopade, Tripti R; Smith, Colin L; Maley, Warren R; Siddiqui, Ali A; Sass, David A
2016-01-01
A 33-year-old woman with a history of intravenous cocaine abuse presented with fatigue, nausea, and jaundice. Serologic testing revealed a positive hepatitis C virus (HCV) antibody and HCV RNA. Ultrasound and magnetic resonance imaging/magnetic resonance cholangiopancreatography showed a partially obstructing lesion in the common hepatic duct, which was confirmed by endoscopic retrograde cholangiopancreatography. Surgical excision revealed a granular cell tumor of the common hepatic duct, with immunohistochemical staining of tumor cells positive for S-100.
Zhang, Xiao-Fei; Weng, De-Sheng; Pan, Ke; Zhou, Zi-Qi; Pan, Qiu-Zhong; Zhao, Jing-Jing; Tang, Yan; Jiang, Shan-Shan; Chen, Chang-Long; Li, Yong-Qiang; Zhang, Hong-Xia; Chang, Alfred E; Wicha, Max S; Zeng, Yi-Xin; Li, Qiao; Xia, Jian-Chuan
2017-11-01
Cancer stem cells (CSCs) are responsible for tumor initiation, progression, and resistance to therapeutic agents; they are usually less sensitive to conventional cancer therapies, and could cause tumor relapse. An ideal therapeutic strategy would therefore be to selectively target and destroy CSCs, thereby preventing tumor relapse. The aim of the present study was to evaluate the effectiveness of dendritic cells (DCs) pulsed with antigen derived from CD105+ human renal cell carcinoma (RCC) CSCs against renal cancer cells in vitro and in vivo. We identified "stem-like" characteristics of CD105+ cells in two human RCC cell lines: A498 and SK-RC-39. Loading with cell lysates did not change the characteristics of the DCs. However, DCs loaded with lysates derived from CD105+ CSCs induced more functionally specific active T cells and specific antibodies against CSCs, and clearly depressed the tumor growth in mice. Our results could form the basis for a novel strategy to improve the efficacy of DC-based immunotherapy for human RCC. © 2017 Wiley Periodicals, Inc.
Song, Yue; Xia, Zhijun; Shen, Keng; Zhai, Xingyue
2013-05-01
To construct recombinant adenoviruses AdHT-rev-casp3 and Ad-rev-casp3, which express autocatalysis caspase-3 driven by human telomerase reverse transcriptase promoter and cytomegalovirus promoter, respectively; and to investigate their antitumor effects on ovarian cancer in vitro and in vivo. Cell viabilities were determined using the cell counting kit 8 and flow cytometry. Reverse transcriptase polymerase chain reaction and immunoblotting assays were used to detect cellular apoptotic activities after treatments. Tumor growth and survival of mice bearing AO cells were studied. AdHT-rev-casp3 significantly suppressed the survival of AO cells in a dose-dependent modality with a viability rate of 60.45% ± 7.8% at an multiplicity of infection (MOI) of 70 and 42.18 ± 5.3% at an MOI of 100, which was somewhat lower than that of the AO cells treated with Ad-rev-casp3 (32.28% ± 5.3% and 21.84% ± 3.4%, respectively). In contrast, AdHT-rev-casp3 induced little human umbilical vein epithelial cell (HUVEC) death with a viability rate of 98.52% ± 6.9% at an MOI of 70, whereas Ad-rev-casp3 induced significant cell death in HUVEC with a viability rate of 27.14% ± 5.4%. Additionally, AdHT-rev-casp3 (MOI = 70) caused significant apoptosis in AO cells with an apoptotic rate of 25.97%, whereas it caused undetectable apoptosis in HUVECs with the rate of only 1.75%. Ad-rev-casp3 (MOI = 70) caused strong apoptosis in both AO and HUVECs, with the rate of 35.82% and 38.12%, respectively. AdHT-rev-casp3 caused markedly higher levels of active caspase-3, causing no detectable active caspase-3 expression in HUVECs. The tumor growth suppression rate of AdHT-rev-casp3 was 54.94%, significantly higher than that of phosphate-buffered saline at the end point of the study. AdHT-rev-casp3 significantly improved the survival of mice receiving intraperitoneal inoculation of AO cells with little liver damage, with the mean survival of 177 ± 12 days. AdHT-rev-casp3 causes effective apoptosis with significant tumor selectivity, suppresses tumor growth, and improves the mouse survival with little liver toxicity. It can be a potent therapeutic agent for the tumor-targeting treatment of ovarian cancer.
PD-1 and its ligands are important immune checkpoints in cancer
Dong, Yinan; Sun, Qian; Zhang, Xinwei
2017-01-01
Checkpoint programmed death-1 (PD-1)/programmed cell death ligands (PD-Ls) have been identified as negative immunoregulatory molecules that promote immune evasion of tumor cells. The interaction of PD-1 and PD-Ls inhibits the function of T cells and tumor-infiltrating lymphocytes (TIL) while increasing the function of immunosuppressive regulatory T cells (Tregs). This condition causes the tumor cells to evade immune response. Thus, the blockade of PD-1/PD-L1 enhances anti-tumor immunity by reducing the number and/or the suppressive activity of Tregs and by restoring the activity of effector T cells. Furthermore, some monoclonal antibodies blockading PD-1/PD-Ls axis have achieved good effect and received Food and Drug Administration approval. The role of PD-1/PD-Ls in tumors has been well studied, but little is known on the mechanism by which PD-1 blocks T-cell activation. In this study, we provide a brief overview on the discovery and regulatory mechanism of PD-1 and PD-L1 dysregulation in tumors, as well as the function and signaling pathway of PD-1 and its ligands; their roles in tumor evasion and clinical treatment were also studied. PMID:27974689
Prusinski Fernung, Lauren E; Al-Hendy, Ayman; Yang, Qiwei
2018-01-01
Although uterine fibroids (UFs) continue to place a major burden on female reproductive health, the mechanisms behind their origin remain undetermined. Normal myometrial stem cells may be transformed into tumor-initiating stem cells, causing UFs, due to unknown causes of somatic mutations in MED12, found in up to 85% of sporadically formed UFs. It is well established in other tumor types that defective DNA repair increases the risk of such tumorigenic somatic mutations, mechanisms not yet studied in UFs. To examine the putative cause(s) of this stem cell transformation, we analyzed DNA repair within stem cells from human UFs compared to those from adjacent myometrium to determine whether DNA repair in fibroid stem cells is compromised. Human fibroid (F) and adjacent myometrial (Myo) stem cells were isolated from fresh tissues, and gene expression relating to DNA repair was analyzed. Fibroid stem cells differentially expressed DNA repair genes related to DNA double- (DSBs) and single-strand breaks. DNA damage was measured using alkaline comet assay. Additionally, DNA DSBs were induced in these stem cells and DNA DSB repair evaluated (1) by determining changes in phosphorylation of DNA DSB-related proteins and (2) by determining differences in γ-H2AX foci formation and relative DNA repair protein RAD50 expression. Overall, F stem cells demonstrated increased DNA damage and altered DNA repair gene expression and signaling, suggesting that human F stem cells demonstrate impaired DNA repair. Compromised F stem cell DNA repair may contribute to further mutagenesis and, consequently, further growth and propagation of UF tumors.
Suspension state increases reattachment of breast cancer cells by up-regulating lamin A/C.
Zhang, Xiaomei; Lv, Yonggang
2017-12-01
Extravasation is a rate-limiting step of tumor metastasis, for which adhesion to endothelium of circulating tumor cells (CTCs) is the prerequisite. The suspension state of CTCs undergoing detachment from primary tumor is a persistent biomechanical cue, which potentially regulates the biophysical characteristics and cellular behaviors of tumor cells. In this study, breast tumor cells MDA-MB-231 in suspension culture condition were used to investigate the effect of suspension state on reattachment of CTCs. Our study demonstrated that suspension state significantly increased the adhesion ability of breast tumor cells. In addition, suspension state markedly promoted the formation of stress fibers and focal adhesions and reduced the motility in reattached breast cancer cells. Moreover, lamin A/C was reversibly accumulated at posttranscriptional level under suspension state, improving the cell stiffness of reattached breast cancer cells. Disruption of actin cytoskeleton by cytochalasin D caused lamin A/C accumulation. Conversely, decreasing actomyosin contraction by ROCK inhibitor Y27632 reduced lamin A/C level. Knocking down lamin A/C weakened the suspension-induced increase of adhesion, and also abolished the suspension-induced decrease of motility and increase of stress fibers and focal adhesion in reattaching tumor cells, suggesting a crucial role of lamin A/C. In conclusion, it was demonstrated that suspension state promoted the reattachment of breast tumor cells by up-regulating lamin A/C via cytoskeleton disruption. These findings highlight the important role of suspension state for tumor cells in tumor metastasis. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schildkopf, Petra, E-mail: petra.schildkopf@uk-erlangen.de; Frey, Benjamin, E-mail: benjamin.frey@uk-erlangen.de; Mantel, Frederick, E-mail: frederick.mantel@web.de
2010-01-01
Colorectal cancer is the second leading cause of death in developed countries. Tumor therapies should on the one hand aim to stop the proliferation of tumor cells and to kill them, and on the other hand stimulate a specific immune response against residual cancer cells. Dying cells are modulators of the immune system contributing to anti-inflammatory or pro-inflammatory responses, depending on the respective cell death form. The positive therapeutic effects of temperature-controlled hyperthermia (HT), when combined with ionizing irradiation (X-ray), were the origin to examine whether combinations of X-ray with HT can induce immune activating tumor cell death forms, alsomore » characterized by the release of the danger signal HMGB1. Human colorectal tumor cells with differing radiosensitivities were treated with combinations of HT (41.5 {sup o}C for 1 h) and X-ray (5 or 10 Gy). Necrotic cell death was prominent after X-ray and could be further increased by HT. Apoptosis remained quite low in HCT 15 and SW480 cells. X-ray and combinations with HT arrested the tumor cells in the radiosensitive G2 cell cycle phase. The amount of released HMGB1 protein was significantly enhanced after combinatorial treatments in comparison to single ones. We conclude that combining X-ray with HT may induce anti-tumor immunity as a result of the predominant induction of inflammatory necrotic tumor cells and the release of HMGB1.« less
Intra-tumor heterogeneity of cancer cells and its implications for cancer treatment
Sun, Xiao-xiao; Yu, Qiang
2015-01-01
Recent studies have revealed extensive genetic and non-genetic variation across different geographical regions of a tumor or throughout different stages of tumor progression, which is referred to as intra-tumor heterogeneity. Several causes contribute to this phenomenon, including genomic instability, epigenetic alteration, plastic gene expression, signal transduction, and microenvironmental differences. These variables may affect key signaling pathways that regulate cancer cell growth, drive phenotypic diversity, and pose challenges to cancer treatment. Understanding the mechanisms underlying this heterogeneity will support the development of effective therapeutic strategies. PMID:26388155
Utilizing Matrigel Transwell Invasion Assay to Detect and Enumerate Circulating Tumor Cells.
Liu, Xingtong; Wu, Xiangwei
2017-01-01
Metastasis is the cause of 90% of human cancer deaths. Circulating tumor cells (CTCs) in the peripheral blood and/or lymphatic vessels are cells shed from primary tumors and considered to be precursors of metastasis. Study of CTCs allows the serial monitoring of tumor progression and may provide predictive and prognostic biomarkers in clinic. Current CTC isolation and detection technologies encounter several challenges, including: heterogeneity of CTCs, low cell viability and/or high rate of contamination post-isolation, and the inability to distinguish viable/invasive from nonviable/nonfunctional CTCs, all of which can limit in vitro and in vivo characterization of CTCs. Here, we describe a new method to detect and enumerate of CTCs based on their invasive property.
Fang, Yifeng; Yu, Hong; Liang, Xiao; Xu, Junfen; Cai, Xiujun
2014-01-01
The high morbidity and mortality of colorectal cancer pose a significant public health problem worldwide. Here we assessed the pro-cancer efficacy and mechanism of action of CCNB1 in different colorectal cancer cells. We provided evidence that CCNB1 mRNA and protein level were upregulated in a subset of human colorectal tumors, and positively correlated with Chk1 expression. Repression of Chk1 caused a significant decrease in cell proliferation and CCNB1 protein expression in colorectal cancer cells. Furthermore, downregulation of CCNB1 impaired colorectal cancer proliferation in vitro and tumor growth in vivo. Specifically, suppression of CCNB1 caused a strong G2/M phase arrest in both HCT116 and SW480 cells, interfering with the expression of cdc25c and CDK1. Additionally, CCNB1 inhibition induced apoptotic death in certain colorectal cancer cells. Together, these results suggest that CCNB1 is activated by Chk1, exerts its oncogenic role in colorectal cancer cells, and may play a key role in the development of a novel therapeutic approach against colorectal cancer. PMID:24971465
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tomioka, Yukiko, E-mail: ytomi@muses.tottori-u.ac.jp; Avian Zoonosis Research Center, Faculty of Agriculture, Tottori University, Tottori 680-8553; Morimatsu, Masami, E-mail: mmorimat@vetmed.hokudai.ac.jp
Highlights: • Tumor-associated antigen MUC1 binds to Siglec-9. • Soluble Siglec-9 reduced proliferation of MUC1-positive tumor in transgenic mice. • Soluble Siglec-9 and MUC1 on tumor cells were colocalized in transgenic mice. • MUC1 expression on tumor cells were reduced in soluble Siglec-9 transgenic mice. - Abstract: Tumor-associated MUC1 binds to Siglec-9, which is expected to mediate tumor cell growth and negative immunomodulation. We hypothesized that a soluble form of Siglec-9 (sSiglec-9) competitively inhibits a binding of MUC1 to its receptor molecules like human Siglec-9, leading to provide antitumor benefit against MUC1-expressing tumor, and generated transgenic mouse lines expressing sSiglec-9more » (sSiglec-9 Tg). When mammary tumor cells expressing MUC1 were intraperitoneally transplanted into sSiglec-9 Tg, tumor proliferation was slower with the lower histological malignancy as compared with non-transgenic mice. The sSiglec-9 was detected in the ascites caused by the tumor in the sSiglec-9 Tg, and sSiglec-9 and MUC1 were often colocalized on surfaces of the tumor cells. PCNA immunohistochemistry also revealed the reduced proliferation of the tumor cells in sSiglec-9 Tg. In sSiglec-9 Tg with remarkable suppression of tumor proliferation, MUC1 expressions were tend to be reduced. In the ascites of sSiglec-9 Tg bearing the tumor, T cells were uniformly infiltrated, whereas aggregations of degenerative T cells were often observed in the non-transgenic mice. These results suggest that sSiglec-9 has an antitumor benefit against MUC1-expressing tumor in the transgenic mice, which may avoid the negative immunomodulation and/or suppress tumor-associated MUC1 downstream signal transduction, and subsequent tumor proliferation.« less
The NUP98 Gene as a Potential Modifier of NF2 Associated Tumors
2017-06-01
limited to observation, surgical removal, and stereotactic radiation [ 1 ]. However, surgery may not be possible if the tumor is inaccessible or when...there are too many tumors. Radiation treatment may cause malignant transformation and/or growth acceleration of benign tumor cells. In addition...genetic syndrome that predisposes individuals to multiple benign tumors of the central and peripheral nervous systems, including vestibular schwannomas
NASA Astrophysics Data System (ADS)
Lukianova-Hleb, Ekaterina Y.; Kim, Yoo-Shin; Belatsarkouski, Ihar; Hanna, Ehab Y.; Gillenwater, Ann M.; O'Neill, Brian; Lapotko, Dmitri
2016-02-01
Failure of cancer surgery to intraoperatively detect and eliminate microscopic residual disease (MRD) causes lethal recurrence and metastases, whereas removal of important normal tissues causes excessive morbidity. We report plasmonic nanobubble (PNB) surgical technology to intraoperatively detect and eliminate MRD in surgical bed. PNBs were generated in vivo in head and neck cancer cells by systemically targeting tumor with gold colloids and locally-applied near-infrared low energy short laser pulse, and were simultaneously detected with acoustic probe. In mouse models of head and neck squamous cell carcinoma, single cancer cells and MRD (undetectable with standard histological methods) were instantaneously non-invasively detected in solid tissue in surgical bed. In resectable MRD, PNB-guided surgery prevented local recurrence and delivered 100% tumor-free survival. In unresectable MRD, PNB nano-surgery improved survival by two-fold compared to standard surgery. PNB metrics correlated with the tumor recurrence rate. PNB surgical technology precisely detects and immediately eliminates MRD at macro- and micro-scale in a simple and safe intraoperative procedure.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mack, Hildegard I.D.; Munger, Karl, E-mail: kmunger@rics.bwh.harvard.edu
Infection with high-risk human papillomaviruses is causally linked to cervical carcinogenesis. However, most lesions caused by high-risk HPV infections do not progress to cancer. Host cell mutations contribute to malignant progression but the molecular nature of such mutations is unknown. Based on a previous study that reported an association between liver kinase B1 (LKB1) tumor suppressor loss and poor outcome in cervical cancer, we sought to determine the molecular basis for this observation. LKB1-negative cervical and lung cancer cells were reconstituted with wild type or kinase defective LKB1 mutants and we examined the importance of LKB1 catalytic activity in knownmore » LKB1-regulated processes including inhibition of cell proliferation and elevated resistance to energy stress. Our studies revealed marked differences in the biological activities of two kinase defective LKB1 mutants in the various cell lines. Thus, our results suggest that LKB1 may be a cell-type specific tumor suppressor. - Highlights: • LKB1 is a tumor suppressor that is linked to Peutz-Jeghers syndrome. • Peutz-Jeghers syndrome patients have a high incidence of cervical cancer. • Cervical cancer is caused by HPV infections. • This study investigates LKB1 tumor suppressor activity in cervical cancer.« less
ID2 collaborates with ID3 to suppress iNKT and innate-like tumors1
Li, Jia; Roy, Sumedha; Kim, Young-Mi; Li, Shibo; Zhang, Baojun; Love, Cassandra; Reddy, Anupama; Rajagopalan, Deepthi; Dave, Sandeep; Diehl, Anna Mae; Zhuang, Yuan
2017-01-01
Inhibitor of DNA binding (ID) proteins, including ID1-4, are transcriptional regulators involved in promoting cell proliferation and survival in various cell types. Although upregulation of Id proteins has been associated with a broad spectrum of tumors, recent studies have identified that ID3 plays a tumor suppressor role in the development of Burkitt’s lymphoma in humans and Hepatosplenic T cell lymphomas in mice. Here, we report rapid lymphoma development in Id2/Id3 double knockout (L-DKO) mice caused by unchecked expansion of either invariant Natural Killer T (iNKT) cells, or a unique subset of innate-like, CD1d-independent T cells. These populations started expansion in neonatal mice and, upon malignant transformation, caused fatality at age between 3–11 months. The malignant cells also gave rise to lymphomas upon transfer to Rag-deficient and wild-type hosts, reaffirming their inherent tumorigenic potential. Microarray analysis revealed a significantly modified program in these neonatal iNKT cells that ultimately led to their malignant transformation. The lymphoma cells demonstrated chromosome instability, along with upregulation of several different signaling pathways, including the cytokine-cytokine receptor interaction pathway, which can promote their expansion and migration. Dysregulation of genes with reported driver mutations and the NF-kB pathway were found to be shared between L-DKO lymphomas and human NKT tumors. Our work identifies a distinct premalignant state and multiple tumoriogenic pathways caused by loss function of ID2 and ID3. Thus, conditional deletion of Id2 and Id3 in developing T cells establishes a unique animal model for iNKT and relevant innate-like lymphomas. PMID:28258199
Enhancement of radiation therapy by the novel vascular targeting agent ZD6126.
Siemann, Dietmar W; Rojiani, Amyn M
2002-05-01
The aim of this study was to evaluate the antitumor efficacy of the novel vascular targeting agent ZD6126 (N-acetylcochinol-O-phosphate) in the rodent KHT sarcoma model, either alone or in combination with single- or fractionated-dose radiation therapy. C3H/HeJ mice bearing i.m. KHT tumors were injected i.p. with ZD6126 doses ranging from 10 to 150 mg/kg. Tumors were irradiated locally in unanesthetized mice using a linear accelerator. Tumor response to ZD6126 administered alone or in combination with radiation was assessed by clonogenic cell survival assay or tumor growth delay. Treatment with ZD6126 led to a rapid tumor vascular shutdown as determined by Hoechst 33342 diffusion. Histologic evaluation showed morphologic damage of tumor cells within a few hours after drug exposure, followed by extensive central tumor necrosis and neoplastic cell death as a result of prolonged ischemia. When combined with radiation, a 150 mg/kg dose of ZD6126 reduced tumor cell survival 10-500-fold compared with radiation alone. These enhancements in tumor cell killing could be achieved for ZD6126 given both before and after radiation exposure. Further, the shape of the cell survival curve observed after the combination therapy suggested that including ZD6126 in the treatment had a major effect on the radiation-resistant hypoxic cell subpopulation associated with this tumor. Finally, when given on a once-weekly basis in conjunction with fractionated radiotherapy, ZD6126 treatment was found to significantly increase the tumor response to daily 2.5 Gy fractions. The present results demonstrated that in the KHT sarcoma, ZD6126 caused rapid tumor vascular shutdown, induction of central tumor necrosis, tumor cell death secondary to ischemia, and enhancement of the antitumor effects of radiation therapy.
Prostate Cancer Stem-Like Cells | Center for Cancer Research
Prostate cancer is the third leading cause of cancer-related death among men, killing an estimated 27,000 men each year in the United States. Men with advanced prostate cancer often become resistant to conventional therapies. Many researchers speculate that the emergence of resistance is due to the presence of cancer stem cells, which are believed to be a small subpopulation of tumor cells that can self-renew and give rise to more differentiated tumor cells. It is thought that these stem cells survive initial therapies (such as chemotherapy and hormone therapy) and then generate new tumor cells that are resistant to these standard treatments. If prostate cancer stem cells could be identified and characterized, it might be possible to design treatments that prevent resistance.
Prehn, Richmond T
2007-05-04
TUMOR PROGRESSION: In many (perhaps in all) tumor systems, a malignant cancer is preceded by a benign lesion. Most benign lesions do not transform to malignancy and many regress. The final transformative step to malignancy differs from the preceding steps in, among other things, that it often occurs in the absence of the original carcinogenic stimulus. Relatively low titers of specific immune reactants are known to stimulate, but cell-to-cell or cell-to-matrix interactions appear to be major inhibitors of tumor-growth. Therefore, it seems reasonable to hypothesize that the mechanism of immunostimulation may be an interference with cell-to-cell or cell-to-matrix communication by a sub-lethal immune-reaction. While the above hypothesis remains unproven, some evidence suggests that immunity may have a major facilitating effect on tumor growth especially at the time of malignant transformation. There is even some evidence suggesting that transformation in vivo may seldom occur in the absence of immunostimulation of the premalignant lesion. Positive selection by the immune reaction may be the reason that tumors are immunogenic.
Wong, J T; Pinto, C E; Gifford, J D; Kurnick, J T; Kradin, R L
1989-11-15
To study the CD4+ and CD8+ tumor infiltrating lymphocytes (TIL) in the antitumor response, we propagated these subsets directly from tumor tissues with anti-CD3:anti-CD8 (CD3,8) and anti-CD3:anti-CD4 (CD3,4) bispecific mAb (BSMAB). CD3,8 BSMAB cause selective cytolysis of CD8+ lymphocytes by bridging the CD8 molecules of target lymphocytes to the CD3 molecular complex of cytolytic T lymphocytes with concurrent activation and proliferation of residual CD3+CD4+ T lymphocytes. Similarly, CD3,4 BSMAB cause selective lysis of CD4+ lymphocytes whereas concurrently activating the residual CD3+CD8+ T cells. Small tumor fragments from four malignant melanoma and three renal cell carcinoma patients were cultured in medium containing CD3,8 + IL-2, CD3,4 + IL-2, or IL-2 alone. CD3,8 led to selective propagation of the CD4+ TIL whereas CD3,4 led to selective propagation of the CD8+ TIL from each of the tumors. The phenotypes of the TIL subset cultures were generally stable when assayed over a 1 to 3 months period and after further expansion with anti-CD3 mAb or lectins. Specific 51Cr release of labeled target cells that were bridged to the CD3 molecular complexes of TIL suggested that both CD4+ and CD8+ TIL cultures have the capacity of mediating cytolysis via their Ti/CD3 TCR complexes. In addition, both CD4+ and CD8+ TIL cultures from most patients caused substantial (greater than 20%) lysis of the NK-sensitive K562 cell line. The majority of CD4+ but not CD8+ TIL cultures also produced substantial lysis of the NK-resistant Daudi cell line. Lysis of the autologous tumor by the TIL subsets was assessed in two patients with malignant melanoma. The CD8+ TIL from one tumor demonstrated cytotoxic activity against the autologous tumor but negligible lysis of allogeneic melanoma targets. In conclusion, immunocompetent CD4+ and CD8+ TIL subsets can be isolated and expanded directly from small tumor fragments of malignant melanoma and renal cell carcinoma using BSMAB. The resultant TIL subsets can be further expanded for detailed studies or for adoptive immunotherapy.
In vitro three-dimensional cancer metastasis modeling: Past, present, and future
NASA Astrophysics Data System (ADS)
Wei-jing, Han; Wei, Yuan; Jiang-rui, Zhu; Qihui, Fan; Junle, Qu; Li-yu, Liu
2016-01-01
Metastasis is the leading cause of most cancer deaths, as opposed to dysregulated cell growth of the primary tumor. Molecular mechanisms of metastasis have been studied for decades and the findings have evolved our understanding of the progression of malignancy. However, most of the molecular mechanisms fail to address the causes of cancer and its evolutionary origin, demonstrating an inability to find a solution for complete cure of cancer. After being a neglected area of tumor biology for quite some time, recently several studies have focused on the impact of the tumor microenvironment on cancer growth. The importance of the tumor microenvironment is gradually gaining attention, particularly from the perspective of biophysics. In vitro three-dimensional (3-D) metastatic models are an indispensable platform for investigating the tumor microenvironment, as they mimic the in vivo tumor tissue. In 3-D metastatic in vitro models, static factors such as the mechanical properties, biochemical factors, as well as dynamic factors such as cell-cell, cell-ECM interactions, and fluid shear stress can be studied quantitatively. With increasing focus on basic cancer research and drug development, the in vitro 3-D models offer unique advantages in fundamental and clinical biomedical studies. Project supported by the National Basic Research Program of China (Grant No. 2013CB837200), the National Natural Science Foundation of China (Grant No. 11474345), and the Beijing Natural Science Foundation, China (Grant No. 7154221).
Gregory, Kalvin J; Zhao, Bing; Bielenberg, Diane R; Dridi, Sami; Wu, Jason; Jiang, Weihua; Huang, Bin; Pirie-Shepherd, Steven; Fannon, Michael
2010-10-18
Vitamin D binding protein-macrophage activating factor (DBP-maf) is a potent inhibitor of tumor growth. Its activity, however, has been attributed to indirect mechanisms such as boosting the immune response by activating macrophages and inhibiting the blood vessel growth necessary for the growth of tumors. In this study we show for the first time that DBP-maf exhibits a direct and potent effect on prostate tumor cells in the absence of macrophages. DBP-maf demonstrated inhibitory activity in proliferation studies of both LNCaP and PC3 prostate cancer cell lines as well as metastatic clones of these cells. Flow cytometry studies with annexin V and propidium iodide showed that this inhibitory activity is not due to apoptosis or cell death. DBP-maf also had the ability to inhibit migration of prostate cancer cells in vitro. Finally, DBP-maf was shown to cause a reduction in urokinase plasminogen activator receptor (uPAR) expression in prostate tumor cells. There is evidence that activation of this receptor correlates with tumor metastasis. These studies show strong inhibitory activity of DBP-maf on prostate tumor cells independent of its macrophage activation.
Bielenberg, Diane R.; Dridi, Sami; Wu, Jason; Jiang, Weihua; Huang, Bin; Pirie-Shepherd, Steven; Fannon, Michael
2010-01-01
Background Vitamin D binding protein-macrophage activating factor (DBP-maf) is a potent inhibitor of tumor growth. Its activity, however, has been attributed to indirect mechanisms such as boosting the immune response by activating macrophages and inhibiting the blood vessel growth necessary for the growth of tumors. Methods and Findings In this study we show for the first time that DBP-maf exhibits a direct and potent effect on prostate tumor cells in the absence of macrophages. DBP-maf demonstrated inhibitory activity in proliferation studies of both LNCaP and PC3 prostate cancer cell lines as well as metastatic clones of these cells. Flow cytometry studies with annexin V and propidium iodide showed that this inhibitory activity is not due to apoptosis or cell death. DBP-maf also had the ability to inhibit migration of prostate cancer cells in vitro. Finally, DBP-maf was shown to cause a reduction in urokinase plasminogen activator receptor (uPAR) expression in prostate tumor cells. There is evidence that activation of this receptor correlates with tumor metastasis. Conclusions These studies show strong inhibitory activity of DBP-maf on prostate tumor cells independent of its macrophage activation. PMID:20976141
ALA-PDT mediated DC vaccine for skin squamous cell carcinoma
NASA Astrophysics Data System (ADS)
Ji, Jie; Fan, Zhixia; Zhou, Feifan; Wang, Xiaojie; Shi, Lei; Zhang, Haiyan; Wang, Peiru; Yang, Degang; Zhang, Linglin; Wang, Xiuli; Chen, Wei R.
2015-03-01
Dendritic cell (DC) based vaccine has emerged as a promising immunotherapy for cancers. However, most DC vaccines so far have only achieved limited success in cancer treatment. Photodynamic therapy (PDT), an established cancer treatment strategy, can cause immunogenic apoptosis to induce an effective antitumor immune response. In this study, we developed a DC-based cancer vaccine using immunogenic apoptotic tumor cells induced by 5-aminolevulinic acid (ALA) mediated PDT. The maturation of DCs induced by PDT-treated apoptotic cells was evaluated. The anti-tumor immunity of ALA-PDT-DC vaccine was tested with mouse model. We observed the maturations of DCs potentiated by ALA-PDT treated tumor cells, including phenotypic maturation (upregulation of surface expression of MHC-II, DC80, and CD86), and functional maturation (enhanced capability to secret INF-Υ and IL-12). ALA-PDT-DC vaccine mediated by apoptotic cells provided protection against tumor in mice, far stronger than that of DC vaccine obtained from freeze/thaw treated tumor cells. Our results indicate that immunogenic apoptotic tumor cells can be more effective in enhancing DC-based cancer vaccine, which could improve the clinical application of PDT- DC vaccines.
An overview of the role of cancer stem cells in spine tumors with a special focus on chordoma
Safari, Mojdeh; Khoshnevisan, Alireza
2014-01-01
Primary malignant tumors of the spine are relatively rare, less than 5% of all spinal column tumors. However, these lesions are often among the most difficult to treat and encompass challenging pathologies such as chordoma and a variety of invasive sarcomas. The mechanisms of tumor recurrence after surgical intervention, as well as resistance to radiation and chemotherapy, remain a pervasive and costly problem. Recent evidence has emerged supporting the hypothesis that solid tumors contain a sub-population of cancer cells that possess characteristics normally associated with stem cells. Particularly, the potential for long-term proliferation appears to be restricted to subpopulations of cancer stem cells (CSCs) functionally defined by their capacity to self-renew and give rise to differentiated cells that phenotypically recapitulate the original tumor, thereby causing relapse and patient death. These cancer stem cells present a unique opportunity to better understand the biology of solid tumors in general, as well as targets for future therapeutics. The general objective of the current study is to discuss the fundamental concepts for understanding the role of CSCs with respect to chemoresistance, radioresistance, special cell surface markers, cancer recurrence and metastasis in tumors of the osseous spine. This discussion is followed by a specific review of what is known about the role of CSCs in chordoma, the most common primary malignant osseous tumor of the spine. PMID:24567788
Abraha, Abraham B; Rana, Krupa; Whalen, Margaret M
2010-11-01
Human natural killer (NK) cells are lymphocytes that destroy tumor and virally infected cells. Previous studies have shown that exposure of NK cells to tributyltin (TBT) greatly diminishes their ability to destroy tumor cells (lytic function) while activating mitogen-activated protein kinases (MAPK) (p44/42, p38, and JNK) in NK cells. The signaling pathway that regulates NK lytic function appears to include activation of protein kinase C(PKC) as well as MAPK activity. TBT-induced activation of MAPKs would trigger a portion of the NK lytic signaling pathway, which would then leave the NK cell unable to trigger this pathway in response to a subsequent encounter with a target cell. In the present study we evaluated the involvement of PKC in inhibition of NK lysis of tumor cells and activation of MAPKs caused by TBT exposure. TBT caused a 2–3-fold activation of PKC at concentrations ranging from 50 to 300 nM (16–98 ng/ml),indicating that activation of PKC occurs in response to TBT exposure. This would then leave the NK cell unable to respond to targets. Treatment with the PKC inhibitor, bisindolylmaleimide I, caused an 85% decrease in the ability of NK cells to lyse tumor cells, validating the involvement of PKC in the lytic signaling pathway. The role of PKC in the activation of MAPKs by TBT was also investigated using bisindolylmaleimide I. The results indicated that, in NK cells where PKC activation was blocked, there was no activation of the MAPK, p44/42 in response to TBT.However, TBT-induced activation of the MAPKs, p38 and JNK did not require PKC activation. These results indicate the pivotal role of PKC in the TBT-induced loss of NK lytic function including activation of p44/42 by TBT in NK cells.
Abraha, Abraham B.; Rana, Krupa; Whalen, Margaret M.
2010-01-01
Human natural killer (NK) cells are lymphocytes that destroy tumor and virally infected cells. Previous studies have shown that exposures of NK cells to tributyltin (TBT) greatly diminish their ability to destroy tumor cells (lytic function) while activating mitogen-activated protein kinases (MAPK) (p44/42, p38, and JNK) in the NK cells. The signaling pathway that regulates NK lytic function appears to include activation of protein kinase C (PKC) as well as MAPK activity. The TBT-induced activation of MAPKs would trigger a portion of the NK lytic signaling pathway, which would then leave the NK cell unable to trigger this pathway in response to a subsequent encounter with a target cell. In the present study we evaluated the involvement of PKC in the inhibition of NK lysis of tumor cells and activation of MAPKs caused by TBT exposures. TBT caused a 2–3 fold activation of PKC at concentrations ranging from 50–300 nM (16–98 ng/mL), indicating that activation of PKC occurs in response to TBT exposures. This would then leave the NK cell unable to respond to targets. Treatment with the PKC inhibitor, bisindolylmaleimide I, caused an 85% decrease in the ability of NK cells to lyse tumor cells validating the involvement of PKC in the lytic signaling pathway. The role of PKC in the activation of MAPKs by TBT was also investigated using bisindolylmaleimide I. The results indicated that in NK cells where PKC activation was blocked there was no activation of the MAPK, p44/42 in response to TBT. However, TBT-induced activation of the MAPKs, p38 and JNK did not require PKC activation. These results indicate the pivotal role of PKC in the TBT-induced loss of NK lytic function including the activation of p44/42 by TBT in NK cells. PMID:20390410
Suppression of angiogenesis by atmospheric pressure plasma in human aortic endothelial cells
NASA Astrophysics Data System (ADS)
Gweon, Bomi; Kim, Hyeonyu; Kim, Kijung; Kim, Mina; Shim, Eunyoung; Kim, Sunja; Choe, Wonho; Shin, Jennifer H.
2014-03-01
Atmospheric pressure plasma (APP) has been recognized as a promising tool for cancer therapy based on its ability to remove cancer cells by causing apoptosis and necrosis. However, the effect of APP on the neighboring tissues of tumors remains unknown. Moreover, the role of APP on the vessels near tumors could be very important, because once a tumor becomes vascularized, the potential for metastasis can increase dramatically. We show in the present study that APP can induce cell cycle arrest in endothelial cells and further suppress the angiogenesis process. These results strongly support the use of APP in cancer treatment.
NASA Astrophysics Data System (ADS)
Burke, Kathleen A.; Dawes, Ryan P.; Cheema, Mehar K.; Perry, Seth; Brown, Edward
2014-02-01
Second Harmonic Generation (SHG) of collagen signals allows for the analysis of collagen structural changes throughout metastatic progression. The directionality of coherent SHG signals, measured through the ratio of the forward-propagating to backward propagating signal (F/B ratio), is affected by fibril diameter, spacing, and order versus disorder of fibril packing within a fiber. As tumors interact with their microenvironment and metastasize, it causes changes in these parameters, and concurrent changes in the F/B ratio. Specifically, the F/B ratio of breast tumors that are highly metastatic to the lymph nodes is significantly higher than those in tumors with restricted lymph node involvement. We utilized in vitro analysis of tumor cell motility through collagen gels of different microstructures, and hence different F/B ratios, to explore the relationship between collagen microstructures and metastatic capabilities of the tumor. By manipulating environmental factors of fibrillogenesis and biochemical factors of fiber composition we created methods of varying the average F/B ratio of the gel, with significant changes in fiber structure occurring as a result of alterations in incubation temperature and increasing type III collagen presence. A migration assay was performed using simultaneous SHG and fluorescent imaging to measure average penetration depth of human tumor cells into the gels of significantly different F/B ratios, with preliminary data demonstrating that cells penetrate deeper into gels of higher F/B ratio caused by lower type III collagen concentration. Determining the role of collagen structure in tumor cell motility will aid in the future prediction metastatic capabilities of a primary tumor.
Maeng, Yong-Sun; Lee, Rina; Lee, Boram; Choi, Seung-il; Kim, Eung Kweon
2016-01-01
Metastasis is the main cause of mortality in cancer patients. Although there are many anti-cancer drugs targeting tumor growth, anti-metastatic agents are rarely developed. Angiogenesis and lymphangiogenesis are crucial for cancer progression; in particular, lymphangiogenesis is pivotal for metastasis in cancer. Here we report that lithium inhibits colon cancer metastasis by blocking lymphangiogenesis. Lithium reduces the expression of transforming growth factor-β-induced protein (TGFBIp) in colon cancer cells by inhibiting Smad3 phosphorylation via GSK3β inactivation. Moreover, lithium inhibits lymphatic endothelial cell migration, which is increased upon TGFBIp expression in tumor cells. Lithium had no significant effect on SW620 tumor growth in vitro and in vivo; however, it inhibited lymphangiogenesis in tumors. In tumor xenografts model, lithium was found to prevent metastasis to the lungs, liver, and lymph nodes by inhibiting TGFBIp-induced tumor lymphangiogenesis. Collectively, our findings demonstrate a novel role of lithium in the inhibition of colon cancer metastasis by blocking TGFBIp expression, and thereby TGFBIp-induced lymphangiogenesis, in primary tumors. PMID:26857144
Molecular Characterization of Growth Hormone-producing Tumors in the GC Rat Model of Acromegaly.
Martín-Rodríguez, Juan F; Muñoz-Bravo, Jose L; Ibañez-Costa, Alejandro; Fernandez-Maza, Laura; Balcerzyk, Marcin; Leal-Campanario, Rocío; Luque, Raúl M; Castaño, Justo P; Venegas-Moreno, Eva; Soto-Moreno, Alfonso; Leal-Cerro, Alfonso; Cano, David A
2015-11-09
Acromegaly is a disorder resulting from excessive production of growth hormone (GH) and consequent increase of insulin-like growth factor 1 (IGF-I), most frequently caused by pituitary adenomas. Elevated GH and IGF-I levels results in wide range of somatic, cardiovascular, endocrine, metabolic, and gastrointestinal morbidities. Subcutaneous implantation of the GH-secreting GC cell line in rats leads to the formation of tumors. GC tumor-bearing rats develop characteristics that resemble human acromegaly including gigantism and visceromegaly. However, GC tumors remain poorly characterized at a molecular level. In the present work, we report a detailed histological and molecular characterization of GC tumors using immunohistochemistry, molecular biology and imaging techniques. GC tumors display histopathological and molecular features of human GH-producing tumors, including hormone production, cell architecture, senescence activation and alterations in cell cycle gene expression. Furthermore, GC tumors cells displayed sensitivity to somatostatin analogues, drugs that are currently used in the treatment of human GH-producing adenomas, thus supporting the GC tumor model as a translational tool to evaluate therapeutic agents. The information obtained would help to maximize the usefulness of the GC rat model for research and preclinical studies in GH-secreting tumors.
Molecular Characterization of Growth Hormone-producing Tumors in the GC Rat Model of Acromegaly
Martín-Rodríguez, Juan F.; Muñoz-Bravo, Jose L.; Ibañez-Costa, Alejandro; Fernandez-Maza, Laura; Balcerzyk, Marcin; Leal-Campanario, Rocío; Luque, Raúl M.; Castaño, Justo P.; Venegas-Moreno, Eva; Soto-Moreno, Alfonso; Leal-Cerro, Alfonso; Cano, David A.
2015-01-01
Acromegaly is a disorder resulting from excessive production of growth hormone (GH) and consequent increase of insulin-like growth factor 1 (IGF-I), most frequently caused by pituitary adenomas. Elevated GH and IGF-I levels results in wide range of somatic, cardiovascular, endocrine, metabolic, and gastrointestinal morbidities. Subcutaneous implantation of the GH-secreting GC cell line in rats leads to the formation of tumors. GC tumor-bearing rats develop characteristics that resemble human acromegaly including gigantism and visceromegaly. However, GC tumors remain poorly characterized at a molecular level. In the present work, we report a detailed histological and molecular characterization of GC tumors using immunohistochemistry, molecular biology and imaging techniques. GC tumors display histopathological and molecular features of human GH-producing tumors, including hormone production, cell architecture, senescence activation and alterations in cell cycle gene expression. Furthermore, GC tumors cells displayed sensitivity to somatostatin analogues, drugs that are currently used in the treatment of human GH-producing adenomas, thus supporting the GC tumor model as a translational tool to evaluate therapeutic agents. The information obtained would help to maximize the usefulness of the GC rat model for research and preclinical studies in GH-secreting tumors. PMID:26549306
Chacon, Jessica Ann; Schutsky, Keith; Powell, Daniel J.
2016-01-01
Genomic destabilizers, such as radiation and chemotherapy, and epigenetic modifiers are used for the treatment of cancer due to their apoptotic effects on the aberrant cells. However, these therapies may also induce widespread changes within the immune system and cancer cells, which may enable tumors to avoid immune surveillance and escape from host anti-tumor immunity. Genomic destabilizers can induce immunogenic death of tumor cells, but also induce upregulation of immune inhibitory ligands on drug-resistant cells, resulting in tumor progression. While administration of immunomodulatory antibodies that block the interactions between inhibitory receptors on immune cells and their ligands on tumor cells can mediate cancer regression in a subset of treated patients, it is crucial to understand how genomic destabilizers alter the immune system and malignant cells, including which inhibitory molecules, receptors and/or ligands are upregulated in response to genotoxic stress. Knowledge gained in this area will aid in the rational design of trials that combine genomic destabilizers, epigenetic modifiers and immunotherapeutic agents that may be synergized to improve clinical responses and prevent tumor escape from the immune system. Our review article describes the impact genomic destabilizers, such as radiation and chemotherapy, and epigenetic modifiers have on anti-tumor immunity and the tumor microenvironment. Although genomic destabilizers cause DNA damage on cancer cells, these therapies can also have diverse effects on the immune system, promote immunogenic cell death or survival and alter the cancer cell expression of immune inhibitor molecules. PMID:27854240
Ferraro, Daniel J.; Kotipatruni, Rama P.; Bhave, Sandeep R.; Jaboin, Jerry J.; Hallahan, Dennis E.
2013-01-01
Lung cancer remains the leading cause of cancer deaths in the United States and the rest of the world. The advent of molecularly directed therapies holds promise for improvement in therapeutic efficacy. Cytosolic phospholipase A2 (cPLA2) is associated with tumor progression and radioresistance in mouse tumor models. Utilizing the cPLA2 specific inhibitor PLA-695, we determined if cPLA2 inhibition radiosensitizes non small cell lung cancer (NSCLC) cells and tumors. Treatment with PLA-695 attenuated radiation induced increases of phospho-ERK and phospho-Akt in endothelial cells. NSCLC cells (LLC and A549) co-cultured with endothelial cells (bEND3 and HUVEC) and pre-treated with PLA-695 showed radiosensitization. PLA-695 in combination with irradiation (IR) significantly reduced migration and proliferation in endothelial cells (HUVEC & bEND3) and induced cell death and attenuated invasion by tumor cells (LLC &A549). In a heterotopic tumor model, the combination of PLA-695 and radiation delayed growth in both LLC and A549 tumors. LLC and A549 tumors treated with a combination of PLA-695 and radiation displayed reduced tumor vasculature. In a dorsal skin fold model of LLC tumors, inhibition of cPLA2 in combination with radiation led to enhanced destruction of tumor blood vessels. The anti-angiogenic effects of PLA-695 and its enhancement of the efficacy of radiotherapy in mouse models of NSCLC suggest that clinical trials for its capacity to improve radiotherapy outcomes are warranted. PMID:23894523
USDA-ARS?s Scientific Manuscript database
We have identified Severe Combined Immunodeficiency (SCID) in a line of Yorkshire pigs at Iowa State University. These SCID pigs lack B-cells and T-cells, but possess Natural Killer (NK) cells. This SCID phenotype is caused by recessive mutations in the Artemis gene. Interestingly, two human tumor c...
Do autologous peripheral blood cell transplants provide more than hematopoietic recovery?
Kessinger, A
1995-07-01
Bone marrow damage caused by myeloablative radiation therapy and/or chemotherapy can be repaired by intravenously infusing viable stem/progenitor cells collected from either blood or bone marrow. The hematopoietic graft product contains both stem/progenitor cells and populations of hematopoietic and nonhematopoietic (accessory) cells. The frequency of accessory cell types varies with the source of the graft product; marrow or blood. Reinfusion of these accessory cells causes effects other than the hematopoietic restoration provided by the stem/progenitor cells such as graft versus host disease and graft versus leukemia effect after allogeneic transplants. Effects of infused accessory cells in the autologous setting are less well studied and could provide ancillary advantages and/or disadvantages to the patient. Do these additional effects actually occur, and, if they do, are they more likely to appear following peripheral blood cell transplants (PBCT) or after autologous bone marrow transplants (AMBT)? Preliminary data are beginning to accumulate which suggest that reinfusion of occult tumor cells is less likely with PBCT, that immune reconstitution is different depending on the source of the autograft and that, for certain diseases, patient event-free survival following PBCT rather than ABMT may be better. However, infusion of occult tumor cells may result in re-establishment of the malignancy. If the accessory cells (including potential occult tumor cells) are eliminated from the product before transplant, will the patient have a better clinical outcome, or would benefits provided by infused accessory cells outweigh the risks of infused occult tumor cells? These controversial issues are in the very early stages of investigation.
Lehrer, Steven; Green, Sheryl; Stock, Richard G
2011-02-01
Some concern has arisen about adverse health effects of cell phones, especially the possibility that the low power microwave-frequency signal transmitted by the antennas on handsets might cause brain tumors or accelerate the growth of subclinical tumors. We analyzed data from the Statistical Report: Primary Brain Tumors in the United States, 2000-2004 and 2007 cell phone subscription data from the Governing State and Local Sourcebook. There was a significant correlation between number of cell phone subscriptions and brain tumors in nineteen US states (r = 0.950, P < 0.001). Because increased numbers of both cell phone subscriptions and brain tumors could be due solely to the fact that some states, such as New York, have much larger populations than other states, such as North Dakota, multiple linear regression was performed with number of brain tumors as the dependent variable, cell phone subscriptions, population, mean family income and mean age as independent variables. The effect of cell phone subscriptions was significant (P = 0.017), and independent of the effect of mean family income (P = 0.894), population (P = 0.003) and age (0.499). The very linear relationship between cell phone usage and brain tumor incidence is disturbing and certainly needs further epidemiological evaluation. In the meantime, it would be prudent to limit exposure to all sources of electro-magnetic radiation.
Overexpression of ZIC5 promotes proliferation in non-small cell lung cancer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Qi; Shi, Run; Wang, Xin
Background: Non-small cell lung cancer (NSCLC) has become the leading cause of cancer-related deaths. It is therefore urgent that we identify new molecular targets to help cure NSCLC patients. Here, we identified ZIC5 as a potential novel oncogene. Methods: We detected the expression of ZIC5 in tumor and normal tissues of NSCLC patients using quantitative real-time PCR and explored its clinical appearance. We then knocked down ZIC5 to observe changes in NSCLC cell proliferation and metastasis. Nude mouse xenograft models were established to measure ZIC5's function in vivo. Results: Our results revealed that ZIC5 was expressed at dramatically higher levels inmore » NSCLC tumor tissues than in normal tissues. High levels of ZIC5 expression were associated with a higher primary tumor grade. ZIC5 expression was significantly inhibited by small interfering RNA. After silencing ZIC5, the metastatic capacity of NSCLC cells was clearly lower. Knocking down ZIC5 significantly inhibited the proliferation of NSCLC cells, causing the cell cycle to be arrested in G2 phase. Xenograft tumor models showed that knocking down ZIC5 also inhibited tumor growth in vivo. Q-PCR and western blot analysis revealed that ZIC5 expression was closely associated with CCNB1 and CDK1 complex expression, while other cell cycle-related genes showed no significant correlation with ZIC5. Conclusions: Our experiment show that ZIC5 is highly upregulated in NSCLC tumor tissues and suggest that ZIC5 may act as an oncogene by influencing CCNB1 and CDK1 complex expression. ZIC5 may therefore be a potential biomarker and therapeutic target for NSCLC patients.« less
The Microenvironment in Epstein-Barr Virus-Associated Malignancies.
Tan, Geok Wee; Visser, Lydia; Tan, Lu Ping; van den Berg, Anke; Diepstra, Arjan
2018-04-13
The Epstein–Barr virus (EBV) can cause a wide variety of cancers upon infection of different cell types and induces a highly variable composition of the tumor microenvironment (TME). This TME consists of both innate and adaptive immune cells and is not merely an aspecific reaction to the tumor cells. In fact, latent EBV-infected tumor cells utilize several specific mechanisms to form and shape the TME to their own benefit. These mechanisms have been studied largely in the context of EBV+ Hodgkin lymphoma, undifferentiated nasopharyngeal carcinoma, and EBV+ gastric cancer. This review describes the composition, immune escape mechanisms, and tumor cell promoting properties of the TME in these three malignancies. Mechanisms of susceptibility which regularly involve genes related to immune system function are also discussed, as only a small proportion of EBV-infected individuals develops an EBV-associated malignancy.
Abernathy, Kristen; Burke, Jeremy
2016-01-01
Despite improvements in cancer therapy and treatments, tumor recurrence is a common event in cancer patients. One explanation of recurrence is that cancer therapy focuses on treatment of tumor cells and does not eradicate cancer stem cells (CSCs). CSCs are postulated to behave similar to normal stem cells in that their role is to maintain homeostasis. That is, when the population of tumor cells is reduced or depleted by treatment, CSCs will repopulate the tumor, causing recurrence. In this paper, we study the application of the CSC Hypothesis to the treatment of glioblastoma multiforme by immunotherapy. We extend the work of Kogan et al. (2008) to incorporate the dynamics of CSCs, prove the existence of a recurrence state, and provide an analysis of possible cancerous states and their dependence on treatment levels.
Specificity in cancer immunotherapy.
Schietinger, Andrea; Philip, Mary; Schreiber, Hans
2008-10-01
From the earliest days in the field of tumor immunology three questions have been asked: do cancer cells express tumor-specific antigens, does the immune system recognize these antigens and if so, what is their biochemical nature? We now know that truly tumor-specific antigens exist, that they are caused by somatic mutations, and that these antigens can induce both humoral and cell-mediated immune responses. Because tumor-specific antigens are exclusively expressed by the cancer cell and are often crucial for tumorigenicity, they are ideal targets for anti-cancer immunotherapy. Nevertheless, the antigens that are targeted today by anti-tumor immunotherapy are not tumor-specific antigens, but antigens that are normal molecules also expressed by normal tissues (so-called "tumor-associated" antigens). If tumor-specific antigens exist and are ideal targets for immunotherapy, why are they not being targeted? In this review, we summarize current knowledge of tumor-specific antigens: their identification, immunological relevance and clinical use. We discuss novel tumor-specific epitopes and propose new approaches that could improve the success of cancer immunotherapy, especially for the treatment of solid tumors.
Zhou, Ji-Hao; Yao, Yu-Shi; Li, Yong-Hui; Xu, Yi-Han; Li, Jing-Xin; Gao, Xiao-Ning; Zhou, Min-Hang; Jiang, Meng-Meng; Gao, Li; Ding, Yi; Lu, Xue-Chun; Shi, Jin-Long; Luo, Xu-Feng; Wang, Jia; Wang, Li-Li; Qu, Chunfeng; Bai, Xue-Feng; Yu, Li
2013-01-01
Lack of immunogenicity of cancer cells has been considered a major reason for their failure in induction of a tumor specific T cell response. In this paper, we present evidence that decitabine (DAC), a DNA methylation inhibitor that is currently used for the treatment of myelodysplastic syndrome (MDS), acute myeloid leukemia (AML) and other malignant neoplasms, is capable of eliciting an anti-tumor cytotoxic T lymphocyte (CTL) response in mouse EL4 tumor model. C57BL/6 mice with established EL4 tumors were treated with DAC (1.0 mg/kg body weight) once daily for 5 days. We found that DAC treatment resulted in infiltration of IFN-γ producing T lymphocytes into tumors and caused tumor rejection. Depletion of CD8+, but not CD4+ T cells resumed tumor growth. DAC-induced CTL response appeared to be elicited by the induction of CD80 expression on tumor cells. Epigenetic evidence suggests that DAC induces CD80 expression in EL4 cells via demethylation of CpG dinucleotide sites in the promoter of CD80 gene. In addition, we also showed that a transient, low-dose DAC treatment can induce CD80 gene expression in a variety of human cancer cells. This study provides the first evidence that epigenetic modulation can induce the expression of a major T cell co-stimulatory molecule on cancer cells, which can overcome immune tolerance, and induce an efficient anti-tumor CTL response. The results have important implications in designing DAC-based cancer immunotherapy. PMID:23671644
Wang, Li-Xin; Mei, Zhen-Yang; Zhou, Ji-Hao; Yao, Yu-Shi; Li, Yong-Hui; Xu, Yi-Han; Li, Jing-Xin; Gao, Xiao-Ning; Zhou, Min-Hang; Jiang, Meng-Meng; Gao, Li; Ding, Yi; Lu, Xue-Chun; Shi, Jin-Long; Luo, Xu-Feng; Wang, Jia; Wang, Li-Li; Qu, Chunfeng; Bai, Xue-Feng; Yu, Li
2013-01-01
Lack of immunogenicity of cancer cells has been considered a major reason for their failure in induction of a tumor specific T cell response. In this paper, we present evidence that decitabine (DAC), a DNA methylation inhibitor that is currently used for the treatment of myelodysplastic syndrome (MDS), acute myeloid leukemia (AML) and other malignant neoplasms, is capable of eliciting an anti-tumor cytotoxic T lymphocyte (CTL) response in mouse EL4 tumor model. C57BL/6 mice with established EL4 tumors were treated with DAC (1.0 mg/kg body weight) once daily for 5 days. We found that DAC treatment resulted in infiltration of IFN-γ producing T lymphocytes into tumors and caused tumor rejection. Depletion of CD8(+), but not CD4(+) T cells resumed tumor growth. DAC-induced CTL response appeared to be elicited by the induction of CD80 expression on tumor cells. Epigenetic evidence suggests that DAC induces CD80 expression in EL4 cells via demethylation of CpG dinucleotide sites in the promoter of CD80 gene. In addition, we also showed that a transient, low-dose DAC treatment can induce CD80 gene expression in a variety of human cancer cells. This study provides the first evidence that epigenetic modulation can induce the expression of a major T cell co-stimulatory molecule on cancer cells, which can overcome immune tolerance, and induce an efficient anti-tumor CTL response. The results have important implications in designing DAC-based cancer immunotherapy.
Renaissance in tumor immunotherapy: possible combination with phototherapy (Conference Presentation)
NASA Astrophysics Data System (ADS)
Hamblin, Michael R.
2016-03-01
Photodynamic therapy (PDT) uses the combination of non-toxic dyes and harmless visible light to produce highly toxic reactive oxygen species that destroy tumors. The ideal cancer treatment should target both the primary tumor and the metastases with minimal toxicity. This is best accomplished by educating the body's immune system to recognize the tumor as foreign so that after the primary tumor is destroyed, distant metastases will also be eradicated. PDT may accomplish this feat and stimulate long-term, specific anti-tumor immunity. PDT causes an acute inflammatory response, the rapid induction of large amounts of necrotic and apoptotic tumor cells, induction of damage-associated molecular patterns (DAMPS) including heat-shock proteins, stimulates tumor antigen presentation to naïve T-cells, and generation of cytotoxic T-cells that can destroy distant tumor metastases. By using various syngeneic mouse tumors in immunocompetent mice, we have studied specific PDT regimens related to tumor type as well as mouse genotype and phenotype. We have investigated the role of tumor-associated antigens in PDT-induced immune response by choosing mouse tumors that express: model defined antigen, naturally-occurring cancer testis antigen, and oncogenic virus-derived antigen. We studied the synergistic combination of low-dose cyclophosphamide and PDT that unmasks the PDT-induced immune response by depleting the immunosuppressive T-regulatory cells. PDT combined with immunostimulants (toll-like receptor ligands) can synergistically maximize the generation of anti-tumor immunity by activating dendritic cells and switching immunosuppressive macrophages to a tumor rejection phenotype. Tumors expressing defined tumor-associated antigens with known MHC class I peptides allows anti-tumor immunity to be quantitatively compared.
Raghunath, Shobana; Pudupakam, Raghavendra Sumanth; Allen, Adria; Biswas, Moanaro; Sriranganathan, Nammalwar
2017-10-20
Oncolytic virotherapy is a promising novel approach that overcomes the limitations posed by radiation and chemotherapy. In this study, the oncolytic efficacy of a recombinant Newcastle disease virus (rNDV) BC-KLQL-GFP, against prostate cancer stem-like/tumor initiating cells was evaluated. Xenograft derived prostaspheres (XPS) induced tumor more efficiently than monolayer cell derived prostaspheres (MCPS) in nude mice. Primary and secondary XPS show enhanced self-renewal and clonogenic potential compared to MCPS. XPS also expressed embryonic stem cell markers, such as Nanog, CD44 and Nestin. Further, prostate specific antigen (PSA) activated recombinant Newcastle Disease Virus (rNDV) was selectively cytotoxic to tumor derived DU145 prostaspheres. An effective concentration (EC 50 ) of 0.11-0.14 multiplicity of infection was sufficient to cause prostasphere cell death in serum free culture. DU145 tumor xenograft derived prostaspheres were used as tumor surrogates as they were enriched for a putative tumor initiating cell population. PSA activated rNDV was efficient in inducing cell death of cells and prostaspheres derived from primary xenografts ex-vivo, thus signifying a potential in vivo efficacy. The EC 50 (∼0.1 MOI) for cytolysis of tumor initiating cells was slightly higher than that was required for the parental cell line, but within the therapeutic margin for safety and efficacy. Copyright © 2017 Elsevier B.V. All rights reserved.
Sever, Richard; Brugge, Joan S.
2015-01-01
SUMMARY Cancer is driven by genetic and epigenetic alterations that allow cells to overproliferate and escape mechanisms that normally control their survival and migration. Many of these alterations map to signaling pathways that control cell growth and division, cell death, cell fate, and cell motility, and can be placed in the context of distortions of wider signaling networks that fuel cancer progression, such as changes in the tumor microenvironment, angiogenesis, and inflammation. Mutations that convert cellular proto-oncogenes to oncogenes can cause hyperactivation of these signaling pathways, whereas inactivation of tumor suppressors eliminates critical negative regulators of signaling. An examination of the PI3K-Akt and Ras-ERK pathways illustrates how such alterations dysregulate signaling in cancer and produce many of the characteristic features of tumor cells. PMID:25833940
Rottlerin upregulates DDX3 expression in hepatocellular carcinoma.
Wang, Zhong; Shen, Gen-Hai; Xie, Jia-Ming; Li, Bin; Gao, Quan-Gen
2018-01-01
Rottlerin has been reported to exert its anti-tumor activity in various types of human cancers. However, the underlying molecular mechanism has not been fully elucidated. In the current study, we explored whether rottlerin exhibits its tumor suppressive function in hepatocellular carcinoma cells. Our MTT assay results showed that rottlerin inhibited cell growth in hepatocellular carcinoma cells. Moreover, we found that rottlerin induced cell apoptosis and caused cell cycle arrest at G1 phase. Furthermore, our wound healing assay result demonstrated that rottlerin retarded cell migration in hepatocellular carcinoma cells. Additionally, rottlerin suppressed cell migration and invasion. Notably, we found that rottlerin upregulated DDX3 expression and subsequently downregulated Cyclin D1 expression and increased p21 level. Importantly, down-regulation of DDX3 abrogated the rottlerin-mediated tumor suppressive function, whereas overexpression of DDX3 promoted the anti-tumor activity of rottlerin. Our study suggests that rottlerin exhibits its anti-cancer activity partly due to upregulation of DDX3 in hepatocellular carcinoma cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Epirubicin-Adsorbed Nanodiamonds Kill Chemoresistant Hepatic Cancer Stem Cells
2015-01-01
Chemoresistance is a primary cause of treatment failure in cancer and a common property of tumor-initiating cancer stem cells. Overcoming mechanisms of chemoresistance, particularly in cancer stem cells, can markedly enhance cancer therapy and prevent recurrence and metastasis. This study demonstrates that the delivery of Epirubicin by nanodiamonds is a highly effective nanomedicine-based approach to overcoming chemoresistance in hepatic cancer stem cells. The potent physical adsorption of Epirubicin to nanodiamonds creates a rapidly synthesized and stable nanodiamond–drug complex that promotes endocytic uptake and enhanced tumor cell retention. These attributes mediate the effective killing of both cancer stem cells and noncancer stem cells in vitro and in vivo. Enhanced treatment of both tumor cell populations results in an improved impairment of secondary tumor formation in vivo compared with treatment by unmodified chemotherapeutics. On the basis of these results, nanodiamond-mediated drug delivery may serve as a powerful method for overcoming chemoresistance in cancer stem cells and markedly improving overall treatment against hepatic cancers. PMID:25437772
Noordam, Lisanne; Sprengers, Dave; Boor, Patrick P. C.; Mancham, Shanta; Menon, Anand G.; Lange, Johan F.; Burger, Pim J. W. A.; Brandt, Alexandra; Galjart, Boris; Kwekkeboom, Jaap; Bruno, Marco J.
2018-01-01
ABSTRACT Purpose: Liver metastasis develops in >50% of patients with colorectal cancer (CRC), and is a leading cause of CRC-related mortality. We aimed to identify which inhibitory immune checkpoint pathways can be targeted to enhance functionality of intra-tumoral T-cells in mismatch repair-proficient liver metastases of colorectal cancer (LM-CRC). Methodology: Intra-tumoral expression of multiple inhibitory molecules was compared among mismatch repair-proficient LM-CRC, peritoneal metastases of colorectal cancer (PM-CRC) and primary CRC. Expression of inhibitory molecules was also analyzed on leukocytes isolated from paired resected metastatic liver tumors, tumor-free liver tissues, and blood of patients with mismatch repair-proficient LM-CRC. The effects of blocking inhibitory pathways on tumor-infiltrating T-cell responses were studied in ex vivo functional assays. Results: Mismatch repair-proficient LM-CRC showed higher expression of inhibitory receptors on intra-tumoral T-cells and contained higher proportions of CD8+ T-cells, dendritic cells and monocytes than mismatch repair-proficient primary CRC and/or PM-CRC. Inhibitory receptors LAG3, PD-1, TIM3 and CTLA4 were higher expressed on CD8+ T-cells, CD4+ T-helper and/or regulatory T-cells in LM-CRC tumors compared with tumor-free liver and blood. Antibody blockade of LAG3 or PD-L1 increased proliferation and effector cytokine production of intra-tumoral T-cells isolated from LM-CRC in response to both polyclonal and autologous tumor-specific stimulations. Higher LAG3 expression on intra-tumoral CD8+ T-cells associated with longer progression-free survival of LM-CRC patients. Conclusion: Mismatch repair-proficient LM-CRC may be more sensitive to immune checkpoint inhibitors than mismatch repair-proficient primary CRC. Blocking LAG3 enhances tumor-infiltrating T-cell responses of mismatch repair-proficient LM-CRC, and therefore may be a new promising immunotherapeutic target for LM-CRC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, You-Shuang; Peng, Yin-Bo; Yao, Min
Lung cancer is the leading cause of cancer death worldwide. Small-cell lung cancer (SCLC) is an aggressive type of lung cancer that shows an overall 5-year survival rate below 10%. Although chemotherapy using cisplatin has been proven effective in SCLC treatment, conventional dose of cisplatin causes adverse side effects. Photodynamic therapy, a form of non-ionizing radiation therapy, is increasingly used alone or in combination with other therapeutics in cancer treatment. Herein, we aimed to address whether low dose cisplatin combination with PDT can effectively induce SCLC cell death by using in vitro cultured human SCLC NCI-H446 cells and in vivo tumor xenograft model.more » We found that both cisplatin and PDT showed dose-dependent cytotoxic effects in NCI-H446 cells. Importantly, co-treatment with low dose cisplatin (1 μM) and PDT (1.25 J/cm{sup 2}) synergistically inhibited cell viability and cell migration. We further showed that the combined therapy induced a higher level of intracellular ROS in cultured NCI-H446 cells. Moreover, the synergistic effect by cisplatin and PDT was recapitulated in tumor xenograft as revealed by a more robust increase in the staining of TUNEL (a marker of cell death) and decrease in tumor volume. Taken together, our findings suggest that low dose cisplatin combination with PDT can be an effective therapeutic modality in the treatment of SCLC patients.« less
Rapamycin causes growth arrest and inhibition of invasion in human chondrosarcoma cells.
Song, Jian; Wang, Xiaobo; Zhu, Jiaxue; Liu, Jun
2016-01-01
Chondrosarcoma is a highly malignant tumor that is characterized by a potent capacity to invade locally and cause distant metastasis and notable for its lack of response to conventional chemotherapy or radiotherapy. Rapamycin, the inhibitor of mammalian target of rapamycin (mTOR), is a valuable drug with diverse clinical applications and regulates many cellular processes. However, the effects of rapamycin on cell growth and invasion of human chondrosarcoma cells are not well known. We determined the effect of rapamycin on cell proliferation, cell cycle arrest and invasion by using MTS, flow cytometry and invasion assays in two human chondrosarcoma cell lines, SW1353 and JJ012. Cell cycle regulatory and invasion-related genes' expression analysis was performed by quantitative RT-PCR (qRT-PCR). We also evaluated the effect of rapamycin on tumor growth by using mice xenograph models. Rapamycin significantly inhibited the cell proliferation, induced cell cycle arrest and decreased the invasion ability of human chondrosarcoma cells. Meanwhile, rapamycin modulated the cell cycle regulatory and invasion-related genes' expression. Furthermore, the tumor growth of mice xenograph models with human chondrosarcoma cells was significantly inhibited by rapamycin. These results provided further insight into the role of rapamycin in chondrosarcoma. Therefore, rapamycin targeted therapy may be a potential treatment strategy for chondrosarcoma.
Stimulation of dendritic cells enhances immune response after photodynamic therapy
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Castano, Ana P.; Hamblin, Michael R.
2009-02-01
Photodynamic therapy (PDT) involves the administration of photosensitizers followed by illumination of the primary tumor with red light producing reactive oxygen species that cause vascular shutdown and tumor cell necrosis and apoptosis. Anti-tumor immunity is stimulated after PDT due to the acute inflammatory response, priming of the immune system to recognize tumor-associated antigens (TAA). The induction of specific CD8+ Tlymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. This process is however, often sub-optimal, in part due to tumor-induced DC dysfunction. Instead of DC that can become mature and activated and have a potent antigen-presenting and immune stimulating phenotype, immature dendritic cells (iDC) are often found in tumors and are part of an immunosuppressive milieu including regulatory T-cells and immunosuppressive cytokines such as TGF-beta and IL10. We here report on the use of a potent DC activating agent, an oligonucleotide (ODN) that contains a non-methylated CpG motif and acts as an agonist of toll like receptor (TLR) 9. TLR activation is a danger signal to notify the immune system of the presence of invading pathogens. CpG-ODN (but not scrambled non-CpG ODN) increased bone-marrow DC activation after exposure to PDT-killed tumor cells, and significantly increased tumor response to PDT and mouse survival after peri-tumoral administration. CpG may be a valuable immunoadjuvant to PDT especially for tumors that produce DC dysfunction.
Shariatpanahi, Seyed Peyman; Shariatpanahi, Seyed Pooya; Madjidzadeh, Keivan; Hassan, Moustapha; Abedi-Valugerdi, Manuchehr
2018-04-07
Myeloid-derived suppressor cells (MDSCs) belong to immature myeloid cells that are generated and accumulated during the tumor development. MDSCs strongly suppress the anti-tumor immunity and provide conditions for tumor progression and metastasis. In this study, we present a mathematical model based on ordinary differential equations (ODE) to describe tumor-induced immunosuppression caused by MDSCs. The model consists of four equations and incorporates tumor cells, cytotoxic T cells (CTLs), natural killer (NK) cells and MDSCs. We also provide simulation models that evaluate or predict the effects of anti-MDSC drugs (e.g., l-arginine and 5-Fluorouracil (5-FU)) on the tumor growth and the restoration of anti-tumor immunity. The simulated results obtained using our model were in good agreement with the corresponding experimental findings on the expansion of splenic MDSCs, immunosuppressive effects of these cells at the tumor site and effectiveness of l-arginine and 5-FU on the re-establishment of antitumor immunity. Regarding this latter issue, our predictive simulation results demonstrated that intermittent therapy with low-dose 5-FU alone could eradicate the tumors irrespective of their origins and types. Furthermore, at the time of tumor eradication, the number of CTLs prevailed over that of cancer cells and the number of splenic MDSCs returned to the normal levels. Finally, our predictive simulation results also showed that the addition of l-arginine supplementation to the intermittent 5-FU therapy reduced the time of the tumor eradication and the number of iterations for 5-FU treatment. Thus, the present mathematical model provides important implications for designing new therapeutic strategies that aim to restore antitumor immunity by targeting MDSCs. Copyright © 2018 Elsevier Ltd. All rights reserved.
Zeng, Xiankun; Singh, Shree Ram; Hou, David; Hou, Steven X.
2012-01-01
An increasing body of evidence suggests that tumors might originate from a few transformed cells that share many properties with normal stem cells. However, it remains unclear how normal stem cells are transformed into cancer stem cells. Here, we demonstrated that mutations causing the loss of tumor suppressor Sav or Scrib or activation of the oncogene Ras transform normal stem cells into cancer stem cells through a multistep process in the adult Drosophila Malpighian Tubules (MTs). In wild-type MTs, each stem cell generates one self-renewing and one differentiating daughter cell. However, in flies with loss-of-function sav or scrib or gain-of-function Ras mutations, both daughter cells grew and behaved like stem cells, leading to the formation of tumors in MTs. Ras functioned downstream of Sav and Scrib in regulating the stem cell transformation. The Ras-transformed stem cells exhibited many of the hallmarks of cancer, such as increased proliferation, reduced cell death, and failure to differentiate. We further demonstrated that several signal transduction pathways (including MEK/MAPK, RhoA, PKA, and TOR) mediate Rasṕ function in the stem cell transformation. Therefore, we have identified a molecular mechanism that regulates stem cell transformation, and this finding may lead to strategies for preventing tumor formation in certain organs. PMID:20432470
Theisen, Emily R; Gajiwala, Snehal; Bearss, Jared; Sorna, Venkataswamy; Sharma, Sunil; Janat-Amsbury, Margit
2014-10-09
Endometrial cancer is the most common gynecologic malignancy. Type II endometrial carcinoma is often poorly differentiated and patients diagnosed with Type II disease (~11%) are disproportionately represented in annual endometrial cancer deaths (48%). Recent genomic studies highlight mutations in chromatin regulators as drivers in Type II endometrial carcinoma tumorigenesis, suggesting the use of epigenetic targeted therapies could provide clinical benefit to these patients. We investigated the anti-tumor efficacy of the LSD1 inhibitor HCI2509 in two poorly differentiated Type II endometrial cancer cell lines AN3CA and KLE. The effects of HCI2509 on viability, proliferation, anchorage-independent growth, global histone methylation, LSD1 target gene induction, cell cycle, caspase activation and TUNEL were assayed. KLE cells were used in an orthotopic xenograft model to assess the anti-tumor activity of HCI2509. Both AN3CA and KLE cells were sensitive to HCI2509 treatment with IC50s near 500 nM for cell viability. Inhibition of LSD1 with HCI2509 caused decreased proliferation and anchorage independent growth in soft agar, elevated global histone methylation, and perturbed the cell cycle in both cell lines. These effects were largely dose-dependent. HCI2509 treatment also caused apoptotic cell death. Orthotopic implantation of KLE cells resulted in slow-growing and diffuse tumors throughout the abdomen. Tumor burden was distributed log-normally. Treatment with HCI2509 resulted 5/9 tumor regressions such that treatment and regressions were significantly associated (p=0.034). Our findings demonstrate the anti-cancer properties of the LSD1 inhibitor HCI2509 on poorly differentiated endometrial carcinoma cell lines, AN3CA and KLE. HCI2509 showed single-agent efficacy in orthotopic xenograft studies. Continued studies are needed to preclinically validate LSD1 inhibition as a therapeutic strategy for endometrial carcinoma.
The Role of Hedgehog Signaling in Tumor Induced Bone Disease
Cannonier, Shellese A.; Sterling, Julie A.
2015-01-01
Despite significant progress in cancer treatments, tumor induced bone disease continues to cause significant morbidities. While tumors show distinct mutations and clinical characteristics, they behave similarly once they establish in bone. Tumors can metastasize to bone from distant sites (breast, prostate, lung), directly invade into bone (head and neck) or originate from the bone (melanoma, chondrosarcoma) where they cause pain, fractures, hypercalcemia, and ultimately, poor prognoses and outcomes. Tumors in bone secrete factors (interleukins and parathyroid hormone-related protein) that induce RANKL expression from osteoblasts, causing an increase in osteoclast mediated bone resorption. While the mechanisms involved varies slightly between tumor types, many tumors display an increase in Hedgehog signaling components that lead to increased tumor growth, therapy failure, and metastasis. The work of multiple laboratories has detailed Hh signaling in several tumor types and revealed that tumor establishment in bone can be controlled by both canonical and non-canonical Hh signaling in a cell type specific manner. This review will explore the role of Hh signaling in the modulation of tumor induced bone disease, and will shed insight into possible therapeutic interventions for blocking Hh signaling in these tumors. PMID:26343726
Role of Extracellular miR-122 in Breast Cancer Metastasis
2016-02-01
expression by miR-122 reduced the level of the GLUT1 causing reduced glucose uptake; and 4) anti-miR-122 therapy suppressed metastasis in a xenograft mouse...metastatic niche selection by circulating tumor cells. 100% completed. Major Task 3: Orthotopic xenograft tumors expressing high miR-122 and...aforementioned cell lines and used to treat NSG mice i.v (Fig. 5). Xenograft tumors were established in NSG mice for over-expression of miR-122 in
Hida, Kyoko; Kikuchi, Hiroshi; Maishi, Nako; Hida, Yasuhiro
2017-08-01
Drug resistance is a major problem in anticancer therapy. ATP-binding cassette (ABC) transporters have a role in the multidrug resistance. A new regimen of chemotherapy has been proposed, called "metronomic chemotherapy". Metronomic chemotherapy is the frequent, regular administration of drug doses designed to maintain low, but active, concentrations of chemotherapeutic drugs over prolonged periods of time, without causing serious toxicities. Metronomic chemotherapy regimens were developed to optimize the antitumor efficacy of agents that target the tumor vasculature instead of tumor cells, and to reduce toxicity of antineoplastic drugs [1]. Nevertheless, recent studies revealed that ABC transporters are expressed at a higher level in the endothelium in the tumor. To avoid resistance to metronomic anti-angiogenic chemotherapy, ABC transporter inhibition of tumor endothelial cells may be a promising strategy. In this mini-review, we discuss the possible mechanism of resistance to metronomic chemotherapy from the viewpoint of tumor endothelial cell biology, focusing on ABC transporters. Copyright © 2017. Published by Elsevier B.V.
A tumor suppressor role of the Bub3 spindle checkpoint protein after apoptosis inhibition
Moutinho-Santos, Tatiana
2013-01-01
Most solid tumors contain aneuploid cells, indicating that the mitotic checkpoint is permissive to the proliferation of chromosomally aberrant cells. However, mutated or altered expression of mitotic checkpoint genes accounts for a minor proportion of human tumors. We describe a Drosophila melanogaster tumorigenesis model derived from knocking down spindle assembly checkpoint (SAC) genes and preventing apoptosis in wing imaginal discs. Bub3-deficient tumors that were also deficient in apoptosis displayed neoplastic growth, chromosomal aneuploidy, and high proliferative potential after transplantation into adult flies. Inducing aneuploidy by knocking down CENP-E and preventing apoptosis does not induce tumorigenesis, indicating that aneuploidy is not sufficient for hyperplasia. In this system, the aneuploidy caused by a deficient SAC is not driving tumorigenesis because preventing Bub3 from binding to the kinetochore does not cause hyperproliferation. Our data suggest that Bub3 has a nonkinetochore-dependent function that is consistent with its role as a tumor suppressor. PMID:23609535
Weir, E C; Burtis, W J; Morris, C A; Brady, T G; Insogna, K L
1988-12-01
A 16K PTH-like protein with a unique primary structure has recently been isolated from several human tumors associated with the syndrome of humoral hypercalcemia of malignancy. Certain spontaneous and transplantable animal tumors also cause this syndrome. The responsible mediator in these animal tumors is not known. We report the isolation of 16K proteins from the rat H500 Leydig cell tumor and the canine apocrine cell adenocarcinoma of the anal sac. Both proteins are potent activators of PTH receptor-coupled adenylate cyclase in bone cells. Both proteins demonstrate similarities in amino acid composition to one another and to the human PTH-like protein. Limited amino-terminal sequence information from the canine protein demonstrates homology with the human PTH-like protein. Antibodies raised to a synthetic human PTH-(1-36)-like peptide cross-react with both the rat and canine proteins in an immunoradiometric assay. These data demonstrate that by physical and immunological criteria PTH-like peptides are present in these animal tumors that appear to be closely related to the human PTH-like peptide. These data further suggest that this protein is not unique to humans, but has an evolutionary origin which extends back at least 65-80 million yr.
Gray, Alana L.; Coleman, David T.; Shi, Runhua; Cardelli, James A.
2016-01-01
Tumor progression to metastatic disease contributes to the vast majority of incurable cancer. Understanding the processes leading to advanced stage cancer is important for the development of future therapeutic strategies. Here, we establish a connection between tumor cell migration, a prerequisite to metastasis, and monocarboxylate transporter 1 (MCT1). MCT1 transporter activity is known to regulate aspects of tumor progression and, as such, is a clinically relevant target for treating cancer. Knockdown of MCT1 expression caused decreased hepatocyte growth factor (HGF)-induced as well as epidermal growth factor (EGF)-induced tumor cell scattering and wound healing. Western blot analysis suggested that MCT1 knockdown (KD) hinders signaling through the HGF receptor (c-Met) but not the EGF receptor. Exogenous, membrane-permeable MCT1 substrates were not able to rescue motility in MCT1 KD cells, nor was pharmacologic inhibition of MCT1 able to recapitulate decreased cell motility as seen with MCT1 KD cells, indicating transporter activity of MCT1 was dispensable for EGF- and HGF-induced motility. These results indicate MCT1 expression, independent of transporter activity, is required for growth factor-induced tumor cell motility. The findings presented herein suggest a novel function for MCT1 in tumor progression independent of its role as a monocarboxylate transporter. PMID:27127175
Regulation of Ovarian Cancer Stem Cells or Tumor-Initiating Cells
Kwon, Mi Jeong; Shin, Young Kee
2013-01-01
Cancer stem cells or tumor-initiating cells (CSC/TICs), which can undergo self-renewal and differentiation, are thought to play critical roles in tumorigenesis, therapy resistance, tumor recurrence and metastasis. Tumor recurrence and chemoresistance are major causes of poor survival rates of ovarian cancer patients, which may be due in part to the existence of CSC/TICs. Therefore, elucidating the molecular mechanisms responsible for the ovarian CSC/TICs is required to develop a cure for this malignancy. Recent studies have indicated that the properties of CSC/TICs can be regulated by microRNAs, genes and signaling pathways which also function in normal stem cells. Moreover, emerging evidence suggests that the tumor microenvironments surrounding CSC/TICs are crucial for the maintenance of these cells. Similarly, efforts are now being made to unravel the mechanism involved in the regulation of ovarian CSC/TICs, although much work is still needed. This review considers recent advances in identifying the genes and pathways involved in the regulation of ovarian CSC/TICs. Furthermore, current approaches targeting ovarian CSC/TICs are described. Targeting both CSC/TICs and bulk tumor cells is suggested as a more effective approach to eliminating ovarian tumors. Better understanding of the regulation of ovarian CSC/TICs might facilitate the development of improved therapeutic strategies for recurrent ovarian cancer. PMID:23528891
Prospects and challenges of quantitative phase imaging in tumor cell biology
NASA Astrophysics Data System (ADS)
Kemper, Björn; Götte, Martin; Greve, Burkhard; Ketelhut, Steffi
2016-03-01
Quantitative phase imaging (QPI) techniques provide high resolution label-free quantitative live cell imaging. Here, prospects and challenges of QPI in tumor cell biology are presented, using the example of digital holographic microscopy (DHM). It is shown that the evaluation of quantitative DHM phase images allows the retrieval of different parameter sets for quantification of cellular motion changes in migration and motility assays that are caused by genetic modifications. Furthermore, we demonstrate simultaneously label-free imaging of cell growth and morphology properties.
Thapa, Narendra; Choi, Suyong; Hedman, Andrew; Tan, Xiaojun; Anderson, Richard A.
2013-01-01
A fundamental property of tumor cells is to defy anoikis, cell death caused by a lack of cell-matrix interaction, and grow in an anchorage-independent manner. How tumor cells organize signaling molecules at the plasma membrane to sustain oncogenic signals in the absence of cell-matrix interactions remains poorly understood. Here, we describe a role for phosphatidylinositol 4-phosphate 5-kinase (PIPK) Iγi2 in controlling anchorage-independent growth of tumor cells in coordination with the proto-oncogene Src. PIPKIγi2 regulated Src activation downstream of growth factor receptors and integrins. PIPKIγi2 directly interacted with the C-terminal tail of Src and regulated its subcellular localization in concert with talin, a cytoskeletal protein targeted to focal adhesions. Co-expression of PIPKIγi2 and Src synergistically induced the anchorage-independent growth of nonmalignant cells. This study uncovers a novel mechanism where a phosphoinositide-synthesizing enzyme, PIPKIγi2, functions with the proto-oncogene Src, to regulate oncogenic signaling. PMID:24151076
The influence of the surgical wound on local tumor recurrence
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baker, D.G.; Masterson, T.M.; Pace, R.
1989-09-01
Failure of a primary surgical treatment for cancer is often caused by recurrence of the tumor at the surgical site. The KHT mouse tumor system recapitulates this experience and provides a useful model to test strategies for reducing the incidence of local recurrence after surgical excision. There was an 82% local recurrence of the KHT tumor after surgery. A cell dilution assay indicated that it would require only 39 tumor cells injected into the wound site to result in the same (82%) incidence of tumors. This figure is in contrast to 340 cells required when the cells were injected intomore » an unwounded flank. With the B16 melanoma in C57B1 mice and the Meth A sarcoma in BALB/c mice, the number of cells necessary to induce a tumor (TD/50) was also significantly reduced when the cells were injected into a surgical wound rather than into nonwounded tissue. The difference in cell number was interpreted as the result of the presence of growth factors derived from the traumatized tissue and the inflammatory cells at the wound site. Neither a 5 nor a 15 Gy dose of x-radiation delivered to the wound site immediately after surgical excision of the KHT tumor resulted in a significant reduction in the incidence of local recurrences. When the same doses of x-radiation were given immediately after injecting 36 KHT cells into a wound, no tumors developed. This difference was believed to have resulted from the hypoxic condition in the wound site and the presence of residual clonogenic tumor cells in a nonproliferating (radioresistant) state.« less
Fibroblasts Influence Survival and Therapeutic Response in a 3D Co-Culture Model
Majety, Meher; Pradel, Leon P.; Gies, Manuela; Ries, Carola H.
2015-01-01
In recent years, evidence has indicated that the tumor microenvironment (TME) plays a significant role in tumor progression. Fibroblasts represent an abundant cell population in the TME and produce several growth factors and cytokines. Fibroblasts generate a suitable niche for tumor cell survival and metastasis under the influence of interactions between fibroblasts and tumor cells. Investigating these interactions requires suitable experimental systems to understand the cross-talk involved. Most in vitro experimental systems use 2D cell culture and trans-well assays to study these interactions even though these paradigms poorly represent the tumor, in which direct cell-cell contacts in 3D spaces naturally occur. Investigating these interactions in vivo is of limited value due to problems regarding the challenges caused by the species-specificity of many molecules. Thus, it is essential to use in vitro models in which human fibroblasts are co-cultured with tumor cells to understand their interactions. Here, we developed a 3D co-culture model that enables direct cell-cell contacts between pancreatic, breast and or lung tumor cells and human fibroblasts/ or tumor-associated fibroblasts (TAFs). We found that co-culturing with fibroblasts/TAFs increases the proliferation in of several types of cancer cells. We also observed that co-culture induces differential expression of soluble factors in a cancer type-specific manner. Treatment with blocking antibodies against selected factors or their receptors resulted in the inhibition of cancer cell proliferation in the co-cultures. Using our co-culture model, we further revealed that TAFs can influence the response to therapeutic agents in vitro. We suggest that this model can be reliably used as a tool to investigate the interactions between a tumor and the TME. PMID:26053043
In vitro induction of apoptosis in tumor cells by inactivated NDV and IAV.
Yang, ShuYan; Liu, WeiQuan; Cui, HuanXian; Sun, ShaoGuang; Wang, JiGui
2007-04-01
We examined how Newcastle disease virus (NDV) and influenza A virus (IAV) inactivated by 5% formaldehyde, used either alone or in combination, can induce apoptosis in both HeLa and SP2/0 cells. Inactive NDV and IAV demonstrated enhanced rates of lysis in apoptotic tumor cells and greater antitumor effects when combined. Our study supports the argument that viral replication does not cause virally induced apoptosis.
Restoration of Immune Surveillance in Lung Cancer by Natural Killer Cells
2017-10-01
microenvironment, Transforming Growth Factor-beta, nicotine, tobacco smokers, e-cigarette-users, lung cancer, microRNA-183, DAP12, NKp44, NKp46...to recognize tumor cells. This loss is caused by transforming growth factor beta (TGFb) produced by tumor cells that can induce microRNA (miR)-183...any effect on NK activation markers, whether they were measured by flow cytometry, western blotting, qPCR. In all experiments, transforming growth
Combined dendritic cell cryotherapy of tumor induces systemic antimetastatic immunity.
Machlenkin, Arthur; Goldberger, Ofir; Tirosh, Boaz; Paz, Adrian; Volovitz, Ilan; Bar-Haim, Erez; Lee, Sung-Hyung; Vadai, Ezra; Tzehoval, Esther; Eisenbach, Lea
2005-07-01
Cryotherapy of localized prostate, renal, and hepatic primary tumors and metastases is considered a minimally invasive treatment demonstrating a low complication rate in comparison with conventional surgery. The main drawback of cryotherapy is that it has no systemic effect on distant metastases. We investigated whether intratumoral injections of dendritic cells following cryotherapy of local tumors (cryoimmunotherapy) provides an improved approach to cancer treatment, combining local tumor destruction and systemic anticancer immunity. The 3LL murine Lewis lung carcinoma clone D122 and the ovalbumin-transfected B16 melanoma clone MO5 served as models for spontaneous metastasis. The antimetastatic effect of cryoimmunotherapy was assessed in the lung carcinoma model by monitoring mouse survival, lung weight, and induction of tumor-specific CTLs. The mechanism of cryoimmunotherapy was elucidated in the melanoma model using adoptive transfer of T cell receptor transgenic OT-I CTLs into the tumor-bearing mice, and analysis of Th1/Th2 responses by intracellular cytokine staining in CD4 and CD8 cells. Cryoimmunotherapy caused robust and tumor-specific CTL responses, increased Th1 responses, significantly prolonged survival and dramatically reduced lung metastasis. Although intratumor administration of dendritic cells alone increased the proliferation rate of CD8 cells, only cryoimmunotherapy resulted in the generation of effector memory cells. Furthermore, cryoimmunotherapyprotected mice that had survived primary MO5 tumors from rechallenge with parental tumors. These results present cryoimmunotherapy as a novel approach for systemic treatment of cancer. We envisage that cryotherapy of tumors combined with subsequent in situ immunotherapy by autologous unmodified immature dendritic cells can be applied in practice.
ABCB1 identifies a subpopulation of uveal melanoma cells with high metastatic propensity
Landreville, Solange; Agapova, Olga A.; Kneass, Zachary T.; Salesse, Christian; Harbour, J. William
2011-01-01
SUMMARY Metastasis of tumor cells to distant organs is the leading cause of death in melanoma. Yet, the mechanisms of metastasis remain poorly understood. One key question is whether all cells in a primary tumor are equally likely to metastasize or whether subpopulations of cells preferentially give rise to metastases. Here, we identified a subpopulation of uveal melanoma cells expressing the multidrug resistance transporter ABCB1 that are highly metastatic compared to ABCB1− bulk tumor cells. ABCB1+ cells also exhibited enhanced clonogenicity, anchorage independent growth, tumorigenicity and mitochondrial activity compared to ABCB1− cells. A375 cutaneous melanoma cells contained a similar subpopulation of highly metastatic ABCB1+ cells. These findings suggest that some uveal melanoma cells have greater potential for metastasis than others, and that a better understanding of such cells may be necessary for more successful therapies for metastatic melanoma. PMID:21575142
Ogawa, Mikako; Tomita, Yusuke; Nakamura, Yuko; Lee, Min-Jung; Lee, Sunmin; Tomita, Saori; Nagaya, Tadanobu; Sato, Kazuhide; Yamauchi, Toyohiko; Iwai, Hidenao; Kumar, Abhishek; Haystead, Timothy; Shroff, Hari; Choyke, Peter L; Trepel, Jane B; Kobayashi, Hisataka
2017-02-07
Immunogenic cell death (ICD) is a form of cell death that activates an adaptive immune response against dead-cell-associated antigens. Cancer cells killed via ICD can elicit antitumor immunity. ICD is efficiently induced by near-infrared photo-immunotherapy (NIR-PIT) that selectively kills target-cells on which antibody-photoabsorber conjugates bind and are activated by NIR light exposure. Advanced live cell microscopies showed that NIR-PIT caused rapid and irreversible damage to the cell membrane function leading to swelling and bursting, releasing intracellular components due to the influx of water into the cell. The process also induces relocation of ICD bio markers including calreticulin, Hsp70 and Hsp90 to the cell surface and the rapid release of immunogenic signals including ATP and HMGB1 followed by maturation of immature dendritic cells. Thus, NIR-PIT is a therapy that kills tumor cells by ICD, eliciting a host immune response against tumor.
Siveen, K S; Kuttan, Girija
2012-01-01
Cell-mediated immunity offers protection against virus-infected cells and tumor cells, involves activation of natural killer (NK) cells, production of antigen-specific cytotoxic T-lymphocytes, and release of various cytokines in response to an antigen. Administration of an ethanolic extract of Aerva lanata was found to stimulate cell-mediated immunological responses in normal and tumor-bearing BALB/c mice. A significant enhancement in NK cell activity in both normal and tumor-bearing hosts was observed after administration of A. lanata. Antibody-dependent cellular cytotoxicity (ADCC) and antibody-dependent complement-mediated cytotoxicity (ACC) were significantly enhanced as well in both sets of treated hosts. In addition, in vivo production of IL-2 and IFNg were each significantly enhanced by extract treatment. The stimulatory effect of A. lanata on cytotoxic T-lymphocyte (CTL) production was determined by Winn's neutralization assay using CTL-sensitive EL4 thymoma cells. A. lanata treatment caused a significant increase in CTL production in both in vivo and in vitro models, in each case as indicated by a significant increase in the life-spans of tumor-injected mice. Taken together, all of these results in the murine model indicate that administration of an ethanolic extract of A. lanata could enhance the cell-mediated anti-tumor response.
The role of the cyclin-dependent kinase inhibitor p21 in apoptosis.
Gartel, Andrei L; Tyner, Angela L
2002-06-01
Cancer develops when the balance between cell proliferation and cell death is disrupted, and the ensuing aberrant proliferation leads to tumor growth. The cyclin-dependent kinase inhibitor p21 is induced by both p53-dependent and -independent mechanisms following stress, and induction of p21 may cause cell cycle arrest. As a proliferation inhibitor, p21 is poised to play an important role in preventing tumor development. This notion is supported by data indicating that p21-null mice are more prone to spontaneous and induced tumorigenesis, and p21 synergizes with other tumor suppressors to protect against tumor progression in mice. However, a number of recent studies have pointed out that in addition to being an inhibitor of cell proliferation, p21 acts as an inhibitor of apoptosis in a number of systems, and this may counteract its tumor-suppressive functions as a growth inhibitor. In the current review, we discuss the role of p21 in regulating cell death and the potential relevance of its expression in cancer.
Zhang, Wei; Yang, Pei; Zhang, Chuanbao; Li, Mingyang; Yao, Kun; Wang, Hongjun; Li, Qingbin; Jiang, Chuanlu; Jiang, Tao
2015-01-01
Loss of ATRX leads to epigenetic alterations, including abnormal levels of DNA methylation at repetitive elements such as telomeres in murine cells. We conducted an extensive DNA methylation and mRNA expression profile study on a cohort of 82 patients with astrocytic tumors to study whether ATRX expression was associated with DNA methylation level in astrocytic tumors and in which cellular functions it participated. We observed that astrocytic tumors with lower ATRX expression harbored higher DNA methylation level at chromatin end and astrocytic tumors with ATRX-low had distinct gene expression profile and DNA methylation profile compared with ATRX-high tumors. Then, we uncovered that several ATRX associated biological functions in the DNA methylation and mRNA expression profile (GEP), including apoptotic process, DNA-dependent positive regulation of transcription, chromatin modification, and observed that ATRX expression was companied by MGMT methylation and expression. We also found that loss of ATRX caused by siRNA induced apoptotic cells increasing, reduced tumor cell proliferation and repressed the cell migration in glioma cells. Our results showed ATRX-related regulatory functions of the combined profiles from DNA methylation and mRNA expression in astrocytic tumors, and delineated that loss of ATRX impacted biological behaviors of astrocytic tumor cells, providing important resources for future dissection of ATRX role in glioma. PMID:25971279
Cai, Jinquan; Chen, Jing; Zhang, Wei; Yang, Pei; Zhang, Chuanbao; Li, Mingyang; Yao, Kun; Wang, Hongjun; Li, Qingbin; Jiang, Chuanlu; Jiang, Tao
2015-07-20
Loss of ATRX leads to epigenetic alterations, including abnormal levels of DNA methylation at repetitive elements such as telomeres in murine cells. We conducted an extensive DNA methylation and mRNA expression profile study on a cohort of 82 patients with astrocytic tumors to study whether ATRX expression was associated with DNA methylation level in astrocytic tumors and in which cellular functions it participated. We observed that astrocytic tumors with lower ATRX expression harbored higher DNA methylation level at chromatin end and astrocytic tumors with ATRX-low had distinct gene expression profile and DNA methylation profile compared with ATRX-high tumors. Then, we uncovered that several ATRX associated biological functions in the DNA methylation and mRNA expression profile (GEP), including apoptotic process, DNA-dependent positive regulation of transcription, chromatin modification, and observed that ATRX expression was companied by MGMT methylation and expression. We also found that loss of ATRX caused by siRNA induced apoptotic cells increasing, reduced tumor cell proliferation and repressed the cell migration in glioma cells. Our results showed ATRX-related regulatory functions of the combined profiles from DNA methylation and mRNA expression in astrocytic tumors, and delineated that loss of ATRX impacted biological behaviors of astrocytic tumor cells, providing important resources for future dissection of ATRX role in glioma.
Hossain, Mohammad Motarab; Ray, Swapan Kumar
2016-01-01
Ewing’s sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing’s sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing’s sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing’s sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing’s sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing’s sarcoma in cell culture and animal models. PMID:27547487
Hossain, Mohammad Motarab; Ray, Swapan Kumar
2014-10-01
Ewing's sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing's sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing's sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing's sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing's sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing's sarcoma in cell culture and animal models.
TGF-β Determines the Pro-migratory Potential of bFGF Signaling in Medulloblastoma.
Santhana Kumar, Karthiga; Neve, Anuja; Guerreiro Stucklin, Ana S; Kuzan-Fischer, Claudia M; Rushing, Elisabeth J; Taylor, Michael D; Tripolitsioti, Dimitra; Behrmann, Lena; Kirschenbaum, Daniel; Grotzer, Michael A; Baumgartner, Martin
2018-06-26
The microenvironment shapes cell behavior and determines metastatic outcomes of tumors. We addressed how microenvironmental cues control tumor cell invasion in pediatric medulloblastoma (MB). We show that bFGF promotes MB tumor cell invasion through FGF receptor (FGFR) in vitro and that blockade of FGFR represses brain tissue infiltration in vivo. TGF-β regulates pro-migratory bFGF function in a context-dependent manner. Under low bFGF, the non-canonical TGF-β pathway causes ROCK activation and cortical translocation of ERK1/2, which antagonizes FGFR signaling by inactivating FGFR substrate 2 (FRS2), and promotes a contractile, non-motile phenotype. Under high bFGF, negative-feedback regulation of FRS2 by bFGF-induced ERK1/2 causes repression of the FGFR pathway. Under these conditions, TGF-β counters inactivation of FRS2 and restores pro-migratory signaling. These findings pinpoint coincidence detection of bFGF and TGF-β signaling by FRS2 as a mechanism that controls tumor cell invasion. Thus, targeting FRS2 represents an emerging strategy to abrogate aberrant FGFR signaling. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
2001-08-04
In August 2001, principal investigator Jeanne Becker sent human ovarian tumor cells to the International Space Station (ISS) aboard the STS-105 mission. The tumor cells were cultured in microgravity for a 14 day growth period and were analyzed for changes in the rate of cell growth and synthesis of associated proteins. In addition, they were evaluated for the expression of several proteins that are the products of oncogenes, which cause the transformation of normal cells into cancer cells. This photo, which was taken by astronaut Frank Culbertson who conducted the experiment for Dr. Becker, shows two cell culture bags containing LN1 ovarian carcinoma cell cultures.
Liu, T; Chopra, A K
2010-02-01
An antitumor activity associated with several bacterial pathogens, including Salmonella enterica serovar Typhimurium, has been reported; however, the underlying immunological mechanism(s) that lead to an antitumor effect are currently unclear. Furthermore, such pathogens cannot be used to suppress tumor growth because of their potential for causing sepsis. Recently, we reported the characterization of S. Typhimurium isogenic mutants from which Braun lipoprotein genes (lppA and B) and the multicopy repressor of high temperature requirement (msbB) gene were deleted. In a mouse infection model, two mutants, namely, lppB/msbB and lppAB/msbB, minimally induced proinflammatory cytokine production at high doses and were nonlethal to animals. We showed that immunization of mice with these mutants, followed by challenge with the wild-type S. Typhimurium, could significantly suppress tumor growth, as evidenced by an 88% regression in tumor size in lppB/msbB mutant-immunized animals over a 24-day period. However, the lppAB/msbB mutant alone was not effective in modulating tumor growth in mice, although the lppB/msbB mutant alone caused marginal regression in tumor size. Importantly, we showed that CD44(+) cells grew much faster than CD44(-) cells from human liver tumors in mice, leading us to examine the possibility that S. Typhimurium might downregulate CD44 in tumors and splenocytes of mice. Consequently, we found in S. Typhimurium-infected mice that tumor size regression could indeed be related to the downregulation of CD44(high) and CD4(+)CD25(+) T(reg) cells. Importantly, the role of lipopolysaccharide and Braun lipoprotein was critical in S. Typhimurium-induced antitumor immune responses. Taken together, we have defined new immune mechanisms leading to tumor suppression in mice by S. Typhimurium.
Pajic, Marina; Blatter, Sohvi; Guyader, Charlotte; Gonggrijp, Maaike; Kersbergen, Ariena; Küçükosmanoğlu, Aslι; Sol, Wendy; Drost, Rinske; Jonkers, Jos; Borst, Piet; Rottenberg, Sven
2017-11-15
Purpose: We aimed to characterize and target drug-tolerant BRCA1-deficient tumor cells that cause residual disease and subsequent tumor relapse. Experimental Design: We studied responses to various mono- and bifunctional alkylating agents in a genetically engineered mouse model for BRCA1/p53 -mutant breast cancer. Because of the large intragenic deletion of the Brca1 gene, no restoration of BRCA1 function is possible, and therefore, no BRCA1-dependent acquired resistance occurs. To characterize the cell-cycle stage from which Brca1 -/- ;p53 -/- mammary tumors arise after cisplatin treatment, we introduced the fluorescent ubiquitination-based cell-cycle indicator (FUCCI) construct into the tumor cells. Results: Despite repeated sensitivity to the MTD of platinum drugs, the Brca1 -mutated mammary tumors are not eradicated, not even by a frequent dosing schedule. We show that relapse comes from single-nucleated cells delaying entry into the S-phase. Such slowly cycling cells, which are present within the drug-naïve tumors, are enriched in tumor remnants. Using the FUCCI construct, we identified nonfluorescent G 0 -like cells as the population most tolerant to platinum drugs. Intriguingly, these cells are more sensitive to the DNA-crosslinking agent nimustine, resulting in an increased number of multinucleated cells that lack clonogenicity. This is consistent with our in vivo finding that the nimustine MTD, among several alkylating agents, is the most effective in eradicating Brca1 -mutated mouse mammary tumors. Conclusions: Our data show that targeting G 0 -like cells is crucial for the eradication of BRCA1/p53-deficient tumor cells. This can be achieved with selected alkylating agents such as nimustine. Clin Cancer Res; 23(22); 7020-33. ©2017 AACR . ©2017 American Association for Cancer Research.
Bauer, Georg; Motz, Manfred
2016-11-01
Neutralizing single-domain antibodies directed towards catalase or superoxide dismutase (SOD) caused efficient reactivation of intercellular reactive oxygen species/reactive nitrogen species (ROS/RNS)-dependent apoptosis-inducing signaling specifically in human tumor cells. Single-domain antibodies targeted tumor cell-specific membrane-associated SOD and catalase, but not the corresponding intracellular enzymes. They were shown to be about 200-fold more effective than corresponding classical recombinant antigen-binding fragments and more than four log steps more efficient than monoclonal antibodies. Combined addition of single-domain antibodies against catalase and SOD caused a remarkable synergistic effect. Proof-of-concept experiments in immunocompromised mice using human tumor xenografts and single-domain antibodies directed towards SOD showed an inhibition of tumor growth. Neutralizing single-domain antibodies directed to catalase and SOD also caused a very strong synergistic effect with the established chemotherapeutic agent taxol, indicating an overlap of signaling pathways. This effect might also be useful in order to avoid unwanted side-effects and to drastically lower the costs for taxol-based therapy. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Prehn, Richmond T
2007-01-01
Tumor progression In many (perhaps in all) tumor systems, a malignant cancer is preceded by a benign lesion. Most benign lesions do not transform to malignancy and many regress. The final transformative step to malignancy differs from the preceding steps in, among other things, that it often occurs in the absence of the original carcinogenic stimulus. Mechanism of immunostimulation Relatively low titers of specific immune reactants are known to stimulate, but cell-to-cell or cell-to-matrix interactions appear to be major inhibitors of tumor-growth. Therefore, it seems reasonable to hypothesize that the mechanism of immunostimulation may be an interference with cell-to-cell or cell-to-matrix communication by a sub-lethal immune-reaction. Discussion While the above hypothesis remains unproven, some evidence suggests that immunity may have a major facilitating effect on tumor growth especially at the time of malignant transformation. There is even some evidence suggesting that transformation in vivo may seldom occur in the absence of immunostimulation of the premalignant lesion. Positive selection by the immune reaction may be the reason that tumors are immunogenic. PMID:17480231
Gilloteaux, Jacques; Jamison, James M; Neal, Deborah R; Loukas, Marios; Doberzstyn, Theresa; Summers, Jack L
2010-05-01
A human bladder carcinoma cell line RT4 was sham-treated with buffer or treated with ascorbate (VC) alone, menadione alone (VK(3)), or a combination of ascorbate:menadione (VC+VK(3)) for 1, 2, and 4 h. Cytotoxic damage was found to be treatment-dependent in this sequence: VC+VK(3)>VC>VK(3)>sham. The combined treatment induced the greatest oxidative stress, with early tumor cell injury affecting the cytoskeletal architecture and contributing to the self-excisions of pieces of cytoplasm freed from organelles. Additional damage, including a reduction in cell size, organelle alterations, nuclear damage, and nucleic acid degradation as well as compromised lysosome integrity, is caused by reactivation of DNases and the redox cycling of VC or VC+VK(3). In addition, cell death caused by VC+VK(3) treatment as well as by prolonged VC treatment is consistent with cell demise by autoschizis, not apoptosis. This report confirms and complements previous observations about this new mode of tumor cell death. It supports the contention that a combination of VC+VK(3), also named Apatone, could be co-administered as a nontoxic adjuvant with radiation and/or chemotherapies to kill bladder tumor cells and other cancer cells without any supplementary risk or side effects for patients.
Malhotra, Sanandan; Justice, James; Morgan, Robin
2017-01-01
Avian leukosis virus (ALV) is a simple retrovirus that causes a wide range of tumors in chickens, the most common of which are B-cell lymphomas. The viral genome integrates into the host genome and uses its strong promoter and enhancer sequences to alter the expression of nearby genes, frequently inducing tumors. In this study, we compare the preferences for ALV integration sites in cultured cells and in tumors, by analysis of over 87,000 unique integration sites. In tissue culture we observed integration was relatively random with slight preferences for genes, transcription start sites and CpG islands. We also observed a preference for integrations in or near expressed and spliced genes. The integration pattern in cultured cells changed over the course of selection for oncogenic characteristics in tumors. In comparison to tissue culture, ALV integrations are more highly selected for proximity to transcription start sites in tumors. There is also a significant selection of ALV integrations away from CpG islands in the highly clonally expanded cells in tumors. Additionally, we utilized a high throughput method to quantify the magnitude of clonality in different stages of tumorigenesis. An ALV-induced tumor carries between 700 and 3000 unique integrations, with an average of 2.3 to 4 copies of proviral DNA per infected cell. We observed increasing tumor clonality during progression of B-cell lymphomas and identified gene players (especially TERT and MYB) and biological processes involved in tumor progression. PMID:29099869
Roswell, R H
1990-02-01
Hypertension resulting from a renin-secreting tumor was first reported in 1967 by Robertson et al. Kihara and coworkers subsequently coined the term juxtaglomerular cell tumor for a similar tumor in a young woman with hyperreninemic hypertension. Since the description of these first two cases, it has become clear that renin-secreting tumors of both renal and nonrenal origin can cause surgically curable hypertension. Primary reninism has been suggested as a more appropriate term for the clinical syndrome associated with renin-secreting tumors, both renal and extrarenal, whether benign or malignant.
Xiao, Jie; Peng, Feng; Yu, Chao; Wang, Min; Li, Xu; Li, Zhipeng; Jiang, Jianxin; Sun, Chengyi
2014-01-01
Background: We intended to investigate the role of microRNA 137 (miR-137) in regulating pancreatic cancer cells’ growth in vitro and tumor development in vivo. Methods: QTR-PCR was used to examine the expression of miR-137 in pancreatic cancer cell lines and tumor cells from human patients. Lentivirual vector containing miR-137 mimic was used to overexpress miR-137 in PANC-1 and MIA PaCa-2 cells. The effects of overexpressing miR-137 on pancreatic cancer cell invasion and chemo-sensitivity to 5-fluorouracil (5-FU) were examined by cell migration and survival essays in vitro. The molecular target of miR-137, pleiotropic growth factor (PTN), was down-regulated by siRNA to examine its effects on cancer cell invasion. MIA PaCa-2 cells with endogenously overexpressed miR-137 were transplanted into null mice to examine tumor growth in vivo. Results: We found miR-137 was markedly underexpressed in both pancreatic cancer cell lines and tumor cells from patients. In cancer cells, transfection of lentivirus containing miR-137 mimic was able to markedly upregulate endogenous expression of miR-137, inhibited cancer cell invasion and increased sensitivities to chemotherapy reagent 5-FU. PTN was significantly down-regulated by overexpressing miR-137 in pancreatic cancer cells, and knocking down PTN was effective to rescue the reduced cancer cell invasion ability caused by miR-137 overexpression. More importantly, overexpressing miR-137 led to significant inhibition on tumor formation, including reductions in tumor weight and tumor size in vivo. Conclusion: Our study demonstrated that miR-137 played an important role in pancreatic cancer development. It may become a new therapeutic target for gene therapy in patients suffered from pancreatic cancer. PMID:25550779
Immune mediated colitis caused by lung cancer treatment with atezolizumab.
González Vázquez, Santiago; de la Riva Onandía, Susana; Echeveste, José Ignacio; Muñoz Navas, Miguel
2017-12-01
Atezolizumab is an IgG1 isotype monoclonal antibody against the protein programmed cell death-ligand 1 (PD- L1). PD-L1 may be highly expressed in some tumors and is believed to inhibit immune cells that recognize and attack tumor cells. Inhibition of PD-L1 can remove its inhibitory effect and provoke an anti-tumor response. In October 2016, the Food and Drugs Administration (FDA) approved atezolizumab for the treatment of patients with metastatic non-small cell lung cancer after disease progression during or following platinum based chemotherapy. We present the case of a 43-year-old male with stage IV lung adenocarcinoma in progression, despite standard chemotherapy.
High hydrostatic pressure-induced cell death in human chondrocytes and chondrosarcoma cells.
Naal, Florian-Dominique; Mengele, Karin; Schauwecker, Johannes; Gollwitzer, Hans; Gerdesmeyer, Ludger; Reuning, Ute; Mittelmeier, Wolfram; Gradinger, Reiner; Schmitt, Manfred; Diehl, Peter
2005-01-01
In orthopedic surgery, sterilization of bone used for reconstruction of osteoarticular defects caused by malignant tumors is carried out in different ways. At present, to devitalize tumor-bearing osteochondral segments, extracorporal irradiation or autoclaving is mainly used, although both methods have substantial disadvantages, e.g. loss of biomechanical and/or biological integrity of the bone and destabilization of the articular surface. In this regard, high hydrostatic pressure (HHP) treatment of bone is a new, advancing technology, now being used in preclinical testing to inactivate tumor cells. To find out if this technique is also suited for extracorporal inactivation of chondrocytes and chondral tumor cells, the effect of HHP on cell viability and morphology of human chondrocytes / chondrosarcoma cells was investigated in the present study. SW1353 chondrosarcoma cells and chondrocytes were subjected to HHP in the range of 50 to 350 MPa (10 min, 37 degrees C) and, subsequently, cell viability and cell morphology assessed. After exposure at 350 MPa, all HHP-treated chondral cells showed explicit morphological changes, evident by membrane ruffling and bleb formation; chondrosarcoma cells treated this way were irreversibly damaged and not alive. We anticipate that, in orthopedic surgery, HHP eventually can serve as a novel, promising technical approach for cell inactivation (including tumor cells) and allow subsequent reimplantation of the osteoarticular autograft.
Mourelatos, D; Dozi-Vassiliades, J; Kotsis, A; Gourtsas, C
1988-03-01
Enhanced cytogenetic damage by cyclophosphamide (CP) was observed when Ehrlich ascites tumor cells were exposed in vivo to nontoxic concentrations of caffeine. One h before i.p. injection of 5-bromodeoxyuridine adsorbed to activated charcoal Ehrlich ascites tumor-bearing mice treated i.p. with CP appear to have a dose-dependent increase in sister chromatid exchange rates and cell division delays. Caffeine increased the survival time of the Ehrlich ascites tumor-bearing mice treated with CP and markedly reduced the ascitic volume. Therefore, the in vivo antitumor effect by CP in conjunction with caffeine appears to correlate well with the in vivo synergistic effect on cytogenetic damage caused by the combined CP plus caffeine treatment.
Stem-Cell-Based Tumorigenesis in Adult Drosophila.
Hou, S X; Singh, S R
2017-01-01
Recent studies suggest that a small subset of cells within a tumor, the so-called cancer stem cells (CSCs), are responsible for tumor propagation, relapse, and the eventual death of most cancer patients. CSCs may derive from a few tumor-initiating cells, which are either transformed normal stem cells or reprogrammed differentiated cells after acquiring initial cancer-causing mutations. CSCs and normal stem cells share some properties, but CSCs differ from normal stem cells in their tumorigenic ability. Notably, CSCs are usually resistant to chemo- and radiation therapies. Despite the apparent roles of CSCs in human cancers, the biology underlying their behaviors remains poorly understood. Over the past few years, studies in Drosophila have significantly contributed to this new frontier of cancer research. Here, we first review how stem-cell tumors are initiated and propagated in Drosophila, through niche appropriation in the posterior midgut and through stem-cell competition for niche occupancy in the testis. We then discuss the differences between normal and tumorigenic stem cells, revealed by studying Ras V12 -transformed stem-cell tumors in the Drosophila kidney. Finally, we review the biology behind therapy resistance, which has been elucidated through studies of stem-cell resistance and sensitivity to death inducers using female germline stem cells and intestinal stem cells of the posterior midgut. We expect that screens using adult Drosophila neoplastic stem-cell tumor models will be valuable for identifying novel and effective compounds for treating human cancers. © 2017 Elsevier Inc. All rights reserved.
Orciani, Monia; Lazzarini, Raffaella; Scartozzi, Mario; Bolletta, Elisa; Mattioli-Belmonte, Monica; Scalise, Alessandro; Di Benedetto, Giovanni; Di Primio, Roberto
2013-12-01
Breast implants are widely used and at times might cause inflammation as a foreign body, followed by fibrous capsule formation around the implant. In cancer, the inflamed stroma is essential for preservation of the tumor. Mesenchymal stem cells can be recruited to sites of inflammation, and their role in cancer development is debated. The authors assessed the effects of inflammation caused by breast implants' effects on tumor. Mesenchymal stem cells were isolated from the fibrous capsules of women who underwent a second operation after 1 year (presenting inflammation) or after 20 years (not presenting inflammation) since initial surgery. After characterization, cells were co-cultured with MCF7, a breast cancer cell line. The expression of genes involved in oncogenesis, proliferation, and epithelial-to-mesenchymal transition was investigated, followed by Western blot analyses. After co-culture with mesenchymal stem cells from the inflamed capsule, MCF7 induced a dose- and time-dependent increase in proliferation. Polymerase chain reaction analyses revealed a dysregulation of genes involved in oncogenesis, proliferation, and epithelial-to-mesenchymal transition. The subsequent evaluation by Western blot did not confirm these results, showing only a modest decrease in the expression of E-cadherin after co-culture with mesenchymal stem cells (both derived from inflamed or control capsules). These data indicate that inflammation caused by breast implants partially affects proliferation of MCF7 but does not influence key mechanisms of tumor development.
Kisker, Oliver; Onizuka, Shinya; Becker, Christian M; Fannon, Michael; Flynn, Evelyn; D'Amato, Robert; Zetter, Bruce; Folkman, Judah; Ray, Rahul; Swamy, Narasimha; Pirie-Shepherd, Steven
2003-01-01
We have isolated a selectively deglycosylated form of vitamin D binding protein (DBP-maf) generated from systemically available DBP by a human pancreatic cancer cell line. DBP-maf is antiproliferative for endothelial cells and antiangiogenic in the chorioallantoic membrane assay. DBP-maf administered daily was able to potently inhibit the growth of human pancreatic cancer in immune compromised mice (T/C=0.09). At higher doses, DBP-maf caused tumor regression. Histological examination revealed that treated tumors had a higher number of infiltrating macrophages as well as reduced microvessel density, and increased levels of apoptosis relative to untreated tumors. Taken together, these data suggest that DBP-maf is an antiangiogenic molecule that can act directly on endothelium as well as stimulate macrophages to attack both the endothelial and tumor cell compartment of a growing malignancy.
Mechanisms of lectin and antibody-dependent polymorphonuclear leukocyte-mediated cytolysis.
Tsunawaki, S; Ikenami, M; Mizuno, D; Yamazaki, M
1983-04-01
The mechanisms of tumor lysis by polymorphonuclear leukocytes (PMNs) were investigated. In antibody-dependent PMN-mediated cytolysis (ADPC), sensitized tumor cells were specifically lysed via Fc receptors on PMNs. On the other hand, lectin-dependent PMN-mediated cytolysis (LDPC) caused nonspecific lysis of several murine tumors after recognition of carbohydrate moieties on the cell membrane of both PMNs and tumor cells. Both ADPC and LDPC depended on glycolysis, and cytotoxicity was mediated by reactive oxygen species; LDPC was dependent on superoxide and ADPC on the myeloperoxidase system. The participation of reactive oxygen species in PMN cytotoxicity was also demonstrated by pharmacological triggering with phorbol myristate acetate. These results indicate that reactive oxygen species have an important role In tumor killing by PMNs and that ADPC and LDPC have partly different cytolytic processes as well as different recognition steps.
Mukherjee, P.; Pathangey, L.B.; Bradley, J.B.; Tinder, T.L.; Basu, G.D.; Akporiaye, E.T.; Gendler, S.J.
2007-01-01
A MUC1-based vaccine was used in a preclinical model of colon cancer. The trial was conducted in a MUC1-tolerant immune competent host injected with MC38 colon cancer cells expressing MUC1. The vaccine included: MHC class I-restricted MUC1 peptides, MHC class II-restricted pan helper peptide, unmethylated CpG oligodeoxynucleotide, and granulocyte macrophage-colony stimulating factor. Immunization was successful in breaking MUC1 self-tolerance, and in eliciting a robust anti-tumor response. The vaccine stimulated IFN-γ-producing CD4+ helper and CD8+ cytotoxic T cells against MUC1 and other undefined MC38 tumor antigens. In the prophylactic setting, immunization caused complete rejection of tumor cells, while in the therapeutic regimen, tumor burden was significantly reduced. PMID:17166639
Mukherjee, P; Pathangey, L B; Bradley, J B; Tinder, T L; Basu, G D; Akporiaye, E T; Gendler, S J
2007-02-19
A MUC1-based vaccine was used in a preclinical model of colon cancer. The trial was conducted in a MUC1-tolerant immune competent host injected with MC38 colon cancer cells expressing MUC1. The vaccine included: MHC class I-restricted MUC1 peptides, MHC class II-restricted pan-helper-peptide, unmethylated CpG oligodeoxynucleotide, and granulocyte macrophage-colony stimulating factor. Immunization was successful in breaking MUC1 self-tolerance, and in eliciting a robust anti-tumor response. The vaccine stimulated IFN-gamma-producing CD4(+) helper and CD8(+) cytotoxic T cells against MUC1 and other undefined MC38 tumor antigens. In the prophylactic setting, immunization caused complete rejection of tumor cells, while in the therapeutic regimen, tumor burden was significantly reduced.
CCL11-induced eosinophils inhibit the formation of blood vessels and cause tumor necrosis.
Xing, Yanjiang; Tian, Yijun; Kurosawa, Takamasa; Matsui, Sayaka; Touma, Maki; Yanai, Takanori; Wu, Qiong; Sugimoto, Kenkichi
2016-06-01
We previously demonstrated that IL-18 and CCL11 were highly expressed in an NFSA tumor cell line that showed limited angiogenesis and severe necrosis. However, IL-18 was not responsible for the immune cell accumulation and necrosis. Here, we attempted to clarify the relevance of CCL11 in angiogenesis and tumor formation. We established CCL11-overexpressing MS-K cell clones (MS-K-CCL11) to assess the role of CCL11 in immune cell accumulation and angiogenesis. The MS-K-CCL11 cells did not form tumors in mice. MS-K-CCL11-conditioned medium (CM) and recombinant CCL11 induced macrophage and eosinophil differentiation from bone marrow cells. The MS-K-CCL11-CM effectively recruited the differentiated eosinophils. Furthermore, the eosinophils damaged the MS-K, NFSA and endothelial cells in a dose-dependent manner. Administration of an antagonist of CCR3, a CCL11 receptor, to NFSA tumor-bearing mice restored the blood vessel formation and blocked the eosinophil infiltration into the NFSA tumors. Furthermore, other CCL11-overexpressing LM8 clones were established, and their tumor formation ability was reduced compared to the parental LM8 cells, accompanied by increased eosinophil infiltration, blockade of angiogenesis and necrosis. These results indicate that CCL11 was responsible for the limited angiogenesis and necrosis by inducing and attracting eosinophils in the tumors. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.
PCTAIRE1 phosphorylates p27 and regulates mitosis in cancer cells.
Yanagi, Teruki; Krajewska, Maryla; Matsuzawa, Shu-ichi; Reed, John C
2014-10-15
PCTAIRE1 is distant relative of the cyclin-dependent kinase family that has been implicated in spermatogenesis and neuronal development, but it has not been studied in cancer. Here, we report that PCTAIRE1 is expressed in prostate, breast, and cervical cancer cells, where its RNAi-mediated silencing causes growth inhibition with aberrant mitosis due to defects in centrosome dynamics. PCTAIRE1 was not similarly involved in proliferation of nontransformed cells, including diploid human IMR-90 fibroblasts. Through yeast two-hybrid screening, we identified tumor suppressor p27 as a PCTAIRE1 interactor. In vitro kinase assays showed PCTAIRE1 phosphorylates p27 at Ser10. PCTAIRE1 silencing modulated Ser10 phosphorylation on p27 and led to its accumulation in cancer cells but not in nontransformed cells. In a mouse xenograft model of PPC1 prostate cancer, conditional silencing of PCTAIRE1 restored p27 protein expression and suppressed tumor growth. Mechanistic studies in HeLa cells showed that PCTAIRE1 phosphorylates p27 during the S and M phases of the cell cycle. Notably, p27 silencing was sufficient to rescue cells from mitotic arrest caused by PCTAIRE1 silencing. Clinically, PCTAIRE1 was highly expressed in primary breast and prostate tumors compared with adjacent normal epithelial tissues. Together our findings reveal an unexpected role for PCTAIRE1 in regulating p27 stability, mitosis, and tumor growth, suggesting PCTAIRE1 as a candidate cancer therapeutic target. ©2014 American Association for Cancer Research.
Hypoxia-mediated alterations and their role in the HER-2/neuregulated CREB status and localization
Steven, André; Leisz, Sandra; Sychra, Katharina; Hiebl, Bernhard; Wickenhauser, Claudia; Mougiakakos, Dimitrios; Kiessling, Rolf; Denkert, Carsten; Seliger, Barbara
2016-01-01
The cAMP-responsive element-binding protein (CREB) is involved in the tumorigenicity of HER-2/neu-overexpressing murine and human tumor cells, but a link between the HER-2/neu-mediated CREB activation, its posttranslational modification and localization and changes in the cellular metabolism, due to an altered (tumor) microenvironment remains to be established. The present study demonstrated that shRNA-mediated silencing of CREB in HER-2/neu-transformed cells resulted in decreased tumor formation, which was associated with reduced angiogenesis, but increased necrotic and hypoxic areas in the tumor. Hypoxia induced pCREBSer133, but not pCREBSer121 expression in HER-2/neu-transformed cells. This was accompanied by upregulation of the hypoxia-inducible genes GLUT1 and VEGF, increased cell migration and matrix metalloproteinase-mediated invasion. Treatment of HER-2/neu+ cells with signal transduction inhibitors targeting in particular HER-2/neu was able to revert hypoxia-controlled CREB activation. In addition to changes in the phosphorylation, hypoxic response of HER-2/neu+ cells caused a transient ubiquitination and SUMOylation as well as a co-localization of nuclear CREB to the mitochondrial matrix. A mitochondrial localization of CREB was also demonstrated in hypoxic areas of HER-2/neu+ mammary carcinoma lesions. This was accompanied by an altered gene expression pattern, activity and metabolism of mitochondria leading to an increased respiratory rate, oxidative phosphorylation and mitochondrial membrane potential and consequently to an enhanced apoptosis and reduced cell viability. These data suggest that the HER-2/neu-mediated CREB activation caused by a hypoxic tumor microenvironment contributes to the neoplastic phenotype of HER-2/neu+ cells at various levels. PMID:27409833
Svensson, Malin; Fast, Jonas; Mossberg, Ann-Kristin; Düringer, Caroline; Gustafsson, Lotta; Hallgren, Oskar; Brooks, Charles L; Berliner, Lawrence; Linse, Sara; Svanborg, Catharina
2003-12-01
HAMLET (human alpha-lactalbumin made lethal to tumor cells) is a complex of human alpha-lactalbumin and oleic acid (C18:1:9 cis) that kills tumor cells by an apoptosis-like mechanism. Previous studies have shown that a conformational change is required to form HAMLET from alpha-lactalbumin, and that a partially unfolded conformation is maintained in the HAMLET complex. This study examined if unfolding of alpha-lactalbumin is sufficient to induce cell death. We used the bovine alpha-lactalbumin Ca(2+) site mutant D87A, which is unable to bind Ca(2+), and thus remains partially unfolded regardless of solvent conditions. The D87A mutant protein was found to be inactive in the apoptosis assay, but could readily be converted to a HAMLET-like complex in the presence of oleic acid. BAMLET (bovine alpha-lactalbumin made lethal to tumor cells) and D87A-BAMLET complexes were both able to kill tumor cells. This activity was independent of the Ca(2+)site, as HAMLET maintained a high affinity for Ca(2+) but D87A-BAMLET was active with no Ca(2+) bound. We conclude that partial unfolding of alpha-lactalbumin is necessary but not sufficient to trigger cell death, and that the activity of HAMLET is defined both by the protein and the lipid cofactor. Furthermore, a functional Ca(2+)-binding site is not required for conversion of alpha-lactalbumin to the active complex or to cause cell death. This suggests that the lipid cofactor stabilizes the altered fold without interfering with the Ca(2+)site.
Santoro, Stephen P.; Kim, Soorin; Motz, Gregory T.; Alatzoglou, Dimitrios; Li, Chunsheng; Irving, Melita; Powell, Daniel J.; Coukos, George
2014-01-01
Aberrant blood vessels enable tumor growth, provide a barrier to immune infiltration, and serve as a source of pro-tumorigenic signals. Targeting tumor blood vessels for destruction, or tumor vascular disruption therapy, can therefore provide significant therapeutic benefit. Here we describe the ability of chimeric antigen receptor (CAR)-bearing T cells to recognize human prostate-specific membrane antigen (hPSMA) on endothelial targets in vitro as well as in vivo. CAR T cells were generated using the anti-PSMA scFv, J591, and the intracellular signaling domains: CD3ζ, CD28, and/or CD137/4-1BB. We found that all anti-hPSMA CAR T cells recognized and eliminated PSMA+ endothelial targets in vitro, regardless of the signaling domain. T cells bearing the 3rd generation anti-hPSMA CAR, P28BBζ, were able to recognize and kill primary human endothelial cells isolated from gynecologic cancers. In addition, the P28BBζ CAR T cells mediated regression of hPSMA-expressing vascular neoplasms in mice. Finally, in murine models of ovarian cancers populated by murine vessels expressing hPSMA, the P28BBζ CAR T cells were able to ablate PSMA+ vessels, cause secondary depletion of tumor cells, and reduce tumor burden. Taken together, these results provide strong rationale for the use of CAR T cells as agents of tumor vascular disruption, specifically those targeting PSMA. PMID:25358763
Tamaki, Tomoaki; Iwakawa, Mayumi; Ohno, Tatsuya; Imadome, Kaori; Nakawatari, Miyako; Sakai, Minako; Tsujii, Hirohiko; Nakano, Takashi; Imai, Takashi
2009-05-01
To clarify how carbon-ion radiotherapy (C-ion) on primary tumors affects the characteristics of subsequently arising metastatic tumor cells. Mouse squamous cell carcinomas, NR-S1, in synergic C3H/HeMsNrs mice were irradiated with a single dose of 5-50 Gy of C-ion (290 MeV per nucleon, 6-cm spread-out Bragg peak) or gamma-rays ((137)Cs source) as a reference beam. The volume of the primary tumors and the number of metastatic nodules in lung were studied, and histologic analysis and microarray analysis of laser-microdissected tumor cells were also performed. Including 5 Gy of C-ion and 8 Gy of gamma-rays, which did not inhibit the primary tumor growth, all doses used in this study inhibited lung metastasis significantly. Pathologic findings showed no difference among the metastatic tumor nodules in the nonirradiated, C-ion-irradiated, and gamma-ray-irradiated groups. Clustering analysis of expression profiles among metastatic tumors and primary tumors revealed a single cluster consisting of metastatic tumors different from their original primary tumors, indicating that the expression profiles of the metastatic tumor cells were not affected by the local application of C-ion or gamma-ray radiotherapy. We found no difference in the incidence and histology, and only small differences in expression profile, of distant metastasis between local C-ion and gamma-ray radiotherapy. The application of local radiotherapy per se or the type of radiotherapy applied did not influence the transcriptional changes caused by metastasis in tumor cells.
Adenovirus-mediated p53 gene delivery inhibits 9L glioma growth in rats.
Badie, B; Drazan, K E; Kramar, M H; Shaked, A; Black, K L
1995-06-01
Adenoviral vectors have recently been shown to effectively deliver genes into a variety of tissues. Since these vectors have some advantages over the more extensively investigated retroviruses, we studied the effect of two replication-defective adenovectors bearing human wild type tumor suppressor gene p53 (Adp53) and Escherichia coli beta-galactosidase gene (AdLacZ) on 9L glioma cells. Successful in vitro gene transfer was shown by DNA polymerase chain reaction (PCR), and expression was confirmed by reverse transcriptase RNA PCR and Western blot analyses. Transduction of 9L cells with the Adp53 inhibited cell growth and induced phenotypic changes consistent with cell death at low titers, while AdLacZ caused cytopathic changes only at high titers. Stereotactic injection of AdLacZ (10(7) plaque forming units) into tumor bed stained 25 to 30% of tumor cells at the site of vector delivery. Injection of Adp53 (10(7) plaque forming units), but not AdLacZ (controls), into established 4-day old 9L glioma brain tumors decreased tumor volume by 40% after 14 days. As a step toward gene therapy of brain tumors using replication-defective adenoviruses, these data support the use of tumor suppressor gene transfer for in vivo treatment of whole animal brain tumor models.
Markowitz, Geoffrey J; Michelotti, Gregory A; Diehl, Anna Mae; Wang, Xiao-Fan
2015-04-01
Initiation and progression of hepatocellular carcinoma (HCC) is intimately associated with a chronically diseased liver tissue. This diseased liver tissue background is a drastically different microenvironment from the healthy liver, especially with regard to immune cell prevalence and presence of mediators of immune function. To better understand the consequences of liver disease on tumor growth and the interplay with its microenvironment, we utilized two standard methods of fibrosis induction and orthotopic implantation of tumors into the inflamed and fibrotic liver to mimic the liver condition in human HCC patients. Compared to non-diseased controls, tumor growth was significantly enhanced under fibrotic conditions. The immune cells that infiltrated the tumors were also drastically different, with decreased numbers of natural killer cells but greatly increased numbers of immune-suppressive CD11b + Gr1 hi myeloid cells in both models of fibrosis. In addition, there were model-specific differences: Increased numbers of CD11b + myeloid cells and CD4 + CD25 + T cells were found in tumors in the bile duct ligation model but not in the carbon tetrachloride model. Induction of fibrosis altered the cytokine production of implanted tumor cells, which could have farreaching consequences on the immune infiltrate and its functionality. Taken together, this work demonstrates that the combination of fibrosis induction with orthotopic tumor implantation results in a markedly different tumor microenvironment and tumor growth kinetics, emphasizing the necessity for more accurate modeling of HCC progression in mice, which takes into account the drastic changes in the tissue caused by chronic liver disease.
COX-2 and PPAR-γ confer cannabidiol-induced apoptosis of human lung cancer cells.
Ramer, Robert; Heinemann, Katharina; Merkord, Jutta; Rohde, Helga; Salamon, Achim; Linnebacher, Michael; Hinz, Burkhard
2013-01-01
The antitumorigenic mechanism of cannabidiol is still controversial. This study investigates the role of COX-2 and PPAR-γ in cannabidiol's proapoptotic and tumor-regressive action. In lung cancer cell lines (A549, H460) and primary cells from a patient with lung cancer, cannabidiol elicited decreased viability associated with apoptosis. Apoptotic cell death by cannabidiol was suppressed by NS-398 (COX-2 inhibitor), GW9662 (PPAR-γ antagonist), and siRNA targeting COX-2 and PPAR-γ. Cannabidiol-induced apoptosis was paralleled by upregulation of COX-2 and PPAR-γ mRNA and protein expression with a maximum induction of COX-2 mRNA after 8 hours and continuous increases of PPAR-γ mRNA when compared with vehicle. In response to cannabidiol, tumor cell lines exhibited increased levels of COX-2-dependent prostaglandins (PG) among which PGD(2) and 15-deoxy-Δ(12,14)-PGJ(2) (15d-PGJ(2)) caused a translocation of PPAR-γ to the nucleus and induced a PPAR-γ-dependent apoptotic cell death. Moreover, in A549-xenografted nude mice, cannabidiol caused upregulation of COX-2 and PPAR-γ in tumor tissue and tumor regression that was reversible by GW9662. Together, our data show a novel proapoptotic mechanism of cannabidiol involving initial upregulation of COX-2 and PPAR-γ and a subsequent nuclear translocation of PPAR-γ by COX-2-dependent PGs.
Chromosomal Translocations: Chicken or Egg? | Center for Cancer Research
Many tumor cells have abnormal chromosomes. Some of these abnormalities are caused by chromosomal translocations, which occur when two chromosomes break and incorrectly rejoin, resulting in an exchange of genetic material. Translocations can activate oncogenes, silence tumor suppressor genes, or result in the creation of completely new fusion gene products. While there is little doubt that chromosomal translocations can contribute to cancer, there is an active "chicken and the egg" discussion about the role translocations and other chromosomal abnormalities play—do they actually cause cancer or merely occur because of other changes within the cancer cell.
The pancreatic niche inhibits the effectiveness of sunitinib treatment of pancreatic cancer
Martínez-Bosch, Neus; Guerrero, Pedro Enrique; Moreno, Mireia; José, Anabel; Iglesias, Mar; Munné-Collado, Jessica; Anta, Héctor; Gibert, Joan; Orozco, Carlos Alberto; Vinaixa, Judith; Fillat, Cristina; Viñals, Francesc; Navarro, Pilar
2016-01-01
Current treatments for pancreatic ductal adenocarcinoma (PDA) are ineffective, making this the 4th leading cause of cancer deaths. Sunitinib is a broad-spectrum inhibitor of tyrosine kinase receptors mostly known for its anti-angiogenic effects. We tested the therapeutic effects of sunitinib in pancreatic cancer using the Ela-myc transgenic mouse model. We showed that Ela-myc pancreatic tumors express PDGFR and VEGFR in blood vessels and epithelial cells, rendering these tumors sensitive to sunitinib by more than only its anti-angiogenic activity. However, sunitinib treatment of Ela-myc mice with either early or advanced tumor progression had no impact on either survival or tumor burden. Further histopathological characterization of these tumors did not reveal differences in necrosis, cell differentiation, angiogenesis, apoptosis or proliferation. In stark contrast, in vitro sunitinib treatment of Ela-myc– derived cell lines showed high sensitivity to the drug, with increased apoptosis and reduced proliferation. Correspondingly, subcutaneous tumors generated from these cell lines completely regressed in vivo after sunitinib treatments. These data point at the pancreatic tumor microenvironment as the most likely barrier preventing sunitinib treatment efficiency in vivo. Combined treatments with drugs that disrupt tumor fibrosis may enhance sunitinib therapeutic effectiveness in pancreatic cancer treatment. PMID:27374084
Kozin, S V; Shkarin, P; Gerweck, L E
2001-06-15
The extracellular pH is lower in tumor than in normal tissue, whereas their intracellular pH is similar. In this study, we show that the tumor-specific pH gradient may be exploited for the treatment of cancer by weak acid chemotherapeutics. i.v.-injected glucose substantially decreased the electrode estimated extracellular pH in a xenografted human tumor while its intracellular pH, evaluated by (31)P magnetic resonance spectroscopy, remained virtually unchanged. The resulting increase in the average cell pH gradient caused a parallel increase in tumor growth delay by the weak acid chlorambucil (CHL). Regardless of glucose administration, the effect of CHL was significantly greater in tumors preirradiated with a large dose of ionizing radiation. This suggests that CHL was especially pronounced in radioresistant hypoxic cells possessing a larger transmembrane pH gradient. These results indicate that the naturally occurring cell pH gradient difference between tumor and normal tissue is a major and exploitable determinant of the uptake of weak acids in the complex tumor microenvironment. The use of such drugs may be especially effective in combination with radiation.
Daman, Zahra; Faghihi, Homa; Montazeri, Hamed
2018-05-02
Recently, salinomycin (SAL) has been reported to inhibit proliferation and induce apoptosis in various tumors. The aim of this study was to deliver SAL to orthotopic model of pancreatic cancer by the aid of poly(lactic-co-glycolic acid) (PLGA) nanoparticles (NPs). The NPs were physico-chemically characterized and evaluated for cytotoxicity on luciferase-transduced AsPC-1 cells in vitro as well as implanted orthotopically into the pancreas of nude mice. SAL (3.5 mg/kg every other day) blocked tumor growth by 52% compared to the control group after 3 weeks of therapy. Western blotting of tumor protein extracts indicated that SAL treatment leads to up-regulation of E-cadherin, β-catenin, and transforming growth factor beta receptor (TGFβR) expressions in AsPC-1 orthotopic tumor. Noteworthy, immunofluorescence staining of adjacent tumor sections showed that treatment with SAL NPs cause significant apoptosis in the tumor cells rather than the stroma. Further investigations also revealed that TGFβR2 over-expression was induced in stroma cells after treatment with SAL NPs. These results highlight SAL-loaded PLGA NPs as a promising system for pancreatic cancer treatment, while the mechanistic questions need to be subsequently tested.
CD133+ tumor initiating cells in a syngenic murine model of pancreatic cancer respond to Minnelide.
Banerjee, Sulagna; Nomura, Alice; Sangwan, Veena; Chugh, Rohit; Dudeja, Vikas; Vickers, Selwyn M; Saluja, Ashok
2014-05-01
Pancreatic adenocarcinoma is the fourth leading cause for cancer-related mortality with a survival rate of less than 5%. Late diagnosis and lack of effective chemotherapeutic regimen contribute to these grim survival statistics. Relapse of any tumor is largely attributed to the presence of tumor-initiating cells (TIC) or cancer stem cells (CSC). These cells are considered as hurdles to cancer therapy as no known chemotherapeutic compound is reported to target them. Thus, there is an urgent need to develop a TIC-targeted therapy for pancreatic cancer. We isolated CD133(+) cells from a spontaneous pancreatic ductal adenocarcinoma mouse model and studied both surface expression, molecular markers of pancreatic TICs. We also studied tumor initiation properties by implanting low numbers of CD133(+) cells in immune competent mice. Effect of Minnelide, a drug currently under phase I clinical trial, was studied on the tumors derived from the CD133(+) cells. Our study showed for the first time that CD133(+) population demonstrated all the molecular markers for pancreatic TIC. These cells initiated tumors in immunocompetent mouse models and showed increased expression of prosurvival and proinvasive proteins compared to the CD133(-) non-TIC population. Our study further showed that Minnelide was very efficient in downregulating both CD133(-) and CD133(+) population in the tumors, resulting in a 60% decrease in tumor volume compared with the untreated ones. As Minnelide is currently under phase I clinical trial, its evaluation in reducing tumor burden by decreasing TIC as well as non-TIC population suggests its potential as an effective therapy. ©2014 AACR.
Nepal, Saroj; Kim, Mi Jin; Hong, Jin Tae; Kim, Sang Hyun; Sohn, Dong-Hwan; Lee, Sung Hee; Song, Kyung; Choi, Dong Young; Lee, Eung Seok; Park, Pil-Hoon
2015-01-01
Leptin, a hormone mainly produced from adipose tissue, has been shown to induce proliferation of cancer cells. However, the molecular mechanisms underlying leptin-induced tumor progression have not been clearly elucidated. In the present study, we investigated the role of autophagy in leptin-induced cancer cell proliferation using human hepatoma (HepG2) and breast cancer cells (MCF-7), and tumor growth in a xenograft model. Herein, we showed that leptin treatment caused autophagy induction as assessed by increase in expression of autophagy-related genes, including beclin-1, Atg5 and LC3 II, further induction of autophagosome formation and autophagic flux. Interestingly, inhibition of autophagic process by treatment with inhibitors and LC3B gene silencing blocked leptin-induced increase in cell number and suppression of apoptosis, indicating a crucial role of autophagy in leptin-induced tumor progression. Moreover, gene silencing of p53 or FoxO3A prevented leptin-induced LC3 II protein expression, suggesting an involvement of p53/FoxO3A axis in leptin-induced autophagy activation. Leptin administration also accelerated tumor growth in BALB/c nude mice, which was found to be autophagy dependent. Taken together, our results demonstrate that leptin-induced tumor growth is mediated by autophagy induction and autophagic process would be a promising target to regulate development of cancer caused by leptin production. PMID:25704884
Shinn, Helen Ki; Jung, Jong Kwon; Park, Jay Kim; Kim, Jong Hoon; Jung, In Young; Lee, Hong Sik
2012-03-01
Although paraganglioma (PGL), an extra-adrenal retroperitoneal pheochromocytoma (PHEO), is a rare catecholamine-secreting neuroendocrine tumor, it can cause severe hypertensive crisis during anesthesia or surgery if undiagnosed preoperatively. Extraluminal perigastric masses may be presumed to be gastrointestinal stromal tumors (GISTs) or soft tissue sarcomas even when histologic confirmation is not possible. Therefore, without a histologic diagnosis or symptoms of excessive catecholamine secretion, PGL may be mistaken for GIST. We report a case of preoperatively undiagnosed PGL which caused hypertensive crisis during anesthesia for retroperitoneal mass excision.
Harnessing tumor necrosis factor receptors to enhance antitumor activities of drugs.
Muntané, Jordi
2011-10-17
Cancer is the second-leading cause of death in the U.S. behind heart disease and over stroke. The hallmarks of cancer comprise six biological capabilities acquired during the multistep development of human tumors. The inhibition of cell death pathways is one of these tumor characteristics which also include sustained proliferative signaling, evading growth suppressor signaling, replicative immortality, angiogenesis, and promotion of invasion and metastasis. Cell death is mediated through death receptor (DR) stimulation initiated by specific ligands that transmit signaling to the cell death machinery or through the participation of mitochondria. Cell death involving DR is mediated by the superfamily of tumor necrosis factor receptor (TNF-R) which includes TNF-R type I, CD95, DR3, TNF-related apoptosis-inducing ligand (TRAIL) receptor-1 (TRAIL-R1) and -2 (TRAIL-R2), DR6, ectodysplasin A (EDA) receptor (EDAR), and the nerve growth factor (NGF) receptor (NGFR). The expression of these receptors in healthy and tumor cells induces treatment side effects that limit the systemic administration of cell death-inducing therapies. The present review is focused on the different therapeutic strategies such as targeted antibodies or small molecules addressed to selective stimulated DR-mediated apoptosis or reduce cell proliferation in cancer cells.
Martin, Janet L; Julovi, Sohel M; Lin, Mike Z; de Silva, Hasanthi C; Boyle, Frances M; Baxter, Robert C
2017-08-04
New molecular targets are needed for women with triple-negative breast cancer (TNBC). This pre-clinical study investigated the combination of the EGFR inhibitor gefitinib with the sphingosine kinase (SphK) inhibitor FTY720 (Fingolimod), aiming to block tumorigenic signaling downstream of IGFBP-3, which is abundantly expressed in basal-like TNBC. In studies of breast cancer cell growth in culture, proliferation was monitored by IncuCyte live-cell imaging, and protein abundance was determined by western blotting. In vivo studies of mammary tumor growth used two models: orthotopic xenograft tumors derived from three basal-like TNBC cell lines, grown in immune-deficient mice, and syngeneic murine 4T1 tumors grown in immune-competent mice. Protein abundance in tumor tissue was assessed by immunohistochemistry. Quantitated by live-cell imaging, the inhibitor combination showed synergistic cytostatic activity in basal-like cell lines across several TNBC molecular subtypes, the synergy being decreased by IGFBP-3 downregulation. Suppression of the tumorigenic mediator CD44 by gefitinib was potentiated by FTY720, consistent with CD44 involvement in the targeted pathway. In MDA-MB-468 and HCC1806 orthotopic TNBC xenograft tumors in nude mice, the drug combination inhibited tumor growth and prolonged mouse survival, although this effect was not significant for the gefitinib-resistant cell line HCC70. Combination treatment of murine 4T1 TNBC tumors in syngeneic BALB/c mice was more effective in immune-competent than immune-deficient (nude) mice, and a relative loss of tumor CD3 (T-cell) immunoreactivity caused by FTY720 treatment alone was alleviated by the drug combination, suggesting that, even at an FTY720 dose causing relative lymphopenia, the combination is still effective in an immune-competent setting. Immunohistochemistry of xenograft tumors showed significant enhancement of caspase-3 cleavage and suppression of Ki67 and phospho-EGFR by the drug combination, but SphK1 downregulation occurred only in MDA-MB-468 tumors, so is unlikely to be integral to treatment efficacy. Our data indicate that targeting IGFBP-3-dependent signaling pathways through gefitinib-FTY720 co-therapy may be effective in many basal-like breast cancers, and suggest tissue IGFBP-3 and CD44 measurement as potential biomarkers of treatment efficacy.
2013-05-30
Breast Cancer; Graft Versus Host Disease; Kidney Cancer; Leukemia; Lymphoma; Mucositis; Multiple Myeloma; Plasma Cell Neoplasm; Myelodysplastic Syndromes; Neuroblastoma; Ovarian Cancer; Sarcoma; Testicular Germ Cell Tumor
Li, Jingjing; Chen, Kan; Wang, Fan; Dai, Weiqi; Li, Sainan; Feng, Jiao; Wu, Liwei; Liu, Tong; Xu, Shizan; Xia, Yujing; Lu, Jie; Zhou, Yingqun; Xu, Ling; Guo, Chuanyong
2017-07-11
Methyl jasmonate has recently been found to have anti-cancer activity. Methyl jasmonate detached hexokinase 2 from a voltage dependent anion channel causing a reduction in mitochondrial transmembrane potential that led to the release of cytochrome C and apoptosis inducing factor resulting in intrinsic apoptosis. Blocked adenosine triphosphate synthesis caused by mitochondrial injury hampered oxidative phosphorylation and led to cell necrosis. The results were applied to the in vivo treatment of nude mice with a satisfactory effect. Collectively, our results suggest that methyl jasmonate may be an adjuvant therapy for liver tumors due to its mechanism in cancer cells compared to that in normal cells: The major function is to inhibit glycolysis instead of changing aerobic metabolism.
Li, Jingjing; Chen, Kan; Wang, Fan; Dai, Weiqi; Li, Sainan; Feng, Jiao; Wu, Liwei; Liu, Tong; Xu, Shizan; Xia, Yujing; Lu, Jie; Zhou, Yingqun; Xu, Ling; Guo, Chuanyong
2017-01-01
Methyl jasmonate has recently been found to have anti-cancer activity. Methyl jasmonate detached hexokinase 2 from a voltage dependent anion channel causing a reduction in mitochondrial transmembrane potential that led to the release of cytochrome C and apoptosis inducing factor resulting in intrinsic apoptosis. Blocked adenosine triphosphate synthesis caused by mitochondrial injury hampered oxidative phosphorylation and led to cell necrosis. The results were applied to the in vivo treatment of nude mice with a satisfactory effect. Collectively, our results suggest that methyl jasmonate may be an adjuvant therapy for liver tumors due to its mechanism in cancer cells compared to that in normal cells: The major function is to inhibit glycolysis instead of changing aerobic metabolism. PMID:28498814
Abhari, Alireza; Rahimzadeh, Sevda
2018-01-01
Cancer progression is a polygenic procedure in which the exosomes can function as substantial roles. Exosomes are tiny, phospholipid bilayer membrane nanovesicles of endocytic derivation with a diameter of 40–100 nm. These nanovesicles can transport bioactive molecules containing mRNAs, proteins, DNA fragments, and non-coding RNAs from a donor cell to recipient cells, and cause the alteration in genetic and epigenetic factors and reprogramming of the target cells. Many diverse cell types such as mesenchymal cells, immune cells, and cancer cells can induce the release of exosomes. Increasing evidence illustrated that the exosomes derived from tumor cells might trigger the tumor initiation, tumor cell growth and progression, metastasis, and drug resistance. The secreted nanovesicles of exosomes can play significant roles in cells communicate via shuttling the nucleic acid molecules and proteins to target cells and tissues. In this review, we discussed multiple mechanisms related to biogenesis, load, and shuttle of the exosomes. Also, we illustrated the diverse roles of exosomes in several types of human cancer development, tumor immunology, angiogenesis, and metastasis. The exosomes may act as the promising biomarkers for the prognosis of various types of cancers which suggested a new pathway for anti-tumor therapeutic of these nanovesicles and promoted exosome-based cancer for clinical diagnostic and remedial procedures. PMID:29868251
Tumor-induced loss of mural Connexin 43 gap junction activity promotes endothelial proliferation.
Choudhary, Mayur; Naczki, Christine; Chen, Wenhong; Barlow, Keith D; Case, L Douglas; Metheny-Barlow, Linda J
2015-05-23
Proper functional association between mural cells and endothelial cells (EC) causes EC of blood vessels to become quiescent. Mural cells on tumor vessels exhibit decreased attachment to EC, which allows vessels to be unstable and proliferative. The mechanisms by which tumors prevent proper association between mural cells and EC are not well understood. Since gap junctions (GJ) play an important role in cell-cell contact and communication, we investigated whether loss of GJ plays a role in tumor-induced mural cell dissociation. Mural cell regulation of endothelial proliferation was assessed by direct co-culture assays of fluorescently labeled cells quantified by flow cytometry or plate reader. Gap junction function was assessed by parachute assay. Connexin 43 (Cx43) protein in mural cells exposed to conditioned media from cancer cells was assessed by Western and confocal microscopy; mRNA levels were assessed by quantitative real-time PCR. Expression vectors or siRNA were utilized to overexpress or knock down Cx43. Tumor growth and angiogenesis was assessed in mouse hosts deficient for Cx43. Using parachute dye transfer assay, we demonstrate that media conditioned by MDA-MB-231 breast cancer cells diminishes GJ communication between mural cells (vascular smooth muscle cells, vSMC) and EC. Both protein and mRNA of the GJ component Connexin 43 (Cx43) are downregulated in mural cells by tumor-conditioned media; media from non-tumorigenic MCF10A cells had no effect. Loss of GJ communication by Cx43 siRNA knockdown, treatment with blocking peptide, or exposure to tumor-conditioned media diminishes the ability of mural cells to inhibit EC proliferation in co-culture assays, while overexpression of Cx43 in vSMC restores GJ and endothelial inhibition. Breast tumor cells implanted into mice heterozygous for Cx43 show no changes in tumor growth, but exhibit significantly increased tumor vascularization determined by CD31 staining, along with decreased mural cell support detected by NG2 staining. Our data indicate that i) functional Cx43 is required for mural cell-induced endothelial quiescence, and ii) downregulation of Cx43 GJ by tumors frees endothelium to respond to angiogenic cues. These data define a novel and important role for maintained Cx43 function in regulation of vessel quiescence, and suggest its loss may contribute to pathological tumor angiogenesis.
Withaferin A (WFA) inhibits tumor growth and metastasis by targeting ovarian cancer stem cells.
Kakar, Sham S; Parte, Seema; Carter, Kelsey; Joshua, Irving G; Worth, Christopher; Rameshwar, Pranela; Ratajczak, Mariusz Z
2017-09-26
Ovarian cancer is the fifth leading cause of deaths due to cancer among women in the United States. In 2017, 22,440 women are expected to be diagnosed with ovarian cancer and 14,080 women will die with it. Currently used chemotherapies (Cisplatin or platinum/taxane combination) targets cancer cells, but spares cancer stem cells (CSCs), which are responsible for tumor relapse leading to recurrence of cancer. Aldehyde dehydrogenase I (ALDH1) positive cancer stem cells are one of the major populations in ovarian tumor and have been related to tumor progression and metastasis. In our studies, we observed expression of ALDH1 in both ovarian surface epithelium (OSE) and cortex with high levels of expression in OSE in normal ovary and benign (BN) tumor, compared to borderline (BL) and high grade (HG) ovarian tumors. In contrast, high levels of expression of ALDH1 were observed in cortex in BL and HG tumors compared to normal ovary and BN tumor. Withaferin A (WFA) alone or in combination with cisplatin (CIS) significantly inhibited the spheroid formation (tumorigenic potential) of isolated ALDH1 CSCs in vitro and significantly reduced its expression in tumors collected from mice bearing orthotopic ovarian tumor compared to control. Treatment of animals with CIS alone significantly increased the ALDH1 CSC population in tumors, suggesting that CIS targets cancer cells but spares cancer stem cells, which undergo amplification. WFA and CIS combination suppresses the expression of securin an "oncogene", suggesting that securin may serve as a downstream signaling gene to mediate the antitumor effects of WFA.
A Novel Ras Effector Pathway Found to Play Significant Role in Tumor Suppression | Poster
By Nancy Parrish, Staff Writer; photo by Richard Frederickson, Staff Photographer Normal cells have mechanisms to prevent the development of cancer. Among these is a type of tumor suppressor mechanism known as oncogene-induced senescence, or OIS, which halts the uncontrolled growth of cells caused by mutations in oncogenes. The oncogene Ras plays a crucial role in inducing OIS
Zhang, Yu; Davis, Celestia; Shah, Sapana; Hughes, Daniel; Ryan, James C; Altomare, Diego; Peña, Maria Marjorette O
2017-01-01
Liver metastasis is the major cause of death from colorectal cancer (CRC). Understanding its mechanisms is necessary for timely diagnosis and development of effective therapies. Interleukin-33 (IL-33) is an IL-1 cytokine family member that uniquely functions as a cytokine and nuclear factor. It is released by necrotic epithelial cells and activated innate immune cells, functioning as an alarmin or an early danger signal. Its role in invoking type 2 immune response has been established; however, it has contrasting roles in tumor development and metastasis. We identified IL-33 as a potently upregulated cytokine in a highly metastatic murine CRC cell line and examined its role in tumor growth and metastasis to the liver. IL-33 was transgenically expressed in murine and human adenocarcinoma and carcinoma cell lines and their growth and spontaneous metastasis to the liver were assessed in orthotopic models of CRC in wild-type C57Bl/6 and Il33 knockout mice. The results showed that increased expression of IL-33 in CRC cells enhanced their tumor take, growth, and liver metastasis. Tumor- rather than host-derived IL-33 induced the enhanced recruitment of CD11b + GR1 + and CD11b + F4/80 + myeloid cells to remodel the tumor microenvironment by increased expression of mobilizing cytokines, and tumor angiogenesis by activating endothelial cells. IL-33 expression was elevated in patient tumor tissues, induced early in adenoma development, and activated by pro-inflammatory cytokines derived from the tumor microenvironment. The data suggest that tumor-derived IL-33 modulates the tumor microenvironment to potently promote colon carcinogenesis and liver metastasis, underscoring its potential as a therapeutic target. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Ghrelin promotes oral tumor cell proliferation by modifying GLUT1 expression.
Kraus, Dominik; Reckenbeil, Jan; Wenghoefer, Matthias; Stark, Helmut; Frentzen, Matthias; Allam, Jean-Pierre; Novak, Natalija; Frede, Stilla; Götz, Werner; Probstmeier, Rainer; Meyer, Rainer; Winter, Jochen
2016-03-01
In our study, ghrelin was investigated with respect to its capacity on proliferative effects and molecular correlations on oral tumor cells. The presence of all molecular components of the ghrelin system, i.e., ghrelin and its receptors, was analyzed and could be detected using real-time PCR and immunohistochemistry. To examine cellular effects caused by ghrelin and to clarify downstream-regulatory mechanisms, two different oral tumor cell lines (BHY and HN) were used in cell culture experiments. Stimulation of either cell line with ghrelin led to a significantly increased proliferation. Signal transduction occurred through phosphorylation of GSK-3β and nuclear translocation of β-catenin. This effect could be inhibited by blocking protein kinase A. Glucose transporter1 (GLUT1), as an important factor for delivering sufficient amounts of glucose to tumor cells having high requirements for this carbohydrate (Warburg effect) was up-regulated by exogenous and endogenous ghrelin. Silencing intracellular ghrelin concentrations using siRNA led to a significant decreased expression of GLUT1 and proliferation. In conclusion, our study describes the role for the appetite-stimulating peptide hormone ghrelin in oral cancer proliferation under the particular aspect of glucose uptake: (1) tumor cells are a source of ghrelin. (2) Ghrelin affects tumor cell proliferation through autocrine and/or paracrine activity. (3) Ghrelin modulates GLUT1 expression and thus indirectly enhances tumor cell proliferation. These findings are of major relevance, because glucose uptake is assumed to be a promising target for cancer treatment.
Wang, Jian; Guli, Qie-Re; Ming, Xiao-Cui; Zhou, Hai-Tao; Cui, Yong-Jie; Jiang, Yue-Feng; Zhang, Di; Liu, Yang
2018-01-01
This study reports a case of primary mucinous carcinoma of the thyroid gland with signet-ring-cell differentiation, and reviews the literature to evaluate its real incidence and the prognosis of these patients. A 74-year-old Chinese woman, presenting with a mass in the right lobe of thyroid gland, came to the hospital. Computed tomography revealed a mass in the right lobe of the thyroid gland, accompanied with right neck lymphadenectasis and airway deviation caused by tumor compression. Thyroid imaging suggested a thyroid malignant tumor and suspicious lymph node metastasis. Histologically, the tumor was characterized by the tumor cells arranged in small nests or trabeculae with an abundant extracellular mucoid matrix. The tumor cells formed diffuse invasion among thyroid follicles. In the peripheral regions, prominent signet-ring-cells formed a sheet-like structure and extended into the extrathyroidal fat tissue. The tumor cells were diffusely positive for thyroid transcription factor-1 (TTF-1) and PAX8, while they were focally positive for pan-cytokeratin (AE1/AE3) and weakly expressed thyroglobulin. Based on the histological features and immunohistochemical profile, a diagnosis of primary mucinous carcinoma of the thyroid gland with signet-ring-cell differentiation was rendered. Using a panel of immunohistochemical markers may be helpful for differential diagnosis and for determining whether the tumor is primary or not.
DNA methylation profiles of ovarian epithelial carcinoma tumors and cell lines.
Houshdaran, Sahar; Hawley, Sarah; Palmer, Chana; Campan, Mihaela; Olsen, Mari N; Ventura, Aviva P; Knudsen, Beatrice S; Drescher, Charles W; Urban, Nicole D; Brown, Patrick O; Laird, Peter W
2010-02-22
Epithelial ovarian carcinoma is a significant cause of cancer mortality in women worldwide and in the United States. Epithelial ovarian cancer comprises several histological subtypes, each with distinct clinical and molecular characteristics. The natural history of this heterogeneous disease, including the cell types of origin, is poorly understood. This study applied recently developed methods for high-throughput DNA methylation profiling to characterize ovarian cancer cell lines and tumors, including representatives of three major histologies. We obtained DNA methylation profiles of 1,505 CpG sites (808 genes) in 27 primary epithelial ovarian tumors and 15 ovarian cancer cell lines. We found that the DNA methylation profiles of ovarian cancer cell lines were markedly different from those of primary ovarian tumors. Aggregate DNA methylation levels of the assayed CpG sites tended to be higher in ovarian cancer cell lines relative to ovarian tumors. Within the primary tumors, those of the same histological type were more alike in their methylation profiles than those of different subtypes. Supervised analyses identified 90 CpG sites (68 genes) that exhibited 'subtype-specific' DNA methylation patterns (FDR<1%) among the tumors. In ovarian cancer cell lines, we estimated that for at least 27% of analyzed autosomal CpG sites, increases in methylation were accompanied by decreases in transcription of the associated gene. The significant difference in DNA methylation profiles between ovarian cancer cell lines and tumors underscores the need to be cautious in using cell lines as tumor models for molecular studies of ovarian cancer and other cancers. Similarly, the distinct methylation profiles of the different histological types of ovarian tumors reinforces the need to treat the different histologies of ovarian cancer as different diseases, both clinically and in biomarker studies. These data provide a useful resource for future studies, including those of potential tumor progenitor cells, which may help illuminate the etiology and natural history of these cancers.
Targeting Quiescence in Prostate Cancer
actively dividing cancer cells causing primary tumor shrinkage, but leave behind quiescent cancer cells which may seed new, more aggressive and chemo...resistant cancers at a later date . During this first year of funding, we have successfully developed prostate cancer cell lines carrying fluorescent cell
NASA Astrophysics Data System (ADS)
Zhao, Tansy Y.
Heightened angiogenesis is both the pathophysiologic hallmark and the potential cause of therapy resistance for glioblastoma (GBM), a deadly brain tumor. It is thought that mesenchymal stem cells (MSCs) play important roles in neovascularization and tumor progression. We postulated that MSCs protect ECs against radiotherapy, which subsequently enhances tumor angiogenesis, and promotes GBM tumor recurrence following therapy. We therefore sought to establish the in-vitro endothelial cell response to stimulation by MSC condition media and ionizing radiation (IR) treatment. We established the gene expression profiles of endothelial cells in response to IR, MSCs and the combination of both. Within the same gene profiles, we identified a unique gene signature that was highly predictive of response to Bevacizumab for GBM patients. We also demonstrated that MSC increased the viability of ECs in response to IR. Protein analysis in ECs suggested MSC-mediated cell cycle arrest as a mechanism for radio-resistance in ECs.
Active immunotherapy for mouse breast cancer with irradiated whole-cell vaccine expressing VEGFR2.
Yan, Heng-Xiu; Cheng, Ping; Wei, Hai-Yan; Shen, Guo-Bo; Fu, Li-Xin; Ni, Jie; Wu, Yang; Wei, Yu-Quan
2013-04-01
As tumor-associated antigens are not well characterized for the majority of human tumors, polyvalent vaccines prepared with whole-tumor antigens are an attractive approach for tumor vaccination. Vascular endothelial growth factor receptor-2 (VEGFR2), as a model antigen with which to explore the feasibility of immunotherapy, has shown great promise as a tumor vaccine. However, the efficacy of immunotherapy is often not ideal when used alone. In this study, we explored the therapeutic efficacy of an irradiated AdVEGFR2-infected cell vaccine-based immunotherapy in the weakly immunogenic and highly metastatic 4T1 murine mammary cancer model. An adenovirus encoding the VEGFR2 gene (AdVEGFR2) was constructed. Lethally irradiated, virus-infected 4T1 cells were used as vaccines. Vaccination with lethally irradiated AdVEGFR2-infected 4T1 cells inhibited subsequent tumor growth and pulmonary metastasis compared with challenge inoculations. Angiogenesis was inhibited, and the number of CD8+ T lymphocytes was increased within the tumors. Antitumor activity was also caused by the adoptive transfer of isolated spleen lymphocytes. In vitro, the expression of HMGB1 and HSP70 in the AdVEGFR2‑infected 4T1 cells was increased, and was involved in the activation of tumor antigen-specific T-cell immunity. Our results indicate that the immunotherapy based on irradiated AdVEGFR2-infected whole-cancer cell vaccines may be a potentially effective strategy for 4T1 cancer treatment.
SHAN, CHAN-CHAN; SHI, LIANG-RONG; DING, MEI-QIAN; ZHU, YI-BEI; LI, XIAO-DONG; XU, BIN; JIANG, JING-TING; WU, CHANG-PING
2015-01-01
Radiofrequency ablation (RFA) causes coagulative necrosis of tumor tissue and the production of local tumor protein debris. These fragments of tumor protein debris contain a large number of various antigens, which can stimulate a specific cellular immune response. In the present study, dendritic cells (DCs) were loaded with tumor protein lysate antigens that were produced in situ by RFA, and were used to treat murine colon carcinoma in combination with cytokine-induced killer (CIK) cells. Subsequent to the treatment of murine colon carcinoma by RFA, the in situ supernatant of tumor lysis was collected and the DCs were loaded with the lysate antigen to generate Ag-DCs. CIK cells induced from the spleen cells of mice were co-cultured with Ag-DCs to generate Ag-DC-CIK cells. The results revealed that the Ag-DC-CIK cells exhibited strong antitumor activity in vitro and in vivo. The morphology and immunophenotypes of these cells were determined using microscopy and flow cytometry, respectively. The cytotoxic activity of Ag-DC-CIK cells was determined using a CCK-8 assay. To establish a mouse model, mice were randomized into Ag-DC-CIK, DC-CIK, CIK and PBS control groups and monitored for tumor growth and survival time. ANOVA was used to compare the trends in the three groups for implanted tumor volumes. The log-rank test was used to compare the survival time. The present findings indicated that DCs loaded with the protein lysate antigens of tumors, produced in situ by RFA, combined with CIK cells may be a novel strategy for cancer treatment. PMID:25788999
Reactive Oxygen Species in Normal and Tumor Stem Cells
Zhou, Daohong; Shao, Lijian; Spitz, Douglas R.
2014-01-01
Reactive oxygen species (ROS) play an important role in determining the fate of normal stem cells. Low levels of ROS are required for stem cells to maintain quiescence and self-renewal. Increases in ROS production cause stem cell proliferation/differentiation, senescence, and apoptosis in a dose-dependent manner, leading to their exhaustion. Therefore, the production of ROS in stem cells is tightly regulated to ensure that they have the ability to maintain tissue homeostasis and repair damaged tissues for the life span of an organism. In this chapter, we discuss how the production of ROS in normal stem cells is regulated by various intrinsic and extrinsic factors and how the fate of these cells is altered by the dysregulation of ROS production under various pathological conditions. In addition, the implications of the aberrant production of ROS by tumor stem cells for tumor progression and treatment are also discussed. PMID:24974178
Wang, Zhi Dong; Wei, Sheng Quan; Wang, Qin Yi
2015-01-01
Tumors require a vascular supply to grow and can achieve this via the expression of pro-angiogenic growth factors. Many potential oncogenic mutations have been identified in tumor angiogenesis. Somatic mutations in the small GTPase KRAS are the most common activating lesions found in human cancer, and are generally associated with poor response to standard therapies. Biguanides, such as the diabetes therapeutics metformin and phenformin, have demonstrated anti-tumor activity both in vitro and in vivo. The extracellular regulated protein kinases (ERK) signaling is known to be a major cellular target of biguanides. Based on KRAS activates several down-stream effectors leading to the stimulation of the RAF/mitogen-activated protein kinase/extracellular signal-regulated kinase (RAF/MEK/ERK) and phosphatidylinositol-3-kinase (PI3K) pathways, we investigated the anti-tumor effects of biguanides on the proliferation of KRAS-mutated tumor cells in vitro and on KRAS-driven tumor growth in vivo. In cancer cells harboring oncogenic KRAS, phenformin switches off the ERK pathway and inhibit the expression of pro-angiogenic molecules. In tumor xenografts harboring the KRAS mutation, phenformin extensively modifies the tumor growth causing abrogation of angiogenesis. These results strongly suggest that significant therapeutic advantage may be achieved by phenformin anti-angiogenesis for the treatment of tumor.
Hatzold, Julia; Beleggia, Filippo; Herzig, Hannah; Altmüller, Janine; Nürnberg, Peter; Bloch, Wilhelm; Wollnik, Bernd; Hammerschmidt, Matthias
2016-01-01
The molecular pathways underlying tumor suppression are incompletely understood. Here, we identify cooperative non-cell-autonomous functions of a single gene that together provide a novel mechanism of tumor suppression in basal keratinocytes of zebrafish embryos. A loss-of-function mutation in atp1b1a, encoding the beta subunit of a Na,K-ATPase pump, causes edema and epidermal malignancy. Strikingly, basal cell carcinogenesis only occurs when Atp1b1a function is compromised in both the overlying periderm (resulting in compromised epithelial polarity and adhesiveness) and in kidney and heart (resulting in hypotonic stress). Blockade of the ensuing PI3K-AKT-mTORC1-NFκB-MMP9 pathway activation in basal cells, as well as systemic isotonicity, prevents malignant transformation. Our results identify hypotonic stress as a (previously unrecognized) contributor to tumor development and establish a novel paradigm of tumor suppression. DOI: http://dx.doi.org/10.7554/eLife.14277.001 PMID:27240166
Constantin, Carolina; Neagu, Monica
2015-01-01
The intrinsic fluorescence of synthetic or natural porphyrins is regarded as an attractive characteristic exploited for assisting early cancer diagnosis and/or tumor localization. Single tumor cells circulating in the blood stream can be considered a major step in depicting dissemination of primary tumors, an event of clinical relevance for prognosis, staging or therapy monitoring of cancer. The third leading cause of cancer death in men is colorectal cancer and the hematogenous spreading of primary tumor cells is one of the main events in metastasis of this type of cancer. Hidden in the myriad of circulating blood cells, tumor cells need both a sensitive and affordable detection technique. 5- (3-methoxy)-4-methoxycarbonylphenyl)-10, 15, 20-tris-(4- methoxycarbonylphenyl) - 21, 23-H porphyne is a synthetic porphyrin with a noticeable preference of accumulation in peripheral blood mononuclear cells isolated from cancer patients as assessed by flow cytometry analysis. In addition, we found distinct accumulation of porphyrin depending on cancer type (cutaneous melanoma versus colorectal cancer). These data lead to the possibility of identifying circulating cells based on preferential accumulation of this new porphyrin in circulating tumor cells because, even accumulated in low percentage of cells the registered intensity of fluorescence was high. Selecting the genetic markers for circulating tumor cells is an option, but high costs and high level of know-how can be somewhat a hurdle for a rapid evaluation. Thus our approach with a new porphyrin can be developed in an accurate and innovative fast tracking method for circulating cancer cells, at least in colorectal cancer patients.
Imaging Nuclear-Cytoplasmic Dynamics in Primary and Metastatic Colon Cancer in Nude Mice.
Hasegawa, Kosuke; Suetsugu, Atsushi; Nakamura, Miki; Matsumoto, Takuro; Aoki, Hitomi; Kunisada, Takahiro; Bouvet, Michael; Shimizu, Masahito; Hoffman, Robert M
2016-05-01
Colon cancer frequently results in metastasis to the liver, where it becomes the main cause of death. However, the cell cycle in primary tumors and metastases is poorly understood. We developed a mouse model of liver metastasis using the human colon cancer cell line HCT-116, which expresses green fluorescent protein (GFP) in the nucleus and red fluorescent protein (RFP) in the cytoplasm (HCT-116-GFP-RFP). HCT-116 GFP-RFP cells were injected into the spleen of nu/nu nude mice. HCT-116-GFP-RFP cells subsequently formed primary tumors in the spleen, as well as metastatic colonies in the liver and retroperitoneum by 28 days after cell transplantation. Using an Olympus FV1000 confocal microscope, it was possible to clearly image mitosis of the dual-colored colon cancer cells in the primary tumor as well as liver and other metastases. Multi-nucleate cancer cells, in addition to mono-nucleate cancer cells and their mitosis, were observed in the primary tumor and metastasis. Multi-nucleate HCT-116-GFP-RFP cells were also observed after culture of the primary and metastatic tumors. A similar ratio of mono-nucleate, multi-nucleate, and mitotic cells grew from the primary and metastatic tumors in culture, suggesting similarity of the nuclear-cytoplasmic dynamics of primary and metastatic cancer cells, further emphasizing the stochastic nature of metastasis. Our results demonstrate a similar heterogeneity of nuclear-cytoplasmic dynamics within primary tumors and metastases, which may be an important factor in the stochastic nature of metastasis. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Jabbar, Shaima; Reuhl, Kenneth; Sarkar, Dipak K
2018-05-16
Excess alcohol use is known to promote development of aggressive tumors in various tissues in human patients, but the cause of alcohol promotion of tumor aggressiveness is not clearly understood. We used an animals model of fetal alcohol exposure that is known to promote tumor development and determined if alcohol programs the pituitary to acquire aggressive prolactin-secreting tumors. Our results show that pituitaries of fetal alcohol-exposed rats produced increased levels of intra-pituitary aromatase protein and plasma estrogen, enhanced pituitary tissue growth, and upon estrogen challenge developed prolactin-secreting tumors (prolactinomas) that were hemorrhagic and often penetrated into the surrounding tissue. Pituitary tumors of fetal alcohol-exposed rats produced higher levels of hemorrhage-associated genes and proteins and multipotency genes and proteins. Cells of pituitary tumor of fetal alcohol exposed rat grew into tumor spheres in ultra-low attachment plate, expressed multipotency genes, formed an increased number of colonies, showed enhanced cell migration, and induced solid tumors following inoculation in immunodeficient mice. These data suggest that fetal alcohol exposure programs the pituitary to develop aggressive prolactinoma after estrogen treatment possibly due to increase in stem cell niche within the tumor microenvironment.
Condensin II mutation causes T-cell lymphoma through tissue-specific genome instability
Woodward, Jessica; Taylor, Gillian C.; Soares, Dinesh C.; Boyle, Shelagh; Sie, Daoud; Read, David; Chathoth, Keerthi; Vukovic, Milica; Tarrats, Nuria; Jamieson, David; Campbell, Kirsteen J.; Blyth, Karen; Acosta, Juan Carlos; Ylstra, Bauke; Arends, Mark J.; Kranc, Kamil R.; Jackson, Andrew P.; Bickmore, Wendy A.
2016-01-01
Chromosomal instability is a hallmark of cancer, but mitotic regulators are rarely mutated in tumors. Mutations in the condensin complexes, which restructure chromosomes to facilitate segregation during mitosis, are significantly enriched in cancer genomes, but experimental evidence implicating condensin dysfunction in tumorigenesis is lacking. We report that mice inheriting missense mutations in a condensin II subunit (Caph2nes) develop T-cell lymphoma. Before tumors develop, we found that the same Caph2 mutation impairs ploidy maintenance to a different extent in different hematopoietic cell types, with ploidy most severely perturbed at the CD4+CD8+ T-cell stage from which tumors initiate. Premalignant CD4+CD8+ T cells show persistent catenations during chromosome segregation, triggering DNA damage in diploid daughter cells and elevated ploidy. Genome sequencing revealed that Caph2 single-mutant tumors are near diploid but carry deletions spanning tumor suppressor genes, whereas P53 inactivation allowed Caph2 mutant cells with whole-chromosome gains and structural rearrangements to form highly aggressive disease. Together, our data challenge the view that mitotic chromosome formation is an invariant process during development and provide evidence that defective mitotic chromosome structure can promote tumorigenesis. PMID:27737961
Kisker, Oliver; Onizuka, Shinya; Becker, Christian M; Fannon, Michael; Flynn, Evelyn; D'Amato, Robert; Zetter, Bruce; Folkman, Judah; Ray, Rahul; Swamy, Narasimha; Pirie-Shepherd, Steven
2003-01-01
Abstract We have isolated a selectively deglycosylated form of vitamin D binding protein (DBP-maf) generated from systemically available DBP by a human pancreatic cancer cell line. DBP-maf is antiproliferative for endothelial cells and antiangiogenic in the chorioallantoic membrane assay. DBP-maf administered daily was able to potently inhibit the growth of human pancreatic cancer in immune compromised mice (T/C=0.09). At higher doses, DBP-maf caused tumor regression. Histological examination revealed that treated tumors had a higher number of infiltrating macrophages as well as reduced microvessel density, and increased levels of apoptosis relative to untreated tumors. Taken together, these data suggest that DBP-maf is an antiangiogenic molecule that can act directly on endothelium as well as stimulate macrophages to attack both the endothelial and tumor cell compartment of a growing malignancy. PMID:12659668
The Diagnosis and Treatment of Autoimmune Encephalitis
2016-01-01
Autoimmune encephalitis causes subacute deficits of memory and cognition, often followed by suppressed level of consciousness or coma. A careful history and examination may show early clues to particular autoimmune causes, such as neuromyotonia, hyperekplexia, psychosis, dystonia, or the presence of particular tumors. Ancillary testing with MRI and EEG may be helpful for excluding other causes, managing seizures, and, rarely, for identifying characteristic findings. Appropriate autoantibody testing can confirm specific diagnoses, although this is often done in parallel with exclusion of infectious and other causes. Autoimmune encephalitis may be divided into several groups of diseases: those with pathogenic antibodies to cell surface proteins, those with antibodies to intracellular synaptic proteins, T-cell diseases associated with antibodies to intracellular antigens, and those associated with other autoimmune disorders. Many forms of autoimmune encephalitis are paraneoplastic, and each of these conveys a distinct risk profile for various tumors. Tumor screening and, if necessary, treatment is essential to proper management. Most forms of autoimmune encephalitis respond to immune therapies, although powerful immune suppression for weeks or months may be needed in difficult cases. Autoimmune encephalitis may relapse, so follow-up care is important. PMID:26754777
2016-07-01
Chronic Myeloproliferative Disorders; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Nausea and Vomiting; Precancerous Condition; Small Intestine Cancer; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific
Anti-tumor activities of decursinol angelate and decursin from Angelica gigas.
Lee, Sanghyun; Lee, Yeon Sil; Jung, Sang Hoon; Shin, Kuk Hyun; Kim, Bak-Kwang; Kang, Sam Sik
2003-09-01
The in vivo anti-tumor activities of decursinol angelate (1) and decursin (2) isolated from the roots of Angelica gigas were investigated. These two compounds, when administered consecutively for 9 days at 50 and 100 mg/kg i.p. in mice, caused a significant increase in the life span and a significant decrease in the tumor weight and volume of mice inoculated with Sarcoma-180 tumor cells. These results suggest that decursinol angelate (1) and decursin (2) from A. gigas have anti-tumor activities.
NASA Astrophysics Data System (ADS)
Lapotko, Dmitri; Lukianova-Hleb, Ekaterina; Zhdanok, Sergei; Rostro, Betty; Simonette, Rebecca; Hafner, Jason; Konopleva, Marina; Andreeff, Michael; Conjusteau, Andre; Oraevsky, Alexander
2008-02-01
In an effort of developing clinical LANTCET (laser-activated nano-thermolysis as cell elimination technology) we achieved selective destruction of individual tumor cells through laser generation of vapor microbubbles around clusters of light absorbing gold nanorods (GNR) selectively formed in target tumor cells. Among all gold nanoparticles, nanorods offer the highest optical absorption in the near-infrared. We applied covalent conjugates of gold nanorods with targeting vectors such as monoclonal antibodies CD33 (specific for Acute Myeloid Leukemia), while GNR conjugates with polyethylene-glycol (PEG) were used as nonspecific targeting control. GNR clusters were formed inside the tumor cells at 37 °C due to endocytosis of large concentration of nanorods accumulated on the surface of tumor cells targeted at 4 °C. Formation of GNR clusters significantly reduces the threshold of tumor cell damage making LANTCET safe for normal cells. Appearance of GNR clusters was verified directly with optical resonance scattering microscopy. LANTCET was performed in vitro with living cells of (1) model myeloid K562 cells (CD33 positive), (2) primary human bone marrow CD33-positive blast cells from patients diagnosed with acute myeloid leukemia. Laser-induced microbubbles were generated and detected with a photothermal microscope equipped with a tunable Ti-Sa pulsed laser. GNT cluster formation caused a 100-fold decrease in the threshold optical fluence for laser microbubble generation in tumor cells compared with that in normal cells under the same targeting and irradiation conditions. Combining imaging based on resonance optical scattering with photothermal imaging of microbubbles, we developed a method for detection, image-guided treatment and monitoring of LANTCET. Pilot experiments were performed in flow mode bringing LANTCET closer to reality of clinical procedure of purging tumor cells from bone marrow grafts.
Bisetto, Sara; Newberg, Andrew; Doria, Cataldo; Levine, Mark; Monti, Daniel A.; Hoek, Jan B.
2016-01-01
We investigated the mechanism of selective ascorbate-induced cytotoxicity in tumor cells, including Hep G2 cells, compared to primary hepatocytes. H2O2 formation was required for ascorbate cytotoxicity, as extracellular catalase treatment protected tumor cells. H2O2 generated by glucose oxidase treatment also caused cell killing, but treatment with a pharmacological dose (5-20 mM) of ascorbate was significantly more cytotoxic at comparable rates of H2O2 production, suggesting that ascorbate enhanced H2O2 cytotoxicity. This was further supported by the finding that ascorbate at a non-cytotoxic dose (1 mM) enhanced cell killing caused by glucose oxidase. Consistent with this conclusion, ascorbate treatment caused deregulation of cellular calcium homeostasis, resulting in massive mitochondrial calcium accumulation. Ascorbate acted synergistically with the chemotherapeutic sorafenib in killing Hep G2 cells, but not primary hepatocytes, suggesting adjuvant ascorbate treatment can broaden sorafenib's therapeutic range. Sorafenib caused mitochondrial depolarization and prevented mitochondrial calcium sequestration. Subsequent ascorbate addition further deregulated cellular calcium homeostasis promoting cell death. Additionally, we present the case of a patient with hepatocellular carcinoma (HCC) who had prolonged regression of a rib metastasis upon combination treatment with ascorbate and sorafenib, indicating that these studies have direct clinical relevance. PMID:27036367
Rouleau, Lauren; Antony, Anil Noronha; Bisetto, Sara; Newberg, Andrew; Doria, Cataldo; Levine, Mark; Monti, Daniel A; Hoek, Jan B
2016-06-01
We investigated the mechanism of selective ascorbate-induced cytotoxicity in tumor cells, including Hep G2 cells, compared to primary hepatocytes. H2O2 formation was required for ascorbate cytotoxicity, as extracellular catalase treatment protected tumor cells. H2O2 generated by glucose oxidase treatment also caused cell killing, but treatment with a pharmacologic dose (5-20mM) of ascorbate was significantly more cytotoxic at comparable rates of H2O2 production, suggesting that ascorbate enhanced H2O2 cytotoxicity. This was further supported by the finding that ascorbate at a non-cytotoxic dose (1mM) enhanced cell killing caused by glucose oxidase. Consistent with this conclusion, ascorbate treatment caused deregulation of cellular calcium homeostasis, resulting in massive mitochondrial calcium accumulation. Ascorbate acted synergistically with the chemotherapeutic sorafenib in killing Hep G2 cells, but not primary hepatocytes, suggesting adjuvant ascorbate treatment can broaden sorafenib's therapeutic range. Sorafenib caused mitochondrial depolarization and prevented mitochondrial calcium sequestration. Subsequent ascorbate addition further deregulated cellular calcium homeostasis promoting cell death. Additionally, we present the case of a patient with hepatocellular carcinoma (HCC) who had prolonged regression of a rib metastasis upon combination treatment with ascorbate and sorafenib, indicating that these studies have direct clinical relevance. Copyright © 2016 Elsevier Inc. All rights reserved.
Targeting of tumor endothelium by RGD-grafted PLGA-nanoparticles.
Danhier, Fabienne; Pourcelle, Vincent; Marchand-Brynaert, Jacqueline; Jérôme, Christine; Feron, Olivier; Préat, Véronique
2012-01-01
The destruction of the neovessels in solid tumors can cause the death of tumor cells resulting from the lack of oxygen and nutrients. Peculiarities of the tumor vasculature, however, also position angiogenic endothelial cells as obvious targets to address cytotoxic drugs into the tumor. In particular, the identification of a three-amino acids sequence, arginine-glycine-aspartate (RGD), as a fundamental recognition site for proliferating endothelial attachment to the extracellular matrix leads to the development of tumor-targeting ligands for nanoparticles. The RGD peptide can target the α(v)β(3) integrin overexpressed by the tumor endothelium, and thereby increases the accumulation of drug-loaded RGD-grafted nanoparticles. RGD-nanoparticles may thus extravasate more efficiently and enter the tumor via the enhanced permeability and retention (EPR) effect. This combination of active and passive processes leads to the penetration of nanoparticles into the tumor tissue, followed by cellular uptake and intracellular delivery of the cytotoxic payload. Since cancer cells may also express α(v)β(3) integrin, the entrapping of RGD-nanoparticles into the tumor interstitial fluid may yet be facilitated through direct binding to cancer cells. Here, we describe methods used for the preparation of RGD-nanoparticles and for the validation of their potential of tumor endothelium targeting both in vitro and in vivo. We also illustrate how RGD-nanoparticles may be more suited than nontargeted modalities for the tumor delivery of poorly soluble and/or highly cytotoxic drugs, using different mouse tumor xenograft models. Copyright © 2012 Elsevier Inc. All rights reserved.
M1-like macrophages change tumor blood vessels and microenvironment in murine melanoma
Kamińska, Natalia; Matuszczak, Sybilla; Cichoń, Tomasz; Pamuła-Piłat, Jolanta; Czapla, Justyna; Smolarczyk, Ryszard; Skwarzyńska, Daria; Kulik, Klaudia; Szala, Stanisław
2018-01-01
Tumor-associated macrophages (TAMs) play a significant role in at least two key processes underlying neoplastic progression: angiogenesis and immune surveillance. TAMs phenotypic changes play important role in tumor vessel abnormalization/ normalization. M2-like TAMs stimulate immunosuppression and formation of defective tumor blood vessels leading to tumor progression. In contrast M1-like TAMs trigger immune response and normalize irregular tumor vascular network which should sensitize cancer cells to chemo- and radiotherapy and lead to tumor growth regression. Here, we demonstrated that combination of endoglin-based DNA vaccine with interleukin 12 repolarizes TAMs from tumor growth-promoting M2-like phenotype to tumor growth-inhibiting M1-like phenotype. Combined therapy enhances tumor infiltration by CD4+, CD8+ lymphocytes and NK cells. Depletion of TAMs as well as CD8+ lymphocytes and NK cells, but not CD4+ lymphocytes, reduces the effect of combined therapy. Furthermore, combined therapy improves tumor vessel maturation, perfusion and reduces hypoxia. It caused that suboptimal doses of doxorubicin reduced the growth of tumors in mice treated with combined therapy. To summarize, combination of antiangiogenic drug and immunostimulatory agent repolarizes TAMs phenotype from M2-like (pro-tumor) into M1-like (anti-tumor) which affects the structure of tumor blood vessels, improves the effect of chemotherapy and leads to tumor growth regression. PMID:29320562
MYC activation is a hallmark of cancer initiation and maintenance.
Gabay, Meital; Li, Yulin; Felsher, Dean W
2014-06-02
The MYC proto-oncogene has been implicated in the pathogenesis of most types of human tumors. MYC activation alone in many normal cells is restrained from causing tumorigenesis through multiple genetic and epigenetically controlled checkpoint mechanisms, including proliferative arrest, apoptosis, and cellular senescence. When pathologically activated in a permissive epigenetic and/or genetic context, MYC bypasses these mechanisms, enforcing many of the "hallmark" features of cancer, including relentless tumor growth associated with DNA replication and transcription, cellular proliferation and growth, protein synthesis, and altered cellular metabolism. MYC mandates tumor cell fate, by inducing stemness and blocking cellular senescence and differentiation. Additionally, MYC orchestrates changes in the tumor microenvironment, including the activation of angiogenesis and suppression of the host immune response. Provocatively, brief or even partial suppression of MYC back to its physiological levels of activation can result in the restoration of intrinsic checkpoint mechanisms, resulting in acute and sustained tumor regression, associated with tumor cells undergoing proliferative arrest, differentiation, senescence, and apoptosis, as well as remodeling of the tumor microenvironment, recruitment of an immune response, and shutdown of angiogenesis. Hence, tumors appear to be "addicted" to MYC because of both tumor cell-intrinsic, cell-autonomous and host-dependent, immune cell-dependent mechanisms. Both the trajectory and persistence of many human cancers require sustained MYC activation. Multiscale mathematical modeling may be useful to predict when tumors will be addicted to MYC. MYC is a hallmark molecular feature of both the initiation and maintenance of tumorigenesis. Copyright © 2014 Cold Spring Harbor Laboratory Press; all rights reserved.
Yang, Li-yun; He, Chang-yu; Chen, Xue-hua; Su, Li-ping; Liu, Bing-ya; Zhang, Hao
2016-01-01
Revival of dormant tumor cells may be an important tumor metastasis mechanism. We hypothesized that aurora kinase A (AURKA), a cell cycle control kinase, promotes the transition of laryngeal squamous cell carcinoma (LSCC) cells from G0 phase to active division. We therefore investigated whether AURKA could revive dormant tumor cells to promote metastasis. Western blotting revealed that AURKA expression was persistently low in dormant laryngeal cancer Hep2 (D-Hep2) cells and high in non-dormant (T-Hep2) cells. Decreasing AURKA expression in T-Hep2 cells induced dormancy and reduced FAK/PI3K/Akt pathway activity. Increasing AURKA expression in D-Hep2 cells increased FAK/PI3K/Akt pathway activity and enhanced cellular proliferation, migration, invasion and metastasis. In addition, FAK/PI3K/Akt pathway inhibition caused dormancy-like behavior and reduced cellular mobility, migration and invasion. We conclude that AURKA may revive dormant tumor cells via FAK/PI3K/Akt pathway activation, thereby promoting migration and invasion in laryngeal cancer. AURKA/FAK/PI3K/Akt inhibitors may thus represent potential targets for clinical LSCC treatment. PMID:27356739
Killing Cancer Cells with the Help of Infrared Light – Photoimmunotherapy
Near-infrared photoimmunotherapy uses an antibody–photoabsorber conjugate that binds to cancer cells. When near-infrared light is applied, the cells swell and then burst, causing the cancer cell to die. Photoimmunotherapy is in clinical trials in patients with inoperable tumors.
Torricelli, Fabio Cesar Miranda; Marchini, Giovanni Scala; Colombo, Jose Roberto; Coelho, Rafael Ferreira; Nahas, Willian Carlos; Srougi, Miguel
2015-01-01
A 25-year-old hypertensive female patient was referred to our institution. Initial workup exams demonstrated a 2.8 cm cortical lower pole tumor in the right kidney. She underwent laparoscopic partial nephrectomy without complications. Histopathologic examination revealed a rare juxtaglomerular cell tumor known as reninoma. After surgery, she recovered uneventfully and all medications were withdrawn. Case hypothesis: Secondary arterial hypertension is a matter of great interest to urologists and nephrologists. Renovascular hypertension, primary hyperadosteronism and pheocromocytoma are potential diagnosis that must not be forgotten and should be excluded. Although rare, chronic pyelonephritis and renal tumors as rennin-producing tumors, nephroblastoma, hypernephroma, and renal cell carcinoma might also induce hypertension and should be in the diagnostic list of clinicians. Promising future implications: Approximately 5% of patients with high blood pressure have specific causes and medical investigation may usually identify such patients. Furthermore, these patients can be successfully treated and cured, most times by minimally invasive techniques. This interesting case might expand knowledge of physicians and aid better diagnostic care in future medical practice.
Induction of parotitis by fine-needle aspiration in parotid Warthin's tumor.
Suzuki, Kensuke; Iwai, Hiroshi; Kaneko, Toshihiko; Sakaguchi, Mariko; Hoshino, Shoichi; Inaba, Muneo
2009-08-01
To estimate parotitis caused by fine-needle aspiration (FNA) in parotid Warthin tumor. Case series with chart review. Hospital records were reviewed for 104 parotid tumors (103 patients) including 35 Warthin tumors, which underwent FNA within our department. Three patients with four Warthin tumors among them noticed parotid pain, swelling, and abscess formation as a consequence of acute parotitis after FNA. Examinations of the materials obtained from tumor puncture or drainage before the start of antibiotic therapy showed no bacterial association in any patient. Two of the patients with Warthin tumor underwent parotidectomy, and the surgical specimens indicated histopathological changes with necrosis, abscess, granuloma, and the infiltration of inflammatory cells including Langhans-type multinucleated giant cells. It is conceivable that Warthin tumor bears the characteristics of inflammation induced by the FNA procedure without any relation to infection. Therefore, it may be better to avoid routine FNA and give priority to diagnostic imagings over FNA in the diagnosis of tumors strongly suspected as Warthin tumor.
Xp11.2 translocation tumor: a rare cause of gross hematuria.
Asaki, Howard E; Moshero, Gianni; Stanton, Melissa L; Humphreys, Mitchell R
2014-02-01
Xp11.2 translocation tumor is a rare but aggressive form of renal cell carcinoma that predominantly occurs in children but also may be found in young adults. Because this type of cancer is diagnosed via histologic and chromosomal analysis, clinicians should consider translocation tumor in the differential diagnosis of patients with renal lesions and gross hematuria.
Vinnitsky, Vladimir
2014-01-01
To date there is no explanation why the development of almost all types of solid tumors occurs sharing a similar scenario: (1) creation of a cancer stem cell (CSC), (2) CSC multiplication and formation of a multicellular tumor spheroid (TS), (3) vascularization of the TS and its transformation into a vascularized primary tumor, (4) metastatic spreading of CSCs, (5) formation of a metastatic TSs and its transformation into metastatic tumors, and (6) potentially endless repetition of this cycle of events. The above gaps in our knowledge are related to the biology of cancer and specifically to tumorigenesis, which covers the process from the creation of a CSC to the formation of a malignant tumor and the development of metastases. My Oncogerminative Theory of Tumorigenesis considers tumor formation as a dynamic self-organizing process that mimics a self-organizing process of early embryo development. In the initial step in that process, gene mutations combined with epigenetic dysregulation cause somatic cells to be reprogrammed into CSCs, which are immortal pseudo-germline cells. Mimicking the behavior of fertilized germline cells, the CSC achieves immortality by passing through the stages of its life-cycle and developing into a pseudo-blastula-stage embryo, which manifests in the body as a malignant tumor. In this view, the development of a malignant tumor from a CSC is a phenomenon of developmental biology, which we named a desperate asexual self-cloning event. The theory explains seven core characteristics of malignant tumors: (1) CSC immortality, (2) multistep development of a malignant tumor from a single CSC, (3) heterogeneity of malignant tumor cell populations, (4) metastatic spread of CSCs, (5) invasive growth, (6) malignant progression, and (7) selective immune tolerance toward cancer cells. The Oncogerminative Theory of Tumorigenesis suggests new avenues for discovery of revolutionary therapies to treat, prevent, and eradicate cancer. PMID:28232878
A Comprehensive Review of the Pharmacologic Management of Uterine Leiomyoma
Lewis, Terrence D.; Malik, Minnie; Britten, Joy; San Pablo, Angelo Macapagal
2018-01-01
Uterine leiomyomata are the most common benign tumors of the gynecologic tract impacting up to 80% of women by 50 years of age. It is well established that these tumors are the leading cause for hysterectomy with an estimated total financial burden greater than $30 billion per year in the United States. However, for the woman who desires future fertility or is a poor surgical candidate, definitive management with hysterectomy is not an optimal management plan. Typical gynecologic symptoms of leiomyoma include infertility, abnormal uterine bleeding (AUB)/heavy menstrual bleeding (HMB) and/or intermenstrual bleeding (IMB) with resulting iron-deficiency anemia, pelvic pressure and pain, urinary incontinence, and dysmenorrhea. The morbidity caused by these tumors is directly attributable to increases in tumor burden. Interestingly, leiomyoma cells within a tumor do not rapidly proliferate, but rather the increase in tumor size is secondary to production of an excessive, stable, and aberrant extracellular matrix (ECM) made of disorganized collagens and proteoglycans. As a result, medical management should induce leiomyoma cells toward dissolution of the extracellular matrix, as well as halting or inhibiting cellular proliferation. Herein, we review the current literature regarding the medical management of uterine leiomyoma. PMID:29780819
Anterior uveal spindle cell tumor in a cat.
Evans, Paige M; Lynch, Gwendolyn L; Dubielzig, Richard R
2010-11-01
To describe a case of anterior uveal spindle cell tumor in a cat with features similar to spindle cell tumor of blue eyed dogs. A 10-year-old female spayed domestic short-haired cat was referred for an iris mass OS. The mass was solitary, nodular, nonpigmented, located medially, and causing dyscoria. A diagnosis of a benign epithelial tumor was suggested by a FNA of the mass. The cat was lost to follow-up for 2 years, after which time she re-presented with glaucoma, blindness and grossly evident iridal mass enlargement OS. Transconjunctival enucleation was performed and the globe submitted for histopathology. Histopathology of the enucleated globe revealed the superior iris to be infiltrated and effaced by a large population of neoplastic spindle cells. The cells were arranged in streams and bundles and exhibited Antoni-A and Antoni-B tissue patterns, which are characteristic of Schwann cell tumors. Mitotic figures were rare and cellular pleomorphism moderate. Immunohistochemical staining was positive for S-100 protein and glial fibrillary acidic protein (GFAP), and negative for Melan-A. Interestingly, there was no histological evidence of glaucoma. Based on its histopathologic characteristics, this iris tumor was diagnosed as a Schwann cell variant of a peripheral nerve sheath tumor (PNST) closely resembling the spindle cell tumor of blue-eyed dogs. Anterior uveal PNST has not been previously reported in cats to the authors' knowledge. The presence of Antoni type A and type B tissue patterns along with immunohistochemical staining may facilitate a diagnosis of PNST and rule out malignant melanoma. © 2010 American College of Veterinary Ophthalmologists.
Amirkhosravi, A; Warnes, G; Biggerstaff, J; Malik, Z; May, K; Francis, J L
1997-07-01
Pentoxifylline (PTX) has been reported to have both direct and indirect anti-tumor effects in experimental tumor models. We studied the effect of PTX on (1) the proliferation of Neuro2a mouse neuroblastoma cells in vitro and in vivo, (2) spontaneous and experimental metastasis, (3) tumor cell membrane fluidity and (4) adhesion to a fibronectin-coated surface. PTX significantly reduced the proliferation of Neuro2a cells in vitro as determined by DNA measurement (P < 0.01) and total cell count (P < 0.02). In vivo, PTX reduced the growth of subcutaneously transplanted primary tumors in syngeneic A/J mice (P < 0.01; n = 15). All seven animals (100%) receiving intravenous tumor cells developed extensive liver metastasis. In contrast, only 1/11 (9%) of animals pre-treated with oral PTX and injected with PTX-treated cells developed liver metastases. Of five mice receiving PTX-treated cells without oral pretreatment of PTX, two out of five (40%) developed liver metastases. There was a slight, but not significant (P = 0.08) increase in both experimental and spontaneous lung metastases formation in PTX-treated animals. However, tumor nodule formation on the lung surface was inefficient. PTX also increased membrane fluidity of the Neuro2a cells and significantly decreased tumor cell adhesion to fibronectin-coated microtiter wells (P < 0.01). We conclude that PTX has a cytostatic effect on the Neuro2a mouse neuroblastoma and exerts an anti-tumor effect on liver metastases following intravenous administration of neuroblastoma cells. Whether these results are directly related to the changes in membrane properties caused by pentoxifylline remains to be established.
Gao, Ling; Deng, Hongju; Zhao, Haibo; Hirbe, Angela; Harding, John; Ratner, Lee; Weilbaecher, Katherine
2005-01-01
One in 20 carriers of human T-cell leukemia virus type 1 (HTLV-1) will develop adult T-cell leukemia/lymphoma (ATL), a disease frequently associated with hypercalcemia, bone destruction, and a fatal course refractory to current therapies. Overexpression of the HTLV-1–encoded Tax oncoprotein under the human granzyme B promoter causes large granular lymphocytic leukemia/lymphomas in mice. We found that Tax+ mice spontaneously developed hypercalcemia, high-frequency osteolytic bone metastases, and enhanced osteoclast activity. We evaluated Tax tumors for the production of osteoclast-activating factors. Purification of Tax+ tumor cells and nonmalignant tumor-infiltrating lymphocytes demonstrated that each of these populations expressed transcripts for distinct osteoclast-activating factors. We then evaluated the effect of osteoclast inhibition on tumor formation. Mice doubly transgenic for Tax and the osteoclast inhibitory factor, osteoprotegerin, were protected from osteolytic bone disease and developed fewer soft-tissue tumors. Likewise, osteoclast inhibition with bone-targeted zoledronic acid protected Tax+ mice from bone and soft-tissue tumors and prolonged survival. Tax+ mice represent the first animal model of high-penetrance spontaneous osteolytic bone metastasis and underscore the critical role of nonmalignant host cells recruited by tumor cells in the process of cancer progression and metastasis. PMID:16118323
BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.
Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili
2017-12-01
Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.
Kopecka, Joanna; Porto, Stefania; Lusa, Sara; Gazzano, Elena; Salzano, Giuseppina; Pinzòn-Daza, Martha Leonor; Giordano, Antonio; Desiderio, Vincenzo; Ghigo, Dario; De Rosa, Giuseppe; Caraglia, Michele; Riganti, Chiara
2016-01-01
The resistance to chemotherapy and the tumor escape from host immunosurveillance are the main causes of the failure of anthracycline-based regimens in breast cancer, where an effective chemo-immunosensitizing strategy is lacking. The clinically used aminobisphosphonate zoledronic acid (ZA) reverses chemoresistance and immunoresistance in vitro. Previously we developed a nanoparticle-based zoledronic acid-containing formulation (NZ) that allowed a higher intratumor delivery of the drug compared with free ZA in vivo. We tested its efficacy in combination with doxorubicin in breast tumors refractory to chemotherapy and immune system recognition as a new combinatorial approach to produce chemo- and immunosensitization. NZ reduced the IC50 of doxorubicin in human and murine chemoresistant breast cancer cells and restored the doxorubicin efficacy against chemo-immunoresistant tumors implanted in immunocompetent mice. By reducing the metabolic flux through the mevalonate pathway, NZ lowered the activity of Ras/ERK1/2/HIF-1α axis and the expression of P-glycoprotein, decreased the glycolysis and the mitochondrial respiratory chain, induced a cytochrome c/caspase 9/caspase 3-dependent apoptosis, thus restoring the direct cytotoxic effects of doxorubicin on tumor cell. Moreover, NZ restored the doxorubicin-induced immunogenic cell death and reversed the tumor-induced immunosuppression due to the production of kynurenine, by inhibiting the STAT3/indoleamine 2,3 dioxygenase axis. These events increased the number of dendritic cells and decreased the number of immunosuppressive T-regulatory cells infiltrating the tumors. Our work proposes the use of nanoparticle encapsulating zoledronic acid as an effective tool overcoming at the same time chemoresistance and immunoresistance in breast tumors, thanks to the effects exerted on tumor cell and tumor-infiltrating immune cells. PMID:26980746
Pattern response of dendritic cells in the tumor microenvironment and breast cancer
da Cunha, Alessandra; Michelin, Marcia A; Murta, Eddie FC
2014-01-01
Breast cancer (BC) is the most common malignant neoplasm and the cause of death by cancer among women worldwide. Its development, including malignancy grade and patient prognosis, is influenced by various mutations that occur in the tumor cell and by the immune system’s status, which has a direct influence on the tumor microenvironment and, consequently, on interactions with non-tumor cells involved in the immunological response. Among the immune response cells, dendritic cells (DCs) play a key role in the induction and maintenance of anti-tumor responses owing to their unique abilities for antigen cross-presentation and promotion of the activation of specific lymphocytes that target neoplasic cells. However, the tumor microenvironment can polarize DCs, transforming them into immunosuppressive regulatory DCs, a tolerogenic phenotype which limits the activity of effector T cells and supports tumor growth and progression. Various factors and signaling pathways have been implicated in the immunosuppressive functioning of DCs in cancer, and researchers are working on resolving processes that can circumvent tumor escape and developing viable therapeutic interventions to prevent or reverse the expression of immunosuppressive DCs in the tumor microenvironment. A better understanding of the pattern of DC response in patients with BC is fundamental to the development of specific therapeutic approaches to enable DCs to function properly. Various studies examining DCs immunotherapy have demonstrated its great potential for inducing immune responses to specific antigens and thereby reversing immunosuppression and related to clinical response in patients with BC. DC-based immunotherapy research has led to immense scientific advances, both in our understanding of the anti-tumor immune response and for the treatment of these patients. PMID:25114862
When Bcl-2 Is Absent, Anti-IGF1R Antibody Is Effective | Center for Cancer Research
A number of new agents being developed to treat cancer are able to kill cancer cells and cause tumor regression, but the mechanisms by which these drugs act, and the biological processes by which they induce cancer cell death are not clear. Understanding which pathways and proteins are influenced by an agent may help predict tumor responses and refine treatment regimens.
A new mild hyperthermia device to treat vascular involvement in cancer surgery.
Ware, Matthew J; Nguyen, Lam P; Law, Justin J; Krzykawska-Serda, Martyna; Taylor, Kimberly M; Cao, Hop S Tran; Anderson, Andrew O; Pulikkathara, Merlyn; Newton, Jared M; Ho, Jason C; Hwang, Rosa; Rajapakshe, Kimal; Coarfa, Cristian; Huang, Shixia; Edwards, Dean; Curley, Steven A; Corr, Stuart J
2017-09-12
Surgical margin status in cancer surgery represents an important oncologic parameter affecting overall prognosis. The risk of disease recurrence is minimized and survival often prolonged if margin-negative resection can be accomplished during cancer surgery. Unfortunately, negative margins are not always surgically achievable due to tumor invasion into adjacent tissues or involvement of critical vasculature. Herein, we present a novel intra-operative device created to facilitate a uniform and mild heating profile to cause hyperthermic destruction of vessel-encasing tumors while safeguarding the encased vessel. We use pancreatic ductal adenocarcinoma as an in vitro and an in vivo cancer model for these studies as it is a representative model of a tumor that commonly involves major mesenteric vessels. In vitro data suggests that mild hyperthermia (41-46 °C for ten minutes) is an optimal thermal dose to induce high levels of cancer cell death, alter cancer cell's proteomic profiles and eliminate cancer stem cells while preserving non-malignant cells. In vivo and in silico data supports the well-known phenomena of a vascular heat sink effect that causes high temperature differentials through tissues undergoing hyperthermia, however temperatures can be predicted and used as a tool for the surgeon to adjust thermal doses delivered for various tumor margins.
Müller, Nadja; Michen, Susanne; Tietze, Stefanie; Töpfer, Katrin; Schulte, Alexander; Lamszus, Katrin; Schmitz, Marc; Schackert, Gabriele; Pastan, Ira; Temme, Achim
2015-06-01
Natural killer (NK) cells are promising effector cells for adjuvant immunotherapy of cancer. So far, several preclinical studies have shown the feasibility of gene-engineered NK cells, which upon expression of chimeric antigen receptors (CARs) are redirected to otherwise NK cell-resistant tumors. Yet, we reasoned that the efficiency of an immunotherapy using CAR-modified NK cells critically relies on efficient migration to the tumor site and might be improved by the engraftment of a receptor specific for a chemokine released by the tumor. On the basis of the DNAX-activation protein 12 (DAP12), a signaling adapter molecule involved in signal transduction of activating NK cell receptors, we constructed an epidermal growth factor variant III (EGFRvIII)-CAR, designated MR1.1-DAP12 which confers specific cytotoxicity of NK cell towards EGFRvIII glioblastoma cells in vitro and to established subcutaneous U87-MG tumor xenografts. So far, infusion of NK cells with expression of MR1.1-DAP12 caused a moderate but significantly delayed tumor growth and increased median survival time when compared with NK cells transduced with an ITAM-defective CAR. Notably, the further genetic engineering of these EGFRvIII-specific NK cells with the chemokine receptor CXCR4 conferred a specific chemotaxis to CXCL12/SDF-1α secreting U87-MG glioblastoma cells. Moreover, the administration of such NK cells resulted in complete tumor remission in a number of mice and a significantly increased survival when compared with the treatment of xenografts with NK cells expressing only the EGFRvIII-specific CAR or mock control. We conclude that chemokine receptor-engineered NK cells with concomitant expression of a tumor-specific CAR are a promising tool to improve adoptive tumor immunotherapy.
Nevoid Basal Cell Carcinoma Syndrome (Gorlin Syndrome).
Bresler, Scott C; Padwa, Bonnie L; Granter, Scott R
2016-06-01
Nevoid basal cell carcinoma syndrome, or basal cell nevus syndrome (Gorlin syndrome), is a rare autosomal dominantly inherited disorder that is characterized by development of basal cell carcinomas from a young age. Other distinguishing clinical features are seen in a majority of patients, and include keratocystic odontogenic tumors (formerly odontogenic keratocysts) as well as dyskeratotic palmar and plantar pitting. A range of skeletal and other developmental abnormalities are also often seen. The disorder is caused by defects in hedgehog signaling which result in constitutive pathway activity and tumor cell proliferation. As sporadic basal cell carcinomas also commonly harbor hedgehog pathway aberrations, therapeutic agents targeting key signaling constituents have been developed and tested against advanced sporadically occurring tumors or syndromic disease, leading in 2013 to FDA approval of the first hedgehog pathway-targeted small molecule, vismodegib. The elucidation of the molecular pathogenesis of nevoid basal cell carcinoma syndrome has resulted in further understanding of the most common human malignancy.
Wang, Hua-Jie; Huang, Jing-Chun; Wu, Sha-Sha; Wang, Cai-Feng; Yu, Xue-Hong; Cao, Ying
2015-04-01
Although tumor is one of the most frequently occurring diseases and a leading cause of death, nanotechnology, one of the frontier sciences, is exhibiting its great potential to tumor treatments. The aim of this study was to design a facile and environmentally-friendly method to prepare bovine serum albumin-conjugated heavy metal sulfides nano-materials, including Ag2S, PbS and CdS. Here, bovine serum albumin was introduced in order to direct the synthesis of nano-materials by using its template effect and supply more sites for further modification in future. The crystal structure and morphology were analyzed by XRD and TEM, respectively. Additionally, the antineoplastic activity of nano-materials was compared by cell viability analysis, optical and electron microscopy observation after exposure of the human hepatoma cell line. The results showed that the inhibition effect of heavy metal sulfides on tumor cells was in the order of nano-PbS > bulk CdS > nano-Ag2S > nano-CdS > bulk PbS > bulk Ag2S. It could be concluded that heavy metal sulfides had significantly negative impact on human hepatoma cells growth but it could not be obviously generalized that nano-particles were always more effective to kill tumor cells than bulk materials. The size and surface reactivity might be the important factors causing the difference.
Huang, Chang-Yu; Wu, Guang-Jer
2016-04-01
Overexpression of METCAM/MUC18, an immunoglobulin-like cell-adhesion molecule, promotes tumorigenesis and progression of human breast cancer cells. We also observed an intriguing phenomenon that a high-expressing SK-BR-3 clone manifested a transient tumor suppression effect in vivo. The purpose of this study was to understand if this was caused by clonal variation, METCAM/MUC18-dosage effect, or the number of cells injected. Several G418-resistant clones of SK-BR-3, expressing different levels of METCAM/MUC18, were obtained for testing effects of human METCAM/MUC18 on in vitro motility, invasiveness, and anchorage-independent colony formation (in vitro tumorigenicity) and in vivo tumorigenesis in female Balb/C athymic nude mice. Tumor sections were made for histology and immunohistochemistry analyses, and tumor lysates for Western blot analysis to determine the effects of human METCAM/MUC18 expression on levels of various downstream effectors. METCAM/MUC18 promoted in vitro motility, invasiveness, and in vitro tumorigenicity of SK-BR-3 cells in a dosage-specific manner. Overexpression of METCAM/MUC18 could promote in vivo tumorigenesis of SK-BR-3 cells even when one tenth of the previously used cell number (5 × 10(5)) was injected and in vivo tumorigenesis of SK-BR-3 cells was directly proportional to the dosage of the protein. The previously observed transient tumor suppression effect from the same clone was no longer observed. The downstream effector, such as phospho-AKT/AKT ratio, was elevated in the tumors. Transient suppression observed previously in the clone was caused by injection of a high cell number (2 × 10(6)-5 × 10(6)). METCAM/MUC18 positively promotes tumorigenesis of SK-BR-3 cells by increasing the survival and proliferation pathway. Copyright © 2016. Published by Elsevier B.V.
Lee, Jaewoo; Lee, Youngju; Xu, Li; White, Rebekah; Sullenger, Bruce A
2017-06-07
Activation of the RNA-sensing pattern recognition receptor (PRR) in cancer cells leads to cell death and cytokine expression. This cancer cell death releases tumor antigens and damage-associated molecular patterns (DAMPs) that induce anti-tumor immunity. However, these cytokines and DAMPs also cause adverse inflammatory and thrombotic complications that can limit the overall therapeutic benefits of PRR-targeting anti-cancer therapies. To overcome this problem, we generated and evaluated two novel and distinct ssRNA molecules (immunogenic cell-killing RNA [ICR]2 and ICR4). ICR2 and ICR4 differentially stimulated cell death and PRR signaling pathways and induced different patterns of cytokine expression in cancer and innate immune cells. Interestingly, DAMPs released from ICR2- and ICR4-treated cancer cells had distinct patterns of stimulation of innate immune receptors and coagulation. Finally, ICR2 and ICR4 inhibited in vivo tumor growth as effectively as poly(I:C). ICR2 and ICR4 are potential therapeutic agents that differentially induce cell death, immune stimulation, and coagulation when introduced into tumors. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
Evasion of cell senescence in SHH medulloblastoma.
Tamayo-Orrego, Lukas; Swikert, Shannon M; Charron, Frédéric
2016-08-17
The mechanisms leading to brain tumor formation are poorly understood. Using Ptch1 +/- mice as a medulloblastoma model, sequential mutations were found to shape tumor evolution. Initially, medulloblastoma preneoplastic lesions display loss of heterozygosity of the Ptch1 wild-type allele, an event associated with cell senescence in preneoplasia. Subsequently, p53 mutations lead to senescence evasion and progression from preneoplasia to medulloblastoma. These findings are consistent with a model where high levels of Hedgehog signaling caused by the loss of the tumor suppressor Ptch1 lead to oncogene-induced senescence and drive p53 mutations. Thus, cell senescence is an important characteristic of a subset of SHH medulloblastoma and might explain the acquisition of somatic TP53 mutations in human medulloblastoma. This mode of medulloblastoma formation contrasts with the one characterizing Li-Fraumeni patients with medulloblastoma, where TP53 germ-line mutations cause chromothriptic genomic instability and lead to mutations in Hedgehog signaling genes, which drive medulloblastoma growth. Here we discuss in detail these 2 alternative mechanisms leading to medulloblastoma tumorigenesis.
Evasion of cell senescence in SHH medulloblastoma
Tamayo-Orrego, Lukas; Swikert, Shannon M.; Charron, Frédéric
2016-01-01
ABSTRACT The mechanisms leading to brain tumor formation are poorly understood. Using Ptch1+/− mice as a medulloblastoma model, sequential mutations were found to shape tumor evolution. Initially, medulloblastoma preneoplastic lesions display loss of heterozygosity of the Ptch1 wild-type allele, an event associated with cell senescence in preneoplasia. Subsequently, p53 mutations lead to senescence evasion and progression from preneoplasia to medulloblastoma. These findings are consistent with a model where high levels of Hedgehog signaling caused by the loss of the tumor suppressor Ptch1 lead to oncogene-induced senescence and drive p53 mutations. Thus, cell senescence is an important characteristic of a subset of SHH medulloblastoma and might explain the acquisition of somatic TP53 mutations in human medulloblastoma. This mode of medulloblastoma formation contrasts with the one characterizing Li-Fraumeni patients with medulloblastoma, where TP53 germ-line mutations cause chromothriptic genomic instability and lead to mutations in Hedgehog signaling genes, which drive medulloblastoma growth. Here we discuss in detail these 2 alternative mechanisms leading to medulloblastoma tumorigenesis. PMID:27229128
Rattanakorn, Kirk; Gadi, Abhilash; Verma, Narendra; Maurizi, Giulia; Gunaratne, Preethi H.; Coarfa, Cristian; Kennedy, Oran D.; Garabedian, Michael J.; Basilico, Claudio; Mansukhani, Alka
2016-01-01
Osteosarcoma (OS) is a highly aggressive pediatric bone cancer in which most tumor cells remain immature and fail to differentiate into bone-forming osteoblasts. However, OS cells readily respond to adipogenic stimuli suggesting they retain mesenchymal stem cell-like properties. Here we demonstrate that nuclear receptor PPARγ agonists such as the anti-diabetic, thiazolidinedione (TZD) drugs induce growth arrest and cause adipogenic differentiation in human, mouse and canine OS cells as well as in tumors in mice. Gene expression analysis reveals that TZDs induce lipid metabolism pathways while suppressing targets of the Hippo-YAP pathway, Wnt signaling and cancer-related proliferation pathways. Significantly, TZD action appears to be restricted to the high Sox2 expressing cancer stem cell population and is dependent on PPARγ expression. TZDs also affect growth and cell fate by causing the cytoplasmic sequestration of the transcription factors SOX2 and YAP that are required for tumorigenicity. Finally, we identify a TZD-regulated gene signature based on Wnt/Hippo target genes and PPARγ that predicts patient outcomes. Together, this work highlights a novel connection between PPARγ agonist in inducing adipogenesis and mimicking the tumor suppressive hippo pathway. It also illustrates the potential of drug repurposing for TZD-based differentiation therapy for osteosarcoma. PMID:27528232
In Vitro Tumor Models: Advantages, Disadvantages, Variables, and Selecting the Right Platform.
Katt, Moriah E; Placone, Amanda L; Wong, Andrew D; Xu, Zinnia S; Searson, Peter C
2016-01-01
In vitro tumor models have provided important tools for cancer research and serve as low-cost screening platforms for drug therapies; however, cancer recurrence remains largely unchecked due to metastasis, which is the cause of the majority of cancer-related deaths. The need for an improved understanding of the progression and treatment of cancer has pushed for increased accuracy and physiological relevance of in vitro tumor models. As a result, in vitro tumor models have concurrently increased in complexity and their output parameters further diversified, since these models have progressed beyond simple proliferation, invasion, and cytotoxicity screens and have begun recapitulating critical steps in the metastatic cascade, such as intravasation, extravasation, angiogenesis, matrix remodeling, and tumor cell dormancy. Advances in tumor cell biology, 3D cell culture, tissue engineering, biomaterials, microfabrication, and microfluidics have enabled rapid development of new in vitro tumor models that often incorporate multiple cell types, extracellular matrix materials, and spatial and temporal introduction of soluble factors. Other innovations include the incorporation of perfusable microvessels to simulate the tumor vasculature and model intravasation and extravasation. The drive toward precision medicine has increased interest in adapting in vitro tumor models for patient-specific therapies, clinical management, and assessment of metastatic potential. Here, we review the wide range of current in vitro tumor models and summarize their advantages, disadvantages, and suitability in modeling specific aspects of the metastatic cascade and drug treatment.
In Vitro Tumor Models: Advantages, Disadvantages, Variables, and Selecting the Right Platform
Katt, Moriah E.; Placone, Amanda L.; Wong, Andrew D.; Xu, Zinnia S.; Searson, Peter C.
2016-01-01
In vitro tumor models have provided important tools for cancer research and serve as low-cost screening platforms for drug therapies; however, cancer recurrence remains largely unchecked due to metastasis, which is the cause of the majority of cancer-related deaths. The need for an improved understanding of the progression and treatment of cancer has pushed for increased accuracy and physiological relevance of in vitro tumor models. As a result, in vitro tumor models have concurrently increased in complexity and their output parameters further diversified, since these models have progressed beyond simple proliferation, invasion, and cytotoxicity screens and have begun recapitulating critical steps in the metastatic cascade, such as intravasation, extravasation, angiogenesis, matrix remodeling, and tumor cell dormancy. Advances in tumor cell biology, 3D cell culture, tissue engineering, biomaterials, microfabrication, and microfluidics have enabled rapid development of new in vitro tumor models that often incorporate multiple cell types, extracellular matrix materials, and spatial and temporal introduction of soluble factors. Other innovations include the incorporation of perfusable microvessels to simulate the tumor vasculature and model intravasation and extravasation. The drive toward precision medicine has increased interest in adapting in vitro tumor models for patient-specific therapies, clinical management, and assessment of metastatic potential. Here, we review the wide range of current in vitro tumor models and summarize their advantages, disadvantages, and suitability in modeling specific aspects of the metastatic cascade and drug treatment. PMID:26904541
Brandmaier, Andrew; Hou, Sheng-Qi; Shen, Wen H
2017-07-21
Continuous and error-free chromosome inheritance through the cell cycle is essential for genomic stability and tumor suppression. However, accumulation of aberrant genetic materials often causes the cell cycle to go awry, leading to malignant transformation. In response to genotoxic stress, cells employ diverse adaptive mechanisms to halt or exit the cell cycle temporarily or permanently. The intrinsic machinery of cycling, resting, and exiting shapes the cellular response to extrinsic stimuli, whereas prevalent disruption of the cell cycle machinery in tumor cells often confers resistance to anticancer therapy. Phosphatase and tensin homolog (PTEN) is a tumor suppressor and a guardian of the genome that is frequently mutated or deleted in human cancer. Moreover, it is increasingly evident that PTEN deficiency disrupts the fundamental processes of genetic transmission. Cells lacking PTEN exhibit cell cycle deregulation and cell fate reprogramming. Here, we review the role of PTEN in regulating the key processes in and out of cell cycle to optimize genomic integrity. Copyright © 2017 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yusuf, Nabiha; Skin Diseases Research Center, University of Alabama at Birmingham, 1530 Third Avenue South, Birmingham, AL 35294-0009; Timares, Laura
Polyaromatic hydrocarbons are ubiquitous environmental pollutants that are potent mutagens and carcinogens. Researchers have taken advantage of these properties to investigate the mechanisms by which chemicals cause cancer of the skin and other organs. When applied to the skin of mice, several carcinogenic polyaromatic hydrocarbons have also been shown to interact with the immune system, stimulating immune responses and resulting in the development of antigen-specific T-cell-mediated immunity. Development of cell-mediated immunity is strain-specific and is governed by Ah receptor genes and by genes located within the major histocompatibility complex. CD8{sup +} T cells are effector cells in the response, whereasmore » CD4{sup +} T cells down-regulate immunity. Development of an immune response appears to have a protective effect since strains of mice that develop a cell-mediated immune response to carcinogenic polyaromatic hydrocarbons are less likely to develop tumors when subjected to a polyaromatic hydrocarbon skin carcinogenesis protocol than mice that fail to develop an immune response. With respect to innate immunity, TLR4-deficient C3H/HeJ mice are more susceptible to polyaromatic hydrogen skin tumorigenesis than C3H/HeN mice in which TLR4 is normal. These findings support the hypothesis that immune responses, through their interactions with chemical carcinogens, play an active role in the prevention of chemical skin carcinogenesis during the earliest stages. Efforts to augment immune responses to the chemicals that cause tumors may be a productive approach to the prevention of tumors caused by these agents.« less
Tumor vessel normalization after aerobic exercise enhances chemotherapeutic efficacy.
Schadler, Keri L; Thomas, Nicholas J; Galie, Peter A; Bhang, Dong Ha; Roby, Kerry C; Addai, Prince; Till, Jacob E; Sturgeon, Kathleen; Zaslavsky, Alexander; Chen, Christopher S; Ryeom, Sandra
2016-10-04
Targeted therapies aimed at tumor vasculature are utilized in combination with chemotherapy to improve drug delivery and efficacy after tumor vascular normalization. Tumor vessels are highly disorganized with disrupted blood flow impeding drug delivery to cancer cells. Although pharmacologic anti-angiogenic therapy can remodel and normalize tumor vessels, there is a limited window of efficacy and these drugs are associated with severe side effects necessitating alternatives for vascular normalization. Recently, moderate aerobic exercise has been shown to induce vascular normalization in mouse models. Here, we provide a mechanistic explanation for the tumor vascular normalization induced by exercise. Shear stress, the mechanical stimuli exerted on endothelial cells by blood flow, modulates vascular integrity. Increasing vascular shear stress through aerobic exercise can alter and remodel blood vessels in normal tissues. Our data in mouse models indicate that activation of calcineurin-NFAT-TSP1 signaling in endothelial cells plays a critical role in exercise-induced shear stress mediated tumor vessel remodeling. We show that moderate aerobic exercise with chemotherapy caused a significantly greater decrease in tumor growth than chemotherapy alone through improved chemotherapy delivery after tumor vascular normalization. Our work suggests that the vascular normalizing effects of aerobic exercise can be an effective chemotherapy adjuvant.
Shinn, Helen Ki; Jung, Jong Kwon; Park, Jay Kim; Kim, Jong Hoon; Jung, In Young
2012-01-01
Although paraganglioma (PGL), an extra-adrenal retroperitoneal pheochromocytoma (PHEO), is a rare catecholamine-secreting neuroendocrine tumor, it can cause severe hypertensive crisis during anesthesia or surgery if undiagnosed preoperatively. Extraluminal perigastric masses may be presumed to be gastrointestinal stromal tumors (GISTs) or soft tissue sarcomas even when histologic confirmation is not possible. Therefore, without a histologic diagnosis or symptoms of excessive catecholamine secretion, PGL may be mistaken for GIST. We report a case of preoperatively undiagnosed PGL which caused hypertensive crisis during anesthesia for retroperitoneal mass excision. PMID:22474560
Han, Xiaosi; Li, Rong; Zhang, Wenbin; Yang, Xiuhua; Fathallah-Shaykh, Hassan; Gillespie, Yancey; Nabors, Burt
2014-01-01
Protein arginine methyltransferase 5 (PRMT5) catalyzes the formation of ω-NG,N′G-symmetric dimethylarginine residues on histones as well as other proteins. The modification play an important role in cell differentiation and tumor cell growth. However, the role of PRMT5 in human glioma cells has not been characterized. In this study, we assessed protein expression profiles of PRMT5 in control brain, WHO grade II astrocytomas, anaplastic astrocytomas, and glioblastoma multiforme (GBM) by immunohistochemistry. PRMT5 was low in glial cells in control brain tissues and low grade astrocytomas. Its expression increased in parallel with malignant progression, and was highly expressed in GBM. Knockdown of PRMT5 by small hairpin RNA caused alterations of p-ERK1/2 and significantly repressed the clonogenic potential and viability of glioma cells. These findings indicate that PRMT5 is a marker of malignant progression in glioma tumors and plays a pivotal role in tumor growth.
Lakhin, A V; Efremova, A S; Makarova, I V; Grishina, E E; Shram, S I; Tarantul, V Z; Gening, L V
2013-01-01
The DNA polymerase iota (Pol iota), which has some peculiar features and is characterized by an extremely error-prone DNA synthesis, belongs to the group of enzymes preferentially activated by Mn2+ instead of Mg2+. In this work, the effect of Mn2+ on DNA synthesis in cell extracts from a) normal human and murine tissues, b) human tumor (uveal melanoma), and c) cultured human tumor cell lines SKOV-3 and HL-60 was tested. Each group displayed characteristic features of Mn-dependent DNA synthesis. The changes in the Mn-dependent DNA synthesis caused by malignant transformation of normal tissues are described. It was also shown that the error-prone DNA synthesis catalyzed by Pol iota in extracts of all cell types was efficiently suppressed by an RNA aptamer (IKL5) against Pol iota obtained in our work earlier. The obtained results suggest that IKL5 might be used to suppress the enhanced activity of Pol iota in tumor cells.
[Granular Cell Tumor of the Lung - a Visual Diagnosis on Bronchoscopy?
Keymel, S; Büter, S; Krüger, S
2018-05-22
A 38 years old patient presented with a progressive reduction of his general condition and weight loss. Chest imaging revealed consolidations and cavities suggesting a mycobacterial infection. For further diagnosis, a bronchoscopy was performed. In fact, a nontuberculous mycobacterial infection was found. As an incidental finding, we saw a white polypoid tumor in the middle lobe bronchus. The histology of this tumor revealed a granular cell tumor (GCT). The GCT is a rare tumor entity which occurs at different anatomical locations. In the lungs, the GCT may become symptomatic as it can cause bronchial obstruction. In chest imaging, it can manifest as infiltration, atelectasis or nodule. Likewise, GCT can be found as an incidental finding in bronchoscopy. First choice treatment is surgical resection of the tumor. © Georg Thieme Verlag KG Stuttgart · New York.
Szczepankiewicz, Filip; van Westen, Danielle; Englund, Elisabet; Westin, Carl-Fredrik; Ståhlberg, Freddy; Lätt, Jimmy; Sundgren, Pia C; Nilsson, Markus
2016-11-15
The structural heterogeneity of tumor tissue can be probed by diffusion MRI (dMRI) in terms of the variance of apparent diffusivities within a voxel. However, the link between the diffusional variance and the tissue heterogeneity is not well-established. To investigate this link we test the hypothesis that diffusional variance, caused by microscopic anisotropy and isotropic heterogeneity, is associated with variable cell eccentricity and cell density in brain tumors. We performed dMRI using a novel encoding scheme for diffusional variance decomposition (DIVIDE) in 7 meningiomas and 8 gliomas prior to surgery. The diffusional variance was quantified from dMRI in terms of the total mean kurtosis (MK T ), and DIVIDE was used to decompose MK T into components caused by microscopic anisotropy (MK A ) and isotropic heterogeneity (MK I ). Diffusion anisotropy was evaluated in terms of the fractional anisotropy (FA) and microscopic fractional anisotropy (μFA). Quantitative microscopy was performed on the excised tumor tissue, where structural anisotropy and cell density were quantified by structure tensor analysis and cell nuclei segmentation, respectively. In order to validate the DIVIDE parameters they were correlated to the corresponding parameters derived from microscopy. We found an excellent agreement between the DIVIDE parameters and corresponding microscopy parameters; MK A correlated with cell eccentricity (r=0.95, p<10 -7 ) and MK I with the cell density variance (r=0.83, p<10 -3 ). The diffusion anisotropy correlated with structure tensor anisotropy on the voxel-scale (FA, r=0.80, p<10 -3 ) and microscopic scale (μFA, r=0.93, p<10 -6 ). A multiple regression analysis showed that the conventional MK T parameter reflects both variable cell eccentricity and cell density, and therefore lacks specificity in terms of microstructure characteristics. However, specificity was obtained by decomposing the two contributions; MK A was associated only to cell eccentricity, and MK I only to cell density variance. The variance in meningiomas was caused primarily by microscopic anisotropy (mean±s.d.) MK A =1.11±0.33 vs MK I =0.44±0.20 (p<10 -3 ), whereas in the gliomas, it was mostly caused by isotropic heterogeneity MK I =0.57±0.30 vs MK A =0.26±0.11 (p<0.05). In conclusion, DIVIDE allows non-invasive mapping of parameters that reflect variable cell eccentricity and density. These results constitute convincing evidence that a link exists between specific aspects of tissue heterogeneity and parameters from dMRI. Decomposing effects of microscopic anisotropy and isotropic heterogeneity facilitates an improved interpretation of tumor heterogeneity as well as diffusion anisotropy on both the microscopic and macroscopic scale. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Lowenstein, P R; Castro, M G
2016-01-01
Malignant brain tumors are one of the most lethal cancers. They originate from glial cells which infiltrate throughout the brain. Current standard of care involves surgical resection, radiotherapy, and chemotherapy; median survival is currently ~14-20 months postdiagnosis. Given that the brain immune system is deficient in priming systemic immune responses to glioma antigens, we proposed to reconstitute the brain immune system to achieve immunological priming from within the brain. Two adenoviral vectors are injected into the resection cavity or remaining tumor. One adenoviral vector expresses the HSV-1-derived thymidine kinase which converts ganciclovir into a compound only cytotoxic to dividing glioma cells. The second adenovirus expresses the cytokine fms-like tyrosine kinase 3 ligand (Flt3L). Flt3L differentiates precursors into dendritic cells and acts as a chemokine that attracts dendritic cells to the brain. HSV-1/ganciclovir killing of tumor cells releases tumor antigens that are taken up by dendritic cells within the brain tumor microenvironment. Tumor killing also releases HMGB1, an endogenous TLR2 agonist that activates dendritic cells. HMGB1-activated dendritic cells, loaded with glioma antigens, migrate to cervical lymph nodes to stimulate a systemic CD8+ T cells cytotoxic immune response against glioma. This immune response is specific to glioma tumors, induces immunological memory, and does neither cause brain toxicity nor autoimmune responses. An IND was granted by the FDA on 4/7/2011. A Phase I, first in person trial, to test whether reengineering the brain immune system is potentially therapeutic is ongoing. © 2016 Elsevier Inc. All rights reserved.
BH3-mimetic small molecule inhibits the growth and recurrence of adenoid cystic carcinoma
Acasigua, Gerson A.; Warner, Kristy A.; Nör, Felipe; Helman, Joseph; Pearson, Alexander T.; Fossati, Anna C.; Wang, Shaomeng; Nör, Jacques E.
2015-01-01
Objectives To evaluate the anti-tumor effect of BM-1197, a new potent and highly specific small molecule inhibitor of Bcl-2/Bcl-xL, in preclinical models of human adenoid cystic carcinoma (ACC). Methods Low passage primary human adenoid cystic carcinoma cells (UM-HACC-2A,-2B,-5,-6) and patient-derived xenograft (PDX) models (UM-PDX-HACC) were developed from surgical specimens obtained from 4 patients. The effect of BM-1197 on cell viability and cell cycle were evaluated in vitro using this panel of low passage ACC cells. The effect of BM-1197 on tumor growth, recurrence and tumor cell apoptosis in vivo was evaluated with the PDX model of ACC (UM-PDX-HACC-5). Results Exposure of low passage primary human ACC cells to BM-1197 mediated an IC50 of 0.92-2.82 μM. This correlated with an increase in the fraction of apoptotic cells (p<0.0001) and an increase in caspase-3 activity (p<0.0001), but no noticeable differences in cell cycle (p>0.05). In vivo, BM-1197 inhibited tumor growth (p=0.0256) and induced tumor cell apoptosis (p=0.0165) without causing significant systemic toxicities, as determined by mouse weight over time. Surprisingly, weekly BM-1197 decreased the incidence of tumor recurrence (p=0.0297), as determined by Kaplan-Meier analysis. Conclusion These data demonstrated that single agent BM-1197 induces apoptosis and inhibits tumor growth in preclinical models of adenoid cystic carcinoma. Notably, single agent BM-1197 inhibited tumor recurrence, which is considered a major clinical challenge in the clinical management of adenoid cystic carcinoma. Collectively, these results suggest that patients with adenoid cystic carcinoma might benefit from therapy with a BH3-mimetic small molecule. PMID:26121939
Long-acting peptidomimergic control of gigantism caused by pituitary acidophilic stem cell adenoma.
Maheshwari, H G; Prezant, T R; Herman-Bonert, V; Shahinian, H; Kovacs, K; Melmed, S
2000-09-01
Gigantism is caused by GH hypersecretion occurring before epiphyseal long bone closure and usually is associated with pituitary adenoma. A 15-yr-old female patient presented with accelerated growth due to a large pituitary tumor that was surgically resected to relieve pressure effects. Second surgery to remove residual tumor tissue was followed by administration of octreotide LAR, a long-acting depot somatostatin analog, together with long-acting cabergoline. Height was over the 95th percentile, with evidence of a recent growth spurt. Serum GH levels were more than 60 ng/mL (normal, <10 ng/mL) with no suppression to 75 g oral glucose, and serum PRL (>8,000 ng/mL; normal, <23 ng/mL) and insulin-like growth factor I levels (845 ng/mL; age-matched normal, 242-660 ng/mL) were elevated. Histology, immunostaining, and electron microscopy demonstrated a pituitary acidophil stem cell adenoma. Tumor tissue expressed both somatostatin receptor type 2 and dopamine receptor type 2. The Gs alpha subunit, GHRH receptor, and MEN1 genes were intact, and tumor tissue abundantly expressed pituitary tumor transforming gene (PTTG). Serum GH and PRL levels were controlled after two surgeries, and with continued cabergoline and octreotide LAR GH, PRL, and insulin-like growth factor I levels were normalized. In conclusion, administration of long-acting somatostatin analog every 4 weeks in combination with a long-acting dopamine agonist biweekly controlled biochemical parameters and accelerated growth in a patient with gigantism caused by a rare pituitary acidophil stem cell adenoma.
Induction of Immune Mediators in Glioma and Prostate Cancer Cells by Non-Lethal Photodynamic Therapy
Kammerer, Robert; Buchner, Alexander; Palluch, Patrick; Pongratz, Thomas; Oboukhovskij, Konstantin; Beyer, Wolfgang; Johansson, Ann; Stepp, Herbert; Baumgartner, Reinhold; Zimmermann, Wolfgang
2011-01-01
Background Photodynamic therapy (PDT) uses the combination of photosensitizing drugs and harmless light to cause selective damage to tumor cells. PDT is therefore an option for focal therapy of localized disease or for otherwise unresectable tumors. In addition, there is increasing evidence that PDT can induce systemic anti-tumor immunity, supporting control of tumor cells, which were not eliminated by the primary treatment. However, the effect of non-lethal PDT on the behavior and malignant potential of tumor cells surviving PDT is molecularly not well defined. Methodology/Principal Findings Here we have evaluated changes in the transcriptome of human glioblastoma (U87, U373) and human (PC-3, DU145) and murine prostate cancer cells (TRAMP-C1, TRAMP-C2) after non-lethal PDT in vitro and in vivo using oligonucleotide microarray analyses. We found that the overall response was similar between the different cell lines and photosensitizers both in vitro and in vivo. The most prominently upregulated genes encoded proteins that belong to pathways activated by cellular stress or are involved in cell cycle arrest. This response was similar to the rescue response of tumor cells following high-dose PDT. In contrast, tumor cells dealing with non-lethal PDT were found to significantly upregulate a number of immune genes, which included the chemokine genes CXCL2, CXCL3 and IL8/CXCL8 as well as the genes for IL6 and its receptor IL6R, which can stimulate proinflammatory reactions, while IL6 and IL6R can also enhance tumor growth. Conclusions Our results indicate that PDT can support anti-tumor immune responses and is, therefore, a rational therapy even if tumor cells cannot be completely eliminated by primary phototoxic mechanisms alone. However, non-lethal PDT can also stimulate tumor growth-promoting autocrine loops, as seen by the upregulation of IL6 and its receptor. Thus the efficacy of PDT to treat tumors may be improved by controlling unwanted and potentially deleterious growth-stimulatory pathways. PMID:21738796
[A case of postmenopausal hyperandrogenism caused by a lipid cell tumor].
Witek, Andrzej; Skałba, Piotr; Chełmicki, Zbigniew; Pajak, Jacek
2002-01-01
Steroid-secreting neoplasms of the ovary and adrenal gland comprise a small group of tumors. A 76-year-old woman presented hair loss, facial hirsutism associated with increased serum total testosterone level. The adrenal glands and the ovaries were normal on radiological and ultrasonographic investigation. The patient was submitted to a pelvic exploratory laparotomy. Hysterectomy and salpingo-oophorectomy were performed. A solid and circumscribed ovarian tumor of 2 cm in diameter was found. The pathological diagnosis was lipid cell tumor with stromal hyperplasia. The purpose of this report is to relate how difficult is to establish the diagnosis and the origin of the hyperandrogenism in a patient with normal image studies.
Tumor-induced Osteomalacia in a 3-Year-Old With Unresectable Central Giant Cell Lesions.
Crossen, Stephanie S; Zambrano, Eduardo; Newman, Beverley; Bernstein, Jonathan A; Messner, Anna H; Bachrach, Laura K; Twist, Clare J
2017-01-01
Tumor-induced osteomalacia (TIO) is a rare cause of hypophosphatemia involving overproduction of fibroblast growth factor 23. TIO has been described largely in adults with small mesenchymal tumors. We report a case of TIO in a child who presented with knee pain and radiographic findings concerning for rickets, and was found to have maxillomandibular giant cell lesions. The patient was treated with oral phosphorus and calcitriol, surgical debulking, and intralesional corticosteroids, which resulted in tumor regression and normalization of serum fibroblast growth factor 23 and phosphorus. This case illustrates the occurrence of this rare paraneoplastic syndrome in children and adds to our knowledge about clinical manifestations and pathologic findings associated with pediatric TIO.
Huang, Ming-Bo; Gonzalez, Ruben R; Lillard, James; Bond, Vincent C
2017-02-14
Discovery and development of a novel anticancer PEG-SMR-Clu peptide to prevent breast cancer metastasis. How breast cancer cells and primary mammary epithelial cells interact and communicate with each other to promote tumorigenesis and how to prevent tumor metastasis has long been a concern of researchers. Cancer cells secrete exosomes containing proteins and RNA. These factors can influence tumor development by directly targeting cancer cells and tumor stroma. In this study, we determined the effects of a peptide as an inhibitor of exosome secretion on breast tumors. We developed a peptide derived from the Secretion Modification Region (SMR) of HIV-1 Nef protein that was modified with PEG on the N-terminus and with a Clusterin (Clu)-binding peptide on the C-terminus. Attachment of PEG to the SMR peptide, termed PEGylation, offers improved water solubility and stability as well as reduced clearance through the kidneys, leading to a longer circulation time. The 12-mer Clu-binding peptide plays multiple roles in tumor development and metastasis. The Clu peptide can be detected by antibody in vivo, thus it has the potential to be used to monitor tumor status and treatment efficacy in animal studies and eventually in cancer patients. PEG-SMRwt-Clu and PEG-SMRwt peptides inhibited the growth of both of MCF-7 (estrogen responsive, ER+) and MDA-MD-231 (estrogen non-responsive, ER-) human breast cancer cells in a dose and time-dependent manner, without inducing cytotoxic effects. The SMRwt peptide, combined with paclitaxel, induced G2/M phase cell cycle arrest on MCF-7 and MDA-MB-231 cells but did not promote apoptosis. PEG-SMRwt-Clu peptide treatment blocked exosome release from both MCF-7 and MDA-MB-231 cells. This effect was blocked by knockdown of the chaperone protein mortalin by either antibody or siRNA. MCF-7 and MDA-MB-231 breast tumor cells were treated with PEG-SMR-Clu peptide alone and in combination with paclitaxel and cisplatin. Cell proliferation and viabilty were determined via cell cycle analysis using Cellometer imaging cytometry, Annexin V and MTT assays. The effects of the PEG-SMR-Clu peptide on tumor exosome release were determined by testing isolated exosome fractions, for (i) expression of CD63 and Alix proteins by Western blotting, (ii) NanoSight nanoparticle tracking analysis (NTA 10) to measure exosomes size and concentration, and (iii) measurement of acetylcholinesterase (AchE) for exosome specific enzyme activity. PEG-SMRwt-CLU peptides inhibited the growth of human breast cancer cells and blocked tumor exosome release in vitro. The peptide alone did not cause increased cytotoxicity or apoptosis induction, but did cause cell cycle G2/M phase arrest in both estrogen responsive and non-responsive breast cancer cells. These data suggest a potential therapeutic value of SMR to prevent breast cancer metastasis and as an adjuvant for the chemotherapeutic treatment of human breast cancer.
HFE genotype affects exosome phenotype in cancer.
Mrowczynski, Oliver D; Madhankumar, A B; Slagle-Webb, Becky; Lee, Sang Y; Zacharia, Brad E; Connor, James R
2017-08-01
Neuroblastoma is the third most common childhood cancer, and timely diagnosis and sensitive therapeutic monitoring remain major challenges. Tumor progression and recurrence is common with little understanding of mechanisms. A major recent focus in cancer biology is the impact of exosomes on metastatic behavior and the tumor microenvironment. Exosomes have been demonstrated to contribute to the oncogenic effect on the surrounding tumor environment and also mediate resistance to therapy. The effect of genotype on exosomal phenotype has not yet been explored. We interrogated exosomes from human neuroblastoma cells that express wild-type or mutant forms of the HFE gene. HFE, one of the most common autosomal recessive polymorphisms in the Caucasian population, originally associated with hemochromatosis, has also been associated with increased tumor burden, therapeutic resistance boost, and negative impact on patient survival. Herein, we demonstrate that changes in genotype cause major differences in the molecular and functional properties of exosomes; specifically, HFE mutant derived exosomes have increased expression of proteins relating to invasion, angiogenesis, and cancer therapeutic resistance. HFE mutant derived exosomes were also shown to transfer this cargo to recipient cells and cause an increased oncogenic functionality in those recipient cells. Copyright © 2017. Published by Elsevier B.V.
Zhu, Chunpeng; Hu, Xun
2013-01-01
Mitotic chromosomal instability (CIN) plays important roles in tumor progression, but what causes CIN is incompletely understood. In general, tumor CIN arises from abnormal mitosis, which is caused by either intrinsic or extrinsic factors. While intrinsic factors such as mitotic checkpoint genes have been intensively studied, the impact of tumor microenvironmental factors on tumor CIN is largely unknown. We investigate if glucose deprivation and lactic acidosis – two tumor microenvironmental factors – could induce cancer cell CIN. We show that glucose deprivation with lactic acidosis significantly increases CIN in 4T1, MCF-7 and HCT116 scored by micronuclei, or aneuploidy, or abnormal mitosis, potentially via damaging DNA, up-regulating mitotic checkpoint genes, and/or amplifying centrosome. Of note, the feature of CIN induced by glucose deprivation with lactic acidosis is similar to that of aneuploid human tumors. We conclude that tumor environmental factors glucose deprivation and lactic acidosis can induce tumor CIN and propose that they are potentially responsible for human tumor aneuploidy. PMID:23675453
Mukherjee, Sumit; Baidoo, Juliet N E; Sampat, Samay; Mancuso, Andrew; David, Lovena; Cohen, Leah S; Zhou, Shuiqin; Banerjee, Probal
2018-01-18
Glioblastoma (GBM) is a deadly brain tumor with a current mean survival of 12-15 months. Despite being a potent anti-cancer agent, the turmeric ingredient curcumin (C) has limited anti-tumor efficacy in vivo due to its low bioavailability. We have reported earlier a strategy involving the use two other polyphenols, epicatechin gallate (E) from green tea and resveratrol (R) from red grapes at a unique, synergistic molar ratio with C (C:E:R: 4:1:12.5, termed TriCurin) to achieve superior potency against HPV+ tumors than C alone at C:E:R (μM): 32:8:100 (termed 32 μM+ TriCurin). We have now prepared liposomal TriCurin (TrLp) and demonstrated that TrLp boosts activated p53 in cultured GL261 mouse GBM cells to trigger apoptosis of GBM and GBM stem cells in vitro. TrLp administration into mice yielded a stable plasma concentration of 210 nM C for 60 min, which, though sub-lethal for cultured GL261 cells, was able to cause repolarization of M2-like tumor (GBM)-associated microglia/macrophages to the tumoricidal M1-like phenotype and intra-GBM recruitment of activated natural killer cells. The intratumor presence of such tumoricidal immune cells was associated with concomitant suppression of tumor-load, and apoptosis of GBM and GBM stem cells. Thus, TrLp is a potential onco-immunotherapeutic agent against GBM tumors.
Protein stabilization by RSUME accounts for PTTG pituitary tumor abundance and oncogenicity.
Fuertes, M; Sapochnik, M; Tedesco, L; Senin, S; Attorresi, A; Ajler, P; Carrizo, G; Cervio, A; Sevlever, G; Bonfiglio, J J; Stalla, G K; Arzt, E
2018-06-01
Increased levels of the proto-oncogene pituitary tumor-transforming gene 1 (PTTG) have been repeatedly reported in several human solid tumors, especially in endocrine-related tumors such as pituitary adenomas. Securin PTTG has a critical role in pituitary tumorigenesis. However, the cause of upregulation has not been found yet, despite analyses made at the gene, promoter and mRNA level that show that no mutations, epigenetic modifications or other mechanisms that deregulate its expression may explain its overexpression and action as an oncogene. We describe that high PTTG protein levels are induced by the RWD-containing sumoylation enhancer (RWDD3 or RSUME), a protein originally identified in the same pituitary tumor cell line in which PTTG was also cloned. We demonstrate that PTTG and RSUME have a positive expression correlation in human pituitary adenomas. RSUME increases PTTG protein in pituitary tumor cell lines, prolongs the half-life of PTTG protein and regulates the PTTG induction by estradiol. As a consequence, RSUME enhances PTTG transcription factor and securin activities. PTTG hyperactivity on the cell cycle resulted in recurrent and unequal divisions without cytokinesis, and the consequential appearance of aneuploidies and multinucleated cells in the tumor. RSUME knockdown diminishes securin PTTG and reduces its tumorigenic potential in a xenograft mouse model. Taken together, our findings show that PTTG high protein steady state levels account for PTTG tumor abundance and demonstrate a critical role of RSUME in this process in pituitary tumor cells. © 2018 Society for Endocrinology.
Hu, Jianpeng; Xuan, Xujun; Han, Conghui; Hao, Lin; Zhang, Peiying; Chen, Meng; He, Houguang; Fan, Tao; Dong, Binzheng
2012-03-01
To construct an adenovirus carrying SEA gene and regulated by telomerase reverse transcriptase (hTERT) and hypoxia-inducible factor (HIF) promoters and investigate its anti-tumor function in vitro, as well as its role in lymphocyte production. hTERT and HIF genes were cloned into adenovirus E1A and E1B shuttle plasmids. The control vector for SEA gene expression is under the regulation of CMV and SV40 promoters. Double regulation was obtained through homologous recombination. The positive clones of replicable adenovirus H2-SEA-Ad were selected by plaque assay. The adenovirus was purified, titrated, and DNA was verified by PCR. The obtained virus was used to infect EJ bladder tumor cells and the SEA Mrna, and protein expression was measured by RT-PCR, western blot, and immunofluorescence microscopy, respectively. Co-culture of lymphocytes and tumor cells was observed dynamically under microscope. The construction of shuttle plasmid p315-CSS-SEA was confirmed by PCR and DNA sequencing. Insertion of superantigen SEA gene in adenovirus (H2-SEA-Ad.SEA) was obtained by homologous recombination. In lymphocytes and tumor cell co-culture, the number of viable tumor cells in test groups was significantly lower than that in control group after 12, 24, and 48 h of treatment. Production of interleukin-2, interleukin-4, and tumor necrosis factor were higher in test groups than in control group. Expression of SEA gene in bladder tumor cells by adenoviral vector caused reduced tumor cell proliferation, as well as stimulation of inflammatory cytokine productions in co-cultures with lymphocytes.
MASUNAGA, SHIN-ICHIRO; SAKURAI, YOSHINORI; TANO, KEIZO; TANAKA, HIROKI; SUZUKI, MINORU; KONDO, NATSUKO; NARABAYASHI, MASARU; WATANABE, TSUBASA; NAKAGAWA, YOSUKE; MARUHASHI, AKIRA; ONO, KOJI
2014-01-01
The aim of the present study was to evaluate the effect of bevacizumab on local tumor response and lung metastatic potential during boron neutron capture therapy (BNCT) and in particular, the response of intratumor quiescent (Q) cells. B16-BL6 melanoma tumor-bearing C57BL/6 mice were continuously administered bromodeoxyuridine (BrdU) to label all proliferating (P) tumor cells. The tumors were irradiated with thermal neutron beams following the administration of a 10B-carrier [L-para-boronophenylalanine-10B (BPA) or sodium mercaptoundecahydrododecaborate-10B (BSH)], with or without the administration of bevacizumab. This was further combined with an acute hypoxia-releasing agent (nicotinamide) or mild temperature hyperthermia (MTH, 40°C for 60 min). Immediately following the irradiation, cells from certain tumors were isolated and incubated with a cytokinesis blocker. The responses of the Q cells and the total (P+Q) cell populations were assessed based on the frequency of micronuclei using immunofluorescence staining for BrdU. In other tumor-bearing mice, 17 days following irradiation, lung metastases were enumerated. Three days following bevacizumab administration, the sensitivity of the total tumor cell population following BPA-BNCT had increased more than that following BSH-BNCT. The combination with MTH, but not with nicotinamide, further enhanced total tumor cell population sensitivity. Regardless of the presence of a 10B-carrier, MTH enhanced the sensitivity of the Q cell population. Regardless of irradiation, the administration of bevacizumab, as well as nicotinamide treatment, demonstrated certain potential in reducing the number of lung metastases especially in BPA-BNCT compared with BSH-BNCT. Thus, the current study revealed that BNCT combined with bevacizumab has the potential to sensitize total tumor cells and cause a reduction in the number of lung metastases to a similar level as nicotinamide. PMID:24944637
Bellone, Matteo; Calcinotto, Arianna; Filipazzi, Paola; De Milito, Angelo; Fais, Stefano; Rivoltini, Licia
2013-01-01
We have recently reported that lowering the pH to values that are frequently detected in tumors causes reversible anergy in both human and mouse CD8+ T lymphocytes in vitro. The same occurs in vivo, in the tumor microenvironment and the administration of proton pump inhibitors, which buffer tumor acidity, can revert T-cell anergy and increase the efficacy of immunotherapy. PMID:23483769
Chemomodulation of Doxorubicin Pharmacodynamics
2002-10-01
with their downstream tar- 2 Department of Chemistry , University of Central Oklahoma, Ed- gets, which include some specific transcription factors. Pro...is a flavonoid that causes 50% growth tumor growth support by the host (42). The clinical efficacy of inhibition of tumor cells at 60 nM (57). It also
DOE Office of Scientific and Technical Information (OSTI.GOV)
Günther, T-hat nia Mara Fischer; Kviecinski, Maicon Roberto; Baron, Carla Cristine
2013-01-18
Graphical abstract: -- Abstract: Pharmacological doses of ascorbate were evaluated for its ability to potentiate the toxicity of sodium orthovanadate (Na{sub 3}VO{sub 4}) in tumor cells. Cytotoxicity, inhibition of cell proliferation, generation of ROS and DNA fragmentation were assessed in T24 cells. Na{sub 3}VO{sub 4} was cytotoxic against T24 cells (EC{sub 50} = 5.8 μM at 24 h), but in the presence of ascorbate (100 μM) the EC{sub 50} fell to 3.3 μM. Na{sub 3}VO{sub 4} plus ascorbate caused a strong inhibition of cell proliferation (up to 20%) and increased the generation of ROS (4-fold). Na{sub 3}VO{sub 4} did notmore » directly cleave plasmid DNA, at this aspect no synergism was found occurring between Na{sub 3}VO{sub 4} and ascorbate once the resulting action of the combination was no greater than that of both substances administered separately. Cells from Ehrlich ascites carcinoma-bearing mice were used to determine the activity of antioxidant enzymes, the extent of the oxidative damage and the type of cell death. Na{sub 3}VO{sub 4} alone, or combined with ascorbate, increased catalase activity, but only Na{sub 3}VO{sub 4} plus ascorbate increased superoxide dismutase activity (up to 4-fold). Oxidative damage on proteins and lipids was higher due to the treatment done with Na{sub 3}VO{sub 4} plus ascorbate (2–3-fold). Ascorbate potentiated apoptosis in tumor cells from mice treated with Na{sub 3}VO{sub 4}. The results indicate that pharmacological doses of ascorbate enhance the generation of ROS induced by Na{sub 3}VO{sub 4} in tumor cells causing inhibition of proliferation and apoptosis. Apoptosis induced by orthovanadate and ascorbate is closer related to inhibition on Bcl-xL and activation of Bax. Our data apparently rule out a mechanism of cell demise p53-dependent or related to Cdk2 impairment.« less
Bauer, Georg
2018-06-01
Tumor cells express NADPH oxidase-1 (NOX1) in their membrane and control NOX1-based intercellular reactive oxygen and nitrogen species (ROS/RNS)-dependent apoptosis-inducing signaling through membrane-associated catalase and superoxide dismutase. of tumor cells with high concentrations of H 2 O 2 , peroxnitrite, HOCl, or increasing the concentration of cell-derived NO causes initial generation of singlet oxygen and local inactivation of membrane-associated catalase. As a result, free peroxynitrite and H 2 O 2 interact and generate secondary singlet oxygen. Inactivation of further catalase molecules by secondary singlet oxygen leads to auto-amplification of singlet oxygen generation and catalase inactivation. This allows reactivation of intercellular ROS/RNS-signaling and selective apoptosis induction in tumor cells. The initial singlet oxygen generation seems to be the critical point in this complex biochemical multistep mechanism. Initial singlet oxygen generation requires the interaction between distinct tumor cell-derived ROS and RNS and may also depend on either the induction of NO synthase expression or NOX1 activation through the FAS receptor. FAS receptor activation can be achieved by singlet oxygen. Autoamplificatory generation of singlet oxygen through the interaction between peroxynitrite and hydrogen peroxide inherits a rich potential for the establishment of synergistic effects that may be instrumental for novel approaches of tumor therapy with high selectivity towards malignant cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Enrichment and single-cell analysis of circulating tumor cells
Song, Yanling; Tian, Tian; Shi, Yuanzhi; Liu, Wenli; Zou, Yuan; Khajvand, Tahereh; Wang, Sili; Zhu, Zhi
2017-01-01
Up to 90% of cancer-related deaths are caused by metastatic cancer. Circulating tumor cells (CTCs), a type of cancer cell that spreads through the blood after detaching from a solid tumor, are essential for the establishment of distant metastasis for a given cancer. As a new type of liquid biopsy, analysis of CTCs offers the possibility to avoid invasive tissue biopsy procedures with practical implications for diagnostics. The fundamental challenges of analyzing and profiling CTCs are the extremely low abundances of CTCs in the blood and the intrinsic heterogeneity of CTCs. Various technologies have been proposed for the enrichment and single-cell analysis of CTCs. This review aims to provide in-depth insights into CTC analysis, including various techniques for isolation of CTCs with capture methods based on physical and biochemical principles, and single-cell analysis of CTCs at the genomic, proteomic and phenotypic level, as well as current developmental trends and promising research directions. PMID:28451298
Enhanced CAR T cell therapy: A novel approach for head and neck cancers.
Wang, Songlin; Zhu, Zhao
2018-05-05
Head and neck cancer that presents in locally advanced stages often results in a bad prognosis with an increased recurrence rate even after curative resections. Radiation therapy is then applied, with multiple side effects, as adjuvant regional therapy. Because of the high rate of recurrence and mortality, new therapies are needed for patients suffering from head and neck malignant tumors.CAR (chimeric antigen receptor) T cell therapy, which was first devised about 25 years ago, causes the killing or apoptosis of target tumor cells through inducing the secretion of cytokines and granzymes by T cells (Cheadle et al., 2014). CARs are comprised of three canonical domains for antigen recognition, T cell activation, and co-stimulation, and are synthetic receptors that reprogram immune cells for therapeutic treatment of multiple tumors (Sadelain, 2017). This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Pancreatic Cancer Sensitive to Selective p38 Pathway Inhibition | Center for Cancer Research
Pancreatic ductal adenocarcinoma (PDAC), the most-common cancer of the pancreas, is an aggressive disease that is estimated by the American Cancer Society to be the fourth leading cause of cancer death in men and women in 2015. Like most solid tumors, PDAC is surrounded by an inflammatory microenvironment containing numerous infiltrating immune cells. These cells are unable to eliminate the tumor and instead create a hospitable environment by providing tumor growth-promoting cytokines, the production of which lies downstream of the kinase p38. Unlike most immune cells, which use the classical pathway to activate p38, T cells employ an alternative p38 pathway that involves phosphorylation of tyrosine 323 (pY323) by the T cell receptor. Jonathan Ashwell, M.D., of CCR’s Laboratory of Immune Cell Biology and his colleagues decided to assess the role of the alternative p38 pathway in pancreatic cancer.
Rous, Peyton; Lange, Linda B.
1913-01-01
A spontaneous chicken sarcoma, peculiarly fissured by blood sinuses, and with a tendency to intracanalicular extension into them, has been transplanted and studied in eight successive groups of fowls. Histologically the growth is a characteristic neoplasm, while in its transfer to new hosts a real transplantation is obviously involved. The development of the first few series of transplantation tumors was very slow. They exhibited the histological structure of the original growth and had the same tendency to metastasize to the skeletal muscles. Recently the tumor has grown more rapidly and in a higher percentage of hosts. With this has come a simplification of structure to that of a pure, spindle-celled sarcoma. Fowls of an alien variety (Plymouth Rock) form quite as good hosts for the tumor as those of the sort (brown Leghorn) in which it was originally found. It has not grown in pigeons, rats, or mice. The question of the cause of the tumor is not taken up in the present paper. It has been found to be due to an agent which will pass through Berkefeld filters. The growth is quite distinct in its characters from the other two transplantable neoplasms of the fowl (a spindle-celled sarcoma, an osteochondrosarcoma) which have such a cause. No growth like it has been observed among the forty-three spontaneous tumors of the fowl that have come under our observation. PMID:19867738
Gammon, Bryan; Guitart, Joan
2012-09-01
Follicular helper T cells are a subset of helper T cells that facilitate B-cell recruitment and maturation. Rare cases of cutaneous T-cell lymphoma manifesting as de novo tumor lesions in intertriginous skin contain an infiltrate rich in B cells. These cases may represent malignant counterparts of skin-homing follicular helper T cells. Two men and 1 woman (age range, 35-58 years) were seen with predominantly intertriginous tumor-stage cutaneous T-cell lymphoma lesions characterized by the absence of epidermotropism and the presence of a mixed infiltrate rich in B cells. Two of the patients died of the disease less than 3 years from the initial diagnosis. The surviving patient has aggressive disease and underwent hematopoietic stem cell transplantation. Two of the patients had a prominent CXCL13+, Bcl6/CD3+, and programmed death protein 1-positive follicular helper T-cell population. The intertriginous tumor variant of cutaneous T-cell lymphoma is heterogeneous but may be associated in some cases with a follicular helper T-cell immunophenotype. These patients may follow an aggressive clinical course. Tumor progression in sanctuary sites on patients receiving phototherapy may manifest as a similar clinical phenotype. Further characterization of the disease process is needed to confirm this observation.
Greenaway, James; Henkin, Jack; Lawler, Jack; Moorehead, Roger; Petrik, Jim
2012-01-01
Epithelial ovarian cancer (EOC) is the fifth most common cancer in women and is characterized by a low 5-year survival rate. One strategy that can potentially improve the overall survival rate in ovarian cancer is the use of antitumor agents such as ABT-510. ABT-510 is a small mimetic peptide of the naturally occurring antiangiogenic compound thrombospondin-1 and has been shown to significantly reduce tumor growth and burden in preclinical mouse models and in naturally occurring tumors in dogs. This is the first evaluation of ABT-510 in a preclinical model of human EOC. Tumorigenic mouse surface epithelial cells were injected into the bursa of C57BL/6 mice that were treated with either 100 mg/kg ABT-510 or an equivalent amount of PBS. ABT-510 caused a significant reduction in tumor size, ascites fluid volume, and secondary lesion dissemination when compared with PBS controls. Analysis of the vasculature of ABT-510-treated mice revealed vascular remodeling with smaller diameter vessels and lower overall area, increased number of mature vessels, and decreased tissue hypoxia. Tumors of ABT-510-treated mice had a significantly higher proportion of apoptotic tumor cells compared with the PBS-treated controls. Immunoblot analysis of cell lysates revealed a reduction in vascular endothelial growth factor, vascular endothelial growth factor receptor-2, and proliferating cell nuclear antigen protein expression as well as expression of members of the phosphatidylinositol 3-kinase and mitogen-activated protein kinase survival pathways. In vitro, ABT-510 induced tumor cell apoptosis in mouse and human ovarian cancer cells. This study shows ABT-510 as a promising candidate for inhibiting tumor growth and ascites formation in human EOC. PMID:19139114
Greenaway, James; Henkin, Jack; Lawler, Jack; Moorehead, Roger; Petrik, Jim
2009-01-01
Epithelial ovarian cancer (EOC) is the fifth most common cancer in women and is characterized by a low 5-year survival rate. One strategy that can potentially improve the overall survival rate in ovarian cancer is the use of antitumor agents such as ABT-510. ABT-510 is a small mimetic peptide of the naturally occurring antiangiogenic compound thrombospondin-1 and has been shown to significantly reduce tumor growth and burden in preclinical mouse models and in naturally occurring tumors in dogs. This is the first evaluation of ABT-510 in a preclinical model of human EOC. Tumorigenic mouse surface epithelial cells were injected into the bursa of C57BL/6 mice that were treated with either 100 mg/kg ABT-510 or an equivalent amount of PBS. ABT-510 caused a significant reduction in tumor size, ascites fluid volume, and secondary lesion dissemination when compared with PBS controls. Analysis of the vasculature of ABT-510-treated mice revealed vascular remodeling with smaller diameter vessels and lower overall area, increased number of mature vessels, and decreased tissue hypoxia. Tumors of ABT-510-treated mice had a significantly higher proportion of apoptotic tumor cells compared with the PBS-treated controls. Immunoblot analysis of cell lysates revealed a reduction in vascular endothelial growth factor, vascular endothelial growth factor receptor-2, and proliferating cell nuclear antigen protein expression as well as expression of members of the phosphatidylinositol 3-kinase and mitogen-activated protein kinase survival pathways. In vitro, ABT-510 induced tumor cell apoptosis in mouse and human ovarian cancer cells. This study shows ABT-510 as a promising candidate for inhibiting tumor growth and ascites formation in human EOC.
Soejima, Kenzo; Kuroda, Aoi; Ishioka, Kota; Yasuda, Hiroyuki; Naoki, Katsuhiko; Shizuko, Kagawa; Hamamoto, Junko; Yin, Yongjun; Ornitz, David M.; Betsuyaku, Tomoko
2014-01-01
Fibroblast growth factor (FGF) 9 is essential for lung development and is highly expressed in a subset of human lung adenocarcinomas. We recently described a mouse model in which FGF9 expression in the lung epithelium caused proliferation of the airway epithelium at the terminal bronchioles and led to rapid development of adenocarcinoma. Here, we used this model to characterize the effects of prolonged FGF9 induction on the proximal and distal lung epithelia, and examined the propagation potential of FGF9-induced lung tumors. We show that prolonged FGF9 overexpression in the lung resulted in the development of adenocarcinomas arising from both alveolar type II and airway secretory cells in the lung parenchyma and airways, respectively. We found that tumor cells harbored tumor-propagating cells that were able to form secondary tumors in recipient mice regardless of FGF9 expression. However, the highest degree of tumor propagation was observed when unfractionated tumor cells were coadministered with autologous, tumor-associated mesenchymal cells. Although the initiation of lung adenocarcinomas was dependent on activation of the FGF9/FGF receptor (FGFR) 3 signaling axis, maintenance and propagation of the tumor was independent of this signaling. Activation of an alternative FGF/FGFR and the interaction with tumor stromal cells is likely to be responsible for the development of this independence. This study demonstrates the complex role of FGF/FGFR signaling in the initiation, growth, and propagation of lung cancer. Our findings suggest that analyzing the expressions of FGFs/FGFRs in human lung cancer will be a useful tool for guiding customized therapy. PMID:25413587
Xiao, Xue; Yang, Gong; Bai, Peng; Gui, Shunping; Nyuyen, Tri M Bui; Mercado-Uribe, Imelda; Yang, Mei; Zou, Juan; Li, Qintong; Xiao, Jianguo; Chang, Bin; Liu, Guangzhi; Wang, He; Liu, Jinsong
2016-08-02
NF-kB can function as an oncogene or tumor suppressor depending on cancer types. The role of NF-kB in low-grade serous ovarian cancer, however, has never been tested. We sought to elucidate the function of NF-kB in the low-grade serous ovarian cancer. The ovarian cancer cell line, HOC-7, derived from a low-grade papillary serous carcinoma. Introduction of a dominant negative mutant, IkBαM, which resulted in decrease of NF-kB function in ovarian cancer cell lines. The transcription ability, tumorigenesis, cell proliferation and apoptosis were observed in derivative cell lines in comparison with parental cells. Western blot analysis indicated increased expression of the anti-apoptotic proteins Bcl-xL and reduced expression of the pro-apoptotic proteins Bax, Bad, and Bid in HOC-7/IĸBαM cell. Further investigations validate this conclusion in KRAS wildtype cell line SKOV3. Interesting, NF-kB can exert its pro-apoptotic effect by activating mitogen-activated protein kinase (MAPK) phosphorylation in SKOV3 ovarian cancer cell, whereas opposite changes detected in p-MEK in HOC-7 ovarian cancer cell, the same as some chemoresistant ovarian cancer cell lines. In vivo animal assay performed on BALB/athymic mice showed that injection of HOC-7 induced subcutaneous tumor growth, which was completely regressed within 7 weeks. In comparison, HOC-7/IĸBαM cells caused sustained tumor growth and abrogated tumor regression, suggesting that knock-down of NF-kB by IĸBαM promoted sustained tumor growth and delayed tumor regression in HOC-7 cells. Our results demonstrated that NF-kB may function as a tumor suppressor by facilitating regression of low grade ovarian serous carcinoma through activating pro-apoptotic pathways.
Vieira, Renata Aparecida Martinez Antunes Ribeiro; Minicucci, Eliana Maria; Marques, Mariangela Esther Alencar; Marques, Silvio Alencar
2012-01-01
Actinic cheilitis is the main precancerous lesion of the lip. Squamous cell carcinoma of the lip is reported together with oral carcinomas in the Brazilian official statistics. Overall, they account for 40% of the head and neck carcinomas. In general, physicians and dentists know little about what causes oral tumor development and progression. Tumor suppressor genes and cell proliferation regulatory proteins play a role in the progression of actinic cheilitis to squamous cell carcinoma and in its biological behavior. Knowledge on prognostic and diagnostic markers has a positive impact on the follow-up of these patients.
Sorafenib selectively depletes human glioblastoma tumor-initiating cells from primary cultures
Carra, Elisa; Barbieri, Federica; Marubbi, Daniela; Pattarozzi, Alessandra; Favoni, Roberto E.; Florio, Tullio; Daga, Antonio
2013-01-01
Glioblastomas are grade IV brain tumors characterized by high aggressiveness and invasiveness, giving patients a poor prognosis. We investigated the effects of the multi-kinase inhibitor sorafenib on six cultures isolated from human glioblastomas and maintained in tumor initiating cells-enriching conditions. These cell subpopulations are thought to be responsible for tumor recurrence and radio- and chemo-resistance, representing the perfect target for glioblastoma therapy. Sorafenib reduces proliferation of glioblastoma cultures, and this effect depends, at least in part, on the inhibition of PI3K/Akt and MAPK pathways, both involved in gliomagenesis. Sorafenib significantly induces apoptosis/cell death via downregulation of the survival factor Mcl-1. We provide evidence that sorafenib has a selective action on glioblastoma stem cells, causing enrichment of cultures in differentiated cells, downregulation of the expression of stemness markers required to maintain malignancy (nestin, Olig2 and Sox2) and reducing cell clonogenic ability in vitro and tumorigenic potential in vivo. The selectivity of sorafenib effects on glioblastoma stem cells is confirmed by the lower sensitivity of glioblastoma cultures after differentiation as compared with the undifferentiated counterpart. Since current GBM therapy enriches the tumor in cancer stem cells, the evidence of a selective action of sorafenib on these cells is therapeutically relevant, even if, so far, results from first phase II clinical trials did not demonstrate its efficacy. PMID:23324350
Sorafenib selectively depletes human glioblastoma tumor-initiating cells from primary cultures.
Carra, Elisa; Barbieri, Federica; Marubbi, Daniela; Pattarozzi, Alessandra; Favoni, Roberto E; Florio, Tullio; Daga, Antonio
2013-02-01
Glioblastomas are grade IV brain tumors characterized by high aggressiveness and invasiveness, giving patients a poor prognosis. We investigated the effects of the multi-kinase inhibitor sorafenib on six cultures isolated from human glioblastomas and maintained in tumor initiating cells-enriching conditions. These cell subpopulations are thought to be responsible for tumor recurrence and radio- and chemo-resistance, representing the perfect target for glioblastoma therapy. Sorafenib reduces proliferation of glioblastoma cultures, and this effect depends, at least in part, on the inhibition of PI3K/Akt and MAPK pathways, both involved in gliomagenesis. Sorafenib significantly induces apoptosis/cell death via downregulation of the survival factor Mcl-1. We provide evidence that sorafenib has a selective action on glioblastoma stem cells, causing enrichment of cultures in differentiated cells, downregulation of the expression of stemness markers required to maintain malignancy (nestin, Olig2 and Sox2) and reducing cell clonogenic ability in vitro and tumorigenic potential in vivo. The selectivity of sorafenib effects on glioblastoma stem cells is confirmed by the lower sensitivity of glioblastoma cultures after differentiation as compared with the undifferentiated counterpart. Since current GBM therapy enriches the tumor in cancer stem cells, the evidence of a selective action of sorafenib on these cells is therapeutically relevant, even if, so far, results from first phase II clinical trials did not demonstrate its efficacy.
Enqvist, Monika; Nilsonne, Gustav; Hammarfjord, Oscar; Wallin, Robert P A; Björkström, Niklas K; Björnstedt, Mikael; Hjerpe, Anders; Ljunggren, Hans-Gustaf; Dobra, Katalin; Malmberg, Karl-Johan; Carlsten, Mattias
2011-10-01
CD94/NKG2A is an inhibitory receptor that controls the activity of a large proportion of human NK cells following interactions with the nonclassical HLA class Ib molecule HLA-E expressed on target cells. In this study, we show that selenite (SeO(3)(2-)), an inorganic selenium compound, induces an almost complete loss of cell surface expression of HLA-E on tumor cells of various origins. Selenite abrogated the HLA-E expression at a posttranscriptional level, since selenite exposure led to a dose-dependent decrease in cellular HLA-E protein expression whereas the mRNA levels remained intact. The loss of HLA-E expression following selenite treatment was associated with decreased levels of intracellular free thiols in the tumor cells, suggesting that the reduced HLA-E protein synthesis was caused by oxidative stress. Indeed, HLA-E expression and the level of free thiols remained intact following treatment with selenomethionine, a selenium compound that does not generate oxidative stress. Loss of HLA-E expression, but not of total HLA class I expression, on tumor cells resulted in increased susceptibility to CD94/NK group 2A-positive NK cells. Our results suggest that selenite may be used to potentiate the anti-tumor cytotoxicity in settings of NK cell-based immunotherapies.
Neuropilin-2 promotes extravasation and metastasis by interacting with endothelial α5 integrin.
Cao, Ying; Hoeppner, Luke H; Bach, Steven; E, Guangqi; Guo, Yan; Wang, Enfeng; Wu, Jianmin; Cowley, Mark J; Chang, David K; Waddell, Nicola; Grimmond, Sean M; Biankin, Andrew V; Daly, Roger J; Zhang, Xiaohui; Mukhopadhyay, Debabrata
2013-07-15
Metastasis, the leading cause of cancer death, requires tumor cell intravasation, migration through the bloodstream, arrest within capillaries, and extravasation to invade distant tissues. Few mechanistic details have been reported thus far regarding the extravasation process or re-entry of circulating tumor cells at metastatic sites. Here, we show that neuropilin-2 (NRP-2), a multifunctional nonkinase receptor for semaphorins, vascular endothelial growth factor (VEGF), and other growth factors, expressed on cancer cells interacts with α5 integrin on endothelial cells to mediate vascular extravasation and metastasis in zebrafish and murine xenograft models of clear cell renal cell carcinoma (RCC) and pancreatic adenocarcinoma. In tissue from patients with RCC, NRP-2 expression is positively correlated with tumor grade and is highest in metastatic tumors. In a prospectively acquired cohort of patients with pancreatic cancer, high NRP-2 expression cosegregated with poor prognosis. Through biochemical approaches as well as Atomic Force Microscopy (AFM), we describe a unique mechanism through which NRP-2 expressed on cancer cells interacts with α5 integrin on endothelial cells to mediate vascular adhesion and extravasation. Taken together, our studies reveal a clinically significant role of NRP-2 in cancer cell extravasation and promotion of metastasis. ©2013 AACR.
The prognostic value of natural killer cell infiltration in resected pulmonary adenocarcinoma.
Takanami, I; Takeuchi, K; Giga, M
2001-06-01
Natural cytotoxicity caused by mediated natural killer cells is believed to play an important role in host-cancer defense mechanisms. Immunohistochemically, we have detected natural killer cells in tissue specimens from patients with pulmonary adenocarcinoma and have assessed their clinical characteristics. Using the monoclonal antibody for CD57 specific marker for natural killer cells, we quantified natural killer cell infiltration in 150 patients with pulmonary adenocarcinoma who underwent curative tumor resection to investigate the relationship between natural killer cell counts and clinicopathologic factors and prognosis. The natural killer cell count was significantly related to the regulation of tumor progression, involving T classification, N classification, and stage (P =.01 for T classification or stage; P =.02 for N classification). A significant difference in the rate of patient survival was detected between those patients whose tumors had either high or low natural killer cell counts in both the overall and stage I groups (P =.0002 for the overall group; P =.049 for the stage I group). These data indicate that natural killer infiltration may contribute to the regulation of tumor progression and that the natural killer cell count can serve as a useful prognostic marker in overall and stage I pulmonary adenocarcinoma.
NASA Astrophysics Data System (ADS)
Chen, Bin
2017-02-01
Photodynamic therapy (PDT) involves the combination of a photosensitizer and light of a specific wavelength. Upon light activation in the presence of oxygen, photosensitizer molecules generate reactive oxygen species that cause cytotoxicity by inducing oxidative stress. Aminolevulinic acid (ALA) is a pro-drug used for the diagnosis and PDT treatment of various solid tumors based on endogenous production of heme precursor protoporphyrin IX (PpIX). Although nearly all types of human cells express heme biosynthesis enzymes and produce PpIX, tumor cells are found to have more PpIX production and accumulation than normal cells, allowing for the detection and treatment of solid tumors. The objective of my research is to explore therapeutic approaches to enhance ALA-based tumor detection and therapy. We have found that high ABCG2 transporter activity in triple negative breast cancer cells (TNBC) contributed to reduced PpIX levels in cells, causing them to be more resistant towards ALA-PDT. The administration of an ABCG2 inhibitor, Ko143, was able to reverse cell resistance to ALA-PDT by enhancing PpIX mitochondrial accumulation and sensitizing cancer cells to ALA-PDT. Ko143 treatment had little effect on PpIX production and ALA-PDT in normal and ER- or HER2-positive cells. Furthermore, since some tyrosine kinase inhibitors (TKI) are known to block ABCG2 transporter activity, we screened a panel of tyrosine kinase inhibitors to examine its effect on enhancing PpIX fluorescence and ALA-PDT efficacy. Several TKIs including lapatinib and gefitinib showed effectiveness in increasing ALA-PpIX fluorescence in TNBC leading to increased cell death after PDT administration. These results indicate that inhibiting ABCG2 transporter using TKIs is a promising approach for targeting TNBC with ALA-based modality.
NASA Astrophysics Data System (ADS)
Davidi, Ronit; Gottfried, Varda; Kimel, Sol
1996-01-01
The chick chorioallantoic membrane (CAM) is a convenient model for the study of photodynamic therapy (PDT). This membrane has a rich vasculature, which mimics the tumor neovasculature, and can also serve as a host for implanted tumors. The transparency of the CAM enables in-vivo monitoring of vascular changes during and post PDT, without the need to sacrifice test animals at each time point. Video documentation and analysis of events occurring during and after irradiation permit the quantification of changes in vessel morphology, blood perfusion and tumor development. The compounds tested in this study belong to a family of potential sensitizers -- the porphycenes. These are phorphyrin isomers based on a 16-membered macrocycle, in which the four methine moieties linking the pyrrole rings have been replaced by two direct bonds and two ethine bridges. Experiments were performed on blood vessels of the intact CAM and on recurrent human melanoma cells implanted on the CAM. Tumor selectivity was demonstrated by measuring drug uptake using fluorescence methods. A sensitizer injected systemically into the embryo yolk sac could be detected in the blood vessels 30 min after injection; 1 h later the sensitizer had preferentially accumulated in the tumor. Tumors were irradiated at the optimal uptake time (after 1 h) for 16 min with a 20 mW HeNe laser. Video image analysis showed that 96 h after irradiation tumors had decreased to 5% of their original size. In contrast, non-irradiated control tumors on the same CAM, continued to proliferate and grew to more than twice their original size. In addition, we observed a difference in the damage mechanism after systemic compared to topical administration. Topical application followed by irradiation caused fast necrosis of tumors, which might suggest direct damage to tumor cells, whereas after systemic administration, PDT damage was manifested by slower necrosis, presumably caused by vascular destruction.
Pro-Apoptotic Activity of New Honokiol/Triphenylmethane Analogues in B-Cell Lymphoid Malignancies.
Mędra, Aleksandra; Witkowska, Magdalena; Majchrzak, Agata; Cebula-Obrzut, Barbara; Bonner, Michael Y; Robak, Tadeusz; Arbiser, Jack L; Smolewski, Piotr
2016-07-30
Honokiol and triphenylmethanes are small molecules with anti-tumor properties. Recently, we synthesized new honokiol analogues (HAs) that possess common features of both groups. We assessed the anti-tumor effectiveness of HAs in B-cell leukemia/lymphoma cells, namely in chronic lymphocytic leukemia (CLL) cells ex vivo and in pre-B-cell acute lymphoblastic leukemia (Nalm-6), Burkitt lymphoma (BL; Raji), diffuse large B-cell lymphoma (DLBCL; Toledo) and multiple myeloma (MM; RPMI 8226) cell lines. Four of these compounds appeared to be significantly active against the majority of cells examined, with no significant impact on healthy lymphocytes. These active HAs induced caspase-dependent apoptosis, causing significant deregulation of several apoptosis-regulating proteins. Overall, these compounds downregulated Bcl-2 and XIAP and upregulated Bax, Bak and survivin proteins. In conclusion, some of the HAs are potent tumor-selective inducers of apoptosis in ex vivo CLL and in BL, DLBCL and MM cells in vitro. Further preclinical studies of these agents are recommended.
Tumor Macroenvironment and Metabolism
Al-Zhoughbi, Wael; Huang, Jianfeng; Paramasivan, Ganapathy S.; Till, Holger; Pichler, Martin; Guertl-Lackner, Barbara; Hoefler, Gerald
2014-01-01
In this review we introduce the concept of the tumor macroenvironment and explore it in the context of metabolism. Tumor cells interact with the tumor microenvironment including immune cells. Blood and lymph vessels are the critical components that deliver nutrients to the tumor and also connect the tumor to the macroenvironment. Several factors are then released from the tumor itself but potentially also from the tumor microenvironment, influencing the metabolism of distant tissues and organs. Amino acids, and distinct lipid and lipoprotein species can be essential for further tumor growth. The role of glucose in tumor metabolism has been studied extensively. Cancer-associated cachexia is the most important tumor-associated systemic syndrome and not only affects the quality of life of patients with various malignancies but is estimated to be the cause of death in 15%–20% of all cancer patients. On the other hand, systemic metabolic diseases such as obesity and diabetes are known to influence tumor development. Furthermore, the clinical implications of the tumor macroenvironment are explored in the context of the patient’s outcome with special consideration for pediatric tumors. Finally, ways to target the tumor macroenvironment that will provide new approaches for therapeutic concepts are described. PMID:24787299
Tumor macroenvironment and metabolism.
Al-Zoughbi, Wael; Al-Zhoughbi, Wael; Huang, Jianfeng; Paramasivan, Ganapathy S; Till, Holger; Pichler, Martin; Guertl-Lackner, Barbara; Hoefler, Gerald
2014-04-01
In this review we introduce the concept of the tumor macroenvironment and explore it in the context of metabolism. Tumor cells interact with the tumor microenvironment including immune cells. Blood and lymph vessels are the critical components that deliver nutrients to the tumor and also connect the tumor to the macroenvironment. Several factors are then released from the tumor itself but potentially also from the tumor microenvironment, influencing the metabolism of distant tissues and organs. Amino acids, and distinct lipid and lipoprotein species can be essential for further tumor growth. The role of glucose in tumor metabolism has been studied extensively. Cancer-associated cachexia is the most important tumor-associated systemic syndrome and not only affects the quality of life of patients with various malignancies but is estimated to be the cause of death in 15%-20% of all cancer patients. On the other hand, systemic metabolic diseases such as obesity and diabetes are known to influence tumor development. Furthermore, the clinical implications of the tumor macroenvironment are explored in the context of the patient's outcome with special consideration for pediatric tumors. Finally, ways to target the tumor macroenvironment that will provide new approaches for therapeutic concepts are described. Copyright © 2014 Elsevier Inc. All rights reserved.
Targeting c-Myc: JQ1 as a promising option for c-Myc-amplified esophageal squamous cell carcinoma.
Wang, Jingyuan; Liu, Zhentao; Wang, Ziqi; Wang, Shubin; Chen, Zuhua; Li, Zhongwu; Zhang, Mengqi; Zou, Jianling; Dong, Bin; Gao, Jing; Shen, Lin
2018-04-10
c-Myc amplification-induced cell cycle dysregulation is a common cause for esophageal squamous cell carcinoma (ESCC), but no approved targeted drug is available so far. The bromodomain inhibitor JQ1, which targets c-Myc, exerts anti-tumor activity in multiple cancers. However, the role of JQ1 in ESCC remains unknown. In this study, we reported that JQ1 had potent anti-proliferative effects on ESCC cells in both time- and dose-dependent manners by inducing cell cycle arrest at G1 phase, cell apoptosis, and the mesenchymal-epithelial transition. Follow-up studies revealed that both c-Myc/cyclin/Rb and PI3K/AKT signaling pathways were inactivated by JQ1, as indicated by the downregulation of c-Myc, cyclin A/E, and phosphorylated Rb, AKT and S6. Tumor suppression induced by JQ1 in c-Myc amplified or highly expressed xenografts was higher than that in xenografts with low expression, suggesting its potential role in prediction. In conclusion, targeting c-Myc by JQ1 could cause significant tumor suppression in ESCC both in vitro and in vivo. Also, c-Myc amplification or high expression might serve as a potential biomarker and provide a promising therapeutic option for ESCC. Copyright © 2018 Elsevier B.V. All rights reserved.
Ardiani, Andressa; Gameiro, Sofia R.; Kwilas, Anna R.; Donahue, Renee N.; Hodge, James W.
2014-01-01
Despite recent advances in diagnosis and management, prostrate cancer remains the second most common cause of death from cancer in American men, after lung cancer. Failure of chemotherapies and hormone-deprivation therapies is the major cause of death in patients with castration-resistant prostate cancer (CRPC). Currently, the androgen inhibitors enzalutamide and abiraterone are approved for treatment of metastatic CRPC. Here we show for the first time that both enzalutamide and abiraterone render prostate tumor cells more sensitive to T cell-mediated lysis through immunogenic modulation, and that these immunomodulatory activities are androgen receptor (AR)-dependent. In studies reported here, the NAIP gene was significantly down-regulated in human prostate tumor cells treated in vitro and in vivo with enzalutamide. Functional analysis revealed that NAIP played a critical role in inducing CTL sensitivity. Amplification of AR is a major mechanism of resistance to androgen-deprivation therapy (ADT). Here, we show that enzalutamide enhances sensitivity to immune-mediated killing of prostate tumor cells that overexpress AR. The immunomodulatory properties of enzalutamide and abiraterone provide a rationale for their use in combination with immunotherapeutic agents in CRPC, especially for patients with minimal response to enzalutamide or abiraterone alone, or for patients who have developed resistance to ADT. PMID:25344864
T Cells that Recognize HPV Protein Can Target Virus-Infected Cells | Center for Cancer Research
Adoptive T-cell transfer (ACT) is a promising form of cancer immunotherapy. Treating patients with T cells isolated from a tumor and subsequently expanded in the lab can cause the complete regression of some melanomas and cervical cancers, but the treatment is currently restricted to a few cancer types. An approach that may be applied to a wider array of cancers involves modifying peripheral blood T cells with chimeric antigen receptors or T-cell receptors (TCR) that target specific tumor antigens. Unfortunately, epithelial cancers, which are the vast majority of cancers diagnosed, have proven difficult to treat this way because most identified antigens are shared with healthy tissues and targeting them leads to toxic side effects. However, cancers caused by persistent human papillomavirus (HPV) infection, including cervical, head and neck, anal, vaginal, vulvar, and penile cancers, may be particularly amenable to the latter form of ACT since the E6 and E7 viral proteins are essential for cancer formation but are not produced in normal tissues. To test this idea, Christian Hinrichs, M.D., and his colleagues examined tumor infiltrating lymphocytes (TILs) from a patient who experienced a prolonged disease-free period after her second surgical removal of metastatic anal cancer in the hopes of identifying a TCR against one of the HPV oncoproteins.
Phillips, P.A.; Sangwan, V.; Borja-Cacho, D.; Dudeja, V.; Vickers, S.M.; Saluja, A.K.
2011-01-01
Pancreatic cancer is a the four leading cause of cancer related deaths and is adisease with poor prognosis. It is refractory to standard chemotherapeutic drugs or to novel treatment modalities, making it imperative to find new treatments. In this study, using both primary and metastatic pancreatic cancer cell lines, we have demonstrated that the flavonoid myricetin induced pancreatic cancer cell death in vitro via apoptosis, and caused a decrease in PI3 kinase activity. In vivo, treatment of orthotopic pancreatic tumors with myricetin resulted in tumor regression and decreased metastatic spread. Importantly, myricetin was non-toxic, both in vitro and in vivo, underscoring its use as a therapeutic agent against pancreatic cancer. PMID:21676539
Anti-VEGF treatment reduces blood supply and increases tumor cell invasion in glioblastoma.
Keunen, Olivier; Johansson, Mikael; Oudin, Anaïs; Sanzey, Morgane; Rahim, Siti A Abdul; Fack, Fred; Thorsen, Frits; Taxt, Torfinn; Bartos, Michal; Jirik, Radovan; Miletic, Hrvoje; Wang, Jian; Stieber, Daniel; Stuhr, Linda; Moen, Ingrid; Rygh, Cecilie Brekke; Bjerkvig, Rolf; Niclou, Simone P
2011-03-01
Bevacizumab, an antibody against vascular endothelial growth factor (VEGF), is a promising, yet controversial, drug in human glioblastoma treatment (GBM). Its effects on tumor burden, recurrence, and vascular physiology are unclear. We therefore determined the tumor response to bevacizumab at the phenotypic, physiological, and molecular level in a clinically relevant intracranial GBM xenograft model derived from patient tumor spheroids. Using anatomical and physiological magnetic resonance imaging (MRI), we show that bevacizumab causes a strong decrease in contrast enhancement while having only a marginal effect on tumor growth. Interestingly, dynamic contrast-enhanced MRI revealed a significant reduction of the vascular supply, as evidenced by a decrease in intratumoral blood flow and volume and, at the morphological level, by a strong reduction of large- and medium-sized blood vessels. Electron microscopy revealed fewer mitochondria in the treated tumor cells. Importantly, this was accompanied by a 68% increase in infiltrating tumor cells in the brain parenchyma. At the molecular level we observed an increase in lactate and alanine metabolites, together with an induction of hypoxia-inducible factor 1α and an activation of the phosphatidyl-inositol-3-kinase pathway. These data strongly suggest that vascular remodeling induced by anti-VEGF treatment leads to a more hypoxic tumor microenvironment. This favors a metabolic change in the tumor cells toward glycolysis, which leads to enhanced tumor cell invasion into the normal brain. The present work underlines the need to combine anti-angiogenic treatment in GBMs with drugs targeting specific signaling or metabolic pathways linked to the glycolytic phenotype.
The self-renewal signaling pathways utilized by gastric cancer stem cells.
Fu, Ying; Li, Hui; Hao, Xishan
2017-04-01
Gastric cancer is a leading cause of cancer-related mortality worldwide. Cancer stem cells are the source of tumor recurrence and metastasis. Self-renewal is a marker of cancer stem cells and also the basis of long-lasting survival and tumor progression. Although the mechanism of gastric cancer stem cell self-renewal is not clear, there are several signaling pathways and environmental factors known to be involved. This mini review describes recent developments in the self-renewal signaling pathway of gastric cancer stem cell research. Advancements made in this field of research will likely support the development of novel therapeutic strategies for gastric cancer.
Role of Hsp-70 in triptolide-mediated cell death of neuroblastoma.
Antonoff, Mara B; Chugh, Rohit; Skube, Steven J; Dudeja, Vikas; Borja-Cacho, Daniel; Clawson, Kimberly A; Vickers, Selwyn M; Saluja, Ashok K
2010-09-01
Our recent work demonstrated that treatment of neuroblastoma with triptolide causes apoptotic cell death in vitro and decreases tumor size in vivo. Triptolide therapy has been associated with reduced expression of Hsp-70, suggesting a mechanism of cell killing involving Hsp-70 inhibition. The principal objective of this study was to investigate the role of Hsp-70 in triptolide-mediated cell death in neuroblastoma. Neuroblastoma cells were transfected with Hsp-70-specific siRNA. Viability, caspase activity, and phosphatidylserine externalization were subsequently measured. An orthotopic, syngeneic murine tumor model was developed, and randomized mice received daily injections of triptolide or vehicle. At 21 d, mice were sacrificed. Immunohistochemisty was used to characterize Hsp-70 levels in residual tumors, and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) was performed to identify cells undergoing apoptosis. Targeted silencing of Hsp-70 with siRNA significantly decreased cellular viability, augmented caspase-3 activity, and resulted in increased annexin-V staining. These effects parallel those findings obtained following treatment with triptolide. Residual tumors from triptolide-treated mice showed minimal staining with Hsp-70 immunohistochemistry, while control tumors stained prominently. Tumors from treated mice demonstrated marked staining with the TUNEL assay, while control tumors showed no evidence of apoptosis. Use of siRNA to suppress Hsp-70 expression in neuroblastoma resulted in apoptotic cell death, similar to the effects of triptolide. Residual tumors from triptolide-treated mice expressed decreased levels of Hsp-70 and demonstrated significant apoptosis. These findings support the hypothesis that Hsp-70 inhibition plays a significant role in triptolide-mediated neuroblastoma cell death. Copyright 2010 Elsevier Inc. All rights reserved.
Hillman, Gilda Gali; Singh-Gupta, Vinita; Al-Bashir, Areen K; Yunker, Christopher K; Joiner, Michael C; Sarkar, Fazlul H; Abrams, Judith; Haacke, E Mark
2011-01-01
Using dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) to monitor vascular changes induced by sunitinib within a murine xenograft kidney tumor, we previously determined a dose that caused only partial destruction of blood vessels leading to “normalization” of tumor vasculature and improved blood flow. In the current study, kidney tumors were treated with this dose of sunitinib to modify the tumor microenvironment and enhance the effect of kidney tumor irradiation. The addition of soy isoflavones to this combined antiangiogenic and radiotherapy approach was investigated based on our studies demonstrating that soy isoflavones can potentiate the radiation effect on the tumors and act as antioxidants to protect normal tissues from treatment-induced toxicity. DCE-MRI was used to monitor vascular changes induced by sunitinib and schedule radiation when the uptake and washout of the contrast agent indicated regularization of blood flow. The combination of sunitinib with tumor irradiation and soy isoflavones significantly inhibited the growth and invasion of established kidney tumors and caused marked aberrations in the morphology of residual tumor cells. DCE-MRI studies demonstrated that the three modalities, sunitinib, radiation, and soy isoflavones, also exerted antiangiogenic effects resulting in increased uptake and clearance of the contrast agent. Interestingly, DCE-MRI and histologic observations of the normal contralateral kidneys suggest that soy could protect the vasculature of normal tissue from the adverse effects of sunitinib. An antiangiogenic approach that only partially destroys inefficient vessels could potentially increase the efficacy and delivery of cytotoxic therapies and radiotherapy for unresectable primary renal cell carcinoma tumors and metastatic disease. PMID:21461174
Anderson, Abigail M.; Bailetti, Alessandro A.; Rodkin, Elizabeth; De, Atish; Bach, Erika A.
2017-01-01
A gain-of-function mutation in the tyrosine kinase JAK2 (JAK2V617F) causes human myeloproliferative neoplasms (MPNs). These patients present with high numbers of myeloid lineage cells and have numerous complications. Since current MPN therapies are not curative, there is a need to find new regulators and targets of Janus kinase/Signal transducer and activator of transcription (JAK/STAT) signaling that may represent additional clinical interventions . Drosophila melanogaster offers a low complexity model to study MPNs as JAK/STAT signaling is simplified with only one JAK [Hopscotch (Hop)] and one STAT (Stat92E). hopTumorous-lethal (Tum-l) is a gain-of-function mutation that causes dramatic expansion of myeloid cells, which then form lethal melanotic tumors. Through an F1 deficiency (Df) screen, we identified 11 suppressors and 35 enhancers of melanotic tumors in hopTum-l animals. Dfs that uncover the Hippo (Hpo) pathway genes expanded (ex) and warts (wts) strongly enhanced the hopTum-l tumor burden, as did mutations in ex, wts, and other Hpo pathway genes. Target genes of the Hpo pathway effector Yorkie (Yki) were significantly upregulated in hopTum-l blood cells, indicating that Yki signaling was increased. Ectopic hematopoietic activation of Yki in otherwise wild-type animals increased hemocyte proliferation but did not induce melanotic tumors. However, hematopoietic depletion of Yki significantly reduced the hopTum-l tumor burden, demonstrating that Yki is required for melanotic tumors in this background. These results support a model in which elevated Yki signaling increases the number of hemocytes, which become melanotic tumors as a result of elevated JAK/STAT signaling. PMID:28620086
Choi, Eun K; Terai, Kaoru; Ji, In-Mi; Kook, Yeon H; Park, Kyung H; Oh, Eun T; Griffin, Robert J; Lim, Byung U; Kim, Jin-Seok; Lee, Doo S; Boothman, David A; Loren, Melissa; Song, Chang W; Park, Heon Joo
2007-01-01
We found that β-lapachone (β-lap), a novel bioreductive drug, caused rapid apoptosis and clonogenic cell death in A549 human lung epithelial cancer cells in vitro in a dose-dependent manner. The clonogenic cell death caused by β-lap could be significantly inhibited by dicoumarol, an inhibitor of NAD(P)H:quinone oxido-reductase (NQO1), and also by siRNA for NQO1, demonstrating that NQO1-induced bioreduction of β-lap is an essential step in β-lap-induced cell death. Irradiation of A549 cells with 4 Gy caused a long-lasting upregulation of NQO1, thereby increasing NQO1-mediated β-lap-induced cell deaths. Although the direct cause of β-lap-induced apoptosis is not yet clear, β-lap treatment reduced the expression of p53 and NF-κB, whereas it increased cytochrome C release, caspase-3 activity, and γH2AX foci formation. Importantly, β-lap treatment immediately after irradiation enhanced radiation-induced cell death, indicating that β-lap sensitizes cancer cells to radiation, in addition to directly killing some of the cells. The growth of A549 tumors induced in immunocompromised mice could be markedly suppressed by local radiation therapy when followed by β-lap treatment. This is the first study to demonstrate that combined radiotherapy and β-lap treatment can have a significant effect on human tumor xenografts. PMID:17786182
Pharmacological targets of breast cancer stem cells: a review.
Pindiprolu, Sai Kiran S S; Krishnamurthy, Praveen T; Chintamaneni, Pavan Kumar
2018-05-01
Breast cancers contain small population of tumor-initiating cells called breast cancer stem cells (BCSCs), which are spared even after chemotherapy. Recently, BCSCs are implicated to be a cause of metastasis, tumor relapse, and therapy resistance in breast cancer. BCSCs have unique molecular mechanisms, which can be targeted to eliminate them. These include surface biomarkers, proteins involved in self-renewal pathways, drug efflux transporters, apoptotic/antiapoptotic proteins, autophagy, metabolism, and microenvironment regulation. The complex molecular mechanisms behind the survival of BCSCs and pharmacological targets for elimination of BCSCs are described in this review.
Würth, Roberto; Bajetto, Adriana; Harrison, Jeffrey K; Barbieri, Federica; Florio, Tullio
2014-01-01
Chemokines are crucial autocrine and paracrine players in tumor development. In particular, CXCL12, through its receptors CXCR4 and CXCR7, affects tumor progression by controlling cancer cell survival, proliferation and migration, and, indirectly, via angiogenesis or recruiting immune cells. Glioblastoma (GBM) is the most prevalent primary malignant brain tumor in adults and despite current multimodal therapies it remains almost incurable. The aggressive and recurrent phenotype of GBM is ascribed to high growth rate, invasiveness to normal brain, marked angiogenesis, ability to escape the immune system and resistance to standard of care therapies. Tumor molecular and cellular heterogeneity severely hinders GBM therapeutic improvement. In particular, a subpopulation of chemo- and radio-therapy resistant tumorigenic cancer stem-like cells (CSCs) is believed to be the main responsible for tumor cell dissemination to the brain. GBM cells display heterogeneous expression levels of CXCR4 and CXCR7 that are overexpressed in CSCs, representing a molecular correlate for the invasive potential of GBM. The microenvironment contribution in GBM development is increasingly emphasized. An interplay exists between CSCs, differentiated GBM cells, and the microenvironment, mainly through secreted chemokines (e.g., CXCL12) causing recruitment of fibroblasts, endothelial, mesenchymal and inflammatory cells to the tumor, via specific receptors such as CXCR4. This review covers recent developments on the role of CXCL12/CXCR4-CXCR7 networks in GBM progression and the potential translational impact of their targeting. The biological and molecular understanding of the heterogeneous GBM cell behavior, phenotype and signaling is still limited. Progress in the identification of chemokine-dependent mechanisms that affect GBM cell survival, trafficking and chemo-attractive functions, opens new perspectives for development of more specific therapeutic approaches that include chemokine-based drugs.
T Cells that Recognize HPV Protein Can Target Virus-Infected Cells | Center for Cancer Research
Treating patients with T cells isolated from a tumor and subsequently expanded in the lab can cause the complete regression of some melanomas and cervical cancers, but the treatment is currently restricted to a few cancer types.
Epstein-Barr virus and nasopharyngeal carcinoma
Young, Lawrence S.; Dawson, Christopher W.
2014-01-01
Since its discovery 50 years ago, Epstein-Barr virus (EBV) has been linked to the development of cancers originating from both lymphoid and epithelial cells. Approximately 95% of the world's population sustains an asymptomatic, life-long infection with EBV. The virus persists in the memory B-cell pool of normal healthy individuals, and any disruption of this interaction results in virus-associated B-cell tumors. The association of EBV with epithelial cell tumors, specifically nasopharyngeal carcinoma (NPC) and EBV-positive gastric carcinoma (EBV-GC), is less clear and is currently thought to be caused by the aberrant establishment of virus latency in epithelial cells that display premalignant genetic changes. Although the precise role of EBV in the carcinogenic process is currently poorly understood, the presence of the virus in all tumor cells provides opportunities for developing novel therapeutic and diagnostic approaches. The study of EBV and its role in carcinomas continues to provide insight into the carcinogenic process that is relevant to a broader understanding of tumor pathogenesis and to the development of targeted cancer therapies. PMID:25418193
Mulder, A H; Raemaekers, J M; Boerman, R H; Mattijssen, V
1999-02-01
A 24-year-old woman with a large cell anaplastic CD 30-positive T-cell non-Hodgkin's lymphoma (NHL) developed downbeat nystagmus, anisocoria, and oscillopsia. Prior to overt cerebral invasion by NHL, she had a thiamine deficiency with very low thiamine concentrations in the CSF, probably caused by protracted vomiting and increased vitamin B1 consumption by intrathecal tumor cells. We believe that her neurologic symptoms were caused -- at least partly -- by thiamine deficiency, as she reacted well to thiamine supplementation at the beginning of treatment.
Alipour, Mohsen; Majidi, Asia; Molaabasi, Fatemeh; Sheikhnejad, Reza; Hosseinkhani, Saman
2018-04-30
Modulating cancer causing genes with nucleic acid based-molecules as cutting-edge approaches need efficient delivery systems to succeed in clinic. Herein, we report design and fabrication of a novel tissue penetrating Peptideticle with charge-structure switching in tumor microenvironment for an effective gene delivery. The comparative in vitro studies indicate that peptideticles identify and bind to tumor endothelial cells and efficiently penetrate into multicellular tumor spheroid. In addition, negatively charged peptideticle at pH 7.4, prevent unwanted interaction while it's sharp charge-structure switching at pH 6.2-6.9 (e.g.in tumor tissue) facilitates malignant cells penetration. More importantly, upon systemic administration into tumor bearing mice, peptideticles effectively localized in tumor tissue and delivered luciferase gene with a 200-fold higher efficiency compared to their non-pH-responsive counterparts. In conclusion, this study presents a robust nanoassembly of safe materials for high efficient tumor gene delivery. This article is protected by copyright. All rights reserved. © 2018 UICC.
Stenbäck, F; Kangas, L; Wasenius, V M
1985-12-01
Specimens from 16 freshly biopsied human tumors, two mammary adenocarcinomas, ten ovarian adenocarcinomas, two squamous cell carcinomas, one malignant histiocytoma and one chondrosarcoma of the bone, two human ovarian adenocarcinomas established by transplantation into nude mice and two adenocarcinomas induced in rat mammary gland were transplanted under the renal capsule of 510 normal immunocompetent mice and 180 rats and the effects of chemotherapy were evaluated. The results showed successful transplantation of all types of tumors in both animal species. Morphological analysis revealed preserved glandular structures with surface microvilli, mucin and CEA production and partially preserved basement membranes. Treatment with cyclophosphamide, vinblastine, adriamycin and cisplatin caused cell shrinkage, degradation and partial or total disappearance of the tumor cells. Vascularization was distinct in all specimens. A cellular infiltrate was found frequently but not consistently. A common end stage was a fibrotic scar with no cellular activity, occasionally giving a misleading impression of a growing tumor on gross observation. The results were obtained rapidly and suggest that the subrenal capsule assay would be useful for evaluating the sensitivity of human tumors to therapeutic manipulation, but needs supplementary histological examination.
DNA replication stress and cancer chemotherapy.
Kitao, Hiroyuki; Iimori, Makoto; Kataoka, Yuki; Wakasa, Takeshi; Tokunaga, Eriko; Saeki, Hiroshi; Oki, Eiji; Maehara, Yoshihiko
2018-02-01
DNA replication is one of the fundamental biological processes in which dysregulation can cause genome instability. This instability is one of the hallmarks of cancer and confers genetic diversity during tumorigenesis. Numerous experimental and clinical studies have indicated that most tumors have experienced and overcome the stresses caused by the perturbation of DNA replication, which is also referred to as DNA replication stress (DRS). When we consider therapeutic approaches for tumors, it is important to exploit the differences in DRS between tumor and normal cells. In this review, we introduce the current understanding of DRS in tumors and discuss the underlying mechanism of cancer therapy from the aspect of DRS. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
Liu, Li-Qiao; Li, Hai-Shan; Shen, Ming-Yue; Hu, Jie-Lun; Xie, Ming-Yong
2018-01-01
The imbalance between cell proliferation and apoptosis can lead to tumor progression, causing oncogenic transformation, abnormal cell proliferation and cell apoptosis suppression. Tea polysaccharide (TPS) is the major bioactive component in green tea, it has showed antioxidant, antitumor and anti-inflammatory bioactivities. In this study, the chemoprophylaxis effects of TPS on colitis-associated colon carcinogenesis, especially the cell apoptosis activation and inhibition effects on cell proliferation and invasion were analyzed. The azoxymethane/dextran sulfate sodium (AOM/DSS) was used to induce the colorectal carcinogenesis in mice. Results showed that the tumor incidence was reduced in TPS-treated AOM/DSS mice compared to AOM/DSS mice. TUNEL staining and Ki-67 immunohistochemistry staining showed that the TPS treatment increased significantly the cell apoptosis and decreased cell proliferation among AOM/DSS mice. Furthermore, TPS reduced the expression levels of the cell cycle protein cyclin D1, matrix metalloproteinase (MMP)-2, and MMP-9. In addition, in vitro studies showed that TPS, suppressed the proliferation and invasion of the mouse colon cancer cells. Overall, our findings demonstrated that TPS could be a potential agent in the treatment and/or prevention of colon tumor, which promoted the apoptosis and suppressed the proliferation and invasion of the mouse colon cancer cells via arresting cell cycle progression. PMID:29419740
Microfluidic Device for Studying Tumor Cell Extravasation in Cancer Metastasis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Henry K; Thundat, Thomas George; Evans III, Boyd Mccutchen
Metastasis is the process by which cancer spreads to form secondary tumors at downstream locations throughout the body. This uncontrolled spreading is the leading cause of death in patients with epithelial cancers and is the main reason that suppressing and targeting cancer has proven to be so challenging. Tumor cell extravasation is one of the key steps in cancer s progression towards a metastatic state. This occurs when circulating tumor cells found within the blood stream are able to transmigrate through the endothelium lining and basement membrane of the vasculature to form metastatic tumors at secondary sites within the body.more » Predicting the likelihood of this occurrence in patients, or being able to determine specific markers involved in this process could lead to preventative measures targeting these types of cancer; moreover, this may lead to the discovery of novel anti-metastatic drugs. We have developed a microfluidic device that has shown the extravasation of fluorescently labeled tumor cells across an endothelial cell lined membrane coated with matrigel followed by the formation of colonies. This device provides the advantages of combining a controlled environment, mimicking that found within the body, with real-time monitoring capabilities allowing for the study of these biomarkers and cellular interactions along with other potential mechanisms involved in the process of extravasation.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huamani, Jessica; Willey, Christopher; Thotala, Dinesh
2008-05-01
Purpose: To determine the efficacy of combining radiation (XRT) with a dual epidermal growth factor receptor (EGFR)/vascular endothelial growth factor receptor inhibitor, AEE788, in prostate cancer models with different levels of EGFR expression. Methods and Materials: Immunoblotting was performed for EGFR, phosphorylated-EGFR, and phosphorylated-AKT in prostate cancer cells. Clonogenic assays were performed on DU145, PC-3, and human umbilical vein endothelial cells treated with XRT {+-} AEE788. Tumor xenografts were established for DU145 and PC-3 on hind limbs of athymic nude mice assigned to four treatment groups: (1) control, (2) AEE788, (3) XRT, and (4) AEE788 + XRT. Tumor blood flowmore » and growth measurements were performed using immunohistochemistry and imaging. Results: AEE788 effectively decreased phosphorylated-EGFR and phosphorylated-AKT levels in DU145 and PC-3 cells. Clonogenic assays showed no radiosensitization for DU145 and PC-3 colonies treated with AEE788 + XRT. However, AEE788 caused decreased proliferation in DU145 cells. AEE788 showed a radiosensitization effect in human umbilical vein endothelial cells and increased apoptosis susceptibility. Concurrent AEE788 + XRT compared with either alone led to significant tumor growth delay in DU145 tumors. Conversely, PC-3 tumors derived no added benefit from combined-modality therapy. In DU145 tumors, a significant decrease in tumor blood flow with combination therapy was shown by using power Doppler sonography and tumor blood vessel destruction on immunohistochemistry. Maldi-spectrometry (MS) imaging showed that AEE788 is bioavailable and heterogeneously distributed in DU145 tumors undergoing therapy. Conclusions: AEE788 + XRT showed efficacy in vitro/in vivo with DU145-based cell models, whereas PC-3-based models were adequately treated with XRT alone without added benefit from combination therapy. These findings correlated with differences in EGFR expression and showed effects on both tumor cell proliferation and vascular destruction.« less
Curcumin and Turmeric Modulate the Tumor-Promoting Effects of Iron In Vitro.
Messner, Donald J; Robinson, Todd; Kowdley, Kris V
2017-04-01
Free or loosely chelated iron has tumor-promoting properties in vitro. Curcumin, a polyphenol derived from the food spice turmeric (Curcuma longa), is a potent antioxidant that binds iron. The primary aim of this study was to investigate whether curcuminoids prevent tumor-promoting effects of iron in T51B cells, a non-neoplastic rat liver epithelial cell line. Purified curcuminoids (curcumin) or a standardized turmeric extract similarly reduced oxidative stress and cytotoxicity associated with iron overload (IC 50 values near 10 μM, P < 0.05). Inhibition of iron-induced tumor promotion (seen upon treatment with 200 μM ferric ammonium citrate ± curcumin/turmeric for 16 wk in culture; subsequently assayed by soft agar colony formation) was nearly complete at 20 μM of total curcuminoids (P < 0.05), a concentration predicted to only partially chelate the added iron. Surprisingly, lower curcumin concentrations (10 μM) increased tumor promotion (P < 0.01). Curcuminoids delivered as a standardized turmeric extract were taken up better by cells, had a longer half-life, and appeared more effective in blocking tumor promotion (P < 0.01), suggesting enhanced curcuminoid delivery to cells in culture. The primary finding that curcuminoids can inhibit tumor promotion caused by iron in T51B cells is tempered by evidence for an underlying increase in neoplastic transformation at lower concentrations.
Hettich, Michael; Lahoti, Jayashree; Prasad, Shruthi; Niedermann, Gabriele
2016-08-15
T cell-recruiting bispecific antibodies (bsAb) show promise in hematologic malignancies and are also being evaluated in solid tumors. In this study, we investigated whether T cell-recruiting bsAbs synergize with hypofractionated tumor radiotherapy (hRT) and/or blockade of the programmed death-1 (PD-1) immune checkpoint, both of which can increase tumor-infiltrating lymphocyte (TIL) numbers. Unexpectedly, large melanomas treated with hRT plus bsAb (AC133×CD3) relapsed faster than those treated with hRT alone, accompanied by massive TIL apoptosis. This fast relapse was delayed by the further addition of anti-PD-1. Mechanistic investigations revealed restimulation-induced cell death mediated by BIM and FAS as an additional cause of bsAb-mediated TIL depletion. In contrast, the double combination of hRT and anti-PD-1 strongly increased TIL numbers, and even very large tumors were completely eradicated. Our study reveals the risk that CD3-engaging bsAbs can induce apoptotic TIL depletion followed by rapid tumor regrowth, reminiscent of tolerance induction by CD3 mAb-mediated T-cell depletion, warranting caution in their use for the treatment of solid tumors. Our findings also argue that combining radiotherapy and anti-PD-1 can be quite potent, including against very large tumors. Cancer Res; 76(16); 4673-83. ©2016 AACR. ©2016 American Association for Cancer Research.
Curcumin and Turmeric Modulate the Tumor-Promoting Effects of Iron In Vitro
Messner, Donald J.; Robinson, Todd; Kowdley, Kris V.
2018-01-01
Free or loosely chelated iron has tumor-promoting properties in vitro. Curcumin, a polyphenol derived from the food spice turmeric (Curcuma longa), is a potent antioxidant that binds iron. The primary aim of this study was to investigate whether curcuminoids prevent tumor-promoting effects of iron in T51B cells, a non-neoplastic rat liver epithelial cell line. Purified curcuminoids (curcumin) or a standardized turmeric extract similarly reduced oxidative stress and cytotoxicity associated with iron overload (IC50 values near 10 μM, P < 0.05). Inhibition of iron-induced tumor promotion (seen upon treatment with 200 μM ferric ammonium citrate ± curcumin/turmeric for 16 wk in culture; subsequently assayed by soft agar colony formation) was nearly complete at 20 μM of total curcuminoids (P < 0.05), a concentration predicted to only partially chelate the added iron. Surprisingly, lower curcumin concentrations (10 μM) increased tumor promotion (P < 0.01). Curcuminoids delivered as a standardized turmeric extract were taken up better by cells, had a longer half-life, and appeared more effective in blocking tumor promotion (P < 0.01), suggesting enhanced curcuminoid delivery to cells in culture. The primary finding that curcuminoids can inhibit tumor promotion caused by iron in T51B cells is tempered by evidence for an underlying increase in neoplastic transformation at lower concentrations. PMID:28129008
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Chen-Shuang; Tian, Haijun, E-mail: haijuntianmd@gmail.com; Department of Orthopaedic Surgery, University of California, Los Angeles, Los Angeles, CA
The emerging role of bone morphogenetic proteins (BMPs) in the initiation and progression of multiple cancers has drawn great attention in cancer research. In this study, we report that BMP-2 can promote the proliferation of the pancreatic tumor cell line, PANC-1. Secreted phosphoprotein 24 kD (Spp24), a BMP binding protein, did not affect the proliferation of the cells but promoted the apoptosis of the cells in vitro. In a xeneograft tumor model using PANC-1 cells, BMP-2 dramatically promoted tumor growth, while Spp24 not only abolished the effect of BMP-2, but also dramatically induced tumor shrinking when used alone. Activation of Smad1/5/8 participatedmore » in this process as demonstrated by immunohistochemical staining of phosphorylated Smad 1/5/8. We conclude that Spp24 can be developed into a therapeutic agent that could be employed in clinical situations where the inhibition of BMPs and related proteins is advantageous. - Highlights: • Spp24 effectively inhibited the in vivo tumor growth of PANC-1. • BMP-2 dramatically promoted tumor growth by promoting PANC-1 proliferation. • Spp24 abolished the tumor growth effect of BMP-2 by promoting PANC-1 apoptosis. • Spp24 may be a candidate as a therapeutic agent of pancreatic cancer.« less
Silva, Patrícia Benites Gonçalves da; Rodini, Carolina Oliveira; Kaid, Carolini; Nakahata, Adriana Miti; Pereira, Márcia Cristina Leite; Matushita, Hamilton; Costa, Silvia Souza da; Okamoto, Oswaldo Keith
2016-08-01
Medulloblastoma is a highly aggressive brain tumor and one of the leading causes of morbidity and mortality related to childhood cancer. These tumors display differential ability to metastasize and respond to treatment, which reflects their high degree of heterogeneity at the genetic and molecular levels. Such heterogeneity of medulloblastoma brings an additional challenge to the understanding of its physiopathology and impacts the development of new therapeutic strategies. This translational effort has been the focus of most pre-clinical studies which invariably employ experimental models using human tumor cell lines. Nonetheless, compared to other cancers, relatively few cell lines of human medulloblastoma are available in central repositories, partly due to the rarity of these tumors and to the intrinsic difficulties in establishing continuous cell lines from pediatric brain tumors. Here, we report the establishment of a new human medulloblastoma cell line which, in comparison with the commonly used and well-established cell line Daoy, is characterized by enhanced proliferation and invasion capabilities, stem cell properties, increased chemoresistance, tumorigenicity in an orthotopic metastatic model, replication of original medulloblastoma behavior in vivo, strong chromosome structural instability and deregulation of genes involved in neural development. These features are advantageous for designing biologically relevant experimental models in clinically oriented studies, making this novel cell line, named USP-13-Med, instrumental for the study of medulloblastoma biology and treatment.
Cytokines in immunogenic cell death: Applications for cancer immunotherapy.
Showalter, Anne; Limaye, Arati; Oyer, Jeremiah L; Igarashi, Robert; Kittipatarin, Christina; Copik, Alicja J; Khaled, Annette R
2017-09-01
Despite advances in treatments like chemotherapy and radiotherapy, metastatic cancer remains a leading cause of death for cancer patients. While many chemotherapeutic agents can efficiently eliminate cancer cells, long-term protection against cancer is not achieved and many patients experience cancer recurrence. Mobilizing and stimulating the immune system against tumor cells is one of the most effective ways to protect against cancers that recur and/or metastasize. Activated tumor specific cytotoxic T lymphocytes (CTLs) can seek out and destroy metastatic tumor cells and reduce tumor lesions. Natural Killer (NK) cells are a front-line defense against drug-resistant tumors and can provide tumoricidal activity to enhance tumor immune surveillance. Cytokines like IFN-γ or TNF play a crucial role in creating an immunogenic microenvironment and therefore are key players in the fight against metastatic cancer. To this end, a group of anthracyclines or treatments like photodynamic therapy (PDT) exert their effects on cancer cells in a manner that activates the immune system. This process, known as immunogenic cell death (ICD), is characterized by the release of membrane-bound and soluble factors that boost the function of immune cells. This review will explore different types of ICD inducers, some in clinical trials, to demonstrate that optimizing the cytokine response brought about by treatments with ICD-inducing agents is central to promoting anti-cancer immunity that provides long-lasting protection against disease recurrence and metastasis. Copyright © 2017. Published by Elsevier Ltd.
Bhardwaj, Sharonlin; Varma, Seema
2018-03-01
Tumor lysis syndrome is a serious and sometimes lethal complication of cancer treatment that is comprised of a set of metabolic disturbances along with clinical manifestations. Initiating chemotherapy in bulky, rapidly proliferating tumors causes rapid cell turnover that in turn releases metabolites into circulation that give rise to metabolic derangements that can be dangerous. This syndrome is usually seen in high-grade hematological malignancies. Less commonly, tumor lysis syndrome can present in solid tumors and even rarely in genitourinary tumors. In this report, the authors describe a specific case of tumor lysis syndrome in a patient with metastatic prostate cancer following treatment with docetaxel.
Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko
2018-05-24
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Lapidot, Tair; Walker, Michael D; Kanner, Joseph
2002-05-22
It has recently been suggested that the ability of apple extracts to inhibit proliferation of tumor cells in vitro may be due to phenolic/flavonoid antioxidants. Our study demonstrates that this inhibition is caused indirectly by H(2)O(2) generated through interaction of the phenolics with the cell culture media. The results indicate that many previously reported effects of flavonoids and phenolic compounds on cultured cells may result from similar artifactual generation of oxidative stress. We suggest that in order to prevent such artifacts, the use of catalase and/or metmyoglobin in the presence of reducing agents should be considered as a method to decompose H(2)O(2) and prevent generation of other reactive oxygen species, which could affect cell proliferation. The use of tumor cells and "nontumor cells" in a bioassay to measure antioxidant activity, in this context, is potentially misleading and should be applied with caution.
Zonov, E V; Voronina, E I; Zenkova, M A; Ageeva, T A; Ryabchikova, E I
2013-03-01
Polychemotherapy (PCT), widely used for the antitumor treatment has a pronounced toxic effect on the organism, and its cytostatic effect sometimes is canceled by multidrug resistance of a neoplasia. Comprehension of the nature and development of pathological changes caused by the PCT during the treatment of cancer is very important to improve the efficiency of the therapy and to clarify the mechanisms of tumor-host interactions. This study was aimed to examine PCT impact on kidney cells and tissues in mice with transplanted resistant lymphosacroma (RLS) and to analyze morphology of metastases of the tumor in kidney during PCT. Male mice CBA/LacSto (55 animals) were intramuscularly implanted in the right hind paw by 105 cells/ml of tumor RLS (a diffuse large B-cell lymphosarcoma) with multi-drug resistance (MDR) phenotype. Mice received combination of cyclophosphamide (50 mg/kg), oncovin (0.1 mg/kg), hydroxydaunorubicin (4 mg/kg), and prednisone (5 mg/kg) accordingly to CHOP scheme each 7 days after inoculation of the tumor. The kidneys were sampled on days 1, 3 and 7 after each series of injection of PCT preparations and processed for light and electron microscopy, immunohistochemical analysis of Ki-67 and Apaf-1 proteins also was performed. Tumor RLS produced metastases comprised of small cells in the kidneys of mice after 8 days post inoculation. Application of PCT resulted in destruction of small-cell metastases and development of many large-cell metastases in kidney. Application of PCT induced the development of prominent damage of nephron cells, primarily in S3 segments of proximal tubules. Even one series of PCT caused reduction of basal plasma folds in these cells and alteration of mitochondria. Damage of proximal tubules and involvement of distal tubules, renal bodies and interstitial tissue in the pathologic process, increased during the experiment. This work presents the description of morphological changes in kidney as well as of the tumor metastases under PCT influence. The obtained data should be considered while designing of remedies for recovery of internal organs functions after antitumor PCT.
Xue, Peng; Wu, Yafeng; Guo, Jinhong; Kang, Yuejun
2015-04-01
Circulating tumor cells (CTCs), which are derived from primary tumor site and transported to distant organs, are considered as the major cause of metastasis. So far, various techniques have been applied for CTC isolation and enumeration. However, there exists great demand to improve the sensitivity of CTC capture, and it remains challenging to elute the cells efficiently from device for further biomolecular and cellular analyses. In this study, we fabricate a dual functional chip integrated with herringbone structure and micropost array to achieve CTC capture and elution through EpCAM-based immunoreaction. Hep3B tumor cell line is selected as the model of CTCs for processing using this device. The results demonstrate that the capture limit of Hep3B cells can reach up to 10 cells (per mL of sample volume) with capture efficiency of 80% on average. Moreover, the elution rate of the captured Hep3B cells can reach up to 69.4% on average for cell number ranging from 1 to 100. These results demonstrate that this device exhibits dual functions with considerably high capture rate and elution rate, indicating its promising capability for cancer diagnosis and therapeutics.
The evolution of tumor metastases during clonal expansion.
Haeno, Hiroshi; Michor, Franziska
2010-03-07
Cancer is a leading cause of morbidity and mortality in many countries. Solid tumors generally initiate at one particular site called the primary tumor, but eventually disseminate and form new colonies in other organs. The development of such metastases greatly diminishes the potential for a cure of patients and is thought to represent the final stage of the multi-stage progression of human cancer. The concept of early metastatic dissemination, however, postulates that cancer cell spread might arise early during the development of a tumor. It is important to know whether metastases are present at diagnosis since this determines treatment strategies and outcome. In this paper, we design a stochastic mathematical model of the evolution of tumor metastases in an expanding cancer cell population. We calculate the probability of metastasis at a given time during tumor evolution, the expected number of metastatic sites, and the total number of cancer cells as well as metastasized cells. Furthermore, we investigate the effect of drug administration and tumor resection on these quantities and predict the survival time of cancer patients. The model presented in this paper allows us to determine the probability and number of metastases at diagnosis and to identify the optimum treatment strategy to maximally prolong survival of cancer patients. 2009 Elsevier Ltd. All rights reserved.
Kebebe, Dereje; Liu, Yuanyuan; Wu, Yumei; Vilakhamxay, Maikhone; Liu, Zhidong; Li, Jiawei
2018-01-01
Cancer has become one of the leading causes of mortality globally. The major challenges of conventional cancer therapy are the failure of most chemotherapeutic agents to accumulate selectively in tumor cells and their severe systemic side effects. In the past three decades, a number of drug delivery approaches have been discovered to overwhelm the obstacles. Among these, nanocarriers have gained much attention for their excellent and efficient drug delivery systems to improve specific tissue/organ/cell targeting. In order to enhance targeting efficiency further and reduce limitations of nanocarriers, nanoparticle surfaces are functionalized with different ligands. Several kinds of ligand-modified nanomedicines have been reported. Cell-penetrating peptides (CPPs) are promising ligands, attracting the attention of researchers due to their efficiency to transport bioactive molecules intracellularly. However, their lack of specificity and in vivo degradation led to the development of newer types of CPP. Currently, activable CPP and tumor-targeting peptide (TTP)-modified nanocarriers have shown dramatically superior cellular specific uptake, cytotoxicity, and tumor growth inhibition. In this review, we discuss recent advances in tumor-targeting strategies using CPPs and their limitations in tumor delivery systems. Special emphasis is given to activable CPPs and TTPs. Finally, we address the application of CPPs and/or TTPs in the delivery of plant-derived chemotherapeutic agents. PMID:29563797
Xu, Lei; Shao, Yiran; Chang, Chengkang; Zhu, Yingchun
2018-01-01
Tumor hypoxia is known to result in radiotherapy resistance and traditional radiotherapy using super-hard X-ray irradiation can cause considerable damage to normal tissue. Therefore, formamide peroxide (FPO) with high reactive oxygen content was employed to enhance the oxygen concentration in tumor cells and increase the radio-sensitivity of low-energy soft-X-ray. To improve stability of FPO, FPO is encapsulated into polyacrylic acid (PAA)-coated hollow mesoporous silica nanoparticles (FPO@HMSNs-PAA). On account of the pH-responsiveness of PAA, FPO@HMSNs-PAA will release more FPO in simulated acidic tumor microenvironment (pH 6.50) and subcellular endosomes (pH 5.0) than in simulated normal tissue media (pH 7.40). When exposed to soft-X-ray irradiation, the released FPO decomposes into oxygen and the generated oxygen further formed many reactive oxygen species (ROS), leading to significant tumor cell death. The ROS-mediated cytotoxicity of FPO@HMSNs-PAA was confirmed by ROS-induced green fluorescence in tumor cells. The presented FPO delivery system with soft-X-ray irradiation paves a way for developing the next opportunities of radiotherapy toward efficient tumor prognosis. PMID:29649155
Is mTOR Inhibitor Good Enough for Treatment All Tumors in TSC Patients?
Habib, Samy L; Al-Obaidi, Noor Y; Nowacki, Maciej; Pietkun, Katarzyna; Zegarska, Barbara; Kloskowski, Tomasz; Zegarski, Wojciech; Drewa, Tomasz; Medina, Edward A; Zhao, Zhenze; Liang, Sitai
2016-01-01
Tuberous sclerosis complex (TSC) is an autosomal dominant and multi-system genetic disorder in humans. TSC affects around 25,000 to 40,000 individuals in the United States and about 1 to 2 million individuals worldwide, with an estimated prevalence of one in 6,000 newborns. TSC occurs in all races and ethnic groups, and in both genders. TSC is caused by defects or mutations in two genes, TSC1 and TSC2. Loss of TSC1/TSC2 leads to dysregulation of mTOR, resulting in aberrant cell differentiation and development, and abnormal enlargement of cells. TSC is characterized by the development of benign and/or malignant tumors in several organs including renal/liver angiomyolipomas, facial angiofibroma, lymphangiomyomatosis, cardiac rhabdomyomas, retinal astrocytic, renal cell carcinoma, and brain subependymal giant cell astrocytomas (SEGA). In addition, TSC disease causes disabling neurologic disorders, including epilepsy, mental retardation and autism. Particularly problematic are the development of renal angiomyolipomas, which tend to be larger, bilateral, multifocal and present at a younger age compared with sporadic forms. In addition, SEGA block the flow of fluid within the brain, causing a buildup of fluid and pressure that leads to blurred vision and seizures. In the current review, we describe the pathology of TSC disease in key organs and summarize the use of mTOR inhibitors to treat tumors in TSC patients.
Is mTOR Inhibitor Good Enough for Treatment All Tumors in TSC Patients?
Habib, Samy L; Al-Obaidi, Noor Y; Nowacki, Maciej; Pietkun, Katarzyna; Zegarska, Barbara; Kloskowski, Tomasz; Zegarski, Wojciech; Drewa, Tomasz; Medina, Edward A.; Zhao, Zhenze; Liang, Sitai
2016-01-01
Tuberous sclerosis complex (TSC) is an autosomal dominant and multi-system genetic disorder in humans. TSC affects around 25,000 to 40,000 individuals in the United States and about 1 to 2 million individuals worldwide, with an estimated prevalence of one in 6,000 newborns. TSC occurs in all races and ethnic groups, and in both genders. TSC is caused by defects or mutations in two genes, TSC1 and TSC2. Loss of TSC1/TSC2 leads to dysregulation of mTOR, resulting in aberrant cell differentiation and development, and abnormal enlargement of cells. TSC is characterized by the development of benign and/or malignant tumors in several organs including renal/liver angiomyolipomas, facial angiofibroma, lymphangiomyomatosis, cardiac rhabdomyomas, retinal astrocytic, renal cell carcinoma, and brain subependymal giant cell astrocytomas (SEGA). In addition, TSC disease causes disabling neurologic disorders, including epilepsy, mental retardation and autism. Particularly problematic are the development of renal angiomyolipomas, which tend to be larger, bilateral, multifocal and present at a younger age compared with sporadic forms. In addition, SEGA block the flow of fluid within the brain, causing a buildup of fluid and pressure that leads to blurred vision and seizures. In the current review, we describe the pathology of TSC disease in key organs and summarize the use of mTOR inhibitors to treat tumors in TSC patients. PMID:27698899
Fischer, Walter; Gustafsson, Lotta; Mossberg, Ann-Kristin; Gronli, Janne; Mork, Sverre; Bjerkvig, Rolf; Svanborg, Catharina
2004-03-15
Malignant brain tumors present a major therapeutic challenge because no selective or efficient treatment is available. Here, we demonstrate that intratumoral administration of human alpha-lactalbumin made lethal to tumor cells (HAMLET) prolongs survival in a human glioblastoma (GBM) xenograft model, by selective induction of tumor cell apoptosis. HAMLET is a protein-lipid complex that is formed from alpha-lactalbumin when the protein changes its tertiary conformation and binds oleic acid as a cofactor. HAMLET induces apoptosis in a wide range of tumor cells in vitro, but the therapeutic effect in vivo has not been examined. In this study, invasively growing human GBM tumors were established in nude rats (Han:rnu/rnu Rowett, n = 20) by transplantation of human GBM biopsy spheroids. After 7 days, HAMLET was administered by intracerebral convection-enhanced delivery for 24 h into the tumor area; and alpha-lactalbumin, the native, folded variant of the same protein, was used as a control. HAMLET reduced the intracranial tumor volume and delayed the onset of pressure symptoms in the tumor-bearing rats. After 8 weeks, all alpha-lactalbumin-treated rats had developed pressure symptoms, but the HAMLET-treated rats remained asymptomatic. Magnetic resonance imaging scans revealed large differences in tumor volume (456 versus 63 mm(3)). HAMLET caused apoptosis in vivo in the tumor but not in adjacent intact brain tissue or in nontransformed human astrocytes, and no toxic side effects were observed. The results identify HAMLET as a new candidate in cancer therapy and suggest that HAMLET should be additionally explored as a novel approach to controlling GBM progression.
Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.
2009-01-01
Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229
Hoppe, T; Kraus, D; Novak, N; Probstmeier, R; Frentzen, M; Wenghoefer, M; Jepsen, S; Winter, J
2016-10-01
The impact of oral pathogens onto the generation and variability of oral tumors has only recently been investigated. To get further insights, oral cancer cells were treated with pathogens and additionally, as a result of this bacterial cellular infection, with human defensins, which are as anti-microbial peptide members of the innate immune system. After cell stimulation, proliferation behavior, expression analysis of oncogenic relevant defensin genes, and effects on EGFR signaling were investigated. The expression of oncogenic relevant anti-microbial peptides was analyzed with real-time PCR and immunohistochemistry. Cell culture experiments were performed to examine cellular impacts caused by stimulation, i.e., altered gene expression, proliferation rate, and EGF receptor-dependent signaling. Incubation of oral tumor cells with an oral pathogen (Porphyromonas gingivalis) and human α-defensins led to an increase in cell proliferation. In contrast, another oral bacterium used, Aggregatibacter actinomycetemcomitans, enhanced cell death. The bacteria and anti-microbial peptides exhibited diverse effects on the transcript levels of oncogenic relevant defensin genes and epidermal growth factor receptor signaling. These two oral pathogens exhibited opposite primary effects on the proliferation behavior of oral tumor cells. Nevertheless, both microbe species led to similar secondary impacts on the proliferation rate by modifying expression levels of oncogenic relevant α-defensin genes. In this respect, oral pathogens exerted multiplying effects on tumor cell proliferation. Additionally, human defensins were shown to differently influence epidermal growth factor receptor signaling, supporting the hypothesis that these anti-microbial peptides serve as ligands of EGFR, thus modifying the proliferation behavior of oral tumor cells.
Heat-directed tumor cell fusion.
Brade, Anthony M; Szmitko, Paul; Ngo, Duc; Liu, Fei-Fei; Klamut, Henry J
2003-03-20
In previous studies we demonstrated that a modified human HSP70b promoter (HSE.70b) directs high levels of gene expression to tumor cells after mild hyperthermia treatment in the range of 41.5-44 degrees C. This transcriptional targeting system exhibits low basal activity at 37 degrees C, is highly induced (950-fold) after mild heat treatment (43 degrees C/30 min), and returns to basal activity levels within 12-24 hours of activation. Here we describe heat-directed targeting of an activated form of the Gibbon ape leukemia virus env protein (GALV FMG) to tumor cells. GALV FMG mediates cell-cell fusion, and when expressed in tumor cells can produce bystander effects of up to 1:200. Transient transfection of a HSE70b.GALV FMG minigene caused extensive syncytia formation in HeLa and HT-1080 cells following mild heat treatment (44 degrees C/30 min). Stable transfection into HT-1080 cells produced a cell line (HG5) that exhibits massive syncytia formation and a 60% reduction in viability relative to a vector-only control (CI1) following heat treatment in vitro. Mild hyperthermia also resulted in syncytia formation, necrosis, and complete macroscopic regression of HG5 xenograft tumors grown in the footpads of mice with severe combined immunodeficiency disorders (SCID). Median survival increased from 12.5 (in heated CI1 controls) to 52 days after a single heat treatment. Heat-directed tumor cell fusion may prove to be a highly beneficial adjunct to existing cancer treatment strategies that take advantage of the synergistic interaction between mild hyperthermia and radiation or chemotherapeutic drugs.
Al-Hendy, Ayman; Lee, Eun J; Wang, Hui Q; Copland, John A
2004-11-01
Leiomyomas (fibroids) are common estrogen-dependent uterine tumors with no effective medicinal treatment; hysterectomy is the mainstay of management. This study was undertaken to investigate a potential therapy for leiomyoma; we used a mutated dominant-negative estrogen receptor gene delivered via an adenoviral vector (Ad-ER-DN). Ad-ER-DN transduction, in both human and rat leiomyoma cell lines, induced an increase in both caspase-3 levels and BAX/Bcl-2 ratio with evident apoptosis in the TdT-mediated dUTP nick-end labeling assay. In nude mice, rat leiomyoma cells ex vivo transduced with Ad-ER-DN supported significantly smaller tumors compared with Ad-LacZ-treated cells 5 weeks after implantation. In mice treated by direct intratumor injection into preexisting lesions, Ad-ER-DN caused immediate overall arrest of tumor growth. The Ad-ER-DN-treated tumors demonstrated severely inhibited cell proliferation (BrdU index) and a marked increase in the number of apoptotic cells (TdT-mediated dUTP nick-end labeling index). Dominant-negative estrogen receptor gene therapy may provide a nonsurgical treatment option for women with symptomatic uterine fibroids who want to preserve their uteri.
Cheng, Xinghua; Chen, Haiquan
2014-01-01
Lung cancer, mostly nonsmall cell lung cancer, continues to be the leading cause of cancer-related death worldwide. With the development of tyrosine kinase inhibitors that selectively target lung cancer-related epidermal growth factor receptor mutations, management of advanced nonsmall cell lung cancer has been greatly transformed. Improvements in progression-free survival and life quality of the patients were observed in numerous clinical studies. However, overall survival is not prolonged because of later-acquired drug resistance. Recent studies reveal a heterogeneous subclonal architecture of lung cancer, so it is speculated that the tumor may rapidly adapt to environmental changes via a Darwinian selection mechanism. In this review, we aim to provide an overview of both spatial and temporal tumor heterogeneity as potential mechanisms underlying epidermal growth factor receptor tyrosine kinase inhibitor resistance in nonsmall cell lung cancer and summarize the possible origins of tumor heterogeneity covering theories of cancer stem cells and clonal evolution, as well as genomic instability and epigenetic aberrations in lung cancer. Moreover, investigational measures that overcome heterogeneity-associated drug resistance and new assays to improve tumor assessment are also discussed. PMID:25285017
Truscott, Laurel; Gell, Joanna; Chang, Vivian Y; Lee, Hane; Strom, Samuel P; Pillai, Rex; Sisk, Anthony; Martinez-Agosto, Julian A; Anderson, Martin; Federman, Noah
2017-01-01
Adolescent brothers were diagnosed with testicular germ cell tumors within the same month. Both were found to have multiple renal cysts on pretreatment imaging done for staging. The proband, his brother, and their mother, were all found to have a novel splice variant in intron 8 of the PKD1 gene by clinical exome sequencing. This is the second family reported with both familial testicular germ cell tumor (FTGCT) and autosomal dominant polycystic kidney disease (ADPKD), and the first described association of FTGCT with a splice variant in PKD1. We suggest that this novel variant in PKD1 may convey increased risk for FTGCT in addition to causing ADPKD. © 2016 Wiley Periodicals, Inc.
Vandeven, Natalie; Nghiem, Paul
2016-07-01
Merkel cell carcinoma (MCC) is a rare but often deadly skin cancer that is typically caused by the Merkel cell polyomavirus (MCPyV). Polyomavirus T-antigen oncoproteins are persistently expressed in virus-positive MCCs (˜80% of cases), while remarkably high numbers of tumor-associated neoantigens are detected in virus-negative MCCs, suggesting that both MCC subsets may be immunogenic. Here we review mechanisms by which these immunogenic tumors evade multiple levels of host immunity. Additionally, we summarize the exciting potential of diverse immune-based approaches to treat MCC. In particular, agents blocking the PD-1 axis have yielded strikingly high response rates in MCC as compared with other solid tumors, highlighting the potential for immune-mediated treatment of this disease.
2011-03-01
UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING...leading cause of cancer death in men in the United States - could be prevented with more effective treatments. Overcoming tumor cell resistance to...as described in prior reports. Recent work has focused on identification of possible functional effects of altered STC1 levels in the prostate tumor
Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.
Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J
2014-03-01
Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (P<0.001) and decreased tumor growth (P<0.001). Pulmonary macrometastasis and Ki67 labeling were reduced with low-dose aurothiomalate (P=0.033 and 0.005, respectively), and tumor emboli and pulmonary micrometastases were decreased with high-dose aurothiomalate (P=0.010 and 0.011, respectively). There was no difference in survival, tumor development, ulceration, mitotic indices, tumor necrosis, nonpulmonary metastases, and caspase-3 labeling. Aurothiomalate treatment inhibited osteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.
Plotnikov, Alexander; Tichler, Thomas; Korenstein, Rafi; Keisari, Yona
2005-12-10
Low electric field cancer treatment-enhanced chemotherapy (LEFCT-EC) is a new treatment modality that combines chemotherapeutic agents and low electric field stimulation. LEFCT-EC was found to destroy malignant mouse tumors and cause massive death of tumor cells. This may enable the immune system cells to efficiently recognize and eliminate tumor cells at the primary tumor site and at metastatic foci. Mice with 15 mm diameter intracutaneous colon carcinomas (CT-26) were injected with BCNU (35 mg/kg), and 2 min later the tumors were exposed to low electric fields (intensity 40 V/cm, pulse duration 180 micros, frequency 500 Hz) for 12 min (LEFCT-EC). We found that treatment with LEFCT-EC achieved complete cure of 93% of the animals. In comparison, electric fields alone (13% cure), chemotherapy alone (0%), surgery (15%) or a combination of surgery and bis-chloroethyl-nitrosurea, carmustine (BCNU; 84%) treatments resulted in lower cure rates. After treatment and cure with LEFCT-EC, 50% of the cured mice developed resistance to a tumor challenge (surgery + BCNU only 15%). Furthermore, splenocytes from cured animals protected naive animals from a tumorigenic dose of tumor cells. Separation of spleen cells into lymphocyte subpopulations indicated a major role for CD4 and CD8 T cells in this protection. FACS analysis revealed restoration of normal splenocyte subpopulation proportions impaired by cytotoxic chemotherapy. Our results suggest that LEFCT-EC can directly destroy primary tumors and facilitate the destruction of metastatic disease by enforcement of antitumor immune responses. Copyright 2005 Wiley-Liss, Inc
Ngwa, Wilfred; Makrigiorgos, G Mike; Berbeco, Ross I
2012-01-01
Theoretical microdosimetry at the subcellular level is employed in this study to estimate the dose enhancement to tumor endothelial cell nuclei, caused by radiation-induced photo/Auger electrons originating from gold nanoparticles (AuNPs) targeting the tumor endothelium, during brachytherapy. A tumor vascular endothelial cell (EC) is modeled as a slab of 2 μm (thickness) × 10 μm (length) × 10 μm (width). The EC contains a nucleus of 5 μm diameter and thickness of 0.5-1 μm, corresponding to nucleus size 5%-10% of cellular volume, respectively. Analytic calculations based on the electron energy loss formula of Cole were carried out to estimate the dose enhancement to the nucleus caused by photo/Auger electrons from AuNPs attached to the exterior surface of the EC. The nucleus dose enhancement factor (nDEF), representing the ratio of the dose to the nucleus with and without the presence of gold nanoparticles was calculated for different AuNP local concentrations. The investigated concentration range considers the potential for significantly higher local concentration near the EC due to preferential accumulation of AuNP in the tumor vasculature. Four brachytherapy sources: I-125, Pd-103, Yb-169, and 50 kVp x-rays were investigated. For nucleus size of 10% of the cellular volume and AuNP concentrations ranging from 7 to 140 mg/g, brachytherapy sources Pd-103, I-125, 50 kVp, and Yb-169 yielded nDEF values of 5.6-73, 4.8-58.3, 4.7-56.6, and 3.2-25.8, respectively. Meanwhile, for nucleus size 5% of the cellular volume in the same concentration range, Pd-103, I-125, 50 kVp, and Yb-169 yielded nDEF values of 6.9-79.2, 5.1-63.2, 5.0-61.5, and 3.3-28.3, respectively. The results predict that a substantial dose boost to the nucleus of endothelial cells can be achieved by applying tumor vasculature-targeted AuNPs in combination with brachytherapy. Such vascular dose boosts could induce tumor vascular shutdown, prompting extensive tumor cell death.
Ramakrishna, V; Eisenthal, A; Skornick, Y; Shinitzky, M
1993-05-01
The B16-BL6 melanoma, like most spontaneously arising tumors, is poorly immunogenic and expresses low levels of major histocompatibility complex (MHC) antigens. Treatment of cells of this tumor in vitro by hydrostatic pressure in the presence of adenosine 2',3'-dialdehyde (oxAdo), a membrane-impermeant crosslinker, caused elevated projection of MHC and a specific tumor antigen as demonstrated by flow-cytometric analysis. Maximum projection of both the MHC and the tumor antigens could be reached by application of 1200 atm for 15 min in the presence of 20 mM oxAdo. It is not yet clear whether this passive increase in availability of antigens on the cell surface originated from a dormant pool of antigens in the plasma membrane or from pressure-induced fusion of antigen-rich intracellular organelles (e.g. the endoplasmic reticulum). The immunogenic properties of the antigen-enriched B16-BL6 cells are described in the following paper.
Tumor-propagating cells and Yap/Taz activity contribute to lung tumor progression and metastasis
Lau, Allison N; Curtis, Stephen J; Fillmore, Christine M; Rowbotham, Samuel P; Mohseni, Morvarid; Wagner, Darcy E; Beede, Alexander M; Montoro, Daniel T; Sinkevicius, Kerstin W; Walton, Zandra E; Barrios, Juliana; Weiss, Daniel J; Camargo, Fernando D; Wong, Kwok-Kin; Kim, Carla F
2014-01-01
Metastasis is the leading cause of morbidity for lung cancer patients. Here we demonstrate that murine tumor propagating cells (TPCs) with the markers Sca1 and CD24 are enriched for metastatic potential in orthotopic transplantation assays. CD24 knockdown decreased the metastatic potential of lung cancer cell lines resembling TPCs. In lung cancer patient data sets, metastatic spread and patient survival could be stratified with a murine lung TPC gene signature. The TPC signature was enriched for genes in the Hippo signaling pathway. Knockdown of the Hippo mediators Yap1 or Taz decreased in vitro cellular migration and transplantation of metastatic disease. Furthermore, constitutively active Yap was sufficient to drive lung tumor progression in vivo. These results demonstrate functional roles for two different pathways, CD24-dependent and Yap/Taz-dependent pathways, in lung tumor propagation and metastasis. This study demonstrates the utility of TPCs for identifying molecules contributing to metastatic lung cancer, potentially enabling the therapeutic targeting of this devastating disease. PMID:24497554
CD44 increases the efficiency of distant metastasis of breast cancer
McFarlane, Suzanne; Coulter, Jonathan A.; Tibbits, Paul; O'Grady, Anthony; McFarlane, Cheryl; Montgomery, Nicola; Hill, Ashleigh; McCarthy, Helen O.; Young, Leonie S.; Kay, Elaine W.; Isacke, Clare M.; Waugh, David J.J.
2015-01-01
Metastasis is the predominant cause of death from cancer yet we have few biomarkers to predict patients at increased risk of metastasis and are unable to effectively treat disseminated disease. Analysis of 448 primary breast tumors determined that expression of the hylauronan receptor CD44 associated with high grade (p = 0.046), ER- (p = 0.001) and PR-negative tumors (p = 0.029), and correlated with increased distant recurrence and reduced disease-free survival in patients with lymph-node positive or large tumors. To determine its functional role in distant metastasis, CD44 was knocked-down in MDA-MB-231 cells using two independent shRNA sequences. Loss of CD44 attenuated tumor cell adhesion to endothelial cells and reduced cell invasion but did not affect proliferation in vitro. To verify the importance of CD44 to post-intravasation events, tumor formation was assessed by quantitative in vivo imaging and post-mortem tissue analysis following an intra-cardiac injection of transfected cells. CD44 knock-down increased survival and decreased overall tumor burden at multiple sites, including the skeleton in vivo. We conclude that elevated CD44 expression on tumour cells within the systemic circulation increases the efficiency of post-intravasation events and distant metastasis in vivo, consistent with its association with increased distant recurrence and reduced disease-free survival in patients. PMID:25888636
Li, Yafan; Wheeler, Deric L; Ananthaswamy, Honnavara N; Verma, Ajit K; Oberley, Terry D
2007-12-01
Our previous studies showed that protein kinase Cepsilon (PKCepsilon) verexpression in mouse skin resulted in metastatic squamous cell carcinoma (SCC) elicited by single 7,12-dimethylbenz(a)anthracene (DMBA)-initiation and 12-O-tetradecanoylphorbol-13-acetate (TPA)-promotion in the absence of preceding papilloma formation as is typically observed in wild type mice. The present study demonstrates that double-DMBA initiation modulates tumor incidence, multiplicity, and latency period in both wild type and PKCepsilon overexpression transgenic (PKCepsilon-Tg) mice. After 17 weeks (wks) of tumor promotion, a reduction in papilloma multiplicity was observed in double- versus single-DMBA initiated wild type mice. Papilloma multiplicity was inversely correlated with cell death indices of interfollicular keratinocytes, indicating decreased papilloma formation was caused by increased cell death and suggesting the origin of papillomas is in interfollicular epidermis. Double-initiated PKCepsilon-Tg mice had accelerated carcinoma formation and cancer incidence in comparison to single-initiated PKCepsilon-Tg mice. Morphologic analysis of mouse skin following double initiation and tumor promotion showed a similar if not identical series of events to those previously observed following single initiation and tumor promotion: putative preneoplastic cells were observed arising from hyperplastic hair follicles (HFs) with subsequent cancer cell infiltration into the dermis. Single-initiated PKCepsilon-Tg mice exhibited increased mitosis in epidermal cells of HFs during tumor promotion.
Hirakawa, Hirokazu; Fujisawa, Hiroshi; Masaoka, Aya; Noguchi, Miho; Hirayama, Ryoichi; Takahashi, Momoko; Fujimori, Akira; Okayasu, Ryuichi
2015-03-01
Hsp90 inhibitors have become well-studied antitumor agents for their selective property against tumors versus normal cells. The combined treatment of Hsp90 inhibitor and conventional photon radiation also showed more effective tumor growth delay than radiation alone. However, little is known regarding the combined treatment of Hsp90 inhibitor and heavy-ion irradiation. In this study, SQ5 human lung tumor cells were used in vitro for clonogenic cell survival and in vivo for tumor growth delay measurement using a mouse xenograft model after 17-allylamino-17-demethoxygeldanamycin (17AAG) pretreatment and carbon ion irradiation. Repair of DNA double strand breaks (DSBs) was also assessed along with expressions of DSB repair-related proteins. Cell cycle analysis after the combined treatment was also performed. The combined treatment of 17AAG and carbon ions revealed a promising treatment option in both in vitro and in vivo studies. One likely cause of this effectiveness was shown to be the inhibition of homologous recombination repair by 17AAG. The more intensified G2 cell cycle delay was also associated with the combined treatment when compared with carbon ion treatment alone. Our findings indicate that the combination of Hsp90 inhibition and heavy-ion irradiation provides a new effective therapeutic alternative for treatment of solid tumors. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Gordillo, Gayle M.; Biswas, Ayan; Khanna, Savita; Spieldenner, James M.; Pan, Xueliang; Sen, Chandan K.
2016-01-01
Endothelial cell tumors are the most common soft tissue tumors in infants. Tumor-forming endothelial (EOMA) cells are able to escape cell death fate despite excessive nuclear oxidant burden. Our previous work recognized perinuclear Nox-4 as a key contributor to EOMA growth. The objective of this work was to characterize the mechanisms by which EOMA cells evade oxidant toxicity and thrive. In EOMA cells, compared with in the cytosol, the nuclear GSSG/GSH ratio was 5-fold higher. Compared to the ratio observed in healthy murine aortic endothelial (MAE) cells, GSSG/GSH was over twice as high in EOMA cells. Multidrug resistance-associated protein-1 (MRP-1), an active GSSG efflux mechanism, showed 2-fold increased activity in EOMA compared with MAE cells. Hyperactive YB-1 and Ape/Ref-1 were responsible for high MRP-1 expression in EOMA. Proximity ligand assay demonstrated MRP-1 and YB-1 binding. Such binding enabled the nuclear targeting of MRP-1 in EOMA in a leptomycin-B-sensitive manner. MRP-1 inhibition as well as knockdown trapped nuclear GSSG, causing cell death of EOMA. Disulfide loading of cells by inhibition of GSSG reductase (bischoloronitrosourea) or thioredoxin reductase (auranofin) was effective in causing EOMA death as well. In sum, EOMA cells survive a heavy oxidant burden by rapid efflux of GSSG, which is lethal if trapped within the cell. A hyperactive MRP-1 system for GSSG efflux acts as a critical survival factor for these cells, making it a potential target for EOMA therapeutics. PMID:26961872
Santos, K. M.; Silva-Oliveira, R. J.; Pinto, F. E.; Oliveira, B. G.; Chagas, R. C. R.; Romão, W.; Reis, R. M. V.
2018-01-01
Metastasis remains the most common cause of death in cancer patients. Inhibition of metalloproteinases (MMPs) is an interesting approach to cancer therapy because of their role in the degradation of extracellular matrix (ECM), cell-cell, and cell-ECM interactions, modulating key events in cell migration and invasion. Herein, we show the cytotoxic and antimetastatic effects of the third fraction (FR3) from Bauhinia variegata candida (Bvc) stem on human cervical tumor cells (HeLa) and human peripheral blood mononuclear cells (PBMCs). FR3 inhibited MMP-2 and MMP-9 activity, indicated by zymogram. This fraction was cytotoxic to HeLa cells and noncytotoxic to PBMCs and decreased HeLa cell migration and invasion. FR3 is believed to stimulate extrinsic apoptosis together with necroptosis, assessed by western blotting. FR3 inhibited MMP-2 activity in the HeLa supernatant, differently from the control. The atomic mass spectrometry (ESI-MS) characterization suggested the presence of glucopyranosides, D-pinitol, fatty acids, and phenolic acid. These findings provide insight suggesting that FR3 contains components with potential tumor-selective cytotoxic action in addition to the action on the migration of tumor cells, which may be due to inhibition of MMPs. PMID:29770331
Ali, Farrah; Khan, Bilal Azhar; Sultana, Sarwat
2016-09-05
UVB (Ultra-violet B) radiation is one of the major etiological factors in various dermal pathology viz. dermatitis, actinic folliculitis, solar urticaria, psoriasis and cancer among many others. UVB causes toxic manifestation in tissues by inciting inflammatory and tumor promoting events. We have designed this study to assess the anti-inflammatory and anti-tumor promotion effect of Wedelolactone (WDL) a specific IKK inhibitor. Results indicate significant restoration of anti-oxidative enzymes due to WDL treatments. We also found that WDL was effective in mitigating inflammatory markers consisting of MPO (myeloperoxidase), Mast cells trafficking, Langerhans cells suppression and COX 2 expression up regulation due to UVB exposure. We also deduce that WDL presented a promising intervention in attenuating early tumor promotion events caused by UVB exposure as indicated by the results of ODC (Ornithine Decarboxylase), Thymidine assay, Vimentin and VEGF (Vascular-endothelial growth factor) expression. This study was able to provide substantial cues for the therapeutic ability of Wedelolactone against inflammatory and tumor promoting events in murine skin depicting plausible role of NFkB pathway. Copyright © 2016 Elsevier B.V. All rights reserved.
A Small-Molecule Antagonist of HIF2α Is Efficacious in Preclinical Models of Renal Cell Carcinoma.
Wallace, Eli M; Rizzi, James P; Han, Guangzhou; Wehn, Paul M; Cao, Zhaodan; Du, Xinlin; Cheng, Tzuling; Czerwinski, Robert M; Dixon, Darryl D; Goggin, Barry S; Grina, Jonas A; Halfmann, Megan M; Maddie, Melissa A; Olive, Sarah R; Schlachter, Stephen T; Tan, Huiling; Wang, Bin; Wang, Keshi; Xie, Shanhai; Xu, Rui; Yang, Hanbiao; Josey, John A
2016-09-15
More than 90% of clear cell renal cell carcinomas (ccRCC) exhibit inactivation of the von Hippel-Lindau (pVHL) tumor suppressor, establishing it as the major underlying cause of this malignancy. pVHL inactivation results in stabilization of the hypoxia-inducible transcription factors, HIF1α and HIF2α, leading to expression of a genetic program essential for the initiation and progression of ccRCC. Herein, we describe the potent, selective, and orally active small-molecule inhibitor PT2385 as a specific antagonist of HIF2α that allosterically blocks its dimerization with the HIF1α/2α transcriptional dimerization partner ARNT/HIF1β. PT2385 inhibited the expression of HIF2α-dependent genes, including VEGF-A, PAI-1, and cyclin D1 in ccRCC cell lines and tumor xenografts. Treatment of tumor-bearing mice with PT2385 caused dramatic tumor regressions, validating HIF2α as a pivotal oncogenic driver in ccRCC. Notably, unlike other anticancer agents that inhibit VEGF receptor signaling, PT2385 exhibited no adverse effect on cardiovascular performance. Thus, PT2385 represents a novel class of therapeutics for the treatment of RCC with potent preclincal efficacy as well as improved tolerability relative to current agents that target the VEGF pathway. Cancer Res; 76(18); 5491-500. ©2016 AACR. ©2016 American Association for Cancer Research.
CBP501 suppresses macrophage induced cancer stem cell like features and metastases
Mine, Naoki; Yamamoto, Sayaka; Saito, Naoya; Sato, Takuji; Sakakibara, Keiichi; Kufe, Donald W.; VonHoff, Daniel D.; Kawabe, Takumi
2017-01-01
CBP501 is an anti-cancer drug candidate which has been shown to increase cis-diamminedichloro-platinum (II) (CDDP) uptake into cancer cell through calmodulin (CaM) inhibition. However, the effects of CBP501 on the cells in the tumor microenvironment have not been addressed. Here, we investigated new aspects of the potential anti-tumor mechanism of action of CBP501 by examining its effects on the macrophages. Macrophages contribute to cancer-related inflammation and sequential production of cytokines such as IL-6 and TNF-α which cause various biological processes that promote tumor initiation, growth and metastasis (1). These processes include the epithelial to mesenchymal transition (EMT) and cancer stem cell (CSC) formation, which are well-known, key events for metastasis. The present work demonstrates that CBP501 suppresses lipopolysaccharide (LPS)-induced production of IL-6, IL-10 and TNF-α by macrophages. CBP501 also suppressed formation of the tumor spheroids by culturing with conditioned medium from the LPS-stimulated macrophage cell line RAW264.7. Moreover, CBP501 suppressed expression of ABCG2, a marker for CSCs, by inhibiting the interaction between cancer cells expressing VCAM-1 and macrophages expressing VLA-4. Consistently with these results, CBP501 in vivo suppressed metastases of a tumor cell line, 4T1, one which is insensitive to combination treatment of CBP501 and CDDP in vitro. Taken together, these results offer potential new, unanticipated advantages of CBP501 treatment in anti-tumor therapy through a mechanism that entails the suppression of interactions between macrophages and cancer cells with suppression of sequential CSC-like cell formation in the tumor microenvironment. PMID:28969049
Leisegang, Matthias; Engels, Boris; Schreiber, Karin; Yew, Poh Yin; Kiyotani, Kazuma; Idel, Christian; Arina, Ainhoa; Duraiswamy, Jaikumar; Weichselbaum, Ralph R; Uckert, Wolfgang; Nakamura, Yusuke; Schreiber, Hans
2016-06-01
Cancers usually contain multiple unique tumor-specific antigens produced by single amino acid substitutions (AAS) and encoded by somatic nonsynonymous single nucleotide substitutions. We determined whether adoptively transferred T cells can reject large, well-established solid tumors when engineered to express a single type of T-cell receptor (TCR) that is specific for a single AAS. By exome and RNA sequencing of an UV-induced tumor, we identified an AAS in p68 (mp68), a co-activator of p53. This AAS seemed to be an ideal tumor-specific neoepitope because it is encoded by a trunk mutation in the primary autochthonous cancer and binds with highest affinity to the MHC. A high-avidity mp68-specific TCR was used to genetically engineer T cells as well as to generate TCR-transgenic mice for adoptive therapy. When the neoepitope was expressed at high levels and by all cancer cells, their direct recognition sufficed to destroy intratumor vessels and eradicate large, long-established solid tumors. When the neoepitope was targeted as autochthonous antigen, T cells caused cancer regression followed by escape of antigen-negative variants. Escape could be thwarted by expressing the antigen at increased levels in all cancer cells or by combining T-cell therapy with local irradiation. Therapeutic efficacies of TCR-transduced and TCR-transgenic T cells were similar. Gene therapy with a single TCR targeting a single AAS can eradicate large established cancer, but a uniform expression and/or sufficient levels of the targeted neoepitope or additional therapy are required to overcome tumor escape. Clin Cancer Res; 22(11); 2734-43. ©2015 AACRSee related commentary by Liu, p. 2602. ©2015 American Association for Cancer Research.
Caicedo-Granados, Emiro; Lin, Rui; Fujisawa, Caitlin; Yueh, Bevan; Sangwan, Veena; Saluja, Ashok
2014-12-01
The incidence of high-risk human papillomavirus (HR-HPV) head and neck squamous cell carcinoma (HNSCC) continues to increase, particularly oropharyngeal squamous cell carcinoma (OPSCC) cases. The inactivation of the p53 tumor suppressor gene promotes a chain of molecular events, including cell cycle progression and apoptosis resistance. Reactivation of wild-type p53 function is an intriguing therapeutic strategy. The aim of this study was to investigate whether a novel compound derived from diterpene triepoxide (Minnelide™) can reactivate wild-type p53 function in HPV-positive HNSCC. For all of our in vitro experiments, we used 2 HPV-positive HNSCC cell lines, University of Michigan squamous cell carcinoma (UM-SCC) 47 and 93-VU-147, and 2 HPV-positive human cervical cancer cell lines, SiHa and CaSki. Cells were treated with different concentrations of triptolide and analyzed for p53 activation. Mice bearing UM-SCC 47 subcutaneous xenografts and HPV-positive patient-derived tumor xenografts were treated with Minnelide and evaluated for tumor growth and p53 activation. In HPV-positive HNSCC, Minnelide reactivated p53 by suppressing E6 oncoprotein. Activation of apoptosis followed, both in vitro and in vivo. In 2 preclinical HNSCC animal models (a subcutaneous xenograft model and a patient-derived tumor xenograft model), Minnelide reactivated p53 function and significantly decreased tumor progression and tumor volume. Triptolide and Minnelide caused cell death in vitro and in vivo in HPV-positive HNSCC by reactivating wild-type p53 and thus inducing apoptosis. In addition, in 2 HPV-positive HNSCC animal models, Minnelide decreased tumor progression and induced apoptosis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Galli, Uwe M; Sauter, Marlies; Lecher, Bernd; Maurer, Simone; Herbst, Hermann; Roemer, Klaus; Mueller-Lantzsch, Nikolaus
2005-04-28
Germ cell tumors (GCTs) are among the most common malignancies in young men. We have previously documented that patients with GCT frequently produce serum antibodies directed against proteins encoded by human endogenous retrovirus (HERV) type K sequences. Transcripts originating from the env gene of HERV-K, including the rec-relative of human immunodeficiency virus rev, are highly expressed in GCTs. We report here that mice that inducibly express HERV-K rec show a disturbed germ cell development and may exhibit, by 19 months of age, changes reminiscent of carcinoma in situ, the predecessor lesion of classic seminoma in humans. This provides the first direct evidence that the expression of a human endogenous retroviral gene previously established as a marker in human germ cell tumors may contribute to organ-specific tumorigenesis in a transgenic mouse model.
The tumor macroenvironment and systemic regulation of breast cancer progression.
Castaño, Zafira; Tracy, Kristin; McAllister, Sandra S
2011-01-01
Breast cancer is the most common malignancy among women worldwide and is the most common cause of death for women between 35 and 50 years of age. Women with breast cancer are at risk of developing metastases for their entire lifetime and, despite local and systemic therapies, approximately 30% of breast cancer patients will relapse (Jemal et al., 2010). Nearly all breast cancer related deaths are due to metastatic disease, even though metastasis is considered to be an inefficient process. In some cases, tumor cells disseminate from primary sites at an early stage, but remain indolent for protracted periods of time before becoming overt, life-threatening tumors. Little is known about the mechanisms that cause these indolent tumors to grow into malignant disease. Because of this gap in our understanding, we are unable to predict which breast cancer patients are likely to experience disease relapse or develop metastases years after treatment of their primary tumor. A better understanding of the mechanisms and signals involved in the exit of tumor cells from dormancy would not only allow for more accurate selection of patients that would benefit from systemic therapy, but could also lead to the development of more targeted therapies to inhibit the signals that promote disease progression. In this review, we address the systemic, or "macroenvironmental", contribution to tumor initiation and progression and what is known about how a pro-tumorigenic systemic environment is established.
NASA Technical Reports Server (NTRS)
Lum, D. F.; McQuaid, K. R.; Gilbertson, V. L.; Hughes-Fulford, M.
1999-01-01
Many colorectal cancers have high levels of cyclo-oxygenase 2 (COX-2), an enzyme that metabolizes the essential fatty acids into prostaglandins. Since the low-density lipoprotein receptor (LDLr) is involved in the uptake of essential fatty acids, we studied the effect of LDL on growth and gene regulation in colorectal cancer cells. DiFi cells grown in lipoprotein-deficient sera (LPDS) grew more slowly than cells with LDL. LDLr antibody caused significant inhibition of tumor cell growth but did not affect controls. In addition, LDL uptake did not change in the presence of excess LDL, suggesting that ldlr mRNA lacks normal feedback regulation in some colorectal cancers. Analysis of the ldlr mRNA showed that excess LDL in the medium did not cause down-regulation of the message even after 24 hr. The second portion of the study examined the mRNA expression of ldlr and its co-regulation with cox-2 in normal and tumor specimens from patients with colorectal adenocarcinomas. The ratio of tumor:paired normal mucosa of mRNA expression of ldlr and of cox-2 was measured in specimens taken during colonoscopy. ldlr and cox-2 transcripts were apparent in 11 of 11 carcinomas. There was significant coordinate up-regulation both of ldlr and of cox-2 in 6 of 11 (55%) tumors compared with normal colonic mucosa. There was no up-regulation of cox-2 without concomitant up-regulation of ldlr. These data suggest that the LDLr is abnormally regulated in some colorectal tumors and may play a role in the up-regulation of cox-2. Copyright 1999 Wiley-Liss, Inc.
Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17
Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.
2012-01-01
Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468
Estrada-Bernal, Adriana; Palanichamy, Kamalakannan; Ray Chaudhury, Abhik; Van Brocklyn, James R
2012-04-01
FTY720 is a sphingosine analogue that down regulates expression of sphingosine-1-phosphate receptors and causes apoptosis of multiple tumor cell types, including glioma cells. This study examined the effect of FTY720 on brain tumor stem cells (BTSCs) derived from human glioblastoma (GBM) tissue. FTY720 treatment of BTSCs led to rapid inactivation of ERK MAP kinase, leading to upregulation of the BH3-only protein Bim and apoptosis. In combination with temozolomide (TMZ), the current standard chemotherapeutic agent for GBM, FTY720 synergistically induced BTSC apoptosis. FTY720 also slowed growth of intracranial xenograft tumors in nude mice and augmented the therapeutic effect of TMZ, leading to enhanced survival. Furthermore, the combination of FTY720 and TMZ decreased the invasiveness of BTSCs in mouse brains. FTY720 is known to cross the blood-brain barrier and recently received Food and Drug Administration approval for treatment of relapsing multiple sclerosis. Thus, FTY720 is an excellent potential therapeutic agent for treatment of GBM.
Correnti, Margherita; Raggi, Chiara
2017-01-01
Poor prognosis and high recurrence remain leading causes of primary liver cancerassociated mortality. The spread of circulating tumor cells (CTCs) in the blood plays a major role in the initiation of metastasis and tumor recurrence after surgery. Nevertheless, only a subset of CTCs can survive, migrate to distant sites and establish secondary tumors. Consistent with cancer stem cell (CSC) hypothesis, stem-like CTCs might represent a potential source for cancer relapse and distant metastasis. Thus, identification of stem-like metastasis-initiating CTC-subset may provide useful clinically prognostic information. This review will emphasize the most relevant findings of CTCs in the context of stem-like biology associated to liver carcinogenesis. In this view, the emerging field of stem-like CTCs may deliver substantial contribution in liver cancer field in order to move to personalized approaches for diagnosis, prognosis and therapy. PMID:27738343
Increased microtubule assembly rates mediate chromosomal instability in colorectal cancer cells
Ertych, Norman; Stolz, Ailine; Stenzinger, Albrecht; Weichert, Wilko; Kaulfuß, Silke; Burfeind, Peter; Aigner, Achim; Wordeman, Linda
2015-01-01
Chromosomal instability (CIN) is defined as the perpetual missegregation of whole chromosomes during mitosis and represents a hallmark of human cancer. However, the mechanisms causing CIN and its consequences on tumor growth are largely unknown. We identify an increase in microtubule plus end assembly rates as a fundamental trigger for CIN in CRC cells. This trigger is mediated by overexpression of the oncogene AURKA or by loss of the tumor suppressor gene CHK2, a genetic constitution found in 73% of human colorectal cancers. Increased microtubule assembly rates are associated with transient abnormalities in mitotic spindle geometry promoting the generation of lagging chromosomes and resulting in CIN. Reconstitution of proper microtubule assembly rates by chemical or genetic means suppresses CIN and thereby, unexpectedly, accelerates tumor growth in vitro and in vivo. Thus, we identify a fundamental mechanism triggering CIN in cancer cells and reveal its adverse consequence on tumor growth. PMID:24976383
CXCL4 mediates tumor regrowth after chemotherapy by suppression of antitumor immunity
Zhang, Yang; Gao, Jing; Wang, Xia; Deng, Shaorong; Ye, Hao; Guan, Wen; Wu, Mingyuan; Zhu, Shunying; Yu, Yan; Han, Wei
2015-01-01
The recurrence of colorectal cancer after chemotherapy is the leading cause of its high mortality. We propose that elucidating the mechanisms of tumor regrowth after chemotherapy in tumor-bearing mice may provide new insights into tumor relapse in cancer patients. We firstly report the identification of a chemokine, CXCL4, that plays an important role in the molecular mechanism of cancer regrowth after chemotherapy. A syngenic transplantation tumor model was established with murine colon cancer CT26 cells and treated with 5-FU. Genome-wide gene expression analysis determined that CXCL4 was transiently upregulated in the tumor model. Systemic overexpression of CXCL4 accelerated cancer growth in vivo, but not in vitro. Conversely, the anti-CXCL4 monoclonal antibody (CXCL4-mab) retarded tumor-regrowth after 5-FU treatment in immune-competent mice, but not nude mice. The CXCL4-mab treatment increased the local expression levels of IFN-γ and Gran-b genes in the tumor-bed, and elevated the function of CTLs against CT26 cells. Thus, the colon cancer cells in responding to the cytotoxic stress of 5-FU produce a high level of CXCL4, which suppresses antitumor immunity to confer the residual cancer cells an advantage for regrowth after chemotherapy. Our findings provide a novel target for developing therapeutics aiming to increase antitumor immunity after chemotherapy. PMID:26479470
CXCL4 mediates tumor regrowth after chemotherapy by suppression of antitumor immunity.
Zhang, Yang; Gao, Jing; Wang, Xia; Deng, Shaorong; Ye, Hao; Guan, Wen; Wu, Mingyuan; Zhu, Shunying; Yu, Yan; Han, Wei
2015-01-01
The recurrence of colorectal cancer after chemotherapy is the leading cause of its high mortality. We propose that elucidating the mechanisms of tumor regrowth after chemotherapy in tumor-bearing mice may provide new insights into tumor relapse in cancer patients. We firstly report the identification of a chemokine, CXCL4, that plays an important role in the molecular mechanism of cancer regrowth after chemotherapy. A syngenic transplantation tumor model was established with murine colon cancer CT26 cells and treated with 5-FU. Genome-wide gene expression analysis determined that CXCL4 was transiently upregulated in the tumor model. Systemic overexpression of CXCL4 accelerated cancer growth in vivo, but not in vitro. Conversely, the anti-CXCL4 monoclonal antibody (CXCL4-mab) retarded tumor-regrowth after 5-FU treatment in immune-competent mice, but not nude mice. The CXCL4-mab treatment increased the local expression levels of IFN-γ and Gran-b genes in the tumor-bed, and elevated the function of CTLs against CT26 cells. Thus, the colon cancer cells in responding to the cytotoxic stress of 5-FU produce a high level of CXCL4, which suppresses antitumor immunity to confer the residual cancer cells an advantage for regrowth after chemotherapy. Our findings provide a novel target for developing therapeutics aiming to increase antitumor immunity after chemotherapy.
Zhang, Li; Wang, Yang; Xia, Tai; Yu, Qianwen; Zhang, Qianyu; Yang, Yuting; Cun, Xingli; Lu, Libao; Gao, Huile; Zhang, Zhirong; He, Qin
2016-10-01
Tumor metastasis would seriously impair the efficacy of chemotherapy. Our previous studies showed losartan combined with paclitaxel-loaded pH-sensitive cleavable liposomes (PTX-Cl-Lip) facilitated paclitaxel accumulation and led to enhanced antitumor efficacy in 4T1 bearing mice. Since losartan could inhibit the level of collagen I which was related to tumor metastasis, this strategy was further applied to suppress tumor metastasis this time. Our in vivo anti-metastatic study manifested losartan could lower the colonies occupied in lungs by 76.4% compared with that of saline group. When losartan and PTX-Cl-Lip were combined, anti-metastatic efficiency reached to 88.2%, which was the best among all the groups. In vitro 3D tumor spheroids studies proved losartan could significantly suppress the invasion of tumor cells. Losartan plus PTX-Cl-Lip could further weaken the metastasis of tumor cells. Mechanism study showed the declination of collagen I level via losartan was caused by inhibition of active transforming growth factor-β1. Western-blot study showed losartan could decrease the level of lysyl oxidase, then inhibit the cross-linking of collagen I, finally weakened the cell signaling transmit via integrin and the metastasis of tumor cells was restrained. All above studies illustrated this combined tactic could achieve favorable effect on suppression of lung tumor metastasis.
TLR4 has a TP53-dependent dual role in regulating breast cancer cell growth
Haricharan, Svasti; Brown, Powel
2015-01-01
Breast cancer is a leading cause of cancer-related death, and it is important to understand pathways that drive the disease to devise effective therapeutic strategies. Our results show that Toll-like receptor 4 (TLR4) drives breast cancer cell growth differentially based on the presence of TP53, a tumor suppressor. TP53 is mutationally inactivated in most types of cancer and is mutated in 30–50% of diagnosed breast tumors. We demonstrate that TLR4 activation inhibits growth of TP53 wild-type cells, but promotes growth of TP53 mutant breast cancer cells by regulating proliferation. This differential effect is mediated by changes in tumor cell cytokine secretion. Whereas TLR4 activation in TP53 mutant breast cancer cells increases secretion of progrowth cytokines, TLR4 activation in TP53 wild-type breast cancer cells increases type I IFN (IFN-γ) secretion, which is both necessary and sufficient for mediating TLR4-induced growth inhibition. This study identifies a novel dichotomous role for TLR4 as a growth regulator and a modulator of tumor microenvironment in breast tumors. These results have translational relevance, demonstrating that TP53 mutant breast tumor growth can be suppressed by pharmacologic TLR4 inhibition, whereas TLR4 inhibitors may in fact promote growth of TP53 wild-type tumors. Furthermore, using data generated by The Cancer Genome Atlas consortium, we demonstrate that the effect of TP53 mutational status on TLR4 activity may extend to ovarian, colon, and lung cancers, among others, suggesting that the viability of TLR4 as a therapeutic target depends on TP53 status in many different tumor types. PMID:26063617
TLR4 has a TP53-dependent dual role in regulating breast cancer cell growth.
Haricharan, Svasti; Brown, Powel
2015-06-23
Breast cancer is a leading cause of cancer-related death, and it is important to understand pathways that drive the disease to devise effective therapeutic strategies. Our results show that Toll-like receptor 4 (TLR4) drives breast cancer cell growth differentially based on the presence of TP53, a tumor suppressor. TP53 is mutationally inactivated in most types of cancer and is mutated in 30-50% of diagnosed breast tumors. We demonstrate that TLR4 activation inhibits growth of TP53 wild-type cells, but promotes growth of TP53 mutant breast cancer cells by regulating proliferation. This differential effect is mediated by changes in tumor cell cytokine secretion. Whereas TLR4 activation in TP53 mutant breast cancer cells increases secretion of progrowth cytokines, TLR4 activation in TP53 wild-type breast cancer cells increases type I IFN (IFN-γ) secretion, which is both necessary and sufficient for mediating TLR4-induced growth inhibition. This study identifies a novel dichotomous role for TLR4 as a growth regulator and a modulator of tumor microenvironment in breast tumors. These results have translational relevance, demonstrating that TP53 mutant breast tumor growth can be suppressed by pharmacologic TLR4 inhibition, whereas TLR4 inhibitors may in fact promote growth of TP53 wild-type tumors. Furthermore, using data generated by The Cancer Genome Atlas consortium, we demonstrate that the effect of TP53 mutational status on TLR4 activity may extend to ovarian, colon, and lung cancers, among others, suggesting that the viability of TLR4 as a therapeutic target depends on TP53 status in many different tumor types.
Bergman, Philip J
2012-11-01
Paraneoplastic syndromes (PNSs) are neoplasm-associated alterations in bodily structure or function or both that occur distant to the tumor. They are an extremely diverse group of clinical aberrations that are associated with the noninvasive actions of the tumor. In many situations, the PNS parallels the underlying malignancy, and therefore, successful treatment of the tumor leads to disappearance of the PNS. Alternatively, recurrence of the PNS after successful treatment signals recurrence of the tumor, and the return of the PNS often significantly precedes the detectable recurrence of the tumor. This is often the case with paraneoplastic hypercalcemia, often referred to as hypercalcemia of malignancy (HM). The most common cause of hypercalcemia in dogs is cancer. Neoplasia is diagnosed in approximately two-thirds of dogs with hypercalcemia vs. approximately one-third in cats. A variety of tumors have been associated with HM. Lymphoma is the most common cause of HM, and the most common anatomical site for dogs with lymphoma-associated HM is the cranial mediastinum. Other tumors associated with HM in dogs and cats include anal sac apocrine gland adenocarcinoma, thyroid carcinoma, multiple myeloma, bone tumors, thymoma, squamous cell carcinoma, mammary gland carcinoma/adenocarcinoma, melanoma, primary lung tumors, chronic lymphocytic leukemia, renal angiomyxoma, and parathyroid gland tumors. As HM is a potential medical emergency, the primary goal in cases of HM is the elucidation of the underlying cause and thereby instituting the appropriate specific therapy. Copyright © 2012 Elsevier Inc. All rights reserved.
LANTCET: laser nanotechnology for screening and treating tumors ex vivo and in vivo
NASA Astrophysics Data System (ADS)
Lapotko, Dmitri O.; Lukianova-Hleb, Ekaterina Y.; Zhdanok, Sergei A.; Hafner, Jason H.; Rostro, Betty C.; Scully, Peter; Konopleva, Marina; Andreeff, Michael; Li, Chun; Hanna, Ehab Y.; Myers, Jeffrey N.; Oraevsky, Alexander A.
2007-06-01
LANTCET (laser-activated nano-thermolysis as cell elimination technology) was developed for selective detection and destruction of individual tumor cells through generation of photothermal bubbles around clusters of light absorbing gold nanoparticles (nanorods and nanoshells) that are selectively formed in target tumor cells. We have applied bare nanoparticles and their conjugates with cell-specific vectors such as monoclonal antibodies CD33 (specific for Acute Myeloid Leukemia) and C225 (specific for carcinoma cells that express epidermal growth factor -EGF). Clusters were formed by using vector-receptor interactions with further clusterization of nanoparticles due to endocytosis. Formation of clusters was verified directly with optical resonance scattering microscopy and microspectroscopy. LANTCET method was tested in vitro for living cell samples with: (1) model myeloid K562 cells (CD33 positive), (2) primary human bone marrow CD33-positive blast cells from patients with the diagnosis of acute myeloid leukemia, (3) monolayers of living EGF-positive carcinoma cells (Hep-2C), (4) human lymphocytes and red blood cells as normal cells. The LANTCET method was also tested in vivo using rats with experimental polymorphic sarcoma. Photothermal bubbles were generated and detected in vitro with a photothermal microscope equipped with a tunable Ti-Sa pulsed laser. We have found that cluster formation caused an almost 100-fold decrease in the bubble generation threshold of laser pulse fluence in tumor cells compared to the bubble generation threshold for normal cells. The animal tumor that was treated with a single laser pulse showed a necrotic area of diameter close to the pump laser beam diameter and a depth of 1-2 mm. Cell level selectivity of tumor damage with single laser pulse was demonstrated. Combining lightscattering imaging with bubble imaging, we introduced a new image-guided mode of the LANTCET operation for screening and treatment of tumors ex vivo and in vivo.
Mishra, Birendra; Lawson, Gregory W; Ripperdan, Ryan; Ortiz, Laura; Luderer, Ulrike
2018-05-21
Astronauts traveling in deep space are exposed to high-charge and energy (HZE) particles from galactic cosmic rays. We have previously determined that irradiation of adult female mice with iron HZE particles induces DNA double-strand breaks, oxidative damage and apoptosis in ovarian follicles, causing premature ovarian failure. These effects occur at lower doses than with conventional photon irradiation. Ovarian failure with resultant loss of negative feedback and elevated levels of gonadotropin hormones is thought to play a role in the pathophysiology of ovarian cancer. Therefore, we hypothesized that charged-iron-particle irradiation induces ovarian tumorigenesis in mice. In this study, three-month-old female mice were exposed to 0 cGy (sham) or 50 cGy iron ions and aged to 18 months. The 50 cGy irradiated mice had increased weight gain with age and lack of estrous cycling, consistent with ovarian failure. A total of 47% and 7% of mice irradiated with 50 cGy had unilateral and bilateral ovarian tumors, respectively, whereas 14% of mice in the 0 cGy group had unilateral tumors. The tumors contained multiple tubular structures, which were lined with cells positive for the epithelial marker cytokeratin, and had few proliferating cells. In some tumors, packets of cells between the tubular structures were immunopositive for the granulosa cell marker FOXL2. Based on these findings, tumors were diagnosed as tubular adenomas or mixed tubular adenoma/granulosa cell tumors. In conclusion, charged-iron-particle-radiation induces ovarian tumors in mice, raising concerns about ovarian tumors as late sequelae of deep space travel in female astronauts.
Todorova, Valentina K; Harms, Stacy A; Kaufmann, Yihong; Luo, Shaoke; Luo, Kevin Q; Babb, Kirk; Klimberg, V Suzanne
2004-12-01
Glutamine (GLN) is a non-essential amino acid that is present in nearly every biochemical pathway and is the major intraorgan nitrogen carrier. GLN via glutamate, is one of the precursors for the synthesis of glutathione (GSH), the major endogenous antioxidant in mammalian cells, which protects them from oxidative injury and cell death. Cancer cells have higher GSH levels than the surrounding normal cells, which attributes to a higher rate of cell proliferation and resistance to chemotherapy. Therefore, selective tumor depletion of GSH presents a promising strategy in cancer treatment. Experimental studies have associated decreased GSH levels with inhibition of proliferation and stimulation of apoptosis. Previous results of our laboratory have provided evidence that dietary GLN diminished tumor development in implantable as well as 7,12-dimethylbenz[a]anthracene (DMBA)-induced breast cancer and elevated GSH in the host tissues. In this study we examined the effects of GLN on GSH levels in DMBA-induced mammary tumors and correlated the results with protein and mRNA expression of apoptosis-related proteins Bcl-2, Bax and caspase-3 in tumor cells. The results have shown that GLN supplementation caused a significant decrease in the tumor GSH levels and the ratio GSH/oxidized GSH (GSSG), accompanied by up-regulation of Bax and caspase-3, and down-regulation of Bcl-2. These findings suggest that dietary GLN supplementation suppresses mammary carcinogenesis by activation of apoptosis in tumor cells and this probably is a result of GSH down-regulation.
IDENTIFYING AND TARGETING TUMOR-INITIATING CELLS IN THE TREATMENT OF BREAST CANCER
Wei, Wei; Lewis, Michael T.
2015-01-01
Breast cancer is the most common cancer in women (exclusive of skin cancer), and is the second leading cause of cancer-related deaths. Although conventional and targeted therapies have improved survival rates, there are still considerable challenges in treating breast cancer, including treatment resistance, disease recurrence, and metastasis. Treatment resistance can be either de novo - due to traits that tumor cells possess prior to treatment, or acquired, - due to traits that tumor cells gain in response to treatment. A recently proposed mechanism of de novo resistance invokes existence of a specialized subset of cancer cells defined as tumor-initiating cells (TICs), or cancer stem cells (CSC). TICs have the capacity to self-renew and regenerate new tumors that consist of all clonally-derived cell types present in the parental tumor. There are data to suggest that TICs are resistant to many conventional cancer therapies, and survive treatment in spite of dramatic shrinkage of the tumor. Residual TICs can then eventually regrow resulting in disease relapse. It is also hypothesized that TIC may be responsible for metastatic disease. If these hypotheses are correct, targeting TICs may be imperative to achieve cure. In this review, we discuss evidence for breast TICs and their apparent resistance to conventional chemotherapy and radiotherapy, as well as to various targeted therapies. We also address the potential impact of breast TIC plasticity and metastatic potential on therapeutic strategies. Finally, we describe several genes and signaling pathways that appear important for TIC function that may represent promising therapeutic targets. PMID:25876646
Inosine Released from Dying or Dead Cells Stimulates Cell Proliferation via Adenosine Receptors.
Chen, Jin; Chaurio, Ricardo A; Maueröder, Christian; Derer, Anja; Rauh, Manfred; Kost, Andriy; Liu, Yi; Mo, Xianming; Hueber, Axel; Bilyy, Rostyslav; Herrmann, Martin; Zhao, Yi; Muñoz, Luis E
2017-01-01
Many antitumor therapies induce apoptotic cell death in order to cause tumor regression. Paradoxically, apoptotic cells are also known to promote wound healing, cell proliferation, and tumor cell repopulation in multicellular organisms. We aimed to characterize the nature of the regenerative signals concentrated in the micromilieu of dead and dying cells. Cultures of viable melanoma B16F10 cells, mouse fibroblasts, and primary human fibroblast-like synoviocytes (FLS) in the presence of dead and dying cells, their supernatants (SNs), or purified agonists and antagonists were used to evaluate the stimulation of proliferation. Viable cell quantification was performed by either flow cytometry of harvested cells or by crystal violet staining of adherent cells. High-performance liquid chromatography and liquid chromatography coupled with mass spectrometry of cell SNs were deployed to identify the nature of growth-promoting factors. Coimplantation of living cells in the presence of SNs collected from dead and dying cells and specific agonists was used to evaluate tumor growth in vivo . The stimulation of proliferation of few surviving cells by bystander dead cells was confirmed for melanoma cells, mouse fibroblasts, and primary FLS. We found that small soluble molecules present in the protein-free fraction of SNs of dead and dying cells were responsible for the promotion of proliferation. The nucleoside inosine released by dead and dying cells acting via adenosine receptors was identified as putative inducer of proliferation of surviving tumor cells after irradiation and heat treatment. Inosine released by dead and dying cells mediates tumor cell proliferation via purinergic receptors. Therapeutic strategies surmounting this pathway may help to reduce the rate of recurrence after radio- and chemotherapy.
CTNNA3 is a tumor suppressor in hepatocellular carcinomas and is inhibited by miR-425
Liu, Fang-E; Chen, Xue-Mei; Zhao, Jing; Lin, Song; Liu, Zhi-Zhen; Zhang, Hu-Qin
2016-01-01
Hepatocellular carcinoma (HCC) is a common and leading cause of death worldwide. Here, we identified that a cell-cell adhesion gene, CTNNA3, is a tumor suppressor in HCC. CTNNA3 inhibited the proliferation, migration and invasion of HCC cell lines. In these cells, CTNNA3 inhibited Akt signal, and in turn decreased the proliferating cell nuclear antigen (PCNA) and the matrix metallopeptidase MMP-9, and increased the cell cycle inhibitor p21Cip1/Waf1. Meanwhile, CTNNA3 is inhibited by miR-425 in HCC. The miR-425 directly bound to the 3′UTR of CTNNA3 and inhibited its expression. The tumor suppressor function of CTNNA3 and the oncogenic function of miR-425 were further confirmed in HCC cell xenograft in nude mice. The miR-425/CTNNA3 axis may provide insights into the mechanisms underlying HCC, and contribute to potential therapeutic strategy of HCC. PMID:26882563
Scala, Stefania; Portella, Giuseppe; Fedele, Monica; Chiappetta, Gennaro; Fusco, Alfredo
2000-01-01
High mobility group I (HMGI) proteins are overexpressed in several human malignant tumors. We previously demonstrated that inhibition of HMGI synthesis prevents thyroid cell transformation. Here, we report that an adenovirus carrying the HMGI(Y) gene in an antisense orientation (Ad-Yas) induced programmed cell death of two human thyroid anaplastic carcinoma cell lines (ARO and FB-1), but not normal thyroid cells. The Ad-Yas virus led to death of lung, colon, and breast carcinoma cells. A control adenovirus carrying the lacZ gene did not inhibit the growth of either normal or neoplastic cells. Ad-Yas treatment of tumors induced in athymic mice by ARO cells caused a drastic reduction in tumor size. Therefore, suppression of HMGI(Y) protein synthesis by an HMGI(Y) antisense adenoviral vector may be a useful treatment strategy in a variety of human malignant neoplasias, in which HMGI(Y) gene overexpression is a general event. PMID:10759549
Engl, Tobias; Makarević, Jasmina; Relja, Borna; Natsheh, Iyad; Müller, Iris; Beecken, Wolf-Dietrich; Jonas, Dietger; Blaheta, Roman A
2005-01-01
Background Tumor development remains one of the major obstacles following organ transplantation. Immunosuppressive drugs such as cyclosporine and tacrolimus directly contribute to enhanced malignancy, whereas the influence of the novel compound mycophenolate mofetil (MMF) on tumor cell dissemination has not been explored. We therefore investigated the adhesion capacity of colon, pancreas, prostate and kidney carcinoma cell lines to endothelium, as well as their beta1 integrin expression profile before and after MMF treatment. Methods Tumor cell adhesion to endothelial cell monolayers was evaluated in the presence of 0.1 and 1 μM MMF and compared to unstimulated controls. beta1 integrin analysis included alpha1beta1 (CD49a), alpha2beta1 (CD49b), alpha3beta1 (CD49c), alpha4beta1 (CD49d), alpha5beta1 (CD49e), and alpha6beta1 (CD49f) receptors, and was carried out by reverse transcriptase-polymerase chain reaction, confocal microscopy and flow cytometry. Results Adhesion of the colon carcinoma cell line HT-29 was strongly reduced in the presence of 0.1 μM MMF. This effect was accompanied by down-regulation of alpha3beta1 and alpha6beta1 surface expression and of alpha3beta1 and alpha6beta1 coding mRNA. Adhesion of the prostate tumor cell line DU-145 was blocked dose-dependently by MMF. In contrast to MMF's effects on HT-29 cells, MMF dose-dependently up-regulated alpha1beta1, alpha2beta1, alpha3beta1, and alpha5beta1 on DU-145 tumor cell membranes. Conclusion We conclude that MMF possesses distinct anti-tumoral properties, particularly in colon and prostate carcinoma cells. Adhesion blockage of HT-29 cells was due to the loss of alpha3beta1 and alpha6beta1 surface expression, which might contribute to a reduced invasive behaviour of this tumor entity. The enhancement of integrin beta1 subtypes observed in DU-145 cells possibly causes re-differentiation towards a low-invasive phenotype. PMID:15644133
Gautam, S C; Chikkala, N F; Lewis, I; Grabowski, D R; Finke, J H; Ganapathi, R
1992-01-01
Development of multidrug-resistance (MDR) remains a major cause of failure in the treatment of cancer with chemotherapeutic agents. In our efforts to explore alternative treatment regimens for multidrug-resistant tumors we have examined the sensitivity of MDR tumor cell lines to lymphokine activated killer (LAK) cells. Adriamycin (ADM) resistant B16-BL6 melanoma, L1210 and P388 leukemic cell lines were tested for sensitivity to lysis by LAK cells in vitro. While ADM-resistant B16-BL6 and L1210 sublines were found to exhibit at least 2-fold greater susceptibility to lysis by LAK cells, sensitivity of ADM-resistant P388 cell was similar to that of parental cells. Since ADM-resistant B16-BL6 cells were efficiently lysed by LAK cells in vitro, the efficacy of therapy with LAK cells against the ADM-resistant B16-BL6 subline in vivo was evaluated. Compared to mice bearing parental B16-BL6 tumor cells, the adoptive transfer of LAK cells and rIL2 significantly reduced formation of experimental metastases (P less than 0.009) and extended median survival time (P less than 0.001) of mice bearing ADM-resistant B16-BL6 tumor cells. Results suggest that immunotherapy with LAK cells and rIL2 may be a useful modality in the treatment of cancers with the MDR phenotype.
Liu, Suxing; Bishop, W Robert; Liu, Ming
2003-08-01
p21(WAF1/Cip1) was initially identified as a cell cycle regulatory protein that can cause cell cycle arrest. It is induced by both p53-dependent and p53-independent mechanisms. This mini-review briefly discusses its currently known functions in apoptosis and drug sensitivity. As an inhibitor of cell proliferation, p21(WAF1/Cip1) plays an important role in drug-induced tumor suppression. Nevertheless, a number of recent studies have shown that p21(WAF1/Cip1) can assume both pro- or anti-apoptotic functions in response to anti-tumor agents depending on cell type and cellular context. This dual role of p21(WAF1/Cip1) in cancer cells complicates using p21(WAF1/Cip1) status to predict response to anti-tumor agents. However, it is possible to develop p21(WAF1/Cip1)-targeted reagents or p21(WAF1/Cip1) gene transfer techniques to have a beneficial effect within a well-defined therapeutic context. Better understanding of the roles of p21(WAF1/Cip1) in tumors should enable a more rational approach to anti-tumor drug design and therapy.
Altered tumor cell growth and tumorigenicity in models of microgravity
NASA Astrophysics Data System (ADS)
Yamauchi, K.; Taga, M.; Furian, L.; Odle, J.; Sundaresan, A.; Pellis, N.; Andrassy, R.; Kulkarni, A.
Spaceflight environment and microgravity (MG) causes immune dysfunction and is a major health risk to humans, especially during long-term space missions. The effects of microgravity environment on tumor growth and carcinogenesis are yet unknown. Hence, we investigated the effects of simulated MG (SMG) on tumor growth and tumorigenicity using in vivo and in vitro models. B16 melanoma cells were cultured in static flask (FL) and rotating wall vessel bioreactors (BIO) to measure growth and properties, melanin production and apoptosis. BIO cultures had 50% decreased growth (p<0.01), increased doubling time and a 150% increase in melanin production (p<0.05). Flow cytometric analysis showed increased apoptosis in BIO. When BIO cultured melanoma cells were inoculated sc in mice there was a significant increase in tumorigenicity as compared to FL cells. Thus SMG may have supported &selected highly tumorigenic cells and it is pos sible that in addition to decreased immune function MG may alter tumor cell characteristics and invasiveness. Thus it is important to study effects of microgravity environment and its stressors using experimental tumors and SMG to understand and evaluate carcinogenic responses to true microgravity. Further studies on carcinogenic events and their mechanisms will allow us develop and formulate countermeasures and protect space travelers. Additional results will be presented. (Supported by NASA NCC8-168 grant, ADK)
Molecular Insights into Division of Single Human Cancer Cells in On-Chip Transparent Microtubes
2016-01-01
In vivo, mammalian cells proliferate within 3D environments consisting of numerous microcavities and channels, which contain a variety of chemical and physical cues. External environments often differ between normal and pathological states, such as the unique spatial constraints that metastasizing cancer cells experience as they circulate the vasculature through arterioles and narrow capillaries, where they can divide and acquire elongated cylindrical shapes. While metastatic tumors cause most cancer deaths, factors impacting early cancer cell proliferation inside the vasculature and those that can promote the formation of secondary tumors remain largely unknown. Prior studies investigating confined mitosis have mainly used 2D cell culture systems. Here, we mimic aspects of metastasizing tumor cells dividing inside blood capillaries by investigating single-cell divisions of living human cancer cells, trapped inside 3D rolled-up, transparent nanomembranes. We assess the molecular effects of tubular confinement on key mitotic features, using optical high- and super-resolution microscopy. Our experiments show that tubular confinement affects the morphology and dynamics of the mitotic spindle, chromosome arrangements, and the organization of the cell cortex. Moreover, we reveal that membrane blebbing and/or associated processes act as a potential genome-safety mechanism, limiting the extent of genomic instability caused by mitosis in confined circumstances, especially in tubular 3D microenvironments. Collectively, our study demonstrates the potential of rolled-up nanomembranes for gaining molecular insights into key cellular events occurring in tubular 3D microenvironments in vivo. PMID:27267364
Willow Leaves' Extracts Contain Anti-Tumor Agents Effective against Three Cell Types
El-Shemy, Hany A.; Aboul-Enein, Ahmed M.; Aboul-Enein, Khalid Mostafa; Fujita, Kounosuke
2007-01-01
Many higher plants contain novel metabolites with antimicrobial, antifungal and antiviral properties. However, in the developed world almost all clinically used chemotherapeutics have been produced by in vitro chemical synthesis. Exceptions, like taxol and vincristine, were structurally complex metabolites that were difficult to synthesize in vitro. Many non-natural, synthetic drugs cause severe side effects that were not acceptable except as treatments of last resort for terminal diseases such as cancer. The metabolites discovered in medicinal plants may avoid the side effect of synthetic drugs, because they must accumulate within living cells. The aim here was to test an aqueous extract from the young developing leaves of willow (Salix safsaf, Salicaceae) trees for activity against human carcinoma cells in vivo and in vitro. In vivo Ehrlich Ascites Carcinoma Cells (EACC) were injected into the intraperitoneal cavity of mice. The willow extract was fed via stomach tube. The (EACC) derived tumor growth was reduced by the willow extract and death was delayed (for 35 days). In vitro the willow extract could kill the majority (75%–80%) of abnormal cells among primary cells harvested from seven patients with acute lymphoblastic leukemia (ALL) and 13 with AML (acute myeloid leukemia). DNA fragmentation patterns within treated cells inferred targeted cell death by apoptosis had occurred. The metabolites within the willow extract may act as tumor inhibitors that promote apoptosis, cause DNA damage, and affect cell membranes and/or denature proteins. PMID:17264881
Du, Yan; Liu, Hua; He, Yiqing; Liu, Yiwen; Yang, Cuixia; Zhou, Muqing; Wang, Wenjuan; Cui, Lian; Hu, Jiajie; Gao, Feng
2013-01-01
Hyaluronan (HA), a simple disaccharide unit, can polymerize and is considered a primary component of the extracellular matrix, which has a wide range of biological functions. In recent years, HA was found on the surface of tumor cells. According to previous reports, differing HA content on the cell surface of tumor cells is closely related to lymph node metastases, but the mechanisms mediating this process remained unclear. This research intended to study the surface content of HA on tumor cells and analyze cell adhesive changes caused by the interaction between HA and its lymphatic endothelial receptor (LYVE-1). We screened and observed high HA content on HS-578T breast cells and low HA content on MCF-7 breast cells through particle exclusion, immunofluorescence and flow cytometry experiments. The expression of LYVE-1, the lymph-vessel specific HA receptor, was consistent with our previous report and enhanced the adhesion of HA(high)-HS-578T cells to COS-7(LYVE-1(+)) through HA in cell static adhesion and dynamic parallel plate flow chamber experiments. MCF-7 breast cells contain little HA on the surface; however, our results showed little adhesion difference between MCF-7 cells and COS-7(LYVE-1(+)) and COS-7(LYVE-1(-)) cells. Similar results were observed concerning the adhesion of HS-578T cells or MCF-7 cells to SVEC4-10 cells. Furthermore, we observed for the first time that the cell surface HA content of high transfer tumor cells was rich, and we visualized the cross-linking of HA cable structures, which may activate LYVE-1 on lymphatic endothelial cells, promoting tumor adhesion. In summary, high-low cell surface HA content of tumor cells through the interaction with LYVE-1 leads to adhesion differences.
Increased metastatic potential of tumor cells in von Willebrand factor-deficient mice.
Terraube, V; Pendu, R; Baruch, D; Gebbink, M F B G; Meyer, D; Lenting, P J; Denis, C V
2006-03-01
The key role played by von Willebrand factor (VWF) in platelet adhesion suggests a potential implication in various pathologies, where this process is involved. In cancer metastasis development, tumor cells interact with platelets and the vessel wall to extravasate from the circulation. As a potential mediator of platelet-tumor cell interactions, VWF could influence this early step of tumor spread and therefore play a role in cancer metastasis. To investigate whether VWF is involved in metastasis development. In a first step, we characterized the interaction between murine melanoma cells B16-BL6 and VWF in vitro. In a second step, an experimental metastasis model was used to compare the formation of pulmonary metastatic foci in C57BL/6 wild-type and VWF-null mice following the injection of B16-BL6 cells or Lewis lung carcinoma cells. In vitro adhesion assays revealed that VWF is able to promote a dose-dependent adhesion of B16-BL6 cells via its Arg-Gly-Asp (RGD) sequence. In the experimental metastasis model, we found a significant increase in the number of pulmonary metastatic foci in VWF-null mice compared with the wild-type mice, a phenotype that could be corrected by restoring VWF plasma levels. We also showed that increased survival of the tumor cells in the lungs during the first 24 h in the absence of VWF was the cause of this increased metastasis. These findings suggest that VWF plays a protective role against tumor cell dissemination in vivo. Underlying mechanisms remain to be investigated.
Li, Mu; Wu, Xingda; Liu, Ning; Li, Xiaoying; Meng, Fanbin; Song, Shaowei
2017-06-01
Pancreatic cancer is one of the leading causes of cancer-related death worldwide. Activating transcription factor 2 (ATF2) is a multifunctional transcription factor, and is implicated in tumor progress, yet its role in pancreatic cancer remains unclear. In the present study, the level of ATF2 in pancreatic cancer tissues and the adjacent non-tumorous tissues was detected by quantitative real-time PCR and Western blot. The roles of ATF2 in the proliferation, cell cycle, and apoptosis of pancreatic cancer cells were investigated through ATF2 silencing, and the effect of ATF2 shRNA on the sensitivity of pancreatic cancer cells to gemcitabine, an anti-tumor drug, was explored. The results of our study showed that the ATF2 level in the pancreatic cancer tissues was higher than that in the adjacent non-tumorous tissues. Silencing of ATF2 was found to inhibit proliferation, arrest cell cycle at G1 phase and induce apoptosis in pancreatic cancer cells. Moreover, ATF2 silencing enhanced gemcitabine-induced growth-inhibition and apoptosis-induction effects in pancreatic cancer cells. In summary, silencing of ATF2 inhibited the growth of pancreatic cancer cells and enhanced the anti-tumor effects of gemcitabine, suggesting that ATF2 plays a pro-survival role in pancreatic cancer. Our results also propose that a high level of ATF2 may serve as a potential biomarker of pancreatic cancer, and that ATF2 may become a potential target for anti-tumor therapy. © 2017 International Federation for Cell Biology.
Pan-RAF and MEK vertical inhibition enhances therapeutic response in non-V600 BRAF mutant cells.
Molnár, Eszter; Rittler, Dominika; Baranyi, Marcell; Grusch, Michael; Berger, Walter; Döme, Balázs; Tóvári, József; Aigner, Clemens; Tímár, József; Garay, Tamás; Hegedűs, Balázs
2018-05-08
Currently, there are no available targeted therapy options for non-V600 BRAF mutated tumors. The aim of this study was to investigate the effects of RAF and MEK concurrent inhibition on tumor growth, migration, signaling and apoptosis induction in preclinical models of non-V600 BRAF mutant tumor cell lines. Six BRAF mutated human tumor cell lines CRL5885 (G466 V), WM3629 (D594G), WM3670 (G469E), MDAMB231 (G464 V), CRL5922 (L597 V) and A375 (V600E as control) were investigated. Pan-RAF inhibitor (sorafenib or AZ628) and MEK inhibitor (selumetinib) or their combination were used in in vitro viability, video microscopy, immunoblot, cell cycle and TUNEL assays. The in vivo effects of the drugs were assessed in an orthotopic NSG mouse breast cancer model. All cell lines showed a significant growth inhibition with synergism in the sorafenib/AZ628 and selumetinib combination. Combination treatment resulted in higher Erk1/2 inhibition and in increased induction of apoptosis when compared to single agent treatments. However, single selumetinib treatment could cause adverse therapeutic effects, like increased cell migration in certain cells, selumetinib and sorafenib combination treatment lowered migratory capacity in all the cell lines. Importantly, combination resulted in significantly increased tumor growth inhibition in orthotropic xenografts of MDAMB231 cells when compared to sorafenib - but not to selumetinib - treatment. Our data suggests that combined blocking of RAF and MEK may achieve increased therapeutic response in non-V600 BRAF mutant tumors.
NUP160-SLC43A3 is a novel recurrent fusion oncogene in angiosarcoma.
Shimozono, Naoki; Jinnin, Masatoshi; Masuzawa, Mamiko; Masuzawa, Mikio; Wang, Zhongzhi; Hirano, Ayaka; Tomizawa, Yukiko; Etoh-Kira, Tomomi; Kajihara, Ikko; Harada, Miho; Fukushima, Satoshi; Ihn, Hironobu
2015-11-01
Angiosarcoma is a malignant vascular tumor originating from endothelial cells of blood vessels or lymphatic vessels. The specific driver mutations in angiosarcoma remain unknown. In this study, we investigated this issue by transcriptome sequencing of patient-derived angiosarcoma cells (ISO-HAS), identifying a novel fusion gene NUP160-SLC43A3 found to be expressed in 9 of 25 human angiosarcoma specimens that were examined. In tumors harboring the fusion gene, the duration between the onset of symptoms and the first hospital visit was significantly shorter, suggesting more rapid tumor progression. Stable expression of the fusion gene in nontransformed human dermal microvascular endothelial cells elicited a gene-expression pattern mimicking ISO-HAS cells and increased cell proliferation, an effect traced in part to NUP160 truncation. Conversely, RNAi-mediated attenuation of NUP160 in ISO-HAS cells decreased cell number. Confirming the oncogenic effects of the fusion protein, subcutaneous implantation of NUP160-SLC43A3-expressing fibroblasts induced tumors resembling human angiosarcoma. Collectively, our findings advance knowledge concerning the genetic causes of angiosarcoma, with potential implications for new diagnostic and therapeutic approaches. ©2015 American Association for Cancer Research.
Veiga, Sonia Rosa; Ge, Xuemei; Mercer, Carol A; Hernández-Alvarez, María Isabel; Thomas, Hala Elnakat; Hernández-Losa, Javier; Ramón Y Cajal, Santiago; Zorzano, Antonio; Thomas, George; Kozma, Sara C
2018-04-24
Hepatocellular carcinoma (HCC) ranks second in cancer mortality and has limited therapeutic options. We recently described the synergistic effect of allosteric and ATP-site competitive inhibitors against the mammalian target of rapamycin (mTOR) for the treatment of HCC. However, such inhibitors induce glycemia and increase mitochondrial efficiency. Here we determined whether the mitochondrial complex I inhibitor Phenformin could reverse both side effects, impose an energetic-stress on cancer cells and suppress the growth of HCC. Human HCC cell lines were used in vitro to access the signaling and energetic impact of mTOR inhibitors and Phenformin, either alone or in combination. Next, the therapeutic utility of these drugs alone or in combination was investigated pre-clinically in human orthotopic tumors implanted in mice, by analyzing their impact on the tumor burden and overall survival. We found Phenformin caused mitochondrial dysfunction and fragmentation, inducing a compensatory shift to glycolysis. In contrast, dual inhibition of mTOR impaired cell growth and glycolysis, while increasing mitochondrial fusion and efficiency. In a mouse model of human HCC, dual inhibition of mTOR, together with Phenformin, was highly efficacious in controlling tumor burden. However, more striking, pretreatment with Phenformin sensitized tumors to dual inhibition of mTOR, leading to a dramatic improvement in survival. Treatment of HCC cells in vitro with the biguanide Phenformin causes a metabolic shift to glycolysis, mitochondrial dysfunction and fragmentation, and dramatically sensitizes orthotopic liver tumors to dual inhibition of mTOR. We therefore propose this therapeutic approach should be tested clinically in HCC. Copyright ©2018, American Association for Cancer Research.
Parray, Aijaz; Siddique, Hifzur R.; Kuriger, Jacquelyn K.; Mishra, Shrawan K.; Rhim, Johng S.; Nelson, Heather H.; Aburatani, Hiroyuki; Konety, Badrinath R.; Koochekpour, Shahriar; Saleem, Mohammad
2015-01-01
High-risk populations exhibit early transformation of localized prostate cancer (CaP) disease to metastasis which results in the mortality of such patients. The paucity of knowledge about the molecular mechanism involved in acquiring of metastatic behavior by primary tumor cells and non-availability of reliable phenotype-discriminating biomarkers are stumbling blocks in the management of CaP disease. Here, we determine the role and translational relevance of ROBO1 (an organogenesis-associated gene) in human CaP. Employing CaP-progression models and prostatic tissues of Caucasian and African-American patients, we show that ROBO1 expression is localized to cell-membrane and significantly lost in primary and metastatic tumors. While Caucasians exhibited similar ROBO1 levels in primary and metastatic phenotype, a significant difference was observed between tumor phenotypes in African-Americans. Epigenetic assays identified promoter methylation of ROBO1 specific to African-American metastatic CaP cells. Using African-American CaP models for further studies, we show that ROBO1 negatively regulates motility and invasiveness of primary CaP cells, and its loss causes these cells to acquire invasive trait. To understand the underlying mechanism, we employed ROBO1-expressing/ROBO1-C2C3-mutant constructs, immunoprecipitation, confocal-microscopy and luciferase-reporter techniques. We show that ROBO1 through its interaction with DOCK1 (at SH3-SH2-domain) controls the Rac-activation. However, loss of ROBO1 results in Rac1-activation which in turn causes E-Cadherin/β-catenin cytoskeleton destabilization and induction of cell migration. We suggest that ROBO1 is a predictive biomarker that has potential to discriminate among CaP types, and could be exploited as a molecular target to inhibit the progression of disease as well as treat metastasis in high-risk populations such as African-Americans. PMID:24752651
CD147 overexpression promotes tumorigenicity in Chinese hamster ovary cells.
Yong, Yu-Le; Liao, Cheng-Gong; Wei, Ding; Chen, Zhi-Nan; Bian, Huijie
2016-04-01
CD147 overexpresses in many epithelium-originated tumors and plays an important role in tumor migration and invasion. Most studies aim at the role of CD147 in tumor progression using tumor cell models. However, the influence of abnormal overexpression of CD147 on neoplastic transformation of normal cells is unknown. Here, the role of CD147 in malignant phenotype transformation in CHO cells was investigated. Three CHO cell lines that stably overexpressed CD147 (CHO-CD147), EGFP-CD147 (CHO-EGFP-CD147), and EGFP (CHO-EGFP) were generated by transfection of plasmids containing human CD147, EGFP-human CD147, and EGFP genes into CHO cells. Cell migration and invasion were detected by wound healing and transwell matrix penetration assay. Trypan blue exclusion, MTT, cell cycle analysis, and BrdU cell proliferation assay were used to detect cell viability and cell proliferation. Annexin V-FITC analysis was performed to detect apoptosis. We found that CD147 overexpression promoted the migration and invasion of CHO cells. CD147 accelerated the G1 to S phase transition and enhanced the CHO cell proliferation. Overexpression of CD147 inhibited both early- and late-stages of apoptosis of CHO-CD147 cells, which is caused by serum deprivation. CHO-EGFP-CD147 cells showed an increased anchorage-independent growth compared with CHO-EGFP cells as detected by soft-agar colony formation assay. The tumors formed by CHO-CD147 cells in nude mice were larger and coupled with higher expression of proliferating cell nuclear antigen and Ki-67 than that of CHO cells. In conclusion, human CD147 overexpression induces malignant phenotype in CHO cells. © 2015 International Federation for Cell Biology.
Magnetic fluid-modeled microgravity: a novel way to treat tumor.
Chen, Jun; Yan, Zhiqiang; Liu, Rongrong; Wang, Nanding; Li, Jing; Wang, Zongren
2011-12-01
With the advances of nanotechnology in recent years, our understanding of the therapy of cancers has deepened and the development of new technologies for cancer diseases has emerged. Here, with the recent discoveries of nanomagnetic fluids as well as microgravity effects upon cancerous cells, we suggest an innovative method of treating tumor using magnetic fluid-modeled microgravity. Magnetic fluids are delivered by outside magnetic field to tumor issue either intravenously or through direct injection, and this is followed by application of an uniform external magnetic field that causes microgravity. The modeled microgravity is to inhibit cancerous cells growth and invasion. Copyright © 2011. Published by Elsevier Ltd.
Janakiram, Naveena B.; Mohammed, Altaf; Bryant, Taylor; Zhang, Yuting; Brewer, Misty; Duff, Ashley; Biddick, Laura; Singh, Anil; Lightfoot, Stan; Steele, Vernon E; Rao, Chinthalapally V.
2016-01-01
Colorectal cancer (CRC) is the second highest cause of cancer-related deaths. A successful strategy to improve chemopreventive efficacies is by down-regulating tumor polyamines and enhancing NK cell activities. Colonic carcinogenesis was induced by azoxymethane (AOM) in male F344 rats. Eight weeks after AOM treatment, animals were fed diets containing Rosuvastatin and difluromethylornithine (DFMO) individually and in combination for 40 weeks. Both agents showed significant suppression of adenocarcinoma multiplicity and incidence with no toxicity compared to untreated rats. Low-dose Rosuvastatin plus DFMO suppressed colon adenocarcinoma multiplicity by 76% compared to low-dose Rosuvastatin (29%) and DFMO (46%), suggesting additive efficacy. Furthermore, low-dose combination caused a delay in colonic adenocarcinoma progression. DFMO, Rosuvastatin and/or combinations significantly decreased polyamine content and increased intra-tumoral NK cells expressing perforin plus IFN-γ compared to untreated colon tumors. Further ex-vivo analysis of splenic NK cells exposed to DFMO, Rosuvastatin or combination resulted in an increase of NKs with perforin expression. This is the first report on Rosuvastatin alone or combination strategy using clinically relevant statin plus DFMO doses which shows a significant suppression of colon adenocarcinomas, and their potential in increasing functional NK cells. This strategy has potential for further testing in high risk individuals for colon cancer. PMID:27841323
Monitoring tumor metastasis by in vivo imaging and flow cytometer
NASA Astrophysics Data System (ADS)
Gu, Zhenqin; Guo, Jin; Liu, Guangda; Li, Yan; Chen, Yun; Chen, Tong; Wang, Chen; Wei, Xunbin
2009-08-01
Prostate cancer is the most common malignancy in American men and the second leading cause of deaths from cancer, after lung cancer. The tumor usually grows slowly and remains confined to the gland for many years. During this time, the tumor produces little or no symptoms or outward signs. As the cancer advances, however, it can metastasize throughout other areas of the body, such as the bones, lungs, and liver. Surgical resection, hormonal therapy, chemotherapy and radiation therapy are the foundation of current prostate cancer therapies. Treatments for prostate cause both short- and long-term side effects that may be difficult to accept. Molecular mechanisms of prostate cancer metastasis need to be understood better and new therapies must be developed to selectively target to unique characteristics of cancer cell growth and metastasis. We have developed the "in vivo microscopy" to study the mechanisms that govern prostate cancer cell spread through the microenvironment in vivo in real-time confocal nearinfrared fluorescence imaging. A recently developed "in vivo flow cytometer" and optical imaging are used to assess prostate cancer cell spreading and the circulation kinetics of prostate cancer cells. A real- time quantitative monitoring of circulating prostate cancer cells by the in vivo flow cytometer will be useful to assess the effectiveness of the potential therapeutic interventions.
Papaefthimiou, Apostolos; Kyrgios, Ioannis; Kotanidou, Eleni P; Maggana, Ioanna; Mouzaki, Konstantina; Galli-Tsinopoulou, Assimina
2015-02-01
Nocturnal enuresis is a common symptom in children. It is usually attributed to benign causes and diagnostic evaluation is not carried out. We report three male young patients initially presenting with short stature and nocturnal enuresis, related to diabetes insipidus, caused by intracranial germinomatous germ cell tumors. In all three cases, water deprivation tests confirmed diabetes insipidus. Extensive endocrinological investigation also showed further hormone deficiencies. Magnetic resonance imaging of the brain revealed the presence of a central nervous system lesion and histology confirmed the final diagnosis. Surgery, radiation with or without chemotherapy was conducted and the patients were treated with hormone replacement therapies. The patients after a long follow-up were free of disease. We present these cases to alert clinicians to bear in mind that the presence of an intracranial germinomatous germ cell tumor should at least be considered in a child presenting with bed wetting, especially if additional symptoms and signs, including late onset puberty and growth delay or morning hypernatremia, may coexist. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Chromosomal Translocations: Chicken or Egg? | Center for Cancer Research
Many tumor cells have abnormal chromosomes. Some of these abnormalities are caused by chromosomal translocations, which occur when two chromosomes break and incorrectly rejoin, resulting in an exchange of genetic material. Translocations can activate oncogenes, silence tumor suppressor genes, or result in the creation of completely new fusion gene products. While there is
Targeting Paclitaxel-Loaded Nanoparticles to Ovarian Cancer
2011-05-01
with each other causes the polymer to collapse to form a nanoparticle of ~20 nm in aqueous solutions as determined by dynamic light scattering (2, 8...molecular target in tumor cells and tumor stroma. Cancer Res. 2008;68:7210-8. 19. von Maltzahn G, Ren Y, Park JH, Min DH, Kotamraju VR, Jayakumar J, et
Cancer hyperthermia using magnetic nanoparticles.
Kobayashi, Takeshi
2011-11-01
Magnetic-nanoparticle-mediated intracellular hyperthermia has the potential to achieve localized tumor heating without any side effects. The technique consists of targeting magnetic nanoparticles to tumor tissue followed by application of an external alternating magnetic field that induces heat through Néel relaxation loss of the magnetic nanoparticles. The temperature in tumor tissue is increased to above 43°C, which causes necrosis of cancer cells, but does not damage surrounding normal tissue. Among magnetic nanoparticles available, magnetite has been extensively studied. Recent years have seen remarkable advances in magnetite-nanoparticle-mediated hyperthermia; both functional magnetite nanoparticles and alternating-magnetic-field generators have been developed. In addition to the expected tumor cell death, hyperthermia treatment has also induced unexpected biological responses, such as tumor-specific immune responses as a result of heat-shock protein expression. These results suggest that hyperthermia is able to kill not only local tumors exposed to heat treatment, but also tumors at distant sites, including metastatic cancer cells. Currently, several research centers have begun clinical trials with promising results, suggesting that the time may have come for clinical applications. This review describes recent advances in magnetite nanoparticle-mediated hyperthermia. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Enhancing adoptive cancer immunotherapy with Vγ2Vδ2 T cells through pulse zoledronate stimulation.
Nada, Mohanad H; Wang, Hong; Workalemahu, Grefachew; Tanaka, Yoshimasa; Morita, Craig T
2017-01-01
Human γδ T cells expressing Vγ2Vδ2 T cell receptors monitor foreign- and self-prenyl pyrophosphate metabolites in isoprenoid biosynthesis to mediate immunity to microbes and tumors. Adoptive immunotherapy with Vγ2Vδ2 T cells has been used to treat cancer patients with partial and complete remissions. Most clinical trials and preclinical studies have used continuous zoledronate exposure to expand Vγ2Vδ2 cells where zoledronate is slowly diluted over the course of the culture. Zoledronate inhibits farnesyl diphosphate synthase (FDPS) in monocytes causing isopentenyl pyrophosphate to accumulate that then stimulates Vγ2Vδ2 cells. Because zoledronate inhibition of FDPS is also toxic for T cells, we hypothesized that a short period of exposure would reduce T cell toxicity but still be sufficient for monocytes uptake. Additionally, IL-15 increases the anti-tumor activity of murine αβ T cells in mice but its effect on the in vivo anti-tumor activity of human Vγ2Vδ2 cells has not been assessed. Human Vγ2Vδ2 T cells were expanded by pulse or continuous zoledronate stimulation with IL-2 or IL-15. Expanded Vγ2Vδ2 cells were tested for their expression of effector molecules and killing of tumor cells as well as their in vivo control of human prostate cancer tumors in immunodeficient NSG mice. Pulse zoledronate stimulation with either IL-2 or IL-15 resulted in more uniform expansion of Vγ2Vδ2 cells with higher purity and cell numbers as compared with continuous exposure. The Vγ2Vδ2 cells had higher levels of CD107a and perforin and increased tumor cytotoxicity. Adoptive immunotherapy with Vγ2Vδ2 cells derived by pulse stimulation controlled human PC-3 prostate cancer tumors in NSG mice significantly better than those derived by continuous stimulation, halting tumor growth. Although pulse zoledronate stimulation with IL-15 preserved early memory subsets, adoptive immunotherapy with IL-15-derived Vγ2Vδ2 cells equally inhibited PC-3 tumor growth as those derived with IL-2. Pulse zoledronate stimulation maximizes the purity, quantity, and quality of expanded Vγ2Vδ2 cells for adoptive immunotherapy but there is no advantage to using IL-15 over IL-2 in our humanized mouse model. Pulse zoledronate stimulation is a simple modification to existing protocols that will enhance the effectiveness of adoptively transferred Vγ2Vδ2 cells by increasing their numbers and anti-tumor activity.
Koido, Masaru; Haga, Naomi; Furuno, Aki; Tsukahara, Satomi; Sakurai, Junko; Tani, Yuri; Sato, Shigeo; Tomida, Akihiro
2017-01-01
Mitochondria can be involved in regulating cellular stress response to hypoxia and tumor growth, but little is known about that mechanistic relationship. Here, we show that mitochondrial deficiency severely retards tumor xenograft growth with impairing hypoxic induction of HIF-1 transcriptional activity. Using mtDNA-deficient ρ0 cells, we found that HIF-1 pathway activation was comparable in slow-growing ρ0 xenografts and rapid-growing parental xenografts. Interestingly, we found that ex vivo ρ0 cells derived from ρ0 xenografts exhibited slightly increased HIF-1α expression and modest HIF-1 pathway activation regardless of oxygen concentration. Surprisingly, ρ0 cells, as well as parental cells treated with oxidative phosphorylation inhibitors, were unable to boost HIF-1 transcriptional activity during hypoxia, although HIF-1α protein levels were ordinarily increased in these cells under hypoxic conditions. These findings indicate that mitochondrial deficiency causes loss of hypoxia-induced HIF-1 transcriptional activity and thereby might lead to a constitutive HIF-1 pathway activation as a cellular adaptation mechanism in tumor microenvironment. PMID:28060746
Hepatic Stellate Cells Alter Liver Immune Environment to Promote Cancer | Center for Cancer Research
Hepatocellular carcinoma (HCC) is the most common form of liver cancer, accounting for up to 90 percent of cases, and is the second most common cause of cancer-related deaths worldwide according to the World Health Organization’s 2014 World Cancer Report. Even when caught early, HCC often recurs, either from intra-liver metastases or new primary tumors, and recurrence is the leading cause of death for patients with HCC. The liver microenvironment is an important contributor to HCC initiation and progression and also likely plays a role in tumor recurrence. Xin Wei Wang, Ph.D., of CCR’s Laboratory of Human Carcinogenesis, and his colleagues wondered whether activated hepatic stellate cells (A-HSCs), stromal cells in the liver known to participate in repair following injury and in the development of fibrosis, contribute directly to HCC recurrence.
Xu, Chen; Liu, Dongning; Chen, Zhixin; Zhuo, Fan; Sun, Huankui; Hu, Jiaping; Li, Taiyuan
2018-06-19
Colorectal cancer (CRC) is among cancers with highest incidence globally and currently ranks fourth as the leading cause of cancer-related deaths worldwide. It remains an urgent need for novel strategies in the management of patients with advanced CRC. Adoptive transfer of allogeneic natural killer (NK) cells represent an attractive option in the treatment of patients with CRC. In this study, we successfully expanded NK cells from umbilical cord blood (UCB) with membrane-bound IL-21, termed eUCB-NK cells. eUCB-NK cells efficiently lysed CRC cell lines in vitro and secreted significantly higher levels of IFN-γ, TNF-α, GM-CSF and CCL3 compared with IL-2 stimulated NK cells. Adoptive transfer of these NK cells significantly inhibited the growth of HT29 xenografts, whereas LoVo tumors were not effectively controlled with eUCB-NK cells. More NK cells inside HT29 tumors, not seen in LoVo tumors, might contribute to the differences in response to eUCB-NK cells. Combination of bevacizumab can increase extravasation of adoptively transferred NK cells into the LoVo tumors and improve the therapeutic activity of eUCB-NK cells. These results justified clinical translation of this UCB-derived NK cell-based therapeutics, either used alone or combined with bevacizumab, as a novel treatment option for patients with CRC.
Michel, Anastasija; Schüler, Andrea; Friedrich, Pamela; Döner, Fatma; Bopp, Tobias; Radsak, Markus; Hoffmann, Markus; Relle, Manfred; Distler, Ute; Kuharev, Jörg; Tenzer, Stefan; Feyerabend, Thorsten B; Rodewald, Hans-Reimer; Schild, Hansjörg; Schmitt, Edgar; Becker, Marc; Stassen, Michael
2013-06-01
Mast cell-deficient Kit(W-sh) "sash" mice are widely used to investigate mast cell functions. However, mutations of c-Kit also affect additional cells of hematopoietic and nonimmune origin. In this study, we demonstrate that Kit(W-sh) causes aberrant extramedullary myelopoiesis characterized by the expansion of immature lineage-negative cells, common myeloid progenitors, and granulocyte/macrophage progenitors in the spleen. A consistent feature shared by these cell types is the reduced expression of c-Kit. Populations expressing intermediate and high levels of Ly6G, a component of the myeloid differentiation Ag Gr-1, are also highly expanded in the spleen of sash mice. These cells are able to suppress T cell responses in vitro and phenotypically and functionally resemble myeloid-derived suppressor cells (MDSC). MDSC typically accumulate in tumor-bearing hosts and are able to dampen immune responses. Consequently, transfer of MDSC from naive sash mice into line 1 alveolar cell carcinoma tumor-bearing wild-type littermates leads to enhanced tumor progression. However, although it can also be observed in sash mice, accelerated growth of transplanted line 1 alveolar cell carcinoma tumors is a mast cell-independent phenomenon. Thus, the Kit(W-sh) mutation broadly affects key steps in myelopoiesis that may have an impact on mast cell research.
Modi, Kshitij D.; Foster, Thomas H.
2013-01-01
Abstract. We demonstrate the use of an enzyme-activatable fluorogenic probe, Neutrophil Elastase 680 FAST (NE680), for in vivo imaging of neutrophil elastase (NE) activity in tumors subjected to photodynamic therapy (PDT). NE protease activity was assayed in SCC VII and EMT6 tumors established in C3H and BALB/c mice, respectively. Four nanomoles of NE680 was injected intravenously immediately following PDT irradiation. 5 h following administration of NE680, whole-mouse fluorescence imaging was performed. At this time point, levels of NE680 fluorescence were at least threefold greater in irradiated versus unirradiated SCC VII and EMT6 tumors sensitized with Photofrin. To compare possible photosensitizer-specific differences in therapy-induced elastase activity, EMT6 tumors were also subjected to 2-(1-hexyloxyethyl)-2-devinyl pyropheophorbide-a (HPPH)-PDT. NE levels measured in HPPH-PDT-treated tumors were twofold higher than in unirradiated controls. Ex vivo labeling of host cells using fluorophore-conjugated antibodies and confocal imaging were used to visualize Gr1+ cells in Photofrin-PDT-treated EMT6 tumors. These data were compared with recently reported analysis of Gr1+ cell accumulation in EMT6 tumors subjected to HPPH-PDT. The population density of infiltrating Gr1+ cells in treated versus unirradiated drug-only control tumors suggests that the differential in NE680 fold enhancement observed in Photofrin versus HPPH treatment may be attributed to the significantly increased inflammatory response induced by Photofrin-PDT. The in vivo imaging of NE680, which is a fluorescent reporter of NE extracellular release caused by neutrophil activation, demonstrates that PDT results in increased NE levels in treated tumors, and the accumulation of the cleaved probe tracks qualitatively with the intratumor Gr1+ cell population. PMID:23897439
Lee, Mui Li; Fung, Shin Yee; Chung, Ivy; Pailoor, Jayalakshmi; Cheah, Swee Hung; Tan, Nget Hong
2014-01-01
King cobra (Ophiophagus hannah) venom L-amino acid oxidase (OH-LAAO), a heat stable enzyme, has been shown to exhibit very potent anti-proliferative activity against human breast and lung tumorigenic cells but not in their non-tumorigenic counterparts. We further examine its in vitro and in vivo anti-tumor activity in a human prostate adenocarcinoma (PC-3) model. OH-LAAO demonstrated potent cytotoxicity against PC-3 cells with IC50 of 0.05 µg/mL after 72 h incubation in vitro. It induced apoptosis as evidenced with an increase in caspase-3/7 cleavages and an increase in annexin V-stained cells. To examine its in vivo anti-tumor activity, we treated PC-3 tumor xenograft implanted subcutaneously in immunodeficient NU/NU (nude) mice with 1 µg/g OH-LAAO given intraperitoneally (i.p.). After 8 weeks of treatment, OH-LAAO treated PC-3 tumors were markedly inhibited, when compared to the control group (P <0.05). TUNEL staining analysis on the tumor sections showed a significantly increase of apoptotic cells in the LAAO-treated animals. Histological examinations of the vital organs in these two groups showed no significant differences with normal tissues, indicating no obvious tissue damage. The treatment also did not cause any significant changes on the body weight of the mice during the duration of the study. These observations suggest that OH-LAAO cytotoxic effects may be specific to tumor xenografts and less to normal organs. Given its potent anti-tumor activities shown in vitro as well as in vivo, the king cobra venom LAAO can potentially be developed to treat prostate cancer and other solid tumors.
McCormick, Kevin D; Ghosh, Arundhati; Trivedi, Sumita; Wang, Lin; Coyne, Carolyn B; Ferris, Robert L; Sarkar, Saumendra N
2016-05-01
Head and neck squamous cell carcinoma (HNSCC) is a devastating disease for which new treatments, such as immunotherapy are needed. Synthetic double-stranded RNAs, which activate toll-like receptor 3 (TLR3), have been used as potent adjuvants in cancer immunotherapy by triggering a proapoptotic response in cancer cells. A better understanding of the mechanism of TLR3-mediated apoptosis and its potential involvement in controlling tumor metastasis could lead to improvements in current treatment. Using paired, autologous primary and metastatic HNSCC cells we previously showed that metastatic, but not primary tumor-derived cells, were unable to activate prosurvival NF-κB in response to p(I):p(C) resulting in an enhanced apoptotic response. Here, we show that transcriptional downregulation of receptor-interacting serine/threonine-protein kinase 1 (RIPK1) in metastatic HNSCC cells causes a loss of TLR3-mediated NF-κB signaling, resulting in enhanced apoptosis. Loss of RIPK1 strongly correlates with metastatic disease in a cohort of HNSCC patients. This downregulation of RIPK1 is possibly mediated by enhanced methylation of the RIPK1 promoter in tumor cells and enhances protumorigenic properties such as cell migration. The results described here establish a novel mechanism of TLR3-mediated apoptosis in metastatic cells and may create new opportunities for using double stranded RNA to target metastatic tumor cells. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Ng, Roland CK
2011-01-01
Acquired isolated renal phosphate wasting associated with a tumor, known as oncogenic osteomalacia or tumor-induced osteomalacia, is a rare paraneoplastic syndrome caused by overproduction of fibroblast growth factor 23. Oncogenic osteomalacia is usually associated with benign mesenchymal tumors. Syndrome of inappropriate antidiuretic hormone secretion (SIADH), on the other hand, is a common paraneoplastic syndrome caused by small cell carcinoma (SCC). Concomitant oncogenic osteomalacia and SIADH associated with SCC is very rare with only 4 other cases reported in the literature. The authors report a case of small cell lung cancer (SCLC)-related renal wasting hypophosphatemia and concurrent SIADH, and review the literature reporting 9 other cases of SCC associated with oncogenic osteomalacia. Almost half of reported cases of renal phosphate wasting associated with SCC concomitantly presented with SIADH. These cases had initial serum phosphorus level lower and survival periods shorter than those without SIADH. This rare combination of a dual paraneoplastic syndrome and low serum phosphorus may be a poor prognostic sign. In addition, both renal phosphate wasting and SIADH usually occur in a short period of time before identification of SCC. Therefore, renal wasting hypophosphatemia with concomitant SIADH/hyponatremia should prompt a search for SCC rather than a benign mesenchymal tumor. PMID:21886301
Tantisattamo, Ekamol; Ng, Roland C K
2011-07-01
Acquired isolated renal phosphate wasting associated with a tumor, known as oncogenic osteomalacia or tumor-induced osteomalacia, is a rare paraneoplastic syndrome caused by overproduction of fibroblast growth factor 23. Oncogenic osteomalacia is usually associated with benign mesenchymal tumors. Syndrome of inappropriate antidiuretic hormone secretion (SIADH), on the other hand, is a common paraneoplastic syndrome caused by small cell carcinoma (SCC). Concomitant oncogenic osteomalacia and SIADH associated with SCC is very rare with only 4 other cases reported in the literature. The authors report a case of small cell lung cancer (SCLC)-related renal wasting hypophosphatemia and concurrent SIADH, and review the literature reporting 9 other cases of SCC associated with oncogenic osteomalacia. Almost half of reported cases of renal phosphate wasting associated with SCC concomitantly presented with SIADH. These cases had initial serum phosphorus level lower and survival periods shorter than those without SIADH. This rare combination of a dual paraneoplastic syndrome and low serum phosphorus may be a poor prognostic sign. In addition, both renal phosphate wasting and SIADH usually occur in a short period of time before identification of SCC. Therefore, renal wasting hypophosphatemia with concomitant SIADH/hyponatremia should prompt a search for SCC rather than a benign mesenchymal tumor.
John, Sebastian; Sivakumar, K. C.; Mishra, Rashmi
2017-01-01
Glioblastoma multiforme (GBM) is a highly aggressive type of brain tumor with an extremely poor prognosis. Recent evidences have shown that the “biomechanical imbalances” induced in GBM patient-derived glioblastoma cells (GC) and in vivo via the administration of synthetic small molecules, may effectively inhibit disease progression and prolong survival of GBM animal models. This novel concept associated with de novo anti-GBM drug development has however suffered obstacles in adequate clinical utility due to the appearance of unrelated toxicity in the prolonged therapeutic windows. Here, we took a “drug repurposing approach” to trigger similar physico-chemical disturbances in the GBM tumor cells, wherein, the candidate therapeutic agent has been previously well established for its neuro-protective roles, safety, efficacy, prolonged tolerance and excellent brain bioavailability in human subjects and mouse models. In this study, we show that the extracts of an Indian traditional medicinal plant Bacopa monnieri (BM) and its bioactive component Bacoside A can generate dosage associated tumor specific disturbances in the hydrostatic pressure balance of the cell via a mechanism involving excessive phosphorylation of calcium/calmodulin-dependent protein kinase IIA (CaMKIIA/CaMK2A) enzyme that is further involved in the release of calcium from the smooth endoplasmic reticular networks. High intracellular calcium stimulated massive macropinocytotic extracellular fluid intake causing cell hypertrophy in the initial stages, excessive macropinosome enlargement and fluid accumulation associated organellar congestion, cell swelling, cell rounding and membrane rupture of glioblastoma cells; with all these events culminating into a non-apoptotic, physical non-homeostasis associated glioblastoma tumor cell death. These results identify glioblastoma tumor cells to be a specific target of the tested herbal medicine and therefore can be exploited as a safe anti-GBM therapeutic. PMID:28663722
John, Sebastian; Sivakumar, K C; Mishra, Rashmi
2017-01-01
Glioblastoma multiforme (GBM) is a highly aggressive type of brain tumor with an extremely poor prognosis. Recent evidences have shown that the "biomechanical imbalances" induced in GBM patient-derived glioblastoma cells (GC) and in vivo via the administration of synthetic small molecules, may effectively inhibit disease progression and prolong survival of GBM animal models. This novel concept associated with de novo anti-GBM drug development has however suffered obstacles in adequate clinical utility due to the appearance of unrelated toxicity in the prolonged therapeutic windows. Here, we took a "drug repurposing approach" to trigger similar physico-chemical disturbances in the GBM tumor cells, wherein, the candidate therapeutic agent has been previously well established for its neuro-protective roles, safety, efficacy, prolonged tolerance and excellent brain bioavailability in human subjects and mouse models. In this study, we show that the extracts of an Indian traditional medicinal plant Bacopa monnieri (BM) and its bioactive component Bacoside A can generate dosage associated tumor specific disturbances in the hydrostatic pressure balance of the cell via a mechanism involving excessive phosphorylation of calcium/calmodulin-dependent protein kinase IIA (CaMKIIA/CaMK2A) enzyme that is further involved in the release of calcium from the smooth endoplasmic reticular networks. High intracellular calcium stimulated massive macropinocytotic extracellular fluid intake causing cell hypertrophy in the initial stages, excessive macropinosome enlargement and fluid accumulation associated organellar congestion, cell swelling, cell rounding and membrane rupture of glioblastoma cells; with all these events culminating into a non-apoptotic, physical non-homeostasis associated glioblastoma tumor cell death. These results identify glioblastoma tumor cells to be a specific target of the tested herbal medicine and therefore can be exploited as a safe anti-GBM therapeutic.
Chimento, Adele; Sirianni, Rosa; Zolea, Fabiana; De Luca, Arianna; Lanzino, Marilena; Catalano, Stefania; Andò, Sebastiano; Pezzi, Vincenzo
2012-05-01
Several substances such as anabolic androgenic steroids (AAS), peptide hormones like insulin-like growth factor-I (IGF-I), aromatase inhibitors and estrogen antagonists are offered via the Internet, and are assumed without considering the potential deleterious effects that can be caused by their administration. In this study we aimed to determine if nandrolone and stanozolol, two commonly used AAS, could have an effect on Leydig cell tumor proliferation and if their effects could be potentiated by the concomitant use of IGF-I. Using a rat Leydig tumor cell line, R2C cells, as experimental model we found that nandrolone and stanozolol caused a dose-dependent induction of aromatase expression and estradiol (E2) production. When used in combination with IGF-I they were more effective than single molecules in inducing aromatase expression. AAS exhibited estrogenic activity and induced rapid estrogen receptor (ER)-dependent pathways involving IGF1R, AKT, and ERK1/2 phosphorylation. Inhibitors for these kinases decreased AAS-dependent aromatase expression. Up-regulated aromatase levels and related E2 production increased cell proliferation as a consequence of increased cyclin E expression. The observation that ER antagonist ICI182,780 was also able to significantly reduce ASS- and AAS + IGF-induced cell proliferation, confirmed a role for estrogens in AAS-dependent proliferative effects. Taken together these data clearly indicate that the use of high doses of AAS, as it occurs in doping practice, enhances Leydig cell proliferation, increasing the risk of tumor development. This risk is higher when AAS are used in association with IGF-I. To our knowledge this is the first report directly associating AAS and testicular cancer. Copyright © 2011 Wiley Periodicals, Inc.
CD117/c-kit in Cancer Stem Cell-Mediated Progression and Therapeutic Resistance
Young, Tyler R.; Mobley, Mary E.
2018-01-01
Metastasis is the primary cause of cancer patient morbidity and mortality, but due to persisting gaps in our knowledge, it remains untreatable. Metastases often occur as patient tumors progress or recur after initial therapy. Tumor recurrence at the primary site may be driven by a cancer stem-like cell or tumor progenitor cell, while recurrence at a secondary site is driven by metastatic cancer stem cells or metastasis-initiating cells. Ongoing efforts are aimed at identifying and characterizing these stem-like cells driving recurrence and metastasis. One potential marker for the cancer stem-like cell subpopulation is CD117/c-kit, a tyrosine kinase receptor associated with cancer progression and normal stem cell maintenance. Further, activation of CD117 by its ligand stem cell factor (SCF; kit ligand) in the progenitor cell niche stimulates several signaling pathways driving proliferation, survival, and migration. This review examines evidence that the SCF/CD117 signaling axis may contribute to the control of cancer progression through the regulation of stemness and resistance to tyrosine kinase inhibitors. PMID:29518044
Smad4 deletion in blood vessel endothelial cells promotes ovarian cancer metastasis.
Yang, Jie; Wang, Ya; Zeng, Zhen; Qiao, Long; Zhuang, Liang; Gao, Qinglei; Ma, Ding; Huang, Xiaoyuan
2017-05-01
SMAD4 is a critical co-smad in signal transduction pathways activated in response to transforming growth factor-β (TGF-β)-related ligands, regulating cell growth and differentiation. The roles played by SMAD4 inactivation in tumors highlighted it as a tumor-suppressor gene. Herein, we report that loss of SMAD4 expression in vascular endothelial cells promotes ovarian cancer invasion. SiRNA transfer of this gene in the HUVEC reduced SMAD4 protein expression and function. Although it reduced the vessel endothelial cell tubule formation in vitro and in vivo, it did not affect the tumor growth significantly in vivo. However, it weakened the barrier integrity in endothelial cells and increased vessel permeability and the ovarian cancer liver metastasis. We documented reduced angiogenesis and increased invasion histologically and by intravital microscopy, and gained mechanistic insight at the messenger and gene level. Finally, we found a negative reciprocal regulation between SMAD4 and FYN. FYN is one of the Src family kinases (SFK), activation of which can cause dissociation of cell-cell junctions and adhesion, resulting in paracellular hypermeability. Upon SMAD4 deletion, we detected high expression levels of FYN in vessel endothelial cells, suggesting the mechanism of the ovarian tumor cells cross the endothelial barrier and transform to an invasive phenotype.