Sample records for cells lacking p53

  1. p53-dependent p21-mediated growth arrest pre-empts and protects HCT116 cells from PUMA-mediated apoptosis induced by EGCG

    PubMed Central

    Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L

    2010-01-01

    The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544

  2. Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.

    PubMed

    Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi

    2003-04-01

    Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.

  3. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    PubMed

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. The In Vivo DNA Binding Properties of Wild-Type and Mutant p53 Proteins in Mammary Cell Lines During the Course of Cell Cycle.

    DTIC Science & Technology

    1996-08-01

    J-4030 TITLE: The In Vivo DNA Binding Properties of Wild-Type and Mutant p53 Proteins in Mammary Cell Lines During the Course of Cell Cycle PRINCIPAL...The In Vivo DNA Binding Properties of 5. FUNDING NUMBERS Wild-Type and Mutant p53 Proteins in Mammary Cell Lines DAMD17-94-J-4030 During the Course of...ABSTRACT (Maximum 200 Using a pair of murine cell lines, one lacking p53 and a derivative cell line containing temperature sensitive p53 val 135

  5. Loss of p53 induces cell proliferation via Ras-independent activation of the Raf/Mek/Erk signaling pathway

    PubMed Central

    Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano

    2014-01-01

    The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756

  6. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    PubMed Central

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  7. The Tumor Suppressor Protein p53 and its Physiological Splicing Variant p53as in a Mouse Mammary Cancer Model

    DTIC Science & Technology

    1997-10-01

    and Biomedical Laboratories. PI - Signature Date TABLE OF CONTENTS Report Documentation Page ii Foreword m Introduction 1-2 Experimental Methods...life studies of P53 or p53as in G1, S, and G2/ M was unsuccessful as reported last year. Long cell cycle times may be responsible for lack of separation...of S-phase 5 cells from G2/ M -phase cells by centrifugal elutriation. Attempts to synchronize cells by density arrest and/or serum starvation resulted

  8. p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex.

    PubMed

    Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine

    2009-04-01

    Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.

  9. Alterations of mitochondrial biogenesis in chronic lymphocytic leukemia cells with loss of p53

    PubMed Central

    Ogasawara, Marcia A.; Liu, Jinyun; Pelicano, Helene; Hammoudi, Naima; Croce, Carlo M.; Keating, Michael J.; Huang, Peng

    2016-01-01

    Deletion of chromosome 17p with a loss of p53 is an unfavorable cytogenetic change in chronic lymphocytic leukemia (CLL) with poor clinical outcome. Since p53 affects mitochondrial function and integrity, we examined possible mitochondrial changes in CLL mice with TCL1-Tg/p53−/− and TCL1-Tg/p53+/+ genotypes and in primary leukemia cells from CLL patients with or without 17p-deletion. Although the expression of mitochondrial COX1, ND2, and ND6 decreased in p53−/−CLL cells, there was an increase in mitochondrial biogenesis as evidenced by higher mitochondrial mass and mtDNA copy number associated with an elevated expression of TFAM and PGC-1α. Surprisingly, the overall mitochondrial respiratory activity and maximum reserved capacity increased in p53−/− CLL cells. Our study suggests that leukemia cells lacking p53 seem able to maintain respiratory function by compensatory increase in mitochondrial biogenesis. PMID:27650502

  10. Induction of Mitotic Cell Death by Overriding G2/M Checkpoint in Endometrial Cancer Cells with Non-functional p53

    PubMed Central

    Meng, Xiangbing; Laidler, Laura L.; Kosmacek, Elizabeth A.; Yang, Shujie; Xiong, Zhi; Zhu, Danlin; Wang, Xinjun; Dai, Donghai; Zhang, Yuping; Wang, Xiaofang; Brachova, Pavla; Albitar, Lina; Liu, Dawei; Ianzini, Fiorenza; Mackey, Michael A.; Leslie, Kimberly K.

    2012-01-01

    Objective Endometrial tumors with non-functional p53, such as serous uterine endometrial carcinomas, are aggressive malignancies with a poor outcome, yet they have an Achilles’ heel: due to loss of p53 function, these tumors may be sensitive to treatments which abrogate the G2/M checkpoint. Our objective was to exploit this weakness to induce mitotic cell death using two strategies: (1) EGFR inhibitor gefitinib combined with paclitaxel to arrest cells at mitosis, or (2) BI2536, an inhibitor of polo-like kinase 1 (PLK1), to block PLK1 activity. Methods We examined the impact of combining gefitinib and paclitaxel or PLK1 inhibitor on expression of G2/M checkpoint controllers, cell viability, and cell cycle progression in endometrial cancer cells with mutant p53. Results In cells lacking normal p53 activity, each treatment activated CDC25C and inactivated Wee1, which in turn activated cdc2 and sent cells rapidly through the G2/M checkpoint and into mitosis. Live cell imaging demonstrated irreversible mitotic arrest and eventual cell death. Combinatorial therapy with paclitaxel and gefitinib was highly synergistic and resulted in a 10-fold reduction in the IC50 for paclitaxel, from 14 nM as a single agent to 1.3 nM in the presence of gefitinib. However, BI2536 alone at low concentrations (5 nM) was the most effective treatment and resulted in massive mitotic cell death. In a xenograft mouse model with p53-deficient cells, low dose BI2536 significantly inhibited tumor growth. Conclusions These findings reveal induction of mitotic cell death as a therapeutic strategy for endometrial tumors lacking functional p53. PMID:23146687

  11. Acentriolar mitosis activates a p53-dependent apoptosis pathway in the mouse embryo

    PubMed Central

    Bazzi, Hisham; Anderson, Kathryn V.

    2014-01-01

    Centrosomes are the microtubule-organizing centers of animal cells that organize interphase microtubules and mitotic spindles. Centrioles are the microtubule-based structures that organize centrosomes, and a defined set of proteins, including spindle assembly defective-4 (SAS4) (CPAP/CENPJ), is required for centriole biogenesis. The biological functions of centrioles and centrosomes vary among animals, and the functions of mammalian centrosomes have not been genetically defined. Here we use a null mutation in mouse Sas4 to define the cellular and developmental functions of mammalian centrioles in vivo. Sas4-null embryos lack centrosomes but survive until midgestation. As expected, Sas4−/− mutants lack primary cilia and therefore cannot respond to Hedgehog signals, but other developmental signaling pathways are normal in the mutants. Unlike mutants that lack cilia, Sas4−/− embryos show widespread apoptosis associated with global elevated expression of p53. Cell death is rescued in Sas4−/− p53−/− double-mutant embryos, demonstrating that mammalian centrioles prevent activation of a p53-dependent apoptotic pathway. Expression of p53 is not activated by abnormalities in bipolar spindle organization, chromosome segregation, cell-cycle profile, or DNA damage response, which are normal in Sas4−/− mutants. Instead, live imaging shows that the duration of prometaphase is prolonged in the mutants while two acentriolar spindle poles are assembled. Independent experiments show that prolonging spindle assembly is sufficient to trigger p53-dependent apoptosis. We conclude that a short delay in the prometaphase caused by the absence of centrioles activates a previously undescribed p53-dependent cell death pathway in the rapidly dividing cells of the mouse embryo. PMID:24706806

  12. Human Cytomegalovirus nuclear egress and secondary envelopment are negatively affected in the absence of cellular p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila

    2016-10-15

    Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, withmore » a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.« less

  13. The absence of p53 during Human Cytomegalovirus infection leads to decreased UL53 expression, disrupting UL50 localization to the inner nuclear membrane, and thereby inhibiting capsid nuclear egress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuan, Man I; O’Dowd, John M.; Fortunato, Elizabeth

    Our electron microscopy study (Kuan et al., 2016) found HCMV nuclear capsid egress was significantly reduced in p53 knockout cells (p53KOs), correlating with inhibited formation of infoldings of the inner nuclear membrane (IINMs). Molecular examination of these phenomena has found p53KOs expressed UL97 and phosphorylated lamins, however the lamina failed to remodel. The nuclear egress complex (NEC) protein UL50 was expressed in almost all cells. UL50 re-localized to the inner nuclear membrane (INM) in ~90% of wt cells, but only ~35% of p53KOs. UL53 expression was significantly reduced in p53KOs, and cells lacking UL50 nuclear staining, expressed no UL53. Re-introductionmore » of p53 into p53KOs largely recovered UL53 positivity and UL50 nuclear re-localization. Nuclear rim located UL50/53 puncta, which co-localized with the major capsid protein, were largely absent in p53KOs. We believe these puncta were IINMs. In the absence of p53, UL53 expression was inhibited, disrupting formation of the NEC/IINMs, and reducing functional virion secretion. -- Highlights: •Phosphorylated nuclear lamins were inefficiently remodeled in p53KO cells. •p53KO cells expressed UL50, but it was not efficiently targeted to the nuclear rim. •UL53 was not expressed in the large majority of p53KO cells. •Cells failing to express UL53 did not localize UL50 to the nucleus. •NEC puncta/infoldings of the inner nuclear membrane were scarce in p53KO cells.« less

  14. p73 Protein Expression Correlates With Radiation-Induced Apoptosis in the Lack of p53 Response to Radiation Therapy for Cervical Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wakatsuki, Masaru; Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba; Ohno, Tatsuya

    2008-03-15

    Purpose: p73 belongs to the p53 tumor suppressor family of genes and can inhibit cell growth in a p53-like manner by inducing apoptosis or cell cycle arrest. Here, we investigated whether p73 could compensate for impaired p53 function in apoptosis induced by radiation therapy (RT) for cervical cancer. Methods and Materials: Sixty-eight patients with squamous cell carcinoma of the cervix who received definitive RT combined with (n = 37) or without (n = 31) cisplatin were investigated. Biopsy specimens were excised from the cervical tumor before RT and after 9 Gy. Results: Mean apoptosis index (AI) was 0.93% before RTmore » and 1.97% after 9 Gy with a significant increase (p < 0.001). For all patients, there was a significant correlation between p73 expression positivity after 9 Gy and AI ratio (AI after 9 Gy/AI before RT) (p = 0.021). Forty-one patients were regarded as the p53-responding group according to the expression of p53 after 9 Gy, whereas the remaining 27 patients were regarded as the p53-nonresponding group. A significant correlation between p73 expression after 9 Gy and AI ratio was observed in the p53-non-responding group (p < 0.001) but not in the p53-responding group (p = 0.940). Conclusion: Our results suggest that p73 plays an important role in compensating for the lack of p53 function in radiation-induced apoptosis of cervical cancer.« less

  15. Integrative Analysis Reveals an Outcome-associated and Targetable Pattern of p53 and Cell Cycle Deregulation in Diffuse Large B-cell Lymphoma

    PubMed Central

    Monti, Stefano; Chapuy, Bjoern; Takeyama, Kunihiko; Rodig, Scott J; Hao, Yangsheng; Yeda, Kelly T.; Inguilizian, Haig; Mermel, Craig; Curie, Treeve; Dogan, Ahmed; Kutok, Jeffery L; Beroukim, Rameen; Neuberg, Donna; Habermann, Thomas; Getz, Gad; Kung, Andrew L; Golub, Todd R; Shipp, Margaret A

    2013-01-01

    Summary Diffuse large B-cell lymphoma (DLBCL) is a clinically and biologically heterogeneous disease with a high proliferation rate. By integrating copy number data with transcriptional profiles and performing pathway analysis in primary DLBCLs, we identified a comprehensive set of copy number alterations (CNAs) that decreased p53 activity and perturbed cell cycle regulation. Primary tumors either had multiple complementary alterations of p53 and cell cycle components or largely lacked these lesions. DLBCLs with p53 and cell cycle pathway CNAs had decreased abundance of p53 target transcripts and increased expression of E2F target genes and the Ki67 proliferation marker. CNAs of the CDKN2A-TP53-RB-E2F axis provide a structural basis for increased proliferation in DLBCL, predict outcome with current therapy and suggest targeted treatment approaches. PMID:22975378

  16. p53 downregulates the Fanconi anaemia DNA repair pathway

    PubMed Central

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-01-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

  17. p53 downregulates the Fanconi anaemia DNA repair pathway.

    PubMed

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-04-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

  18. p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

    PubMed

    Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

    1996-09-01

    Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

  19. Hsp90 inhibitors sensitise human colon cancer cells to topoisomerase I poisons by depletion of key anti-apoptotic and cell cycle checkpoint proteins.

    PubMed

    McNamara, Anne V; Barclay, Monica; Watson, Alastair J M; Jenkins, John R

    2012-02-01

    Hsp90 and topoisomerase I are both targets for chemotherapeutic agents. Topoisomerase I poisons are standard clinical treatments, whilst Hsp90 inhibitors are progressing through clinical trials. We have demonstrated that when an Hsp90 inhibitor and topoisomerase I poison are combined they produce a synergistic increase in apoptosis in both p53⁺/⁺ and p53⁻/⁻ HCT116 human colon cancer cells. Lack of p53 is associated with an increase in sensitivity to the combination treatment; p53⁺/⁺ cells treated with the topoisomerase I poison topotecan (TPT) arrest at G2, whereas in p53⁻/⁻ cells the additional presence of the Hsp90 inhibitor geldanamycin (GA) selectively abrogates the G2M checkpoint. More importantly we report that there is a common underlying p53-independent mechanism behind the observed synergistic combined drug effect. We show that concurrent treatment with GA and TPT is able to reverse TPT induced up-regulation of the anti-apoptotic protein Bcl2 in both p53⁺/⁺ and p53⁻/⁻ HCT116 cells. The data suggests that inhibition of Hsp90 mediates down-regulation of Bcl2 following the combination treatment and cause a synergistic increase in apoptosis in both p53⁺/⁺ and p53⁻/⁻ HCT116 cells; p53⁻/⁻ HCT116 cells are more sensitive to the treatment because they also fail to arrest at G2 in the cell cycle. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Increased sensitivity of p53-deficient cells to anticancer agents due to loss of Pms2

    PubMed Central

    Fedier, A; Ruefenacht, U B; Schwarz, V A; Haller, U; Fink, D

    2002-01-01

    A large fraction of human tumours carries mutations in the p53 gene. p53 plays a central role in controlling cell cycle checkpoint regulation, DNA repair, transcription, and apoptosis upon genotoxic stress. Lack of p53 function impairs these cellular processes, and this may be the basis of resistance to chemotherapeutic regimens. By virtue of the involvement of DNA mismatch repair in modulating cytotoxic pathways in response to DNA damaging agents, we investigated the effects of loss of Pms2 on the sensitivity to a panel of widely used anticancer agents in E1A/Ha-Ras-transformed p53-null mouse fibroblasts either proficient or deficient in Pms2. We report that lack of the Pms2 gene is associated with an increased sensitivity, ranging from 2–6-fold, to some types of anticancer agents including the topoisomerase II poisons doxorubicin, etoposide and mitoxantrone, the platinum compounds cisplatin and oxaliplatin, the taxanes docetaxel and paclitaxel, and the antimetabolite gemcitabine. In contrast, no change in sensitivity was found after treatment with 5-fluorouracil. Cell cycle analysis revealed that both, Pms2-deficient and -proficient cells, retain the ability to arrest at the G2/M upon cisplatin treatment. The data indicate that the concomitant loss of Pms2 function chemosensitises p53-deficient cells to some types of anticancer agents, that Pms2 positively modulates cell survival by mechanisms independent of p53, and that increased cytotoxicity is paralleled by increased apoptosis. Tumour-targeted functional inhibition of Pms2 may be a valuable strategy for increasing the efficacy of anticancer agents in the treatment of p53-mutant cancers. British Journal of Cancer (2002) 87, 1027–1033. doi:10.1038/sj.bjc.6600599 www.bjcancer.com © 2002 Cancer Research UK PMID:12434296

  1. p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

    PubMed

    Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

    2015-03-01

    The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

  2. Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

    PubMed

    Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

    2015-07-16

    p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

  3. Accumulation of p53 in infectious mononucleosis tissues.

    PubMed

    Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L

    2000-11-01

    Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company

  4. P53 oncosuppressor influences selection of genomic imbalances in response to ionizing radiations in human osteosarcoma cell line SAOS-2.

    PubMed

    Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra

    2008-07-01

    To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.

  5. Control of G1 arrest after DNA damage.

    PubMed Central

    Kastan, M B; Kuerbitz, S J

    1993-01-01

    The temporal relationship between DNA damage and DNA replication may be critical in determining whether the genetic changes necessary for cellular transformation occur after DNA damage. Recent characterization of the mechanisms responsible for alterations in cell-cycle progression after DNA damage in our laboratory have implicated the p53 (tumor suppressor) protein in the G1 arrest that occurs after certain types of DNA damage. In particular, we found that levels of p53 protein increased rapidly and transiently after nonlethal doses of gamma irradiation (XRT) in hematopoietic cells with wild-type, but not mutant, p53 genes. These changes in p53 protein levels were temporally linked to a transient G1 arrest in these cells. Hematopoietic cells with mutant or absent p53 genes did not exhibit this G1 arrest, through they continued to demonstrate a G2 arrest. We recently extended these observations of a tight correlation between the status of the endogenous p53 genes and this G1 arrest after XRT and this cell-cycle alteration after XRT was then established by transfecting cells lacking endogenous p53 genes with a wild-type gene and observing acquisition of the G1 arrest and by transfecting cells processing endogenous wild-type p53 genes with a mutant p53 gene and observing loss of the G1 arrest after XRT. These observations and their significance for our understanding of the mechanisms of DNA damage-induced cellular transformation are discussed. PMID:8013425

  6. Immortal, telomerase-negative cell lines derived from a Li-Fraumeni syndrome patient exhibit telomere length variability and chromosomal and minisatellite instabilities.

    PubMed

    Tsutsui, Takeki; Kumakura, Shin-Ichi; Tamura, Yukiko; Tsutsui, Takeo W; Sekiguchi, Mizuki; Higuchi, Tokihiro; Barrett, J Carl

    2003-05-01

    Five immortal cell lines derived from a Li-Fraumeni syndrome patient (MDAH 087) with a germline mutant p53 allele were characterized with respect to telomere length and genomic instability. The remaining wild-type p53 allele is lost in the cell lines. Telomerase activity was undetectable in all immortal cell lines. Five subclones of each cell line and five re-subclones of each of the subclones also showed undetectable telomerase activity. All five immortal cell lines exhibited variability in the mean length of terminal restriction fragments (TRFs). Subclones of each cell line, and re-subclones of the subclones also showed TRF variability, indicating that the variability is owing to clonal heterogeneity. Chromosome aberrations were observed at high frequencies in these cell lines including the subclones and re-subclones, and the principal types of aberrations were breaks, double minute chromosomes and dicentric chromosomes. In addition, minisatellite instability detected by DNA fingerprints was observed in the immortal cell lines. However, all of the cell lines were negative for microsatellite instability. As minisatellite sequences are considered recombinogenic in mammalian cells, these results suggest that recombination rates can be increased in these cell lines. Tumor-derived human cell lines, HT1080 cells and HeLa cells that also lack p53 function, exhibited little genomic instability involving chromosomal and minisatellite instabilities, indicating that chromosomal and minisatellite instabilities observed in the immortal cell lines lacking telomerase activity could not result from loss of p53 function.

  7. Integrated High Throughput Analysis Identifies GSK3 as a Crucial Determinant of p53-Mediated Apoptosis in Lung Cancer Cells.

    PubMed

    Zhang, Yu; Zhu, Chenyang; Sun, Bangyao; Lv, Jiawei; Liu, Zhonghua; Liu, Shengwang; Li, Hai

    2017-01-01

    p53 dysfunction is frequently observed in lung cancer. Although restoring the tumour suppressor function of p53 is recently approved as a putative strategy for combating cancers, the lack of understanding of the molecular mechanism underlying p53-mediated lung cancer suppression has limited the application of p53-based therapies in lung cancer. Using RNA sequencing, we determined the transcriptional profile of human non-small cell lung carcinoma A549 cells after treatment with two p53-activating chemical compounds, nutlin and RITA, which could induce A549 cell cycle arrest and apoptosis, respectively. Bioinformatics analysis of genome-wide gene expression data showed that distinct transcription profiles were induced by nutlin and RITA and 66 pathways were differentially regulated by these two compounds. However, only two of these pathways, 'Adherens junction' and 'Axon guidance', were found to be synthetic lethal with p53 re-activation, as determined via integrated analysis of genome-wide gene expression profile and short hairpin RNA (shRNA) screening. Further functional protein association analysis of significantly regulated genes associated with these two synthetic lethal pathways indicated that GSK3 played a key role in p53-mediated A549 cell apoptosis, and then gene function study was performed, which revealed that GSK3 inhibition promoted p53-mediated A549 cell apoptosis in a p53 post-translational activity-dependent manner. Our findings provide us with new insights regarding the mechanism by which p53 mediates A549 apoptosis and may cast light on the development of more efficient p53-based strategies for treating lung cancer. © 201 The Author(s). Published by S. Karger AG, Basel.

  8. E3 ubiquitin ligase Pirh2 enhances tumorigenic properties of human non-small cell lung carcinoma cells

    PubMed Central

    Fedorova, Olga; Shuvalov, Oleg; Merkulov, Valeriy; Vasileva, Elena; Antonov, Alexey; Barlev, Nikolai A.

    2016-01-01

    The product of RCHY1 human gene, Pirh2, is a RING-finger containing E3 ligase that modifies p53 with ubiquitin residues resulting in its subsequent degradation in proteasomes. Transcription of RCHY1 is regulated by p53 itself thus forming a negative regulatory feedback loop. Functionally, by eliminating p53, Pirh2 facilitates tumorigenesis. However, the role of Pirh2 in cancer cells lacking p53 is yet not well understood. Therefore, we decided to elucidate the role of Pirh2 in p53-negative human non-small cell lung carcinoma cells, H1299. We found that ectopic expression of Pirh2 enhanced cell proliferation, resistance to doxorubicin, and increased migration potential. Ablation of Pirh2 by specific shRNA reversed these phenotypes. Mechanistically, Pirh2 increased mRNA and protein levels of the c-Myc oncogene. The bioinformatics data indicate that co-expression of both c-Myc and Pirh2 strongly correlated with poor survival of lung cancer patients. Collectively, our results suggest that Pirh2 can be considered as a potential pharmacological target for developing anticancer therapies to treat p53-negative cancers. PMID:28191284

  9. Lack of dependence on p53 for DNA double strand break repair of episomal vectors in human lymphoblasts

    NASA Technical Reports Server (NTRS)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.

  10. p53 protects against genome instability following centriole duplication failure

    PubMed Central

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  11. Chk1/2 inhibition overcomes the cisplatin resistance of head and neck cancer cells secondary to the loss of functional p53

    PubMed Central

    Gadhikar, Mayur A.; Sciuto, Maria Rita; Alves, Marcus Vinicius Ortega; Pickering, Curtis R.; Osman, Abdullah A.; Neskey, David M.; Zhao, Mei; Fitzgerald, Alison L.; Myers, Jeffrey N.; Frederick, Mitchell J

    2014-01-01

    Despite the use of multimodality therapy employing cisplatin to treat patients with advanced stage head and neck squamous cell carcinoma (HNSCC), there is an unacceptably high rate of treatment failure. TP53 is the most commonly mutated gene in HNSCC, and the impact of p53 mutation on response to cisplatin treatment is poorly understood. Here we show unambiguously that wild type TP53 (wtp53) is associated with sensitivity of HNSCC cells to cisplatin treatment while mutation or loss of TP53 is associated with cisplatin resistance. We also demonstrate that senescence is the major cellular response to cisplatin in wtp53 HNSCC cells and that cisplatin resistance in p53 null or mutant TP53 cells is due to their lack of senescence. Given the dependence on Chk1/2 kinases to mediate the DNA damage response in p53 deficient cells, there is potential to exploit this to therapeutic advantage through targeted inhibition of the Chk1/2 kinases. Treatment of p53 deficient HNSCC cells with the Chk inhibitor AZD7762 sensitizes them to cisplatin through induction of mitotic cell death. This is the first report demonstrating the ability of a Chk kinase inhibitor to sensitize TP53-deficient HNSCC to cisplatin in a synthetic lethal manner, which has significance given the frequency of TP53 mutations in this disease and because cisplatin has become part of standard therapy for aggressive HNSCC tumors. These pre-clinical data provide evidence that a personalized approach to the treatment of HNSCC based on Chk inhibition in p53 mutant tumors may be feasible. PMID:23839309

  12. Mitomycin C and decarbamoyl mitomycin C induce p53-independent p21WAF1/CIP1 activation

    PubMed Central

    Cheng, Shu-Yuan; Seo, Jiwon; Huang, Bik Tzu; Napolitano, Tanya; Champeil, Elise

    2016-01-01

    Mitomycin C (MC), a commonly used anticancer drug, induces DNA damage via DNA alkylation. Decarbamoyl mitomycin C (DMC), another mitomycin lacking the carbamate at C10, generates similar lesions as MC. Interstrand cross-links (ICLs) are believed to be the lesions primarily responsible for the cytotoxicity of MC and DMC. The major ICL generated by MC (α-ICL) has a trans stereochemistry at the guanine-drug linkage whereas the major ICL from DMC (β-ICL) has the opposite, cis, stereochemistry. In addition, DMC can provoke strong p53-independent cell death. Our hypothesis is that the stereochemistry of the major unique β-ICL generated by DMC is responsible for this p53-independent cell death signaling. p53 gene is inactively mutated in more than half of human cancers. p21WAF1/CIP1 known as a major effector of p53 is involved in p53-dependent and -independent control of cell proliferation and death. This study revealed the role of p21WAF1/CIP1 on MC and DMC triggered cell damage. MCF-7 (p53-proficient) and K562 (p53-deficient) cells were used. Cell cycle distributions were shifted to the G1/S phase in MCF-7 treated with MC and DMC, but were shifted to the S phase in K562. p21WAF1/CIP1 activation was observed in both cells treated with MC and DMC, and DMC triggered more significant activation. Knocking down p53 in MCF-7 did not attenuate MC and DMC induced p21WAF1/CIP1 activation. The α-ICL itself was enough to cause p21WAF1/CIP1 activation. PMID:27666201

  13. Relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation in chronic lymphocytic leukemia.

    PubMed

    Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R

    2002-08-15

    Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.

  14. The anticancer effect of saffron in two p53 isogenic colorectal cancer cell lines

    PubMed Central

    2012-01-01

    Background Saffron extract, a natural product, has been shown to induce apoptosis in several tumor cell lines. Nevertheless, the p53-dependency of saffron’s mechanism of action in colon cancer remains unexplored. Material and methods In order to examine saffron’s anti-proliferative and pro-apoptotic effects in colorectal cancer cells, we treated two p53 isogenic HCT116 cell lines (HCT wildtype and HCT p53−/−) with different doses of the drug and analyzed cell proliferation and apoptosis in a time-dependent manner. MTT viability and crystal violet assays were performed in order to determine the effective dose of saffron on both cell lines. The cell cycle progress was examined by Flow cytometric analysis. Apoptosis was assessed using Annexin-PI-staining and Western Blotting for caspase 3 and PARP cleavage. Autophagy was determined by Western Blotting of the light chain 3 (LC3)-II and Beclin 1 proteins. The protein content of phospho-H2AX (γH2AX), a sensor of DNA double strand breaks, was also analyzed by Western Blotting. Results Saffron extract induced a p53-dependent pattern of cell cycle distribution with a full G2/M stop in HCT116 p53 wildtype cells. However, it induced a remarkable delay in S/G2 phase transit with entry into mitosis in HCT116 p53 −/− cells. The apoptotic Pre-G1 cell fraction as well as Annexin V staining and caspase 3 cleavage showed a more pronounced apoptosis induction in HCT116 p53 wildtype cells. Obviously, the significantly higher DNA-damage, reflected by ɣH2AX protein levels in cells lacking p53, was coped by up-regulation of autophagy. The saffron-induced LC3-II protein level was a remarkable indication of the accumulation of autophagosomes, a response to the cellular stress condition of drug treatment. Conclusions This is the first study showing the effect of saffron in HCT116 colorectal cancer cells with different p53 status. Saffron induced DNA-damage and apoptosis in both cell lines. However, autophagy has delayed the induction of apoptosis in HCT116 p53 −/− cells. Considering the fact that most tumors show a functional p53 inactivation, further research is needed to elucidate the long-term effects of saffron in p53 −/− tumors. PMID:22640402

  15. A dual role of p53 in the control of autophagy.

    PubMed

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

    2008-08-01

    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  16. B-cell posttransplant lymphoproliferative disorder isolated to the central nervous system is Epstein-Barr virus positive and lacks p53 and Myc expression by immunohistochemistry.

    PubMed

    Sundin, Andrew; Grzywacz, Bartosz J; Yohe, Sophia; Linden, Michael A; Courville, Elizabeth L

    2017-03-01

    In this retrospective study from one institution, we performed a clinicopathological study of a cohort of patients with posttransplant lymphoproliferative disorder (PTLD) confined to the central nervous system. We also identified a comparison cohort of patients with de novo primary diffuse large B-cell lymphoma of the central nervous system. We performed a detailed morphologic review, evaluated Epstein-Barr virus (EBV) by in situ hybridization, and interpreted a panel of immunohistochemical stains in a subset of cases including Hans classification markers (CD10, BCL6, MUM1), p53, CD30, Myc, and BCL2. All 17 of the posttransplant and none of 11 de novo cases were EBV positive (P < .005). Morphologic patterns identified in the PTLD cases were monomorphic diffuse large B-cell lymphoma pattern (10 patients) and "T-cell-rich" pattern (7 patients). The monomorphic posttransplant cases were more likely to be Myc negative (P = .015) and CD30 positive (P < .005) than the de novo cases, and showed a similarly low rate of p53 positivity by immunohistochemistry. No prognostic factors for overall survival were identified. Central nervous system PTLD is EBV positive, typically lacks p53 and Myc expression by immunohistochemistry, and can present with numerous background T lymphocytes. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Loss of p53 protein during radiation transformation of primary human mammary epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wazer, D.E.; Chu, Qiuming; Liu, Xiao Long

    1994-04-01

    The causative factors leading to breast cancer are largely unknown. Increased incidence of breast cancer following diagnostic or therapeutic radiation suggests that radiation may contribute to mammary oncogenesis. This report describes the in vitro neoplastic transformation of a normal human mammary epithelial cell strain, 76N, by fractionated [gamma]-irradiation at a clinically used dose (30 Gy). The transformed cells (76R-30) were immortal, had reduced growth factor requirements, and produced tumors in nude mice. Remarkably, the 76R-30 cells completely lacked the p53 tumor suppressor protein. Loss of p53 was due to deletion of the gene on one allele and a 26-bp deletionmore » within the third intron on the second allele which resulted in abnormal splicing out of either the third or fourth exon from the mRNA. PCR with a mutation-specific primer showed that intron 3 mutation was present in irradiated cells before selection for immortal phenotype. 76R-30 cells did not exhibit G[sub 1] arrest in response to radiation, indicating a loss of p53-mediated function. Expression of the wild-type p53 gene in 76R-30 cells led to their growth inhibition. Thus, loss of p53 protein appears to have contributed to neoplastic transformation of these cells. This unique model should facilitate analyses of molecular mechanisms of radiation-induced breast cancer and allow identification of p53-regulated cellular genes in breast cells. 44 refs., 8 figs., 1 tab.« less

  18. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

    PubMed

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

    2016-04-12

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia.

  19. Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Finlay, C.A.; Hinds, P.W.; Tan, T.H.

    1988-02-01

    The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

  20. New orally active DNA minor groove binding small molecule CT-1 acts against breast cancer by targeting tumor DNA damage leading to p53-dependent apoptosis.

    PubMed

    Saini, Karan Singh; Hamidullah; Ashraf, Raghib; Mandalapu, Dhanaraju; Das, Sharmistha; Siddiqui, Mohd Quadir; Dwivedi, Sonam; Sarkar, Jayanta; Sharma, Vishnu Lal; Konwar, Rituraj

    2017-04-01

    Targeting tumor DNA damage and p53 pathway is a clinically established strategy in the development of cancer chemotherapeutics. Majority of anti-cancer drugs are delivered through parenteral route for reasons like severe toxicity, lack of stability, and poor enteral absorption. Current DNA targeting drugs in clinical like anthracycline suffers from major drawbacks like cardiotoxicity. Here, we report identification of a new orally active small molecule curcumin-triazole conjugate (CT-1) with significant anti-breast cancer activity in vitro and in vivo. CT-1 selectively and significantly inhibits viability of breast cancer cell lines; retards cells cycle progression at S phase and induce mitochondrial-mediated cell apoptosis. CT-1 selectively binds to minor groove of DNA and induces DNA damage leading to increase in p53 along with decrease in its ubiquitination. Inhibition of p53 with pharmacological inhibitor as well as siRNA revealed the necessity of p53 in CT-1-mediated anti-cancer effects in breast cancer cells. Studies using several other intact p53 and deficient p53 cancer cell lines further confirmed necessity of p53 in CT-1-mediated anti-cancer response. Pharmacological inhibition of pan-caspase showed CT-1 induces caspase-dependent cell death in breast cancer cells. Most interestingly, oral administration of CT-1 induces significant inhibition of tumor growth in LA-7 syngeneic orthotropic rat mammary tumor model. CT-1 treated mammary tumor shows enhancement in DNA damage, p53 upregulation, and apoptosis. Collectively, CT-1 exhibits potent anti-cancer effect both in vitro and in vivo and could serve as a safe orally active lead for anti-cancer drug development. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  1. p53 prevents progression of nevi to melanoma predominantly through cell cycle regulation

    PubMed Central

    Terzian, Tamara; Torchia, Enrique C.; Dai, Daisy; Robinson, Steven E.; Murao, Kazutoshi; Stiegmann, Regan A.; Gonzalez, Victoria; Boyle, Glen M.; Powell, Marianne B.; Pollock, Pamela M.; Lozano, Guillermina; Robinson, William A.; Roop, Dennis R.; Box, Neil F.

    2011-01-01

    p53 is the central member of a critical tumor suppressor pathway in virtually all tumor types, where it is silenced mainly by missense mutations. In melanoma, p53 predominantly remains wild type, thus its role has been neglected. To study the effect of p53 on melanocyte function and melanomagenesis, we crossed the ‘high-p53’ Mdm4+/− mouse to the well-established TP-ras0/+ murine melanoma progression model. After treatment with the carcinogen dimethylbenzanthracene (DMBA), TP-ras0/+ mice on the Mdm4+/− background developed fewer tumors with a delay in the age of onset of melanomas compared to TP-ras0/+ mice. Furthermore, we observed a dramatic decrease in tumor growth, lack of metastasis with increased survival of TP-ras0/+: Mdm4+/− mice. Thus, p53 effectively prevented the conversion of small benign tumors to malignant and metastatic melanoma. p53 activation in cultured primary melanocyte and melanoma cell lines using Nutlin-3, a specific Mdm2 antagonist, supported these findings. Moreover, global gene expression and network analysis of Nutlin-3-treated primary human melanocytes indicated that cell cycle regulation through the p21WAF1/CIP1 signaling network may be the key anti-melanomagenic activity of p53. PMID:20849464

  2. Chk2 mediates RITA-induced apoptosis.

    PubMed

    de Lange, J; Verlaan-de Vries, M; Teunisse, A F A S; Jochemsen, A G

    2012-06-01

    Reactivation of the p53 tumor-suppressor protein by small molecules like Nutlin-3 and RITA (reactivation of p53 and induction of tumor cell apoptosis) is a promising strategy for cancer therapy. The molecular mechanisms involved in the responses to RITA remain enigmatic. Several groups reported the induction of a p53-dependent DNA damage response. Furthermore, the existence of a p53-dependent S-phase checkpoint has been suggested, involving the checkpoint kinase Chk1. We have recently shown synergistic induction of apoptosis by RITA in combination with Nutlin-3, and we observed concomitant Chk2 phosphorylation. Therefore, we investigated whether Chk2 contributes to the cellular responses to RITA. Strikingly, the induction of apoptosis seemed entirely Chk2 dependent. Transcriptional activity of p53 in response to RITA required the presence of Chk2. A partial rescue of apoptosis observed in Noxa knockdown cells emphasized the relevance of p53 transcriptional activity for RITA-induced apoptosis. In addition, we observed an early p53- and Chk2-dependent block of DNA replication upon RITA treatment. Replicating cells seemed more prone to entering RITA-induced apoptosis. Furthermore, the RITA-induced DNA damage response, which was not a secondary effect of apoptosis induction, was strongly attenuated in cells lacking p53 or Chk2. In conclusion, we identified Chk2 as an essential mediator of the cellular responses to RITA.

  3. Chk2 mediates RITA-induced apoptosis

    PubMed Central

    de Lange, J; Verlaan-de Vries, M; Teunisse, A F A S; Jochemsen, A G

    2012-01-01

    Reactivation of the p53 tumor-suppressor protein by small molecules like Nutlin-3 and RITA (reactivation of p53 and induction of tumor cell apoptosis) is a promising strategy for cancer therapy. The molecular mechanisms involved in the responses to RITA remain enigmatic. Several groups reported the induction of a p53-dependent DNA damage response. Furthermore, the existence of a p53-dependent S-phase checkpoint has been suggested, involving the checkpoint kinase Chk1. We have recently shown synergistic induction of apoptosis by RITA in combination with Nutlin-3, and we observed concomitant Chk2 phosphorylation. Therefore, we investigated whether Chk2 contributes to the cellular responses to RITA. Strikingly, the induction of apoptosis seemed entirely Chk2 dependent. Transcriptional activity of p53 in response to RITA required the presence of Chk2. A partial rescue of apoptosis observed in Noxa knockdown cells emphasized the relevance of p53 transcriptional activity for RITA-induced apoptosis. In addition, we observed an early p53- and Chk2-dependent block of DNA replication upon RITA treatment. Replicating cells seemed more prone to entering RITA-induced apoptosis. Furthermore, the RITA-induced DNA damage response, which was not a secondary effect of apoptosis induction, was strongly attenuated in cells lacking p53 or Chk2. In conclusion, we identified Chk2 as an essential mediator of the cellular responses to RITA. PMID:22158418

  4. Small-molecule MDM2 antagonists attenuate the senescence-associated secretory phenotype.

    PubMed

    Wiley, Christopher D; Schaum, Nicholas; Alimirah, Fatouma; Lopez-Dominguez, Jose Alberto; Orjalo, Arturo V; Scott, Gary; Desprez, Pierre-Yves; Benz, Christopher; Davalos, Albert R; Campisi, Judith

    2018-02-05

    Processes that have been linked to aging and cancer include an inflammatory milieu driven by senescent cells. Senescent cells lose the ability to divide, essentially irreversibly, and secrete numerous proteases, cytokines and growth factors, termed the senescence-associated secretory phenotype (SASP). Senescent cells that lack p53 tumor suppressor function show an exaggerated SASP, suggesting the SASP is negatively controlled by p53. Here, we show that increased p53 activity caused by small molecule inhibitors of MDM2, which promotes p53 degradation, reduces inflammatory cytokine production by senescent cells. Upon treatment with the MDM2 inhibitors nutlin-3a or MI-63, human cells acquired a senescence-like growth arrest, but the arrest was reversible. Importantly, the inhibitors reduced expression of the signature SASP factors IL-6 and IL-1α by cells made senescent by genotoxic stimuli, and suppressed the ability of senescent fibroblasts to stimulate breast cancer cell aggressiveness. Our findings suggest that MDM2 inhibitors could reduce cancer progression in part by reducing the pro-inflammatory environment created by senescent cells.

  5. Roles of p53 and p27 Kip1 in the regulation of neurogenesis in the murine adult subventricular zone

    PubMed Central

    Gil-Perotin, Sara; Haines, Jeffery D.; Kaur, Jasbir; Marin-Husstege, Mireya; Spinetta, Michael J.; Kim, Kwi-Hye; Duran-Moreno, Maria; Schallert, Timothy; Zindy, Frederique; Roussel, Martine F.; Garcia-Verdugo, Jose M.; Casaccia, Patrizia

    2011-01-01

    The tumor suppressor protein p53 (Trp53) and the cell cycle inhibitor p27 Kip1 (Cdknb1) have both been implicated in regulating proliferation of adult subventricular zone (aSVZ) cells. We previously reported that genetic ablation of Trp53 (Trp53 −/−) or Cdknb1 (p27 Kip1−/−) increased proliferation of cells in the aSVZ, but differentially affected the number of adult born neuroblasts. We therefore hypothesized that these molecules might play non-redundant roles. To test this hypothesis we generated mice lacking both genes (Trp53 −/−;p27 Kip1−/−) and analysed the consequences on aSVZ cells and adult neuroblasts. Proliferation and self-renewal of cultured aSVZ cells were increased in the double mutants compared with control, but the mice did not develop spontaneous brain tumors. In contrast, the number of adult-born neuroblasts in the double mutants was similar to wild-type animals and suggested a complementation of the p27 Kip1−/− phenotype due to loss of Trp53. Cellular differences detected in the aSVZ correlated with cellular changes in the olfactory bulb and behavioral data on novel odor recognition. The exploration time for new odors was reduced in p27 Kip1−/− mice, increased in Trp53 −/− mice and normalized in the double Trp53−/−;p27 Kip1−/− mutants. At the molecular level, Trp53 −/− aSVZ cells were characterized by higher levels of NeuroD and Math3 and by the ability to generate neurons more readily. In contrast, p27 Kip1−/− cells generated fewer neurons, due to enhanced proteasomal degradation of pro-neural transcription factors. Together, these results suggest that p27 Kip1 and p53 function non-redundantly to modulate proliferation and self-renewal of aSVZ cells and antagonistically in regulating adult neurogenesis. PMID:21899604

  6. Wee-1 Kinase Inhibition Overcomes Cisplatin Resistance Associated with High-Risk TP53 Mutations in Head and Neck Cancer through Mitotic Arrest Followed by Senescence

    PubMed Central

    Osman, Abdullah A.; Monroe, Marcus M.; Ortega Alves, Marcus V.; Patel, Ameeta A.; Katsonis, Panagiotis; Fitzgerald, Alison L.; Neskey, David M.; Frederick, Mitchell J.; Woo, Sang Hyeok; Caulin, Carlos; Hsu, Teng-Kuei; McDonald, Thomas O.; Kimmel, Marek; Meyn, Raymond E.; Lichtarge, Olivier; Myers, Jeffrey N.

    2015-01-01

    Although cisplatin has played a role in “standard-of-care” multimodality therapy for patients with advanced squamous cell carcinoma of the head and neck (HNSCC), the rate of treatment failure remains particularly high for patients receiving cisplatin whose tumors have mutations in the TP53 gene. We found that cisplatin treatment of HNSCC cells with mutant TP53 leads to arrest of cells in the G2 phase of the cell cycle, leading us to hypothesize that the wee-1 kinase inhibitor MK-1775 would abrogate the cisplatin-induced G2 block and thereby sensitize isogenic HNSCC cells with mutant TP53 or lacking p53 expression to cisplatin. We tested this hypothesis using clonogenic survival assays, flow cytometry, and in vivo tumor growth delay experiments with an orthotopic nude mouse model of oral tongue cancer. We also used a novel TP53 mutation classification scheme to identify which TP53 mutations are associated with limited tumor responses to cisplatin treatment. Clonogenic survival analyses indicate that nanomolar concentration of MK-1775 sensitizes HNSCC cells with high-risk mutant p53 to cisplatin. Consistent with its ability to chemosensitize, MK-1775 abrogated the cisplatin-induced G2 block in p53-defective cells leading to mitotic arrest associated with a senescence-like phenotype. Furthermore, MK-1775 enhanced the efficacy of cisplatin in vivo in tumors harboring TP53 mutations. These results indicate that HNSCC cells expressing high-risk p53 mutations are significantly sensitized to cisplatin therapy by the selective wee-1 kinase inhibitor, supporting the clinical evaluation of MK-1775 in combination with cisplatin for the treatment of patients with TP53 mutant HNSCC. PMID:25504633

  7. Reversible p53 inhibition prevents cisplatin ototoxicity without blocking chemotherapeutic efficacy.

    PubMed

    Benkafadar, Nesrine; Menardo, Julien; Bourien, Jérôme; Nouvian, Régis; François, Florence; Decaudin, Didier; Maiorano, Domenico; Puel, Jean-Luc; Wang, Jing

    2017-01-01

    Cisplatin is a widely used chemotherapy drug, despite its significant ototoxic side effects. To date, the mechanism of cisplatin-induced ototoxicity remains unclear, and hearing preservation during cisplatin-based chemotherapy in patients is lacking. We found activation of the ATM-Chk2-p53 pathway to be a major determinant of cisplatin ototoxicity. However, prevention of cisplatin-induced ototoxicity is hampered by opposite effects of ATM activation upon sensory hair cells: promoting both outer hair cell death and inner hair cell survival. Encouragingly, however, genetic or pharmacological ablation of p53 substantially attenuated cochlear cell apoptosis, thus preserving hearing. Importantly, systemic administration of a p53 inhibitor in mice bearing patient-derived triple-negative breast cancer protected auditory function, without compromising the anti-tumor efficacy of cisplatin. Altogether, these findings highlight a novel and effective strategy for hearing protection in cisplatin-based chemotherapy. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  8. Epigallocatechin-3-Gallate Prevents Autoimmune-Associated Down-Regulation of p21 in Salivary Gland Cells Through a p53-Independent Pathway

    PubMed Central

    Dickinson, Douglas; Yu, Hongfang; Ohno, Seiji; Thomas, Cristina; DeRossi, Scott; Ma, Yat-Ho; Yates, Nicole; Hahn, Emily; Bisch, Frederick; Yamamoto, Tetsuya; Hsu, Stephen

    2015-01-01

    The submandibular salivary glands of non-obese diabetic (NOD) mice, a model for Sjogren’s syndrome and type-1 diabetes, show an elevated level of proliferating cell nuclear antigen (PCNA), a protein involved in cell proliferation and repair of DNA damage. We reported previously that epigallocatechin-3-gallate (EGCG), the most abundant green tea catechin, normalizes the PCNA level. PCNA’s activity can be regulated by the cyclin-dependent kinase inhibitor p21, which is also important for epithelial cell differentiation. In turn, expression of p21 and PCNA are partially regulated by Rb phosphorylation levels. EGCG was found to modulate p21 expression in epithelial cells, suggesting that EGCG-induced p21 could be associated with down-regulation of PCNA in vivo. The current study examined the protein levels of p21 and p53 (which can up-regulate p21) in NOD mice fed with either water or EGCG, and the effect of EGCG on p21 and p53 in cell line models with either normal or defective Rb. In NOD mice, the p21 level was low, and EGCG normalized it. In contrast to HSG cells with functional Rb, negligible expression of p21 in NS-SV-AC cells that lack Rb was not altered by EGCG treatment. Inhibition of p53 by siRNA demonstrated that p21 and p53 were induced independently in HSG cells by a physiological concentration range of EGCG, suggesting p53 could be an important but not conditional factor associated with p21 expression. In conclusion, PCNA and p21 levels are altered inversely in the NOD model for SS and in HSG cells, and warrant further study as candidate new markers for salivary dysfunction associated with xerostomia. Induction of p21 by EGCG could provide clinically useful normalization of salivary glands by promoting differentiation and reducing PCNA levels. PMID:24329914

  9. Ineffectiveness of the presence of H-ras/p53 combination of mutations in squamous cell carcinoma cells to induce a conversion of a nontumorigenic to a tumorigenic phenotype.

    PubMed

    Lee, H; Li, D; Prior, T; Casto, B C; Weghorst, C M; Shuler, C F; Milo, G E

    1997-10-01

    Human tumor cells have properties in vitro or in surrogate hosts that are distinct from those of normal cells, such as immortality, anchorage independence, and tumor formation in nude mice. However, different cells from individual tumors may exhibit some, but not all of these features. In previous years, human tumor cell lines derived from different tumor and tissue types have been studied to determine those molecular changes that are associated with the in vitro properties listed above and with tumorigenicity in nude mice. In the present study, seven cell lines derived from human tumors were characterized for p53 and ras mutations that may occur in SCC tumor phenotypes and for tumor formation in nude mice. This investigation was designed to examine whether co-occurrence of mutated ras and p53 lead to a malignant stage in the progression process. None of the seven cell lines contained mutations in the recognized "hot spots" of the p53 tumor suppressor gene, but four had a nonsense/splice mutation in codon 126 and a mutation in codon 12 of the H-ras gene. The remaining three cell lines had p53 mutations in intron 5, in codon 193, and a missense mutation in codon 126, respectively. Four of seven cell lines were nontumorigenic; two of these cell lines contained a nonsense p53-126 mutation and mutated ras; one had a missense mutation at codon 126 but no mutated ras; the the fourth had only a p53 mutation at codon 193. Two of the nontumorigenic cell lines were converted to tumorigenicity after treatment with methyl methanesulfonate or N-methyl-N'-nitro-N-nitrosoguanidine with no apparent additional mutations in either gene. Our analysis revealed that there was a high frequency of genetic diversity and mutations in both p53 and H-ras. There was also a lack of a causal relationship in the presence of mutations in p53 and the cells' ability to exhibit a malignant potential in nude mice.

  10. Telomere dysfunction and cell survival: roles for distinctTIN2-containing complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Sahn-Ho; Davalos, Albert R.; Heo, Seok-Jin

    Telomeres are maintained by three DNA binding proteins, TRF1, TRF2 and POT1, and several associated factors. One factor, TIN2, binds TRF1 and TRF2 directly and POT1 indirectly. These and two other proteins form a soluble complex that may be the core telomere-maintenance complex. It is not clear whether subcomplexes exist or function in vivo. Here, we provide evidence for two TIN2 subcomplexes with distinct functions in human cells. TIN2 ablation by RNA interference caused telomere uncapping and p53-independent cell death in all cells tested. However, we isolated two TIN2 complexes from cell lysates, each selectively sensitive to a TIN2 mutantmore » (TIN2-13, TIN2-15C). In cells with wild-type p53 function, TIN2-15C was more potent than TIN2-13 in causing telomere uncapping and eventual growth arrest. In cells lacking p53 function, TIN215C more than TIN2-13 caused genomic instability and cell death. Thus, TIN2 subcomplexes likely have distinct functions in telomere maintenance, and may provide selective targets for eliminating cells with mutant p53.« less

  11. A Nanoparticle Carrying the p53 Gene Targets Tumors Including Cancer Stem Cells, Sensitizes Glioblastoma to Chemotherapy and Improves Survival

    PubMed Central

    2015-01-01

    Temozolomide (TMZ)-resistance in glioblastoma multiforme (GBM) has been linked to upregulation of O6-methylguanine-DNA methyltransferase (MGMT). Wild-type (wt) p53 was previously shown to down-modulate MGMT. However, p53 therapy for GBM is limited by lack of efficient delivery across the blood brain barrier (BBB). We have developed a systemic nanodelivery platform (scL) for tumor-specific targeting (primary and metastatic), which is currently in multiple clinical trials. This self-assembling nanocomplex is formed by simple mixing of the components in a defined order and a specific ratio. Here, we demonstrate that scL crosses the BBB and efficiently targets GBM, as well as cancer stem cells (CSCs), which have been implicated in recurrence and treatment resistance in many human cancers. Moreover, systemic delivery of scL-p53 down-modulates MGMT and induces apoptosis in intracranial GBM xenografts. The combination of scL-p53 and TMZ increased the antitumor efficacy of TMZ with enhanced survival benefit in a mouse model of highly TMZ-resistant GBM. scL-p53 also sensitized both CSCs and bulk tumor cells to TMZ, increasing apoptosis. These results suggest that combining scL-p53 with standard TMZ treatment could be a more effective therapy for GBM. PMID:24811110

  12. L'effet de p53 sur la radiosensibilité des cellules humaines normales et cancéreuses

    NASA Astrophysics Data System (ADS)

    Little, J. B.; Li, C. Y.; Nagasawa, H.; Huang, H.

    1998-04-01

    The radiosensitivity of normal human fibroblasts in p53 dependent and associated with the loss of cells from the cycling population as the result of an irreversible G1 arrest; cells lacking normal p53 function show no arrest and are more radioresistant. Under conditions in which the repair potentially lethal radiation damage is facilitated, the fraction of cells arrested in G1 is reduced and survival is enhanced. The response of human tumor cells differs significantly. The radiation-induced G1 arrest is minimal or absent in p53+ tumor cells, and loss of normal p53 function has no consistent effect on their radiosensitivity. These results suggest that p53 status may not be a useful predictive marker for the response of human solid tumors to radiation therapy. La radiosensibilité des fibroblastes diploïdes humains est liée à l'expression de p53, et à la perte de cellules en cycle résultant d'un arrêt irréversible en phase G1 ; dans les cellules n'ayant pas une fonction p53 normale, on ne constate aucun arrêt, et elles sont plus radio-résistantes. Dans des conditions favorables à la réparation de lésions potentiellement léthales dues à l'irradiation, la proportion de cellules bloquées en phase G1 baisse, et les chances de survie sont accrues. Bien différente est la réaction des cellules cancéreuses humaines. Le blocage par irradiation en phase G1 est minime ou inexistant dans les cellules cancéreuses p53^+, et la perte de la fonction normale p53 n'a pas d'effet constant sur leur radiosensibilité. Ces résultats laissent penser que l'expression de p53 n'est pas un indice fiable permettant de prévoir la réaction des tumeurs solides à la radiothérapie.

  13. Lipoic acid induces p53-independent cell death in colorectal cancer cells and potentiates the cytotoxicity of 5-fluorouracil.

    PubMed

    Dörsam, Bastian; Göder, Anja; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg

    2015-10-01

    Alpha-lipoic acid (LA), which plays a pivotal role in mitochondrial energy metabolism, is an endogenous dithiol compound with an array of antioxidative functions. It has been shown that LA triggers cell death in tumor cell lines, whereas non-transformed cells are hardly affected. In the present study, we analyzed the cytotoxicity of LA on colorectal cancer (CRC) cells differing in their p53 status and investigated a putative synergistic effect with the anticancer drug 5-fluorouracil (5-FU). We show that LA induces a dose-dependent decrease in cell viability, which was independent of the p53 status as attested in isogenic p53-proficient and p53-deficient cell lines. This effect was largely attributable to cell death induction as revealed by Annexin-V/PI staining. LA-treated HCT116 cells underwent caspase-dependent and caspase-independent cell death, which was blocked by the pan-caspase inhibitor zVAD and the RIP-kinase inhibitor Necrostatin-1, respectively. In CaCO-2 and HT29 cells, LA induced caspase-dependent cell demise via activation of caspase-9, caspase-3 and caspase-7 with subsequent PARP-1 cleavage as demonstrated by immunoblot analysis, activity assays and pan-caspase inhibition. Interestingly, LA treatment did neither activate p53 nor induced genotoxic effects as shown by lack of DNA strand breaks and phosphorylation of histone 2AX. Finally, we provide evidence that LA increases the cytotoxic effect induced by the anticancer drug 5-FU as revealed by significantly enhanced cell death rates in HCT116 and CaCO-2 cells. Collectively, these findings demonstrate that LA induces CRC cell death independent of their p53 status and potentiates the cytotoxicity of 5-FU without causing DNA damage on its own, which makes it a candidate for tumor therapy.

  14. A combination of p53-activating APR-246 and phosphatidylserine-targeting antibody potently inhibits tumor development in hormone-dependent mutant p53-expressing breast cancer xenografts

    PubMed Central

    Liang, Yayun; Mafuvadze, Benford; Besch-Williford, Cynthia; Hyder, Salman M

    2018-01-01

    Background Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53) lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood vessels, which serve as the major route for tumor metastasis, in tumor xenografts compared with either agent alone. Conclusion Based on our findings, we contend that breast tumor growth might effectively be controlled by simultaneous targeting of mtp53 protein and tumor blood vessels in mtp53-expressing cancers. PMID:29606888

  15. Downregulated long non-coding RNA MEG3 in breast cancer regulates proliferation, migration and invasion by depending on p53’s transcriptional activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Lin; Li, Yu; Yang, Bangxiang, E-mail: b19933009@qq.coom

    Long non-coding RNAs (lncRNAs) was found to play critical roles in tumorigenesis, hence, screen of tumor-related lncRNAs, identification of their biological roles is important for understanding the processes of tumorigenesis. In this study, we identified the expressing difference of several tumor-related lncRNAs in breast cancer samples and found that, MEG3, which is downregulated in non-small cell lung cancer (NSCLC) tumor tissues, is also downregulated in breast cancer samples compared with adjacent tissues. For figuring out the effect of MEG3 in breast cancer cells MCF7 and MB231, we overexpressed MEG3 in these cells, and found that it resulted the inhibition ofmore » proliferation, colony formation, migration and invasion capacities by enhancing p53’s transcriptional activity on its target genes, including p21, Maspin and KAI1. MEG3 presented similar effects in MB157, which is a p53-null breast cancer cell line, when functional p53 but not p53R273H mutant, which lacks transcriptional activity, was introduced. Surprisingly, overexpression of MEG3 activates p53’s transcriptional activity by decreasing MDM2’s transcription level, and thus stabilizes and accumulates P53. Taken together, our findings indicate that MEG3 is downregulated in breast cancer tissues and affects breast cancer cells’ malignant behaviors, which indicate MEG3 a potential therapeutic target for breast cancer. - Highlights: • MEG3 RNA is widely downregulated in breast tumor tissue. • MEG3 regulates P53 indirectly through transcriptional regulation of MDM2. • Under unstressed condition, MEG3-related P53 accumulation transcriptionally activates p53’s target genes. • MEG3 expression level tightly regulates proliferation, colony formation, migration and invasion in breast tumor cells.« less

  16. β-Catenin C-terminal signals suppress p53 and are essential for artery formation

    PubMed Central

    Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.

    2016-01-01

    Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

  17. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  18. Roles of HAUSP-mediated p53 regulation in central nervous system development.

    PubMed

    Kon, N; Zhong, J; Kobayashi, Y; Li, M; Szabolcs, M; Ludwig, T; Canoll, P D; Gu, W

    2011-08-01

    The deubiquitinase HAUSP (herpesvirus-associated ubiquitin-specific protease; also called USP7) has a critical role in regulating the p53-Mdm2 (murine double minute 2) pathway. By using the conventional knockout approach, we previously showed that hausp inactivation leads to early embryonic lethality. To fully understand the physiological functions of hausp, we have generated mice lacking hausp specifically in the brain and examined the impacts of this manipulation on brain development. We found that deletion of hausp in neural cells resulted in neonatal lethality. The brains from these mice displayed hypoplasia and deficiencies in development, which were mainly caused by p53-mediated apoptosis. Detailed analysis also showed an increase of both p53 levels and p53-dependent transcriptional activation in hausp knockout brains. Notably, neural cell survival and brain development of hausp-mutant mice can largely be restored in the p53-null background. Nevertheless, in contrast to the case of mdm2- and mdm4 (murine double minute 4)-mutant mice, inactivation of p53 failed to completely rescue the neonatal lethality of these hausp-mutant mice. These results indicate that HAUSP-mediated p53 regulation is crucial for brain development, and also suggest that both the p53-dependent and the p53-independent functions of HAUSP contribute to the neonatal lethality of hausp-mutant mice.

  19. Ginsenoside Rg3 Inhibits Melanoma Cell Proliferation through Down-Regulation of Histone Deacetylase 3 (HDAC3) and Increase of p53 Acetylation

    PubMed Central

    Shan, Xiu; Fu, Yuan-Shan; Aziz, Faisal; Wang, Xiao-Qi; Yan, Qiu; Liu, Ji-Wei

    2014-01-01

    Malignant melanoma is an aggressive and deadly form of skin cancer, and despite recent advances in available therapies, is still lacking in completely effective treatments. Rg3, a monomer extracted from ginseng roots, has been attempted for the treatment of many cancers. It is reported that the expressions of histone deacetylase 3 (HDAC3) and p53 acetylation correlate with tumor cell growth. However, the antitumor effect of Rg3 on melanoma and the mechanism by which it regulates HDAC3 expression and p53 acetylation remain unknown. We found high expression of HDAC3 in human melanoma tissues to be significantly correlated to lymph node metastasis and clinical stage of disease (p<0.05). In melanoma cells, Rg3 inhibited cell proliferation and induced G0/G1 cell cycle arrest. Rg3 also decreased the expression of HDAC3 and increased the acetylation of p53 on lysine (k373/k382). Moreover, suppression of HDAC3 by either siRNA or a potent HDAC3 inhibitor (MS-275) inhibited cell proliferation, increased p53 acetylation and transcription activity. In A375 melanoma xenograft studies, we demonstrated that Rg3 and HDAC3 short hairpin RNA (shHDAC3) inhibited the growth of xenograft tumors with down-regulation of HDAC3 expression and up-regulation of p53 acetylation. In conclusion, Rg3 has antiproliferative activity against melanoma by decreasing HDAC3 and increasing acetylation of p53 both in vitro and in vivo. Thus, Rg3 serves as a potential therapeutic agent for the treatment of melanoma. PMID:25521755

  20. p53 Mediates Vast Gene Expression Changes That Contribute to Poor Chemotherapeutic Response in a Mouse Model of Breast Cancer.

    PubMed

    Tonnessen-Murray, Crystal; Ungerleider, Nathan A; Rao, Sonia G; Wasylishen, Amanda R; Frey, Wesley D; Jackson, James G

    2018-05-28

    p53 is a transcription factor that regulates expression of genes involved in cell cycle arrest, senescence, and apoptosis. TP53 harbors mutations that inactivate its transcriptional activity in roughly 30% of breast cancers, and these tumors are much more likely to undergo a pathological complete response to chemotherapy. Thus, the gene expression program activated by wild-type p53 contributes to a poor response. We used an in vivo genetic model system to comprehensively define the p53- and p21-dependent genes and pathways modulated in tumors following doxorubicin treatment. We identified genes differentially expressed in spontaneous mammary tumors harvested from treated MMTV-Wnt1 mice that respond poorly (Trp53+/+) or favorably (Trp53-null) and those that lack the critical senescence/arrest p53 target gene Cdkn1a. Trp53 wild-type tumors differentially expressed nearly 10-fold more genes than Trp53-null tumors after treatment. Pathway analyses showed that genes involved in cell cycle, senescence, and inflammation were enriched in treated Trp53 wild-type tumors; however, no genes/pathways were identified that adequately explain the superior cell death/tumor regression observed in Trp53-null tumors. Cdkn1a-null tumors that retained arrest capacity (responded poorly) and those that proliferated (responded well) after treatment had remarkably different gene regulation. For instance, Cdkn1a-null tumors that arrested upregulated Cdkn2a (p16), suggesting an alternative, p21-independent route to arrest. Live animal imaging of longitudinal gene expression of a senescence/inflammation gene reporter in Trp53+/+ tumors showed induction during and after chemotherapy treatment, while tumors were arrested, but expression rapidly diminished immediately upon relapse. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  1. The ubiquitin ligase LIN41/TRIM71 targets p53 to antagonize cell death and differentiation pathways during stem cell differentiation

    PubMed Central

    Nguyen, Duong Thi Thuy; Richter, Daniel; Michel, Geert; Mitschka, Sibylle; Kolanus, Waldemar; Cuevas, Elisa; Gregory Wulczyn, F

    2017-01-01

    Rapidity and specificity are characteristic features of proteolysis mediated by the ubiquitin-proteasome system. Therefore, the UPS is ideally suited for the remodeling of the embryonic stem cell proteome during the transition from pluripotent to differentiated states and its inverse, the generation of inducible pluripotent stem cells. The Trim-NHL family member LIN41 is among the first E3 ubiquitin ligases to be linked to stem cell pluripotency and reprogramming. Initially discovered in C. elegans as a downstream target of the let-7 miRNA, LIN41 is now recognized as a critical regulator of stem cell fates as well as the timing of neurogenesis. Despite being indispensable for embryonic development and neural tube closure in mice, the underlying mechanisms for LIN41 function in these processes are poorly understood. To better understand the specific contributions of the E3 ligase activity for the stem cell functions of LIN41, we characterized global changes in ubiquitin or ubiquitin-like modifications using Lin41-inducible mouse embryonic stem cells. The tumor suppressor protein p53 was among the five most strongly affected proteins in cells undergoing neural differentiation in response to LIN41 induction. We show that LIN41 interacts with p53, controls its abundance by ubiquitination and antagonizes p53-dependent pro-apoptotic and pro-differentiation responses. In vivo, the lack of LIN41 is associated with upregulation of Grhl3 and widespread caspase-3 activation, two downstream effectors of p53 with essential roles in neural tube closure. As Lin41-deficient mice display neural tube closure defects, we conclude that LIN41 is critical for the regulation of p53 functions in cell fate specification and survival during early brain development. PMID:28430184

  2. Establishment of a new human pre-B acute lymphoblastic leukemia cell line (KMO-90) with 1;19 translocation carrying p53 gene alterations.

    PubMed

    Sotomatsu, M; Hayashi, Y; Kawamura, M; Yugami, S; Shitara, T

    1993-10-01

    A new human pre-B acute lymphoblastic leukemia cell line (KMO-90) was established from the bone marrow sample of a 12-year-old girl with acute lymphoblastic leukemia (ALL) carrying 1;19 chromosome translocation. KMO-90 cells expressed HLA-DR, CD10, CD19, and CD22 antigens. These cells had also cytoplasmic immunoglobulin lacking surface immunoglobulin, indicating that these had a pre-B phenotype. Chromosome analysis of this cell line showed 48, XX, +8, +19, t(1;19)(q23;p13). Southern blot analysis showed the same sized rearrangements of the E2A gene in KMO-90 cells as those in the original leukemic cells. By means of reverse transcriptase-polymerase chain reaction analysis, we detected E2A/PBX1 fusion transcripts in KMO-90 cells. KMO-90 is useful when studying the role of the 1;19 translocation in the etiology of pre-B ALL. Furthermore, we studied alterations of the p53 gene in this cell line by polymerase chain reaction, single-strand conformation polymorphism analysis. KMO-90 cells were identified to have a point mutation at codon 177 (CCC-->TCC) of the p53 gene, suggesting that alterations of the p53 gene may have an important role in the establishment of this cell line.

  3. Pharmacological targeting of p53 through RITA is an effective antitumoral strategy for malignant pleural mesothelioma.

    PubMed

    Di Marzo, Domenico; Forte, Iris Maria; Indovina, Paola; Di Gennaro, Elena; Rizzo, Valeria; Giorgi, Francesca; Mattioli, Eliseo; Iannuzzi, Carmelina Antonella; Budillon, Alfredo; Giordano, Antonio; Pentimalli, Francesca

    2014-01-01

    Malignant mesothelioma, a very aggressive tumor associated to asbestos exposure, is expected to increase in incidence, and unfortunately, no curative modality exists. Reactivation of p53 is a new attractive antitumoral strategy. p53 is rarely mutated in mesothelioma, but it is inactivated in most tumors by the lack of p14(ARF). Here, we evaluated the feasibility of this approach in pleural mesothelioma by testing RITA and nutlin-3, two molecules able to restore p53 function through a different mechanism, on a panel of mesothelioma cell lines representing the epithelioid (NCI-H28, NCI-H2452, IST-MES 2), biphasic (MSTO-211H), and sarcomatoid (NCI-H2052) histotypes compared with the normal mesothelial HMC-hTERT. RITA triggered robust caspase-dependent apoptosis specifically in epithelioid and biphasic mesothelioma cell lines, both through wild-type and mutant p53, concomitant to p21 downregulation. Conversely, nutlin-3 induced a p21-dependent growth arrest, rather than apoptosis, and was slightly toxic on HMC-hTERT.   Interestingly, we identified a previously undetected point mutation of p53 (p.Arg249Ser) in IST-MES 2, and showed that RITA is also able to reactivate this p53 mutant protein and its apoptotic function. RITA reduced tumor growth in a MSTO-211H-derived xenograft model of mesothelioma and synergized with cisplatin, which is the mainstay of treatment for this tumor. Our data indicate that reactivation of p53 and concomitant p21 downregulation effectively induce cell death in mesothelioma, a tumor characterized by a high intrinsic resistance to apoptosis. Altogether, our findings provide the preclinical framework supporting the use of p53-reactivating agents alone, or in combination regimens, to improve the outcome of patients with mesothelioma.

  4. Tumorigenicity of MCF-7 human breast cancer cells lacking the p38α mitogen-activated protein kinase.

    PubMed

    Mendoza, Rhone A; Moody, Emily E; Enriquez, Marlene I; Mejia, Sylvia M; Thordarson, Gudmundur

    2011-01-01

    We have generated cell lines with significantly reduced expression of the p38 mitogen-activated protein kinase (p38 MAPK), Min-p38 MAPK cells, and used these cells to investigate p38 MAPK's role in tumorigenesis of breast cancer cells. MCF-7 cells were stably transfected with a plasmid producing small interfering RNA that inhibited the expression of p38 MAPK. Control cells were stably transfected with the same plasmid producing non-interfering RNA. The reduction in the p38 MAPK activity caused a significant increase in the expressions of estrogen receptor-α (ERα) and the progesterone receptor, but eliminated the expression of ERβ. Min-p38 MAPK cells showed an enhanced overall growth response to 17β-estradiol (E₂), whereas GH plus epidermal growth factor were largely ineffective growth stimulators in these cells compared to controls. Although the long-term net growth rate of the Min-p38 MAPK cells was increased in response to E₂, their proliferation rate was lower compared to controls in short-term cultures. However, the Min-p38 MAPK cells did show a significant decreased rate of apoptosis after E₂ treatment and a reduction in the basal phosphorylation of p53 tumor suppressor protein compared to controls. When the Min-p38 MAPK cells were xenografted into E₂-treated athymic nude mice, their tumorigenicity was enhanced compared to control cells. Increased tumorigenicity of Min-p38 MAPK cells was caused mainly by a decrease in the apoptosis rate indicating that the lack of the p38 MAPK caused an imbalance to increase the ERα:ERβ ratio and a reduction in the activity of the p53 tumor suppressor protein.

  5. p73 coordinates with Δ133p53 to promote DNA double-strand break repair.

    PubMed

    Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun

    2018-03-06

    Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.

  6. Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, Matej; Hrstka, Roman; Pečinka, Petr; Adámik, Matej; Vojtesek, Borivoj; Paleček, Emil; Deppert, Wolfgang; Fojta, Miroslav

    2013-01-01

    Hot spot mutant p53 (mutp53) proteins exert oncogenic gain-of-function activities. Binding of mutp53 to DNA is assumed to be involved in mutp53-mediated repression or activation of several mutp53 target genes. To investigate the importance of DNA topology on mutp53-DNA recognition in vitro and in cells, we analyzed the interaction of seven hot spot mutp53 proteins with topologically different DNA substrates (supercoiled, linear and relaxed) containing and/or lacking mutp53 binding sites (mutp53BS) using a variety of electrophoresis and immunoprecipitation based techniques. All seven hot spot mutp53 proteins (R175H, G245S, R248W, R249S, R273C, R273H and R282W) were found to have retained the ability of wild-type p53 to preferentially bind circular DNA at native negative superhelix density, while linear or relaxed circular DNA was a poor substrate. The preference of mutp53 proteins for supercoiled DNA (supercoil-selective binding) was further substantiated by competition experiments with linear DNA or relaxed DNA in vitro and ex vivo. Using chromatin immunoprecipitation, the preferential binding of mutp53 to a sc mutp53BS was detected also in cells. Furthermore, we have shown by luciferase reporter assay that the DNA topology influences p53 regulation of BAX and MSP/MST1 promoters. Possible modes of mutp53 binding to topologically constrained DNA substrates and their biological consequences are discussed. PMID:23555710

  7. Tumorigenicity of MCF-7 human breast cancer cells lacking the p38α mitogen-activated protein kinase

    PubMed Central

    Mendoza, Rhone A; Moody, Emily E; Enriquez, Marlene I; Mejia, Sylvia M; Thordarson, Gudmundur

    2011-01-01

    We have generated cell lines with significantly reduced expression of the p38 mitogen-activated protein kinase (p38 MAPK), Min-p38 MAPK cells, and used these cells to investigate its role in tumorigenesis of breast cancer cells. MCF-7 cells were stably transfected with a plasmid producing small interfering RNA that inhibited the expression of p38 MAPK. Control cells were stably transfected with the same plasmid producing non-interfering RNA. The reduction in the p38 MAPK activity caused a significant increase in the expressions of the estrogen receptor-α (ERα) and the progesterone receptor, but eliminated the expression of the ERβ. Min-p38 MAPK cells showed an enhanced overall growth response to 17β-estradiol (E2), whereas growth hormone plus epidermal growth factor were largely ineffective growth stimulators in these cells compared to controls. Although the long-term net growth rate of the Min-p38 MAPK cells was increased in response to E2, their proliferation rate was not different from controls in short-term cultures. However, the Min-p38 MAPK cells did show a significant decreased rate of apoptosis after E2 treatment and a reduction in the basal phosphorylation of p53 tumor suppressor protein compared to controls. When the Min-p38 MAPK cells were xenografted into E2-treated athymic nude mice, their tumorigenicity was enhanced compared to control cells. Conclusions: increased tumorigenicity of Min-p38 MAPK cells was caused mainly by a decrease in apoptosis rate indicating that the lack of the p38 MAPK caused an imbalance to increase the ERα:ERβ ratio and a reduction in the activity of the p53 tumor suppressor protein. PMID:20974639

  8. Tripeptidyl peptidase II plays a role in the radiation response of selected primary cell types but not based on nuclear translocation and p53 stabilization.

    PubMed

    Firat, Elke; Tsurumi, Chizuko; Gaedicke, Simone; Huai, Jisen; Niedermann, Gabriele

    2009-04-15

    The giant cytosolic protease tripeptidyl peptidase II (TPPII) was recently proposed to play a role in the DNA damage response. Shown were nuclear translocation of TPPII after gamma-irradiation, lack of radiation-induced p53 stabilization in TPPII-siRNA-treated cells, and complete tumor regression in mice after gamma-irradiation when combined with TPPII-siRNA silencing or a protease inhibitor reported to inhibit TPPII. This suggested that TPPII could be a novel target for tumor radiosensitization and prompted us to study radiation responses using TPPII-knockout mice. Neither the sensitivity to total body irradiation nor the radiosensitivity of resting lymphoid cells, which both strongly depend on p53, was altered in the absence of TPPII. Functional integrity of p53 in TPPII-knockout cells is further shown by a proper G(1) arrest and by the accumulation of p53 and its transcriptional targets, p21, Bax, and Fas, on gamma-irradiation. Furthermore, we could not confirm radiation-induced nuclear translocation of TPPII. Nevertheless, after gamma-irradiation, we found slightly increased mitotic catastrophe of TPPII-deficient primary fibroblasts and increased apoptosis of TPPII-deficient activated CD8(+) T cells. The latter was accompanied by delayed resolution of the DNA double-strand break marker gammaH2AX. This could, however, be due to increased apoptotic DNA damage rather than reduced DNA damage repair. Our data do not confirm a role for TPPII in the DNA damage response based on nuclear TPPII translocation and p53 stabilization but nevertheless do show increased radiation-induced cell death of selected nontransformed cell types in the absence of the TPPII protease.

  9. ERK mediated upregulation of death receptor 5 overcomes the lack of p53 functionality in the diaminothiazole DAT1 induced apoptosis in colon cancer models: efficiency of DAT1 in Ras-Raf mutated cells.

    PubMed

    Thamkachy, Reshma; Kumar, Rohith; Rajasekharan, K N; Sengupta, Suparna

    2016-03-08

    p53 is a tumour suppressor protein that plays a key role in many steps of apoptosis, and malfunctioning of this transcription factor leads to tumorigenesis. Prognosis of many tumours also depends upon the p53 status. Most of the clinically used anticancer compounds activate p53 dependent pathway of apoptosis and hence require p53 for their mechanism of action. Further, Ras/Raf/MEK/ERK axis is an important signaling pathway activated in many cancers. Dependence of diaminothiazoles, compounds that have gained importance recently due to their anticancer and anti angiogenic activities, were tested in cancer models with varying p53 or Ras/Raf mutational status. In this study we have used p53 mutated and knock out colon cancer cells and xenograft tumours to study the role of p53 in apoptosis mediated by diaminothiazoles. Colon cancer cell lines with varying mutational status for Ras or Raf were also used. We have also examined the toxicity and in vivo efficacy of a lead diaminothiazole 4-Amino-5-benzoyl-2-(4-methoxy phenylamino)thiazole (DAT1) in colon cancer xenografts. We have found that DAT1 is active in both in vitro and in vivo models with nonfunctional p53. Earlier studies have shown that extrinsic pathway plays major role in DAT1 mediated apoptosis. In this study, we have found that DAT1 is causing p53 independent upregulation of the death receptor 5 by activating the Ras/Raf/MEK/ERK signaling pathway both in wild type and p53 suppressed colon cancer cells. These findings are also confirmed by the in vivo results. Further, DAT1 is more efficient to induce apoptosis in colon cancer cells with mutated Ras or Raf. Minimal toxicity in both acute and subacute studies along with the in vitro and in vivo efficacy of DAT1 in cancers with both wild type and nonfunctional p53 place it as a highly beneficial candidate for cancer chemotherapy. Besides, efficiency in cancer cells with mutations in the Ras oncoprotein or its downstream kinase Raf raise interest in diaminothiazole class of compounds for further follow-up.

  10. Forced Expression of Heat Shock Protein 27 (Hsp27) Reverses P-Glycoprotein (ABCB1)-mediated Drug Efflux and MDR1 Gene Expression in Adriamycin-resistant Human Breast Cancer Cells*

    PubMed Central

    Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J.; Ilangovan, Govindasamy

    2011-01-01

    Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G2/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer. PMID:21784846

  11. Forced expression of heat shock protein 27 (Hsp27) reverses P-glycoprotein (ABCB1)-mediated drug efflux and MDR1 gene expression in Adriamycin-resistant human breast cancer cells.

    PubMed

    Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J; Ilangovan, Govindasamy

    2011-09-23

    Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G(2)/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer.

  12. Inhibition of proliferation and induction of apoptosis in soft tissue sarcoma cells by interferon-α and retinoids

    PubMed Central

    Brodowicz, T; Wiltschke, C; Kandioler-Eckersberger, D; Grunt, T W; Rudas, M; Schneider, S M; Hejna, M; Budinsky, A; Zielinski, C C

    1999-01-01

    Uncontrolled proliferation and a defect of apoptosis constitute crucial elements in the development and progression of tumours. Among many other biological response modifiers known to influence these mechanisms, the efficacy of retinoids and interferons in the treatment of various malignant entities is currently matter of discussion. In the present study, we have investigated the effects of 9-cis-retinoic acid (9cRA), 13-cis-retinoic acid (13cRA), all-trans-retinoic acid (tRA) and interferon-α on proliferation and apoptosis of human soft tissue sarcoma (STS) cell lines HTB-82 (rhabdomyosarcoma), HTB-91 (fibrosarcoma), HTB-92 (liposarcoma), HTB-93 (synovial sarcoma) and HTB-94 (chondrosarcoma) in relation to p53 genotype as well as p53 expression. HTB-91, HTB-92 and HTB-94 STS cells exhibited mutant p53, whereas wild-type p53 was found in HTB-93 STS cells, and a normal p53 status in HTB-82 STS cells, carrying a silent point mutation only. Interferon-α, irrespective of p53 status, inhibited the proliferation of all five cell lines dose- and time-dependently. Similarly, 9cRA, 13cRA and tRA decreased the proliferation of HTB-82 and HTB-93 STS cells, whereas the proliferation of p53-mutated HTB-91, HTB-92 and HTB-94 STS cells remained unchanged. Furthermore, only 9cRA and tRA were capable of inducing apoptosis in HTB-82 and HTB-93 STS cells, whereas HTB-91, HTB-92 and HTB-94 STS cells did not undergo apoptosis under the influence of 9cRA or tRA. Retinoic acid receptor (RAR)-α and RAR-β mRNA were not detectable by Northern blot analysis in the five STS cell lines, whereas mRNA for the universal retinoic acid receptor, RAR-γ, was expressed in all STS cell lines indicating that retinoid resistance was not associated with a lack of RAR expression. Apoptosis was not induced by interferon-α or 13cRA in any of the five STS cell lines tested. Our results indicate that within the panel of tested STS cell lines, inhibition of proliferation and induction of apoptosis result from different mechanisms which differ in their dependence upon the presence of intact p53. © 1999 Cancer Research Campaign PMID:10424735

  13. Functional characterization of p53 pathway components in the ancient metazoan Trichoplax adhaerens

    NASA Astrophysics Data System (ADS)

    Siau, Jia Wei; Coffill, Cynthia R.; Zhang, Weiyun Villien; Tan, Yaw Sing; Hundt, Juliane; Lane, David; Verma, Chandra; Ghadessy, Farid

    2016-09-01

    The identification of genes encoding a p53 family member and an Mdm2 ortholog in the ancient placozoan Trichoplax adhaerens advocates for the evolutionary conservation of a pivotal stress-response pathway observed in all higher eukaryotes. Here, we recapitulate several key functionalities ascribed to this known interacting protein pair by analysis of the placozoan proteins (Tap53 and TaMdm2) using both in vitro and cellular assays. In addition to interacting with each other, the Tap53 and TaMdm2 proteins are also able to respectively bind human Mdm2 and p53, providing strong evidence for functional conservation. The key p53-degrading function of Mdm2 is also conserved in TaMdm2. Tap53 retained DNA binding associated with p53 transcription activation function. However, it lacked transactivation function in reporter genes assays using a heterologous cell line, suggesting a cofactor incompatibility. Overall, the data supports functional roles for TaMdm2 and Tap53, and further defines the p53 pathway as an evolutionary conserved fulcrum mediating cellular response to stress.

  14. PRMT1-Mediated Translation Regulation Is a Crucial Vulnerability of Cancer.

    PubMed

    Hsu, Jessie Hao-Ru; Hubbell-Engler, Benjamin; Adelmant, Guillaume; Huang, Jialiang; Joyce, Cailin E; Vazquez, Francisca; Weir, Barbara A; Montgomery, Philip; Tsherniak, Aviad; Giacomelli, Andrew O; Perry, Jennifer A; Trowbridge, Jennifer; Fujiwara, Yuko; Cowley, Glenn S; Xie, Huafeng; Kim, Woojin; Novina, Carl D; Hahn, William C; Marto, Jarrod A; Orkin, Stuart H

    2017-09-01

    Through an shRNA screen, we identified the protein arginine methyltransferase Prmt1 as a vulnerable intervention point in murine p53/Rb-null osteosarcomas, the human counterpart of which lacks effective therapeutic options. Depletion of Prmt1 in p53-deficient cells impaired tumor initiation and maintenance in vitro and in vivo Mechanistic studies reveal that translation-associated pathways were enriched for Prmt1 downstream targets, implicating Prmt1 in translation control. In particular, loss of Prmt1 led to a decrease in arginine methylation of the translation initiation complex, thereby disrupting its assembly and inhibiting translation. p53/Rb-null cells were sensitive to p53-induced translation stress, and analysis of human cancer cell line data from Project Achilles further revealed that Prmt1 and translation-associated pathways converged on the same functional networks. We propose that targeted therapy against Prmt1 and its associated translation-related pathways offer a mechanistic rationale for treatment of osteosarcomas and other cancers that exhibit dependencies on translation stress response. Cancer Res; 77(17); 4613-25. ©2017 AACR . ©2017 American Association for Cancer Research.

  15. Nutlin-3 down-regulates retinoblastoma protein expression and inhibits muscle cell differentiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walsh, Erica M.; Niu, MengMeng; Bergholz, Johann

    The p53 tumor suppressor gene plays a critical role in regulation of proliferation, cell death and differentiation. The MDM2 oncoprotein is a major negative regulator for p53 by binding to and targeting p53 for proteasome-mediated degradation. The small molecule inhibitor, nutlin-3, disrupts MDM2-p53 interaction resulting in stabilization and activation of p53 protein. We have previously shown that nutlin-3 activates p53, leading to MDM2 accumulation as concomitant of reduced retinoblastoma (Rb) protein stability. It is well known that Rb is important in muscle development and myoblast differentiation and that rhabdomyosarcoma (RMS), or cancer of the skeletal muscle, typically harbors MDM2 amplification.more » In this study, we show that nutlin-3 inhibited myoblast proliferation and effectively prevented myoblast differentiation, as evidenced by lack of expression of muscle differentiation markers including myogenin and myosin heavy chain (MyHC), as well as a failure to form multinucleated myotubes, which were associated with dramatic increases in MDM2 expression and decrease in Rb protein levels. These results indicate that nutlin-3 can effectively inhibit muscle cell differentiation. - Highlights: • Nutlin-3 inhibits myoblast proliferation and prevents differentiation into myotubes. • Nutlin-3 increases MDM2 expression and down-regulates Rb protein levels. • This study has implication in nutlin-3 treatment of rhabdomyosarcomas.« less

  16. Ziyuglycoside I Inhibits the Proliferation of MDA-MB-231 Breast Carcinoma Cells through Inducing p53-Mediated G2/M Cell Cycle Arrest and Intrinsic/Extrinsic Apoptosis.

    PubMed

    Zhu, Xue; Wang, Ke; Zhang, Kai; Zhang, Ting; Yin, Yongxiang; Xu, Fei

    2016-11-22

    Due to the aggressive clinical behavior, poor outcome, and lack of effective specific targeted therapies, triple-negative breast cancer (TNBC) has currently been recognized as one of the most malignant types of tumors. In the present study, we investigated the cytotoxic effect of ziyuglycoside I, one of the major components extracted from Chinese anti-tumor herbal Radix Sanguisorbae , on the TNBC cell line MDA-MB-231. The underlying molecular mechanism of the cytotoxic effect ziyuglycoside I on MDA-MB-231 cells was investigated with cell viability assay, flow cytometric analysis and Western blot. Compared to normal mammary gland Hs 578Bst cells, treatment of ziyuglycoside I resulted in a significant growth inhibitory effect on MDA-MB-231 cells. Ziyuglycoside I induced the G2/M phase arrest and apoptosis of MDA-MB-231 cells in a dose-dependent manner. These effects were found to be partially mediated through the up-regulation of p53 and p21 WAF1 , elevated Bax/Bcl-2 ratio, and the activation of both intrinsic (mitochondrial-initiated) and extrinsic (Fas/FasL-initiated) apoptotic pathways. Furthermore, the p53 specific siRNA attenuated these effects. Our study suggested that ziyuglycoside I-triggered MDA-MB-231 cell cycle arrest and apoptosis were probably mediated by p53. This suggests that ziyuglycoside I might be a potential drug candidate for treating TNBC.

  17. Pulsed or continuous electromagnetic field induce p53/p21-mediated apoptotic signaling pathway in mouse spermatogenic cells in vitro and thus may affect male fertility.

    PubMed

    Solek, Przemyslaw; Majchrowicz, Lena; Bloniarz, Dominika; Krotoszynska, Ewelina; Koziorowski, Marek

    2017-05-01

    The impact of electromagnetic field (EMF) on the human health and surrounding environment is a common topic investigated over the years. A significant increase in the electromagnetic field concentration arouses public concern about the long-term effects of EMF on living organisms associated with many aspects. In the present study, we investigated the effects of pulsed and continuous electromagnetic field (PEMF/CEMF) on mouse spermatogenic cell lines (GC-1 spg and GC-2 spd) in terms of cellular and biochemical features in vitro. We evaluated the effect of EMF on mitochondrial metabolism, morphology, proliferation rate, viability, cell cycle progression, oxidative stress balance and regulatory proteins. Our results strongly suggest that EMF induces oxidative and nitrosative stress-mediated DNA damage, resulting in p53/p21-dependent cell cycle arrest and apoptosis. Therefore, spermatogenic cells due to the lack of antioxidant enzymes undergo oxidative and nitrosative stress-mediated cytotoxic and genotoxic events, which contribute to infertility by reduction in healthy sperm cells pool. In conclusion, electromagnetic field present in surrounding environment impairs male fertility by inducing p53/p21-mediated cell cycle arrest and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Monitoring p53 by MDM2 and MDMX is required for endocrine pancreas development and function in a spatio-temporal manner.

    PubMed

    Zhang, Yiwei; Zeng, Shelya X; Hao, Qian; Lu, Hua

    2017-03-01

    Although p53 is not essential for normal embryonic development, it plays a pivotal role in many biological and pathological processes, including cell fate determination-dependent and independent events and diseases. The expression and activity of p53 largely depend on its two biological inhibitors, MDM2 and MDMX, which have been shown to form a complex in order to tightly control p53 to an undetectable level during early stages of embryonic development. However, more delicate studies using conditional gene-modification mouse models show that MDM2 and MDMX may function separately or synergistically on p53 regulation during later stages of embryonic development and adulthood in a cell and tissue-specific manner. Here, we report the role of the MDM2/MDMX-p53 pathway in pancreatic islet morphogenesis and functional maintenance, using mouse lines with specific deletion of MDM2 or MDMX in pancreatic endocrine progenitor cells. Interestingly, deletion of MDM2 results in defects of embryonic endocrine pancreas development, followed by neonatal hyperglycemia and lethality, by inducing pancreatic progenitor cell apoptosis and inhibiting cell proliferation. However, unlike MDM2-knockout animals, mice lacking MDMX in endocrine progenitor cells develop normally. But, surprisingly, the survival rate of adult MDMX-knockout mice drastically declines compared to control mice, as blockage of neonatal development of endocrine pancreas by inhibition of cell proliferation and subsequent islet dysfunction and hyperglycemia eventually lead to type 1 diabetes-like disease with advanced diabetic nephropathy. As expected, both MDM2 and MDMX deletion-caused pancreatic defects are completely rescued by loss of p53, verifying the crucial role of the MDM2 and/or MDMX in regulating p53 in a spatio-temporal manner during the development, functional maintenance, and related disease progress of endocrine pancreas. Also, our study suggests a possible mouse model of advanced diabetic nephropathy, which is complementary to other established diabetic models and perhaps useful for the development of anti-diabetes therapies. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Canine gastric carcinoma: immunohistochemical expression of cell cycle proteins (p53, p21, and p16) and heat shock proteins (Hsp27 and Hsp70).

    PubMed

    Carrasco, V; Canfrán, S; Rodríguez-Franco, F; Benito, A; Sáinz, A; Rodríguez-Bertos, A

    2011-01-01

    Immunohistochemical staining for cell cycle proteins and heat shock proteins was performed on 17 canine gastric carcinomas. The immunoexpression of p53, p21, p16, Hsp27, and Hsp70 was investigated. A study was conducted to determine the histological type and parameters related to tumor malignancy. Possible associations and trends were assessed between the immunoexpression of each protein and tumor type as well as specific parameters of malignancy. High intratumor frequency of cellular p53 immunostaining was observed (61.96% average), but lower frequencies of p21 and p16 expression were present (34.65% and 10.41%, respectively). The p53 overexpression was associated with tumor infiltration (P = .0258). Expression of p21 was lower in undifferentiated carcinomas, and the loss of expression was associated with histopathological parameters characteristic of a poor prognosis such as lymphatic vessel invasion (P = .0258). The lack of p16 immunoreactivity was related to histopathological characteristics of malignancy such as the presence of evident and multiple nucleoli (P = .0475). In contrast, deep tumor infiltration was observed in those carcinomas with a high p16 index (P = .0475). Hsp70 appeared to be overexpressed in all gastric neoplasms included in this study. This is in contrast to Hsp27, because a group of tumors showed complete lack of Hsp27 immunoexpression, whereas the others displayed extensive Hsp27 immunostaining. The differences in Hsp27 did not correlate with any of the histopathological parameters, but Hsp27 immunoexpression was higher in the undifferentiated carcinoma. No significant differences in the expression of the proteins were found in canine gastric carcinomas according to their histological type. These findings may be useful for establishing a prognosis for canine gastric carcinoma.

  20. Aberrant AKT activation drives well-differentiated liposarcoma

    PubMed Central

    Gutierrez, Alejandro; Snyder, Eric L.; Marino-Enriquez, Adrian; Zhang, Yi-Xiang; Sioletic, Stefano; Kozakewich, Elena; Grebliunaite, Ruta; Ou, Wen-bin; Sicinska, Ewa; Raut, Chandrajit P.; Demetri, George D.; Perez-Atayde, Antonio R.; Wagner, Andrew J.; Fletcher, Jonathan A.; Fletcher, Christopher D. M.; Look, A. Thomas

    2011-01-01

    Well-differentiated liposarcoma (WDLPS), one of the most common human sarcomas, is poorly responsive to radiation and chemotherapy, and the lack of animal models suitable for experimental analysis has seriously impeded functional investigation of its pathobiology and development of effective targeted therapies. Here, we show that zebrafish expressing constitutively active Akt2 in mesenchymal progenitors develop WDLPS that closely resembles the human disease. Tumor incidence rates were 8% in p53 wild-type zebrafish, 6% in p53 heterozygotes, and 29% in p53-homozygous mutant zebrafish (P = 0.013), indicating that aberrant Akt activation collaborates with p53 mutation in WDLPS pathogenesis. Analysis of primary clinical specimens of WDLPS, and of the closely related dedifferentiated liposarcoma (DDLPS) subtype, revealed immunohistochemical evidence of AKT activation in 27% of cases. Western blot analysis of a panel of cell lines derived from patients with WDLPS or DDLPS revealed robust AKT phosphorylation in all cell lines examined, even when these cells were cultured in serum-free media. Moreover, BEZ235, a small molecule inhibitor of PI3K and mammalian target of rapamycin that effectively inhibits AKT activation in these cells, impaired viability at nanomolar concentrations. Our findings are unique in providing an animal model to decipher the molecular pathogenesis of WDLPS, and implicate AKT as a previously unexplored therapeutic target in this chemoresistant sarcoma. PMID:21930930

  1. PPAR{gamma} ligands induce growth inhibition and apoptosis through p63 and p73 in human ovarian cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Soyeon; Innovative Research Institute for Cell Therapy, Seoul National University College of Medicine and Hospital, Seoul; Lee, Jae-Jung

    2011-03-18

    Research highlights: {yields} PPAR{gamma} ligands increased the rate of apoptosis and inhibition of proliferation in ovarian cancer cells. {yields} PPAR{gamma} ligands induced p63 and p73 expression, but not p53. {yields} p63 and p73 leads to an increase in p21 expression and apoptosis in ovarian cancer cells with treatment PPAR{gamma} ligands. {yields} These findings suggest that PPAR{gamma} ligands suppressed growth of ovarian cancer cells through upregulation of p63 and p73. -- Abstract: Peroxisome proliferator-activated receptor gamma (PPAR{gamma}) agonists, including thiazolidinediones (TZDs), can induce anti-proliferation, differentiation, and apoptosis in various cancer cell types. This study investigated the mechanism of the anticancer effectmore » of TZDs on human ovarian cancer. Six human ovarian cancer cell lines (NIH:OVCAR3, SKOV3, SNU-251, SNU-8, SNU-840, and 2774) were treated with the TZD, which induced dose-dependent inhibition of cell growth. Additionally, these cell lines exhibited various expression levels of PPAR{gamma} protein as revealed by Western blotting. Flow cytometry showed that the cell cycle was arrested at the G1 phase, as demonstrated by the appearance of a sub-G1 peak. This observation was corroborated by the finding of increased levels of Bax, p21, PARP, and cleaved caspase 3 in TGZ-treated cells. Interestingly, when we determined the effect of p53-induced growth inhibition in these three human ovarian cancer cells, we found that they either lacked p53 or contained a mutant form of p53. Furthermore, TGZ induced the expression of endogenous or exogenous p63 and p73 proteins and p63- or p73-directed short hairpin (si) RNAs inhibited the ability of TGZ to regulate expression of p21 in these cells. Thus, our results suggest that PPAR{gamma} ligands can induce growth suppression of ovarian cancer cells and mediate p63 and p73 expression, leading to enhanced growth inhibition and apoptosis. The tumor suppressive effects of PPAR{gamma} ligands may have applications for the treatment of ovarian cancer.« less

  2. Autophagy is induced through the ROS-TP53-DRAM1 pathway in response to mitochondrial protein synthesis inhibition.

    PubMed

    Xie, Xiaolei; Le, Li; Fan, Yanxin; Lv, Lin; Zhang, Junjie

    2012-07-01

    Mitoribosome in mammalian cells is responsible for synthesis of 13 mtDNA-encoded proteins, which are integral parts of four mitochondrial respiratory chain complexes (I, III, IV and V). ERAL1 is a nuclear-encoded GTPase important for the formation of the 28S small mitoribosomal subunit. Here, we demonstrate that knockdown of ERAL1 by RNA interference inhibits mitochondrial protein synthesis and promotes reactive oxygen species (ROS) generation, leading to autophagic vacuolization in HeLa cells. Cells that lack ERAL1 expression showed a significant conversion of LC3-I to LC3-II and an enhanced accumulation of autophagic vacuoles carrying the LC3 marker, all of which were blocked by the autophagy inhibitor 3-MA as well as by the ROS scavenger NAC. Inhibition of mitochondrial protein synthesis either by ERAL1 siRNA or chloramphenicol (CAP), a specific inhibitor of mitoribosomes, induced autophagy in HTC-116 TP53 (+/+) cells, but not in HTC-116 TP53 (-/-) cells, indicating that tumor protein 53 (TP53) is essential for the autophagy induction. The ROS elevation resulting from mitochondrial protein synthesis inhibition induced TP53 expression at transcriptional levels by enhancing TP53 promoter activity, and increased TP53 protein stability by suppressing TP53 ubiquitination through MAPK14/p38 MAPK-mediated TP53 phosphorylation. Upregulation of TP53 and its downstream target gene DRAM1, but not CDKN1A/p21, was required for the autophagy induction in ERAL1 siRNA or CAP-treated cells. Altogether, these data indicate that autophagy is induced through the ROS-TP53-DRAM1 pathway in response to mitochondrial protein synthesis inhibition.

  3. Gamma rays induce a p53-independent mitochondrial biogenesis that is counter-regulated by HIF1α

    PubMed Central

    Bartoletti-Stella, A; Mariani, E; Kurelac, I; Maresca, A; Caratozzolo, M F; Iommarini, L; Carelli, V; Eusebi, L H; Guido, A; Cenacchi, G; Fuccio, L; Rugolo, M; Tullo, A; Porcelli, A M; Gasparre, G

    2013-01-01

    Mitochondrial biogenesis is an orchestrated process that presides to the regulation of the organelles homeostasis within a cell. We show that γ-rays, at doses commonly used in the radiation therapy for cancer treatment, induce an increase in mitochondrial mass and function, in response to a genotoxic stress that pushes cells into senescence, in the presence of a functional p53. Although the main effector of the response to γ-rays is the p53-p21 axis, we demonstrated that mitochondrial biogenesis is only indirectly regulated by p53, whose activation triggers a murine double minute 2 (MDM2)-mediated hypoxia-inducible factor 1α (HIF1α) degradation, leading to the release of peroxisome-proliferator activated receptor gamma co-activator 1β inhibition by HIF1α, thus promoting mitochondrial biogenesis. Mimicking hypoxia by HIF1α stabilization, in fact, blunts the mitochondrial response to γ-rays as well as the induction of p21-mediated cell senescence, indicating prevalence of the hypoxic over the genotoxic response. Finally, we also show in vivo that post-radiotherapy mitochondrial DNA copy number increase well correlates with lack of HIF1α increase in the tissue, concluding this may be a useful molecular tool to infer the trigger of a hypoxic response during radiotherapy, which may lead to failure of activation of cell senescence. PMID:23764844

  4. PRMT1-Mediated Translation Regulation is a Crucial Vulnerability of Cancer | Office of Cancer Genomics

    Cancer.gov

    Through an shRNA screen, we identified the protein arginine methyltransferase Prmt1 as a vulnerable intervention point in murine p53/Rb-null osteosarcomas, the human counterpart of which lacks effective therapeutic options. Depletion of Prmt1 in p53-deficient cells impaired tumor initiation and maintenance in vitro and in vivo Mechanistic studies reveal that translation-associated pathways were enriched for Prmt1 downstream targets, implicating Prmt1 in translation control.

  5. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

    PubMed Central

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-01-01

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984

  6. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    PubMed

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  7. E2F1 and E2F2 prevent replicative stress and subsequent p53-dependent organ involution.

    PubMed

    Iglesias-Ara, A; Zenarruzabeitia, O; Buelta, L; Merino, J; Zubiaga, A M

    2015-10-01

    Tissue homeostasis requires tight regulation of cellular proliferation, differentiation and apoptosis. E2F1 and E2F2 transcription factors share a critical role in tissue homeostasis, since their combined inactivation results in overall organ involution, specially affecting the pancreatic gland, which subsequently triggers diabetes. We have examined the mechanism by which these E2Fs regulate tissue homeostasis. We show that pancreas atrophy in E2F1/E2F2 double-knockout (DKO) mice is associated with mitochondrial apoptosis and activation of the p53 pathway in young animals, before the development of diabetes. A deregulated expression of E2F target genes was detected in pancreatic cells of young DKO animals, along with unscheduled DNA replication and activation of a DNA damage response. Importantly, suppression of DNA replication in vivo with aphidicolin led to a significant inhibition of the p53 pathway in DKO pancreas, implying a causal link between DNA replication stress and p53 activation in this model. We further show that activation of the p53 pathway has a key role in the aberrant phenotype of DKO mice, since targeted inactivation of p53 gene abrogated cellular apoptosis and prevented organ involution and insulin-dependent diabetes in mice lacking E2F1/E2F2. Unexpectedly, p53 inactivation unmasked oncogenic features of E2F1/E2F2-depleted cells, as evidenced by an accelerated tumor development in triple-knockout mice compared with p53(-/-) mice. Collectively, our data reveal a role for E2F1 and E2F2 as suppressors of replicative stress in differentiating cells, and uncover the existence of a robust E2F-p53 regulatory axis to enable tissue homeostasis and prevent tumorigenesis. These findings have implications in the design of approaches targeting E2F for cancer therapy.

  8. E2F1 and E2F2 prevent replicative stress and subsequent p53-dependent organ involution

    PubMed Central

    Iglesias-Ara, A; Zenarruzabeitia, O; Buelta, L; Merino, J; Zubiaga, A M

    2015-01-01

    Tissue homeostasis requires tight regulation of cellular proliferation, differentiation and apoptosis. E2F1 and E2F2 transcription factors share a critical role in tissue homeostasis, since their combined inactivation results in overall organ involution, specially affecting the pancreatic gland, which subsequently triggers diabetes. We have examined the mechanism by which these E2Fs regulate tissue homeostasis. We show that pancreas atrophy in E2F1/E2F2 double-knockout (DKO) mice is associated with mitochondrial apoptosis and activation of the p53 pathway in young animals, before the development of diabetes. A deregulated expression of E2F target genes was detected in pancreatic cells of young DKO animals, along with unscheduled DNA replication and activation of a DNA damage response. Importantly, suppression of DNA replication in vivo with aphidicolin led to a significant inhibition of the p53 pathway in DKO pancreas, implying a causal link between DNA replication stress and p53 activation in this model. We further show that activation of the p53 pathway has a key role in the aberrant phenotype of DKO mice, since targeted inactivation of p53 gene abrogated cellular apoptosis and prevented organ involution and insulin-dependent diabetes in mice lacking E2F1/E2F2. Unexpectedly, p53 inactivation unmasked oncogenic features of E2F1/E2F2-depleted cells, as evidenced by an accelerated tumor development in triple-knockout mice compared with p53−/− mice. Collectively, our data reveal a role for E2F1 and E2F2 as suppressors of replicative stress in differentiating cells, and uncover the existence of a robust E2F-p53 regulatory axis to enable tissue homeostasis and prevent tumorigenesis. These findings have implications in the design of approaches targeting E2F for cancer therapy. PMID:25656653

  9. Curcumin causes superoxide anion production and p53-independent apoptosis in human colon cancer cells.

    PubMed

    Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W

    2010-11-01

    Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.

  10. Regulators of apoptosis in cholangiocarcinoma.

    PubMed

    Jhala, Nirag C; Vickers, Selwyn M; Argani, Pedram; McDonald, Jay M

    2005-04-01

    Dysregulation of mediators of apoptosis is associated with carcinogenesis. For biliary duct cancers, p53 gene mutation is an important contributor to carcinogenesis. Mutations in the p53 gene affect transcription of the Fas gene, resulting in lack of Fas expression on cell membrane. It has been previously shown that cloned Fas-negative but not Fas-positive human cholangiocarcinoma cells are resistant to anti-Fas-mediated apoptosis and develop tumors in nude mice. In addition, interferon gamma induces Fas expression in Fas-negative cholangiocarcinoma cells and makes them susceptible to apoptosis. Therefore, it becomes important to characterize immunophenotypic expression of p53 and Fas in normal and neoplastic human tissues of the biliary tract to further understand the pathogenesis of the disease. To date, human studies to characterize differences in immunophenotypic expression of the Fas protein between intrahepatic and extrahepatic biliary duct cancers and in their precursor lesions have not been performed. To report the immunophenotypic expression of p53 and Fas expression in various stages in the development of bile duct cancers (intrahepatic and extrahepatic tumor location) and their association with tumor differentiation. Thirty bile duct cancer samples (13 intrahepatic and 17 extrahepatic) from 18 men and 12 women who ranged in age from 44 to 77 years (mean age, 65.6 years) were retrieved from the surgical pathology files. Hematoxylin-eosin-stained slides were evaluated for the type and grade of tumor and dysplastic changes in the biliary tract epithelium. Additional slides were immunohistochemically stained with p53 and anti-Fas mouse monoclonal antibody. The pattern of Fas distribution and percentage of cells positive for p53 and Fas expression were determined. The percentage of Fas-expressing cells is significantly (P = .01) more frequently noted in extrahepatic tumors compared with intrahepatic tumors. Furthermore, Fas expression decreased from dysplastic epithelium to cholangiocarcinoma (P = .01), and this decreasing trend continued from well to poorly differentiated tumors. Nuclear p53 expression was not identified in normal and dysplastic epithelium but was noted in 30% of carcinomas (P = .02). Fas expression is an early event in pathogenesis of bile duct cancers. Immunophenotypic expression of Fas is associated with well to moderately differentiated tumors but not with poor tumor differentiation.

  11. Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

    PubMed

    Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

    2012-04-01

    Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

  12. TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.

    PubMed

    Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J

    2005-12-08

    TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

  13. A High-Content Small Molecule Screen Identifies Sensitivity of Glioblastoma Stem Cells to Inhibition of Polo-Like Kinase 1

    PubMed Central

    Danovi, Davide; Folarin, Amos; Gogolok, Sabine; Ender, Christine; Elbatsh, Ahmed M. O.; Engström, Pär G.; Stricker, Stefan H.; Gagrica, Sladjana; Georgian, Ana; Yu, Ding; U, Kin Pong; Harvey, Kevin J.; Ferretti, Patrizia; Paddison, Patrick J.; Preston, Jane E.; Abbott, N. Joan; Bertone, Paul; Smith, Austin; Pollard, Steven M.

    2013-01-01

    Glioblastoma multiforme (GBM) is the most common primary brain cancer in adults and there are few effective treatments. GBMs contain cells with molecular and cellular characteristics of neural stem cells that drive tumour growth. Here we compare responses of human glioblastoma-derived neural stem (GNS) cells and genetically normal neural stem (NS) cells to a panel of 160 small molecule kinase inhibitors. We used live-cell imaging and high content image analysis tools and identified JNJ-10198409 (J101) as an agent that induces mitotic arrest at prometaphase in GNS cells but not NS cells. Antibody microarrays and kinase profiling suggested that J101 responses are triggered by suppression of the active phosphorylated form of polo-like kinase 1 (Plk1) (phospho T210), with resultant spindle defects and arrest at prometaphase. We found that potent and specific Plk1 inhibitors already in clinical development (BI 2536, BI 6727 and GSK 461364) phenocopied J101 and were selective against GNS cells. Using a porcine brain endothelial cell blood-brain barrier model we also observed that these compounds exhibited greater blood-brain barrier permeability in vitro than J101. Our analysis of mouse mutant NS cells (INK4a/ARF−/−, or p53−/−), as well as the acute genetic deletion of p53 from a conditional p53 floxed NS cell line, suggests that the sensitivity of GNS cells to BI 2536 or J101 may be explained by the lack of a p53-mediated compensatory pathway. Together these data indicate that GBM stem cells are acutely susceptible to proliferative disruption by Plk1 inhibitors and that such agents may have immediate therapeutic value. PMID:24204733

  14. Heterogeneity of p53 dependent genomic responses following ethanol exposure in a developmental mouse model of fetal alcohol spectrum disorder.

    PubMed

    Camargo Moreno, Maria; Mooney, Sandra M; Middleton, Frank A

    2017-01-01

    Prenatal ethanol exposure can produce structural and functional deficits in the brain and result in Fetal Alcohol Spectrum Disorder (FASD). In rodent models acute exposure to a high concentration of alcohol causes increased apoptosis in the developing brain. A single causal molecular switch that signals for this increase in apoptosis has yet to be identified. The protein p53 has been suggested to play a pivotal role in enabling cells to engage in pro-apoptotic processes, and thus figures prominently as a hub molecule in the intracellular cascade of responses elicited by alcohol exposure. In the present study we examined the effect of ethanol-induced cellular and molecular responses in primary somatosensory cortex (SI) and hippocampus of 7-day-old wild-type (WT) and p53-knockout (KO) mice. We quantified apoptosis by active caspase-3 immunohistochemistry and ApopTag™ labeling, then determined total RNA expression levels in laminae of SI and hippocampal subregions. Immunohistochemical results confirmed increased incidence of apoptotic cells in both regions in WT and KO mice following ethanol exposure. The lack of p53 was not protective in these brain regions. Molecular analyses revealed a heterogeneous response to ethanol exposure that varied depending on the subregion, and which may go undetected using a global approach. Gene network analyses suggest that the presence or absence of p53 alters neuronal function and synaptic modifications following ethanol exposure, in addition to playing a classic role in cell cycle signaling. Thus, p53 may function in a way that underlies the intellectual and behavioral deficits observed in FASD.

  15. Combined radiation and p53 gene therapy of malignant glioma cells.

    PubMed

    Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

    1999-01-01

    More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We conclude that responses to p53 gene therapy are variable among gliomas and most likely depend upon both cellular p53 status and as yet ill-defined downstream pathways involving activation of cell cycle regulatory and apoptotic genes.

  16. Telomere dysfunction and cell survival: Roles for distinct TIN2-containing complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Sahn-ho; Davalos, Albert R.; Heo, Seok-Jin

    Telomeres are maintained by three DNA binding proteins (TRF1, TRF2 and POT1), and several associated factors. One factor, TIN2, binds TRF1 and TRF2 directly and POT1 indirectly. Along with two other proteins, TPP1 and hRap1, these form a soluble complex that may be the core telomere maintenance complex. It is not clear whether sub-complexes also exist in vivo. We provide evidence for two TIN2 sub-complexes with distinct functions in human cells. We isolated these two TIN2 sub-complexes from nuclear lysates of unperturbed cells and cells expressing TIN2 mutants TIN2-13, TIN2-15C, which cannot bind TRF2 or TRF1, respectively. In cells withmore » wild-type p53 function, TIN2-15C was more potent than TIN2-13 in causing telomere uncapping and eventual growth arrest. In cells lacking p53 function, TIN2-15C was more potent than TIN2-13 in causing telomere dysfunction and cell death. Our findings suggest that distinct TIN2 complexes exist, and that TIN2-15C-sensitive subcomplexes are particularly important for cell survival in the absence of functional p53.« less

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53more » status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.« less

  18. Suppression of Innate Immune Response by Primary Human Keratinocytes Expressing HPV-16 E6 and E7

    DTIC Science & Technology

    2005-01-01

    respectively. High-risk HPVs have been correlated with at least 90% of cervical cancers and more than 50% of other anogenital cancers (113). 10 An in vitro...substantiated by the lack of p53 mutations discovered in HPV -related cancers . Through the binding and degradation of p53, E6 can drive cells with chromosomal...of class I molecules and accessory proteins, such as TAP-1, are down-regulated in HPV infections and cervical cancers [reviewed in (71, 108

  19. Expression of p27 and its ubiquitin ligase subunit Skp2 in upper urinary tract transitional cell carcinoma.

    PubMed

    Langner, Cord; von Wasielewski, Reinhard; Ratschek, Manfred; Rehak, Peter; Zigeuner, Richard

    2004-09-01

    To analyze p27 and S-phase kinase-associated protein 2 (Skp2) expression in upper urinary tract transitional cell carcinoma (TCC) with respect to biologic significance. p27 (p27/kip1) is involved in cell cycle control, and loss of p27 protein expression may result in tumor development and/or progression. The association of p27 with the ubiquitin ligase subunit Skp2 targets p27 for degradation. A total of 53 upper urinary tract TCC specimens were investigated immunohistochemically using a tissue microarray technique. The immunoreactivity of p27 and Skp2 was analyzed with respect to associations with pT stage, grade, and prognosis. Non-neoplastic renal tissue showed p27 immunoreactivity in tubule epithelium and pelvic urothelium, but lacked immunoreactivity for Skp2. In the TCC specimens, p27 immunoreactivity was noted in 47 (89%) of 53 cases. High p27 expression (50% or greater of tumor cell nuclei) tended to decrease with rising tumor stage (14 [45%] of 31 with pT1-pT2 versus 4 [18%] of 22 with pT3; P = 0.076), but was independent of tumor grade (11 [39%] of 28 grade 2 versus 7 [28%] of 25 grade 3-4; P = 0.56). Skp2 immunoreactivity was noted in 32 (60%) of 53 tumors. Skp2 expression increased with rising tumor stage (9 [41%] of 22 pT1 versus 23 [74%] of 31 pT2-pT3; P = 0.023) and tumor grade (12 [43%] of 28 grade 2 versus 20 [80%] of 25 grade 3; P = 0.043) and was associated with angioinvasion (P = 0.017). In multivariate analysis, tumor stage proved to be the only independent prognostic factor regarding disease-free survival. p27 and Skp2 are additional biomarkers in urogenital pathologic findings. The statistically significant association of Skp2 expression with high-grade TCC, as well as the lack of expression in non-neoplastic tissue, suggests that Skp2 could be a promising target for future cancer therapy strategies.

  20. Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status

    PubMed Central

    Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L

    2000-01-01

    p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365

  1. Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.

    PubMed

    He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu

    2015-02-10

    Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.

  2. Reduced hippocampal damage and epileptic seizures after status epilepticus in mice lacking proapoptotic Puma

    PubMed Central

    Engel, Tobias; Murphy, Brona M.; Hatazaki, Seiji; Jimenez-Mateos, Eva M.; Concannon, Caoimhin G.; Woods, Ina; Prehn, Jochen H. M.; Henshall, David C.

    2010-01-01

    The functional significance of neuronal death for pathogenesis of epilepsy and the underlying molecular mechanisms thereof remain incompletely understood. The p53 transcription factor has been implicated in seizure damage, but its target genes and the influence of cell death under its control on epilepsy development are unknown. In the present study, we report that status epilepticus (SE) triggered by intra-amygdala kainic acid in mice causes rapid p53 accumulation and subsequent hippocampal damage. Expression of p53-up-regulated mediator of apoptosis (Puma), a proapoptotic Bcl-2 homology domain 3-only protein under p53 control, was increased within a few hours of SE. Induction of Puma was blocked by pharmacologic inhibition of p53, and hippocampal damage was also reduced. Puma induction was also blocked in p53-deficient mice subject to SE. Compared to Puma-expressing mice, Puma-deficient mice had significantly smaller hippocampal lesions after SE. Long-term, continuous telemetric EEG monitoring revealed a ∼60% reduction in the frequency of epileptic seizures in the Puma-deficient mice compared to Puma-expressing mice. These are the first data showing genetic deletion of a proapoptotic protein acting acutely to influence neuronal death subsequently alters the phenotype of epilepsy in the long-term, supporting the concept that apoptotic pathway activation is a trigger of epileptogenesis.—Engel, T., Murphy, B. M., Hatazaki, S., Jimenez-Mateos, E. M., Concannon, C. G., Woods, I., Prehn, J. H. M., Henshall, D. C. Reduced hippocampal damage and epileptic seizures after status epilepticus in mice lacking proapoptotic Puma. PMID:19890018

  3. Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer

    PubMed Central

    Knight, Jennifer F.; Lesurf, Robert; Zhao, Hong; Pinnaduwage, Dushanthi; Davis, Ryan R.; Saleh, Sadiq M. I.; Zuo, Dongmei; Naujokas, Monica A.; Chughtai, Naila; Herschkowitz, Jason I.; Prat, Aleix; Mulligan, Anna Marie; Muller, William J.; Cardiff, Robert D.; Gregg, Jeff P.; Andrulis, Irene L.; Hallett, Michael T.; Park, Morag

    2013-01-01

    Triple-negative breast cancer (TNBC) accounts for ∼20% of cases and contributes to basal and claudin-low molecular subclasses of the disease. TNBCs have poor prognosis, display frequent mutations in tumor suppressor gene p53 (TP53), and lack targeted therapies. The MET receptor tyrosine kinase is elevated in TNBC and transgenic Met models (Metmt) develop basal-like tumors. To investigate collaborating events in the genesis of TNBC, we generated Metmt mice with conditional loss of murine p53 (Trp53) in mammary epithelia. Somatic Trp53 loss, in combination with Metmt, significantly increased tumor penetrance over Metmt or Trp53 loss alone. Unlike Metmt tumors, which are histologically diverse and enriched in a basal-like molecular signature, the majority of Metmt tumors with Trp53 loss displayed a spindloid pathology with a distinct molecular signature that resembles the human claudin-low subtype of TNBC, including diminished claudins, an epithelial-to-mesenchymal transition signature, and decreased expression of the microRNA-200 family. Moreover, although mammary specific loss of Trp53 promotes tumors with diverse pathologies, those with spindloid pathology and claudin-low signature display genomic Met amplification. In both models, MET activity is required for maintenance of the claudin-low morphological phenotype, in which MET inhibitors restore cell-cell junctions, rescue claudin 1 expression, and abrogate growth and dissemination of cells in vivo. Among human breast cancers, elevated levels of MET and stabilized TP53, indicative of mutation, correlate with highly proliferative TNBCs of poor outcome. This work shows synergy between MET and TP53 loss for claudin-low breast cancer, identifies a restricted claudin-low gene signature, and provides a rationale for anti-MET therapies in TNBC. PMID:23509284

  4. Cytoplasmic sequestration of the tumor suppressor p53 by a heat shock protein 70 family member, mortalin, in human colorectal adenocarcinoma cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gestl, Erin E., E-mail: egestl@wcupa.edu; Anne Boettger, S., E-mail: aboettger@wcupa.edu

    2012-06-29

    Highlights: Black-Right-Pointing-Pointer Eight human colorectal cell lines were evaluated for p53 and mortalin localization. Black-Right-Pointing-Pointer Six cell lines displayed cytoplasmic sequestration of the tumor suppressor p53. Black-Right-Pointing-Pointer Direct interaction between mortalin and p53 was shown in five cell lines. Black-Right-Pointing-Pointer Cell lines positive for p53 sequestration yielded elevated p53 expression levels. Black-Right-Pointing-Pointer This study yields the first evidence of cytoplasmic sequestration p53 by mortalin. -- Abstract: While it is known that cytoplasmic retention of p53 occurs in many solid tumors, the mechanisms responsible for this retention have not been positively identified. Since heatshock proteins like mortalin have been associated withmore » p53 inactivation in other tumors, the current study sought to characterize this potential interaction in never before examined colorectal adenocarcinoma cell lines. Six cell lines, one with 3 different fractions, were examined to determine expression of p53 and mortalin and characterize their cellular localization. Most of these cell lines displayed punctate p53 and mortalin localization in the cell cytoplasm with the exception of HCT-8 and HCT116 379.2 cells, where p53 was not detected. Nuclear p53 was only observed in HCT-116 40-16, LS123, and HT-29 cell lines. Mortalin was only localized in the cytoplasm in all cell lines. Co-immunoprecipitation and immunohistochemistry revealed that p53 and mortalin were bound and co-localized in the cytoplasmic fraction of four cell lines, HCT-116 (40-16 and 386; parental and heterozygous fractions respectively of the same cell line), HT-29, LS123 and LoVo, implying that p53 nuclear function is limited in those cell lines by being restricted to the cytoplasm. Mortalin gene expression levels were higher than gene expression levels of p53 in all cell lines. Cell lines with cytoplasmic sequestration of p53, however, also displayed elevated p53 gene expression levels compared to cell lines without p53 sequestration. Our data reveal the characteristic cytoplasmic sequestration of p53 by the heat shock protein mortalin in human colorectal adenocarcinoma cell lines, as is the case for other cancers, such as glioblastomas and hepatocellular carcinomas.« less

  5. Human urinary bladder epithelial cells lacking wild-type p53 function are deficient in the repair of 4-aminobiphenyl-DNA adducts in genomic DNA.

    PubMed

    Swaminathan, Santhanam; Torino, Jennifer L; Burger, Melissa S

    2002-01-29

    The effect of the tumor suppressor gene TP53 on repair of genomic DNA damage was examined in human urinary bladder transitional cell carcinoma (TCC) cell lines. Utilizing TCC10 containing wild-type p53 (wt-p53) as the parental line, an isogenic set of cell lines was derived by retroviral infection that expressed a transdominant mutant p53 (Arg --> His at codon 273, TDM273-TCC10), or the human papilloma virus 16-E6 oncoprotein (E6-TCC10). 32P-postlabeling analyses were performed on DNA from TCC cultures obtained after treatment with N-hydroxy-4-aminobiphenyl (N-OH-ABP), N-hydroxy-4-acetylaminobiphenyl (N-OH-AABP) and N-acetoxy-4-acetylaminobiphenyl (N-OAc-AABP). The major adduct was identified as N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP) with all three chemicals. The amount of adducts in urothelial DNA ranged between 0.1 and 20 per 10(6) nucleotides, N-OAc-AABP yielding the highest levels, followed by N-OH-ABP and N-OH-AABP. To determine, if the functional status of p53 affects the rate of repair of dG-C8-ABP in genomic DNA, TCC10 and the TDM273-TCC10 and E6-TCC10 isotypes were exposed to N-OH-AABP for 12h and the DNA damage was allowed to repair up to 24h. The adduct levels were quantified and compared between the TCC10 isotypes. The amounts of dG-C8-ABP that remained in genomic DNA from E6-TCC10 and TDM273-TCC10 were approximately two-fold higher, as compared to the parental TCC10. At the dose used for DNA repair studies, N-OH-AABP or N-OAc-AABP did not induce apoptosis in TCC10. However, N-OAc-AABP at high doses (>5 microM) induced apoptosis, as evidenced by DNA fragmentation analyses. Furthermore, N-OAc-AABP-mediated apoptosis was independent of the functional status of wt-p53, since both E6-TCC10 and the parental TCC10 exhibited DNA fragmentation following treatment. These results suggest that p53 might modulate the repair of DNA adducts generated from the human bladder carcinogen ABP in its target human uroepithelial cells. This implies that in p53 null cells the unrepaired DNA damage could cause accumulation of mutation, which might contribute to increased genomic instability and neoplastic progression.

  6. Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

    PubMed Central

    Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

    2012-01-01

    During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

  7. A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53

    PubMed Central

    Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena

    2016-01-01

    p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

  8. CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

    PubMed

    He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

    2016-01-01

    The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

  9. Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.

    PubMed

    Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald

    2013-04-17

    The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

  10. The impact of p53 on the early stage replication of retrovirus.

    PubMed

    Kinnetz, Michaela; Alghamdi, Faris; Racz, Michael; Hu, Wenwei; Shi, Binshan

    2017-08-09

    The function of p53 in cancer biology has been studied extensively, but its role in anti-retrovirus infection has been elusive for many years. The restriction of retrovirus early stage replication by p53 was investigated in this study. VSV-G pseudotyped retrovirus with GFP reporter gene was used to infect both HCT116 p53 +/+ cells and its isogenic p53 knockout HCT116 p53 -/- cells. The infection was detected by flow cytometry. Reverse transcription products were quantified by real time PCR. Mutation analysis was performed after 1-LTR cycle and 2-LTR cycle DNA were amplified and PCR products were sequenced. Transcription and translation of cyclin-dependent kinase inhibitor 1 (p21 Cip1 ) and SAM domain and HD domain-containing protein 1 (SAMHD1) were analyzed by TaqMan PCR and Western blot experiments. siRNA experiment was applied to study the role of p53 downstream gene p21 Cip1 in the restriction of retrovirus infection. It was found that the block of retrovirus infection in non-cycling cells was significantly attenuated in HCT116 p53 -/- cells when compared to HCT116 p53 +/+ cells. It was found that both late reverse transcription products and viral 2-LTR cycle DNA were significantly increased in infected non-cycling HCT116 p53 -/- cells. Furthermore, the mutation frequency detected in 1-LTR DNA from HCT116 p53 +/+ cells were significantly decreased in comparison to HCT116 p53 -/- cells. A higher number of insertion and deletion mutations were detected in the joint region of 2-LTR cycle DNA in infected p53 +/+ cells. Cell cycle analysis showed retrovirus infection promoted host cell replication. Higher levels of mRNA and protein of p21 Cip1 were found in HCT116 p53 +/+ cells in comparison to the HCT116 p53 -/- cells. Furthermore, knockdown of p21 Cip1 in non-cycling HCT116 p53 +/+ cells significantly increased the infection. The results of this study showed that p53 is an important restriction factor that interferes with retrovirus infection in its early stage of replication. Our results suggested that p53 mediates the inhibition of retrovirus infection in non-cycling cells through it downstream gene p21 Cip1 , and p53 also functions to influence formation of 1-LTR cycle and 2-LTR cycle DNA.

  11. Hypoxia induces p53 accumulation in the S-phase and accumulation of hypophosphorylated retinoblastoma protein in all cell cycle phases of human melanoma cells.

    PubMed Central

    Danielsen, T.; Hvidsten, M.; Stokke, T.; Solberg, K.; Rofstad, E. K.

    1998-01-01

    Hypoxia has been shown to induce accumulation of p53 and of hypophosphorylated retinoblastoma protein (pRb) in tumour cells. In this study, the cell cycle dependence of p53 accumulation and pRb hypophosphorylation in four human melanoma cell lines that are wild type for p53 was investigated using two-parameter flow cytometry measurements of p53 or pRb protein content and DNA content. The hypoxia-induced increase in p53 protein was higher in S-phase than in G1 and G2 phases in all cell lines. The accumulation of p53 in S-phase during hypoxia was not related to hypoxia-induced apoptosis or substantial cell cycle specific cell inactivation during the first 24 h of reoxygenation. pRb was hypophosphorylated in all cell cycle phases by hypoxia treatment. The results did not support a direct link between p53 and pRb during hypoxia because p53 was induced in a cell cycle-specific manner, whereas no cell cycle-dependent differences in pRb hypophosphorylation were detected. Only a fraction of the cell populations (0.60+/-0.10) showed hypophosphorylated pRb. Thus, pRb is probably not the only mediator of the hypoxia-induced cell cycle block seen in all cells and all cell cycle phases. Moreover, the cell cycle-dependent induction of p53 by hypoxia suggests that the primary function of p53 accumulation during hypoxia is other than to arrest the cells. Images Figure 4 Figure 7 PMID:9862563

  12. Immunohistochemical co-expression status of cytokeratin 5/6, androgen receptor, and p53 as prognostic factors of adjuvant chemotherapy for triple negative breast cancer.

    PubMed

    Maeda, Tetsuyo; Nakanishi, Yoko; Hirotani, Yukari; Fuchinoue, Fumi; Enomoto, Katsuhisa; Sakurai, Kenichi; Amano, Sadao; Nemoto, Norimichi

    2016-03-01

    Triple negative breast cancer (TNBC) is immunohistochemically characterised by the lack of expression of the estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor type 2 (HER2). TNBC is known for its poor prognosis and high recurrence probability. There is no effective targeted treatment for TNBC, but only adjuvant chemotherapies. There are two TNBC subtypes, basal-like and non-basal-like, which are defined based on positive cytokeratin (CK) 5/6 and/or epidermal growth factor receptor (EGFR) expression. In particular, CK5/6 expression is reported to correlate with TNBC recurrence. TNBC lacks ER-α expression, but some TNBCs are known to express the androgen receptor (AR). Moreover, although p53 accumulation is detected in various malignant tumors, its influence on adjuvant chemotherapy for patients with TNBC remains unclear. The aim of this study was to assess the combined immunohistochemical expression of CK 5/6, AR, and p53 as a potential prognostic marker of adjuvant chemotherapy for patients with TNBC. The expression of CK5/6, AR, and p53 in formalin-fixed and paraffin-embedded (FFPE) surgical sections from 52 patients with TNBC was analysed by immunohistochemistry (IHC) and the co-expression patterns in individual cells were investigated by immunofluorescent (IF) staining. Low AR expression was correlated with high clinical stage (P < 0.05) and low nuclear grade (P < 0.05). The expression of CK5/6 and p53 did not correlate with clinicopathological features. Patients who needed adjuvant chemotherapy presented the worst prognosis. In particular, when the IHC expression pattern was CK5/6 (-), AR (-), and p53 (+), the disease free survival (DFS) and overall survival (OS) were the worst. On the other hand, patients with AR (+) and p53 (-) TNBC presented a good prognosis. The analysis of the co-expression status of these three markers showed that no cells presented both AR and CK5/6 expression. Furthermore, TP53 mRNA expression was higher in patients with AR-negative TNBC (P < 0.05) and in patients with the worst prognosis (P < 0.05) than in the other patients. These results suggested that, in patients with CK5/6-negative TNBC, AR expression correlated with good prognosis, but p53 accumulation correlated with poor prognosis. The present IHC markers allowed us to predict the post-surgery prognosis of patients with TNBC. In conclusion, TNBCs are heterogeneous. Patients with the CK5/6 (-), AR (-), and p53 (+) TNBC subtype, evaluated by IHC, presented the worst prognosis. These IHC markers will be helpful to follow patients with TNBC.

  13. Resveratrol and Pterostilbene Exhibit Anticancer Properties Involving the Downregulation of HPV Oncoprotein E6 in Cervical Cancer Cells.

    PubMed

    Chatterjee, Kaushiki; AlSharif, Dina; Mazza, Christina; Syar, Palwasha; Al Sharif, Mohamed; Fata, Jimmie E

    2018-02-21

    Cervical cancer is one of the most common cancers in women living in developing countries. Due to a lack of affordable effective therapy, research into alternative anticancer compounds with low toxicity such as dietary polyphenols has continued. Our aim is to determine whether two structurally similar plant polyphenols, resveratrol and pterostilbene, exhibit anticancer and anti-HPV (Human papillomavirus) activity against cervical cancer cells. To determine anticancer activity, extensive in vitro analyses were performed. Anti-HPV activity, through measuring E6 protein levels, subsequent downstream p53 effects, and caspase-3 activation, were studied to understand a possible mechanism of action. Both polyphenols are effective agents in targeting cervical cancer cells, having low IC50 values in the µM range. They decrease clonogenic survival, reduce cell migration, arrest cells at the S-phase, and reduce the number of mitotic cells. These findings were significant, with pterostilbene often being more effective than resveratrol. Resveratrol and to a greater extent pterostilbene downregulates the HPV oncoprotein E6, induces caspase-3 activation, and upregulates p53 protein levels. Results point to a mechanism that may involve the downregulation of the HPV E6 oncoprotein, activation of apoptotic pathways, and re-establishment of functional p53 protein, with pterostilbene showing greater efficacy than resveratrol.

  14. ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Olaparib.

    PubMed

    Wang, Chen; Jette, Nicholas; Moussienko, Daniel; Bebb, D Gwyn; Lees-Miller, Susan P

    2017-04-01

    The ataxia telangiectasia mutated (ATM) protein kinase plays a central role in the cellular response to DNA damage. Loss or inactivation of both copies of the ATM gene (ATM) leads to ataxia telangiectasia, a devastating childhood condition characterized by neurodegeneration, immune deficiencies, and cancer predisposition. ATM is also absent in approximately 40% of mantle cell lymphomas (MCLs), and we previously showed that MCL cell lines with loss of ATM are sensitive to poly-ADP ribose polymerase (PARP) inhibitors. Next-generation sequencing of patient tumors has revealed that ATM is altered in many human cancers including colorectal, lung, prostate, and breast. Here, we show that the colorectal cancer cell line SK-CO-1 lacks detectable ATM protein expression and is sensitive to the PARP inhibitor olaparib. Similarly, HCT116 colorectal cancer cells with shRNA depletion of ATM are sensitive to olaparib, and depletion of p53 enhances this sensitivity. Moreover, HCT116 cells are sensitive to olaparib in combination with the ATM inhibitor KU55933, and sensitivity is enhanced by deletion of p53. Together our studies suggest that PARP inhibitors may have potential for treating colorectal cancer with ATM dysfunction and/or colorectal cancer with mutation of p53 when combined with an ATM kinase inhibitor. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Heterogeneity of p53 dependent genomic responses following ethanol exposure in a developmental mouse model of fetal alcohol spectrum disorder

    PubMed Central

    Mooney, Sandra M.; Middleton, Frank A.

    2017-01-01

    Prenatal ethanol exposure can produce structural and functional deficits in the brain and result in Fetal Alcohol Spectrum Disorder (FASD). In rodent models acute exposure to a high concentration of alcohol causes increased apoptosis in the developing brain. A single causal molecular switch that signals for this increase in apoptosis has yet to be identified. The protein p53 has been suggested to play a pivotal role in enabling cells to engage in pro-apoptotic processes, and thus figures prominently as a hub molecule in the intracellular cascade of responses elicited by alcohol exposure. In the present study we examined the effect of ethanol-induced cellular and molecular responses in primary somatosensory cortex (SI) and hippocampus of 7-day-old wild-type (WT) and p53-knockout (KO) mice. We quantified apoptosis by active caspase-3 immunohistochemistry and ApopTag™ labeling, then determined total RNA expression levels in laminae of SI and hippocampal subregions. Immunohistochemical results confirmed increased incidence of apoptotic cells in both regions in WT and KO mice following ethanol exposure. The lack of p53 was not protective in these brain regions. Molecular analyses revealed a heterogeneous response to ethanol exposure that varied depending on the subregion, and which may go undetected using a global approach. Gene network analyses suggest that the presence or absence of p53 alters neuronal function and synaptic modifications following ethanol exposure, in addition to playing a classic role in cell cycle signaling. Thus, p53 may function in a way that underlies the intellectual and behavioral deficits observed in FASD. PMID:28723918

  16. Role of p53–fibrinolytic system cross-talk in the regulation of quartz-induced lung injury

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhandary, Yashodhar P.; Shetty, Shwetha K.; Marudamuthu, Amarnath S.

    2015-03-01

    Silica is the major component of airborne dust generated by wind, manufacturing and/or demolition. Chronic occupational inhalation of silica dust containing crystalline quartz is by far the predominant form of silicosis in humans. Silicosis is a progressive lung disease that typically arises after a very long latency and is a major occupational concern with no known effective treatment. The mechanism of silicosis is not clearly understood. However, silicosis is associated with increased cell death, expression of redox enzymes and pro-fibrotic cytokines and chemokines. Since alveolar epithelial cell (AEC) death and disruption of alveolar fibrinolysis is often associated with both acutemore » and chronic lung injuries, we explored whether p53-mediated changes in the urokinase-type plasminogen activator (uPA) system contributes to silica-induced lung injury. We further sought to determine whether caveolin-1 scaffolding domain peptide (CSP), which inhibits p53 expression, mitigates lung injury associated with exposure to silica. Lung tissues and AECs isolated from wild-type (WT) mice exposed to silica exhibit increased apoptosis, p53 and PAI-1, and suppression of uPA expression. Treatment of WT mice with CSP inhibits PAI-1, restores uPA expression and prevents AEC apoptosis by suppressing p53, which is otherwise induced in mice exposed to silica. The process involves CSP-mediated inhibition of serine-15 phosphorylation of p53 by inhibition of protein phosphatase 2A-C (PP2A-C) interaction with silica-induced caveolin-1 in AECs. These observations suggest that changes in the p53–uPA fibrinolytic system cross-talk contribute to lung injury caused by inhalation of silica dust containing crystalline quartz and is protected by CSP by targeting this pathway. - Highlights: • Chronic exposure to quartz dusts is a major cause of lung injury and silicosis. • The survival of patients with silicosis is bleak due to lack of effective treatments. • This study defines a new role of p53–uPA cross-talk in quartz-induced lung injury. • Targeting the p53–uPA system inhibits ATII cell/lung injury due to quartz exposure.« less

  17. Benzo[a]pyrene-7,8-dihydrodiol promotes checkpoint activation and G2/M arrest in human bronchoalveolar carcinoma H358 cells.

    PubMed

    Caino, M Cecilia; Oliva, Jose L; Jiang, Hao; Penning, Trevor M; Kazanietz, Marcelo G

    2007-03-01

    Polycyclic aromatic hydrocarbons (PAHs) are potent carcinogens that require metabolic activation inside cells. The proximate carcinogens PAH-diols can be converted to o-quinones by aldo-keto reductases (AKRs) or to diol-epoxides by cytochrome P450 (P450) enzymes. We assessed the effect of benzo[a]pyrene-7,8-dihydrodiol (BPD) on proliferation in p53-null bronchoalveolar carcinoma H358 cells. BPD treatment led to a significant inhibition of proliferation and arrest in G2/M in H358 cells. The relative contribution of the AKR and P450 pathways to cell cycle arrest was assessed. Overexpression of AKR1A1 did not affect cell proliferation or cell cycle progression, and benzo[a]pyrene-7,8-dione did not cause any noticeable effect on cell growth, suggesting that AKR1A1 metabolic products were not involved in the antiproliferative effect of BPD. On the other hand, blockade of P450 induction or inhibition of P450 activity greatly impaired the effect of BPD. Moreover, P450 induction by 2,3,7,8-tetrachlorodibenzo-p-dioxin significantly enhanced the antiproliferative effect of BPD. Mechanistic studies revealed that BPD caused a DNA damage response, Chk1 activation, and accumulation of phospho-Cdc2 (Tyr15) in H358 cells, effects that were impaired by an ataxia-telangectasia mutated (ATM)/ATM-related (ATR) inhibitor. Similar results were observed in human bronchoepithelial BEAS-2B cells, arguing for analogous mechanisms in tumorigenic and immortalized nontumorigenic cells lacking functional p53. Our data suggest that a p53-independent pathway operates in lung epithelial cells in response to BPD that involves P450 induction and subsequent activation of the ATR/ATM/Chk1 damage check-point pathway and cell cycle arrest in G2/M.

  18. Green tea polyphenols causes cell cycle arrest and apoptosis in prostate cancer cells by suppressing class I histone deacetylases

    PubMed Central

    Thakur, Vijay S.; Gupta, Sanjay

    2012-01-01

    Green tea polyphenols (GTPs) reactivate epigenetically silenced genes in cancer cells and trigger cell cycle arrest and apoptosis; however, the mechanisms whereby these effects occur are not well understood. We investigated the molecular mechanisms underlying the antiproliferative effects of GTP, which may be similar to those of histone deacetylase (HDAC) inhibitors. Exposure of human prostate cancer LNCaP cells (harboring wild-type p53) and PC-3 cells (lacking p53) with 10–80 μg/ml of GTP for 24 h resulted in dose-dependent inhibition of class I HDAC enzyme activity and its protein expression. GTP treatment causes an accumulation of acetylated histone H3 in total cellular chromatin, resulting in increased accessibility to bind with the promoter sequences of p21/waf1 and Bax, consistent with the effects elicited by an HDAC inhibitor, trichostatin A. GTP treatment also resulted in increased expression of p21/waf1 and Bax at the protein and message levels in these cells. Furthermore, treatment of cells with proteasome inhibitor, MG132 together with GTP prevented degradation of class I HDACs, compared with cells treated with GTP alone, indicating increased proteasomal degradation of class I HDACs by GTP. These alterations were consistent with G0–G1 phase cell cycle arrest and induction of apoptosis in both cell lines. Our findings provide new insight into the mechanisms of GTP action in human prostate cancer cells irrespective of their p53 status and suggest a novel approach to prevention and/or therapy of prostate cancer achieved via HDAC inhibition. PMID:22114073

  19. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

    PubMed

    Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

    2014-06-14

    The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

  20. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway

    PubMed Central

    2014-01-01

    Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies. PMID:24927749

  1. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    PubMed Central

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  2. Irradiation With Carbon Ion Beams Induces Apoptosis, Autophagy, and Cellular Senescence in a Human Glioma-Derived Cell Line

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jinno-Oue, Atsushi; Shimizu, Nobuaki; 21st Century Center of Excellence Program for Biomedical Research Using Accelerator Technology, Maebashi, Gunma

    2010-01-15

    Purpose: We examined biological responses of human glioma cells to irradiation with carbon ion beams (C-ions). Methods and Materials: A human glioma-derived cell line, NP-2, was irradiated with C-ions. Apoptotic cell nuclei were stained with Hoechst 33342. Induction of autophagy was examined either by staining cells with monodansylcadaverine (MDC) or by Western blotting to detect conversion of microtuble-associated protein light chain 3 (MAP-LC3) (LC3-I) to the membrane-bound form (LC3-II). Cellular senescence markers including induction of senescence-associated beta-galactosidase (SA-beta-gal) were examined. The mean telomere length of irradiated cells was determined by Southern blot hybridization. Expression of tumor suppressor p53 and cyclin/cyclin-dependentmore » kinase inhibitor p21{sup WAF1/CIP1} in the irradiated cells was analyzed by Western blotting. Results: When NP-2 cells were irradiated with C-ions at 6 Gy, the major population of the cells died of apoptosis and autophagy. The residual fraction of attached cells (<1% of initially irradiated cells) could not form a colony: however, they showed a morphological phenotype consistent with cellular senescence, that is, enlarged and flattened appearance. The senescent nature of these attached cells was further indicated by staining for SA-beta-gal. The mean telomere length was not changed after irradiation with C-ions. Phosphorylation of p53 at serine 15 as well as the expression of p21{sup WAF1/CIP1} was induced in NP-2 cells after irradiation. Furthermore, we found that irradiation with C-ions induced cellular senescence in a human glioma cell line lacking functional p53. Conclusions: Irradiation with C-ions induced apoptosis, autophagy, and cellular senescence in human glioma cells.« less

  3. The rapid destabilization of p53 mRNA in immortal chicken embryo fibroblast cells.

    PubMed

    Kim, H; You, S; Foster, L K; Farris, J; Foster, D N

    2001-08-23

    The steady-state levels of p53 mRNA were dramatically lower in immortal chicken embryo fibroblast (CEF) cell lines compared to primary CEF cells. In the presence of cycloheximide (CHX), the steady-state levels of p53 mRNA markedly increased in immortal CEF cell lines, similar to levels found in primary cells. The de novo synthetic rates of p53 mRNA were relatively similar in primary and immortal cells grown in the presence or absence of CHX. Destabilization of p53 mRNA was observed in the nuclei of immortal, but not primary, CEF cells. The half-life of p53 mRNA in primary cells was found to be a relatively long 23 h compared to only 3 h in immortal cells. The expression of transfected p53 cDNA was inhibited in immortal cells, but restored upon CHX treatment. The 5'-region of the p53 mRNA was shown to be involved in the rapid p53 mRNA destabilization in immortal cells by expression analysis of 5'- and 3'-deleted p53 cDNAs as well as fusion mRNA constructs of N-terminal p53 and N-terminal deleted LacZ genes. Together, it is suggestive that the downregulation of p53 mRNA in immortal CEF cells occurs through a post-transcriptional destabilizing mechanism.

  4. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    PubMed

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  5. Endorsing cellular competitiveness in aberrant epithelium of oral submucous fibrosis progression: neighbourhood analysis of immunohistochemical attributes.

    PubMed

    Anura, Anji; Kazi, Anees; Pal, Mousumi; Paul, Ranjan Rashmi; Sengupta, Sanghamitra; Chatterjee, Jyotirmoy

    2018-04-23

    Epithelial abnormality during the transformation of oral submucous fibrosis (OSF) into oral squamous cell carcinoma has been well studied and documented. However, the differential contribution of atrophy and hyperplasia for malignant potentiality of OSF is yet to be resolved. Existing diagnostic conjectures lack precise diagnostic attributes which may be effectively resolved by substantiation of specific molecular pathology signatures. Present study elucidates existence of cellular competitiveness in OSF conditions using computer-assisted neighbourhood analysis in quantitative immunohistochemistry (IHC) framework. The concept of field cancerization was contributory in finding correspondence among neighbouring cells of epithelial layers with reference to differential expression of cardinal cancer-related genes [c-Myc (oncogene), p53 (tumour suppressor), and HIF-1α (hypoxia regulator)] which are known to be important sensors in recognizing cellular competitive interface. Our analyses indicate that different states of OSF condition may be associated with different forms of competitiveness within epithelial neighbouring cells which might be responsible to shape the present and future of the pre-malignant condition. Analytical findings indicated association of atrophic epithelium with stress-driven competitive environment having low c-Myc, high-p53, and stable HIF-1α (the looser cells) which undergo apoptosis. Whereas, the cells with high c-Myc + (winner cells) give rise to hyperplastic epithelium via possible mutation in p53. The epithelial dysplasia plausibly occurs due to clonal expansion of c-Myc and p53 positive supercompetitor cells. Present study proposes quantitative IHC along with neighbourhood analysis which might help us to dig deeper on to the interaction among epithelial cell population to provide a better understanding of field cancerization and malignant transformation of pre-malignancy.

  6. Cellular characteristics of primary and immortal canine embryonic fibroblast cells.

    PubMed

    You, Seungkwon; Moon, Jai-Hee; Kim, Tae-Kyung; Kim, Sung-Chan; Kim, Jai-Woo; Yoon, Du-Hak; Kwak, Sungwook; Hong, Ki-Chang; Choi, Yun-Jaie; Kim, Hyunggee

    2004-08-31

    Using normal canine embryonic fibroblasts (CaEF) that were shown to be senescent at passages 7th-9th, we established two spontaneously immortalized CaEF cell lines (designated CGFR-Ca-1 and -2) from normal senescent CaEF cells, and an immortal CaEF cell line by exogenous introduction of a catalytic telomerase subunit (designated CGFR-Ca-3). Immortal CGFR- Ca-1, -2 and -3 cell lines grew faster than primary CaEF counterpart in the presence of either 0.1% or 10% FBS. Cell cycle analysis demonstrated that all three immortal CaEF cell lines contained a significantly high proportion of S-phase cells compared to primary CaEF cells. CGFR-Ca-1 and -3 cell lines showed a loss of p53 mRNA and protein expression leading to inactivation of p53 regulatory function, while the CGFR-Ca-2 cell line was found to have the inactive mutant p53. Unlike the CGFR-Ca-3 cell line that down-regulated p16INK4a mRNA due to its promoter methylation but had an intact p16INK4a regulatory function, CGFR-Ca-1 and -2 cell lines expressed p16INK4a mRNA but had a functionally inactive p16INK4a regulatory pathway as judged by the lack of obvious differences in cell growth and phenotype when reconstituted with wild-type p16INK4a. All CGFR-Ca-1, -2 and -3 cell lines were shown to be untransformed but immortal as determined by anchorage-dependent assay, while these cell lines were fully transformed when overexpressed oncogenic H-rasG12V. Taken together, similar to the nature of murine embryo fibroblasts, the present study suggests that normal primary CaEF cells have relatively short in vitro lifespans and should be spontaneously immortalized at high frequency.

  7. p53 in breast cancer subtypes and new insights into response to chemotherapy.

    PubMed

    Bertheau, Philippe; Lehmann-Che, Jacqueline; Varna, Mariana; Dumay, Anne; Poirot, Brigitte; Porcher, Raphaël; Turpin, Elisabeth; Plassa, Louis-François; de Roquancourt, Anne; Bourstyn, Edwige; de Cremoux, Patricia; Janin, Anne; Giacchetti, Sylvie; Espié, Marc; de Thé, Hugues

    2013-08-01

    Despite an obvious central role of p53 in the hallmarks of cancer, TP53 status is not yet used for the management of breast cancer. Recent findings may lead to reconsider the role of p53 in breast cancer. TP53 mutations are the most frequent genetic alterations in breast cancer, observed in 30% of breast carcinomas. Their distribution is highly linked to molecular tumor subtypes found in 26% of luminal tumors (17% of luminal A, 41% of luminal B), in 50% of HER2 amplified tumors, in 69% of molecular apocrine breast carcinomas and in 88% of basal-like carcinomas. The type of mutation is linked to the tumor subtype with higher frequency of base-pair substitutions in luminal tumors, whereas molecular apocrine and basal-like tumors present much higher frequency of complex mutations (deletions/insertions). The timing of TP53 mutation also depends on the tumor subtype, being the first important event in luminal tumors but occurring after PTEN loss in basal-like tumors. Regarding response to cytotoxic chemotherapy, the situation is far from the p53-dependent apoptosis paradigm with subsequent clinical response. We reported that TP53 mutated non inflammatory locally advanced breast carcinomas had a high rate of complete pathological response to dose-dense doxorubicin-cyclophosphamide chemotherapy, while TP53 wild-type (WT) tumors never achieved complete response. Using human breast cancer xenograft models, we suggested that this could be due to the induction of senescence in TP53 WT tumor cells. A recent work confirmed these findings in MMTV-Wnt1 mammary tumors, showing that growth arrest and senescent phenotype, not apoptosis, were induced in TP53 WT tumors following doxorubicin treatment, while lack of arrest in mutant tumors resulted in aberrant mitoses, cell death and a superior clinical response. Furthermore, in ER positive (ER(+)) breast tumors, it has been recently reported that ER represses the p53-mediated apoptotic response induced by DNA damage. Taken together, these data can help to better understand p53-mediated response to doxorubicin-based chemotherapy in breast cancer: in ER(+) TP53 WT breast cancers, ER-induced inhibition of p53 apoptotic response would lead preferentially to tumor cell senescence and subsequent resistance to treatment. Conversely, in ER negative (ER(-)) TP53 mutated breast cancers, accumulation of genetic abnormalities would lead to mitotic catastrophe and subsequent better response. In view of these recent results, p53 impact in breast cancer should be reconsidered. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Chronic centrosome amplification without tumorigenesis

    PubMed Central

    Vitre, Benjamin; Holland, Andrew J.; Kulukian, Anita; Shoshani, Ofer; Hirai, Maretoshi; Wang, Yin; Maldonado, Marcus; Cho, Thomas; Boubaker, Jihane; Swing, Deborah A.; Tessarollo, Lino; Evans, Sylvia M.; Fuchs, Elaine; Cleveland, Don W.

    2015-01-01

    Centrosomes are microtubule-organizing centers that facilitate bipolar mitotic spindle assembly and chromosome segregation. Recognizing that centrosome amplification is a common feature of aneuploid cancer cells, we tested whether supernumerary centrosomes are sufficient to drive tumor development. To do this, we constructed and analyzed mice in which centrosome amplification can be induced by a Cre-recombinase–mediated increase in expression of Polo-like kinase 4 (Plk4). Elevated Plk4 in mouse fibroblasts produced supernumerary centrosomes and enhanced the expected mitotic errors, but proliferation continued only after inactivation of the p53 tumor suppressor. Increasing Plk4 levels in mice with functional p53 produced centrosome amplification in liver and skin, but this did not promote spontaneous tumor development in these tissues or enhance the growth of chemically induced skin tumors. In the absence of p53, Plk4 overexpression generated widespread centrosome amplification, but did not drive additional tumors or affect development of the fatal thymic lymphomas that arise in animals lacking p53. We conclude that, independent of p53 status, supernumerary centrosomes are not sufficient to drive tumor formation. PMID:26578792

  9. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    PubMed

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  10. Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min

    Highlights: {yields} The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. {yields} GSN interacts with transactivation- and DNA binding domains of p53. {yields} GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. {yields} GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate thatmore » GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.« less

  11. New Small Molecules Targeting Apoptosis and Cell Viability in Osteosarcoma

    PubMed Central

    Maugg, Doris; Rothenaigner, Ina; Schorpp, Kenji; Potukuchi, Harish Kumar; Korsching, Eberhard; Baumhoer, Daniel; Hadian, Kamyar

    2015-01-01

    Despite the option of multimodal therapy in the treatment strategies of osteosarcoma (OS), the most common primary malignant bone tumor, the standard therapy has not changed over the last decades and still involves multidrug chemotherapy and radical surgery. Although successfully applied in many patients a large number of patients eventually develop recurrent or metastatic disease in which current therapeutic regimens often lack efficacy. Thus, new therapeutic strategies are urgently needed. In this study, we performed a phenotypic high-throughput screening campaign using a 25,000 small-molecule diversity library to identify new small molecules selectively targeting osteosarcoma cells. We could identify two new small molecules that specifically reduced cell viability in OS cell lines U2OS and HOS, but affected neither hepatocellular carcinoma cell line (HepG2) nor primary human osteoblasts (hOB). In addition, the two compounds induced caspase 3 and 7 activity in the U2OS cell line. Compared to conventional drugs generally used in OS treatment such as doxorubicin, we indeed observed a greater sensitivity of OS cell viability to the newly identified compounds compared to doxorubicin and staurosporine. The p53-negative OS cell line Saos-2 almost completely lacked sensitivity to compound treatment that could indicate a role of p53 in the drug response. Taken together, our data show potential implications for designing more efficient therapies in OS. PMID:26039064

  12. Enhanced radiosensitivity of malignant glioma cells after adenoviral p53 transduction.

    PubMed

    Broaddus, W C; Liu, Y; Steele, L L; Gillies, G T; Lin, P S; Loudon, W G; Valerie, K; Schmidt-Ullrich, R K; Fillmore, H L

    1999-12-01

    The goal of this study was to determine whether adenoviral vector-mediated expression of human wildtype p53 can enhance the radiosensitivity of malignant glioma cells that express native wild-type p53. The p53 gene is thought to function abnormally in the majority of malignant gliomas, although it has been demonstrated to be mutated in only approximately 30%. This has led to studies in which adenoviral transduction with wild-type human p53 has been investigated in an attempt to slow tumor cell growth. Recent studies suggest that reconstitution of wild-type p53 can render cells more susceptible to radiation-mediated death, primarily by p53-mediated apoptosis. Rat RT2 glioma cells were analyzed for native p53 status by reverse transcriptase-polymerase chain reaction and sequence analysis and for p53 expression by Western blot analysis. Clonogenic survival and the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay were used to characterize RT2 cell radiosensitivity and apoptosis, respectively, with and without prior transduction with p53-containing and control adenoviral vectors. Animal survival length was monitored after intracerebral implantation with transduced and nontransduced RT2 cells, with and without cranial radiation. The RT2 cells were demonstrated to express native rat wild-type p53 and to markedly overexpress human p53 following adenoviral p53 transduction. The combination of p53 transduction followed by radiation resulted in marked decreases in RT2 cell survival and increases in apoptosis at radiation doses from 2 to 6 Gy. Animals receiving cranial radiation after intracerebral implantation with RT2 cells previously transduced with p53 survived significantly longer than control animals (p<0.01). The ability to enhance the radiosensitivity of malignant glioma cells that express wild-type p53 by using adenoviral transduction to induce overexpression of p53 offers hope for this approach as a therapeutic strategy, not only in human gliomas that express mutant p53, but also in those that express wild-type p53.

  13. TP53 mutations, expression and interaction networks in human cancers

    PubMed Central

    Wang, Xiaosheng; Sun, Qingrong

    2017-01-01

    Although the associations of p53 dysfunction, p53 interaction networks and oncogenesis have been widely explored, a systematic analysis of TP53 mutations and its related interaction networks in various types of human cancers is lacking. Our study explored the associations of TP53 mutations, gene expression, clinical outcomes, and TP53 interaction networks across 33 cancer types using data from The Cancer Genome Atlas (TCGA). We show that TP53 is the most frequently mutated gene in a number of cancers, and its mutations appear to be early events in cancer initiation. We identified genes potentially repressed by p53, and genes whose expression correlates significantly with TP53 expression. These gene products may be especially important nodes in p53 interaction networks in human cancers. This study shows that while TP53-truncating mutations often result in decreased TP53 expression, other non-truncating TP53 mutations result in increased TP53 expression in some cancers. Survival analyses in a number of cancers show that patients with TP53 mutations are more likely to have worse prognoses than TP53-wildtype patients, and that elevated TP53 expression often leads to poor clinical outcomes. We identified a set of candidate synthetic lethal (SL) genes for TP53, and validated some of these SL interactions using data from the Cancer Cell Line Project. These predicted SL genes are promising candidates for experimental validation and the development of personalized therapeutics for patients with TP53-mutated cancers. PMID:27880943

  14. TP53 mutations, expression and interaction networks in human cancers.

    PubMed

    Wang, Xiaosheng; Sun, Qingrong

    2017-01-03

    Although the associations of p53 dysfunction, p53 interaction networks and oncogenesis have been widely explored, a systematic analysis of TP53 mutations and its related interaction networks in various types of human cancers is lacking. Our study explored the associations of TP53 mutations, gene expression, clinical outcomes, and TP53 interaction networks across 33 cancer types using data from The Cancer Genome Atlas (TCGA). We show that TP53 is the most frequently mutated gene in a number of cancers, and its mutations appear to be early events in cancer initiation. We identified genes potentially repressed by p53, and genes whose expression correlates significantly with TP53 expression. These gene products may be especially important nodes in p53 interaction networks in human cancers. This study shows that while TP53-truncating mutations often result in decreased TP53 expression, other non-truncating TP53 mutations result in increased TP53 expression in some cancers. Survival analyses in a number of cancers show that patients with TP53 mutations are more likely to have worse prognoses than TP53-wildtype patients, and that elevated TP53 expression often leads to poor clinical outcomes. We identified a set of candidate synthetic lethal (SL) genes for TP53, and validated some of these SL interactions using data from the Cancer Cell Line Project. These predicted SL genes are promising candidates for experimental validation and the development of personalized therapeutics for patients with TP53-mutated cancers.

  15. Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

    PubMed Central

    Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

    2008-01-01

    Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

  16. Therapeutic targeting of the p53 pathway in cancer stem cells

    PubMed Central

    Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.

    2013-01-01

    Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602

  17. Functional activation of mutant p53V172F by platinum analogs in cisplatin-resistant human tumor cells is dependent on serine-20 phosphorylation

    PubMed Central

    Xie, Xiaolei; He, Guangan; Siddik, Zahid H.

    2017-01-01

    Dysfunctionality of the p53 tumor suppressor is a major cause of therapeutic drug resistance in cancer. Recently we reported that mutant, but otherwise functional, p53V172F was inactivated in cisplatin-resistant 2780CP/Cl-16 and 2780CP/Cl-24 human ovarian tumor cells by increased recruitment of the inhibitor MDM4. The current study demonstrates that, unlike cisplatin, platinum analogs oxaliplatin and DACH-diacetato-dichloro-Pt(IV) (DAP), strongly stabilize and activate p53V172F in resistant cells, as indicated by prolonged p53 half-life and transactivation of targets p21 (CDKN1A) and MDM2. This increase in MDM2 reduced MDM4 levels in cell lysates as well as the p53 immunocomplex and prevented reversion of p53 to the inactive p53-MDM2-MDM4 bound state. Phosphorylation of p53 at Ser15 was demonstrated by all three drugs in sensitive A2780 and corresponding resistant 2780CP/Cl-16 and 2780CP/Cl-24 cell lines. However, cisplatin induced Ser20 phosphorylation in A2780 cells only, but not in resistant cells; in contrast, both DAP and oxaliplatin induced this phosphorylation in all three cell lines. The inference that Ser20 phosphorylation is more important for p53 activation was confirmed by ectopic expression of a phosphomimetic (S20D) mutant p53 that displayed reduced binding, relative to wild-type p53, to both MDM2 and MDM4 in p53-knockout A2780 cells. In consonance, temporal studies demonstrated drug-induced Ser15 phosphorylation coincided with p53 stabilization, whereas Ser20 phosphorylation coincided with p53 transactivation. Implications Cisplatin fails to activate the pathway involved in phosphorylating mutant p53V172F at Ser20 in resistant cells, but this phosphorylation is restored by oxaliplatin and DAP that reactivates p53 function and circumvents cisplatin resistance. PMID:28031409

  18. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage

    PubMed Central

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-01-01

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments. PMID:23235459

  19. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

    PubMed

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-12-13

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

  20. Oxidative Pentose Phosphate Pathway Inhibition Is A Key Determinant of Antimalarial Induced Cancer Cell Death

    PubMed Central

    Salas, Eduardo; Roy, Srirupa; Marsh, Timothy; Rubin, Brian; Debnath, Jayanta

    2015-01-01

    Despite immense interest in employing antimalarials as autophagy inhibitors to treat cancer, it remains unclear if these agents act predominantly via autophagy inhibition or whether other pathways direct their anti-cancer properties. By comparing the treatment effects of the antimalarials chloroquine (CQ) and quinacrine (Q) on KRAS mutant lung cancer cells, we demonstrate that inhibition of the oxidative arm of the pentose phosphate pathway (oxPPP) is required for antimalarial induced apoptosis. Despite inhibiting autophagy, neither CQ treatment nor RNAi against autophagy regulators (ATGs) promote cell death. In contrast, Q triggers high levels of apoptosis, both in vitro and in vivo, and this phenotype requires both autophagy inhibition and p53-dependent inhibition of the oxPPP. Simultaneous genetic targeting of the oxPPP and autophagy is sufficient to trigger apoptosis in lung cancer cells, including cells lacking p53. Thus, in addition to reduced autophagy, oxPPP inhibition serves as an important determinant of antimalarial cytotoxicity in cancer cells. PMID:26434592

  1. Identification of a novel compound (β-sesquiphellandrene) from turmeric (Curcuma longa) with anticancer potential: comparison with curcumin.

    PubMed

    Tyagi, Amit Kumar; Prasad, Sahdeo; Yuan, Wei; Li, Shiyou; Aggarwal, Bharat B

    2015-12-01

    Considering that as many as 80% of the anticancer drugs have their roots in natural products derived from traditional medicine, we examined compounds other than curcumin from turmeric (Curcuma longa) that could exhibit anticancer potential. Present study describes the isolation and characterization of another turmeric-derived compound, β-sesquiphellandrene (SQP) that exhibits anticancer potential comparable to that of curcumin. We isolated several compounds from turmeric, including SQP, α-curcumene, ar-turmerone, α-turmerone, β-turmerone, and γ-turmerone, only SQP was found to have antiproliferative effects comparable to those of curcumin in human leukemia, multiple myeloma, and colorectal cancer cells. While lack of the NF-κB-p65 protein had no effect on the activity of SQP, lung cancer cells that expressed p53 were more susceptible to the cytotoxic effect of SQP than were cells that lacked p53 expression. SQP was also found to be highly effective in suppressing cancer cell colony formation and inducing apoptosis, as shown by assays of intracellular esterase activity, plasma membrane integrity, and cell-cycle phase. SQP was found to induce cytochrome c release and activate caspases that lead to poly ADP ribose polymerase cleavage. SQP exposure was associated with downregulation of cell survival proteins such cFLIP, Bcl-xL, Bcl-2, c-IAP1, and survivin. Furthermore, SQP was found to be synergistic with the chemotherapeutic agents velcade, thalidomide and capecitabine. Overall, our results indicate that SQP has anticancer potential comparable to that of curcumin.

  2. Disruption of p53 function sensitizes breast cancer MCF-7 cells to cisplatin and pentoxifylline.

    PubMed

    Fan, S; Smith, M L; Rivet, D J; Duba, D; Zhan, Q; Kohn, K W; Fornace, A J; O'Connor, P M

    1995-04-15

    The possibility that appropriately designed chemotherapy could act selectively against p53-defective tumor cells was explored in MCF-7 human breast cancer cells. These cells were chosen because they have normal p53 function but are representative of a tumor cell type that does not readily undergo p53-dependent apoptosis. Two sublines (MCF-7/E6 and MCF-7/mu-p53) were established in which p53 function was disrupted by transfection with either the human papillomavirus type-16 E6 gene or a dominant-negative mutant p53 gene. p53 function in MCF-7/E6 and MCF-7/mu-p53 cells was defective relative to control cells in that there were no increases in p53 or p21Waf1/Cip1 protein levels and no G1 arrest following exposure to ionizing radiation. Survival assays showed that p53 disruption sensitized MCF-7 cells to cisplatin (CDDP) but not to several other DNA-damaging agents. CDDP sensitization was not limited to MCF-7 cells since p53 disruption in human colon carcinoma RKO cells also enhanced sensitivity to CDDP. Contrary to the other DNA-damaging agents tested, CDDP-induced DNA lesions are repaired extensively by nucleotide excision, and in agreement with a defect in this process, MCF-7/E6 and MCF-7/mu-p53 cells exhibited a reduced ability to repair a CDDP-damaged chloramphenicol acetyltransferase-reporter plasmid transfected into the cells. Therefore, we attributed the increased CDDP sensitivity of MCF-7 cells with disrupted p53 to defects in G1 checkpoint control, nucleotide excision repair, or both. The G2 checkpoint inhibitor pentoxifylline exhibited synergism with CDDP in killing MCF-7/E6 cells but did not affect sensitivity of the control cells. Moreover, pentoxifylline inhibited G2 checkpoint function to a greater extent in MCF-7/E6 than in the parental cells. These results suggested that, in the absence of p53 function, cancer cells are more vulnerable to G2 checkpoint abrogators. Our results show that a combination of CDDP and pentoxifylline is capable of synergistic and preferential killing of p53-defective tumor cells that do not readily undergo apoptosis.

  3. Mutant p53-Expressing Cells Undergo Necroptosis via Cell Competition with the Neighboring Normal Epithelial Cells.

    PubMed

    Watanabe, Hirotaka; Ishibashi, Kojiro; Mano, Hiroki; Kitamoto, Sho; Sato, Nanami; Hoshiba, Kazuya; Kato, Mugihiko; Matsuzawa, Fumihiko; Takeuchi, Yasuto; Shirai, Takanobu; Ishikawa, Susumu; Morioka, Yuka; Imagawa, Toshiaki; Sakaguchi, Kazuyasu; Yonezawa, Suguru; Kon, Shunsuke; Fujita, Yasuyuki

    2018-06-26

    p53 is a tumor suppressor protein, and its missense mutations are frequently found in human cancers. During the multi-step progression of cancer, p53 mutations generally accumulate at the mid or late stage, but not in the early stage, and the underlying mechanism is still unclear. In this study, using mammalian cell culture and mouse ex vivo systems, we demonstrate that when p53R273H- or p53R175H-expressing cells are surrounded by normal epithelial cells, mutant p53 cells undergo necroptosis and are basally extruded from the epithelial monolayer. When mutant p53 cells alone are present, cell death does not occur, indicating that necroptosis results from cell competition with the surrounding normal cells. Furthermore, when p53R273H mutation occurs within RasV12-transformed epithelia, cell death is strongly suppressed and most of the p53R273H-expressing cells remain intact. These results suggest that the order of oncogenic mutations in cancer development could be dictated by cell competition. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Changes in p53 expression in mouse fibroblasts can modify motility and extracellular matrix organization.

    PubMed

    Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J

    2000-11-23

    Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.

  5. Aciculatin Induces p53-Dependent Apoptosis via MDM2 Depletion in Human Cancer Cells In Vitro and In Vivo

    PubMed Central

    Lai, Chin-Yu; Tsai, An-Chi; Chen, Mei-Chuan; Chang, Li-Hsun; Sun, Hui-Lung; Chang, Ya-Ling; Chen, Chien-Chih

    2012-01-01

    Aciculatin, a natural compound extracted from the medicinal herb Chrysopogon aciculatus, shows potent anti-cancer potency. This study is the first to prove that aciculatin induces cell death in human cancer cells and HCT116 mouse xenografts due to G1 arrest and subsequent apoptosis. The primary reason for cell cycle arrest and cell death was p53 accumulation followed by increased p21 level, dephosphorylation of Rb protein, PUMA expression, and induction of apoptotic signals such as cleavage of caspase-9, caspase-3, and PARP. We demonstrated that p53 allele-null (−/−) (p53-KO) HCT116 cells were more resistant to aciculatin than cells with wild-type p53 (+/+). The same result was achieved by knocking down p53 with siRNA in p53 wild-type cells, indicating that p53 plays a crucial role in aciculatin-induced apoptosis. Although DNA damage is the most common event leading to p53 activation, we found only weak evidence of DNA damage after aciculatin treatment. Interestingly, the aciculatin-induced downregulation of MDM2, an important negative regulator of p53, contributed to p53 accumulation. The anti-cancer activity and importance of p53 after aciculatin treatment were also confirmed in the HCT116 xenograft models. Collectively, these results indicate that aciculatin treatment induces cell cycle arrest and apoptosis via inhibition of MDM2 expression, thereby inducing p53 accumulation without significant DNA damage and genome toxicity. PMID:22912688

  6. The role of morphine on rat neural stem cells viability, neuro-angiogenesis and neuro-steroidgenesis properties.

    PubMed

    Abdyazdani, Nima; Nourazarian, Alireza; Nozad Charoudeh, Hojjatollah; Kazemi, Masoumeh; Feizy, Navid; Akbarzade, Maryam; Mehdizadeh, Amir; Rezaie, Jafar; Rahbarghazi, Reza

    2017-01-01

    A lack of comprehensive data exists on the effect of morphine on neural stem cell neuro-steroidogenesis and neuro-angiogenesis properties. We, herein, investigated the effects of morphine (100μM), naloxone (100μM) and their combination on rat neural stem cells viability, clonogenicity and Ki-67 expression over a period of 72h. Any alterations in the total fatty acids profile under treatment protocols were elucidated by direct transesterification method. We also monitored the expression of p53, aromatase and 5-alpha reductase by real-time PCR assay. To examine angiogenic capacity, in vitro tubulogenesis and the level of VE-cadherin transcript were investigated during neural to endothelial differentiation under the experimental procedure. Cells supplemented with morphine displayed reduced survival (p<0.01) and clonogenicity (p<0.001). Flow cytometric analysis showed a decrease in Ki-67 during 72h. Naloxone potentially blunted morphine-induced all effects. The normal levels of fatty acids, including saturated and unsaturated were altered by naloxone and morphine supplements. Following 48h, the up-regulation of p53, aromatase and 5-alpha reductase genes occurred in morphine-primed cells. Using three-dimensional culture models of angiogenesis and real time PCR assay, we showed morphine impaired the tubulogenesis properties of neural stem cells (p<0.001) by the inhibition of trans-differentiation into vascular cells and led to decrease of in VE-cadherin expression. Collectively, morphine strongly impaired the healthy status of neural stem cells by inducing p53 and concurrent elevation of aromatase and 5-alpha reductase activities especially during early 48h. Also, neural stem cells-being exposed to morphine lost their potency to elicit angiogenesis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Impact of p53 status on heavy-ion radiation-induced micronuclei in circulating erythrocytes

    NASA Technical Reports Server (NTRS)

    Chang, P. Y.; Torous, D.; Lutze-Mann, L.; Winegar, R.

    2000-01-01

    Transgenic mice that differed in their p53 genetic status were exposed to an acute dose of highly charged and energetic (HZE) iron particle radiation. Micronuclei (MN) in two distinct populations of circulating peripheral blood erythrocytes, the immature reticulocytes (RETs) and the mature normochromatic erythrocytes (NCEs), were measured using a simple and efficient flow cytometric procedure. Our results show significant elevation in the frequency of micronucleated RETs (%MN-RETs) at 2 and 3 days post-radiation. At 3 days post-irradiation, the magnitude of the radiation-induced MN-RET was 2.3-fold higher in the irradiated p53 wild-type animals compared to the unirradiated controls, 2.5-fold higher in the p53 hemizygotes and 4.3-fold higher in the p53 nullizygotes. The persistence of this radiation-induced elevation of MN-RETs is dependent on the p53 genetic background of the animal. In the p53 wild-type and p53 hemizygotes, %MN-RETs returned to control levels by 9 days post-radiation. However, elevated levels of %MN-RETs in p53 nullizygous mice persisted beyond 56 days post-radiation. We also observed elevated MN-NCEs in the peripheral circulation after radiation, but the changes in radiation-induced levels of MN-NCEs appear dampened compared to those of the MN-RETs for all three strains of animals. These results suggest that the lack of p53 gene function may play a role in the iron particle radiation-induced genomic instability in stem cell populations in the hematopoietic system.

  8. Inhibition of NAMPT pathway by FK866 activates the function of p53 in HEK293T cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thakur, Basant Kumar, E-mail: thakur.basant@mh-hannover.de; Department of Molecular Hematopoiesis, Hannover Medical School, Carl Neuberg Str-1, 30625 Hannover; Dittrich, Tino

    2012-08-03

    Highlights: Black-Right-Pointing-Pointer In 293T cells, p53 is considered to be inactive due to its interaction with the large T-antigen. Black-Right-Pointing-Pointer Acetylation of p53 at lysine 382 is important for its functional activation. Black-Right-Pointing-Pointer First evidence to document the presence of a functional p53 in 293T cells. Black-Right-Pointing-Pointer Inhibition of NAMPT/SIRT pathway by FK866 in 293T cells increases the functional activity of p53. Black-Right-Pointing-Pointer This activation of p53 involves reversible acetylation of p53 at lysine 382. -- Abstract: Inactivation of p53 protein by endogenous and exogenous carcinogens is involved in the pathogenesis of different human malignancies. In cancer associated with SV-40more » DNA tumor virus, p53 is considered to be non-functional mainly due to its interaction with the large T-antigen. Using the 293T cell line (HEK293 cells transformed with large T antigen) as a model, we provide evidence that p53 is one of the critical downstream targets involved in FK866-mediated killing of 293T cells. A reduced rate of apoptosis and an increased number of cells in S-phase was accompanied after knockdown of p53 in these cells. Inhibition of NAMPT by FK866, or inhibition of SIRT by nicotinamide decreased proliferation and triggered death of 293T cells involving the p53 acetylation pathway. Additionally, knockdown of p53 attenuated the effect of FK866 on cell proliferation, apoptosis, and cell cycle arrest. The data presented here shed light on two important facts: (1) that p53 in 293T cells is active in the presence of FK866, an inhibitor of NAMPT pathway; (2) the apoptosis induced by FK866 in 293T cells is associated with increased acetylation of p53 at Lys382, which is required for the functional activity of p53.« less

  9. The putative oncotarget CSN5 controls a transcription-uncorrelated p53-mediated autophagy implicated in cancer cell survival under curcumin treatment.

    PubMed

    Zhang, Qing-Yu; Jin, Rui; Zhang, Xian; Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong

    2016-10-25

    Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53-/- cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin.

  10. Protective mechanisms of p53-p21-pRb proteins against DNA damage-induced cell death.

    PubMed

    Garner, Elizabeth; Raj, Kenneth

    2008-02-01

    There have been innumerate demonstrations of p53's activity as a tumour suppressor protein with the ability to stimulate cell signalling that can lead to cell cycle arrest and cell death in the event of DNA damage. Despite the solid body of evidence to support these properties of p53, reports have emerged that suggest a role for p53 in protecting cells from cell death. Our recent report highlighted a mechanism by which p53 activity can promote cell survival in the event of DNA damage. Here we present the various mechanisms that are activated by p53 signalling that can confer protection to cells with damaged DNA and emphasise the practical and clinical implications of a more balanced and context-dependent understanding of p53's pro-apoptotic and pro-survival activities.

  11. Synthesis of cytochrome C oxidase 2: a p53-dependent metabolic regulator that promotes respiratory function and protects glioma and colon cancer cells from hypoxia-induced cell death.

    PubMed

    Wanka, C; Brucker, D P; Bähr, O; Ronellenfitsch, M; Weller, M; Steinbach, J P; Rieger, J

    2012-08-16

    P53 has an important role in the processing of starvation signals. P53-dependent molecular mediators of the Warburg effect reduce glucose consumption and promote mitochondrial function. We therefore hypothesized that the retention of wild-type p53 characteristic of primary glioblastomas limits metabolic demands induced by deregulated signal transduction in the presence of hypoxia and nutrient depletion. Here we report that short hairpin RNA-mediated gene suppression of wild-type p53 or ectopic expression of mutant temperature-sensitive dominant-negative p53(V135A) increased glucose consumption and lactate production, decreased oxygen consumption and enhanced hypoxia-induced cell death in p53 wild-type human glioblastoma cells. Similarly, genetic knockout of p53 in HCT116 colon carcinoma cells resulted in reduced respiration and hypersensitivity towards hypoxia-induced cell death. Further, wild-type p53 gene silencing reduced the expression of synthesis of cytochrome c oxidase 2 (SCO2), an effector necessary for respiratory chain function. An SCO2 transgene reverted the metabolic phenotype and restored resistance towards hypoxia in p53-depleted and p53 mutant glioma cells in a rotenone-sensitive manner, demonstrating that this effect was dependent on intact oxidative phosphorylation. Supplementation with methyl-pyruvate, a mitochondrial substrate, rescued p53 wild-type but not p53 mutant cells from hypoxic cell death, demonstrating a p53-mediated selective aptitude to metabolize mitochondrial substrates. Further, SCO2 gene silencing in p53 wild-type glioma cells sensitized these cells towards hypoxia. Finally, lentiviral gene suppression of SCO2 significantly enhanced tumor necrosis in a subcutaneous HCT116 xenograft tumor model, compatible with impaired energy metabolism in these cells. These findings demonstrate that glioma and colon cancer cells with p53 wild-type status can skew the Warburg effect and thereby reduce their vulnerability towards tumor hypoxia in an SCO2-dependent manner. Targeting SCO2 may therefore represent a valuable strategy to enhance sensitivity towards hypoxia and may complement strategies targeting glucose metabolism.

  12. Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response

    PubMed Central

    Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

    2014-01-01

    In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

  13. p53-dependent cell death/apoptosis is required for a productive adenovirus infection.

    PubMed

    Hall, A R; Dix, B R; O'Carroll, S J; Braithwaite, A W

    1998-09-01

    The p53 tumor suppressor protein binds to both cellular and viral proteins, which influence its biological activity. One such protein is the large E1b tumor antigen (E1b58kDa) from adenoviruses (Ads), which abrogates the ability of p53 to transactivate various promoters. This inactivation of p53 function is believed to be the mechanism by which E1b58kDa contributes to the cell transformation process. Although the p53-E1b58kDa complex occurs during infection and is conserved among different serotypes, there are limited data demonstrating that it has a role in virus replication. However, loss of p53 expression occurs after adenovirus infection of human cells and an E1b58kDa deletion mutant (Onyx-015, also called dl 1520) selectively replicates in p53-defective cells. These (and other) data indicate a plausible hypothesis is that loss of p53 function may be conducive to efficient adenovirus replication. However, wild-type (wt) Ad5 grows more efficiently in cells expressing a wt p53 protein. These studies indicate that the hypothesis may be an oversimplification. Here, we show that cells expressing wt p53, as well as p53-defective cells, allow adenovirus replication, but only cells expressing wt p53 show evidence of virus-induced cytopathic effect. This correlates with the ability of adenovirus to induce cell death. Our data indicate that p53 plays a necessary part in mediating cellular destruction to allow a productive adenovirus infection. In contrast, p53-deficient cells are less sensitive to the cytolytic effects of adenovirus and as such raise questions about the use of E1b58kDa-deficient adenoviruses in tumor therapy.

  14. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cappadone, C., E-mail: concettina.cappadone@unibo.it; Stefanelli, C.; Malucelli, E.

    2015-11-13

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of themore » cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.« less

  15. Wogonin induces apoptosis by suppressing E6 and E7 expressions and activating intrinsic signaling pathways in HPV-16 cervical cancer cells.

    PubMed

    Kim, Man Sub; Bak, Yesol; Park, Yun Sun; Lee, Dong Hun; Kim, Jung Hee; Kang, Jeong Woo; Song, Hyuk-Hwan; Oh, Sei-Ryang; Yoon, Do Young

    2013-08-01

    Wogonin is a flavonoid compound extracted from Scutellaria baicalensis and is well known as a benzodiazepine receptor ligand with anxiolytic effects. Many recent studies have demonstrated that wogonin modulates angiogenesis, proliferation, invasion, and tumor progress in various cancer tissues. We further explored the mechanism of action of wogonin on cervical cancer cells that contain or lack human papillomavirus (HPV) DNA. Wogonin was cytotoxic to HPV 16 (+) cervical cancer cells, SiHa and CaSki, but not to HPV-negative cells. We demonstrated that wogonin induced apoptosis by suppressing the expressions of the E6 and E7 viral oncogenes in HPV-infected cervical cancer CaSki and SiHa cells. The modulation of p53 and protein retinoblastoma (pRb) were also triggered by the suppression of E6 and E7 expressions. However, p53 was not altered in HPV-negative cervical cancer C33A cells. Moreover, wogonin modulated the mitochondrial membrane potential and the expression of pro- and anti-apoptotic factors such as Bax and Bcl-2. Wogonin also provoked the cleavage of caspase-3, caspase-9, and poly ADP ribose polymerase. After transfection of siRNAs to target E6 and E7, additional restoration of p53 and pRb was not induced, but processing of caspases and PARP was increased compared with wogonin treatment alone. Together, our findings demonstrated that wogonin effectively promotes apoptosis by downregulating E6 and E7 expressions and promoting intrinsic apoptosis in human cervical cancer cells.

  16. Regulation of autophagy by cytoplasmic p53.

    PubMed

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  17. The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential

    PubMed Central

    Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre

    2015-01-01

    Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205

  18. Phosphorylation of p53 modifies sensitivity to ionizing radiation.

    PubMed

    Okaichi, Kumio; Nose, Kanako; Kotake, Takako; Izumi, Nanaka; Kudo, Takashi

    2011-06-01

    Phosphorylation is an important modification involved in the control of p53 activity. We examined the relationship between p53 phosphorylation and cell radiosensitivity. We prepared H1299 cells (p53-null) with various mutations of p53 at three sites (serine 15, 20 and 46) and examined the radiosensitivity of the cells. In three mutant forms of p53--S15A, S20A and S46A--serine was converted to alanine at these sites to prevent phosphorylation, and in two other mutant forms, S15D and S20D, serine was converted to aspartic acid to mimic phosphorylation. H1299 cells were more radioresistant than cells with wild-type p53. Cells with the S15A and S46A mutant forms of p53 were radiosensitive, whereas those with the S15D, S20A and S20D forms showed medium radiosensitivity. Thus the sensitivity of cells to ionizing radiation varies according to the site of phosphorylation of p53.

  19. Progesterone facilitates chromosome instability (aneuploidy) in p53 null normal mammary epithelial cells

    NASA Technical Reports Server (NTRS)

    Goepfert, T. M.; McCarthy, M.; Kittrell, F. S.; Stephens, C.; Ullrich, R. L.; Brinkley, B. R.; Medina, D.

    2000-01-01

    Mammary epithelial cells from p53 null mice have been shown recently to exhibit an increased risk for tumor development. Hormonal stimulation markedly increased tumor development in p53 null mammary cells. Here we demonstrate that mammary tumors arising in p53 null mammary cells are highly aneuploid, with greater than 70% of the tumor cells containing altered chromosome number and a mean chromosome number of 56. Normal mammary cells of p53 null genotype and aged less than 14 wk do not exhibit aneuploidy in primary cell culture. Significantly, the hormone progesterone, but not estrogen, increases the incidence of aneuploidy in morphologically normal p53 null mammary epithelial cells. Such cells exhibited 40% aneuploidy and a mean chromosome number of 54. The increase in aneuploidy measured in p53 null tumor cells or hormonally stimulated normal p53 null cells was not accompanied by centrosome amplification. These results suggest that normal levels of progesterone can facilitate chromosomal instability in the absence of the tumor suppressor gene, p53. The results support the emerging hypothesis based both on human epidemiological and animal model studies that progesterone markedly enhances mammary tumorigenesis.

  20. A protein folding molecular imaging biosensor monitors the effects of drugs that restore mutant p53 structure and its downstream function in glioblastoma cells

    PubMed Central

    Paulmurugan, Ramasamy; Afjei, Rayhaneh; Sekar, Thillai V.; Babikir, Husam A.; Massoud, Tarik F.

    2018-01-01

    Misfolding mutations in the DNA-binding domain of p53 alter its conformation, affecting the efficiency with which it binds to chromatin to regulate target gene expression and cell cycle checkpoint functions in many cancers, including glioblastoma. Small molecule drugs that recover misfolded p53 structure and function may improve chemotherapy by activating p53-mediated senescence. We constructed and optimized a split Renilla luciferase (RLUC) complementation molecular biosensor (NRLUC-p53-CRLUC) to determine small molecule-meditated folding changes in p53 protein. After initial evaluation of the biosensor in three different cells lines, we engineered endogenously p53P98L mutant (i.e. not affecting the DNA-binding domain) Ln229 glioblastoma cells, to express the biosensor containing one of four different p53 proteins: p53wt, p53Y220C, p53G245S and p53R282W. We evaluated the consequent phenotypic changes in these four variant cells as well as the parental cells after exposure to PhiKan083 and SCH529074, drugs previously reported to activate mutant p53 folding. Specifically, we measured induced RLUC complementation and consequent therapeutic response. Upon stable transduction with the p53 biosensors, we demonstrated that these originally p53P98L Ln229 cells had acquired p53 cellular phenotypes representative of each p53 protein expressed within the biosensor fusion protein. In these engineered variants we found a differential drug response when treated with doxorubicin and temozolomide, either independently or in combination with PhiKan083 or SCH529074. We thus developed a molecular imaging complementation biosensor that mimics endogenous p53 function for use in future applications to screen novel or repurposed drugs that counter the effects of misfolding mutations responsible for oncogenic structural changes in p53. PMID:29765555

  1. Transduction of Recombinant M3-p53-R12 Protein Enhances Human Leukemia Cell Apoptosis

    PubMed Central

    Lu, Tsung Chi; Zhao, Guan- Hao; Chen, Yao Yun; Chien, Chia-Ying; Huang, Chi-Hung; Lin, Kwang Hui; Chen, Shen Liang

    2016-01-01

    Tumor suppressor protein p53 plays important roles in initiating cell cycle arrest and promoting tumor cell apoptosis. Previous studies have shown that p53 is either mutated or defective in approximately 50% of human cancers; therefore restoring normal p53 activity in cancer cells might be an effective anticancer therapeutic approach. Herein, we designed a chimeric p53 protein flanked with the MyoD N-terminal transcriptional activation domain (amino acids 1-62, called M3) and a poly-arginine (R12) cell penetrating signal in its N-and C-termini respectively. This chimeric protein, M3-p53-R12, can be expressed in E. coli and purified using immobilized metal ion chromatography followed by serial refolding dialysis. The purified M3-p53-R12 protein retains DNA-binding activity and gains of cell penetrating ability. Using MTT assay, we demonstrated that M3-p53-R12 inhibited the growth of K562, Jurkat as well as HL-60 leukemia cells carrying mutant p53 genes. Results from FACS analysis also demonstrated that transduction of M3-p53-R12 protein induced cell cycle arrest of these leukemia cells. Of special note, M3-p53-R12 has no apoptotic effect on normal mesenchymal stem cells (MSC) and leukocytes, highlighting its differential effects on normal and tumor cells. To sum up, our results reveal that purified recombinant M3-p53-R12 protein has functions of suppressing the leukemia cell lines' proliferation and launching cell apoptosis, suggesting the feasibility of using M3-p53-R12 protein as an anticancer drug. In the future we will test whether this chimeric protein can preferentially trigger the death of malignant cancer cells without affecting normal cells in animals carrying endogenous or xenographic tumors. PMID:27390612

  2. ΔNp63 promotes pediatric neuroblastoma and osteosarcoma by regulating tumor angiogenesis

    PubMed Central

    Bid, Hemant K.; Roberts, Ryan D.; Cam, Maren; Audino, Anthony; Kurmasheva, Raushan T.; Lin, Jiayuh; Houghton, Peter J.; Cam, Hakan

    2013-01-01

    The tumor suppressor gene p53 and its family members p63/p73 are critical determinants of tumorigenesis. ΔNp63 is a splice variant of p63, which lacks the N-terminal transactivation domain. It is thought to antagonize p53-, p63- and p73- dependent translation, thus blocking their tumor suppressor activity. In our studies of the pediatric solid tumors neuroblastoma and osteosarcoma, we find overexpression of ΔNp63; however, there is no correlation of ΔNp63 expression with p53 mutation status. Our data suggest that ΔNp63 itself endows cells with a gain of function that leads to malignant transformation, a function independent of any p53 antagonism. Here, we demonstrate that ΔNp63 overexpression, independent of p53, increases secretion of interleukin-6 (IL-6) and interleukin-8 (IL-8), leading to elevated phosphorylation of STAT-3 (Tyr-705). We show that elevated phosphorylation of STAT-3 leads to stabilization of HIF-1α protein, resulting in VEGF secretion. We also show human clinical data, which suggests a mechanistic role for ΔNp63 in osteosarcoma metastasis. In summary, our studies reveal the mechanism by which ΔNp63, as a master transcription factor, modulates tumor angiogenesis. PMID:24154873

  3. The putative oncotarget CSN5 controls a transcription-uncorrelated p53-mediated autophagy implicated in cancer cell survival under curcumin treatment

    PubMed Central

    Sheng, Ji-Po; Yu, Fang; Tan, Ren-Xiang; Pan, Ying; Huang, Jun-Jian; Kong, Ling-Dong

    2016-01-01

    Curcumin has shown promise as a safe and specific anticancer agent. The COP9 signalosome (CSN) component CSN5, a known specific target for curcumin, can control p53 stability by increasing its degradation through ubiquitin system. But the correlation of CSN5-controlled p53 to anticancer therapeutic effect of curcumin is currently unknown. Here we showed that CSN5-controlled p53 was transcriptional inactive and responsible for autophagy in human normal BJ cells and cancer HepG2 cells under curcumin treatment. Of note, CSN5-initiated cellular autophagy by curcumin treatment was abolished in p53-null HCT116p53−/− cancer cells, which could be rescued by reconstitution with wild-type p53 or transcription inactive p53 mutant p53R273H. Furthermore, CSN5-controlled p53 conferred a pro-survival autophagy in diverse cancer cells response to curcumin. Genetic p53 deletion, as well as autophagy pharmacological inhibition by chloroquine, significantly enhanced the therapeutic effect of curcumin on cancer cells in vitro and in vivo, but not normal cells. This study identifies a novel CSN5-controlled p53 in autophagy of human cells. The p53 expression state is a useful biomarker for predicting the anticancer therapeutic effect of curcumin. Therefore, the pharmacologic autophagy manipulation may benefit the ongoing anticancer clinical trials of curcumin. PMID:27626169

  4. p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin

    2008-01-25

    S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53{sup wt}) or being p(HCT-116 p53{sup -/-}), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53{sup -/-} xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53{sup wt}more » cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53{sup wt} cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75{sup NTR}, p53 and Bax.« less

  5. Split T Cell Tolerance against a Self/Tumor Antigen: Spontaneous CD4+ but Not CD8+ T Cell Responses against p53 in Cancer Patients and Healthy Donors

    PubMed Central

    Tsuji, Takemasa; Matsuzaki, Junko; Ritter, Erika; Miliotto, Anthony; Ritter, Gerd; Odunsi, Kunle; Old, Lloyd J.; Gnjatic, Sacha

    2011-01-01

    Analyses of NY-ESO-1-specific spontaneous immune responses in cancer patients revealed that antibody and both CD4+ and CD8+ T cell responses were induced together in cancer patients. To explore whether such integrated immune responses are also spontaneously induced for other tumor antigens, we have evaluated antibody and T cell responses against self/tumor antigen p53 in ovarian cancer patients and healthy individuals. We found that 21% (64/298) of ovarian cancer patients but no healthy donors showed specific IgG responses against wild-type p53 protein. While none of 12 patients with high titer p53 antibody showed spontaneous p53-specific CD8+ T cell responses following a single in vitro sensitization, significant p53-specific IFN-γ producing CD4+ T cells were detected in 6 patients. Surprisingly, similar levels of p53-specific CD4+ T cells but not CD8+ T cells were also detected in 5/10 seronegative cancer patients and 9/12 healthy donors. Importantly, p53-specific CD4+ T cells in healthy donors originated from a CD45RA− antigen-experienced T cell population and recognized naturally processed wild-type p53 protein. These results raise the possibility that p53-specific CD4+ T cells reflect abnormalities in p53 occurring in normal individuals and that they may play a role in processes of immunosurveillance or immunoregulation of p53-related neoplastic events. PMID:21858191

  6. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Zhendong, E-mail: zdyu@hotmail.com; Wang, Hao; Zhang, Libin

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrugmore » system.« less

  7. Heme oxygenase-1 affects generation and spontaneous cardiac differentiation of induced pluripotent stem cells.

    PubMed

    Stepniewski, Jacek; Pacholczak, Tomasz; Skrzypczyk, Aniela; Ciesla, Maciej; Szade, Agata; Szade, Krzysztof; Bidanel, Romain; Langrzyk, Agnieszka; Grochowski, Radoslaw; Vandermeeren, Felix; Kachamakova-Trojanowska, Neli; Jez, Mateusz; Drabik, Grazyna; Nakanishi, Mahito; Jozkowicz, Alicja; Dulak, Jozef

    2018-02-01

    Cellular stress can influence efficiency of iPSCs generation and their differentiation. However, the role of intracellular cytoprotective factors in these processes is still not well known. Therefore, we investigated the effect of HO-1 (Hmox1) or Nrf2 (Nfe2l2), two major cytoprotective genes. Hmox1 -/- fibroblasts demonstrated decreased reprogramming efficiency in comparison to Hmox1 +/+ cells. Reversely, pharmacological enhancement of HO-1 resulted in higher number of iPSCs colonies. Importantly, elevated level of both p53 and p53-regulated miR-34a and 14-3-3σ was observed in HO-1-deficient fibroblasts whereas downregulation of p53 in these cells markedly increased their reprogramming efficiency. In human fibroblasts HO-1 silencing also induced p53 expression and affected reprogramming outcome. Hmox1 +/+ and Hmox1 -/- iPSCs similarly differentiated in vitro to cells originating from three germ layers, however, lower number of contracting cells was observed during this process in HO-1-deficient cells indicating attenuated cardiac differentiation. Importantly, silencing of Hmox1 in murine ESC using CRISPR/Cas-9 editing also impaired their spontaneous cardiac differentiation. Decreased reprogramming efficiency was also observed in Nrf2-lacking fibroblasts. Reversely, sulforaphane, a Nrf2 activator, increased the number of iPSCs colonies. However, both Nfe2l2 +/+ and Nfe2l2 -/- iPSCs showed similar pluripotency and differentiation capacity. These results indicate that regulation of HO-1 expression can further optimize generation and cardiac differentiation of iPSCs. © 2018 IUBMB Life, 70(2):129-142, 2018. © 2018 International Union of Biochemistry and Molecular Biology.

  8. Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

    PubMed

    Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

    2016-03-01

    The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  9. Inhibition of SIRT1 Catalytic Activity Increases p53 Acetylation but Does Not Alter Cell Survival following DNA Damage

    PubMed Central

    Solomon, Jonathan M.; Pasupuleti, Rao; Xu, Lei; McDonagh, Thomas; Curtis, Rory; DiStefano, Peter S.; Huber, L. Julie

    2006-01-01

    Human SIRT1 is an enzyme that deacetylates the p53 tumor suppressor protein and has been suggested to modulate p53-dependent functions including DNA damage-induced cell death. In this report, we used EX-527, a novel, potent, and specific small-molecule inhibitor of SIRT1 catalytic activity to examine the role of SIRT1 in p53 acetylation and cell survival after DNA damage. Treatment with EX-527 dramatically increased acetylation at lysine 382 of p53 after different types of DNA damage in primary human mammary epithelial cells and several cell lines. Significantly, inhibition of SIRT1 catalytic activity by EX-527 had no effect on cell growth, viability, or p53-controlled gene expression in cells treated with etoposide. Acetyl-p53 was also increased by the histone deacetylase (HDAC) class I/II inhibitor trichostatin A (TSA). EX-527 and TSA acted synergistically to increase acetyl-p53 levels, confirming that p53 acetylation is regulated by both SIRT1 and HDACs. While TSA alone reduced cell survival after DNA damage, the combination of EX-527 and TSA had no further effect on cell viability and growth. These results show that, although SIRT1 deacetylates p53, this does not play a role in cell survival following DNA damage in certain cell lines and primary human mammary epithelial cells. PMID:16354677

  10. Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo

    PubMed Central

    Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah

    2016-01-01

    Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting “oncogene addiction” could be a promising strategy for combatting p53 mutant tumors. PMID:27765910

  11. Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo.

    PubMed

    Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah

    2016-11-22

    Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting "oncogene addiction" could be a promising strategy for combatting p53 mutant tumors.

  12. Involvement of stromal p53 in tumor-stroma interactions

    PubMed Central

    Bar, Jair; Moskovits, Neta; Oren, Moshe

    2009-01-01

    p53 is a major tumor-suppressor gene, inactivated by mutations in about half of all human cancer cases, and probably incapacitated by other means in most other cases. Most research regarding the role of p53 in cancer has focused on its ability to elicit apoptosis or growth arrest of cells that are prone to become malignant owing to DNA damage or oncogene activation, i.e. cell-autonomous activities of p53. However, p53 activation within a cell can also exert a variety of effects upon neighboring cells, through secreted factors and paracrine and endocrine mechanisms. Of note, p53 within cancer stromal cells can inhibit tumor growth and malignant progression. Cancer cells that evolve under this inhibitory influence acquire mechanisms to silence stromal p53, either by direct inhibition of p53 within stromal cells, or through pressure for selection of stromal cells with compromised p53 function. Hence, activation of stromal p53 by chemotherapy or radiotherapy might be part of the mechanisms by which these treatments cause cancer regression. However, in certain circumstances, activation of stromal p53 by cytotoxic anti-cancer agents might actually promote treatment resistance, probably through stromal p53-mediated growth arrest of the cancer cells or through protection of the tumor vasculature. Better understanding of the underlying molecular mechanisms is thus required. Hopefully, this will allow their manipulation towards better inhibition of cancer initiation, progression and metastasis. PMID:19914385

  13. p53 isoform Δ133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming.

    PubMed

    Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun

    2016-11-22

    Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.

  14. Loss of Atrx Sensitizes Cells to DNA Damaging Agents through p53-Mediated Death Pathways

    PubMed Central

    Conte, Damiano; Huh, Michael; Goodall, Emma; Delorme, Marilyne; Parks, Robin J.; Picketts, David J.

    2012-01-01

    Prevalent cell death in forebrain- and Sertoli cell-specific Atrx knockout mice suggest that Atrx is important for cell survival. However, conditional ablation in other tissues is not associated with increased death indicating that diverse cell types respond differently to the loss of this chromatin remodeling protein. Here, primary macrophages isolated from Atrx f/f mice were infected with adenovirus expressing Cre recombinase or β-galactosidase, and assayed for cell survival under different experimental conditions. Macrophages survive without Atrx but undergo rapid apoptosis upon lipopolysaccharide (LPS) activation suggesting that chromatin reorganization in response to external stimuli is compromised. Using this system we next tested the effect of different apoptotic stimuli on cell survival. We observed that survival of Atrx-null cells were similar to wild type cells in response to serum withdrawal, anti-Fas antibody, C2 ceramide or dexamethasone treatment but were more sensitive to 5-fluorouracil (5-FU). Cell survival could be rescued by re-introducing Atrx or by removal of p53 demonstrating the cell autonomous nature of the effect and its p53-dependence. Finally, we demonstrate that multiple primary cell types (myoblasts, embryonic fibroblasts and neurospheres) were sensitive to 5-FU, cisplatin, and UV light treatment. Together, our results suggest that cells lacking Atrx are more sensitive to DNA damaging agents and that this may result in enhanced death during development when cells are at their proliferative peak. Moreover, it identifies potential treatment options for cancers associated with ATRX mutations, including glioblastoma and pancreatic neuroendocrine tumors. PMID:23284920

  15. Loss of Atrx sensitizes cells to DNA damaging agents through p53-mediated death pathways.

    PubMed

    Conte, Damiano; Huh, Michael; Goodall, Emma; Delorme, Marilyne; Parks, Robin J; Picketts, David J

    2012-01-01

    Prevalent cell death in forebrain- and Sertoli cell-specific Atrx knockout mice suggest that Atrx is important for cell survival. However, conditional ablation in other tissues is not associated with increased death indicating that diverse cell types respond differently to the loss of this chromatin remodeling protein. Here, primary macrophages isolated from Atrx(f/f) mice were infected with adenovirus expressing Cre recombinase or β-galactosidase, and assayed for cell survival under different experimental conditions. Macrophages survive without Atrx but undergo rapid apoptosis upon lipopolysaccharide (LPS) activation suggesting that chromatin reorganization in response to external stimuli is compromised. Using this system we next tested the effect of different apoptotic stimuli on cell survival. We observed that survival of Atrx-null cells were similar to wild type cells in response to serum withdrawal, anti-Fas antibody, C2 ceramide or dexamethasone treatment but were more sensitive to 5-fluorouracil (5-FU). Cell survival could be rescued by re-introducing Atrx or by removal of p53 demonstrating the cell autonomous nature of the effect and its p53-dependence. Finally, we demonstrate that multiple primary cell types (myoblasts, embryonic fibroblasts and neurospheres) were sensitive to 5-FU, cisplatin, and UV light treatment. Together, our results suggest that cells lacking Atrx are more sensitive to DNA damaging agents and that this may result in enhanced death during development when cells are at their proliferative peak. Moreover, it identifies potential treatment options for cancers associated with ATRX mutations, including glioblastoma and pancreatic neuroendocrine tumors.

  16. Abrogation of p53 by its antisense in MCF-7 breast carcinoma cells increases cyclin D1 via activation of Akt and promotion of cell proliferation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chhipa, Rishi Raj; Kumari, Ratna; Upadhyay, Ankur Kumar

    2007-11-15

    The p53 protein has been a subject of intense research interest since its discovery as about 50% of human cancers carry p53 mutations. Mutations in the p53 gene are the most frequent genetic lesions in breast cancers suggesting a critical role of p53 in breast cancer development, growth and chemosensitivity. This report describes the derivation and characterization of MCF-7As53, an isogenic cell line derived from MCF-7 breast carcinoma cells in which p53 was abrogated by antisense p53 cDNA. Similar to MCF-7 and simultaneously selected hygromycin resistant MCF-7H cells, MCF-7As53 cells have consistent basal epithelial phenotype, morphology, and estrogen receptor expressionmore » levels at normal growth conditions. Present work documents investigation of molecular variations, growth kinetics, and cell cycle related studies in relation to absence of wild-type p53 protein and its transactivation potential as well. Even though wild-type tumor suppressor p53 is an activator of cell growth arrest and apoptosis-mediator genes such as p21, Bax, and GADD45 in MCF-7As53 cells, no alterations in expression levels of these genes were detected. The doubling time of these cells decreased due to depletion of G0/G1 cell phase because of constitutive activation of Akt and increase in cyclin D1 protein levels. This proliferative property was abrogated by wortmannin, an inhibitor of PI3-K/Akt signaling pathway. Therefore this p53 null cell line indicates that p53 is an indispensable component of cellular signaling system which is regulated by caveolin-1 expression, involving Akt activation and increase in cyclin D1, thereby promoting proliferation of breast cancer cells.« less

  17. Inactivation of p53 by Human T-Cell Lymphotropic Virus Type 1 Tax Requires Activation of the NF-κB Pathway and Is Dependent on p53 Phosphorylation

    PubMed Central

    Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.

    2000-01-01

    p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327

  18. Zn(II)-curc targets p53 in thyroid cancer cells.

    PubMed

    Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella

    2015-10-01

    TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.

  19. Adaptation of cancer cells from different entities to the MDM2 inhibitor nutlin-3 results in the emergence of p53-mutated multi-drug-resistant cancer cells

    PubMed Central

    Michaelis, M; Rothweiler, F; Barth, S; Cinatl, J; van Rikxoort, M; Löschmann, N; Voges, Y; Breitling, R; von Deimling, A; Rödel, F; Weber, K; Fehse, B; Mack, E; Stiewe, T; Doerr, H W; Speidel, D; Cinatl, J

    2011-01-01

    Six p53 wild-type cancer cell lines from infrequently p53-mutated entities (neuroblastoma, rhabdomyosarcoma, and melanoma) were continuously exposed to increasing concentrations of the murine double minute 2 inhibitor nutlin-3, resulting in the emergence of nutlin-3-resistant, p53-mutated sublines displaying a multi-drug resistance phenotype. Only 2 out of 28 sublines adapted to various cytotoxic drugs harboured p53 mutations. Nutlin-3-adapted UKF-NB-3 cells (UKF-NB-3rNutlin10 μM, harbouring a G245C mutation) were also radiation resistant. Analysis of UKF-NB-3 and UKF-NB-3rNutlin10 μM cells by RNA interference experiments and lentiviral transduction of wild-type p53 into p53-mutated UKF-NB-3rNutlin10 μM cells revealed that the loss of p53 function contributes to the multi-drug resistance of UKF-NB-3rNutlin10 μM cells. Bioinformatics PANTHER pathway analysis based on microarray measurements of mRNA abundance indicated a substantial overlap in the signalling pathways differentially regulated between UKF-NB-3rNutlin10 μM and UKF-NB-3 and between UKF-NB-3 and its cisplatin-, doxorubicin-, or vincristine-resistant sublines. Repeated nutlin-3 adaptation of neuroblastoma cells resulted in sublines harbouring various p53 mutations with high frequency. A p53 wild-type single cell-derived UKF-NB-3 clone was adapted to nutlin-3 in independent experiments. Eight out of ten resulting sublines were p53-mutated harbouring six different p53 mutations. This indicates that nutlin-3 induces de novo p53 mutations not initially present in the original cell population. Therefore, nutlin-3-treated cancer patients should be carefully monitored for the emergence of p53-mutated, multi-drug-resistant cells. PMID:22170099

  20. The roles of p53R2 in cancer progression based on the new function of mutant p53 and cytoplasmic p21.

    PubMed

    Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin

    2014-03-18

    Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    PubMed

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-06

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  2. Regulation of autophagy by cytoplasmic p53

    PubMed Central

    Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2009-01-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141

  3. p53 adenoviral vector (Ad-CMV-p53) induced prostatic growth inhibition of primary cultures of human prostate and an experimental rat model.

    PubMed

    Shirakawa, T; Gotoh, A; Gardner, T A; Kao, C; Zhang, Z J; Matsubara, S; Wada, Y; Hinata, N; Fujisawa, M; Hanioka, K; Matsuo, M; Kamidono, S

    2000-01-01

    Benign prostatic hyperplasia (BPH) is the most common proliferative disease affecting men. Numerous minimally invasive technologies are being developed or are currently in use to obviate the need for transurethral surgery. The goal of the present study was to develop a novel molecular based approach for the treatment of BPH using recombinant p53 adenoviral vector. The over-expression of wt-p53 can cause cell apoptosis or cell growth arrest, thus preventing the uncontrolled cell proliferation underlying BPH pathophysiology. Ad-CMV-p53, a replication-deficient recombinant adenovirus containing cytomegalovirus promoter driving p53 gene, was used. Human prostate stromal (PS) cells were evaluated for apoptosis (TUNEL assay), mRNA levels of key cell cycle regulators influencing apoptosis (p-53, Bax and Bcl-2) using quantitative RT-PCR and cytotoxicity after Ad-CMV-p53. Ad-CMV-p53 was unilaterally injected into rat ventral prostates and growth inhibition was measured by prostate weight 3 weeks after injection. In vitro exposure to Ad-CMV-p53 significantly inhibited the proliferation of PS cells, induced mRNA over-expression of both wt-p53 and Bax, and increased the proportion of apoptotic cells. A 30% decrease in average prostate weight was demonstrated in rodents after Ad-CMV-p53 injection. The results suggest that further investigation of molecular gene therapy with recombinant wt-p53 adenovirus for the treatment of BPH is warranted.

  4. The anti-cancer peptide, PNC-27, induces tumor cell necrosis of a poorly differentiated non-solid tissue human leukemia cell line that depends on expression of HDM-2 in the plasma membrane of these cells.

    PubMed

    Davitt, Katlin; Babcock, Blake D; Fenelus, Maly; Poon, Chi Kong; Sarkar, Abhishek; Trivigno, Vincent; Zolkind, Paul A; Matthew, Sheena M; Grin'kina, Natalia; Orynbayeva, Zulfiya; Shaikh, Mohammad F; Adler, Victor; Michl, Josef; Sarafraz-Yazdi, Ehsan; Pincus, Matthew R; Bowne, Wilbur B

    2014-01-01

    We have developed the anti-cancer peptide, PNC-27, which is a membrane-active peptide that binds to the HDM-2 protein expressed in the cancer cell membranes of solid tissue tumor cells and induces transmembrane pore formation in cancer, but not in normal cells, resulting in tumor cell necrosis that is independent of p53 activity in these cells. We now extend our study to non-solid tissue tumor cells, in this case, a primitive, possible stem cell human leukemia cell line (K562) that is also p53-homozygously deleted. Our purpose was twofold: to investigate if these cells likewise express HDM-2 in their plasma membranes and to determine if our anti-cancer peptide induces tumor cell necrosis in these non-solid tissue tumor cells in a manner that depends on the interaction between the peptide and membrane-bound HDM-2. The anti-cancer activity and mechanism of PNC-27, which carries a p53 aa12-26-leader sequence connected on its carboxyl terminal end to a trans-membrane-penetrating sequence or membrane residency peptide (MRP), was studied against p53-null K562 leukemia cells. Murine leukocytes were used as a non-cancer cell control. Necrosis was determined by measuring the lactate dehydrogenase (LDH) release and apoptosis was determined by the detection of Caspases 3 and 7. Membrane colocalization of PNC-27 with HDM-2 was analyzed microscopically using fluorescently labeled antibodies against HDM-2 and PNC-27 peptides. We found that K562 cells strongly express HDM-2 protein in their membranes and that PNC-27 co-localizes with this protein in the membranes of these cells. PNC-27, but not the negative control peptide PNC-29, is selectively cytotoxic to K562 cells, inducing nearly 100 percent cell killing with LDH release. In contrast, this peptide had no effect on the lymphocyte control cells. The results suggest that HDM-2 is expressed in the membranes of non-solid tissue tumor cells in addition to the membranes of solid tissue tumor cells. Since K-562 cells appear to be in the stem cell family, the results suggest that early developing tumor cells also express HDM-2 protein in their membranes. Since PNC-27 induces necrosis of K-562 leukemia cells and co-localizes with HDM-2 in the tumor cell membrane as an early event, we conclude that the association of PNC-27 with HDM-2 in the cancer cell membrane results in trans-membrane pore formation which results in cancer cell death, as previously discovered in a number of different solid tissue tumor cells. Since K562 cells lack p53 expression, these effects of PNC-27 on this leukemia cell line occur by a p53-independent pathway. © 2014 by the Association of Clinical Scientists, Inc.

  5. TRIM65 negatively regulates p53 through ubiquitination

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Yang; Ma, Chengyuan; Zhou, Tong

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediatedmore » degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.« less

  6. Mutant p53 expression in fallopian tube epithelium drives cell migration.

    PubMed

    Quartuccio, Suzanne M; Karthikeyan, Subbulakshmi; Eddie, Sharon L; Lantvit, Daniel D; Ó hAinmhire, Eoghainín; Modi, Dimple A; Wei, Jian-Jun; Burdette, Joanna E

    2015-10-01

    Ovarian cancer is the fifth leading cause of cancer death among US women. Evidence supports the hypothesis that high-grade serous ovarian cancers (HGSC) may originate in the distal end of the fallopian tube. Although a heterogeneous disease, 96% of HGSC contain mutations in p53. In addition, the "p53 signature," or overexpression of p53 protein (usually associated with mutation), is a potential precursor lesion of fallopian tube derived HGSC suggesting an essential role for p53 mutation in early serous tumorigenesis. To further clarify p53-mutation dependent effects on cells, murine oviductal epithelial cells (MOE) were stably transfected with a construct encoding for the R273H DNA binding domain mutation in p53, the most common mutation in HGSC. Mutation in p53 was not sufficient to transform MOE cells but did significantly increase cell migration. A similar p53 mutation in murine ovarian surface epithelium (MOSE), another potential progenitor cell for serous cancer, was not sufficient to transform the cells nor change migration suggesting tissue specific effects of p53 mutation. Microarray data confirmed expression changes of pro-migratory genes in p53(R273H) MOE compared to parental cells, which could be reversed by suppressing Slug expression. Combining p53(R273H) with KRAS(G12V) activation caused transformation of MOE into high-grade sarcomatoid carcinoma when xenografted into nude mice. Elucidating the specific role of p53(R273H) in the fallopian tube will improve understanding of changes at the earliest stage of transformation. This information can help develop chemopreventative strategies to prevent the accumulation of additional mutations and reverse progression of the "p53 signature" thereby, improving survival rates. © 2015 UICC.

  7. Rigor of cell fate decision by variable p53 pulses and roles of cooperative gene expression by p53

    PubMed Central

    Murakami, Yohei; Takada, Shoji

    2012-01-01

    Upon DNA damage, the cell fate decision between survival and apoptosis is largely regulated by p53-related networks. Recent experiments found a series of discrete p53 pulses in individual cells, which led to the hypothesis that the cell fate decision upon DNA damage is controlled by counting the number of p53 pulses. Under this hypothesis, Sun et al. (2009) modeled the Bax activation switch in the apoptosis signal transduction pathway that can rigorously “count” the number of uniform p53 pulses. Based on experimental evidence, here we use variable p53 pulses with Sun et al.’s model to investigate how the variability in p53 pulses affects the rigor of the cell fate decision by the pulse number. Our calculations showed that the experimentally anticipated variability in the pulse sizes reduces the rigor of the cell fate decision. In addition, we tested the roles of the cooperativity in PUMA expression by p53, finding that lower cooperativity is plausible for more rigorous cell fate decision. This is because the variability in the p53 pulse height is more amplified in PUMA expressions with more cooperative cases. PMID:27857606

  8. Mechanisms that enhance sustainability of p53 pulses.

    PubMed

    Kim, Jae Kyoung; Jackson, Trachette L

    2013-01-01

    The tumor suppressor p53 protein shows various dynamic responses depending on the types and extent of cellular stresses. In particular, in response to DNA damage induced by γ-irradiation, cells generate a series of p53 pulses. Recent research has shown the importance of sustaining repeated p53 pulses for recovery from DNA damage. However, far too little attention has been paid to understanding how cells can sustain p53 pulses given the complexities of genetic heterogeneity and intrinsic noise. Here, we explore potential molecular mechanisms that enhance the sustainability of p53 pulses by developing a new mathematical model of the p53 regulatory system. This model can reproduce many experimental results that describe the dynamics of p53 pulses. By simulating the model both deterministically and stochastically, we found three potential mechanisms that improve the sustainability of p53 pulses: 1) the recently identified positive feedback loop between p53 and Rorα allows cells to sustain p53 pulses with high amplitude over a wide range of conditions, 2) intrinsic noise can often prevent the dampening of p53 pulses even after mutations, and 3) coupling of p53 pulses in neighboring cells via cytochrome-c significantly reduces the chance of failure in sustaining p53 pulses in the presence of heterogeneity among cells. Finally, in light of these results, we propose testable experiments that can reveal important mechanisms underlying p53 dynamics.

  9. p53 Hypersensitivity Is the Predominant Mechanism of the Unique Responsiveness of Testicular Germ Cell Tumor (TGCT) Cells to Cisplatin

    PubMed Central

    Gutekunst, Matthias; Oren, Moshe; Weilbacher, Andrea; Dengler, Michael A.; Markwardt, Christiane; Thomale, Jürgen; Aulitzky, Walter E.; van der Kuip, Heiko

    2011-01-01

    Consistent with the excellent clinical results in testicular germ cell tumors (TGCT), most cell lines derived from this cancer show an exquisite sensitivity to Cisplatin. It is well accepted that the high susceptibility of TGCT cells to apoptosis plays a central role in this hypersensitive phenotype. The role of the tumor suppressor p53 in this response, however, remains controversial. Here we show that siRNA-mediated silencing of p53 is sufficient to completely abrogate hypersensitivity not only to Cisplatin but also to non-genotoxic inducers of p53 such as the Mdm2 antagonist Nutlin-3 and the proteasome inhibitor Bortezomib. The close relationship between p53 protein levels and induction of apoptosis is lost upon short-term differentiation, indicating that this predominant pro-apoptotic function of p53 is unique in pluripotent embryonal carcinoma (EC) cells. RNA interference experiments as well as microarray analysis demonstrated a central role of the pro-apoptotic p53 target gene NOXA in the p53-dependent apoptotic response of these cells. In conclusion, our data indicate that the hypersensitivity of TGCT cells is a result of their unique sensitivity to p53 activation. Furthermore, in the very specific cellular context of germ cell-derived pluripotent EC cells, p53 function appears to be limited to induction of apoptosis. PMID:21532991

  10. Mutant p53 establishes targetable tumor dependency by promoting unscheduled replication

    PubMed Central

    Singh, Shilpa; Vaughan, Catherine A.; Frum, Rebecca A.; Grossman, Steven R.; Deb, Sumitra

    2017-01-01

    Gain-of-function (GOF) p53 mutations are observed frequently in most intractable human cancers and establish dependency for tumor maintenance and progression. While some of the genes induced by GOF p53 have been implicated in more rapid cell proliferation compared with p53-null cancer cells, the mechanism for dependency of tumor growth on mutant p53 is unknown. This report reveals a therapeutically targetable mechanism for GOF p53 dependency. We have shown that GOF p53 increases DNA replication origin firing, stabilizes replication forks, and promotes micronuclei formation, thus facilitating the proliferation of cells with genomic abnormalities. In contrast, absence or depletion of GOF p53 leads to decreased origin firing and a higher frequency of fork collapse in isogenic cells, explaining their poorer proliferation rate. Following genome-wide analyses utilizing ChIP-Seq and RNA-Seq, GOF p53–induced origin firing, micronuclei formation, and fork protection were traced to the ability of GOF p53 to transactivate cyclin A and CHK1. Highlighting the therapeutic potential of CHK1’s role in GOF p53 dependency, experiments in cell culture and mouse xenografts demonstrated that inhibition of CHK1 selectively blocked proliferation of cells and tumors expressing GOF p53. Our data suggest the possibility that checkpoint inhibitors could efficiently and selectively target cancers expressing GOF p53 alleles. PMID:28394262

  11. Mutant human tumor suppressor p53 modulates the activation of mitogen-activated protein kinase and nuclear factor-kappaB, but not c-Jun N-terminal kinase and activated protein-1.

    PubMed

    Gulati, Anthony P; Yang, Yang-Ming; Harter, David; Mukhopadhyay, Asok; Aggarwal, Bharat B; Aggarwal, Bharat A; Benzil, Deborah L; Whysner, John; Albino, Anthony P; Murali, Raj; Jhanwar-Uniyal, Meena

    2006-01-01

    The roles of the mitogen-activated kinase protein (MAPK) pathway, nuclear factor-kappa B (NF-kappaB), and activator protein-1 (AP-1) in cellular responses to growth factors and mitogen are well established. However, the manner by which these proliferative pathways are affected by the tumor suppressor protein p53 is not fully understood. We report here the results of an investigation of the status of p53 on two human melanoma cell lines with wild-type p53 (SK-Mel-186) or mutant p53 (SK-Mel-110). The basal levels of the activated extracellular-signal regulated kinases 1 and 2 (ERK1/2) were high in cells with wild-type p53, but low in cells with mutant p53. The 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced activation of ERK1/2 through the phosphorylation of threonine and tyrosine at 202 and 204, respectively, was demonstrated in both cell lines, however, in a discrete manner. TPA-induced activation of ERK1/2 was sustained in wild-type p53 cells, while only a transient activation was seen in mutant p53 cells. Inhibition of MAPK kinase (MEK), an upstream kinase, by U0126, blocked TPA-induced activation of ERK1/2 in wild-type p53 cells and in mutant p53 cells. Treatment of wild-type p53 (SK-Mel 186) cells with small interfering RNA (siRNA) of p53 displayed a transient induction of activation of ERK1/2 following TPA treatment, indicating that p53 has a role in the regulation of the activation of ERK1/2. NF-kappaB activity decreased significantly in cells with wild-type p53, while enhanced NF-kappaB activity was evident in cells with mutant p53. The expression of either wild-type or mutant p53 had a similar effect on TPA-induced Jun N-terminal kinase (JNK) activation, indicating specificity for the ERK pathway. Similarly, AP-1 binding activity showed a transient variation in both cell lines after TPA treatment but with different kinetics. These observations suggest that both wild-type and mutant p53 can modulate the activation pathways for ERK1/2, and NF-kappaB distinctively, while modulating the pathways of JNK and AP-1 similarly. These differences may influence cellular processes such as proliferation, differentiation, and apoptosis. 2005 Wiley-Liss, Inc.

  12. TRIM25 has a dual function in the p53/Mdm2 circuit.

    PubMed

    Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C

    2015-11-12

    P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context.

  13. Battle against cancer: an everlasting saga of p53.

    PubMed

    Hao, Qian; Cho, William C

    2014-12-01

    Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  14. CCAAT/enhancer-binding protein α is required for hepatic outgrowth via the p53 pathway in zebrafish

    PubMed Central

    Yuan, Hao; Wen, Bin; Liu, Xiaohui; Gao, Ce; Yang, Ruimeng; Wang, Luxiang; Chen, Saijuan; Chen, Zhu; de The, Hugues; Zhou, Jun; Zhu, Jun

    2015-01-01

    CCAAT/enhancer-binding protein α (C/ebpα) is a transcription factor that plays important roles in the regulation of hepatogenesis, adipogenesis and hematopoiesis. Disruption of the C/EBPα gene in mice leads to disturbed liver architecture and neonatal death due to hypoglycemia. However, the precise stages of liver development affected by C/ebpα loss are poorly studied. Using the zebrafish embryo as a model organism, we show that inactivation of the cebpa gene by TALENs results in a small liver phenotype. Further studies reveal that C/ebpα is distinctively required for hepatic outgrowth but not for hepatoblast specification. Lack of C/ebpα leads to enhanced hepatic cell proliferation and subsequent increased cell apoptosis. Additional loss of p53 can largely rescue the hepatic defect in cebpa mutants, suggesting that C/ebpα plays a role in liver growth regulation via the p53 pathway. Thus, our findings for the first time demonstrate a stage-specific role for C/ebpα during liver organogenesis. PMID:26511037

  15. CCAAT/enhancer-binding protein α is required for hepatic outgrowth via the p53 pathway in zebrafish.

    PubMed

    Yuan, Hao; Wen, Bin; Liu, Xiaohui; Gao, Ce; Yang, Ruimeng; Wang, Luxiang; Chen, Saijuan; Chen, Zhu; de The, Hugues; Zhou, Jun; Zhu, Jun

    2015-10-29

    CCAAT/enhancer-binding protein α (C/ebpα) is a transcription factor that plays important roles in the regulation of hepatogenesis, adipogenesis and hematopoiesis. Disruption of the C/EBPα gene in mice leads to disturbed liver architecture and neonatal death due to hypoglycemia. However, the precise stages of liver development affected by C/ebpα loss are poorly studied. Using the zebrafish embryo as a model organism, we show that inactivation of the cebpa gene by TALENs results in a small liver phenotype. Further studies reveal that C/ebpα is distinctively required for hepatic outgrowth but not for hepatoblast specification. Lack of C/ebpα leads to enhanced hepatic cell proliferation and subsequent increased cell apoptosis. Additional loss of p53 can largely rescue the hepatic defect in cebpa mutants, suggesting that C/ebpα plays a role in liver growth regulation via the p53 pathway. Thus, our findings for the first time demonstrate a stage-specific role for C/ebpα during liver organogenesis.

  16. A ‘synthetic-sickness’ screen for senescence re-engagement targets in mutant cancer backgrounds

    PubMed Central

    Godwin, Lauren S.; Bilsland, Alan E.; Stevenson, Katrina H.; Moore, Jon D.; Wiggins, Ceri M.; Collinson, Rebecca S.; Mudd, Clare; Sadaie, Mahito; Bennett, Dorothy C.; Torrance, Christopher J.; Keith, W. Nicol

    2017-01-01

    Senescence is a universal barrier to immortalisation and tumorigenesis. As such, interest in the use of senescence-induction in a therapeutic context has been gaining momentum in the past few years; however, senescence and immortalisation remain underserved areas for drug discovery owing to a lack of robust senescence inducing agents and an incomplete understanding of the signalling events underlying this complex process. In order to address this issue we undertook a large-scale morphological siRNA screen for inducers of senescence phenotypes in the human melanoma cell line A375P. Following rescreen and validation in a second cancer cell line, HCT116 colorectal carcinoma, a panel of 16 of the most robust hits were selected for further validation based on significance and the potential to be targeted by drug-like molecules. Using secondary assays for detection of senescence biomarkers p21, 53BP1 and senescence associated beta-galactosidase (SAβGal) in a panel of HCT116 cell lines carrying cancer-relevant mutations, we show that partial senescence phenotypes can be induced to varying degrees in a context dependent manner, even in the absence of p21 or p53 expression. However, proliferation arrest varied among genetic backgrounds with predominantly toxic effects in p21 null cells, while cells lacking PI3K mutation failed to arrest. Furthermore, we show that the oncogene ECT2 induces partial senescence phenotypes in all mutant backgrounds tested, demonstrating a dependence on activating KRASG13D for growth suppression and a complete senescence response. These results suggest a potential mechanism to target mutant KRAS signalling through ECT2 in cancers that are reliant on activating KRAS mutations and remain refractory to current treatments. PMID:28806777

  17. A Synthetic Interaction Screen Identifies Factors Selectively Required for Proliferation and TERT Transcription in p53-Deficient Human Cancer Cells

    PubMed Central

    Park, Sung Mi; Zhu, Lihua J.; Debily, Marie-anne; Kittler, Ellen L. W.; Zapp, Maria L.; Lapointe, David; Gobeil, Stephane; Virbasius, Ching-Man; Green, Michael R.

    2012-01-01

    Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi)–based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53−) human cancer cells. We find that compared to p53-competent (p53+) human cancer cell lines, diverse p53− human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53− cells, RNAi–mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53− but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53− cancer cells. PMID:23284306

  18. Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

    PubMed Central

    Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

    2018-01-01

    Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

  19. Co-expression of p53 and MDM2 in human atherosclerosis: implications for the regulation of cellularity of atherosclerotic lesions.

    PubMed

    Ihling, C; Haendeler, J; Menzel, G; Hess, R D; Fraedrich, G; Schaefer, H E; Zeiher, A M

    1998-07-01

    Atherosclerosis is a fibroproliferative disease of the arterial intima. It was recently found that wild-type p53 (wt p53) accumulates in human atherosclerotic tissue. Wt p53 is a cell cycle regulator involved in DNA repair, DNA synthesis, cell differentiation, and apoptosis and might therefore make an important contribution to the cellularity of atherosclerotic plaques. The product of the MDM2 gene is a nuclear protein which forms a complex with p53, thereby inhibiting the negative regulatory effects of wt p53 on cell cycle progression. In order to address a potential role of the interaction of p53 with MDM2 for the regulation of cellularity in atherosclerotic tissue, 22 carotid atheromatous plaques from patients undergoing endarterectomy were studied to determine the presence of p53 immunoreactivity (IR), MDM2 IR, cell proliferation as evidenced by MIB1/Ki-67 IR and DNA fragmentation by in situ terminal transferase-mediated dUTP 3' end labelling (TUNEL), as a marker for apoptosis. p53 IR localized to areas with evidence of chronic inflammation (22/22) and was observed in virtually all cell types in 68.79 +/- 7.51 per cent of the nuclei. p53 staining in the control tissue from human internal mammary arteries was present in 0.2 +/- 0.29 per cent of the cells (P < or = 0.002). MDM2 IR was present in all cases (22/22) in macrophages and smooth muscle cells (SMCs) in 60.53 +/- 8.32 per cent of the nuclei (controls: 0.8 +/- 0.65 per cent, P < or = 0.002) and co-localized with p53 IR as shown by examination of adjacent sections and by double immunofluorescence labelling. Importantly, co-immunoprecipitation and western blot analysis revealed that p53 and MDM2 were physically associated, indicating that MDM2-p53 complex formation takes place in vivo in human atherosclerotic tissue. Positive TUNEL staining and MIB1/Ki-67 IR present in 3.01 +/- 1.27 per cent of the nuclei (controls: 0 per cent, P < or = 0.002) localized to the same plaque compartments as p53 IR and MDM2 IR. Thus, the fate of cells with p53 accumulation may depend on the interaction and the stoichiometry of the p53 and MDM2 proteins. Cells were indeed found with strong p53 accumulation and nuclear morphology typical for apoptosis and there were a few MIB1/Ki-67-positive cells with co-expression of MDM2, indicating a possible role for MDM2 in reversing the negative regulatory effects of p53 for cell cycle progression. The nuclear co-localization of p53 IR with MDM2 IR and the co-immunoprecipitation assay indicate the presence of p53-MDM2 complex formation in vivo in human atherosclerotic tissue. The destiny of individual p53 and MDM2-co-expressing cells either to undergo p53-dependent apoptosis or to re-enter the cycle of cell proliferation may depend on the relative ratios of the two proteins. p53 and MDM2 may therefore play an important role in regulating cellularity and inflammatory activity in human atherosclerotic plaques.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Youn-hee; Kim, Donghern; Dai, Jin

    Occupational and environmental exposure to arsenic (III) and chromium VI (Cr(VI)) have been confirmed to cause lung cancer. Mechanisms of these metals carcinogenesis are still under investigation. Selection of cell lines to be used is essential for the studies. Human bronchial epithelial BEAS-2B cells are the cells to be utilized by most of scientists. However, due to p53 missense mutation (CCG → TCG) at codon 47 and the codon 72 polymorphism (CGC → CCC) in BEAS-2B cells, its usage has frequently been questioned. The present study has examined activity and expression of 53 and its downstream target protein p21 uponmore » acute or chronic exposure of BEAS-2B cells to arsenic and Cr(VI). The results show that short-term exposure of BEAS-2B cells to arsenic or Cr(VI) was able to activate both p53 and p21. Chronic exposure of BEAS-2B cells to these two metals caused malignant cell transformation and tumorigenesis. In arsenic-transformed BEAS-2B cells reductions in p53 promoter activity, mRNA expression, and phosphorylation of p53 at Ser392 were observed, while the total p53 protein level remained the same compared to those in passage-matched parent ones. p21 promoter activity and expression were decreased in arsenic-transformed cells. Cr(VI)-transformed cells exhibit elevated p53 promoter activity, mRNA expression, and phosphorylation at Ser15, but reduced phosphorylation at Ser392 and total p53 protein level compared to passage-matched parent ones. p21 promoter activity and expression were elevated in Cr(VI)-transformed cells. These results demonstrate that p53 is able to respond to exposure of arsenic or Cr(VI), suggesting that BEAS-2B cells are an appropriate in vitro model to investigate arsenic or Cr(VI) induced lung cancer. - Highlights: • Short-term exposure of BEAS-2B cells to arsenic or Cr(VI) activates p53 and p21. • Chronic exposure of BEAS-2B cells to arsenic or Cr(VI) causes cell transformation and tumorigenesis. • Arsenic-transformed cells exhibit reduced activities of p53 and p21. • Cr(VI)-transformed cells exhibit increased activities of p53 and p21.« less

  1. Chaperone-mediated autophagy degrades mutant p53

    PubMed Central

    Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

    2013-01-01

    Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

  2. ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53

    PubMed Central

    Sullivan, Kelly D.; Padilla-Just, Nuria; Henry, Ryan E.; Porter, Christopher C.; Kim, Jihye; Tentler, John J.; Eckhardt, S. Gail; Tan, Aik Choon; DeGregori, James; Espinosa, Joaquín M.

    2012-01-01

    The p53 tumor suppressor orchestrates alternative stress responses including cell cycle arrest and apoptosis, but the mechanisms defining cell fate upon p53 activation are poorly understood. Several small molecule activators of p53 have been developed, including Nutlin-3, but their therapeutic potential is limited by the fact that they induce reversible cell cycle arrest in most cancer cell types. We report here the results of a ‘Synthetic Lethal with Nutlin-3’ genome-wide shRNA screen, which revealed that the ATM and MET kinases govern cell fate choice upon p53 activation. Genetic or pharmacological interference with ATM or MET activity converts the cellular response from cell cycle arrest into apoptosis in diverse cancer cell types without affecting expression of key p53 target genes. ATM and MET inhibitors enable Nutlin-3 to kill tumor spheroids. These results identify novel pathways controlling the cellular response to p53 activation and aid in the design of p53-based therapies. PMID:22660439

  3. p53 is a key regulator for osthole-triggered cancer pathogenesis.

    PubMed

    Huang, Ssu-Ming; Tsai, Cheng-Fang; Chen, Dar-Ren; Wang, Min-Ying; Yeh, Wei-Lan

    2014-01-01

    Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development.

  4. [Application of PLA Method for Detection of p53/p63/p73 Complexes in Situ in Tumour Cells and Tumour Tissue].

    PubMed

    Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B

    2017-01-01

    PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I - LO1413. The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study. The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 13. 3. 2017Accepted: 26. 3. 2017.

  5. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

    PubMed Central

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika

    2016-01-01

    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  6. The influence of SV40 immortalization of human fibroblasts on p53-dependent radiation responses

    NASA Technical Reports Server (NTRS)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The simian virus 40 large tumor antigen (SV40 Tag) has been ascribed many functions critical to viral propagation, including binding to the mammalian tumor suppressor p53. Recent studies have demonstrated that SV40-transformed murine cells have functional p53. The status of p53 in SV40-immortalized human cells, however, has not been characterized. We have found that in response to ionizing radiation, p53-dependent p21 transactivation activity is present, albeit reduced, in SV40-immortalized cells and that this activity can be further reduced with either dominant negative p53 expression or higher SV40 Tag expression. Furthermore, overexpression of p53 in SV40-immortalized ataxia-telangiectasia (A-T) cells restores p53-dependent p21 induction to typical A-T levels. All SV40-immortalized cell lines exhibited an absence of G1 arrest. Moreover, all SV40-immortalized cell lines exhibited increased apoptosis relative to primary cells in response to ionizing radiation, suggesting that SV40 immortalization results in a unique phenotype with regard to DNA damage responses. Copyright 1999 Academic Press.

  7. TSPAN12 is a critical factor for cancer–fibroblast cell contact-mediated cancer invasion

    PubMed Central

    Otomo, Ryo; Otsubo, Chihiro; Matsushima-Hibiya, Yuko; Miyazaki, Makoto; Tashiro, Fumio; Ichikawa, Hitoshi; Kohno, Takashi; Ochiya, Takahiro; Yokota, Jun; Nakagama, Hitoshi; Taya, Yoichi; Enari, Masato

    2014-01-01

    Communication between cancer cells and their microenvironment controls cancer progression. Although the tumor suppressor p53 functions in a cell-autonomous manner, it has also recently been shown to function in a non–cell-autonomous fashion. Although functional defects have been reported in p53 in stromal cells surrounding cancer, including mutations in the p53 gene and decreased p53 expression, the role of p53 in stromal cells during cancer progression remains unclear. We herein show that the expression of α-smooth muscle actin (α-SMA), a marker of cancer-associated fibroblasts (CAFs), was increased by the ablation of p53 in lung fibroblasts. CAFs enhanced the invasion and proliferation of lung cancer cells when cocultured with p53-depleted fibroblasts and required contact between cancer and stromal cells. A comprehensive analysis using a DNA chip revealed that tetraspanin 12 (TSPAN12), which belongs to the tetraspanin protein family, was derepressed by p53 knockdown. TSPAN12 knockdown in p53-depleted fibroblasts inhibited cancer cell proliferation and invasion elicited by coculturing with p53-depleted fibroblasts in vitro, and inhibited tumor growth in vivo. It also decreased CXC chemokine ligand 6 (CXCL6) secretion through the β-catenin signaling pathway, suggesting that cancer cell contact with TSPAN12 in fibroblasts transduced β-catenin signaling into fibroblasts, leading to the secretion of CXCL6 to efficiently promote invasion. These results suggest that stroma-derived p53 plays a pivotal role in epithelial cancer progression and that TSPAN12 and CXCL6 are potential targets for lung cancer therapy. PMID:25512506

  8. Notch1 Signaling Sensitizes Tumor Necrosis Factor-related Apoptosis-inducing Ligand-induced Apoptosis in Human Hepatocellular Carcinoma Cells by Inhibiting Akt/Hdm2-mediated p53 Degradation and Up-regulating p53-dependent DR5 Expression*

    PubMed Central

    Wang, Chunmei; Qi, Runzi; Li, Nan; Wang, Zhengxin; An, Huazhang; Zhang, Qinghua; Yu, Yizhi; Cao, Xuetao

    2009-01-01

    Notch signaling plays a critical role in regulating cell proliferation, differentiation, and apoptosis. Our previous study showed that overexpression of Notch1 could inhibit human hepatocellular carcinoma (HCC) cell growth by arresting the cell cycle and inducing apoptosis. HCC cells are resistant to apoptotic induction by tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), so new therapeutic approaches have been explored to sensitize HCC cells to TRAIL-induced apoptosis. We are wondering whether and how Notch1 signaling can enhance the sensitivity of HCC cells to TRAIL-induced apoptosis. In this study, we found that overexpression of ICN, the constitutive activated form of Notch1, up-regulated p53 protein expression in HCC cells by inhibiting proteasome degradation. p53 up-regulation was further observed in human primary hepatocellular carcinoma cells after activation of Notch signaling. Inhibition of the Akt/Hdm2 pathway by Notch1 signaling was responsible for the suppression of p53 proteasomal degradation, thus contributing to the Notch1 signaling-mediated up-regulation of p53 expression. Accordingly, Notch1 signaling could make HCC cells more sensitive to TRAIL-induced apoptosis, whereas Notch1 signaling lost the synergistic promotion of TRAIL-induced apoptosis in p53-silenced HepG2 HCC cells and p53-defective Hep3B HCC cells. The data suggest that enhancement of TRAIL-induced apoptosis by Notch1 signaling is dependent upon p53 up-regulation. Furthermore, Notch1 signaling could enhance DR5 expression in a p53-dependent manner. Taken together, Notch1 signaling sensitizes TRAIL-induced apoptosis in HCC cells by inhibiting Akt/Hdm2-mediated p53 degradation and up-regulating p53-dependent DR5 expression. Thus, our results suggest that activation of Notch1 signaling may be a promising approach to improve the therapeutic efficacy of TRAIL-resistant HCC. PMID:19376776

  9. Identification of p53 unbound to T-antigen in human cells transformed by simian virus 40 T-antigen.

    PubMed

    O'Neill, F J; Hu, Y; Chen, T; Carney, H

    1997-02-27

    In several clones of SV40-transformed human cells, we investigated the relative amounts of large T-Antigen (T-Ag) and p53 proteins, both unbound and associated within complexes, with the goal of identifying changes associated with transformation and immortalization. Cells were transformed by wild type (wt) T-Ag, a functionally temperature sensitive T-Ag (tsA58) and other T-Ag variants. Western analysis showed that while most of the T-Ag was ultimately bound by p53, most of the p53 remained unbound to T-Ag. Unbound p53 remained in the supernatant after a T-Ag immunoprecipitation and p53 was present in two to fourfold excess of T-Ag. In one transformant there was five to tenfold more p53 than T-Ag. p53 was present in transformants in amounts at least 200-fold greater than in untransformed human cells. In wt and variant T-Ag transformants, including those generated with tsA58 T-Ag, large amounts of unbound p53 were present in both pre-crisis and immortal cells and when the cells were grown at permissive or non-permissive temperatures. We also found that in transformants produced by tsA58, an SV40/JCV chimeric T-Ag and other variants, T-Ag appeared to form a complex with p53 slowly perhaps because one or both proteins matured slowly. The presence in transformed human cells of large amounts of unbound p53 and in excess of T-Ag suggests that sequestration of p53 by T-Ag, resulting from complex formation, is required neither for morphological transformation nor immortalization of human cells. Rather, these results support the proposal that high levels of p53, the T-Ag/p53 complexes, or other biochemical event(s), lead to transformation and immortalization of human cells by T-Ag.

  10. p53 elevation in human cells halt SV40 infection by inhibiting T-ag expression

    PubMed Central

    Drayman, Nir; Ben-nun-Shaul, Orly; Butin-Israeli, Veronika; Srivastava, Rohit; Rubinstein, Ariel M.; Mock, Caroline S.; Elyada, Ela; Ben-Neriah, Yinon; Lahav, Galit; Oppenheim, Ariella

    2016-01-01

    SV40 large T-antigen (T-ag) has been known for decades to inactivate the tumor suppressor p53 by sequestration and additional mechanisms. Our present study revealed that the struggle between p53 and T-ag begins very early in the infection cycle. We found that p53 is activated early after SV40 infection and defends the host against the infection. Using live cell imaging and single cell analyses we found that p53 dynamics are variable among individual cells, with only a subset of cells activating p53 immediately after SV40 infection. This cell-to-cell variabilty had clear consequences on the outcome of the infection. None of the cells with elevated p53 at the beginning of the infection proceeded to express T-ag, suggesting a p53-dependent decision between abortive and productive infection. In addition, we show that artificial elevation of p53 levels prior to the infection reduces infection efficiency, supporting a role for p53 in defending against SV40. We further found that the p53-mediated host defense mechanism against SV40 is not facilitated by apoptosis nor via interferon-stimulated genes. Instead p53 binds to the viral DNA at the T-ag promoter region, prevents its transcriptional activation by Sp1, and halts the progress of the infection. These findings shed new light on the long studied struggle between SV40 T-ag and p53, as developed during virus-host coevolution. Our studies indicate that the fate of SV40 infection is determined as soon as the viral DNA enters the nucleus, before the onset of viral gene expression. PMID:27462916

  11. Bim directly antagonizes Bcl-xl in doxorubicin-induced prostate cancer cell apoptosis independently of p53.

    PubMed

    Yang, Min-Chi; Lin, Ru-Wei; Huang, Shih-Bo; Huang, Shin-Yuan; Chen, Wen-Jie; Wang, Shiaw; Hong, Yi-Ren; Wang, Chihuei

    2016-01-01

    Doxorubicin and other anthracycline compounds exert their anti-cancer effects by causing DNA damage and initiating cell cycle arrest in cancer cells, followed by apoptosis. DNA damage generally activates a p53-mediated pathway to initiate apoptosis by increasing the level of the BH3-only protein, Puma. However, p53-mediated apoptosis in response to DNA damage has not yet been validated in prostate cancers. In the current study, we used LNCaP and PC3 prostate cancer cells, representing wild type p53 and a p53-null model, to determine if DNA damage activates p53-mediated apoptosis in prostate cancers. Our results revealed that PC3 cells were 4 to 8-fold less sensitive than LNCaP cells to doxorubicin-inuced apoptosis. We proved that the differential response of LNCaP and PC3 to doxorubicin was p53-independent by introducing wild-type or dominant negative p53 into PC3 or LNCaP cells, respectively. By comparing several apoptosis-related proteins in both cell lines, we found that Bcl-xl proteins were much more abundant in PC3 cells than in LNCaP cells. We further demonstrated that Bcl-xl protects LNCaP and PC3 cells from doxorubicin-induced apoptosis by using ABT-263, an inhibitor of Bcl-xl, as a single agent or in combination with doxorubicin to treat LNCaP or PC3 cells. Bcl-xl rather than p53, likely contributes to the differential response of LNCaP and PC3 to doxorubicin in apoptosis. Finally, co-immunoprecipitation and siRNA analysis revealed that a BH3-only protein, Bim, is involved in doxorubicin-induced apoptosis by directly counteracting Bcl-xl.

  12. P53 alters the cytotoxicity and genotoxicity for oxidized graphene in human B-lymphoblastoid cells

    NASA Astrophysics Data System (ADS)

    Petibone, Dayton Matthew

    Widespread use of oxidized graphene nanomaterials in industry, medicine, and consumer products raises concern about potential adverse impacts on human health. The p53 tumor suppressor protein is crucial to maintaining cellular and genetic stability to prevent carcinogenesis. Here, we show that oxygen functionalized graphene (f-G) absorption and p53 functional status correlate with cytotoxicity and genotoxicity in human B-lymphoblastoid cells. Trends in f-G absorption by were dose-dependent. Cells with functional p53 exposed to f-G arrested in G0/G1 phase of the cell cycle, suppressed f-G induced reactive oxygen species (ROS), and had elevated apoptosis. While compared to p53 competent cells, the p53 deficient cells exposed to f-G accumulated in S-phase of the cell cycle, had elevated ROS levels, and evaded apoptosis. The f-G genotoxicity was evident as increased loss-of-heterozygosity mutants independent of p53 status, and structural chromosome damage in p53 deficient cells. These findings have broad implications for the safety and efficacy of oxidized graphene nanomaterials in industrial, consumer products and biomedical applications.

  13. CDIP, a novel pro-apoptotic gene, regulates TNFalpha-mediated apoptosis in a p53-dependent manner.

    PubMed

    Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

    2007-07-25

    We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-alpha expression tightly correlates with CDIP expression, and that inhibition of TNF-alpha signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-alpha is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-alpha impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 --> CDIP --> TNF-alpha apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy.

  14. JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation

    PubMed Central

    Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

    2009-01-01

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types—MDM2, Pirh2, and COP1—and the HECT-domain type—ARF-BP1—have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G1 phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation. PMID:19509332

  15. JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation.

    PubMed

    Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

    2009-06-23

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types--MDM2, Pirh2, and COP1--and the HECT-domain type--ARF-BP1--have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G(1) phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation.

  16. CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.

    PubMed

    He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang

    2015-03-01

    Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.

  17. Mulberry leaf polyphenol extract induced apoptosis involving regulation of adenosine monophosphate-activated protein kinase/fatty acid synthase in a p53-negative hepatocellular carcinoma cell.

    PubMed

    Yang, Tzi-Peng; Lee, Huei-Jane; Ou, Ting-Tsz; Chang, Ya-Ju; Wang, Chau-Jong

    2012-07-11

    The polyphenols in mulberry leaf possess the ability to inhibit cell proliferation, invasion, and metastasis of tumors. It was reported that the p53 status plays an important role in switching apoptosis and the cell cycle following adenosine monophosphate-activated protein kinase (AMPK) activation. In this study, we aimed to detect the effect of the mulberry leaf polyphenol extract (MLPE) on inducing cell death in p53-negative (Hep3B) and p53-positive (Hep3B with transfected p53) hepatocellular carcinoma cells and also to clarify the role of p53 in MLPE-treated cells. After treatment of the Hep3B cells with MLPE, apoptosis was induced via the AMPK/PI3K/Akt and Bcl-2 family pathways. Transient transfection of p53 into Hep3B cells led to switching autophagy instead of apoptosis by MLPE treatment. We demonstrated that acridine orange staining and protein expressions of LC-3 and beclin-1 were increased in p53-transfected cells. These results implied induction of apoptosis or autophagy in MLPE-treated hepatocellular carcinoma cells can be due to the p53 status. We also found MLPE can not only activate AMPK but also diminish fatty acid synthase, a molecular target for cancer inhibition. At present, our results indicate MLPE can play an active role in mediating the cell death of hepatocellular carcinoma cells and the p53 might play an important role in regulating the death mechanisms.

  18. C2-streptavidin mediates the delivery of biotin-conjugated tumor suppressor protein p53 into tumor cells.

    PubMed

    Fahrer, Jörg; Schweitzer, Brigitte; Fiedler, Katja; Langer, Torben; Gierschik, Peter; Barth, Holger

    2013-04-17

    We have previously generated a recombinant C2-streptavidin fusion protein for the delivery of biotin-labeled molecules of low molecular weight into the cytosol of mammalian cells. A nontoxic moiety of Clostridium botulinum C2 toxin mediates the cellular uptake, whereas the streptavidin unit serves as a binding platform for biotin-labeled cargo molecules. In the present study, we used the C2-streptavidin transporter to introduce biotin-conjugated p53 protein into various mammalian cell lines. The p53 tumor suppressor protein is inactivated in many human cancers by multiple mechanisms and therefore the restoration of its activity in tumor cells is of great therapeutic interest. Recombinant p53 was expressed in insect cells and biotin-labeled. Biotin-p53 retained its specific high-affinity DNA-binding as revealed by gel-shift analysis. Successful conjugation of biotin-p53 to the C2-streptavidin transporter was monitored by an overlay blot technique and confirmed by real-time surface plasmon resonance, providing a KD-value in the low nM range. C2-streptavidin significantly enhanced the uptake of biotin-p53 into African Green Monkey (Vero) epithelial cells as shown by flow cytometry. Using cell fractionation, the cytosolic translocation of biotin-p53 was detected in Vero cells as well as in HeLa cervix carcinoma cells. In line with this finding, confocal microscopy displayed cytoplasmic staining of biotin-p53 in HeLa and HL60 leukemia cells. Internalized biotin-p53 partially colocalized with early endosomes, as confirmed by confocal microscopy. In conclusion, our results demonstrate the successful conjugation of biotin-p53 to C2-streptavidin and its subsequent receptor-mediated endocytosis into different human tumor cell lines.

  19. Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.

    PubMed

    Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B

    2018-05-23

    TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.

  20. Adenovirally mediated p53 overexpression diversely influence the cell cycle of HEp-2 and CAL 27 cell lines upon cisplatin and methotrexate treatment.

    PubMed

    Kraljević Pavelić, Sandra; Marjanović, Marko; Poznić, Miroslav; Kralj, Marijeta

    2009-12-01

    p53 gene plays a crucial role in the response to therapy. Since it is inactivated in the majority of human cancers, it is strongly believed that the p53 mutations confer resistance to therapeutics. In this paper we analyzed the influence of two mechanistically diverse antitumor agents--cisplatin and methotrexate on the proliferation and cell cycle of two head and neck squamous cancer cell lines HEp-2 (wild type p53 gene, but HPV 18/E6-inactivated protein) and CAL 27 (mutated p53 gene), along with the influence of adenovirally mediated p53 overexpression in modulation of cisplatin and methoterexate effects, whereby subtoxic vector/compound concentrations were employed. p53 gene was introduced into tumor cells using adenoviral vector (AdCMV-p53). The cell cycle perturbations were measured by two parameter flow cytometry. The expression of p53, p21(WAF1/CIP1) and cyclin B1 proteins was examined using immunocytochemistry and western blot methods. In CAL 27 cells overexpression of p53 completely abrogated high S phase content observed in methotrexate-treated cells into a G1 and slight G2 arrest, while it sustained G2 arrest of the cells treated with cisplatin, along with the reduction of DNA synthesis and cyclin B1 expression. On the other hand, in HEp-2 cell line p53 overexpression slightly slowed down the progression through S phase in cells treated with methotrexate, decreased the cyclin B1 expression only after 24 h, and failed to sustain the G2 arrest after treatment with cisplatin alone. Instead, it increased the population of S phase cells that were not actively synthesizing DNA, sustained cyclin B1 expression and allowed the G2 cells to progress through mitosis. This study demonstrates that adenovirally mediated p53 overexpression at sub-cytotoxic levels enhanced the activity of low doses of cisplatin and methotrexate in HEp-2 and CAL 27 cells through changes in the cell cycle. However, the mechanisms of these effects differ depending on the genetic context and on the chemotherapeutics' modality of action.

  1. Stimulation of autophagy by the p53 target gene Sestrin2.

    PubMed

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

    2009-05-15

    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  2. Mechanism of p53-Dependent Apoptosis and its Role in Breast Cancer Therapy

    DTIC Science & Technology

    1999-07-01

    inducibly express p53 as previously described (Chen et a!., 1996). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A62-91)-l, -5, and -6 cells...1994) was used as template, ( a ) Levels of p53, p21 and actin in p53-3 and p53(gln22-ser23/A62-91)-2 and -14 cells were assayed by Western blot...CGG TAC CCC TGT CAT CTT CTG TC; and reverse primer C393 as used for generating p53(A62-91). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A74

  3. The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line.

    PubMed

    Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen

    2018-06-01

    The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

  4. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

  5. [6]-Gingerol Induces Cell Cycle Arrest and Cell Death of Mutant p53-expressing Pancreatic Cancer Cells

    PubMed Central

    Park, Yon Jung; Wen, Jing; Bang, Seungmin; Park, Seung Woo

    2006-01-01

    [6]-Gingerol, a major phenolic compound derived from ginger, has anti-bacterial, anti-inflammatory and anti-tumor activities. While several molecular mechanisms have been described to underlie its effects on cells in vitro and in vivo, the underlying mechanisms by which [6]-gingerol exerts anti-tumorigenic effects are largely unknown. The purpose of this study was to investigate the action of [6]-gingerol on two human pancreatic cancer cell lines, HPAC expressing wild-type (wt) p53 and BxPC-3 expressing mutated p53. We found that [6]-gingerol inhibited the cell growth through cell cycle arrest at G1 phase in both cell lines. Western blot analyses indicated that [6]-gingerol decreased both Cyclin A and Cyclin-dependent kinase (Cdk) expression. These events led to reduction in Rb phosphorylation followed by blocking of S phase entry. p53 expression was decreased by [6]-gingerol treatment in both cell lines suggesting that the induction of Cyclin-dependent kinase inhibitor, p21cip1, was p53-independent. [6]-Gingerol induced mostly apoptotic death in the mutant p53-expressing cells, while no signs of early apoptosis were detected in wild type p53-expressing cells and this was related to the increased phosphorylation of AKT. These results suggest that [6]-gingerol can circumvent the resistance of mutant p53-expressing cells towards chemotherapy by inducing apoptotic cell death while it exerts cytostatic effect on wild type p53-expressing cells by inducing temporal growth arrest. PMID:17066513

  6. Impact of 7,12-dimethylbenz[a]anthracene exposure on connexin gap junction proteins in cultured rat ovaries

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ganesan, Shanthi, E-mail: shanthig@iastate.edu; Keating, Aileen F., E-mail: akeating@iastate.edu

    2014-01-15

    7,12-Dimethylbenz[a]anthracene (DMBA) destroys ovarian follicles in a concentration-dependent manner. The impact of DMBA on connexin (CX) proteins that mediate communication between follicular cell types along with pro-apoptotic factors p53 and Bax were investigated. Postnatal day (PND) 4 Fisher 344 rat ovaries were cultured for 4 days in vehicle medium (1% DMSO) followed by a single exposure to vehicle control (1% DMSO) or DMBA (12.5 nM or 75 nM) and cultured for 4 or 8 days. RT-PCR was performed to quantify Cx37, Cx43, p53 and Bax mRNA level. Western blotting and immunofluorescence staining were performed to determine CX37 or CX43 levelmore » and/or localization. Cx37 mRNA and protein increased (P < 0.05) at 4 days of 12.5 nM DMBA exposure. Relative to vehicle control-treated ovaries, mRNA encoding Cx43 decreased (P < 0.05) but CX43 protein increased (P < 0.05) at 4 days by both DMBA exposures. mRNA expression of pro-apoptotic p53 was decreased (P < 0.05) but no changes in Bax expression were observed after 4 days of DMBA exposures. In contrast, after 8 days, DMBA decreased Cx37 and Cx43 mRNA and protein but increased both p53 and Bax mRNA levels. CX43 protein was located between granulosa cells, while CX37 was located at the oocyte cell surface of all follicle stages. These findings support that DMBA exposure impacts ovarian Cx37 and Cx43 mRNA and protein prior to both observed changes in pro-apoptotic p53 and Bax and follicle loss. It is possible that such interference in follicular cell communication is detrimental to follicle viability, and may play a role in DMBA-induced follicular atresia. - Highlights: • DMBA increases Cx37 and Cx43 expression prior to follicle loss. • During follicle loss both Cx37 and Cx43 expressions are reduced. • CX43 protein is absent in follicle remnants lacking an oocyte.« less

  7. Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17

    PubMed Central

    Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.

    2012-01-01

    Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468

  8. p53 Is a Key Regulator for Osthole-Triggered Cancer Pathogenesis

    PubMed Central

    Huang, Ssu-Ming; Tsai, Cheng-Fang; Wang, Min-Ying

    2014-01-01

    Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development. PMID:25013761

  9. Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

    DOE PAGES

    Botcheva, Krassimira; McCorkle, Sean R.

    2014-11-21

    The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less

  10. p53 Enables metabolic fitness and self-renewal of nephron progenitor cells.

    PubMed

    Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida

    2015-04-01

    Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre(+);p53(fl/fl)) induces progressive depletion of Cited1(+)/Six2(+) self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre(+);p53(fl/fl) cap has 30% fewer Six2(GFP(+)) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre(+);p53(fl/fl) cells in the S and G2/M phases compared with Six2Cre(+);p53(+/+) cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP(+)) CM cells revealed that the top downregulated genes in Six2Cre(+);p53(fl/fl) CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼ 50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. © 2015. Published by The Company of Biologists Ltd.

  11. Expression of C-terminal deleted p53 isoforms in neuroblastoma

    PubMed Central

    Goldschneider, David; Horvilleur, Emilie; Plassa, Louis-François; Guillaud-Bataille, Marine; Million, Karine; Wittmer-Dupret, Evelyne; Danglot, Gisèle; de Thé, Hughes; Bénard, Jean; May, Evelyne; Douc-Rasy, Sétha

    2006-01-01

    The tumor suppressor gene, p53, is rarely mutated in neuroblastomas (NB) at the time of diagnosis, but its dysfunction could result from a nonfunctional conformation or cytoplasmic sequestration of the wild-type p53 protein. However, p53 mutation, when it occurs, is found in NB tumors with drug resistance acquired over the course of chemotherapy. As yet, no study has been devoted to the function of the specific p53 mutants identified in NB cells. This study includes characterization and functional analysis of p53 expressed in eight cell lines: three wild-type cell lines and five cell lines harboring mutations. We identified two transcription-inactive p53 variants truncated in the C-terminus, one of which corresponded to the p53β isoform recently identified in normal tissue by Bourdon et al. [J. C. Bourdon, K. Fernandes, F. Murray-Zmijewski, G. Liu, A. Diot, D. P. Xirodimas, M. K. Saville and D. P. Lane (2005) Genes Dev., 19, 2122–2137]. Our results show, for the first time, that the p53β isoform is the only p53 species to be endogenously expressed in the human NB cell line SK-N-AS, suggesting that the C-terminus truncated p53 isoforms may play an important role in NB tumor development. PMID:17028100

  12. Increased Arf/p53 activity in stem cells, aging and cancer.

    PubMed

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

    2017-04-01

    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  13. Transcriptional inhibition of p21{sup WAF1/CIP1} gene (CDKN1) expression by survivin is at least partially p53-dependent: Evidence for survivin acting as a transcription factor or co-factor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang, Lei; Pre-Doctoral Chinese Fellowship Student, Second West China Hospital, Sichuan University, Sichuan; Ling, Xiang

    2012-05-04

    Highlights: Black-Right-Pointing-Pointer Survivin inhibits the expression of p21 protein, mRNA and promoter activity. Black-Right-Pointing-Pointer Survivin neutralizes p53-induced p21 expression and promoter activity. Black-Right-Pointing-Pointer Survivin physically interacts with p53 in cancer cells. Black-Right-Pointing-Pointer Genetic silencing of endogenous survivin upregulates p21 in p53 wild type cancer cells. Black-Right-Pointing-Pointer Both p53 and survivin interacts on the two p53-binding sites in the p21 promoter. -- Abstract: Growing evidence suggests a role for the antiapoptotic protein survivin in promotion of cancer cell G1/S transition and proliferation. However, the underlying mechanism is unclear. Further, although upregulation of p21{sup WAF1/CIP1} by p53 plays an important role inmore » p53-mediated cell G1 arrests in response to various distresses, it is unknown whether survivin plays a role in the regulation of p21{sup WAF1/CIP1} expression. Here, we report that exogenous expression of survivin in p53-wild type MCF-7 breast cancer cells inhibits the expression of p21{sup WAF1/CIP1} protein, mRNA and promoter activity, while the survivin C84A mutant and antisense failed to do so. Cotransfection experiments in the p53 mutant H1650 lung cancer cell line showed that survivin neutralizes p53-induced p21{sup WAF1/CIP1} expression and promoter activity. Importantly, genetically silencing of endogenous survivin using lentiviral survivin shRNA also enhances endogenous p21 in p53 wild type cancer cells, suggesting the physiological relevance of the fining. We further demonstrated that both p53 and survivin interacts on the two p53-binding sites in the p21{sup WAF1/CIP1} promoter (-2313 to -2212; -1452 to -1310), and survivin physically interacts with p53 in cancer cells. Together, we propose that survivin may act as a transcription factor or cofactor to interact with p53 on the p21{sup WAF1/CIP1} promoter leading to the inhibition of p21{sup WAF1/CIP1} expression at least in part by neutralizing p53-mediated transcriptional activation of the p21 gene.« less

  14. 5-Methoxyflavanone induces cell cycle arrest at the G2/M phase, apoptosis and autophagy in HCT116 human colon cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shin, Soon Young; Department of Biomedical Science and Technology, Research Center for Transcription Control, Konkuk University, Seoul 143-701; Hyun, Jiye

    2011-08-01

    Natural flavonoids have diverse pharmacological activities, including anti-oxidative, anti-inflammatory, and anti-cancer activities. In this study, we investigated the molecular mechanism underlying the action of 5-methoxyflavanone (5-MF) which has a strong bioavailability and metabolic stability. Our results show that 5-MF inhibited the growth and clonogenicity of HCT116 human colon cancer cells, and that it activated DNA damage responses, as revealed by the accumulation of p53 and the phosphorylation of DNA damage-sensitive proteins, including ataxia-telangiectasia mutated (ATM) at Ser1981, checkpoint kinase 2 (Chk2) at Thr68, and histone H2AX at Ser139. 5-MF-induced DNA damage was confirmed in a comet tail assay. We alsomore » found that 5-MF increased the cleavage of caspase-2 and -7, leading to the induction of apoptosis. Pretreatment with the ATM inhibitor KU55933 enhanced 5-MF-induced {gamma}-H2AX formation and caspase-7 cleavage. HCT116 cells lacking p53 (p53{sup -/-}) or p21 (p21{sup -/-}) exhibited increased sensitivity to 5-MF compared to wild-type cells. 5-MF further induced autophagy via an ERK signaling pathway. Blockage of autophagy with the MEK inhibitor U0126 potentiated 5-MF-induced {gamma}-H2AX formation and caspase-2 activation. These results suggest that a caspase-2 cascade mediates 5-MF-induced anti-tumor activity, while an ATM/Chk2/p53/p21 checkpoint pathway and ERK-mediated autophagy act as a survival program to block caspase-2-mediated apoptosis induced by 5-MF. - Graphical abstract: Display Omitted Highlights: > 5-MF inhibits the proliferation of HCT116 colon cancer cells. > 5-MF inhibits cell cycle progression and induces apoptosis. > Inhibition of autophagy triggers 5-MF-induced apoptosis. > Inhibition of ERK signaling blocks 5-MF-induced autophagy but activates apoptosis. > Treatment with 5-MF in combination with an ERK inhibitor may be a potential therapeutic strategy in human colon cancer.« less

  15. Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy

    PubMed Central

    Tovar, Christian; Rosinski, James; Filipovic, Zoran; Higgins, Brian; Kolinsky, Kenneth; Hilton, Holly; Zhao, Xiaolan; Vu, Binh T.; Qing, Weiguo; Packman, Kathryn; Myklebost, Ola; Heimbrook, David C.; Vassilev, Lyubomir T.

    2006-01-01

    The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53–MDM2 interaction. PMID:16443686

  16. MicroRNA-145 is regulated by DNA methylation and p53 gene mutation in prostate cancer

    PubMed Central

    Suh, Seong O.; Chen, Yi; Zaman, Mohd Saif; Hirata, Hiroshi; Yamamura, Soichiro; Shahryari, Varahram; Liu, Jan; Tabatabai, Z.Laura; Kakar, Sanjay; Deng, Guoren; Tanaka, Yuichiro; Dahiya, Rajvir

    2011-01-01

    MiR-145 is downregulated in various cancers including prostate cancer. However, the underlying mechanisms of miR-145 downregulation are not fully understood. Here, we reported that miR-145 was silenced through DNA hypermethylation and p53 mutation status in laser capture microdissected (LCM) prostate cancer and matched adjacent normal tissues. In 22 of 27 (81%) prostate tissues, miR-145 was significantly downregulated in the cancer compared with the normal tissues. Further studies on miR-145 downregulation mechanism showed that miR-145 is methylated at the promoter region in both prostate cancer tissues and 50 different types of cancer cell lines. In seven cancer cell lines with miR-145 hypermethylation, 5-aza-2′-deoxycytidine treatment dramatically induced miR-145 expression. Interestingly, we also found a significant correlation between miR-145 expression and the status of p53 gene in both LCM prostate tissues and 47 cancer cell lines. In 29 cell lines with mutant p53, miR-145 levels were downregulated in 28 lines (97%), whereas in 18 cell lines with wild-type p53 (WT p53), miR-145 levels were downregulated in only 6 lines (33%, P < 0.001). Electrophoretic mobility shift assay showed that p53 binds to the p53 response element upstream of miR-145, but the binding was inhibited by hypermethylation. To further confirm that p53 binding to miR-145 could regulate miR-145 expression, we transfected WT p53 and MUT p53 into PC-3 cells and found that miR-145 is upregulated by WT p53 but not with MUTp53. The apoptotic cells are increased after WT p53 transfection. In summary, this is the first report documenting that downregulation of miR-145 is through DNA methylation and p53 mutation pathways in prostate cancer. PMID:21349819

  17. Essential role of caspase-8 in p53/p73-dependent apoptosis induced by etoposide in head and neck carcinoma cells

    PubMed Central

    2011-01-01

    Background Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. Results We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. Conclusions we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. Our data suggest the importance of caspase-8-mediated positive feedback amplification in the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. PMID:21801448

  18. Essential role of caspase-8 in p53/p73-dependent apoptosis induced by etoposide in head and neck carcinoma cells.

    PubMed

    Liu, Juan; Uematsu, Hiroshi; Tsuchida, Nobuo; Ikeda, Masa-Aki

    2011-07-31

    Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. Our data suggest the importance of caspase-8-mediated positive feedback amplification in the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Simoes, Maria L.; Hockley, Sarah L.; Schwerdtle, Tanja

    Aristolochic acid (AA) is the causative agent of urothelial tumours associated with aristolochic acid nephropathy. These tumours contain TP53 mutations and over-express TP53. We compared transcriptional and translational responses of two isogenic HCT116 cell lines, one expressing TP53 (p53-WT) and the other with this gene knocked out (p53-null), to treatment with aristolochic acid I (AAI) (50-100 {mu}M) for 6-48 h. Modulation of 118 genes was observed in p53-WT cells and 123 genes in p53-null cells. Some genes, including INSIG1, EGR1, CAV1, LCN2 and CCNG1, were differentially expressed in the two cell lines. CDKN1A was selectively up-regulated in p53-WT cells, leadingmore » to accumulation of TP53 and CDKN1A. Apoptotic signalling, measured by caspase-3 and -7 activity, was TP53-dependent. Both cell types accumulated in S phase, suggesting that AAI-DNA adducts interfere with DNA replication, independently of TP53 status. The oncogene MYC, frequently over-expressed in urothelial tumours, was up-regulated by AAI, whereas FOS was down-regulated. Observed modulation of genes involved in endocytosis, e.g. RAB5A, may be relevant to the known inhibition of receptor-mediated endocytosis, an early sign of AA-mediated proximal tubule injury. AAI-DNA adduct formation was significantly greater in p53-WT cells than in p53-null cells. Collectively, phenotypic anchoring of the AAI-induced expression profiles to DNA adduct formation, cell-cycle parameters, TP53 expression and apoptosis identified several genes linked to these biological outcomes, some of which are TP53-dependent. These results strengthen the importance of TP53 in AA-induced cancer, and indicate that other alterations, e.g. to MYC oncogenic pathways, may also contribute.« less

  20. Abrogation of Gli3 expression suppresses the growth of colon cancer cells via activation of p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kang, Han Na; Oh, Sang Cheul; Kim, Jun Suk

    2012-03-10

    p53, the major human tumor suppressor, appears to be related to sonic hedgehog (Shh)-Gli-mediated tumorigenesis. However, the role of p53 in tumor progression by the Shh-Gli signaling pathway is poorly understood. Herein we investigated the critical regulation of Gli3-p53 in tumorigenesis of colon cancer cells and the molecular mechanisms underlying these effects. RT-PCR analysis indicated that the mRNA level of Shh and Gli3 in colon tumor tissues was significantly higher than corresponding normal tissues (P < 0.001). The inhibition of Gli3 by treatment with Gli3 siRNA resulted in a clear decrease in cell proliferation and enhanced the level of expressionmore » of p53 proteins compared to treatment with control siRNA. The half-life of p53 was dramatically increased by treatment with Gli3 siRNA. In addition, treatment with MG132 blocked MDM2-mediated p53 ubiquitination and degradation, and led to accumulation of p53 in Gli3 siRNA-overexpressing cells. Importantly, ectopic expression of p53 siRNA reduced the ability of Gli3 siRNA to suppress proliferation of those cells compared with the cells treated with Gli3 siRNA alone. Moreover, Gli3 siRNA sensitized colon cancer cells to treatment with anti-cancer agents (5-FU and bevacizumab). Taken together, our studies demonstrate that loss of Gli3 signaling leads to disruption of the MDM2-p53 interaction and strongly potentiate p53-dependent cell growth inhibition in colon cancer cells, indicating a basis for the rational use of Gli3 antagonists as a novel treatment option for colon cancer.« less

  1. Drug resistance to inhibitors of the human double minute-2 E3 ligase is mediated by point mutations of p53, but can be overcome with the p53 targeting agent RITA.

    PubMed

    Jones, Richard J; Bjorklund, Chad C; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J; Orlowski, Robert Z

    2012-10-01

    The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover and has been validated preclinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, whereas Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA (reactivation of p53 and induction of tumor cell apoptosis). HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor nongenotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G(2)-M arrest, upregulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared with RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation.

  2. Detection of p53 mutations in proliferating vascular cells in glioblastoma multiforme.

    PubMed

    Kawasoe, Takuma; Takeshima, Hideo; Yamashita, Shinji; Mizuguchi, Sohei; Fukushima, Tsuyoshi; Yokogami, Kiyotaka; Yamasaki, Kouji

    2015-02-01

    Glioblastoma multiforme (GBM), one of the most aggressive tumors in humans, is highly angiogenic. However, treatment with the angiogenesis inhibitor bevacizumab has not significantly prolonged overall patient survival times. GBM resistance to angiogenesis inhibitors is attributed to multiple interacting mechanisms. Although mesenchymal transition via glioma stem-like cells has attracted attention, it is considered a poor biomarker. There is no simple method for differentiating tumor-derived and reactive vascular cells from normal cells. The authors attempted to detect the mesenchymal transition of tumor cells by means of p53 and isocitrate dehydrogenase 1 (IDH1) immunohistochemistry. Using antibody against p53 and IDH1 R132H, the authors immunohistochemically analyzed GBM tissue from patients who had undergone surgery at the University of Miyazaki Hospital during August 2005-December 2011. They focused on microvascular proliferation with a p53-positive ratio exceeding 50%. They compared TP53 mutations in original tumor tissues and in p53-positive and p53-negative microvascular proliferation cells collected by laser microdissection. Among 61 enrolled GBM patients, the first screening step (immunostaining) identified 46 GBMs as p53 positive, 3 of which manifested areas of prominent p53-positive microvascular proliferation (>50%). Histologically, areas of p53-positive microvascular proliferation tended to be clustered, and they coexisted with areas of p53-negative microvascular proliferation. Both types of microvascular proliferation cells were clearly separated from original tumor cells by glial fibrillary acidic protein, epidermal growth factor receptor, and low-/high-molecular-weight cytokeratin. DNA sequencing analysis disclosed that p53-positive microvascular proliferation cells exhibited TP53 mutations identical to those observed in the original tumor; p53-negative microvascular proliferation cells contained a normal allele. Although immunostaining indicated that 3 (2 primary and 1 secondary) of the 61 GBMs were positive for IDH1, no tumors contained microvascular proliferation cells positive for IDH1 R132H. Some microvascular proliferation clusters in GBM result from mesenchymal transition. The identification of useful markers might reveal this phenomenon as an infrequent event in GBMs.

  3. Rapamycin regulates the proliferation of Huh7, a hepatocellular carcinoma cell line, by up-regulating p53 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kwon, Sora; Jeon, Ji-Sook; Ahn, Curie

    Rapamycin, a specific inhibitor of mTOR used extensively as an immunosuppressant, has been expanded recently to cancer therapy, because the mTOR signal is known to be up-regulated in various cancer cells including hepatocellular carcinoma (HCC) cells. In spite of extensive efforts to employ mTOR inhibitors as anti-HCC therapy, they have not yet been approved by the FDA. Because of the heterogeneity and complexity of molecular signaling in HCC, suitable biomarkers should be identified or discovered to improve clinical efficacy of mTOR-specific inhibitors to HCC cells. In this study, the effect of rapamycin was investigated on two different HCC cell lines,more » Huh7 cells and HepG2 cells. Rapamycin was found to inhibit the proliferation of Huh7 cells but not of HepG2 cells. Moreover, it was found that rapamycin can up-regulate p53 at the protein level, but not affect its transcript. To understand the critical role of p53 in the rapamycin effect, knock-down experiments were performed using small-interfering RNAs (siRNAs). The anti-proliferative effect of rapamycin on Huh7 cells clearly disappeared after blocking p53 production with siRNA, which indicates that p53 is a critical factor in the anti-proliferative effect of rapamycin in HCC cells. The over-expression system of p53 was also employed to mimic the effect of rapamycin and found that cell proliferation was clearly down-regulated by p53 over-expression. Finally, we found that the extracellular signal-regulated kinase 1/2 (ERK1/2) signal was regulated by p53 whose expression was induced by rapamycin. Overall, this study demonstrates that rapamycin inhibited the proliferation of Huh7 cells by up-regulating the expression of p53 and down-regulating the ERK1/2 signal, indicating that p53 is a useful biomarker for anti-cancer therapy using the specific inhibitor of mTOR signal, rapamycin, against hepatocellular carcinoma cells. - Highlights: • Rapamycin inhibits the proliferation of hepatocellular carcinoma cells depending on the expression of p53. • Rapamycin up-regulates p53 at the protein level, but not affect its transcript. • The up-regulation of p53 expression by rapamycin inhibits ERK signal.« less

  4. 53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

    PubMed

    Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

    2016-07-02

    Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

  5. CDIP, a novel pro-apoptotic gene, regulates TNFα-mediated apoptosis in a p53-dependent manner

    PubMed Central

    Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

    2007-01-01

    We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-α expression tightly correlates with CDIP expression, and that inhibition of TNF-α signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-α is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-α impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 → CDIP → TNF-α apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy. PMID:17599062

  6. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    PubMed Central

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

  7. Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer.

    PubMed

    Shen, Youfeng; Xu, Kaixiang; Yuan, Zaimei; Guo, Jianxiong; Zhao, Heng; Zhang, Xuezeng; Zhao, Lu; Qing, Yubo; Li, Honghui; Pan, Weirong; Jia, Baoyu; Zhao, Hong-Ye; Wei, Hong-Jiang

    2017-11-03

    Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Transcription activator-like effector nucleases (TALENs) were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO) cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT) for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19) were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean section after 38 days of gestation for genotyping. Finally, six live piglets and one stillborn piglet were collected from two recipients by caesarean section. Sequencing analyses of the target site confirmed the P53 biallelic knockout in all fetuses and piglets, consistent with the genotype of the donor cells. The qPCR analysis showed that the expression of the P53 mRNA had significant reduction in various tissues of the knockout piglets. Furthermore, confocal microscopy and western blotting analyses demonstrated that the fibroblast cells of Diannan miniature piglets with a P53 biallelic knockout were defective in mediating DNA damage when incubated with doxorubicin. TALENs combined with SCNT was successfully used to generate P53 KO Diannan miniature pigs. Although these genetically engineered Diannan miniature pigs had no tumorigenic signs, the P53 gene was dysfunctional. We believe that these pigs will provide powerful new resources for preclinical oncology and basic cancer research.

  8. Delayed cell cycle progression in selenoprotein W depleted cells is regulated by a mitogen-activated protein kinase kinase 4–p38–p53 pathway

    USDA-ARS?s Scientific Manuscript database

    Selenoprotein W (SEPW1) is a ubiquitous, highly conserved thioredoxin-like protein whose depletion causes a p53- and p21Cip1-dependent G1-phase cell cycle arrest in breast and prostate epithelial cells. SEPW1 depletion increases phosphorylation of Ser33 in p53, which is associated with decreased p53...

  9. Reactivation of wild-type and mutant p53 by tryptophanolderived oxazoloisoindolinone SLMP53-1, a novel anticancer small-molecule

    PubMed Central

    Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília

    2016-01-01

    Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173

  10. Negative feedback regulation of wild-type p53 biosynthesis.

    PubMed Central

    Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W

    1995-01-01

    When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087

  11. p53-regulated autophagy is controlled by glycolysis and determines cell fate

    PubMed Central

    Duan, Lei; Perez, Ricardo E.; Davaadelger, Batzaya; Dedkova, Elena N.; Blatter, Lothar A.; Maki, Carl G.

    2015-01-01

    The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis. PMID:26337205

  12. Influence of p53 status on the effects of boron neutron capture therapy in glioblastoma.

    PubMed

    Seki, Keiko; Kinashi, Yuko; Takahashi, Sentaro

    2015-01-01

    The tumor suppressor gene p53 is mutated in glioblastoma. We studied the relationship between the p53 gene and the biological effects of boron neutron capture therapy (BNCT). The human glioblastoma cells; A172, expressing wild-type p53, and T98G, with mutant p53, were irradiated by the Kyoto University Research Reactor (KUR). The biological effects after neutron irradiation were evaluated by the cell killing effect, 53BP1 foci assay and apoptosis induction. The survival-fraction data revealed that A172 was more radiosensitive than T98G, but the difference was reduced when boronophenylalanine (BPA) was present. Both cell lines exhibited similar numbers of foci, suggesting that the initial levels of DNA damage did not depend on p53 function. Detection of apoptosis revealed a lower rate of apoptosis in the T98G. BNCT causes cell death in glioblastoma cells, regardless of p53 mutation status. In T98G cells, cell killing and apoptosis occurred effectively following BNCT. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  13. Expression of P53 protein after exposure to ionizing radiation

    NASA Astrophysics Data System (ADS)

    Salazar, A. M.; Salvador, C.; Ruiz-Trejo, C.; Ostrosky, P.; Brandan, M. E.

    2001-10-01

    One of the most important tumor suppressor genes is p53 gene, which is involved in apoptotic cell death, cell differentiation and cell cycle arrest. The expression of p53 gene can be evaluated by determining the presence of P53 protein in cells using Western Blot assay with a chemiluminescent method. This technique has shown variabilities that are due to biological factors. Film developing process can influence the quality of the p53 bands obtained. We irradiated tumor cell lines and human peripheral lymphocytes with 137Cs and 60Co gamma rays to standardize irradiation conditions, to compare ionizing radiation with actinomycin D and to reduce the observed variability of P53 protein induction levels. We found that increasing radiation doses increase P53 protein induction while it decreases viability. We also conclude that ionizing radiation could serve as a positive control for Western Blot analysis of protein P53. In addition, our results show that the developing process may play an important role in the quality of P53 protein bands and data interpretation.

  14. p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

    PubMed Central

    Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

    2011-01-01

    Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

  15. Stabilisation of p53 enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation.

    PubMed

    Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K

    2011-09-27

    Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.

  16. p53 activation by Ni(II) is a HIF-1α independent response causing caspases 9/3-mediated apoptosis in human lung cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, Victor C.; Morse, Jessica L.; Zhitkovich, Anatoly, E-mail: anatoly_zhitkovich@brown.edu

    2013-06-15

    Hypoxia mimic nickel(II) is a human respiratory carcinogen with a suspected epigenetic mode of action. We examined whether Ni(II) elicits a toxicologically significant activation of the tumor suppressor p53, which is typically associated with genotoxic responses. We found that treatments of H460 human lung epithelial cells with NiCl{sub 2} caused activating phosphorylation at p53-Ser15, accumulation of p53 protein and depletion of its inhibitor MDM4 (HDMX). Confirming the activation of p53, its knockdown suppressed the ability of Ni(II) to upregulate MDM2 and p21 (CDKN1A). Unlike DNA damage, induction of GADD45A by Ni(II) was p53-independent. Ni(II) also increased p53-Ser15 phosphorylation and p21more » expression in normal human lung fibroblasts. Although Ni(II)-induced stabilization of HIF-1α occurred earlier, it had no effect on p53 accumulation and Ser15 phosphorylation. Ni(II)-treated H460 cells showed no evidence of necrosis and their apoptosis and clonogenic death were suppressed by p53 knockdown. The apoptotic role of p53 involved a transcription-dependent program triggering the initiator caspase 9 and its downstream executioner caspase 3. Two most prominently upregulated proapoptotic genes by Ni(II) were PUMA and NOXA but only PUMA induction required p53. Knockdown of p53 also led to derepression of antiapoptotic MCL1 in Ni(II)-treated cells. Overall, our results indicate that p53 plays a major role in apoptotic death of human lung cells by Ni(II). Chronic exposure to Ni(II) may promote selection of resistant cells with inactivated p53, providing an explanation for the origin of p53 mutations by this epigenetic carcinogen. - Highlights: • Ni(II) is a strong activator of the transcription factor p53. • Apoptosis is a principal form of death by Ni(II) in human lung epithelial cells. • Ni(II)-activated p53 triggers caspases 9/3-mediated apoptotic program. • NOXA and PUMA are two main proapoptotic genes induced by Ni(II). • HIF-1α and p53 are independent stress responses to hypoxia-mimicking Ni(II)« less

  17. Transcriptional specificity in various p53-mutant cells.

    PubMed

    Okaichi, Kumio; Izumi, Nanaka; Takamura, Yuma; Fukui, Shoichi; Kudo, Takashi

    2013-03-01

    Mutation of the tumor suppressor gene p53 is the most common genetic alteration observed in human tumors. However, the relationship between the mutation point of p53 and the transcriptional specificity is not so obvious. We prepared Saos-2 cells with various mutations of p53 that are found in human tumors, and examined the resulting transcriptional alterations in the cells. Loss of function and gain of function were observed in all p53 mutants. Hot-spot mutations of p53 are frequently found in tumor cells. We compared hot-spot mutations and other mutations of p53 and found that a more than 2-fold transcription of CADPS2, PIWIL4 and TRIM9 was induced by hot spot mutations, but not by other mutations. As PIWIL4 suppresses the p16(INK4A) and ARF pathway, restraining cell growth and genomic instability, induction of PIWIL4 expression may be one reason why hot-spot mutations are frequently found in tumor cells.

  18. Antiproliferative and Apoptotic Effect of Dendrosomal Curcumin Nanoformulation in P53 Mutant and Wide-Type Cancer Cell Lines.

    PubMed

    Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid

    2017-01-01

    The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  19. Mule determines the apoptotic response to HDAC inhibitors by targeted ubiquitination and destruction of HDAC2

    PubMed Central

    Zhang, Jing; Kan, Shu; Huang, Brian; Hao, Zhenyue; Mak, Tak W.; Zhong, Qing

    2011-01-01

    Histone deacetylases (HDACs) are major epigenetic modulators involved in a broad spectrum of human diseases including cancers. Administration of HDAC inhibitors (HDACis) leads to growth inhibition, differentiation, and apoptosis of cancer cells. Understanding the regulatory mechanism of HDACs is imperative to harness the therapeutic potentials of HDACis. Here we show that HDACi- and DNA damage-induced apoptosis are severely compromised in mouse embryonic fibroblasts lacking a HECT domain ubiquitin ligase, Mule (Mcl-1 ubiquitin ligase E3). Mule specifically targets HDAC2 for ubiquitination and degradation. Accumulation of HDAC2 in Mule-deficient cells leads to compromised p53 acetylation as well as crippled p53 transcriptional activation, accumulation, and apoptotic response upon DNA damage and Nutlin-3 treatments. These defects in Mule-null cells can be partially reversed by HDACis and fully rescued by lowering the elevated HDAC2 in Mule-null cells to the normal levels as in wild-type cells. Taken together, our results reveal a critical regulatory mechanism of HDAC2 by Mule and suggest this pathway determines the cellular response to HDACis and DNA damage. PMID:22016339

  20. [Interaction between p53 and MDM2 in human lung cancer cells].

    PubMed

    Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J

    2014-01-01

    The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo  or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) -  mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and MDM2 positive. In 46 (34%) cases, elevation of p53 was combined with MDM2 negative expression. Other tumor samples were either negative for both proteins (71/ 52%), or p53 negative and MDM2 positive in 10 (7%) tumor samples. Absence of p53 staining in most studies indicates absence of p53 mutation, and on the contrary, positive expression of p53 is a sign of p53 mutations with loss of function. In our study, 34% of cases with extensively high level of p53 without increased level of MDM2 were identified. We suppose that these are tumors with inactivating mutations that stabilize p53. On the other hand, tumors with high level of stabilized wildtype p53 protein and simultaneously with increased MDM2 staining (9 samples/7%) represent group with functional p53. In this group of patients, we could expect better prognosis with regard to function of p53 protein.

  1. Accumulation of p53 is associated with tumour progression in cutaneous lesions of renal allograft recipients.

    PubMed Central

    Stark, L. A.; Arends, M. J.; McLaren, K. M.; Benton, E. C.; Shahidullah, H.; Hunter, J. A.; Bird, C. C.

    1994-01-01

    Renal allograft recipients suffer from a markedly increased susceptibility to premalignant and malignant cutaneous lesions. Although various aetiological factors have been implicated, little is known of the associated genetic events. In this study we initially employed immunocytochemical techniques to investigate the prevalence and localisation of accumulated p53 in over 200 cutaneous biopsies (including 56 squamous cell carcinomas) from renal allograft recipients and immunocompetent controls. In renal allograft recipients accumulated p53 was present in 24% of uninvolved skin samples, 14% of viral warts, 41% of premalignant keratoses, 65% of intraepidermal carcinomas and 56% of squamous cell carcinomas [squamous cell carcinoma and intraepidermal carcinoma differed significantly from uninvolved skin (P < 0.005) and viral warts (P < 0.01)]. A similar trend was revealed in immunocompetent patients (an older, chronically sun-exposed population) but with lower prevalence of p53 immunoreactivity: 25% of uninvolved skin samples, 0% of viral warts, 25% of keratoses, 53% of intraepidermal carcinomas and 53% of squamous cell carcinomas. These differences were not statistically significant. Morphologically, p53 immunoreactivity strongly associated with areas of epidermal dysplasia and the abundance of staining correlated positively with the severity of dysplasia. These data suggest that p53 plays a role in skin carcinogenesis and is associated with progression towards the invasive state. No correlation was observed between accumulated p53 and the presence of human papillomavirus (HPV) DNA in any of the lesions. Single-strand conformational polymorphism analysis (exons 5-8) was used to determine the frequency of mutated p53 in 28 malignancies with varying degrees of immunopositivity. p53 mutations were found in 5/9 (56%) malignancies with p53 staining in > 50% of cells, reducing to 1/6 (17%) where 10-50% of cells were positively stained and none where < 10% of cells were stained. These data imply that factors other than p53 gene mutation play a part in accumulation of p53 in skin cancers. Images Figure 2 Figure 3 PMID:7917913

  2. Apoptotic actions of p53 require transcriptional activation of PUMA and do not involve a direct mitochondrial/cytoplasmic site of action in postnatal cortical neurons.

    PubMed

    Uo, Takuma; Kinoshita, Yoshito; Morrison, Richard S

    2007-11-07

    Recent studies in non-neuronal cells have shown that the tumor suppressor p53 can promote cell death through a transcription-independent mechanism involving its direct action with a subset of Bcl-2 family member proteins in the cytosol and at the mitochondria. In cultured cortical neurons, however, we could not find evidence supporting a significant contribution of the cytosolic/mitochondrial p53 pathway, and available evidence instead corroborated the requirement for the transcriptional activity of p53. When directly targeted to the cytosol/mitochondria, wild-type p53 lost its apoptosis-inducing activity in neurons but not in non-neuronal cells. The N-terminal p53 fragment (transactivation and proline-rich domains), which induces apoptosis in non-neuronal cells via the cytosolic/mitochondrial pathway, displayed no apoptogenic activity in neurons. In neuronal apoptosis induced by camptothecin or an MDM2 (murine double minute 2) inhibitor, nutlin-3, endogenous p53 protein did not accumulate in the cytosol/mitochondria, and transcriptional inhibition after p53 induction effectively blocked cell death. In addition, overexpression of a dominant-negative form of p53 (R273H) completely suppressed induction of proapoptotic p53 target genes and cell death. PUMA (p53-upregulated modulator of apoptosis) was one such gene induced by camptothecin, and its overexpression was sufficient to induce Bax (Bcl-2-associated X protein)-dependent neuronal death, whereas Noxa was not apoptogenic. These results collectively demonstrate that, in contrast to non-neuronal cells, the apoptotic activity of p53 in postnatal cortical neurons does not rely on its direct action at the cytosol/mitochondria but is exclusively mediated through its transcription-dependent functions. The uniqueness of p53-mediated apoptotic signaling in postnatal cortical neurons was further illustrated by the dispensable function of the proline-rich domain of p53.

  3. The E3 ubiquitin ligase Mule acts through the ATM-p53 axis to maintain B lymphocyte homeostasis.

    PubMed

    Hao, Zhenyue; Duncan, Gordon S; Su, Yu-Wen; Li, Wanda Y; Silvester, Jennifer; Hong, Claire; You, Han; Brenner, Dirk; Gorrini, Chiara; Haight, Jillian; Wakeham, Andrew; You-Ten, Annick; McCracken, Susan; Elia, Andrew; Li, Qinxi; Detmar, Jacqui; Jurisicova, Andrea; Hobeika, Elias; Reth, Michael; Sheng, Yi; Lang, Philipp A; Ohashi, Pamela S; Zhong, Qing; Wang, Xiaodong; Mak, Tak W

    2012-01-16

    Cellular homeostasis is controlled by pathways that balance cell death with survival. Mcl-1 ubiquitin ligase E3 (Mule) is an E3 ubiquitin ligase that targets the proapoptotic molecule p53 for polyubiquitination and degradation. To elucidate the role of Mule in B lymphocyte homeostasis, B cell-specific Mule knockout (BMKO) mice were generated using the Cre-LoxP recombination system. Analysis of BMKO mice showed that Mule was essential for B cell development, proliferation, homeostasis, and humoral immune responses. p53 transactivation was increased by two- to fourfold in Mule-deficient B cells at steady state. Genetic ablation of p53 in BMKO mice restored B cell development, proliferation, and homeostasis. p53 protein was increased in resting Mule-deficient mouse embryonic fibroblasts (MEFs) and embryonic stem (ES) cells. Loss of Mule in both MEFs and B cells at steady state resulted in increased levels of phospho-ataxia telangiectasia mutated (ATM) and the ATM substrate p53. Under genotoxic stress, BMKO B cells were resistant to apoptosis, and control MEFs exhibited evidence of a physical interaction between Mule and phospho-ATM. Phospho-ATM, phospho-p53, and Brca1 levels were reduced in Mule-deficient B cells and MEFs subjected to genotoxic stress. Thus, Mule regulates the ATM-p53 axis to maintain B cell homeostasis under both steady-state and stress conditions.

  4. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    PubMed Central

    2010-01-01

    Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19Arf and nutlin-3. Conclusions To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53. PMID:20569441

  5. p53-Regulated Apoptosis Is Differentiation Dependent in Ultraviolet B-Irradiated Mouse Keratinocytes

    PubMed Central

    Tron, Victor A.; Trotter, Martin J.; Tang, Liren; Krajewska, Maryla; Reed, John C.; Ho, Vincent C.; Li, Gang

    1998-01-01

    Previous studies from our laboratory, using p53 transgenic mice, have suggested that ultraviolet (UV) light-induced keratinocyte apoptosis in the skin is not affected by overexpression of mutant p53 protein. To further elucidate a possible role for p53 in UV-induced keratinocyte cell death, we now examine apoptosis in skin and isolated keratinocytes from p53 null (−/−) mice and assess the influence of cell differentiation on this process. In vivo, using this knockout model, epidermal keratinocytes in p53−/− mice exhibited only a 5.2-fold increase in apoptosis after 2000 J/m2 UVB irradiation compared with a 26.3-fold increase in normal control animals. If this p53-dependent apoptosis is important in elimination of precancerous, UV-damaged keratinocytes, then it should be active in the undifferentiated cells of the epidermal basal layer. To test this hypothesis, we examined the effect of differentiation on UV-induced apoptosis in primary cultures of murine and human keratinocytes. Apoptosis was p53-independent in undifferentiated murine keratinocytes, which exhibited relative resistance to UVB-induced killing with only a 1.5-fold increase in apoptosis in p53+/+ cells and a 1.4-fold increase in p53−/− cells. Differentiated keratinocytes, in contrast, showed a 9.4-fold UVB induction of apoptosis in p53+/+ cells, almost three times the induction observed in p53−/− cells. This UV-induced difference in apoptosis was observed when keratinocytes were cultured on type IV collagen substrate, but not on plastic alone. Western blotting of UV-irradiated, differentiated keratinocytes did not support a role for either Bax or Bcl-2 in this process. In support of these findings in mice, cell death in human cultured keratinocytes also occurred in a differentiation-associated fashion. We conclude that p53-induced apoptosis eliminates damaged keratinocytes in the differentiated cell compartment, but this mechanism is not active in the basal, undifferentiated cells and is therefore of questionable significance in protection against skin cancer induction. PMID:9708817

  6. Two major pathways of penile carcinogenesis: HPV-induced penile cancers overexpress p16ink4a, HPV-negative cancers associated with dermatoses express p53, but lack p16ink4a overexpression.

    PubMed

    Mannweiler, Sebastian; Sygulla, Stephan; Winter, Elke; Regauer, Sigrid

    2013-07-01

    Penile squamous cell carcinomas (SCC) arise either through transforming infections with human papillomavirus (HPV) or independent of HPV, often in the background of lichen sclerosus (LS) and lichen planus (LP). Despite impact on therapy and prognosis, etiologic stratifications are missing in most histological diagnoses and publications about penile cancers/precursors. Classification of penile lesions into HPV-induced or HPV-negative via immunohistochemical demonstration of p16(ink4a) overexpression, a surrogate marker for transforming HPV-high-risk infections, and p53 expression in the absence of p16(ink4a) overexpression. Archival formalin-fixed material of 123 invasive penile cancers and 43 pre-invasive lesions was evaluated for the presence of LS, LP, 28 HPV genotypes, and expression of p53 and p16(ink4a). Seventy-two of 123 SCCs and 33 of 43 pre-invasive lesions showed p16(ink4a) overexpression independent of HPV-HR genotypes involved; 66 of 72 SCCs and 29 of 43 precursor lesions revealed a single HPV-high-risk-genotype (HPV-HR16 in 76% followed by HPV33, HPV31, HPV45, HPV18, HPV56); 5 of 72 SCCs and 4 of 43 precursor lesions revealed multiple HPV-HR-genotypes. One SCC revealed HPV-LR and HR-DNA. Fifty-one of 123 SCCs and 10 precursor lesions were p16(ink4a) negative, but showed nuclear p53 expression in tumor cells and basal keratinocytes. Forty-nine of 51 SCCs and 10 of 10 precursor lesions lacked HPV DNA. Two of 51 SCCs contained HPV18 and HPV45 DNA, respectively, but p16(ink4a) negativity classified them as non-HPV-induced. Twenty-seven of 51 SCCs showed peritumoral LS, 13 of 51 SCCs showed peritumoral LP, and 11 SCCs revealed no peritumoral tissue. Histologically, HPV-negative precursors showed hyperkeratotic, verrucous, atrophic, and basaloid differentiation. This was a retrospective study. p16(ink4a) overexpression identifies HPV-HR-induced penile carcinogenesis independent of HPV-HR genotype. p53 expression along with p16(ink4a) negativity identifies HPV-negative cancers. Correct etiologic classification of penile lesions during diagnostic work-up allows optimal therapy decisions. Copyright © 2013 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  7. TRIM25 enhances cell growth and cell survival by modulating p53 signals via interaction with G3BP2 in prostate cancer.

    PubMed

    Takayama, Ken-Ichi; Suzuki, Takashi; Tanaka, Tomoaki; Fujimura, Tetsuya; Takahashi, Satoru; Urano, Tomohiko; Ikeda, Kazuhiro; Inoue, Satoshi

    2018-04-01

    Prostate cancer growth is promoted by the gene regulatory action of androgen receptor (AR) and its downstream signals. The aberrant dysfunction of tumor suppressor p53 has an important role in the prognosis of cancer. We previously found that androgen treatments translocate p53 to the cytoplasm. The mechanism of this translocation depends on sumoylation of p53 by complex of SUMO E3 ligase RanBP2 with androgen-induced GTPase-activating protein-binding protein 2 (G3BP2). Here, we identified tripartite motif-containing protein 25 (TRIM25)/estrogen-responsive finger protein (Efp) as a novel interacting partner of G3BP2 protein complex. Then, we demonstrated that TRIM25 knockdown resulted in p53 downstream activation for cell cycle inhibition and apoptosis induction in LNCaP and 22Rv1 cells. In contrast, overexpression of TRIM25 promoted prostate cancer cell proliferation and inhibited apoptosis by docetaxel treatment in LNCaP cells. We observed that p53 activity was reduced by mechanism of G3BP2-mediated nuclear export in TRIM25-overexpressing prostate cancer cells. We also found TRIM25 is important for G3BP2/RanBP2-mediated p53 modification. Clinically, we newly demonstrated that TRIM25 is a prognostic factor for prostate cancer patients. Expression of TRIM25 is significantly associated with cytoplasmic p53 expression and G3BP2. Moreover, TRIM25 knockdown results in reduced tumor growth and increased p53 activity in the mouse xenograft model of prostate cancer. Thus, our findings show that overexpression of TRIM25 promoted prostate cancer cell proliferation and cell survival by modulating p53 nuclear export mechanism with G3BP2 interaction.

  8. Growth hormone is a cellular senescence target in pituitary and nonpituitary cells

    PubMed Central

    Chesnokova, Vera; Zhou, Cuiqi; Ben-Shlomo, Anat; Zonis, Svetlana; Tani, Yuji; Ren, Song-Guang; Melmed, Shlomo

    2013-01-01

    Premature proliferative arrest in benign or early-stage tumors induced by oncoproteins, chromosomal instability, or DNA damage is associated with p53/p21 activation, culminating in either senescence or apoptosis, depending on cell context. Growth hormone (GH) elicits direct peripheral metabolic actions as well as growth effects mediated by insulin-like growth factor 1 (IGF1). Locally produced peripheral tissue GH, in contrast to circulating pituitary-derived endocrine GH, has been proposed to be both proapoptotic and prooncogenic. Pituitary adenomas expressing and secreting GH are invariably benign and exhibit DNA damage and a senescent phenotype. We therefore tested effects of nutlin-induced p53-mediated senescence in rat and human pituitary cells. We show that DNA damage senescence induced by nutlin triggers the p53/p21 senescent pathway, with subsequent marked induction of intracellular pituitary GH in vitro. In contrast, GH is not induced in cells devoid of p53. Furthermore we show that p53 binds specific GH promoter motifs and enhances GH transcription and secretion in senescent pituitary adenoma cells and also in nonpituitary (human breast and colon) cells. In vivo, treatment with nutlin results in up-regulation of both p53 and GH in the pituitary gland, as well as increased GH expression in nonpituitary tissues (lung and liver). Intracrine GH acts in pituitary cells as an apoptosis switch for p53-mediated senescence, likely protecting the pituitary adenoma from progression to malignancy. Unlike in the pituitary, in nonpituitary cells GH exerts antiapoptotic properties. Thus, the results show that GH is a direct p53 transcriptional target and fulfills criteria as a p53 target gene. Induced GH is a readily measurable cell marker for p53-mediated cellular senescence. PMID:23940366

  9. Wt-p53 action in human leukaemia cell lines corresponding to different stages of differentiation.

    PubMed

    Rizzo, M G; Zepparoni, A; Cristofanelli, B; Scardigli, R; Crescenzi, M; Blandino, G; Giuliacci, S; Ferrari, S; Soddu, S; Sacchi, A

    1998-05-01

    Recent studies support the potential application of the wt-p53 gene in cancer therapy. Expression of exogenous wt-p53 suppresses a variety of leukaemia phenotypes by acting on cell survival, proliferation and/or differentiation. As for tumour gene therapy, the final fate of the neoplastic cells is one of the most relevant points. We examined the effects of exogenous wt-p53 gene expression in several leukaemia cell lines to identify p53-responsive leukaemia. The temperature-sensitive p53Val135 mutant or the human wt-p53 cDNA was transduced in leukaemia cell lines representative of different acute leukaemia FAB subtypes, including M1 (KG1), M2 (HL-60), M3 (NB4), M5 (U937) and M6 (HEL 92.1.7), as well as blast crisis of chronic myelogenous leukaemia (BC-CML: K562, BV173) showing diverse differentiation features. By morphological, molecular and biochemical analyses, we have shown that exogenous wt-p53 gene expression induces apoptosis only in cells corresponding to M1, M2 and M3 of the FAB classification and in BC-CML showing morphological and cytochemical features of undifferentiated blast cells. In contrast, it promotes differentiation in the others. Interestingly, cell responsiveness was independent of the vector used and the status of the endogenous p53 gene.

  10. Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

    PubMed

    Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

    2003-08-01

    Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its effective induction of apoptosis and tumor growth inhibition.

  11. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

    PubMed

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-12-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

  12. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

    PubMed Central

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-01-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

  13. Actin cytoskeleton organization, cell surface modification and invasion rate of 5 glioblastoma cell lines differing in PTEN and p53 status

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Djuzenova, Cholpon S., E-mail: djuzenova_t@ukw.de; Fiedler, Vanessa; Memmel, Simon

    Glioblastoma cells exhibit highly invasive behavior whose mechanisms are not yet fully understood. The present study explores the relationship between the invasion capacity of 5 glioblastoma cell lines differing in p53 and PTEN status, expression of mTOR and several other marker proteins involved in cell invasion, actin cytoskeleton organization and cell morphology. We found that two glioblastoma lines mutated in both p53 and PTEN genes (U373-MG and SNB19) exhibited the highest invasion rates through the Matrigel or collagen matrix. In DK-MG (p53wt/PTENwt) and GaMG (p53mut/PTENwt) cells, F-actin mainly occurred in the numerous stress fibers spanning the cytoplasm, whereas U87-MG (p53wt/PTENmut),more » U373-MG and SNB19 (both p53mut/PTENmut) cells preferentially expressed F-actin in filopodia and lamellipodia. Scanning electron microscopy confirmed the abundant filopodia and lamellipodia in the PTEN mutated cell lines. Interestingly, the gene profiling analysis revealed two clusters of cell lines, corresponding to the most (U373-MG and SNB19, i.e. p53 and PTEN mutated cells) and less invasive phenotypes. The results of this study might shed new light on the mechanisms of glioblastoma invasion. - Highlights: • We examine 5 glioblastoma lines on the invasion capacity and actin cytoskeleton. • Glioblastoma cell lines mutated in both p53 and PTEN were the most invasive. • Less invasive cells showed much less lamellipodia, but more actin stress fibers. • A mechanism for the differences in tumor cell invasion is proposed.« less

  14. p53 regulates mesenchymal stem cell-mediated tumor suppression in a tumor microenvironment through immune modulation.

    PubMed

    Huang, Y; Yu, P; Li, W; Ren, G; Roberts, A I; Cao, W; Zhang, X; Su, J; Chen, X; Chen, Q; Shou, P; Xu, C; Du, L; Lin, L; Xie, N; Zhang, L; Wang, Y; Shi, Y

    2014-07-17

    p53 is one of the most studied genes in cancer biology, and mutations in this gene may be predictive for the development of many types of cancer in humans and in animals. However, whether p53 mutations in non-tumor stromal cells can affect tumor development has received very little attention. In this study, we show that B16F0 melanoma cells form much larger tumors in p53-deficient mice than in wild-type mice, indicating a potential role of p53 deficiency in non-tumor cells of the microenvironment. As mesenchymal stem cells (MSCs) are attracted to tumors and form a major component of the tumor microenvironment, we examined the potential role of p53 status in MSCs in tumor development. We found that larger tumors resulted when B16F0 melanoma cells were co-injected with bone marrow MSCs derived from p53-deficient mice rather than MSCs from wild-type mice. Interestingly, this tumor-promoting effect by p53-deficient MSCs was not observed in non-obese diabetic/severe combined immunodeficiency mice, indicating the immune response has a critical role. Indeed, in the presence of inflammatory cytokines, p53-deficient MSCs expressed more inducible nitric oxide synthase (iNOS) and exhibited greater immunosuppressive capacity. Importantly, tumor promotion by p53-deficient MSCs was abolished by administration of S-methylisothiourea, an iNOS inhibitor. Therefore, our data demonstrate that p53 status in tumor stromal cells has a key role in tumor development by modulating immune responses.

  15. Rescue of p53 function by small-molecule RITA in cervical carcinoma by blocking E6-mediated degradation.

    PubMed

    Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina

    2010-04-15

    Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.

  16. p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

    PubMed

    Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

    2007-10-01

    Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

  17. Modulation of the response of prostate cancer cell lines to cisplatin treatment using small interfering RNA.

    PubMed

    Parra, Eduardo; Ferreira, Jorge

    2013-10-01

    Cisplatin is one of the most effective and widely used chemotherapeutic agents against several types of human cancers. However, the underlying mechanisms of action are not fully understood. We aimed to investigate the possible molecular mechanism(s) of acquired chemoresistance observed in prostate cancer cells treated with cisplatin. Human LNCaP cells (bearing wild-type p53) and PC-3 cells (lacking p53) were used. The expression levels of protein were determined by western blotting, and the mRNA levels were determined by reverse transcription-polymerase chain reaction (RT-PCR). Cell viability was measured by MTT assay, and the transcriptional effect of small interfering RNA (siRNA) was measured by luciferase reporter gene. We showed that cisplatin treatment increased JNK-1 and JNK-2 activity and expression in both LNCaP and PC-3 cells. In addition, the knockdown of JNK-1 expression by siRNA-JNK-1 or siRNA-JNK-2 significantly impaired the upregulation of AP-1 luciferase reporter gene, but failed to decrease the levels of AP-1 reporter gene expression induced by TPA treatment. Our observations indicate that JNK-1 and JNK-2 may be involved in the chemoresistance observed in prostate cancer cells treated with cisplatin and that blocking the stimulation of Jun kinase (JNK) signaling may be important for regulating the susceptibility to cisplatin of prostate cancer.

  18. Chloroquine activates the p53 pathway and induces apoptosis in human glioma cells

    PubMed Central

    Kim, Ella L.; Wüstenberg, Robin; Rübsam, Anne; Schmitz-Salue, Christoph; Warnecke, Gabriele; Bücker, Eva-Maria; Pettkus, Nadine; Speidel, Daniel; Rohde, Veit; Schulz-Schaeffer, Walter; Deppert, Wolfgang; Giese, Alf

    2010-01-01

    Glioblastoma is the most common malignant brain tumor in adults. The currently available treatments offer only a palliative survival advantage and the need for effective treatments remains an urgent priority. Activation of the p53 growth suppression/apoptotic pathway is one of the promising strategies in targeting glioma cells. We show that the quinoline derivative chloroquine activates the p53 pathway and suppresses growth of glioma cells in vitro and in vivo in an orthotopic (U87MG) human glioblastoma mouse model. Induction of apoptosis is one of the mechanisms underlying the effects of chloroquine on suppressing glioma cell growth and viability. siRNA-mediated downregulation of p53 in wild-type but not mutant p53 glioblastoma cells substantially impaired chloroquine-induced apoptosis. In addition to its p53-activating effects, chloroquine may also inhibit glioma cell growth via p53-independent mechanisms. Our results clarify the mechanistic basis underlying the antineoplastic effect of chloroquine and reveal its therapeutic potential as an adjunct to glioma chemotherapy. PMID:20308316

  19. Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

    PubMed

    Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

    2018-03-01

    Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

  20. p53 in survival, death and metabolic health: a lifeguard with a licence to kill.

    PubMed

    Kruiswijk, Flore; Labuschagne, Christiaan F; Vousden, Karen H

    2015-07-01

    The function of p53 as a tumour suppressor has been attributed to its ability to promote cell death or permanently inhibit cell proliferation. However, in recent years, it has become clear that p53 can also contribute to cell survival. p53 regulates various metabolic pathways, helping to balance glycolysis and oxidative phosphorylation, limiting the production of reactive oxygen species, and contributing to the ability of cells to adapt to and survive mild metabolic stresses. Although these activities may be integrated into the tumour suppressive functions of p53, deregulation of some elements of the p53-induced response might also provide tumours with a survival advantage.

  1. [Expression of Ki-67 and P53 protein in oral squamous cell carcinoma and its clinical significance].

    PubMed

    He, Wei; Xiao, Yan; Chen, Wei-min

    2015-04-01

    To investigate the clinical and pathological features and its relationship with the expression of Ki-67 and p53 protein in oral squamous cell carcinoma. Immunohistochemical SP staining method was used to quantify the protein expression levels of Ki-67 and p53 protein in 10 cases of normal oral mucosa, 16 cases of oral leukoplakia (OLK) tissue, and 48 cases of oral squamous cell carcinoma. The relationship of the expression of Ki-67 and p53 protein to clinical and pathological data was analyzed, and SPSS17.0 software package was used for statistical analysis. The positive expression rate of Ki-67 protein in normal oral mucosa, oral leukoplakia and oral squamous cell carcinoma was 30%, 56.3% and 79.2%, respectively; The positive expression rate of p53 was 0%, 43.8%, and 70.8%, respectively; Ki-67 and p53 expression had significant difference among normal oral mucosa, oral leukoplakia and oral squamous cell carcinoma (P<0.05); The expression of Ki-67 protein was significantly elevated with tumor stage, differentiation and cervical lymph node metastasis (P<0.05); The expression of p53 protein was significantly related to the degree of tumor differentiation (P<0.05); The expression of Ki-67 and p53 was positively correlated in oral squamous cell carcinoma (P<0.05). The high expression of Ki-67 and p53 protein in oral squamous cell carcinoma tissues may play an important role in the development of oral squamous cell carcinoma.

  2. Human T-cell leukemia virus type-1-encoded protein HBZ represses p53 function by inhibiting the acetyltransferase activity of p300/CBP and HBO1

    PubMed Central

    Hoang, Kimson; Ankney, John A.; Nguyen, Stephanie T.; Rushing, Amanda W.; Polakowski, Nicholas; Miotto, Benoit; Lemasson, Isabelle

    2016-01-01

    Adult T-cell leukemia (ATL) is an often fatal malignancy caused by infection with the complex retrovirus, human T-cell Leukemia Virus, type 1 (HTLV-1). In ATL patient samples, the tumor suppressor, p53, is infrequently mutated; however, it has been shown to be inactivated by the viral protein, Tax. Here, we show that another HTLV-1 protein, HBZ, represses p53 activity. In HCT116 p53+/+ cells treated with the DNA-damaging agent, etoposide, HBZ reduced p53-mediated activation of p21/CDKN1A and GADD45A expression, which was associated with a delay in G2 phase-arrest. These effects were attributed to direct inhibition of the histone acetyltransferase (HAT) activity of p300/CBP by HBZ, causing a reduction in p53 acetylation, which has be linked to decreased p53 activity. In addition, HBZ bound to, and inhibited the HAT activity of HBO1. Although HBO1 did not acetylate p53, it acted as a coactivator for p53 at the p21/CDKN1A promoter. Therefore, through interactions with two separate HAT proteins, HBZ impairs the ability of p53 to activate transcription. This mechanism may explain how p53 activity is restricted in ATL cells that do not express Tax due to modifications of the HTLV-1 provirus, which accounts for a majority of patient samples. PMID:26625199

  3. A planarian p53 homolog regulates proliferation and self-renewal in adult stem cell lineages.

    PubMed

    Pearson, Bret J; Sánchez Alvarado, Alejandro

    2010-01-01

    The functions of adult stem cells and tumor suppressor genes are known to intersect. However, when and how tumor suppressors function in the lineages produced by adult stem cells is unknown. With a large population of stem cells that can be manipulated and studied in vivo, the freshwater planarian is an ideal system with which to investigate these questions. Here, we focus on the tumor suppressor p53, homologs of which have no known role in stem cell biology in any invertebrate examined thus far. Planaria have a single p53 family member, Smed-p53, which is predominantly expressed in newly made stem cell progeny. When Smed-p53 is targeted by RNAi, the stem cell population increases at the expense of progeny, resulting in hyper-proliferation. However, ultimately the stem cell population fails to self-renew. Our results suggest that prior to the vertebrates, an ancestral p53-like molecule already had functions in stem cell proliferation control and self-renewal.

  4. Inhibition of Mdm2 Sensitizes Human Retinal Pigment Epithelial Cells to Apoptosis

    PubMed Central

    Ray, Ramesh M.; Chaum, Edward; Johnson, Dianna A.; Johnson, Leonard R.

    2011-01-01

    Purpose. Because recent studies indicate that blocking the interaction between p53 and Mdm2 results in the nongenotoxic activation of p53, the authors sought to investigate whether the inhibition of p53-Mdm2 binding activates p53 and sensitizes human retinal epithelial cells to apoptosis. Methods. Apoptosis was evaluated by the activation of caspases and DNA fragmentation assays. The Mdm2 antagonist Nutlin-3 was used to dissociate p53 from Mdm2 and, thus, to increase p53 activity. Knockdown of p53 expression was accomplished by using p53 siRNA. Results. ARPE-19 and primary RPE cells expressed high levels of the antiapoptotic proteins Bcl-2 and Bcl-xL. Exposure of these cells to camptothecin (CPT) or TNF-α/ cycloheximide (CHX) failed to induce apoptosis. In contrast, treatment with the Mdm2 antagonist Nutlin-3 in the absence of CPT or TNF-α/CHX increased apoptosis. Activation of p53 in response to Nutlin-3 also increased levels of Noxa, p53-upregulated modulator of apoptosis (PUMA), and Siva-1, decreased expression of Bcl-2 and Bcl-xL, and simultaneously increased caspases-9 and -3 activities and DNA fragmentation. Knockdown of p53 decreased the basal expression of p21Cip1 and Bcl-2, inhibited the Nutlin-3–induced upregulation of Siva-1 and PUMA expression, and consequently inhibited caspase-3 activation. Conclusions. These results indicate that the normally available pool of intracellular p53 is predominantly engaged in the regulation of cell cycle checkpoints by p21Cip1 and does not trigger apoptosis in response to DNA-damaging agents. However, the blockage of p53 binding to Mdm2 frees a pool of p53 that is sufficient, even in the absence of DNA-damaging agents, to increase the expression of proapoptotic targets and to override the resistance of RPE cells to apoptosis. PMID:21345989

  5. Differential S-phase progression after irradiation of p53 functional versus non-functional tumour cells

    PubMed Central

    Zölzer, Friedo; Mußfeldt, Tamare; Streffer, Christian

    2014-01-01

    Background Many pathways seem to be involved in the regulation of the intra-S-phase checkpoint after exposure to ionizing radiation, but the role of p53 has proven to be rather elusive. Here we have a closer look at the progression of irradiated cells through S-phase in dependence of their p53 status. Materials and methods. Three pairs of tumour cell lines were used, each consisting of one p53 functional and one p53 non-functional line. Cells were labelled with bromodeoxyuridine(BrdU) immediately after irradiation, they were then incubated in label-free medium, and at different times afterwards their position within the S-phase was determined by means of flow cytometry. Results While in the p53 deficient cells progression through S-phase was slowed significantly over at least a few hours, it was halted for just about an hour in the p53 proficient cells and then proceeded without further delay or even at a slightly accelerated pace. Conclusions It is clear from the experiments presented here that p53 does play a role for the progress of cells through the S-phase after X-ray exposure, but the exact mechanisms by which replicon initiation and elongation is controlled in irradiated cells remain to be elucidated. PMID:25435848

  6. UBR2 Enriched in p53 Deficient Mouse Bone Marrow Mesenchymal Stem Cell-Exosome Promoted Gastric Cancer Progression via Wnt/β-Catenin Pathway.

    PubMed

    Mao, Jiahui; Liang, Zhaofeng; Zhang, Bin; Yang, Huan; Li, Xia; Fu, Hailong; Zhang, Xu; Yan, Yongmin; Xu, Wenrong; Qian, Hui

    2017-11-01

    The deficiency or mutation of p53 has been linked to several types of cancers. The mesenchymal stem cell (MSC) is an important component in the tumor microenvironment, and exosomes secreted by MSCs can transfer bioactive molecules, including proteins and nucleic acid, to other cells in the tumor microenvironment to influence the progress of a tumor. However, whether the state of p53 in MSCs can impact the bioactive molecule secretion of exosomes to promote cancer progression and the regulatory mechanism remains elusive. Our study aimed to investigate the regulation of ubiquitin protein ligase E3 component n-recognin 2 (UBR2) enriched in exosomes secreted by p53 deficient mouse bone marrow MSC (p53 -/- mBMMSC) in gastric cancer progression in vivo and in vitro. We found that the concentration of exosome was significantly higher in p53 -/- mBMMSC than that in p53 wild-type mBMMSC (p53 +/+ mBMMSC). In particular, UBR2 was highly expressed in p53 -/- mBMMSC cells and exosomes. P53 -/- mBMMSC exosomes enriched UBR2 could be internalized into p53 +/+ mBMMSC and murine foregastric carcinoma (MFC) cells and induce the overexpression of UBR2 in these cells which elevated cell proliferation, migration, and the expression of stemness-related genes. Mechanistically, the downregulation of UBR2 in p53 -/- mBMMSC exosomes could reverse these actions. Moreover, a majority of Wnt family members, β-catenin, and its downstream genes (CD44, CyclinD1, CyclinD3, and C-myc) were significantly decreased in MFC knockdown UBR2 and β-catenin depletion, an additional depletion of UBR2 had no significant difference in the expression of Nanog, OCT4, Vimentin, and E-cadherin. Taken together, our findings indicated that p53 -/- mBMMSC exosomes could deliver UBR2 to target cells and promote gastric cancer growth and metastasis by regulating Wnt/β-catenin pathway. Stem Cells 2017;35:2267-2279. © 2017 AlphaMed Press.

  7. p53 functions as a cell cycle control protein in osteosarcomas.

    PubMed

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-11-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  8. Photodynamic injury of isolated crayfish neuron and surrounding glial cells: the role of p53

    NASA Astrophysics Data System (ADS)

    Sharifulina, S. A.; Uzdensky, A. B.

    2015-03-01

    The pro-apoptotic transcription factor p53 is involved in cell responses to injurious impacts. Using its inhibitor pifithrin- α and activators tenovin-1, RITA and WR-1065, we studied its potential participation in inactivation and death of isolated crayfish mechanoreceptor neuron and satellite glial cells induced by photodynamic treatment, a strong inducer of oxidative stress. In dark, p53 activation by tenovin-1 or WR-1065 shortened activity of isolated neurons. Tenovin-1 and WR-1065 induced apoptosis of glial cells, whereas pifithrin-α was anti-apoptotic. Therefore, p53 mediated glial apoptosis and suppression of neuronal activity after axotomy. Tenovin-1 but not other p53 modulators induced necrosis of axotomized neurons and surrounding glia, possibly, through p53-independent pathway. Under photodynamic treatment, p53 activators tenovin-1 and RITA enhanced glial apoptosis indicating the pro-apoptotic activity of p53. Photoinduced necrosis of neurons and glia was suppressed by tenovin-1 and, paradoxically, by pifithrin-α. Modulation of photoinduced changes in the neuronal activity and necrosis of neurons and glia was possibly p53-independent. The different effects of p53 modulators on neuronal and glial responses to axotomy and photodynamic impact were apparently associated with different signaling pathways in neurons and glial cells.

  9. Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX

    PubMed Central

    Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

    2011-01-01

    Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 – HdmX and Wip1, leading to efficient elimination of tumour cells. PMID:21546907

  10. Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX.

    PubMed

    Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

    2011-11-01

    Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 - HdmX and Wip1, leading to efficient elimination of tumour cells.

  11. p53 and TAp63 Promote Keratinocyte Proliferation and Differentiation in Breeding Tubercles of the Zebrafish

    PubMed Central

    Fischer, Boris; Metzger, Manuel; Richardson, Rebecca; Knyphausen, Philipp; Ramezani, Thomas; Franzen, Rainer; Schmelzer, Elmon; Bloch, Wilhelm; Carney, Thomas J.; Hammerschmidt, Matthias

    2014-01-01

    p63 is a multi-isoform member of the p53 family of transcription factors. There is compelling genetic evidence that ΔNp63 isoforms are needed for keratinocyte proliferation and stemness in the developing vertebrate epidermis. However, the role of TAp63 isoforms is not fully understood, and TAp63 knockout mice display normal epidermal development. Here, we show that zebrafish mutants specifically lacking TAp63 isoforms, or p53, display compromised development of breeding tubercles, epidermal appendages which according to our analyses display more advanced stratification and keratinization than regular epidermis, including continuous desquamation and renewal of superficial cells by derivatives of basal keratinocytes. Defects are further enhanced in TAp63/p53 double mutants, pointing to partially redundant roles of the two related factors. Molecular analyses, treatments with chemical inhibitors and epistasis studies further reveal the existence of a linear TAp63/p53->Notch->caspase 3 pathway required both for enhanced proliferation of keratinocytes at the base of the tubercles and their subsequent differentiation in upper layers. Together, these studies identify the zebrafish breeding tubercles as specific epidermal structures sharing crucial features with the cornified mammalian epidermis. In addition, they unravel essential roles of TAp63 and p53 to promote both keratinocyte proliferation and their terminal differentiation by promoting Notch signalling and caspase 3 activity, ensuring formation and proper homeostasis of this self-renewing stratified epithelium. PMID:24415949

  12. mTOR inhibitors blunt the p53 response to nucleolar stress by regulating RPL11 and MDM2 levels

    PubMed Central

    Goudarzi, Kaveh M; Nistér, Monica; Lindström, Mikael S

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a master regulator of cell growth through its ability to stimulate ribosome biogenesis and mRNA translation. In contrast, the p53 tumor suppressor negatively controls cell growth and is activated by a wide range of insults to the cell. The mTOR and p53 signaling pathways are connected by a number of different mechanisms. Chemotherapeutics that inhibit ribosome biogenesis often induce nucleolar stress and activation of p53. Here we have investigated how the p53 response to nucleolar stress is affected by simultaneous mTOR inhibition in osteosarcoma and glioma cell lines. We found that inhibitors of the mTOR pathway including rapamycin, wortmannin, and caffeine blunted the p53 response to nucleolar stress induced by actinomycin D. Synthetic inhibitors of mTOR (temsirolimus, LY294.002 and PP242) also impaired actinomycin D triggered p53 stabilization and induction of p21. Ribosomal protein (RPL11) is known to be required for p53 protein stabilization following nucleolar stress. Treatment of cells with mTOR inhibitors may lead to reduced synthesis of RPL11 and thereby destabilize p53. We found that rapamycin mimicked the effect of RPL11 depletion in terms of blunting the p53 response to nucleolar stress. However, the extent to which the levels of p53 and RPL11 were reduced by rapamycin varied between cell lines. Additional mechanisms whereby rapamycin blunts the p53 response to nucleolar stress are likely to be involved. Indeed, rapamycin increased the levels of endogenous MDM2 despite inhibition of its phosphorylation at Ser-166. Our findings may have implications for the design of combinatorial cancer treatments with mTOR pathway inhibitors. PMID:25482947

  13. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

    PubMed Central

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-01-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474

  14. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    PubMed

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  15. Fusaric Acid Induces DNA Damage and Post-Translational Modifications of p53 in Human Hepatocellular Carcinoma (HepG2 ) Cells.

    PubMed

    Ghazi, Terisha; Nagiah, Savania; Tiloke, Charlette; Sheik Abdul, Naeem; Chuturgoon, Anil A

    2017-11-01

    Fusaric acid (FA), a common fungal contaminant of maize, is known to mediate toxicity in plants and animals; however, its mechanism of action is unclear. p53 is a tumor suppressor protein that is activated in response to cellular stress. The function of p53 is regulated by post-translational modifications-ubiquitination, phosphorylation, and acetylation. This study investigated a possible mechanism of FA induced toxicity in the human hepatocellular carcinoma (HepG 2 ) cell line. The effect of FA on DNA integrity and post-translational modifications of p53 were investigated. Methods included: (a) culture and treatment of HepG 2 cells with FA (IC 50 : 580.32 μM, 24 h); (b) comet assay (DNA damage); (c) Western blots (protein expression of p53, MDM2, p-Ser-15-p53, a-K382-p53, a-CBP (K1535)/p300 (K1499), HDAC1 and p-Ser-47-Sirt1); and (d) Hoechst 33342 assay (apoptosis analysis). FA caused DNA damage in HepG 2 cells relative to the control (P < 0.0001). FA decreased the protein expression of p53 (0.24-fold, P = 0.0004) and increased the expression of p-Ser-15-p53 (12.74-fold, P = 0.0126) and a-K382-p53 (2.24-fold, P = 0.0096). This occurred despite the significant decrease in the histone acetyltransferase, a-CBP (K1535)/p300 (K1499) (0.42-fold, P = 0.0023) and increase in the histone deacetylase, p-Ser-47-Sirt1 (1.22-fold, P = 0.0020). The expression of MDM2, a negative regulator of p53, was elevated in the FA treatment compared to the control (1.83-fold, P < 0.0001). FA also inhibited cell proliferation and induced apoptosis in HepG 2 cells as evidenced by the Hoechst assay. Together, these results indicate that FA is genotoxic and post-translationally modified p53 leading to HepG 2 cell death. J. Cell. Biochem. 118: 3866-3874, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  16. Down-regulation of MutS homolog 3 by hypoxia in human colorectal cancer

    PubMed Central

    Li, Jie; Koike, Junichi; Kugoh, Hiroyuki; Arita, Michitsune; Ohhira, Takahito; Kikuchi, Yoshinori; Funahashi, Kimihiko; Takamatsu, Ken; Boland, C. Richard; Koi, Minoru; Hemmi, Hiromichi

    2013-01-01

    Down-regulation of hMSH3 is associated with elevated microsatellite alterations at selected tetranucleotide repeats and low levels of microsatellite instability in colorectal cancer (CRC). However, the mechanism that down-regulates hMSH3 in CRC is not known. In this study, a significant association between over-expression of glucose transporter 1, a marker for hypoxia, and down-regulation of hMSH3 in CRC tissues was observed. Therefore, we examined the effect of hypoxia on the expression of hMSH3 in human cell lines. When cells with wild type p53 (wt-p53) were exposed to hypoxia, rapid down-regulation of both hMSH2 and hMSH3 occurred. In contrast, when null or mutated p53 (null/mut-p53) cells were exposed to hypoxia, only hMSH3 was down-regulated, and at slower rate than wt-p53 cells. Using a reporter assay, we found that disruption of the two putative hypoxia response elements (HREs) located within the promoter region of the hMSH3 abrogated the suppressive effect of hypoxia on reporter activity regardless of p53 status. In an EMSA, two different forms of HIF-1α complexes that specifically bind to these HREs were detected. A larger complex containing HIF-1α predominantly bound to the HREs in hypoxic null/mut-p53 cells whereas a smaller complex predominated in wt-p53 cells. Finally, HIF-1α knockdown by siRNA significantly inhibited down-regulation of hMSH3 by hypoxia in both wt-p53 and mut-p53 cells. Taken together, our results suggest that the binding of HIF-1α complexes to HRE sites is necessary for down-regulation of hMSH3 in both wt-p53 and mut-p53 cells. PMID:22343000

  17. Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F₀-ATP synthase

    PubMed Central

    Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

    2013-01-01

    We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169

  18. Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F0-ATP synthase.

    PubMed

    Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

    2013-09-01

    We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.

  19. ROS-dependent activation of JNK converts p53 into an efficient inhibitor of oncogenes leading to robust apoptosis

    PubMed Central

    Shi, Y; Nikulenkov, F; Zawacka-Pankau, J; Li, H; Gabdoulline, R; Xu, J; Eriksson, S; Hedström, E; Issaeva, N; Kel, A; Arnér, E S J; Selivanova, G

    2014-01-01

    Rescue of the p53 tumor suppressor is an attractive cancer therapy approach. However, pharmacologically activated p53 can induce diverse responses ranging from cell death to growth arrest and DNA repair, which limits the efficient application of p53-reactivating drugs in clinic. Elucidation of the molecular mechanisms defining the biological outcome upon p53 activation remains a grand challenge in the p53 field. Here, we report that concurrent pharmacological activation of p53 and inhibition of thioredoxin reductase followed by generation of reactive oxygen species (ROS), result in the synthetic lethality in cancer cells. ROS promote the activation of c-Jun N-terminal kinase (JNK) and DNA damage response, which establishes a positive feedback loop with p53. This converts the p53-induced growth arrest/senescence to apoptosis. We identified several survival oncogenes inhibited by p53 in JNK-dependent manner, including Mcl1, PI3K, eIF4E, as well as p53 inhibitors Wip1 and MdmX. Further, we show that Wip1 is one of the crucial executors downstream of JNK whose ablation confers the enhanced and sustained p53 transcriptional response contributing to cell death. Our study provides novel insights for manipulating p53 response in a controlled way. Further, our results may enable new pharmacological strategy to exploit abnormally high ROS level, often linked with higher aggressiveness in cancer, to selectively kill cancer cells upon pharmacological reactivation of p53. PMID:24413150

  20. The p53 inhibitor, pifithrin-{alpha}, suppresses self-renewal of embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abdelalim, Essam Mohamed, E-mail: essam_abdelalim@yahoo.com; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522; Tooyama, Ikuo

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer We determine the role of p53 in ES cells under unstressful conditions. Black-Right-Pointing-Pointer PFT-{alpha} suppresses ES cell proliferation. Black-Right-Pointing-Pointer PFT-{alpha} induces ES cell cycle arrest. Black-Right-Pointing-Pointer PFT-{alpha} downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-{alpha}, an inhibitor ofmore » p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-{alpha} resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-{alpha} caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.« less

  1. Reactivating p53 and Inducing Tumor Apoptosis (RITA) Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin.

    PubMed

    Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph

    2017-04-01

    Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 <3.0 μmol/l) were identified within established (4/9) and primary patient-derived (2/5) CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC cells within both panels of established CRC cell lines and primary patient-derived CRC cell lines (6/14) that provide a rationale for combining RITA with 5FU or oxaliplatin to enhance the antiproliferative response to both chemotherapeutic agents. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Addition of interferon-α to the p53-SLP® vaccine results in increased production of interferon-γ in vaccinated colorectal cancer patients: a phase I/II clinical trial.

    PubMed

    Zeestraten, Eliane C M; Speetjens, Frank M; Welters, Marij J P; Saadatmand, Sepideh; Stynenbosch, Linda F M; Jongen, Rogier; Kapiteijn, Ellen; Gelderblom, Hans; Nijman, Hans W; Valentijn, A Rob P M; Oostendorp, Jaap; Fathers, Lorraine M; Drijfhout, Jan W; van de Velde, Cornelis J H; Kuppen, Peter J K; van der Burg, Sjoerd H; Melief, Cornelis J M

    2013-04-01

    We previously established safety and immunogenicity of a p53 synthetic long peptides (p53-SLP®) vaccine. In the current trial, we investigated whether combination of interferon-alpha (IFN-α) with p53-SLP® is both safe and able to improve the induced p53-specific IFN-γ response. Eleven colorectal cancer patients successfully treated for metastatic disease were enrolled in this study. Of these, nine patients completed follow-up after two injections with p53-SLP® together with IFN-α. Safety and p53-specific immune responses were determined before and after vaccination. Furthermore, cryopreserved PBMCs were compared head-to-head to cryopreserved PBMCs obtained in our previous trial with p53-SLP® only. Toxicity of p53-SLP® vaccination in combination with IFN-α was limited to Grade 1 or 2, with predominantly small ongoing swellings at the vaccination site. All patients harbored p53-specific T cells after vaccination and most patients showed p53-specific antibodies. Compared to the previous trial, addition of IFN-α significantly improved the frequency of p53-specific T cells in IFN-γ ELISPOT. Moreover, in this trial, p53-specific T cells were detectable in blood samples of all patients in a direct ex vivo multiparameter flowcytometric assay, opposed to only 2 of 10 patients vaccinated with p53-SLP® only. Finally, patients in this trial displayed a broader p53-specific immunoglobulin-G response, indicating an overall better p53-specific T-helper response. Our study shows that p53-SLP® vaccination combined with IFN-α injection is safe and capable of inducing p53-specific immunity. When compared to a similar trial with p53-SLP® vaccination alone the combination was found to induce significantly more IFN-γ producing p53-specific T cells. Copyright © 2012 UICC.

  3. Simultaneous activation of p53 and inhibition of XIAP enhance the activation of apoptosis signaling pathways in AML

    PubMed Central

    Carter, Bing Z.; Mak, Duncan H.; Schober, Wendy D.; Koller, Erich; Pinilla, Clemencia; Vassilev, Lyubomir T.; Reed, John C.

    2010-01-01

    Activation of p53 by murine double minute (MDM2) antagonist nutlin-3a or inhibition of X-linked inhibitor of apoptosis (XIAP) induces apoptosis in acute myeloid leukemia (AML) cells. We demonstrate that concomitant inhibition of MDM2 by nutlin-3a and of XIAP by small molecule antagonists synergistically induced apoptosis in p53 wild-type OCI-AML3 and Molm13 cells. Knockdown of p53 by shRNA blunted the synergy, and down-regulation of XIAP by antisense oligonucleotide (ASO) enhanced nutlin-3a–induced apoptosis, suggesting that the synergy was mediated by p53 activation and XIAP inhibition. This is supported by data showing that inhibition of both MDM2 and XIAP by their respective ASOs induced significantly more cell death than either ASO alone. Importantly, p53 activation and XIAP inhibition enhanced apoptosis in blasts from patients with primary AML, even when the cells were protected by stromal cells. Mechanistic studies demonstrated that XIAP inhibition potentiates p53-induced apoptosis by decreasing p53-induced p21 and that p53 activation enhances XIAP inhibition-induced cell death by promoting mitochondrial release of second mitochondria-derived activator of caspases (SMAC) and by inducing the expression of caspase-6. Because both XIAP and p53 are presently being targeted in ongoing clinical trials in leukemia, the combination strategy holds promise for expedited translation into the clinic. PMID:19897582

  4. Drug Resistance to Inhibitors of the Human Double Minute-2 E3 Ligase is Mediated by Point Mutations of p53, but can be Overcome with the p53 Targeting Agent RITA

    PubMed Central

    Jones, Richard J.; Bjorklund, Chad C.; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J.; Orlowski, Robert Z.

    2012-01-01

    The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover, and has been validated pre-clinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, while Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA. HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor non-genotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G2/M arrest, up-regulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared to RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation. PMID:22933706

  5. Wasabi 6-(methylsulfinyl)hexyl isothiocyanate induces apoptosis in human colorectal cancer cells through p53-independent mitochondrial dysfunction pathway.

    PubMed

    Yano, Satoshi; Wu, Shusong; Sakao, Kozue; Hou, De-Xing

    2018-05-14

    6-(Methylsulfinyl)hexyl isothiocyanate (6-MSITC), a major bioactive compound in Wasabi [Wasabia japonica (Miq.) Matsum.], has revealed the inhibitory effect on colon carcinogenesis in rat cancer model although the underlying mechanism is unclear. In this study, we used two types of human colorectal cancer cells (HCT116 p53 +/+ and HCT116 p53 -/- ) to investigate the anticancer activity and molecular mechanisms of 6-MSITC. Interestingly, 6-MSITC inhibited the cell proliferation in both types of cells with similar IC 50 value although a light increase in the phosphorylation and accumulation of P53 protein was observed in HCT116 p53 +/+ cells at 24 h after treatment. In addition, 6-MSITC increased the ratio of proapoptotic cells in both types of cells with the same fashion in a p53-independent manner. The data from mitochondrial analysis revealed that 6-MSITC enhanced the ratio of proapoptotic B-cell lymphoma-2-associated X protein/antiapoptotic myeloid cell leukemia 1, and sequentially caused mitochondrial membrane potential (ΔΨ m ) loss, cytochrome c release, and caspase-3 activation in both types of cells. Taken together, Wasabi 6-MSITC induced apoptosis of human colorectal cancer cells in p53-independent mitochondrial dysfunction pathway. These findings suggest that 6-MSITC might be a potential agent for colon cancer chemoprevention although with p53 mutation. © 2018 BioFactors, 2018. © 2018 International Union of Biochemistry and Molecular Biology.

  6. A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.

    PubMed

    Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping

    2018-05-23

    PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.

  7. Changes in O-Linked N-Acetylglucosamine (O-GlcNAc) Homeostasis Activate the p53 Pathway in Ovarian Cancer Cells*

    PubMed Central

    de Queiroz, Rafaela Muniz; Madan, Rashna; Chien, Jeremy; Dias, Wagner Barbosa; Slawson, Chad

    2016-01-01

    O-GlcNAcylation is a dynamic post-translational modification consisting of the addition of a single N-acetylglucosamine sugar to serine and threonine residues in proteins by the enzyme O-linked β-N-acetylglucosamine transferase (OGT), whereas the enzyme O-GlcNAcase (OGA) removes the modification. In cancer, tumor samples present with altered O-GlcNAcylation; however, changes in O-GlcNAcylation are not consistent between tumor types. Interestingly, the tumor suppressor p53 is modified by O-GlcNAc, and most solid tumors contain mutations in p53 leading to the loss of p53 function. Because ovarian cancer has a high frequency of p53 mutation rates, we decided to investigate the relationship between O-GlcNAcylation and p53 function in ovarian cancer. We measured a significant decrease in O-GlcNAcylation of tumor tissue in an ovarian tumor microarray. Furthermore, O-GlcNAcylation was increased, and OGA protein and mRNA levels were decreased in ovarian tumor cell lines not expressing the protein p53. Treatment with the OGA inhibitor Thiamet-G (TMG), silencing of OGA, or overexpression of OGA and OGT led to p53 stabilization, increased nuclear localization, and increased protein and mRNA levels of p53 target genes. These data suggest that changes in O-GlcNAc homeostasis activate the p53 pathway. Combination treatment of the chemotherapeutic cisplatin with TMG decreased tumor cell growth and enhanced cell cycle arrest without impairing cytotoxicity. The effects of TMG on tumor cell growth were partially dependent on wild type p53 activation. In conclusion, changes in O-GlcNAc homeostasis activate the wild type p53 pathway in ovarian cancer cells, and OGA inhibition has the potential as an adjuvant treatment for ovarian carcinoma. PMID:27402830

  8. Novel Derivative of Benzofuran Induces Cell Death Mostly by G2/M Cell Cycle Arrest through p53-dependent Pathway but Partially by Inhibition of NF-κB*

    PubMed Central

    Manna, Sunil K.; Bose, Julie S.; Gangan, Vijay; Raviprakash, Nune; Navaneetha, Thota; Raghavendra, Pongali B.; Babajan, Banaganapalli; Kumar, Chitta S.; Jain, Swatantra K.

    2010-01-01

    The Dracaena resin is widely used in traditional medicine as an anticancer agent, and benzofuran lignan is the active component. In this report, we provide evidence that the synthetic derivative of benzofuran lignan (Benfur) showed antitumor activities. It induced apoptosis in p53-positive cells. Though it inhibited endotoxin-induced nuclear factor κB (NF-κB) activation in both p53-positive and -negative cells, the activation of caspase 3 was observed in p53-positive cells. It showed partial cell death effect in both p53-positive and -negative cells through inhibition of NF-κB. Cell cycle analysis using flow cytometry showed that treatment with this novel benozofuran lignan derivative to Jurkat T-cells, but not U-937 cells, resulted in a G2/M arrest in a dose- and time-dependent manner. It increased amounts of p21, p27, and cyclin B, but not phospho-Rb through p53 nuclear translocation in Jurkat T-cells, but not in U-937 cells. It inhibited amounts of MDM2 (murine double minute 2) by repressing the transcription factor Sp1, which was also proved in silico. It induced cell death in tumor cells, but not in primary T-cells. Overall, our data suggest that Benfur-mediated cell death is partially dependent upon NF-κB, but predominantly dependent on p53. Thus, this novel benzofuran lignan derivative can be effective chemopreventive or chemotherapeutic agent against malignant T-cells. PMID:20472557

  9. The p53-reactivating small-molecule RITA enhances cisplatin-induced cytotoxicity and apoptosis in head and neck cancer.

    PubMed

    Roh, Jong-Lyel; Ko, Jung Ho; Moon, Soo Jin; Ryu, Chang Hwan; Choi, Jun Young; Koch, Wayne M

    2012-12-01

    We evaluated whether the restoration of p53 function by the p53-reactivating small molecule RITA (reactivation of p53 and induction of tumor cell apoptosis enhances cisplatin-induced cytotoxicity and apoptosis in head-and-neck cancer (HNC). RITA induced prominent accumulation and reactivation of p53 in a wild-type TP53-bearing HNC cell line. RITA showed maximal growth suppression in tumor cells showing MDM2-dependent p53 degradation. RITA promoted apoptosis in association with upregulation of p21, BAX, and cleaved caspase-3; notably, the apoptotic response was blocked by pifithrin-α, demonstrating its p53 dependence. With increasing concentrations, RITA strongly induced apoptosis rather than G2-phase arrest. In combination therapy, RITA enhanced cisplatin-induced growth inhibition and apoptosis of HNC cells invitro and in vivo. Our data suggest that the restoration of p53 tumor-suppressive function by RITA enhances the cytotoxicity and apoptosis of cisplatin, an action that may offer an attractive strategy for treating HNC. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  10. Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

    2016-04-22

    The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatinmore » immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.« less

  11. Crocidolite asbestos causes an induction of p53 and apoptosis in cultured A-549 lung carcinoma cells.

    PubMed

    Pääkkö, P; Rämet, M; Vähäkangas, K; Korpela, N; Soini, Y; Turunen, S; Jaworska, M; Gillissen, A

    1998-01-01

    A number of genotoxic chemicals and agents, such as benzo(a)pyrene and ultraviolet light, are able to induce nuclear accumulation of p53 protein. Usually, this response is transient and a consequence of stabilization of the wild-type p53 protein. After withdrawal of the exposure, the amount of p53 protein returns to a normal level within hours or a few days. We have studied the p53 response to the exposure of crocidolite asbestos in A-549 lung carcinoma cells using three different methods, i.e., p53 immunohistochemistry, Western blotting and metabolic labelling followed by p53 immunoprecipitation. With these techniques we demonstrate a dose-dependent p53 nuclear response to crocidolite exposure. The half-life of p53 protein in A-549 lung carcinoma cells cultured in serum-free media increased from 30 up to 80 min, and the protein reacted with a wild-type specific antibody suggesting that it was in a wild-type conformation. In situ 3'-end labelling of A-549 cells demonstrated a dose-dependent increase in apoptotic activity. Our data support the idea that increased apoptotic activity, induced by crocidolite, is mediated by p53.

  12. Tetraploidization or autophagy: The ultimate fate of senescent human endometrial stem cells under ATM or p53 inhibition.

    PubMed

    Borodkina, Aleksandra V; Shatrova, Alla N; Deryabin, Pavel I; Grukova, Anastasiya A; Nikolsky, Nikolay N; Burova, Elena B

    2016-01-01

    Previously we demonstrated that endometrium-derived human mesenchymal stem cells (hMESCs) via activation of the ATM/p53/p21/Rb pathway enter the premature senescence in response to oxidative stress. Down regulation effects of the key components of this signaling pathway, particularly ATM and p53, on a fate of stressed hMESCs have not yet been investigated. In the present study by using the specific inhibitors Ku55933 and Pifithrin-α, we confirmed implication of both ATM and p53 in H(2)O(2)-induced senescence of hMESCs. ATM or p53 down regulation was shown to modulate differently the cellular fate of H(2)O(2)-treated hMESCs. ATM inhibition allowed H(2)O(2)-stimulated hMESCs to escape the permanent cell cycle arrest due to loss of the functional ATM/p53/p21/Rb pathway, and induced bypass of mitosis and re-entry into S phase, resulting in tetraploid cells. On the contrary, suppression of the p53 transcriptional activity caused a pronounced cell death of H(2)O(2)-treated hMESCs via autophagy induction. The obtained data clearly demonstrate that down regulation of ATM or p53 shifts senescence of human endometrial stem cells toward tetraploidization or autophagy.

  13. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia

    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either permore » se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.« less

  14. Evidence that expression of a mutated p53 gene attenuates apoptotic cell death in human gastric intestinal-type carcinomas in vivo.

    PubMed

    Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H

    1997-05-01

    To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P < 0.05). Apoptotic cells were identified from routinely stained sections and by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P < 0.05). The proliferating cell nuclear antigen index, defined similarly to the TI, was 56.4 +/- 16.3% in category A, and it was significantly higher than that in category B (P < 0.05). The immunohistochemically detected expression of p21CIP1/WAP1 did not differ between the two categories, while Bax-positive tumor cells were more frequently detected in category A. These results indicate that (1) expression of a mutated p53 gene attenuates apoptotic cell death of gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.

  15. Inhibition of autophagy as a treatment strategy for p53 wild-type acute myeloid leukemia

    PubMed Central

    Folkerts, Hendrik; Hilgendorf, Susan; Wierenga, Albertus T J; Jaques, Jennifer; Mulder, André B; Coffer, Paul J; Schuringa, Jan Jacob; Vellenga, Edo

    2017-01-01

    Here we have explored whether inhibition of autophagy can be used as a treatment strategy for acute myeloid leukemia (AML). Steady-state autophagy was measured in leukemic cell lines and primary human CD34+ AML cells with a large variability in basal autophagy between AMLs observed. The autophagy flux was higher in AMLs classified as poor risk, which are frequently associated with TP53 mutations (TP53mut), compared with favorable- and intermediate-risk AMLs. In addition, the higher flux was associated with a higher expression level of several autophagy genes, but was not affected by alterations in p53 expression by knocking down p53 or overexpression of wild-type p53 or p53R273H. AML CD34+ cells were more sensitive to the autophagy inhibitor hydroxychloroquine (HCQ) than normal bone marrow CD34+ cells. Similar, inhibition of autophagy by knockdown of ATG5 or ATG7 triggered apoptosis, which coincided with increased expression of p53. In contrast to wild-type p53 AML (TP53wt), HCQ treatment did not trigger a BAX and PUMA-dependent apoptotic response in AMLs harboring TP53mut. To further characterize autophagy in the leukemic stem cell-enriched cell fraction AML CD34+ cells were separated into ROSlow and ROShigh subfractions. The immature AML CD34+-enriched ROSlow cells maintained higher basal autophagy and showed reduced survival upon HCQ treatment compared with ROShigh cells. Finally, knockdown of ATG5 inhibits in vivo maintenance of AML CD34+ cells in NSG mice. These results indicate that targeting autophagy might provide new therapeutic options for treatment of AML since it affects the immature AML subfraction. PMID:28703806

  16. miR-300 promotes proliferation and EMT-mediated colorectal cancer migration and invasion by targeting p53.

    PubMed

    Wang, Lin; Yu, Peiwu

    2016-12-01

    p53 mutations in tumors can induce the loss of wild-type tumor-suppressing p53 function, which results in the increase in proliferation, migration and invasion ability in cancer cells. Studies have shown that the expression of p53 is regulated by several microRNAs (miRNAs). In the present study, we found that miR-300 and p53 were significantly increased in colorectal cancer (CRC) tissues when compared with levels noted in adjacent colorectal tissues. Both miR-300 and p53 were significantly correlated with lymphatic metastasis and TNM stage. Both miR-300 and p53 promoted CRC cell (SW480 and HT29) proliferation, migration, and invasion, respectively, in vitro. In addition, we found that miR-300 is a direct positive regulator of p53 through binding to the binding site in the 3'UTR of the p53 gene in human CRC cells. Moreover, both miR-300 and p53 induced CRC cell epithelial‑mesenchymal transition (EMT) respectively. Taken together, we demonstrated that miR-300 promoted proliferation and EMT-mediated CRC migration and invasion by targeting p53. These findings provide a new theoretical basis and potential therapeutic targets, and thus lays the foundation for exploring the pathogenesis of CRC.

  17. p53 functions as a cell cycle control protein in osteosarcomas.

    PubMed Central

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  18. Modulation of oxidative stress and subsequent induction of apoptosis and endoplasmic reticulum stress allows citral to decrease cancer cell proliferation.

    PubMed

    Kapur, Arvinder; Felder, Mildred; Fass, Lucas; Kaur, Justanjot; Czarnecki, Austin; Rathi, Kavya; Zeng, San; Osowski, Kathryn Kalady; Howell, Colin; Xiong, May P; Whelan, Rebecca J; Patankar, Manish S

    2016-06-08

    The monoterpenoid, citral, when delivered through PEG-b-PCL nanoparticles inhibits in vivo growth of 4T1 breast tumors. Here, we show that citral inhibits proliferation of multiple human cancer cell lines. In p53 expressing ECC-1 and OVCAR-3 but not in p53-deficient SKOV-3 cells, citral induces G1/S cell cycle arrest and apoptosis as determined by Annexin V staining and increased cleaved caspase3 and Bax and decreased Bcl-2. In SKOV-3 cells, citral induces the ER stress markers CHOP, GADD45, EDEM, ATF4, Hsp90, ATG5, and phospho-eIF2α. The molecular chaperone 4-phenylbutyric acid attenuates citral activity in SKOV-3 but not in ECC-1 and OVCAR-3 cells. In p53-expressing cells, citral increases phosphorylation of serine-15 of p53. Activation of p53 increases Bax, PUMA, and NOXA expression. Inhibition of p53 by pifithrin-α, attenuates citral-mediated apoptosis. Citral increases intracellular oxygen radicals and this leads to activation of p53. Inhibition of glutathione synthesis by L-buthionine sulfoxamine increases potency of citral. Pretreatment with N-acetylcysteine decreases phosphorylation of p53 in citral-treated ECC-1 and OVCAR-3. These results define a p53-dependent, and in the absence of p53, ER stress-dependent mode of action of citral. This study indicates that citral in PEG-b-PCL nanoparticle formulation should be considered for treatment of breast and other tumors.

  19. Modulation of oxidative stress and subsequent induction of apoptosis and endoplasmic reticulum stress allows citral to decrease cancer cell proliferation

    PubMed Central

    Kapur, Arvinder; Felder, Mildred; Fass, Lucas; Kaur, Justanjot; Czarnecki, Austin; Rathi, Kavya; Zeng, San; Osowski, Kathryn Kalady; Howell, Colin; Xiong, May P.; Whelan, Rebecca J.; Patankar, Manish S.

    2016-01-01

    The monoterpenoid, citral, when delivered through PEG-b-PCL nanoparticles inhibits in vivo growth of 4T1 breast tumors. Here, we show that citral inhibits proliferation of multiple human cancer cell lines. In p53 expressing ECC-1 and OVCAR-3 but not in p53-deficient SKOV-3 cells, citral induces G1/S cell cycle arrest and apoptosis as determined by Annexin V staining and increased cleaved caspase3 and Bax and decreased Bcl-2. In SKOV-3 cells, citral induces the ER stress markers CHOP, GADD45, EDEM, ATF4, Hsp90, ATG5, and phospho-eIF2α. The molecular chaperone 4-phenylbutyric acid attenuates citral activity in SKOV-3 but not in ECC-1 and OVCAR-3 cells. In p53-expressing cells, citral increases phosphorylation of serine-15 of p53. Activation of p53 increases Bax, PUMA, and NOXA expression. Inhibition of p53 by pifithrin-α, attenuates citral-mediated apoptosis. Citral increases intracellular oxygen radicals and this leads to activation of p53. Inhibition of glutathione synthesis by L-buthionine sulfoxamine increases potency of citral. Pretreatment with N-acetylcysteine decreases phosphorylation of p53 in citral-treated ECC-1 and OVCAR-3. These results define a p53-dependent, and in the absence of p53, ER stress-dependent mode of action of citral. This study indicates that citral in PEG-b-PCL nanoparticle formulation should be considered for treatment of breast and other tumors. PMID:27270209

  20. Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

    PubMed Central

    Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

    2015-01-01

    ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792

  1. p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

    PubMed

    Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

    2004-06-01

    The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

  2. p53 Mutation suppresses adult neurogenesis in medaka fish (Oryzias latipes)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Isoe, Yasuko; Okuyama, Teruhiro; Taniguchi, Yoshihito

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer Progenitor migration is accompanied by an increase in their numbers in the adult brain. Black-Right-Pointing-Pointer p53 Mutation suppressed an increase in the number of the migrated progenitors. Black-Right-Pointing-Pointer The decreased progenitor number is not due to enhanced cell death. Black-Right-Pointing-Pointer p53 Mutation did not affect proliferation of stem cells. -- Abstract: Tumor suppressor p53 negatively regulates self-renewal of neural stem cells in the adult murine brain. Here, we report that the p53 null mutation in medaka fish (Oryzias latipes) suppressed neurogenesis in the telencephalon, independent of cell death. By using 5-bromo-29-deoxyuridine (BrdU) immunohistochemistry, we identified 18 proliferation zonesmore » in the brains of young medaka fish; in situ hybridization showed that p53 was expressed selectively in at least 12 proliferation zones. We also compared the number of BrdU-positive cells present in the whole telencephalon of wild-type (WT) and p53 mutant fish. Immediately after BrdU exposure, the number of BrdU-positive cells did not differ significantly between them. One week after BrdU-exposure, the BrdU-positive cells migrated from the proliferation zone, which was accompanied by an increased number in the WT brain. In contrast, no significant increase was observed in the p53 mutant brain. Terminal deoxynucleotidyl transferase (dUTP) nick end-labeling revealed that there was no significant difference in the number of apoptotic cells in the telencephalon of p53 mutant and WT medaka, suggesting that the decreased number of BrdU-positive cells in the mutant may be due to the suppression of proliferation rather than the enhancement of neural cell death. These results suggest that p53 positively regulates neurogenesis via cell proliferation.« less

  3. An adaptive molecular timer in p53-meidated cell fate decision

    NASA Astrophysics Data System (ADS)

    Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

    The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

  4. Okadaic acid mediates p53 hyperphosphorylation and growth arrest in cells with wild-type p53 but increases aberrant mitoses in cells with non-functional p53.

    PubMed

    Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T

    1999-06-01

    The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.

  5. p53 Is a Host Cell Regulator during Herpes Simplex Encephalitis.

    PubMed

    Maruzuru, Yuhei; Koyanagi, Naoto; Takemura, Naoki; Uematsu, Satoshi; Matsubara, Daisuke; Suzuki, Yutaka; Arii, Jun; Kato, Akihisa; Kawaguchi, Yasushi

    2016-08-01

    p53 is a critical host cell factor in the cellular response to a broad range of stress factors. We recently reported that p53 is required for efficient herpes simplex virus 1 (HSV-1) replication in cell culture. However, a defined role for p53 in HSV-1 replication and pathogenesis in vivo remains elusive. In this study, we examined the effects of p53 on HSV-1 infection in vivo using p53-deficient mice. Following intracranial inoculation, p53 knockout reduced viral replication in the brains of mice and led to significantly reduced rates of mortality due to herpes simplex encephalitis. These results suggest that p53 is an important host cell regulator of HSV-1 replication and pathogenesis in the central nervous system (CNS). HSV-1 causes sporadic cases of encephalitis, which, even with antiviral therapy, can result in severe neurological defects and even death. Many host cell factors involved in the regulation of CNS HSV-1 infection have been investigated using genetically modified mice. However, most of these factors are immunological regulators and act via immunological pathways in order to restrict CNS HSV-1 infection. They therefore provide limited information on intrinsic host cell regulators that may be involved in the facilitation of CNS HSV-1 infection. Here we demonstrate that a host cell protein, p53, which has generally been considered a host cell restriction factor for various viral infections, is required for efficient HSV-1 replication and pathogenesis in the CNS of mice. This is the first report showing that p53 positively regulates viral replication and pathogenesis in vivo and provides insights into its molecular mechanism, which may suggest novel clinical treatment options for herpes simplex encephalitis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  6. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    PubMed Central

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Wilhelm Doerr, H; Rödel, F; Speidel, D; Cinatl, J

    2012-01-01

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3rRITA10 μM to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells. PMID:22476102

  7. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    PubMed

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  8. p53 suppresses hyper-recombination by modulating BRCA1 function

    PubMed Central

    Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui

    2015-01-01

    Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908

  9. Crosstalk between the IGF-1R/AKT/mTORC1 pathway and the tumor suppressors p53 and p27 determines cisplatin sensitivity and limits the effectiveness of an IGF-1R pathway inhibitor

    PubMed Central

    Davaadelger, Batzaya; Duan, Lei; Perez, Ricardo E.; Gitelis, Steven; Maki, Carl G.

    2016-01-01

    The insulin-like growth factor-1 receptor (IGF-1R) signaling pathway is aberrantly activated in multiple cancers and can promote proliferation and chemotherapy resistance. Multiple IGF-1R inhibitors have been developed as potential therapeutics. However, these inhibitors have failed to increase patient survival when given alone or in combination with chemotherapy agents. The reason(s) for the disappointing clinical effect of these inhibitors is not fully understood. Cisplatin (CP) activated the IGF-1R/AKT/mTORC1 pathway and stabilized p53 in osteosarcoma (OS) cells. p53 knockdown reduced IGF-1R/AKT/mTORC1 activation by CP, and IGF-1R inhibition reduced the accumulation of p53. These data demonstrate positive crosstalk between p53 and the IGF-1R/AKT/mTORC1 pathway in response to CP. Further studies showed the effect of IGF-1R inhibition on CP response is dependent on p53 status. In p53 wild-type cells treated with CP, IGF-1R inhibition increased p53s apoptotic function but reduced p53-dependent senescence, and had no effect on long term survival. In contrast, in p53-null/knockdown cells, IGF-1R inhibition reduced apoptosis in response to CP and increased long term survival. These effects were due to p27 since IGF-1R inhibition stabilized p27 in CP-treated cells, and p27 depletion restored apoptosis and reduced long term survival. Together, the results demonstrate 1) p53 expression determines the effect of IGF-1R inhibition on cancer cell CP response, and 2) crosstalk between the IGF-1R/AKT/mTORC1 pathway and p53 and p27 can reduce cancer cell responsiveness to chemotherapy and may ultimately limit the effectiveness of IGF-1R pathway inhibitors in the clinic. PMID:27050276

  10. Checkpoint Kinase-Dependent Regulation of DNA Repair and Genome Instability in Breast Cancer

    DTIC Science & Technology

    2009-06-01

    4A-mediated ubiquitination and deg- radation. J. Biol. Chem. 276:48175–48182. 14. Chu, G., and E. Chang. 1988. Xeroderma pigmentosum group E cells lack...a nuclear factor that binds to damaged DNA. Science 242:564–567. 15. Cleaver, J. E. 2005. Cancer in xeroderma pigmentosum and related disorders of...28. Hwang, B. J., J. M. Ford, P. C. Hanawalt, and G. Chu. 1999. Expression of the p48 xeroderma pigmentosum gene is p53-dependent and is involved in

  11. p53 Restoration in Induction and Maintenance of Senescence: Differential Effects in Premalignant and Malignant Tumor Cells

    PubMed Central

    Harajly, Mohamad; Zalzali, Hasan; Nawaz, Zafar; Ghayad, Sandra E.; Ghamloush, Farah; Basma, Hussein; Zainedin, Samiha; Rabeh, Wissam; Jabbour, Mark; Tawil, Ayman; Badro, Danielle A.; Evan, Gerard I.

    2015-01-01

    The restoration of p53 has been suggested as a therapeutic approach in tumors. However, the timing of p53 restoration in relation to its efficacy during tumor progression still is unclear. We now show that the restoration of p53 in murine premalignant proliferating pineal lesions resulted in cellular senescence, while p53 restoration in invasive pineal tumors did not. The effectiveness of p53 restoration was not dependent on p19Arf expression but showed an inverse correlation with Mdm2 expression. In tumor cells, p53 restoration became effective when paired with either DNA-damaging therapy or with nutlin, an inhibitor of p53-Mdm2 interaction. Interestingly, the inactivation of p53 after senescence resulted in reentry into the cell cycle and rapid tumor progression. The evaluation of a panel of human supratentorial primitive neuroectodermal tumors (sPNET) showed low activity of the p53 pathway. Together, these data suggest that the restoration of the p53 pathway has different effects in premalignant versus invasive pineal tumors, and that p53 activation needs to be continually sustained, as reversion from senescence occurs rapidly with aggressive tumor growth when p53 is lost again. Finally, p53 restoration approaches may be worth exploring in sPNET, where the p53 gene is intact but the pathway is inactive in the majority of examined tumors. PMID:26598601

  12. Reciprocal inhibition of p53 and nuclear factor-kappaB transcriptional activities determines cell survival or death in neurons.

    PubMed

    Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef

    2003-09-17

    The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.

  13. p53: traffic cop at the crossroads of DNA repair and recombination.

    PubMed

    Sengupta, Sagar; Harris, Curtis C

    2005-01-01

    p53 mutants that lack DNA-binding activities, and therefore, transcriptional activities, are among the most common mutations in human cancer. Recently, a new role for p53 has come to light, as the tumour suppressor also functions in DNA repair and recombination. In cooperation with its function in transcription, the transcription-independent roles of p53 contribute to the control and efficiency of DNA repair and recombination.

  14. Wip1 and p53 contribute to HTLV-1 Tax-induced tumorigenesis

    PubMed Central

    2012-01-01

    Background Human T-cell Leukemia Virus type 1 (HTLV-1) infects 20 million individuals world-wide and causes Adult T-cell Leukemia/Lymphoma (ATLL), a highly aggressive T-cell cancer. ATLL is refractory to treatment with conventional chemotherapy and fewer than 10% of afflicted individuals survive more than 5 years after diagnosis. HTLV-1 encodes a viral oncoprotein, Tax, that functions in transforming virus-infected T-cells into leukemic cells. All ATLL cases are believed to have reduced p53 activity although only a minority of ATLLs have genetic mutations in their p53 gene. It has been suggested that p53 function is inactivated by the Tax protein. Results Using genetically altered mice, we report here that Tax expression does not achieve a functional equivalence of p53 inactivation as that seen with genetic mutation of p53 (i.e. a p53−/− genotype). Thus, we find statistically significant differences in tumorigenesis between Tax+p53+/+versus Tax+p53−/− mice. We also find a role contributed by the cellular Wip1 phosphatase protein in tumor formation in Tax transgenic mice. Notably, Tax+Wip1−/− mice show statistically significant reduced prevalence of tumorigenesis compared to Tax+Wip1+/+ counterparts. Conclusions Our findings provide new insights into contributions by p53 and Wip1 in the in vivo oncogenesis of Tax-induced tumors in mice. PMID:23256545

  15. Lack of a p21waf1/cip -dependent G1/S checkpoint in neural stem and progenitor cells after DNA damage in vivo.

    PubMed

    Roque, Telma; Haton, Céline; Etienne, Olivier; Chicheportiche, Alexandra; Rousseau, Laure; Martin, Ludovic; Mouthon, Marc-André; Boussin, François D

    2012-03-01

    The cyclin-dependent kinase inhibitor p21(waf1/cip) mediates the p53-dependent G1/S checkpoint, which is generally considered to be a critical requirement to maintain genomic stability after DNA damage. We used staggered 5-ethynyl-2'deoxyuridine/5-bromo-2'-deoxyuridine double-labeling in vivo to investigate the cell cycle progression and the role of p21(waf1/cip) in the DNA damage response of neural stem and progenitor cells (NSPCs) after exposure of the developing mouse cortex to ionizing radiation. We observed a radiation-induced p21-dependent apoptotic response in migrating postmitotic cortical cells. However, neural stem and progenitor cells (NSPCs) did not initiate a p21(waf1/cip1) -dependent G1/S block and continued to enter S-phase at a similar rate to the non-irradiated controls. The G1/S checkpoint is not involved in the mechanisms underlying the faithful transmission of the NSPC genome and/or the elimination of critically damaged cells. These processes typically involve intra-S and G2/M checkpoints that are rapidly activated after irradiation. p21 is normally repressed in neural cells during brain development except at the G1 to G0 transition. Lack of activation of a G1/S checkpoint and apoptosis of postmitotic migrating cells after DNA damage appear to depend on the expression of p21 in neural cells, since substantial cell-to-cell variations are found in the irradiated cortex. This suggests that repression of p21 during brain development prevents the induction of the G1/S checkpoint after DNA damage. Copyright © 2011 AlphaMed Press.

  16. The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

    PubMed

    Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

    2018-03-23

    p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Surgical resection and radiofrequency ablation initiate cancer in cytokeratin-19+- liver cells deficient for p53 and Rb.

    PubMed

    Matondo, Ramadhan B; Toussaint, Mathilda Jm; Govaert, Klaas M; van Vuuren, Luciel D; Nantasanti, Sathidpak; Nijkamp, Maarten W; Pandit, Shusil K; Tooten, Peter Cj; Koster, Mirjam H; Holleman, Kaylee; Schot, Arend; Gu, Guoqiang; Spee, Bart; Roskams, Tania; Rinkes, Inne Borel; Schotanus, Baukje; Kranenburg, Onno; de Bruin, Alain

    2016-08-23

    The long term prognosis of liver cancer patients remains unsatisfactory because of cancer recurrence after surgical interventions, particularly in patients with viral infections. Since hepatitis B and C viral proteins lead to inactivation of the tumor suppressors p53 and Retinoblastoma (Rb), we hypothesize that surgery in the context of p53/Rb inactivation initiate de novo tumorigenesis.We, therefore, generated transgenic mice with hepatocyte and cholangiocyte/liver progenitor cell (LPC)-specific deletion of p53 and Rb, by interbreeding conditional p53/Rb knockout mice with either Albumin-cre or Cytokeratin-19-cre transgenic mice.We show that liver cancer develops at the necrotic injury site after surgical resection or radiofrequency ablation in p53/Rb deficient livers. Cancer initiation occurs as a result of specific migration, expansion and transformation of cytokeratin-19+-liver (CK-19+) cells. At the injury site migrating CK-19+ cells formed small bile ducts and adjacent cells strongly expressed the transforming growth factor β (TGFβ). Isolated cytokeratin-19+ cells deficient for p53/Rb were resistant against hypoxia and TGFβ-mediated growth inhibition. CK-19+ specific deletion of p53/Rb verified that carcinomas at the injury site originates from cholangiocytes or liver progenitor cells.These findings suggest that human liver patients with hepatitis B and C viral infection or with mutations for p53 and Rb are at high risk to develop tumors at the surgical intervention site.

  18. Surgical resection and radiofrequency ablation initiate cancer in cytokeratin-19+- liver cells deficient for p53 and Rb

    PubMed Central

    Govaert, Klaas M; van Vuuren, Luciel D; Nantasanti, Sathidpak; Nijkamp, Maarten W; Pandit, Shusil K; Tooten, Peter CJ; Koster, Mirjam H; Holleman, Kaylee; Schot, Arend; Gu, Guoqiang; Spee, Bart; Roskams, Tania; Rinkes, Inne Borel; Schotanus, Baukje; Kranenburg, Onno; de Bruin, Alain

    2016-01-01

    The long term prognosis of liver cancer patients remains unsatisfactory because of cancer recurrence after surgical interventions, particularly in patients with viral infections. Since hepatitis B and C viral proteins lead to inactivation of the tumor suppressors p53 and Retinoblastoma (Rb), we hypothesize that surgery in the context of p53/Rb inactivation initiate de novo tumorigenesis. We, therefore, generated transgenic mice with hepatocyte and cholangiocyte/liver progenitor cell (LPC)-specific deletion of p53 and Rb, by interbreeding conditional p53/Rb knockout mice with either Albumin-cre or Cytokeratin-19-cre transgenic mice. We show that liver cancer develops at the necrotic injury site after surgical resection or radiofrequency ablation in p53/Rb deficient livers. Cancer initiation occurs as a result of specific migration, expansion and transformation of cytokeratin-19+-liver (CK-19+) cells. At the injury site migrating CK-19+ cells formed small bile ducts and adjacent cells strongly expressed the transforming growth factor β (TGFβ). Isolated cytokeratin-19+ cells deficient for p53/Rb were resistant against hypoxia and TGFβ-mediated growth inhibition. CK-19+ specific deletion of p53/Rb verified that carcinomas at the injury site originates from cholangiocytes or liver progenitor cells. These findings suggest that human liver patients with hepatitis B and C viral infection or with mutations for p53 and Rb are at high risk to develop tumors at the surgical intervention site. PMID:27323406

  19. The PTTG1-targeting miRNAs miR-329, miR-300, miR-381, and miR-655 inhibit pituitary tumor cell tumorigenesis and are involved in a p53/PTTG1 regulation feedback loop

    PubMed Central

    Diao, Cai-feng; Li, Jian-wei; Su, Jing-liang; Zhang, Sai

    2015-01-01

    Deregulation of the pituitary tumor transforming gene (PTTG1), a newly discovered oncogene, is a hallmark of various malignancies, including pituitary tumors. However, the mechanisms regulating PTTG1 expression are still needed to be explored. MicroRNAs (miRNAs) are a novel class of small RNA molecules that act as posttranscriptional regulators of gene expression and can play a significant role in tumor development. Here, we identified a series of miRNAs, namely, miR-329, miR-300, miR-381 and miR-655, which could target PTTG1 messenger RNA and inhibit its expression. Interestingly, all four miRNAs significantly that are downregulated in pituitary tumors were mapped to the 14q32.31 locus, which acts as a tumor suppressor in several cancers. Functional studies show that the PTTG1-targeting miRNAs inhibit proliferation, migration and invasion but induce apoptosis in GH3 and MMQ cells. Furthermore, overexpression of a PTTG1 expression vector lacking the 3′UTR partially reverses the tumor suppressive effects of these miRNAs. Next, we identified the promoter region of PTTG1-targeting miRNAs with binding sites for p53. In our hands, p53 transcriptionally activated the expression of these miRNAs in pituitary tumor cells. Finally, we found that PTTG1 could inhibit p53 transcriptional activity to the four miRNAs. These data indicate the existence of a feedback loop between PTTG1 targeting miRNAs, PTTG1 and p53 that promotes pituitary tumorigenesis. Together, these findings suggest that these PTTG1-targeting miRNAs are important players in the regulation of pituitary tumorigenesis and that these miRNAs may serve as valuable therapeutic targets for cancer treatment. PMID:26320179

  20. A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

    PubMed Central

    Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

    2015-01-01

    Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

  1. Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.

    PubMed

    Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald

    2017-06-01

    p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p < 0.001). The p53 and Bcl-2 immunoreactivity was increased in aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.

  2. Synergistic effect of p53 on TSA-induced stanniocalcin 1 expression in human nasopharyngeal carcinoma cells, CNE2.

    PubMed

    Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C

    2012-06-01

    Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.

  3. Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.

    PubMed

    Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu

    2016-11-04

    Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. © 2015 Wiley Periodicals, Inc.

  4. Targeting MDM2 for Treatment of Adenoid Cystic Carcinoma

    PubMed Central

    Warner, Kristy A.; Nör, Felipe; Acasigua, Gerson A.; Martins, Manoela D.; Zhang, Zhaocheng; McLean, Scott A.; Spector, Matthew E.; Chepeha, Douglas B.; Helman, Joseph; Wick, Michael J.; Moskaluk, Christopher A.; Castilho, Rogerio M.; Pearson, Alexander T.; Wang, Shaomeng; Nör, Jacques E.

    2016-01-01

    Purpose There are no effective treatment options for patients with advanced adenoid cystic carcinoma (ACC). Here, we evaluated the effect of a new small molecule inhibitor of the MDM2-p53 interaction (MI-773) in preclinical models of ACC. Experimental Design To evaluate the anti-tumor effect of MI-773, we administered it to mice harboring 3 different patient-derived xenograft (PDX) models of ACC expressing functional p53. The effect of MI-773 on MDM2, p53, phospho-p53 and p21 was examined by Western blots in 5 low passage primary human ACC cell lines and in MI-773-treated PDX tumors. Results Single agent MI-773 caused tumor regression in the 3 PDX models of ACC studied here. For example, we observed a tumor growth inhibition (TGI) index of 127% in UM-PDX-HACC-5 tumors that was associated with an increase in the fraction of apoptotic cells (p=0.015). The number of p53-positive cells was increased in MI-773-treated PDX tumors (p<0.001), with a correspondent shift in p53 localization from the nucleus to the cytoplasm. Western blots demonstrated that MI-773 potently induced expression of p53 and its downstream targets p21, MDM2 and induced phosphorylation of p53 (serine 392) in low passage primary human ACC cells. Notably, MI-773 induced a dose-dependent increase in the fraction of apoptotic ACC cells and in the fraction of cells in the G1 phase of cell cycle (p<0.05). Conclusions Collectively, these data demonstrate that therapeutic inhibition of the MDM2-p53 interaction with MI-773 activates downstream effectors of apoptosis and causes robust tumor regression in preclinical models of adenoid cystic carcinoma. PMID:26936915

  5. Tumor suppressor p53 negatively regulates glycolysis stimulated by hypoxia through its target RRAD

    PubMed Central

    Wu, Rui; Liang, Yingjian; Lin, Meihua; Liu, Jia; Chan, Chang S.; Hu, Wenwei; Feng, Zhaohui

    2014-01-01

    Cancer cells display enhanced glycolysis to meet their energetic and biosynthetic demands even under normal oxygen concentrations. Recent studies have revealed that tumor suppressor p53 represses glycolysis under normoxia as a novel mechanism for tumor suppression. As the common microenvironmental stress for tumors, hypoxia drives the metabolic switch from the oxidative phosphorylation to glycolysis, which is crucial for survival and proliferation of cancer cells under hypoxia. The p53's role and mechanism in regulating glycolysis under hypoxia is poorly understood. Here, we found that p53 represses hypoxia-stimulated glycolysis in cancer cells through RRAD, a newly-identified p53 target. RRAD expression is frequently decreased in lung cancer. Ectopic expression of RRAD greatly reduces glycolysis whereas knockdown of RRAD promotes glycolysis in lung cancer cells. Furthermore, RRAD represses glycolysis mainly through inhibition of GLUT1 translocation to the plasma membrane. Under hypoxic conditions, p53 induces RRAD, which in turn inhibits the translocation of GLUT1 and represses glycolysis in lung cancer cells. Blocking RRAD by siRNA greatly abolishes p53's function in repressing glycolysis under hypoxia. Taken together, our results revealed an important role and mechanism of p53 in antagonizing the stimulating effect of hypoxia on glycolysis, which contributes to p53's function in tumor suppression. PMID:25114038

  6. RITA enhances chemosensivity of pre-B ALL cells to doxorubicin by inducing p53-dependent apoptosis.

    PubMed

    Kazemi, Ahmad; Safa, Majid; Shahbazi, Atefeh

    2011-07-01

    The use of low-molecular-weight, non-peptidic molecules that disrupt the interaction between the p53 tumor suppressor and its negative regulator MDM2 has provided a promising alternative for the treatment of different types of cancer. Here, we used small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) to sensitize leukemic NALM-6 cells to doxorubicin by upregulating p53 protein. RITA alone effectively inhibited NALM-6 cells viability in dose-dependent manner as measured by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide assay and induced apoptosis as evaluated by flow cytometry, whereas RITA in combination with doxorubicin enhanced NALM-6 cells to doxorubicin-sensitivity and promoted doxorubicin induced apoptosis. Levels of p53 protein and its proapoptotic target genes, quantified by western blot and real-time PCR respectively, showed that expression of p53 was significantly increased after RITA treatment. Using p53 inhibitors PFT-alpha and PFT-mu it was shown that p53-mediated apoptosis induced by RITA can be regulated by both p53-transcription-dependent and -independent pathways. Moreover, RITA-induced apoptosis was accompanied by the activation of caspase-3 and PARP cleavage. Therefore, exploiting synergistic effects between RITA and chemotherapeutics might be an effective clinical strategy for leukemia chemotherapy.

  7. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    PubMed

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  8. DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

    PubMed Central

    Polato, Federica; Rusconi, Paolo

    2014-01-01

    Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

  9. Wee1 Kinase Inhibitor AZD1775 Radiosensitizes Hepatocellular Carcinoma Regardless of TP53 Mutational Status Through Induction of Replication Stress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cuneo, Kyle C., E-mail: kcuneo@umich.edu; Morgan, Meredith A.; Davis, Mary A.

    2016-06-01

    Purpose: Wee1 kinase inhibitors are effective radiosensitizers in cells lacking a G{sub 1} checkpoint. In this study we examined the potential effect of Wee1 kinase inhibition on inducing replication stress in hepatocellular carcinoma (HCC). Methods and Materials: Five independent datasets from the Oncomine database comparing gene expression in HCC compared to normal tissue were combined and specific markers associated with Wee1 sensitivity were analyzed. We then performed a series of in vitro experiments to study the effect of Wee1 inhibition on irradiated HCC cell lines with varying p53 mutational status. Clonogenic survival assays and flow cytometry using anti-γH2AX and phospho-histone H3more » antibodies with propidium iodide were performed to study the effect of AZD1775 on survival, cell cycle, and DNA repair. Additionally, nucleoside enriched medium was used to examine the effect of altering nucleotide pools on Wee1 targeted radiation sensitization. Results: Our analysis of the Oncomine database found high levels of CDK1 and other cell cycle regulators indicative of Wee1 sensitivity in HCC. In our in vitro experiments, treatment with AZD1775 radiosensitized and chemosensitized Hep3B, Huh7, and HepG2 cell lines and was associated with delayed resolution of γH2AX foci and the induction of pan-nuclear γH2AX staining. Wee1 inhibition attenuated radiation-induced G{sub 2} arrest in the Hep3B (TP53 null) and Huh7 (TP53 mutant) cell lines but not in the TP53 wild-type cell line HepG2. Supplementation with nucleosides reversed the radiation-sensitizing effect of AZD1775 and reduced the amount of cells with pan-nuclear γH2AX staining after radiation. Conclusions: Radiation sensitization with Wee1 inhibition occurs in cells regardless of their p53 mutational status. In this study we show for the first time that replication stress via the overconsumption of nucleotides plays an important role in AZD1775-induced radiation sensitization.« less

  10. Phosphorylated Hsp27 activates ATM-dependent p53 signaling and mediates the resistance of MCF-7 cells to doxorubicin-induced apoptosis.

    PubMed

    Xu, Yimiao; Diao, Ying; Qi, Shimei; Pan, Xiaolong; Wang, Qi; Xin, Yinqiang; Cao, Xiang; Ruan, Jie; Zhao, Zhihui; Luo, Lan; Liu, Chang; Yin, Zhimin

    2013-05-01

    DNA damage activates p53 and its downstream target genes, which further leads to apoptosis or survival either by the cell cycle arrest or by DNA repair. In many tumors, the heat shock protein 27 (Hsp27) is expressed at high levels to provide protection against anticancer drugs. However, the roles of Hsp27 in p53-mediated cellular responses to DNA damage are controversial. Here, we investigated the interplay between the phosphorylation status of Hsp27 and p53 in kidney 293A (HEK293A) cells and found that over-expressing phosphorylated Hsp27 mimics (Hsp27-3D) activated p53/p21 in an ATM-dependent manner. In addition, incubation with doxorubicin (Dox), an anticancer drug, induced Hsp27 phosphorylation in human adenocarcinoma cells (MCF-7). In contrast, inhibition of Hsp27 phosphorylation retarded both p53 induction and p21 accumulation, and led to cell apoptosis. Furthermore, phosphorylated Hsp27 increased p53 nuclear importing and its downstream target gene expression such as p21 and MDM2, while de-phosphorylated Hsp27 impeded this procession. Taken together, our data suggest that Hsp27, in its phosphorylated or de-phosphorylated status, plays different roles in regulating p53 pathway and cell survival. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Vectors to Increase Production Efficiency of Inducible Pluripotent Stem Cell (iPSC) | NCI Technology Transfer Center | TTC

    Cancer.gov

    This invention describes the discovery that specific p53 isoform increase the number of inducible pluripotent stem cells (iPS). It is known that the activity of p53 regulates the self-renewal and pluripotency of normal and cancer stem cells, and also affects re-programming efficiency of iPS cells. This p53 isoform-based technology provides a more natural process of increasing iPS cell production than previous methods of decreasing p53. NCI seeks licensees for this technology.

  12. P53 protein in proliferation, repair and apoptosis of cells.

    PubMed

    Wawryk-Gawda, Ewelina; Chylińska-Wrzos, Patrycja; Lis-Sochocka, Marta; Chłapek, Katarzyna; Bulak, Kamila; Jędrych, Marian; Jodłowska-Jędrych, Barbara

    2014-05-01

    The p53 protein is an important factor of many intra- and extracellular processes. This protein regulates the repair of cellular DNA and induces apoptosis. It is also responsible for the regulation of the senescence and the cell entering the subsequent stages of the cellular cycle. The protein p53 is also involved in inhibiting angiogenesis and the induction of oxidative shock. In our study, we examined the activity of p53 protein in the uterine epithelial cells in rats treated with cladribine. Its action is mainly based on apoptosis induction. We compared the activity of p53 protein in cells with a high apoptosis index and in cells with active repair mechanisms and high proliferation index. We observed stronger p53 protein expression in the epithelial cells of the materials taken 24 h after the last dose of 2-CdA associated with the active process of apoptosis and inhibition of proliferation. After 4 weeks from the last dose of cladribine, the stronger expression of p53 protein was associated with both the existing changes in the cell's genome, the effects of the ongoing repair mechanisms, as well as the high proliferation activity.

  13. Honokiol induces autophagic cell death in malignant glioma through reactive oxygen species-mediated regulation of the p53/PI3K/Akt/mTOR signaling pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Chien-Ju

    Honokiol, an active constituent extracted from the bark of Magnolia officinalis, possesses anticancer effects. Apoptosis is classified as type I programmed cell death, while autophagy is type II programmed cell death. We previously proved that honokiol induces cell cycle arrest and apoptosis of U87 MG glioma cells. Subsequently in this study, we evaluated the effect of honokiol on autophagy of glioma cells and examined the molecular mechanisms. Administration of honokiol to mice with an intracranial glioma increased expressions of cleaved caspase 3 and light chain 3 (LC3)-II. Exposure of U87 MG cells to honokiol also induced autophagy in concentration- andmore » time-dependent manners. Results from the addition of 3-methyladenine, an autophagy inhibitor, and rapamycin, an autophagy inducer confirmed that honokiol-induced autophagy contributed to cell death. Honokiol decreased protein levels of PI3K, phosphorylated (p)-Akt, and p-mammalian target of rapamycin (mTOR) in vitro and in vivo. Pretreatment with a p53 inhibitor or transfection with p53 small interfering (si)RNA suppressed honokiol-induced autophagy by reversing downregulation of p-Akt and p-mTOR expressions. In addition, honokiol caused generation of reactive oxygen species (ROS), which was suppressed by the antioxidant, vitamin C. Vitamin C also inhibited honokiol-induced autophagic and apoptotic cell death. Concurrently, honokiol-induced alterations in levels of p-p53, p53, p-Akt, and p-mTOR were attenuated following vitamin C administration. Taken together, our data indicated that honokiol induced ROS-mediated autophagic cell death through regulating the p53/PI3K/Akt/mTOR signaling pathway. - Highlights: • Exposure of mice with intracranial gliomas to honokiol induces cell apoptosis and autophagy. • Honokiol triggers autophagy of human glioma cells via the PISK/AKT/mTOR signaling pathway. • P53 induces autophagy via regulating the AKT/mTOR pathway in honokiol-treated glioma cells. • ROS participates in honokiol-induced cell death through the p53-mediated signaling pathway. • Honokiol induces ROS-mediated autophagic cell death via the p53/PI3K/Akt/mTOR mechanism.« less

  14. p53 inactivation decreases dependence on estrogen/ERK signalling for proliferation but promotes EMT and susceptility to 3-bromopyruvate in ERα+ breast cancer MCF-7 cells.

    PubMed

    Rieber, Manuel; Strasberg-Rieber, Mary

    2014-03-15

    Most breast cancers express the estrogen receptor alpha (ERα(+)), harbor wt TP53, depend on estrogen/ERK signalling for proliferation, and respond to anti-estrogens. However, concomittant activation of the epidermal growth factor receptor (EGFR)/MEK pathway promotes resistance by decreasing estrogen dependence. Previously, we showed that retroviral transduction of mutant p53 R175H into wt TP53 ERα(+) MCF-7 cells induces epidermal growth factor (EGF)-independent proliferation, activation of the EGF receptor (p-EGFR) and some characteristics of epithelial-mesenchymal transition (EMT). To investigate whether p53 inactivation augments ERα(+) cell proliferation in response to restrictive estradiol, chemical MEK inhibition or metabolic inhibitors. Introduction of mutant p53 R175H lowered expression of p53-dependent PUMA and p21WAF1, decreased E-cadherin and cytokeratin 18 associated with EMT, but increased the % of proliferating ERα(+)/Ki67 cells, diminishing estrogen dependence. These cells also exhibited higher proliferation in the presence of MEK-inhibitor UO126, reciprocally correlating with preferential susceptibility to the pyruvate analog 3-bromopyruvate (3-BrPA) without a comparable response to 2-deoxyglucose. p53 siRNA silencing by electroporation in wt TP53 MCF-7 cells also decreased estrogen dependence and response to MEK inhibition, while also conferring susceptibility to 3-BrPA. (a) ERα(+) breast cancer cells dysfunctional for TP53 which proliferate irrespective of low estrogen and chemical MEK inhibition are likely to increase metabolic consumption becoming increasingly susceptible to 3-BrPA; (b) targeting the pyruvate pathway may improve response to endocrine therapy in ERα(+) breast cancer with p53 dysfunction. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  15. The p53-p21WAF1 checkpoint pathway plays a protective role in preventing DNA rereplication induced by abrogation of FOXF1 function

    PubMed Central

    Lo, Pang-Kuo; Lee, Ji Shin; Sukumar, Saraswati

    2011-01-01

    We previously identified FOXF1 as a potential tumor suppressor gene with an essential role in preventing DNA rereplication to maintain genomic stability, which is frequently inactivated in breast cancer through the epigenetic mechanism. Here we further addressed the role of the p53-p21WAF1 checkpoint pathway in DNA rereplication induced by silencing of FOXF1. Knockdown of FOXF1 by small interference RNA (siRNA) rendered colorectal p53-null and p21WAF1-null HCT116 cancer cells more susceptible to rereplication and apoptosis than the wild-type parental cells. In parental HCT116 cells with a functional p53 checkpoint, the p53-p21WAF1 checkpoint pathway was activated upon FOXF1 knockdown, which was concurrent with suppression of the CDK2-Rb cascade and induction of G1 arrest. In contrast, these events were not observed in FOXF1-depleted HCT116-p53−/− and HCT116-p21−/− cells, indicating the p53-dependent checkpoint function is vital for inhibiting CDK2 to induce G1 arrest and protect cells from rereplication. The pharmacologic inhibitor (caffeine) of Ataxia telangiectasia mutated (ATM) and ataxia telangiectasia and Rad3 related (ATR) protein kinases abolished activation of the p53-p21WAF1 pathway upon FOXF1 knockdown, suggesting that suppression of FOXF1 function triggered the ATM/ATR-mediated DNA damage response. Cosilencing of p53 by siRNA synergistically enhanced the effect of FOXF1 depletion on stimulation of DNA rereplication and apoptosis in wild-type HCT116. Finally, we show that FOXF1 expression is predominantly silenced in breast and colorectal cancer cell lines with inactive p53. Our study demonstrated that the p53-p21WAF1 checkpoint pathway is an intrinsically protective mechanism to prevent DNA rereplication induced by silencing of FOXF1. PMID:21964066

  16. Adenovirus Type 5 Early Region 1B 55K Oncoprotein-Dependent Degradation of Cellular Factor Daxx Is Required for Efficient Transformation of Primary Rodent Cells▿

    PubMed Central

    Schreiner, Sabrina; Wimmer, Peter; Groitl, Peter; Chen, Shuen-Yuan; Blanchette, Paola; Branton, Philip E.; Dobner, Thomas

    2011-01-01

    Early region 1B 55K (E1B-55K) from adenovirus type 5 (Ad5) is a multifunctional regulator of lytic infection and contributes in vitro to complete cell transformation of primary rodent cells in combination with Ad5 E1A. Inhibition of p53 activated transcription plays a key role in processes by which E1B-55K executes its oncogenic potential. Nevertheless, additional functions of E1B-55K or further protein interactions with cellular factors of DNA repair, transcription, and apoptosis, including Mre11, PML, and Daxx, may also contribute to the transformation process. In line with previous results, we performed mutational analysis to define a Daxx interaction motif within the E1B-55K polypeptide. The results from these studies showed that E1B-55K/Daxx binding is not required for inhibition of p53-mediated transactivation or binding and degradation of cellular factors (p53/Mre11). Surprisingly, these mutants lost the ability to degrade Daxx and showed reduced transforming potential in primary rodent cells. In addition, we observed that E1B-55K lacking the SUMO-1 conjugation site (SCS/K104R) was sufficient for Daxx interaction but no longer capable of E1B-55K-dependent proteasomal degradation of the cellular factor Daxx. These results, together with the observation that E1B-55K SUMOylation is required for efficient transformation, provides evidence for the idea that SUMO-1-conjugated E1B-55K-mediated degradation of Daxx plays a key role in adenoviral oncogenic transformation. We assume that the viral protein contributes to cell transformation through the modulation of Daxx-dependent pathways. This further substantiates the assumption that further mechanisms for efficient transformation of primary cells can be separated from functions required for the inhibition of p53-stimulated transcription. PMID:21697482

  17. Crosstalk between mitochondrial stress signals regulates yeast chronological lifespan.

    PubMed

    Schroeder, Elizabeth A; Shadel, Gerald S

    2014-01-01

    Mitochondrial DNA (mtDNA) exists in multiple copies per cell and is essential for oxidative phosphorylation. Depleted or mutated mtDNA promotes numerous human diseases and may contribute to aging. Reduced TORC1 signaling in the budding yeast, Saccharomyces cerevisiae, extends chronological lifespan (CLS) in part by generating a mitochondrial ROS (mtROS) signal that epigenetically alters nuclear gene expression. To address the potential requirement for mtDNA maintenance in this response, we analyzed strains lacking the mitochondrial base-excision repair enzyme Ntg1p. Extension of CLS by mtROS signaling and reduced TORC1 activity, but not caloric restriction, was abrogated in ntg1Δ strains that exhibited mtDNA depletion without defects in respiration. The DNA damage response (DDR) kinase Rad53p, which transduces pro-longevity mtROS signals, is also activated in ntg1Δ strains. Restoring mtDNA copy number alleviated Rad53p activation and re-established CLS extension following mtROS signaling, indicating that Rad53p senses mtDNA depletion directly. Finally, DDR kinases regulate nucleus-mitochondria localization dynamics of Ntg1p. From these results, we conclude that the DDR pathway senses and may regulate Ntg1p-dependent mtDNA stability. Furthermore, Rad53p senses multiple mitochondrial stresses in a hierarchical manner to elicit specific physiological outcomes, exemplified by mtDNA depletion overriding the ability of Rad53p to transduce an adaptive mtROS longevity signal. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  18. hCLCA2 is a p53-inducible inhibitor of breast cancer cell proliferation

    PubMed Central

    Walia, Vijay; Ding, Ming; Kumar, Sumit; Nie, Daotai; Premkumar, Louis; Elble, Randolph C.

    2009-01-01

    hCLCA2 is frequently downregulated in breast cancer and is a candidate tumor suppressor gene. We show here that the hCLCA2 gene is strongly induced by p53 in response to DNA damage. Adenoviral expression of p53 induces hCLCA2 in a variety of breast cell lines. Further, we find that p53 binds to consensus elements in the hCLCA2 promoter and mutation of these sites abolishes p53-responsiveness and induction by DNA damage. Adenoviral transduction of hCLCA2 into immortalized cells induces p53, CDK inhibitors p21 and p27, and cell cycle arrest by 24 hours, and caspase induction and apoptosis by 40 hours post-infection. Transduction of the malignant tumor cell line BT549 on the other hand does not induce p53, p21, or p27 but instead induces apoptosis directly and more rapidly. Knockout and knockdown studies indicate that growth inhibition and apoptosis are signaled via multiple pathways. Conversely, suppression of hCLCA2 by RNA interference enhances proliferation of MCF10A and reduces sensitivity to doxorubicin. Gene expression profiles indicate that hCLCA2 levels are strongly predictive of tumor cell sensitivity to doxorubicin and other chemotherapeutics. Because certain Cl- channels are proposed to promote apoptosis by reducing intracellular pH, we tested whether, and established that, hCLCA2 enhances Cl- current in breast cancer cells and reduces pH to ∼6.7. These results reveal hCLCA2 as a novel p53-inducible growth inhibitor, explain how its downregulation confers a survival advantage to tumor cells, and suggest both prognostic and therapeutic applications. PMID:19654313

  19. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    PubMed

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  20. Cell cycle regulation and apoptosis mediated by p53 in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei.

    PubMed

    Nuñez-Hernandez, Dahlia M; Felix-Portillo, Monserrath; Peregrino-Uriarte, Alma B; Yepiz-Plascencia, Gloria

    2018-01-01

    Although hypoxic aquatic environments cause negative effects on shrimp, these animals can withstand somewhat hypoxia, but the cellular mechanisms underlying this capacity are still poorly understood. In humans, mild hypoxia causes the induction of many proteins to allow cell survival. In contrast, apoptosis is induced during severe hypoxia leading to cell death. p53 is a key transcription factor that determines cells fate towards cell cycle arrest or induction of apoptosis in humans. The aim of this work was to study the role of p53 in cell cycle regulation and apoptosis in response to hypoxia in hepatopancreas of the white shrimp Litopenaeus vannamei. p53 was silenced by RNAi and afterwards the shrimp were exposed to hypoxia. Cdk-2 was used as indicator of cell cycle progression while caspase-3 expression and caspase activity were analyzed as indicators of apoptosis. p53 levels in hepatopancreas were significantly higher at 48 h after hypoxic treatment. Increased expression levels of Cdk-2 were found in p53-silenced shrimp after 24 and 48 h in the normoxic treatments as well as 48 h after hypoxia, indicating a possible role of p53 in cell cycle regulation. In response to hypoxia, unsilenced shrimp showed an increase in caspase-3 expression levels, however an increase was also observed in caspase activity at 24 h of normoxic conditions in p53-silenced shrimps. Taken together these results indicate the involvement of p53 in regulation of cell cycle and apoptosis in the white shrimp in response to hypoxia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Wild-type p53 reactivation by small-molecule Minnelide™ in human papillomavirus (HPV)-positive head and neck squamous cell carcinoma.

    PubMed

    Caicedo-Granados, Emiro; Lin, Rui; Fujisawa, Caitlin; Yueh, Bevan; Sangwan, Veena; Saluja, Ashok

    2014-12-01

    The incidence of high-risk human papillomavirus (HR-HPV) head and neck squamous cell carcinoma (HNSCC) continues to increase, particularly oropharyngeal squamous cell carcinoma (OPSCC) cases. The inactivation of the p53 tumor suppressor gene promotes a chain of molecular events, including cell cycle progression and apoptosis resistance. Reactivation of wild-type p53 function is an intriguing therapeutic strategy. The aim of this study was to investigate whether a novel compound derived from diterpene triepoxide (Minnelide™) can reactivate wild-type p53 function in HPV-positive HNSCC. For all of our in vitro experiments, we used 2 HPV-positive HNSCC cell lines, University of Michigan squamous cell carcinoma (UM-SCC) 47 and 93-VU-147, and 2 HPV-positive human cervical cancer cell lines, SiHa and CaSki. Cells were treated with different concentrations of triptolide and analyzed for p53 activation. Mice bearing UM-SCC 47 subcutaneous xenografts and HPV-positive patient-derived tumor xenografts were treated with Minnelide and evaluated for tumor growth and p53 activation. In HPV-positive HNSCC, Minnelide reactivated p53 by suppressing E6 oncoprotein. Activation of apoptosis followed, both in vitro and in vivo. In 2 preclinical HNSCC animal models (a subcutaneous xenograft model and a patient-derived tumor xenograft model), Minnelide reactivated p53 function and significantly decreased tumor progression and tumor volume. Triptolide and Minnelide caused cell death in vitro and in vivo in HPV-positive HNSCC by reactivating wild-type p53 and thus inducing apoptosis. In addition, in 2 HPV-positive HNSCC animal models, Minnelide decreased tumor progression and induced apoptosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. A tryptophanol-derived oxazolopiperidone lactam is cytotoxic against tumors via inhibition of p53 interaction with murine double minute proteins.

    PubMed

    Soares, Joana; Raimundo, Liliana; Pereira, Nuno A L; dos Santos, Daniel J V A; Pérez, Maria; Queiroz, Glória; Leão, Mariana; Santos, Maria M M; Saraiva, Lucília

    2015-01-01

    Inactivation of the p53 tumor suppressor protein by interaction with murine double minute (MDM) proteins, MDM2 and MDMX, is a common event in human tumors expressing wild-type p53. In these tumors, the simultaneous inhibition of these interactions with MDMs, for a full p53 reactivation, represents a promising anticancer strategy. Herein, we report the identification of a dual inhibitor of the p53 interaction with MDM2 and MDMX, the (S)-tryptophanol derivative OXAZ-1, from the screening of a small library of enantiopure tryptophanol-derived oxazolopiperidone lactams, using a yeast-based assay. With human colon adenocarcinoma HCT116 cell lines expressing wild-type p53 (HCT116 p53(+/+)) and its p53-null isogenic derivative (HCT116 p53(-/-)), it was shown that OXAZ-1 induced a p53-dependent tumor growth-inhibitory effect. In fact, OXAZ-1 induced p53 stabilization, up-regulated p53 transcription targets, such as MDM2, MDMX, p21, Puma and Bax, and led to PARP cleavage, in p53(+/+), but not in p53(-/-), HCT116 cells. In addition, similar tumor cytotoxic effects were observed for OXAZ-1 against MDMX-overexpressing breast adenocarcinoma MCF-7 tumor cells, commonly described as highly resistant to MDM2-only inhibitors. In HCT116 p53(+/+) cells, the disruption of the p53 interaction with MDMs by OXAZ-1 was further confirmed by co-immunoprecipitation. It was also shown that OXAZ-1 potently triggered a p53-dependent mitochondria-mediated apoptosis, characterized by reactive oxygen species generation, mitochondrial membrane potential dissipation, Bax translocation to mitochondria, and cytochrome c release, and exhibited a p53-dependent synergistic effect with conventional chemotherapeutic drugs. Collectively, in this work, a novel selective activator of the p53 pathway is reported with promising antitumor properties to be explored either alone or combined with conventional chemotherapeutic drugs. Moreover, OXAZ-1 may represent a promising starting scaffold to search for new dual inhibitors of the p53-MDMs interaction. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Depletion of pro-oncogenic RUNX2 enhances gemcitabine (GEM) sensitivity of p53-mutated pancreatic cancer Panc-1 cells through the induction of pro-apoptotic TAp63.

    PubMed

    Ozaki, Toshinori; Nakamura, Mizuyo; Ogata, Takehiro; Sang, Meijie; Yoda, Hiroyuki; Hiraoka, Kiriko; Sang, Meixiang; Shimozato, Osamu

    2016-11-01

    Recently, we have described that siRNA-mediated silencing of runt-related transcription factor 2 (RUNX2) improves anti-cancer drug gemcitabine (GEM) sensitivity of p53-deficient human pancreatic cancer AsPC-1 cells through the augmentation of p53 family TAp63-dependent cell death pathway. In this manuscript, we have extended our study to p53-mutated human pancreatic cancer Panc-1 cells. According to our present results, knockdown of mutant p53 alone had a marginal effect on GEM-mediated cell death of Panc-1 cells. We then sought to deplete RUNX2 using siRNA in Panc-1 cells and examined its effect on GEM sensitivity. Under our experimental conditions, RUNX2 knockdown caused a significant enhancement of GEM sensitivity of Panc-1 cells. Notably, GEM-mediated induction of TAp63 but not of TAp73 was further stimulated in RUNX2-depleted Panc-1 cells, indicating that, like AsPC-1 cells, TAp63 might play a pivotal role in the regulation of GEM sensitivity of Panc-1 cells. Consistent with this notion, forced expression of TAp63α in Panc-1 cells promoted cell cycle arrest and/or cell death, and massively increased luciferase activities driven by TAp63-target gene promoters such as p21WAF1 and NOXA. In addition, immunoprecipitation experiments indicated that RUNX2 forms a complex with TAp63 in Panc-1 cells. Taken together, our current observations strongly suggest that depletion of RUNX2 enhances the cytotoxic effect of GEM on p53-mutated Panc-1 cells through the stimulation of TAp63-dependent cell death pathway even in the presence of a large amount of pro-oncogenic mutant p53, and might provide an attractive strategy to treat pancreatic cancer patients with p53 mutations.

  4. Depletion of pro-oncogenic RUNX2 enhances gemcitabine (GEM) sensitivity of p53-mutated pancreatic cancer Panc-1 cells through the induction of pro-apoptotic TAp63

    PubMed Central

    Ozaki, Toshinori; Nakamura, Mizuyo; Ogata, Takehiro; Sang, Meijie; Yoda, Hiroyuki; Hiraoka, Kiriko; Sang, Meixiang; Shimozato, Osamu

    2016-01-01

    Recently, we have described that siRNA-mediated silencing of runt-related transcription factor 2 (RUNX2) improves anti-cancer drug gemcitabine (GEM) sensitivity of p53-deficient human pancreatic cancer AsPC-1 cells through the augmentation of p53 family TAp63-dependent cell death pathway. In this manuscript, we have extended our study to p53-mutated human pancreatic cancer Panc-1 cells. According to our present results, knockdown of mutant p53 alone had a marginal effect on GEM-mediated cell death of Panc-1 cells. We then sought to deplete RUNX2 using siRNA in Panc-1 cells and examined its effect on GEM sensitivity. Under our experimental conditions, RUNX2 knockdown caused a significant enhancement of GEM sensitivity of Panc-1 cells. Notably, GEM-mediated induction of TAp63 but not of TAp73 was further stimulated in RUNX2-depleted Panc-1 cells, indicating that, like AsPC-1 cells, TAp63 might play a pivotal role in the regulation of GEM sensitivity of Panc-1 cells. Consistent with this notion, forced expression of TAp63α in Panc-1 cells promoted cell cycle arrest and/or cell death, and massively increased luciferase activities driven by TAp63-target gene promoters such as p21WAF1 and NOXA. In addition, immunoprecipitation experiments indicated that RUNX2 forms a complex with TAp63 in Panc-1 cells. Taken together, our current observations strongly suggest that depletion of RUNX2 enhances the cytotoxic effect of GEM on p53-mutated Panc-1 cells through the stimulation of TAp63-dependent cell death pathway even in the presence of a large amount of pro-oncogenic mutant p53, and might provide an attractive strategy to treat pancreatic cancer patients with p53 mutations. PMID:27713122

  5. Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance.

    PubMed

    Walia, Mannu K; Ho, Patricia Mw; Taylor, Scott; Ng, Alvin Jm; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew Cw; Martin, T John; Walkley, Carl R

    2016-04-12

    Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS.

  6. Cytotoxicity of the indole alkaloid reserpine from Rauwolfia serpentina against drug-resistant tumor cells.

    PubMed

    Abdelfatah, Sara A A; Efferth, Thomas

    2015-02-15

    The antihypertensive reserpine is an indole alkaloid from Rauwolfia serpentina and exerts also profound activity against cancer cells in vitro and in vivo. The present investigation was undertaken to investigate possible modes of action to explain its activity toward drug-resistant tumor cells. Sensitive and drug-resistant tumor cell lines overexpressing P-glycoprotein (ABCB1/MDR1), breast cancer resistance protein (ABCG2/BCRP), mutation-activated epidermal growth factor receptor (EGFR), wild-type and p53-knockout cells as well as the NCI panel of cell lines from different tumor origin were analyzed. Reserpine's cytotoxicity was investigated by resazurin and sulforhodamine assays, flow cytometry, and COMPARE and hierarchical cluster analyses of transcriptome-wide microarray-based RNA expressions. P-glycoprotein- or BCRP overexpressing tumor cells did not reveal cross-resistance to reserpine. EGFR-overexpressing cells were collateral sensitive and p53- Knockout cells cross-resistant to this drug compared to their wild-type parental cell lines. Reserpine increased the uptake of doxorubicin in P-glycoprotein-overexpressing cells, indicating that reserpine inhibited the efflux function of P-glycoprotein. Using molecular docking, we found that reserpine bound with even higher binding energy to P-glycoprotein and EGFR than the control drugs verapamil (P-glycoprotein inhibitor) and erlotinib (EGFR inhibitor). COMPARE and cluster analyses of microarray data showed that the mRNA expression of a panel of genes predicted the sensitivity or resistance of the NCI tumor cell line panel with statistical significance. The genes belonged to diverse pathways and biological functions, e.g. cell survival and apoptosis, EGFR activation, regulation of angiogenesis, cell mobility, cell adhesion, immunological functions, mTOR signaling, and Wnt signaling. The lack of cross-resistance to most resistance mechanisms and the collateral sensitivity in EGFR-transfectants compared to wild-type cells speak for a promising role of reserpine in cancer chemotherapy. Reserpine deserves further consideration for cancer therapy in the clinical setting. Copyright © 2015 Elsevier GmbH. All rights reserved.

  7. miR-338-3p confers 5-fluorouracil resistance in p53 mutant colon cancer cells by targeting the mammalian target of rapamycin.

    PubMed

    Han, Jia; Li, Jie; Tang, Kaijie; Zhang, Huahua; Guo, Bo; Hou, Ni; Huang, Chen

    2017-11-15

    Evidence demonstrate that p53 mutations and microRNAs (miRs) are important components of 5-FU resistance in colorectal cancer (CRC). miR-338-3p has been reported associated with cancer prognosis. However whether or not it influences chemotherapy sensitivity and the underlying mechanisms have not been elucidated. Here, three types of human colon cancer cell lines, HT29 (mutant p53), HCT116 (wild-type p53), and HCT116 p53 -/- (deficient p53), were treated with 5-FU. We showed that expression of miR-338-3p was correlated with apoptosis and 5-FU resistance in colon cancer cells. Ectopic expression of miR-338-3p conferred resistance to 5-FU in HCT116 cells. Further experiments indicated that miR-338-3p mediated 5-FU resistance through down-regulation of mTOR expression. Moreover, inhibition of miR-338-3p in HT29 and HCT116 p53 -/- cells increased their sensitivity to 5-FU treatment. Furthermore, we detected autophagy changes in our experiment because mTOR was known prominently regulating autophagy and the competition between autophagy and apoptosis in response to 5-FU was a mechanism influencing 5-FU sensitivity. Our results reveal a critical and novel role of miR-338-3p in the correlation of 5-FU resistance with p53 status. Moreover, the miR-338-3p inhibitor has the potential to overcome 5-FU resistance in p53 mutant colon cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Loss of DDB1 Leads to Transcriptional p53 Pathway Activation in Proliferating Cells, Cell Cycle Deregulation, and Apoptosis in Zebrafish Embryos.

    PubMed

    Hu, Zhilian; Holzschuh, Jochen; Driever, Wolfgang

    2015-01-01

    DNA damage-binding protein 1 (DDB1) is a large subunit of the heterodimeric DDB complex that recognizes DNA lesions and initiates the nucleotide excision repair process. DDB1 is also a component of the CUL4 E3 ligase complex involved in a broad spectrum of cellular processes by targeted ubiquitination of key regulators. Functions of DDB1 in development have been addressed in several model organisms, however, are not fully understood so far. Here we report an ENU induced mutant ddb1 allele (ddb1m863) identified in zebrafish (Danio rerio), and analyze its effects on development. Zebrafish ddb1 is expressed broadly, both maternally and zygotically, with enhanced expression in proliferation zones. The (ddb1m863 mutant allele affects the splice acceptor site of exon 20, causing a splicing defect that results in truncation of the 1140 amino acid protein after residue 800, lacking part of the β-propeller domain BPC and the C-terminal helical domain CTD. ddb1m863 zygotic mutant embryos have a pleiotropic phenotype, including smaller and abnormally shaped brain, head skeleton, eyes, jaw, and branchial arches, as well as reduced dopaminergic neuron groups. However, early forming tissues develop normally in zygotic ddb1m863 mutant embryos, which may be due to maternal rescue. In ddb1m863 mutant embryos, pcna-expressing proliferating cell populations were reduced, concurrent with increased apoptosis. We also observed a concomitant strong up-regulation of transcripts of the tumor suppressor p53 (tp53) and the cell cycle inhibitor cdkn1a (p21a/bCIP1/WAF1) in proliferating tissues. In addition, transcription of cyclin genes ccna2 and ccnd1 was deregulated in ddb1m863 mutants. Reduction of p53 activity by anti-sense morpholinos alleviated the apoptotic phenotype in ddb1m863 mutants. These results imply that Ddb1 may be involved in maintaining proper cell cycle progression and viability of dividing cells during development through transcriptional mechanisms regulating genes involved in cell cycle control and cell survival.

  9. p205, a potential tumor suppressor, inhibits cell proliferation via multiple pathways of cell cycle regulation.

    PubMed

    Asefa, Benyam; Dermott, Jonathan M; Kaldis, Philipp; Stefanisko, Karen; Garfinkel, David J; Keller, Jonathan R

    2006-02-20

    p205 is a member of the interferon-inducible p200 family of proteins that regulate cell proliferation. Over-expression of p205 inhibits cell growth, although its mechanism of action is currently unknown. Therefore, we evaluated the effect of p205 on the p53 and Rb-dependent pathways of cell cycle regulation. p205 expression results in elevated levels of p21, and activates the p21 promoter in vitro in a p53-dependent manner. In addition, p205 induces increased expression of Rb, and binds directly to Rb and p53. Interestingly, p205 also induces growth inhibition independent of p53 and Rb by delaying G2/M progression in proliferating cells, and is a substrate for Cdk2 kinase activity. Finally, we have identified other binding partners of p205 by a yeast two-hybrid screen, including the paired homeodomain protein HoxB2. Taken together, our results indicate that p205 induces growth arrest by interaction with multiple transcription factors that regulate the cell cycle, including but not entirely dependent on the Rb- and p53-mediated pathways of growth inhibition.

  10. WWOX and p53 Dysregulation Synergize to Drive the Development of Osteosarcoma.

    PubMed

    Del Mare, Sara; Husanie, Hussam; Iancu, Ortal; Abu-Odeh, Mohammad; Evangelou, Konstantinos; Lovat, Francesca; Volinia, Stefano; Gordon, Jonathan; Amir, Gail; Stein, Janet; Stein, Gary S; Croce, Carlo M; Gorgoulis, Vassilis; Lian, Jane B; Aqeilan, Rami I

    2016-10-15

    Osteosarcoma is a highly metastatic form of bone cancer in adolescents and young adults that is resistant to existing treatments. Development of an effective therapy has been hindered by very limited understanding of the mechanisms of osteosarcomagenesis. Here, we used genetically engineered mice to investigate the effects of deleting the tumor suppressor Wwox selectively in either osteoblast progenitors or mature osteoblasts. Mice with conditional deletion of Wwox in preosteoblasts (Wwox Δosx1 ) displayed a severe inhibition of osteogenesis accompanied by p53 upregulation, effects that were not observed in mice lacking Wwox in mature osteoblasts. Deletion of p53 in Wwox Δosx1 mice rescued the osteogenic defect. In addition, the Wwox;p53 Δosx1 double knockout mice developed poorly differentiated osteosarcomas that resemble human osteosarcoma in histology, location, metastatic behavior, and gene expression. Strikingly, the development of osteosarcomas in these mice was greatly accelerated compared with mice lacking p53 only. In contrast, combined WWOX and p53 inactivation in mature osteoblasts did not accelerate osteosarcomagenesis compared with p53 inactivation alone. These findings provide evidence that a WWOX-p53 network regulates normal bone formation and that disruption of this network in osteoprogenitors results in accelerated osteosarcoma. The Wwox;p53 Δosx1 double knockout establishes a new osteosarcoma model with significant advancement over existing models. Cancer Res; 76(20); 6107-17. ©2016 AACR. ©2016 American Association for Cancer Research.

  11. Modeling the Etiology of p53-mutated Cancer Cells*

    PubMed Central

    Perez, Ricardo E.; Shen, Hong; Duan, Lei; Kim, Reuben H.; Kim, Terresa; Park, No-Hee; Maki, Carl G.

    2016-01-01

    p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds. PMID:27022024

  12. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  13. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    PubMed

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  14. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    PubMed Central

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  15. New Insights into the Mechanism of Inhibition of p53 by Simian Virus 40 Large T Antigen

    PubMed Central

    Sheppard, Hilary M.; Corneillie, Siska I.; Espiritu, Christine; Gatti, Andrea; Liu, Xuan

    1999-01-01

    Simian virus 40 (SV40) large tumor antigen (T antigen) has been shown to inhibit p53-dependent transcription by preventing p53 from binding to its cognate cis element. Data presented in this report provide the first direct functional evidence that T antigen, under certain conditions, may also repress p53-dependent transcription by a mechanism in which the transactivation domain of p53 is abrogated while DNA binding is unaffected. Specifically, p53 purified as a complex with T antigen from mouse cells was found to bind DNA as a transcriptionally inactive intact complex, while that purified from human cells was found to bind DNA independently of T antigen and could activate p53-dependent transcription. This difference in activity may be dependent on a different interaction of T antigen with mouse and human p53 and, in addition, on the presence of super T, which is found only in transformed rodent cells. These results suggest that subtle yet important differences exist between the inhibition of p53 by T antigen in mouse and human cells. The implications of this finding with respect to SV40-associated malignancies are discussed. PMID:10082540

  16. Novel MDM2 inhibitor SAR405838 (MI-773) induces p53-mediated apoptosis in neuroblastoma

    PubMed Central

    Lu, Jiaxiong; Guan, Shan; Zhao, Yanling; Yu, Yang; Wang, Yongfeng; Shi, Yonghua; Mao, Xinfang; Yang, Kristine L.; Sun, Wenjing; Xu, Xin; Yi, Joanna S.; Yang, Tianshu; Yang, Jianhua; Nuchtern, Jed G.

    2016-01-01

    Neuroblastoma (NB), which accounts for about 15% of cancer-related mortality in children, is the most common childhood extracranial malignant tumor. In NB, somatic mutations of the tumor suppressor, p53, are exceedingly rare. Unlike in adult tumors, the majority of p53 downstream functions are still intact in NB cells with wild-type p53. Thus, restoring p53 function by blocking its interaction with p53 suppressors such as MDM2 is a viable therapeutic strategy for NB treatment. Herein, we show that MDM2 inhibitor SAR405838 is a potent therapeutic drug for NB. SAR405838 caused significantly decreased cell viability of p53 wild-type NB cells and induced p53-mediated apoptosis, as well as augmenting the cytotoxic effects of doxorubicin (Dox). In an in vivo orthotopic NB mouse model, SAR405838 induced apoptosis in NB tumor cells. In summary, our data strongly suggest that MDM2-specific inhibitors like SAR405838 may serve not only as a stand-alone therapy, but also as an effective adjunct to current chemotherapeutic regimens for treating NB with an intact MDM2-p53 axis. PMID:27764791

  17. Dual targeting of wild-type and mutant p53 by small molecule RITA results in the inhibition of N-Myc and key survival oncogenes and kills neuroblastoma cells in vivo and in vitro.

    PubMed

    Burmakin, Mikhail; Shi, Yao; Hedström, Elisabeth; Kogner, Per; Selivanova, Galina

    2013-09-15

    Restoration of the p53 function in tumors is a promising therapeutic strategy due to the high potential of p53 as tumor suppressor and the fact that established tumors depend on p53 inactivation for their survival. Here, we addressed the question whether small molecule RITA can reactivate p53 in neuroblastoma and suppress the growth of neuroblastoma cells in vitro and in vivo. The ability of RITA to inhibit growth and to induce apoptosis was shown in seven neuroblastoma cell lines. Mechanistic studies were carried out to determine the p53 dependence and the molecular mechanism of RITA-induced apoptosis in neuroblastoma, using cell viability assays, RNAi silencing, co-immunoprecipitation, qPCR, and Western blotting analysis. In vivo experiments were conducted to study the effect of RITA on human neuroblastoma xenografts in mice. RITA induced p53-dependent apoptosis in a set of seven neuroblastoma cell lines, carrying wild-type or mutant p53; it activated p53 and triggered the expression of proapoptotic p53 target genes. Importantly, p53 activated by RITA inhibited several key oncogenes that are high-priority targets for pharmacologic anticancer strategies in neuroblastoma, including N-Myc, Aurora kinase, Mcl-1, Bcl-2, Wip-1, MDM2, and MDMX. Moreover, RITA had a strong antitumor effect in vivo. Reactivation of wild-type and mutant p53 resulting in the induction of proapoptotic factors along with ablation of key oncogenes by compounds such as RITA may be a highly effective strategy to treat neuroblastoma. ©2013 AACR.

  18. Rad53 regulates replication fork restart after DNA damage in Saccharomyces cerevisiae

    PubMed Central

    Szyjka, Shawn J.; Aparicio, Jennifer G.; Viggiani, Christopher J.; Knott, Simon; Xu, Weihong; Tavaré, Simon; Aparicio, Oscar M.

    2008-01-01

    Replication fork stalling at a DNA lesion generates a damage signal that activates the Rad53 kinase, which plays a vital role in survival by stabilizing stalled replication forks. However, evidence that Rad53 directly modulates the activity of replication forks has been lacking, and the nature of fork stabilization has remained unclear. Recently, cells lacking the Psy2–Pph3 phosphatase were shown to be defective in dephosphorylation of Rad53 as well as replication fork restart after DNA damage, suggesting a mechanistic link between Rad53 deactivation and fork restart. To test this possibility we examined the progression of replication forks in methyl-methanesulfonate (MMS)-damaged cells, under different conditions of Rad53 activity. Hyperactivity of Rad53 in pph3Δ cells slows fork progression in MMS, whereas deactivation of Rad53, through expression of dominant-negative Rad53-KD, is sufficient to allow fork restart during recovery. Furthermore, combined deletion of PPH3 and PTC2, a second, unrelated Rad53 phosphatase, results in complete replication fork arrest and lethality in MMS, demonstrating that Rad53 deactivation is a key mechanism controlling fork restart. We propose a model for regulation of replication fork progression through damaged DNA involving a cycle of Rad53 activation and deactivation that coordinates replication restart with DNA repair. PMID:18628397

  19. Quercetin Enhances the Antitumor Activity of Trichostatin A through Upregulation of p53 Protein Expression In Vitro and In Vivo

    PubMed Central

    Chan, Shu-Ting; Yang, Nae-Cherng; Huang, Chin-Shiu; Liao, Jiunn-Wang; Yeh, Shu-Lan

    2013-01-01

    This study investigated the effects of quercetin on the anti-tumor effect of trichostatin A (TSA), a novel anticancer drug, in vitro and in vivo and the possible mechanisms of these effects in human lung cancer cells. We first showed that quercetin (5 µM) significantly increased the growth arrest and apoptosis in A549 cells (expressing wild-type p53) induced by 25 ng/mL of (82.5 nM) TSA at 48 h by about 25% and 101%, respectively. However, such enhancing effects of quercetin (5 µM) were not significant in TSA-exposed H1299 cells (a p53 null mutant) or were much lower than in A549 cells. In addition, quercetin significantly increased TSA-induced p53 expression in A549 cells. Transfection of p53 siRNA into A549 cells significantly but not completely diminished the enhancing effects of quercetin on TSA-induced apoptosis. Furthermore, we demonstrated that quercetin enhanced TSA-induced apoptosis through the mitochondrial pathway. Transfection of p53 siRNA abolished such enhancing effects of quercetin. However, quercetin increased the acetylation of histones H3 and H4 induced by TSA in A549 cells, even with p53 siRNA transfection as well as in H1299 cells. In a xenograft mouse model of lung cancer, quercetin enhanced the antitumor effect of TSA. Tumors from mice treated with TSA in combination with quercetin had higher p53 and apoptosis levels than did those from control and TSA-treated mice. These data indicate that regulation of the expression of p53 by quercetin plays an important role in enhancing TSA-induced apoptosis in A549 cells. However, p53-independent mechanisms may also contribute to the enhancing effect of quercetin. PMID:23342112

  20. Histone deacetylase inhibitors prevent p53-dependent and p53-independent Bax-mediated neuronal apoptosis through two distinct mechanisms.

    PubMed

    Uo, Takuma; Veenstra, Timothy D; Morrison, Richard S

    2009-03-04

    Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and p53-independent intrinsic apoptotic programs require the proapoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing postmitochondrial events including cleavage of caspase-9 and caspase-3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions.

  1. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    PubMed

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  2. Phosphorylation of Tip60 by GSK-3 determines the induction of PUMA and apoptosis by p53

    PubMed Central

    Charvet, Céline; Wissler, Manuela; Brauns-Schubert, Prisca; Wang, Shang-Jui; Tang, Yi; Sigloch, Florian C.; Mellert, Hestia; Brandenburg, Martin; Lindner, Silke E.; Breit, Bernhard; Green, Douglas R.; McMahon, Steven B.; Borner, Christoph; Gu, Wei; Maurer, Ulrich

    2011-01-01

    Summary Activation of p53 by DNA damage results in either cell cycle arrest, allowing DNA repair and cell survival, or induction of apoptosis. As these opposite outcomes are both mediated by p53 stabilization, additional mechanisms to determine this decision must exist. Here we show that glycogen synthase kinase-3 (GSK-3) is required for the p53-mediated induction of the pro-apoptotic BH3 only-protein PUMA, an essential mediator of p53-induced apoptosis. Inhibition of GSK-3 protected from cell death induced by DNA damage and promoted increased long-term cell survival. We demonstrate that GSK-3 phosphorylates serine 86 of the p53-acetyltransferase Tip60. A Tip60S86A mutant was less active to induce p53 K120 acetylation, Histone 4 acetylation and expression of PUMA. Our data suggest that GSK-3 mediated Tip60S86-phosphorylation provides a link between PI3K signaling and the choice for or against apoptosis induction by p53. PMID:21658600

  3. E2 Proteins from High- and Low-Risk Human Papillomavirus Types Differ in Their Ability To Bind p53 and Induce Apoptotic Cell Death

    PubMed Central

    Parish, Joanna L.; Kowalczyk, Anna; Chen, Hsin-Tien; Roeder, Geraldine E.; Sessions, Richard; Buckle, Malcolm; Gaston, Kevin

    2006-01-01

    The E2 proteins from oncogenic (high-risk) human papillomaviruses (HPVs) can induce apoptotic cell death in both HPV-transformed and non-HPV-transformed cells. Here we show that the E2 proteins from HPV type 6 (HPV6) and HPV11, two nononcogenic (low-risk) HPV types, fail to induce apoptosis. Unlike the high-risk HPV16 E2 protein, these low-risk E2 proteins fail to bind p53 and fail to induce p53-dependent transcription activation. Interestingly, neither the ability of p53 to activate transcription nor the ability of p53 to bind DNA, are required for HPV16 E2-induced apoptosis in non-HPV-transformed cells. However, mutations that reduce the binding of the HPV16 E2 protein to p53 inhibit E2-induced apoptosis in non-HPV-transformed cells. In contrast, the interaction between HPV16 E2 and p53 is not required for this E2 protein to induce apoptosis in HPV-transformed cells. Thus, our data suggest that this high-risk HPV E2 protein induces apoptosis via two pathways. One pathway involves the binding of E2 to p53 and can operate in both HPV-transformed and non-HPV-transformed cells. The second pathway requires the binding of E2 to the viral genome and can only operate in HPV-transformed cells. PMID:16611918

  4. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  5. Endothelial cell senescence with aging in healthy humans: prevention by habitual exercise and relation to vascular endothelial function.

    PubMed

    Rossman, Matthew J; Kaplon, Rachelle E; Hill, Sierra D; McNamara, Molly N; Santos-Parker, Jessica R; Pierce, Gary L; Seals, Douglas R; Donato, Anthony J

    2017-11-01

    Cellular senescence is emerging as a key mechanism of age-related vascular endothelial dysfunction, but evidence in healthy humans is lacking. Moreover, the influence of lifestyle factors such as habitual exercise on endothelial cell (EC) senescence is unknown. We tested the hypothesis that EC senescence increases with sedentary, but not physically active, aging and is associated with vascular endothelial dysfunction. Protein expression (quantitative immunofluorescence) of p53, a transcription factor related to increased cellular senescence, and the cyclin-dependent kinase inhibitors p21 and p16 were 116%, 119%, and 128% greater (all P < 0.05), respectively, in ECs obtained from antecubital veins of older sedentary (60 ± 1 yr, n = 12) versus young sedentary (22 ± 1 yr, n = 9) adults. These age-related differences were not present (all P > 0.05) in venous ECs from older exercising adults (57 ± 1 yr, n = 13). Furthermore, venous EC protein levels of p53 ( r  = -0.49, P = 0.003), p21 ( r  = -0.38, P = 0.03), and p16 ( r  = -0.58, P = 0.002) were inversely associated with vascular endothelial function (brachial artery flow-mediated dilation). Similarly, protein expression of p53 and p21 was 26% and 23% higher (both P < 0.05), respectively, in ECs sampled from brachial arteries of healthy older sedentary (63 ± 1 yr, n = 18) versus young sedentary (25 ± 1 yr, n = 9) adults; age-related changes in arterial EC p53 and p21 expression were not observed ( P > 0.05) in older habitually exercising adults (59 ± 1 yr, n = 14). These data indicate that EC senescence is associated with sedentary aging and is linked to endothelial dysfunction. Moreover, these data suggest that prevention of EC senescence may be one mechanism by which aerobic exercise protects against endothelial dysfunction with age. NEW & NOTEWORTHY Our study provides novel evidence in humans of increased endothelial cell senescence with sedentary aging, which is associated with impaired vascular endothelial function. Furthermore, our data suggest an absence of age-related increases in endothelial cell senescence in older exercising adults, which is linked with preserved vascular endothelial function. Copyright © 2017 the American Physiological Society.

  6. EBNA3C regulates p53 through induction of Aurora kinase B

    PubMed Central

    Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.

    2015-01-01

    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

  7. SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

    2014-06-15

    Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutatedmore » (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.« less

  8. COH-203, a novel microtubule inhibitor, exhibits potent anti-tumor activity via p53-dependent senescence in hepatocellular carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qi, Huan; Zuo, Dai-Ying; Bai, Zhao-Shi

    Highlights: • COH-203 exhibits anti-hepatoma effects in vitro and in vivo with low toxicity. • COH-203 inhibits tubulin polymerization. • COH-203 induces mitotic arrest followed by mitotic slippage in BEL-7402 cells. • COH-203 induces p53-dependent senescence in BEL-7402 cells. - Abstract: 5-(3-Hydroxy-4-methoxyphenyl)-4-(3,4,5-trimethoxyphenyl)-3H-1, 2-dithiol-3-one (COH-203) is a novel synthesized analogue of combretastatin A-4 that can be classified as a microtubule inhibitor. In this study, we evaluated the anti-hepatoma effect of COH-203 in vitro and in vivo and explored the underlying molecular mechanisms. COH-203 was shown to be more effective in inhibiting the proliferation of liver cancer cells compared with normal livermore » cells. COH-203 also displayed potent anti-tumor activity in a hepatocellular carcinoma xenograft model without significant toxicity. Mechanistic studies demonstrated that treatment with COH-203 induced mitotic arrest by inhibiting tubulin polymerization in BEL-7402 liver cancer cells. Long-term COH-203 treatment in BEL-7402 cells led to mitotic slippage followed by senescence via the p14{sup Arf}–p53–p21 and p16{sup INK4α}–Rb pathways. Furthermore, suppression of p53 via pifithrin-α (p53 inhibitor) and p53-siRNA attenuated COH-203-induced senescence in BEL-7402 cells, suggesting that COH-203 induced senescence p53-dependently. In conclusion, we report for the first time that COH-203, one compound in the combretastatin family, promotes anti-proliferative activity through the induction of p-53 dependent senescence. Our findings will provide a molecular rationale for the development of COH-203 as a promising anti-tumor agent.« less

  9. Mule determines the apoptotic response to HDAC inhibitors by targeted ubiquitination and destruction of HDAC2.

    PubMed

    Zhang, Jing; Kan, Shu; Huang, Brian; Hao, Zhenyue; Mak, Tak W; Zhong, Qing

    2011-12-15

    Histone deacetylases (HDACs) are major epigenetic modulators involved in a broad spectrum of human diseases including cancers. Administration of HDAC inhibitors (HDACis) leads to growth inhibition, differentiation, and apoptosis of cancer cells. Understanding the regulatory mechanism of HDACs is imperative to harness the therapeutic potentials of HDACis. Here we show that HDACi- and DNA damage-induced apoptosis are severely compromised in mouse embryonic fibroblasts lacking a HECT domain ubiquitin ligase, Mule (Mcl-1 ubiquitin ligase E3). Mule specifically targets HDAC2 for ubiquitination and degradation. Accumulation of HDAC2 in Mule-deficient cells leads to compromised p53 acetylation as well as crippled p53 transcriptional activation, accumulation, and apoptotic response upon DNA damage and Nutlin-3 treatments. These defects in Mule-null cells can be partially reversed by HDACis and fully rescued by lowering the elevated HDAC2 in Mule-null cells to the normal levels as in wild-type cells. Taken together, our results reveal a critical regulatory mechanism of HDAC2 by Mule and suggest this pathway determines the cellular response to HDACis and DNA damage. © 2011 by Cold Spring Harbor Laboratory Press

  10. Phase I dendritic cell p53 peptide vaccine for head and neck cancer.

    PubMed

    Schuler, Patrick J; Harasymczuk, Malgorzata; Visus, Carmen; Deleo, Albert; Trivedi, Sumita; Lei, Yu; Argiris, Athanassios; Gooding, William; Butterfield, Lisa H; Whiteside, Theresa L; Ferris, Robert L

    2014-05-01

    p53 accumulation in head and neck squamous cell carcinoma (HNSCC) cells creates a targetable tumor antigen. Adjuvant dendritic cell (DC)-based vaccination against p53 was tested in a phase I clinical trial. Monocyte-derived DC from 16 patients were loaded with two modified HLA-class I p53 peptides (Arm 1), additional Th tetanus toxoid peptide (Arm 2), or additional Th wild-type (wt) p53-specific peptide (Arm 3). Vaccine DCs (vDC) were delivered to inguinal lymph nodes at three time points. vDC phenotype, circulating p53-specific T cells, and regulatory T cells (Treg) were serially monitored by flow cytometry and cytokine production by Luminex. vDC properties were compared with those of DC1 generated with an alternative maturation regimen. No grade II-IV adverse events were observed. Two-year disease-free survival of 88% was favorable. p53-specific T-cell frequencies were increased postvaccination in 11 of 16 patients (69%), with IFN-γ secretion detected in four of 16 patients. Treg frequencies were consistently decreased (P = 0.006) relative to prevaccination values. The phenotype and function of DC1 were improved relative to vDC. Adjuvant p53-specific vaccination of patients with HNSCC was safe and associated with promising clinical outcome, decreased Treg levels, and modest vaccine-specific immunity. HNSCC patients' DC required stronger maturation stimuli to reverse immune suppression and improve vaccine efficacy. ©2014 AACR.

  11. Anticancer Activity of Marine Sponge Hyrtios sp. Extract in Human Colorectal Carcinoma RKO Cells with Different p53 Status

    PubMed Central

    Lim, Hyun Kyung; Bae, Woori; Lee, Hyi-Seung

    2014-01-01

    Drug development using marine bioresources is limited even though the ocean occupies about 70% of the earth and contains a large number of biological materials. From the screening test of the marine sponge extracts, we found Hyrtios sp. sponge collected from Chuuk island, Micronesia. In this study, the Hyrtios sp. extract was examined for anticancer activity against human colorectal carcinoma RKO cells that are wildtype for p53 and RKO-E6 that are p53 defective. The Hyrtios sp. extract dose-dependently inhibited viability in both cell lines. Multinucleation as an indication of mitotic catastrophe was also observed. Cytotoxicity tests gave significantly different results for RKO and RKO-E6 cells after 48 h exposure to Hyrtios sp. extract. In RKO cells treated with Hyrtios sp. extract, cell death occurred by induction of p53 and p21 proteins. In p53-defective RKO-E6 cells, Hyrtios sp. extract decreased expression of JNK protein and increased p21 protein. These results indicate that Hyrtios sp. extract induced apoptosis via different pathways depending on p53 status and could be a good natural product for developing new anticancer drugs. PMID:25243139

  12. Wilms tumor gene 1 (WT1), TP53, RAS/BRAF and KIT aberrations in testicular germ cell tumors.

    PubMed

    Boublikova, L; Bakardjieva-Mihaylova, V; Skvarova Kramarzova, K; Kuzilkova, D; Dobiasova, A; Fiser, K; Stuchly, J; Kotrova, M; Buchler, T; Dusek, P; Grega, M; Rosova, B; Vernerova, Z; Klezl, P; Pesl, M; Zachoval, R; Krolupper, M; Kubecova, M; Stahalova, V; Abrahamova, J; Babjuk, M; Kodet, R; Trka, J

    2016-07-01

    Wilms tumor gene 1 (WT1), a zinc-finger transcription factor essential for testis development and function, along with other genes, was investigated for their role in the pathogenesis of testicular germ cell tumors (TGCT). In total, 284 TGCT and 100 control samples were investigated, including qPCR for WT1 expression and BRAF mutation, p53 immunohistochemistry detection, and massively parallel amplicon sequencing. WT1 was significantly (p < 0.0001) under-expressed in TGCT, with an increased ratio of exon 5-lacking isoforms, reaching low levels in chemo-naïve relapsed TGCT patients vs. high levels in chemotherapy-pretreated relapsed patients. BRAF V600E mutation was identified in 1% of patients only. p53 protein was lowly expressed in TGCT metastases compared to the matched primary tumors. Of 9 selected TGCT-linked genes, RAS/BRAF and WT1 mutations were frequent while significant TP53 and KIT variants were not detected (p = 0.0003). WT1 has been identified as a novel factor involved in TGCT pathogenesis, with a potential prognostic impact. Distinct biologic nature of the two types of relapses occurring in TGCT has been demonstrated. Differential mutation rate of the key TGCT-related genes has been documented. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Structure and stability insights into tumour suppressor p53 evolutionary related proteins.

    PubMed

    Pagano, Bruno; Jama, Abdullah; Martinez, Pierre; Akanho, Ester; Bui, Tam T T; Drake, Alex F; Fraternali, Franca; Nikolova, Penka V

    2013-01-01

    The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs) of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.

  14. The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

    PubMed

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Jing-Ping; Lin, Kai-Han; Liu, Chun-Yen

    In this work, we demonstrated that the growth of human non-small-cell-lung-cancer cells H460 and A549 cells can be inhibited by low concentrations of an epoxide derivative, teroxirone, in both in vitro and in vivo models. The cytotoxicity was mediated by apoptotic cell death through DNA damage. The onset of ultimate apoptosis is dependent on the status of p53. Teroxirone caused transient elevation of p53 that activates downstream p21 and procaspase-3 cleavage. The presence of caspase-3 inhibitor reverted apoptotic phenotype. Furthermore, we showed the cytotoxicity of teroxirone in H1299 cells with stable ectopic expression of p53, but not those of mutantmore » p53. A siRNA-mediated knockdown of p53 expression attenuated drug sensitivity. The in vivo experiments demonstrated that teroxirone suppressed growth of xenograft tumors in nude mice. Being a potential therapeutic agent by restraining cell growth through apoptotic death at low concentrations, teroxirone provides a feasible perspective in reversing tumorigenic phenotype of human lung cancer cells. - Highlights: • Teroxirone repressed tumor cell growth in nude mice of human lung cancer cells. • The apoptotic cell death reverted by caspase-3 inhibitor is related to p53 status. • Teroxirone provides a good candidate for lung cancer treatment.« less

  16. Curcumin induces permanent growth arrest of human colon cancer cells: link between senescence and autophagy.

    PubMed

    Mosieniak, Grazyna; Adamowicz, Marek; Alster, Olga; Jaskowiak, Hubert; Szczepankiewicz, Andrzej A; Wilczynski, Grzegorz M; Ciechomska, Iwona A; Sikora, Ewa

    2012-06-01

    Curcumin, a natural polyphenol derived from the rhizome of Curcuma longa, is a potent anticancer agent, which restricts tumor cell growth both in vitro and in vivo. Thus far curcumin was shown to induce death of cancer cells. This study reports the induction of cellular senescence of human colon cancer cells HCT116 upon curcumin treatment. The SA-β-galactosidase activation was observed both in p53+/+ and p53-/- cells, however the latter ones were less sensitive to the prosenescent activity of curcumin. Upregulation of p53 and p21 proteins was observed in p53+/+ HCT116, while p53-independent induction of p21 was noticed in p53-/- HCT116. Moreover, the senescence of HCT116 cells was accompanied by autophagy, that was confirmed by electron microscopy observations of autophagosomes in the curcumin-treated cells as well as LC3-II expression, punctue staining of LC3 and increased content of acidic vacuoles. Inhibition of autophagy, due to the diminished expression of ATG5 by RNAi decreased the number of senescent cells induced by curcumin, but did not lead to increased cell death. Altogether, we demonstrated a new antitumor activity of curcumin leading to cancer cell senescence and revealed the presence of a functional link between senescence and autophagy in curcumin-treated cells. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  17. Regulation of monocarboxylate transporter MCT1 expression by p53 mediates inward and outward lactate fluxes in tumors.

    PubMed

    Boidot, Romain; Végran, Frédérique; Meulle, Aline; Le Breton, Aude; Dessy, Chantal; Sonveaux, Pierre; Lizard-Nacol, Sarab; Feron, Olivier

    2012-02-15

    The monocarboxylate transporter (MCT) family member MCT1 can transport lactate into and out of tumor cells. Whereas most oxidative cancer cells import lactate through MCT1 to fuel mitochondrial respiration, the role of MCT1 in glycolysis-derived lactate efflux remains less clear. In this study, we identified a direct link between p53 function and MCT1 expression. Under hypoxic conditions, p53 loss promoted MCT1 expression and lactate export produced by elevated glycolytic flux, both in vitro and in vivo. p53 interacted directly with the MCT1 gene promoter and altered MCT1 mRNA stabilization. In hypoxic p53(-/-) tumor cells, NF-κB further supported expression of MCT1 to elevate its levels. Following glucose deprivation, upregulated MCT1 in p53(-/-) cells promoted lactate import and favored cell proliferation by fuelling mitochondrial respiration. We also found that MCT1 expression was increased in human breast tumors harboring p53 mutations and coincident features of hypoxia, with higher MCT1 levels associated with poorer clinical outcomes. Together, our findings identify MCT1 as a target for p53 repression and they suggest that MCT1 elevation in p53-deficient tumors allows them to adapt to metabolic needs by facilitating lactate export or import depending on the glucose availability.

  18. Mdm-2 binding and TAF(II)31 recruitment is regulated by hydrogen bond disruption between the p53 residues Thr18 and Asp21.

    PubMed

    Jabbur, James R; Tabor, Amy D; Cheng, Xiaodong; Wang, Hua; Uesugi, Motonari; Lozano, Guillermina; Zhang, Wei

    2002-10-10

    Analyses of five wild-type p53 containing cell lines revealed lineage specific differences in phosphorylation of Thr18 after treatment with ionizing (IR) or ultraviolet (UV) radiation. Importantly, Thr18 phosphorylation correlated with induction of the p53 downstream targets p21(Waf1/Cip1) (p21) and Mdm-2, suggesting a transactivation enhancing role. Thr18 phosphorylation has been shown to abolish side-chain hydrogen bonding between Thr18 and Asp21, an interaction necessary for stabilizing alpha-helical conformation within the transactivation domain. Mutagenesis-derived hydrogen bond disruption attenuated the interaction of p53 with the transactivation repressor Mdm-2 but had no direct effect on the interaction of p53 with the basal transcription factor TAF(II)31. However, prior incubation of p53 mutants with Mdm-2 modulated TAF(II)31 interaction with p53, suggesting Mdm-2 blocks the accessibility of p53 to TAF(II)31. Consistently, p53-null cells transfected with hydrogen bond disrupting p53 mutants demonstrated enhanced endogenous p21 expression, whereas p53/Mdm-2-double null cells exhibited no discernible differences in p21 expression. We conclude disruption of intramolecular hydrogen bonding between Thr18 and Asp21 enhances p53 transactivation by modulating Mdm-2 binding, facilitating TAF(II)31 recruitment.

  19. Enhanced radiosensitization of p53 mutant cells by oleamide.

    PubMed

    Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil

    2006-04-01

    Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.

  20. Involvement of Novel Multifunction Steroid Hormone Receptor Coactivator, E6-Associated Protein, in Prostate Gland Tumorigenesis

    DTIC Science & Technology

    2009-01-01

    HPV infection in cervical carcinoma cells . However, this effect is E6 dependent, as p53 could only be degraded by the formation of E6 and E6-AP...and prostate cancer cell proliferation. E6-AP by itself can modulate p53 levels in prostate cancer cells independent of E6. Our data also indicates...p53 levels in prostate glands and prostate cancer cells : E6-AP was initially identified as an E3 ligase which promotes the degradation of p53 during

  1. Differential effects on apoptosis induction in hepatocyte lines by stable expression of hepatitis B virus X protein

    PubMed Central

    Fiedler, Nicola; Quant, Ellen; Fink, Ludger; Sun, Jianguang; Schuster, Ralph; Gerlich, Wolfram H; Schaefer, Stephan

    2006-01-01

    AIM: Hepatitis B virus protein X (HBx) has been shown to be weakly oncogenic in vitro. The transforming activities of HBx have been linked with the inhibition of several functions of the tumor suppressor p53. We have studied whether HBx may have different effects on p53 depending on the cell type. METHODS: We used the human hepatoma cell line HepG2 and the immortalized murine hepatocyte line AML12 and analyzed stably transfected clones which expressed physiological amounts of HBx. P53 was induced by UV irradiation. RESULTS: The p53 induction by UV irradiation was unaffected by stable expression of HBx. However, the expression of the cyclin kinase inhibitor p21waf/cip/sdi which gets activated by p53 was affected in the HBx transformed cell line AML12-HBx9, but not in HepG2. In AML-HBx9 cells, p21waf/cip/sdi-protein expression and p21waf/cip/sdi transcription were deregulated. Furthermore, the process of apoptosis was affected in opposite ways in the two cell lines investigated. While stable expression of HBx enhanced apoptosis induced by UV irradiation in HepG2-cells, apoptosis was decreased in HBx transformed AML12-HBx9. P53 repressed transcription from the HBV enhancer I, when expressed from expression vectors or after induction of endogenous p53 by UV irradiation. Repression by endogenous p53 was partially reversible by stably expressed HBx in both cell lines. CONCLUSION: Stable expression of HBx leads to deregulation of apoptosis induced by UV irradiation depending on the cell line used. In an immortalized hepatocyte line HBx acted anti-apoptotic whereas expression in a carcinoma derived hepatocyte line HBx enhanced apoptosis. PMID:16937438

  2. Cell cycle control, checkpoint mechanisms, and genotoxic stress.

    PubMed Central

    Shackelford, R E; Kaufmann, W K; Paules, R S

    1999-01-01

    The ability of cells to maintain genomic integrity is vital for cell survival and proliferation. Lack of fidelity in DNA replication and maintenance can result in deleterious mutations leading to cell death or, in multicellular organisms, cancer. The purpose of this review is to discuss the known signal transduction pathways that regulate cell cycle progression and the mechanisms cells employ to insure DNA stability in the face of genotoxic stress. In particular, we focus on mammalian cell cycle checkpoint functions, their role in maintaining DNA stability during the cell cycle following exposure to genotoxic agents, and the gene products that act in checkpoint function signal transduction cascades. Key transitions in the cell cycle are regulated by the activities of various protein kinase complexes composed of cyclin and cyclin-dependent kinase (Cdk) molecules. Surveillance control mechanisms that check to ensure proper completion of early events and cellular integrity before initiation of subsequent events in cell cycle progression are referred to as cell cycle checkpoints and can generate a transient delay that provides the cell more time to repair damage before progressing to the next phase of the cycle. A variety of cellular responses are elicited that function in checkpoint signaling to inhibit cyclin/Cdk activities. These responses include the p53-dependent and p53-independent induction of Cdk inhibitors and the p53-independent inhibitory phosphorylation of Cdk molecules themselves. Eliciting proper G1, S, and G2 checkpoint responses to double-strand DNA breaks requires the function of the Ataxia telangiectasia mutated gene product. Several human heritable cancer-prone syndromes known to alter DNA stability have been found to have defects in checkpoint surveillance pathways. Exposures to several common sources of genotoxic stress, including oxidative stress, ionizing radiation, UV radiation, and the genotoxic compound benzo[a]pyrene, elicit cell cycle checkpoint responses that show both similarities and differences in their molecular signaling. Images Figure 3 PMID:10229703

  3. The Role of JMY in p53 Regulation.

    PubMed

    Adighibe, Omanma; Pezzella, Francesco

    2018-05-31

    Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

  4. Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wan, Chunhua; Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu; Ma, Xa

    2014-12-15

    Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleavedmore » PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly activated in Mn-exposed brain cells. • p53 translocates into mitochondria following Mn exposure. • p53 causes mitochondrial deficit via transcription-dependent and -independent actions. • PFT-α and PFT-μ ameliorate Mn-induced mitochondrial deficit and neuronal apoptosis.« less

  5. Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

    PubMed

    Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

    2015-10-01

    The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. TP53 Mutational Status Is a Potential Marker for Risk Stratification in Wilms Tumour with Diffuse Anaplasia

    PubMed Central

    Chagtai, Tasnim; Popov, Sergey D.; Sebire, Neil J.; Vujanic, Gordan; Perlman, Elizabeth; Anderson, James R.; Grundy, Paul; Dome, Jeffrey S.; Pritchard-Jones, Kathy

    2014-01-01

    Purpose The presence of diffuse anaplasia in Wilms tumours (DAWT) is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information. Patients and Methods We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32) and gene expression (n = 36) arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling. Results From the 40 cases, 22 (55%) had TP53 mutations (2 detected only after deep-sequencing), 20 of which also had 17p loss (91%); 18 (45%) cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25) had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR), 3.89; 95% confidence interval (CI), 1.26–16.0) and death (p = 0.04, HR, 4.95; 95% CI, 1.36–31.7) compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03). These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes. Conclusion This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker. PMID:25313908

  7. TP53 mutational status is a potential marker for risk stratification in Wilms tumour with diffuse anaplasia.

    PubMed

    Maschietto, Mariana; Williams, Richard D; Chagtai, Tasnim; Popov, Sergey D; Sebire, Neil J; Vujanic, Gordan; Perlman, Elizabeth; Anderson, James R; Grundy, Paul; Dome, Jeffrey S; Pritchard-Jones, Kathy

    2014-01-01

    The presence of diffuse anaplasia in Wilms tumours (DAWT) is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information. We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32) and gene expression (n = 36) arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling. From the 40 cases, 22 (55%) had TP53 mutations (2 detected only after deep-sequencing), 20 of which also had 17p loss (91%); 18 (45%) cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25) had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR), 3.89; 95% confidence interval (CI), 1.26-16.0) and death (p = 0.04, HR, 4.95; 95% CI, 1.36-31.7) compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03). These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes. This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker.

  8. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms.

    PubMed

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K; Xiong, Yue; Chen, Xian; Wan, Yisong Y

    2016-01-05

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1-cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms.

  9. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms

    PubMed Central

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K.; Xiong, Yue; Chen, Xian; Wan, Yisong Y.

    2016-01-01

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1–cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms. PMID:26728942

  10. Janus face-like effects of Aurora B inhibition: antitumoral mode of action versus induction of aneuploid progeny.

    PubMed

    Wiedemuth, Ralf; Klink, Barbara; Fujiwara, Mamoru; Schröck, Evelin; Tatsuka, Masaaki; Schackert, Gabriele; Temme, Achim

    2016-10-01

    The mitotic Aurora B kinase is overexpressed in tumors and various inhibitors for Aurora B are currently under clinical assessments. However, when considering Aurora B kinase inhibitors as anticancer drugs, their mode of action and the role of p53 status as a possible predictive factor for response still needs to be investigated. In this study, we analyzed the effects of selective Aurora B inhibition using AZD1152-HQPA/Barasertib (AZD1152) on HCT116 cells, U87-MG, corresponding isogenic p53-deficient cells and a primary glioblastoma cell line. AZD1152 treatment caused polyploidy and non-apoptotic cell death in all cell lines irrespective of p53 status and was accompanied by poly-merotelic kinetochore-microtubule attachments and DNA damage. In p53 wild-type cells a DNA damage response induced an inefficient pseudo-G1 cell cycle arrest, which was not able to halt ongoing endoreplication of cells. Of note, release of tumor cells from AZD1152 resulted in recovery of aneuploid progenies bearing numerical and structural chromosomal aberrations. Yet, AZD1152 treatment enhanced death receptor TRAIL-R2 levels in all tumor cell lines investigated. A concomitant increase of the activating natural killer (NK) cell ligand MIC A/B in p53-deficient cells and an induction of FAS/CD95 in cells containing p53 rendered AZD1152-treated cells more susceptible for NK-cell-mediated lysis. Our study mechanistically explains a p53-independent mode of action of a chemical Aurora B inhibitor and suggests a potential triggering of antitumoral immune responses, following polyploidization of tumor cells, which might constrain recovery of aneuploid tumor cells. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Initiation of autoimmunity to the p53 tumor suppressor protein by complexes of p53 and SV40 large T antigen

    PubMed Central

    1994-01-01

    Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have implications for understanding the pathogenesis of ANAs in SLE. In particular, our results imply that autoimmunity can be initiated by a "hit and run" mechanism in which the binding of a viral antigen to a self protein triggers an immune response that subsequently can be perpetuated by self antigen. PMID:8145041

  12. Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

    PubMed Central

    Cheng, J; Haas, M

    1990-01-01

    Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

  13. A p53-inducible microRNA-34a downregulates Ras signaling by targeting IMPDH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Hwa-Ryeon; Roe, Jae-Seok; Lee, Ji-Eun

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer p53 downregulates IMPDH. Black-Right-Pointing-Pointer p53-dependent miR-34a transactivation inhibits IMPDH transcription. Black-Right-Pointing-Pointer miR-34a-mediated inhibition of IMPDH downregulates GTP-dependent Ras signal. -- Abstract: p53 is a well-known transcription factor that controls cell cycle arrest and cell death in response to a wide range of stresses. Moreover, p53 regulates glucose metabolism and its mutation results in the metabolic switch to the Warburg effect found in cancer cells. Nucleotide biosynthesis is also critical for cell proliferation and the cell division cycle. Nonetheless, little is known about whether p53 regulates nucleotide biosynthesis. Here we demonstrated that p53-inducible microRNA-34a (miR-34a) repressed inosine 5 Primemore » -monophosphate dehydrogenase (IMPDH), a rate-limiting enzyme of de novo GTP biosynthesis. Treatment with anti-miR-34a inhibitor relieved the expression of IMPDH upon DNA damage. Ultimately, miR-34a-mediated inhibition of IMPDH resulted in repressed activation of the GTP-dependent Ras signaling pathway. In summary, we suggest that p53 has a novel function in regulating purine biosynthesis, aided by miR-34a-dependent IMPDH repression.« less

  14. Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance

    PubMed Central

    Walia, Mannu K; Ho, Patricia MW; Taylor, Scott; Ng, Alvin JM; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew CW; Martin, T John; Walkley, Carl R

    2016-01-01

    Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS. DOI: http://dx.doi.org/10.7554/eLife.13446.001 PMID:27070462

  15. PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu Dehua; Fan, Wufang; Liu, Guohong

    2006-04-01

    HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showedmore » that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties.« less

  16. Alpha-santalol, a chemopreventive agent against skin cancer, causes G2/M cell cycle arrest in both p53-mutated human epidermoid carcinoma A431 cells and p53 wild-type human melanoma UACC-62 cells

    PubMed Central

    2010-01-01

    Background α-Santalol, an active component of sandalwood oil, has shown chemopreventive effects on skin cancer in different murine models. However, effects of α-santalol on cell cycle have not been studied. Thus, the objective of this study was to investigate effects of α-santalol on cell cycle progression in both p53 mutated human epidermoid carcinoma A431 cells and p53 wild-type human melanoma UACC-62 cells to elucidate the mechanism(s) of action. Methods MTT assay was used to determine cell viability in A431 cells and UACC-62; fluorescence-activated cell sorting (FACS) analysis of propidium iodide staining was used for determining cell cycle distribution in A431 cells and UACC-62 cells; immunoblotting was used for determining the expression of various proteins and protein complexes involved in the cell cycle progression; siRNA were used to knockdown of p21 or p53 in A431 and UACC-62 cells and immunofluorescence microscopy was used to investigate microtubules in UACC-62 cells. Results α-Santalol at 50-100 μM decreased cell viability from 24 h treatment and α-santalol at 50 μM-75 μM induced G2/M phase cell cycle arrest from 6 h treatment in both A431 and UACC-62 cells. α-Santalol altered expressions of cell cycle proteins such as cyclin A, cyclin B1, Cdc2, Cdc25c, p-Cdc25c and Cdk2. All of these proteins are critical for G2/M transition. α-Santalol treatment up-regulated the expression of p21 and suppressed expressions of mutated p53 in A431 cells; whereas, α-santalol treatment increased expressions of wild-type p53 in UACC-62 cells. Knockdown of p21 in A431 cells, knockdown of p21 and p53 in UACC-62 cells did not affect cell cycle arrest caused by α-santalol. Furthermore, α-santalol caused depolymerization of microtubules similar to vinblastine in UACC-62 cells. Conclusions This study for the first time identifies effects of α-santalol in G2/M phase arrest and describes detailed mechanisms of G2/M phase arrest by this agent, which might be contributing to its overall cancer preventive efficacy in various mouse skin cancer models. PMID:20682067

  17. Actual Proliferating Index and p53 protein expression as prognostic marker in odontogenic cysts.

    PubMed

    Gadbail, A R; Chaudhary, M; Patil, S; Gawande, M

    2009-10-01

    The purpose of this study was to evaluate the biological aggressiveness of odontogenic keratocyst/keratocystic odontogenic tumour (KCOT), radicular cyst (RC) and dentigerous cyst (DC) by observing the actual proliferative activity of epithelium, and p53 protein expression. The actual proliferative activity was measured by Ki-67 Labelling Index and argyrophilic nucleolar organizing regions (AgNOR) count per nucleus. The p53 protein expression was also evaluated. Ki-67 positive cells were observed higher in suprabasal cell layers of KCOT with uniform distribution, a few of them were predominantly observed in basal cell layer in RC and DC. The AgNOR count was significantly higher in suprabasal cell layers of KCOT. The actual proliferative activity was noted to be higher in suprabasal cell layers of KCOT. The p53 immunolabelling was dense and scattered in basal and suprabasal cell layers in KCOT. The weakly stained p53 positive cells were observed diffusely distributed in KCOT, whereas they were mainly seen in basal cell layer of RC and DC. The quantitative and qualitative differences of the proliferative activity and the p53 protein expression in sporadic KCOT may be associated with intrinsic growth potential that could play a role in its development and explain locally aggressive biological behaviour. AgNOR count and p53 protein detection in odontogenic lesions can be of great consequence to predict the biological behaviour and prognosis.

  18. Selected Alkylating Agents Can Overcome Drug Tolerance of G0-like Tumor Cells and Eradicate BRCA1-Deficient Mammary Tumors in Mice.

    PubMed

    Pajic, Marina; Blatter, Sohvi; Guyader, Charlotte; Gonggrijp, Maaike; Kersbergen, Ariena; Küçükosmanoğlu, Aslι; Sol, Wendy; Drost, Rinske; Jonkers, Jos; Borst, Piet; Rottenberg, Sven

    2017-11-15

    Purpose: We aimed to characterize and target drug-tolerant BRCA1-deficient tumor cells that cause residual disease and subsequent tumor relapse. Experimental Design: We studied responses to various mono- and bifunctional alkylating agents in a genetically engineered mouse model for BRCA1/p53 -mutant breast cancer. Because of the large intragenic deletion of the Brca1 gene, no restoration of BRCA1 function is possible, and therefore, no BRCA1-dependent acquired resistance occurs. To characterize the cell-cycle stage from which Brca1 -/- ;p53 -/- mammary tumors arise after cisplatin treatment, we introduced the fluorescent ubiquitination-based cell-cycle indicator (FUCCI) construct into the tumor cells. Results: Despite repeated sensitivity to the MTD of platinum drugs, the Brca1 -mutated mammary tumors are not eradicated, not even by a frequent dosing schedule. We show that relapse comes from single-nucleated cells delaying entry into the S-phase. Such slowly cycling cells, which are present within the drug-naïve tumors, are enriched in tumor remnants. Using the FUCCI construct, we identified nonfluorescent G 0 -like cells as the population most tolerant to platinum drugs. Intriguingly, these cells are more sensitive to the DNA-crosslinking agent nimustine, resulting in an increased number of multinucleated cells that lack clonogenicity. This is consistent with our in vivo finding that the nimustine MTD, among several alkylating agents, is the most effective in eradicating Brca1 -mutated mouse mammary tumors. Conclusions: Our data show that targeting G 0 -like cells is crucial for the eradication of BRCA1/p53-deficient tumor cells. This can be achieved with selected alkylating agents such as nimustine. Clin Cancer Res; 23(22); 7020-33. ©2017 AACR . ©2017 American Association for Cancer Research.

  19. Combined RAF1 protein expression and p53 mutational status provides a strong predictor of cellular radiosensitivity

    PubMed Central

    Warenius, H M; Jones, M; Gorman, T; McLeish, R; Seabra, L; Barraclough, R; Rudland, P

    2000-01-01

    The tumour suppressor gene, p53, and genes coding for positive signal transduction factors can influence transit through cell-cycle checkpoints and modulate radiosensitivity. Here we examine the effects of RAF1 protein on the rate of exit from a G2/M block induced by γ-irradiation in relation to intrinsic cellular radiosensitivity in human cell lines expressing wild-type p53 (wtp53) protein as compared to mutant p53 (mutp53) protein. Cell lines which expressed mutp53 protein were all relatively radioresistant and exhibited no relationship between RAF1 protein and cellular radiosensitivity. Cell lines expressing wtp53 protein, however, showed a strong relationship between RAF1 protein levels and the radiosensitivity parameter SF2. In addition, when post-irradiation perturbation of G2/M transit was compared using the parameter T50 (time after the peak of G2/M delay at which 50% of the cells had exited from a block induced by 2 Gy of irradiation), RAF1 was related to T50 in wtp53, but not mutp53, cell lines. Cell lines which expressed wtp53 protein and high levels of RAF1 had shorter T50s and were also more radiosensitive. These results suggest a cooperative role for wtp53 and RAF1 protein in determining cellular radiosensitivity in human cells, which involves control of the G2/M checkpoint. © 2000 Cancer Research Campaign PMID:10993658

  20. p53-independent p21 induction by MELK inhibition.

    PubMed

    Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

    2017-08-29

    MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated.

  1. p53-independent p21 induction by MELK inhibition

    PubMed Central

    Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

    2017-01-01

    MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated. PMID:28938528

  2. Selective resistance of CD44hi T cells to p53-dependent cell death results in persistence of immunologic memory after total body irradiation.

    PubMed

    Yao, Zhenyu; Jones, Jennifer; Kohrt, Holbrook; Strober, Samuel

    2011-10-15

    Our previous studies showed that treatment of mice with total body irradiation (TBI) or total lymphoid tissue irradiation markedly changes the balance of residual T cell subsets to favor CD4(+)CD44(hi) NKT cells because of the differential resistance of the latter subset to cell death. The object of the current study was to further elucidate the changed balance and mechanisms of differential radioresistance of T cell subsets after graded doses of TBI. The experimental results showed that CD4(+) T cells were markedly more resistant than CD8(+) T cells, and CD44(hi) T cells, including NKT cells and memory T cells, were markedly more resistant than CD44(lo) (naive) T cells. The memory T cells immunized to alloantigens persisted even after myeloablative (1000 cGy) TBI and were able to prevent engraftment of bone marrow transplants. Although T cell death after 1000 cGy was prevented in p53(-/-) mice, there was progressive T cell death in p53(-/-) mice at higher doses. Although p53-dependent T cell death changed the balance of subsets, p53-independent T cell death did not. In conclusion, resistance of CD44(hi) T cells to p53-dependent cell death results in the persistence of immunological memory after TBI and can explain the immune-mediated rejection of marrow transplants in sensitized recipients.

  3. Differential protein expression, DNA binding and interaction with SV40 large tumour antigen implicate the p63-family of proteins in replicative senescence.

    PubMed

    Djelloul, Siham; Tarunina, Marina; Barnouin, Karin; Mackay, Alan; Jat, Parmjit S

    2002-02-07

    P53 activity plays a key role in mammalian cells when they undergo replicative senescence at their Hayflick limit. To determine whether p63 proteins, members of the family of p53-related genes, are also involved in this process, we examined their expression in serially passaged rat embryo fibroblasts. Upon senescence, two truncated DeltaNp63 proteins decreased in abundance whereas two TAp63 isoforms accumulated. 2-D gel analysis showed that the DeltaNp63 proteins underwent post-translational modifications in both proliferating and senescent cells. Direct binding of DeltaNp63 proteins to a p53 consensus motif was greater in proliferating cells than senescent cells. In contrast p63alpha isoforms bound to DNA in a p53 dependent manner and this was higher in senescent cells than proliferating cells. An interaction of p63alpha proteins with SV40 large tumour antigen was also detected and ectopic expression of DeltaNp63alpha can extend the lifespan of rat embryo fibroblasts. Taken together the results indicate that p63 proteins may play a role in replicative senescence either by competition for p53 DNA binding sites or by direct interaction with p53 protein bound to DNA.

  4. Transactivation of bad by vorinostat-induced acetylated p53 enhances doxorubicin-induced cytotoxicity in cervical cancer cells.

    PubMed

    Lee, Sook-Jeong; Hwang, Sung-Ook; Noh, Eun Joo; Kim, Dong-Uk; Nam, Miyoung; Kim, Jong Hyeok; Nam, Joo Hyun; Hoe, Kwang-Lae

    2014-02-14

    Vorinostat (VOR) has been reported to enhance the cytotoxic effects of doxorubicin (DOX) with fewer side effects because of the lower DOX dosage in breast cancer cells. In this study, we investigated the novel mechanism underlying the synergistic cytotoxic effects of VOR and DOX co-treatment in cervical cancer cells HeLa, CaSki and SiHa cells. Co-treatment with VOR and DOX at marginal doses led to the induction of apoptosis through caspase-3 activation, poly (ADP-ribose) polymerase cleavage and DNA micronuclei. Notably, the synergistic growth inhibition induced by the co-treatment was attributed to the upregulation of the pro-apoptotic protein Bad, as the silencing of Bad expression using small interfering RNA (siRNA) abolished the phenomenon. As siRNA against p53 did not result in an increase in acetylated p53 and the consequent upregulation of Bad, the observed Bad upregulation was mediated by acetylated p53. Moreover, a chromatin immunoprecipitation analysis showed that the co-treatment of HeLa cells with VOR and DOX increased the recruitment of acetylated p53 to the bad promoter, with consequent bad transactivation. Conversely, C33A cervical cancer cells containing mutant p53 co-treated with VOR and DOX did not exhibit Bad upregulation, acetylated p53 induction or consequent synergistic growth inhibition. Together, the synergistic growth inhibition of cervical cancer cell lines induced by co-treatment with VOR and DOX can be attributed to the upregulation of Bad, which is induced by acetylated p53. These results show for the first time that the acetylation of p53, rather than histones, is a mechanism for the synergistic growth inhibition induced by VOR and DOX co-treatments.

  5. p53-Mediated Cellular Response to DNA Damage in Cells with Replicative Hepatitis B Virus

    NASA Astrophysics Data System (ADS)

    Puisieux, Alain; Ji, Jingwei; Guillot, Celine; Legros, Yann; Soussi, Thierry; Isselbacher, Kurt; Ozturk, Mehmet

    1995-02-01

    Wild-type p53 acts as a tumor suppressor gene by protecting cells from deleterious effects of genotoxic agents through the induction of a G_1/S arrest or apoptosis as a response to DNA damage. Transforming proteins of several oncogenic DNA viruses inactivate tumor suppressor activity of p53 by blocking this cellular response. To test whether hepatitis B virus displays a similar effect, we studied the p53-mediated cellular response to DNA damage in 2215 hepatoma cells with replicative hepatitis B virus. We demonstrate that hepatitis B virus replication does not interfere with known cellular functions of p53 protein.

  6. Abnormal mitosis triggers p53-dependent cell cycle arrest in human tetraploid cells.

    PubMed

    Kuffer, Christian; Kuznetsova, Anastasia Yurievna; Storchová, Zuzana

    2013-08-01

    Erroneously arising tetraploid mammalian cells are chromosomally instable and may facilitate cell transformation. An increasing body of evidence shows that the propagation of mammalian tetraploid cells is limited by a p53-dependent arrest. The trigger of this arrest has not been identified so far. Here we show by live cell imaging of tetraploid cells generated by an induced cytokinesis failure that most tetraploids arrest and die in a p53-dependent manner after the first tetraploid mitosis. Furthermore, we found that the main trigger is a mitotic defect, in particular, chromosome missegregation during bipolar mitosis or spindle multipolarity. Both a transient multipolar spindle followed by efficient clustering in anaphase as well as a multipolar spindle followed by multipolar mitosis inhibited subsequent proliferation to a similar degree. We found that the tetraploid cells did not accumulate double-strand breaks that could cause the cell cycle arrest after tetraploid mitosis. In contrast, tetraploid cells showed increased levels of oxidative DNA damage coinciding with the p53 activation. To further elucidate the pathways involved in the proliferation control of tetraploid cells, we knocked down specific kinases that had been previously linked to the cell cycle arrest and p53 phosphorylation. Our results suggest that the checkpoint kinase ATM phosphorylates p53 in tetraploid cells after abnormal mitosis and thus contributes to proliferation control of human aberrantly arising tetraploids.

  7. p63 and p73 coordinate p53 function to determine the balance between survival, cell death, and senescence in adult neural precursor cells

    PubMed Central

    Fatt, M P; Cancino, G I; Miller, F D; Kaplan, D R

    2014-01-01

    The p53 family members p73 and p63 have been implicated in various aspects of stem cell regulation. Here, we have asked whether they work together to regulate stem cell biology, focusing upon neural precursor cells (NPCs) in the adult murine brain. By studying mice that are haploinsufficient for p63 and/or p73, we show that these two proteins cooperate to ensure appropriate NPC self-renewal and long-term maintenance in the hippocampus and forebrain, and that when both are haploinsufficient, the NPC deficits are significantly greater than haploinsufficiency for either alone. We show that, in the case of p63+/− mice, this decrease in adult NPCs is caused by enhanced apoptosis. However, when p73 is coincidently haploinsufficient, this rescues the enhanced apoptosis of p63+/− NPCs under both basal conditions and following genotoxic stress, instead causing increased cellular senescence. This increase in cellular senescence is likely due, at least in part, to increased levels of basal DNA damage and p53 activation, as genetic ablation of p53 completely rescues the senescence phenotype observed in p63+/−; p73+/− mice. Thus, the presence of p73 determines whether p63+/− NPCs exhibit increased p53-dependent apoptosis or senescence. Together, these studies demonstrate that p63 and p73 cooperate to maintain adult NPC pools through regulation of p53 function; p63 antagonizes p53 to promote cellular survival, whereas p73 regulates self-renewal and p53-mediated apoptosis versus senescence. PMID:24809925

  8. On p53 revival using system oriented drug dosage design.

    PubMed

    Haseeb, Muhammad; Azam, Shumaila; Bhatti, A I; Azam, Rizwan; Ullah, Mukhtar; Fazal, Sahar

    2017-02-21

    We propose a new paradigm in the drug design for the revival of the p53 pathway in cancer cells. It is shown that the current strategy of using small molecule based Mdm2 inhibitors is not enough to adequately revive p53 in cancerous cells, especially when it comes to the extracting pulsating behavior of p53. This fact has come to notice when a novel method for the drug dosage design is introduced using system oriented concepts. As a test case, small molecule drug Mdm2 repressor Nutlin 3a is considered. The proposed method determines the dose of Nutlin to revive p53 pathway functionality. For this purpose, PBK dynamics of Nutlin have also been integrated with p53 pathway model. The p53 pathway is the focus of researchers for the last thirty years for its pivotal role as a frontline cancer suppressant protein due to its effect on cell cycle checkpoints and cell apoptosis in response to a DNA strand break. That is the reason for finding p53 being absent in more than 50% of tumor cancers. Various drugs have been proposed to revive p53 in cancer cells. Small molecule based drugs are at the foremost and are the subject of advanced clinical trials. The dosage design of these drugs is an important issue. We use control systems concepts to develop the drug dosage so that the cancer cells can be treated in appropriate time. We investigate by using a computational model how p53 protein responds to drug Nutlin 3a, an agent that interferes with the MDM2-mediated p53 regulation. The proposed integrated model describes in some detail the regulation network of p53 including the negative feedback loop mediated by MDM2 and the positive feedback loop mediated by Mdm2 mRNA as well as the reversible represses of MDM2 caused by Nutlin. The reported PBK dynamics of Nutlin 3a are also incorporated to see the full effect. It has been reported that p53 response to stresses in two ways. Either it has a sustained (constant) p53 response, or there are oscillations in p53 concentration. The claimed dosage strategy achieves the p53 response in the first case. However, for the induction of oscillations, it is shown through bifurcation analysis that to achieve oscillating behavior of p53 inhibition of Mdm2 is not enough, rather antirepression of the p53-Mdm2 complex is also needed which leads to the need of a new drug design paradigm. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bae, Soo Kyung; Gwak, Jungsug; Song, Im-Sook

    Highlights: {yields} TopIn activates p53-dependent transcription in colon cancer cells. {yields} TopIn induces apoptosis in colon cancer cells. {yields} TopIn selectively inhibits topoisomerase I activity. {yields} TopIn does not affect the activity of BCRP and MDR-1. -- Abstract: The tumor suppressor p53 plays an important role in cellular emergency mechanisms through regulating the genes involved in cell cycle arrest and apoptosis. To identify small molecules that can activate p53-responsive transcription, we performed chemical screening using genetically engineered HCT116 reporter cells. We found that TopIn (7-phenyl-6H-[1,2,5]oxadiazolo[3,4-e]indole 3-oxide) efficiently activated p53-mediated transcriptional activity and induced phosphorylation of p53 at Ser15, thereby stabilizingmore » the p53 protein. Furthermore, TopIn upregulated the expression of p21{sup WAF1/CIP1}, a downstream target of p53, and suppressed cellular proliferation in various colon cancer cells. Additionally, TopIn induced DNA fragmentation, caspase-3/7 activation and poly ADP ribose polymerase cleavage, typical biochemical markers of apoptosis, in p53 wild-type and mutated colon cancer cells. Finally, we found that TopIn inhibited topoisomerase I activity, but not topoisomerase II, in vitro and induced the formation of the topoisomerase I-DNA complex in HCT116 colon cancer cells. Unlike camptothecin (CPT) and its derivative SN38, TopIn did not affect the activity of the ATP-binding cassette transporter breast cancer resistance protein (BCRP) or multidrug-resistant protein-1 (MDR-1). These results suggest that TopIn may present a promising new topoisomerase I-targeting anti-tumor therapeutics.« less

  10. Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dai, Jiawen; Itahana, Koji, E-mail: koji.itahana@duke-nus.edu.sg; Baskar, Rajamanickam, E-mail: r.baskar@nccs.com.sg

    Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G{sub 1}/S or G{sub 2}/M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G{sub 0}, therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involvedmore » in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its known role in radio-resistance.« less

  11. InP/Ga0.47In0.53As monolithic, two-junction, three-terminal tandem solar cells

    NASA Technical Reports Server (NTRS)

    Wanlaas, M. W.; Gessert, T. A.; Horner, G. S.; Emery, K. A.; Coutts, T. J.

    1991-01-01

    The work presented has focussed on increasing the efficiency of InP-based solar cells through the development of a high-performance InP/Ga(0.47)In(0.53)As two-junction, three-terminal monolithic tandem cell. Such a tandem is particularly suited to space applications where a radiation-hard top cell (i.e., InP) is required. Furthermore, the InP/Ga(0.47)In(0.53)As materials system is lattice matched and offers a top cell/bottom cell bandgap differential (0.60 eV at 300 K) suitable for high tandem cell efficiencies under AMO illumination. A three-terminal configuration was chosen since it allows for independent power collection from each subcell in the monolithic stack, thus minimizing the adverse impact of radiation damage on the overall tandem efficiency. Realistic computer modeling calculations predict an efficiency boost of 7 to 11 percent from the Ga(0.47)In(0.53)As bottom cell under AMO illumination (25 C) for concentration ratios in the 1 to 1000 range. Thus, practical AMO efficiencies of 25 to 32 percent appear possible with the InP/Ga(0.47)In(0.53)As tandem cell. Prototype n/p/n InP/Ga(0.47)In(0.53)As monolithic tandem cells were fabricated and tested successfully. Using an aperture to define the illuminated areas, efficiency measurements performed on a non-optimized device under standard global illumination conditions (25 C) with no antireflection coating (ARC) give 12.2 percent for the InP top cell and 3.2 percent for the Ga(0.47)In(0.53)As bottom cell, yielding an overall tandem efficiency of 15.4 percent. With an ARC, the tandem efficiency could reach approximately 22 percent global and approximately 20 percent AMO. Additional details regarding the performance of individual InP and Ga(0.47)In(0.53)As component cells, fabrication and operation of complete tandem cells and methods for improving the tandem cell performance, are also discussed.

  12. Synergy between Prkdc and Trp53 regulates stem cell proliferation and GI-ARS after irradiation.

    PubMed

    Gurley, Kay E; Ashley, Amanda K; Moser, Russell D; Kemp, Christopher J

    2017-11-01

    Ionizing radiation (IR) is one of the most widely used treatments for cancer. However, acute damage to the gastrointestinal tract or gastrointestinal acute radiation syndrome (GI-ARS) is a major dose-limiting side effect, and the mechanisms that underlie this remain unclear. Here we use mouse models to explore the relative roles of DNA repair, apoptosis, and cell cycle arrest in radiation response. IR induces DNA double strand breaks and DNA-PK mutant Prkdc scid/scid mice are sensitive to GI-ARS due to an inability to repair these breaks. IR also activates the tumor suppressor p53 to trigger apoptotic cell death within intestinal crypt cells and p53 deficient mice are resistant to apoptosis. To determine if DNA-PK and p53 interact to govern radiosensitivity, we compared the response of single and compound mutant mice to 8 Gy IR. Compound mutant Prkdc scid/scid /Trp53 -/- mice died earliest due to severe GI-ARS. While both Prkdc scid/scid and Prkdc scid/scid /Trp53 -/- mutant mice had higher levels of IR-induced DNA damage, particularly within the stem cell compartment of the intestinal crypt, in Prkdc scid/scid /Trp53 -/- mice these damaged cells abnormally progressed through the cell cycle resulting in mitotic cell death. This led to a loss of Paneth cells and a failure to regenerate the differentiated epithelial cells required for intestinal function. IR-induced apoptosis did not correlate with radiosensitivity. Overall, these data reveal that DNA repair, mediated by DNA-PK, and cell cycle arrest, mediated by p53, cooperate to protect the stem cell niche after DNA damage, suggesting combination approaches to modulate both pathways may be beneficial to reduce GI-ARS. As many cancers harbor p53 mutations, this also suggests targeting DNA-PK may be effective to enhance sensitivity of p53 mutant tumors to radiation.

  13. Effects of the Kava Chalcone Flavokawain A Differ in Bladder Cancer Cells with Wild-type versus Mutant p53

    PubMed Central

    Tang, Yaxiong; Simoneau, Anne R.; Xie, Jun; Shahandeh, Babbak; Zi, Xiaolin

    2010-01-01

    Flavokawain A is the predominant chalcone from kava extract. We have assessed the mechanisms of flavokawain A's action on cell cycle regulation. In a p53 wild-type, low-grade, and papillary bladder cancer cell line (RT4), flavokawain A increased p21/WAF1 and p27/KIP1, which resulted in a decrease in cyclin-dependent kinase-2 (CDK2) kinase activity and subsequent G1 arrest. The increase of p21/WAF1 protein corresponded to an increased mRNA level, whereas p27/KIP1 accumulation was associated with the down-regulation of SKP2 and then increased the stability of the p27/KIP1 protein. The accumulation of p21/WAF1 and p27/KIP1 was independent of cell cycle position and thus not a result of the cell cycle arrest. In contrast, flavokawain A induced a G2-M arrest in six p53 mutant-type, high-grade bladder cancer cell lines (T24, UMUC3, TCCSUP, 5637, HT1376, and HT1197). Flavokawain A significantly reduced the expression of CDK1-inhibitory kinases, Myt1 and Wee1, and caused cyclin B1 protein accumulation leading to CDK1 activation in T24 cells. Suppression of p53 expression by small interfering RNA in RT4 cells restored Cdc25C expression and down-regulated p21/WAF1 expression, which allowed Cdc25C and CDK1 activation and then led to a G2-M arrest and an enhanced growth-inhibitory effect by flavokawain A. Consistently, flavokawain A also caused a pronounced CDK1 activation and G2-M arrest in p53 knockout but not in p53 wild-type HCT116 cells. This selectivity of flavokawain A for inducing a G2-M arrest in p53-defective cells deserves further investigation as a new mechanism for the prevention and treatment of bladder cancer. PMID:19138991

  14. WNT activation by lithium abrogates TP53 mutation associated radiation resistance in medulloblastoma.

    PubMed

    Zhukova, Nataliya; Ramaswamy, Vijay; Remke, Marc; Martin, Dianna C; Castelo-Branco, Pedro; Zhang, Cindy H; Fraser, Michael; Tse, Ken; Poon, Raymond; Shih, David J H; Baskin, Berivan; Ray, Peter N; Bouffet, Eric; Dirks, Peter; von Bueren, Andre O; Pfaff, Elke; Korshunov, Andrey; Jones, David T W; Northcott, Paul A; Kool, Marcel; Pugh, Trevor J; Pomeroy, Scott L; Cho, Yoon-Jae; Pietsch, Torsten; Gessi, Marco; Rutkowski, Stefan; Bognár, Laszlo; Cho, Byung-Kyu; Eberhart, Charles G; Conter, Cecile Faure; Fouladi, Maryam; French, Pim J; Grajkowska, Wieslawa A; Gupta, Nalin; Hauser, Peter; Jabado, Nada; Vasiljevic, Alexandre; Jung, Shin; Kim, Seung-Ki; Klekner, Almos; Kumabe, Toshihiro; Lach, Boleslaw; Leonard, Jeffrey R; Liau, Linda M; Massimi, Luca; Pollack, Ian F; Ra, Young Shin; Rubin, Joshua B; Van Meir, Erwin G; Wang, Kyu-Chang; Weiss, William A; Zitterbart, Karel; Bristow, Robert G; Alman, Benjamin; Hawkins, Cynthia E; Malkin, David; Clifford, Steven C; Pfister, Stefan M; Taylor, Michael D; Tabori, Uri

    2014-12-24

    TP53 mutations confer subgroup specific poor survival for children with medulloblastoma. We hypothesized that WNT activation which is associated with improved survival for such children abrogates TP53 related radioresistance and can be used to sensitize TP53 mutant tumors for radiation. We examined the subgroup-specific role of TP53 mutations in a cohort of 314 patients treated with radiation. TP53 wild-type or mutant human medulloblastoma cell-lines and normal neural stem cells were used to test radioresistance of TP53 mutations and the radiosensitizing effect of WNT activation on tumors and the developing brain. Children with WNT/TP53 mutant medulloblastoma had higher 5-year survival than those with SHH/TP53 mutant tumours (100% and 36.6%±8.7%, respectively (p<0.001)). Introduction of TP53 mutation into medulloblastoma cells induced radioresistance (survival fractions at 2Gy (SF2) of 89%±2% vs. 57.4%±1.8% (p<0.01)). In contrast, β-catenin mutation sensitized TP53 mutant cells to radiation (p<0.05). Lithium, an activator of the WNT pathway, sensitized TP53 mutant medulloblastoma to radiation (SF2 of 43.5%±1.5% in lithium treated cells vs. 56.6±3% (p<0.01)) accompanied by increased number of γH2AX foci. Normal neural stem cells were protected from lithium induced radiation damage (SF2 of 33%±8% for lithium treated cells vs. 27%±3% for untreated controls (p=0.05). Poor survival of patients with TP53 mutant medulloblastoma may be related to radiation resistance. Since constitutive activation of the WNT pathway by lithium sensitizes TP53 mutant medulloblastoma cells and protect normal neural stem cells from radiation, this oral drug may represent an attractive novel therapy for high-risk medulloblastomas.

  15. Mechanical cell competition kills cells via induction of lethal p53 levels

    PubMed Central

    Wagstaff, Laura; Goschorska, Maja; Kozyrska, Kasia; Duclos, Guillaume; Kucinski, Iwo; Chessel, Anatole; Hampton-O'Neil, Lea; Bradshaw, Charles R.; Allen, George E.; Rawlins, Emma L.; Silberzan, Pascal; Carazo Salas, Rafael E.; Piddini, Eugenia

    2016-01-01

    Cell competition is a quality control mechanism that eliminates unfit cells. How cells compete is poorly understood, but it is generally accepted that molecular exchange between cells signals elimination of unfit cells. Here we report an orthogonal mechanism of cell competition, whereby cells compete through mechanical insults. We show that MDCK cells silenced for the polarity gene scribble (scribKD) are hypersensitive to compaction, that interaction with wild-type cells causes their compaction and that crowding is sufficient for scribKD cell elimination. Importantly, we show that elevation of the tumour suppressor p53 is necessary and sufficient for crowding hypersensitivity. Compaction, via activation of Rho-associated kinase (ROCK) and the stress kinase p38, leads to further p53 elevation, causing cell death. Thus, in addition to molecules, cells use mechanical means to compete. Given the involvement of p53, compaction hypersensitivity may be widespread among damaged cells and offers an additional route to eliminate unfit cells. PMID:27109213

  16. Preliminary report on the effect of brachytherapy on expression of p53, bc1-2 and apoptosis in squamous cell carcinoma of the oesophagus.

    PubMed

    Sur, Monalisa; Sur, Ranjan K; Cooper, Kum; Bizos, Damon

    2003-02-01

    Pre-brachytherapy biopsies and post-brachytherapy oesophagectomy specimens of 10 patients with early squamous cell carcinoma of the middle third of the oesophagus were examined for the expression of p53, bcl-2 and apoptosis using immunohistochemical markers. There was no expression of p53 in one patient in both pre- and post-brachytherapy specimens. In 8 patients, p53 staining was strongly positive (3+) with approximately 50% or more cells, and with diffuse and no specific pattern in the pre-brachytherapy biopsies. The tumour areas of the post-brachytherapy specimens of this group showed strong 3+ positivity with p53 (10-50% positive cell count), with the pattern being focal and peripheral in the tumour islands. The centre of the tumour islands showed necrosis and/or keratinisation. In one patient, the pre-brachytherapy biopsy showed expression of p53 while the post-brachytherapy specimen was negative. bcl-2 expression in both pre- and post-brachytherapy was equivocal and inconclusive in both the pre- and post-brachytherapy specimens. Apoptosis was negative in all the pre- and post-brachytherapy tissue sections in the presence of positive controls. Brachytherapy does not cause cell death by apoptosis but by necrosis and maturation of the cells into better differentiated cells, which is caused by OH free radical, and induction of the keratin gene respectively. It is possible that brachytherapy may cause destruction of cells containing wild-type p53, while mutant p53 in cells located at the tumour periphery escape the effect of brachytherapy. This may be responsible for the high incidence of local recurrence and distant metastasis in oesophageal cancer treated with radiotherapy. There is no effect of brachytherapy on bcl-2 expression in oesophageal cancer.

  17. Blocking angiotensin II Type 1 receptor triggers apoptotic cell death in human pancreatic cancer cells.

    PubMed

    Gong, Qiaoke; Davis, Molly; Chipitsyna, Galina; Yeo, Charles J; Arafat, Hwyda A

    2010-07-01

    Pancreatic ductal adenocarcinoma (PDA) is an aggressive malignancy with an annual mortality rate close to its annual incidence. We recently demonstrated that angiotensin II (AngII) type 1 receptor (AT1R) might be involved in PDA angiogenesis. This study evaluated the antiproliferative and proapoptotic effects of an AT1R blocker, losartan, in PDA cells with different p53 mutation status. Cell cycle was analyzed by flow cytometric analysis of DNA content; apoptosis by annexin V-fluorescein isothiocyanate (V-FITC) and terminal deoxytransferase (TdT)-mediated dUTP nick-end labeling staining; messenger RNA and protein by real-time polymerase chain reaction and Western blotting; caspase-3 activity by colorimetric assay; and promoter activity by luciferase assay. Losartan dose-dependently decreased cell survival and increased their preG1 accumulation. It also increased p53, p21, p27, and Bax and reduced Bcl-2 and Bcl-xl expression. In wtp53 cells, losartan increased p53 transcription and activated caspase-3 in both cell lines. However, its proapoptotic effects in mtp53 cells were mainly caspase-3-dependent. Our data describe the involvement of AT1R in PDA cell apoptotic machinery and provide the first evidences that losartan stimulates the proapoptotic signaling pathways regardless of the p53 mutation status. As loss of p53 function is frequently observed in PDA patients, our data suggest AT1R blockade as a novel therapeutic strategy to control PDA growth.

  18. Immunohistochemical detection of tumor suppressor gene p53 protein in feline injection site-associated sarcomas.

    PubMed

    Nambiar, P R; Jackson, M L; Ellis, J A; Chelack, B J; Kidney, B A; Haines, D M

    2001-03-01

    Sarcomas associated with injection sites are a rare but important problem in cats. Immunohistochemical detection of p53 protein may correlate to mutation of the p53 tumor suppressor gene, a gene known to be important in oncogenesis. The expression of nuclear p53 protein in 40 feline injection site-assocated sarcomas was examined by immunohistochemical staining. In 42.5% (17/40), tumor cell nuclei were stained darkly; in 20% (8/40), tumor cell nuclei were stained palely; and in 37.5% (15/40), tumor cell nuclei were unstained. Immunohistochemical detection of p53 protein in a proportion of injection site-associated sarcomas suggests that mutation of the p53 gene may play a role in the pathogenesis of these tumors.

  19. Analysis of TP53 gene expression and p53 level of human hypopharyngeal FaDu (HTB-43) head and neck cancer cell line after microRNA-181a inhibition.

    PubMed

    Cheah, Y K; Cheng, R W; Yeap, S K; Khoo, C H; See, H S

    2014-03-17

    The identification of new biomarkers for early detection of highly recurrent head and neck cancer is urgently needed. MicroRNAs (miRNAs) are small and non-coding RNAs that regulate cancer-related gene expression, such as tumor protein 53 (TP53) gene expression. This study was carried out to analyze TP53 gene expression using real-time PCR and to determine changes in intracellular p53 level by flow cytometry after downregulation of miRNA-181a miRNA inhibitor in the FaDu cell line. TP53 gene expression showed a 3-fold increment and the p53 protein level was also increased in the miRNA-181a-treated cells. In conclusion, miRNA-181a binds to the TP53 gene and inhibits its expression, decreasing the synthesis of p53.

  20. Selective sensitization to DNA-damaging agents in a human rhabdomyosarcoma cell line with inducible wild-type p53 overexpression.

    PubMed

    Gibson, A A; Harwood, F G; Tillman, D M; Houghton, J A

    1998-01-01

    Drug-induced cytotoxicity or apoptosis may be influenced by the expression of the p53 tumor suppressor gene and by the specific oncogene expressed, which may dictate the threshold at which a cytotoxic response may by induced. The objective of the study was to elucidate how DNA-damaging agents with different mechanisms of action were sensitized in the context of expression of the Pax3/FKHR fusion protein, a transformation event unique to alveolar rhabdomyosarcomas (ARMSs), and wild-type p53 (wtp53). A wtp53 cDNA was subcloned into the pGRE5-2/EBV vector with dexamethasone-inducible overexpression and transfected into Rh30 ARMS cells that express Pax3/FKHR and a mutant p53 phenotype. Following dexamethasone induction of wtp53 overexpression in a derived clone (Cl.#27), growth was slowed, and cells accumulated in G1. Functional wtp53 activity was demonstrated by selective transactivation of p50-2, a wtp53 chloramphenicol acetyltransferase reporter construct, and by up-regulated expression of endogenous p21Waf1. Data demonstrated p53-dependent sensitization (> or = 4-fold) to bleomycin, actinomycin D, and 5-fluorouracil and considerably less p53-dependence (< or = 2-fold) for doxorubicin, topotecan, etoposide, and cisplatin in Cl.#27 compared to an equivalent clone containing the pGRE5-EBV vector alone (VC#3). Data demonstrate that ARMS cells show a selective sensitization to DNA-damaging agents when wtp53 is overexpressed. The cytotoxic activity of agents that are not potentiated substantially must, therefore, depend upon p53-independent factors that relate to the mechanism of drug action.

  1. The p53-Reactivating Small Molecule RITA Induces Senescence in Head and Neck Cancer Cells

    PubMed Central

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L.; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N.; Skinner, Heath D.

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC. PMID:25119136

  2. Predominant role of DNA polymerase eta and p53-dependent translesion synthesis in the survival of ultraviolet-irradiated human cells.

    PubMed

    Lerner, Leticia K; Francisco, Guilherme; Soltys, Daniela T; Rocha, Clarissa R R; Quinet, Annabel; Vessoni, Alexandre T; Castro, Ligia P; David, Taynah I P; Bustos, Silvina O; Strauss, Bryan E; Gottifredi, Vanesa; Stary, Anne; Sarasin, Alain; Chammas, Roger; Menck, Carlos F M

    2017-02-17

    Genome lesions trigger biological responses that help cells manage damaged DNA, improving cell survival. Pol eta is a translesion synthesis (TLS) polymerase that bypasses lesions that block replicative polymerases, avoiding continued stalling of replication forks, which could lead to cell death. p53 also plays an important role in preventing cell death after ultraviolet (UV) light exposure. Intriguingly, we show that p53 does so by favoring translesion DNA synthesis by pol eta. In fact, the p53-dependent induction of pol eta in normal and DNA repair-deficient XP-C human cells after UV exposure has a protective effect on cell survival after challenging UV exposures, which was absent in p53- and Pol H-silenced cells. Viability increase was associated with improved elongation of nascent DNA, indicating the protective effect was due to more efficient lesion bypass by pol eta. This protection was observed in cells proficient or deficient in nucleotide excision repair, suggesting that, from a cell survival perspective, proper bypass of DNA damage can be as relevant as removal. These results indicate p53 controls the induction of pol eta in DNA damaged human cells, resulting in improved TLS and enhancing cell tolerance to DNA damage, which parallels SOS responses in bacteria. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Loss of autocrine endothelial-derived VEGF significantly reduces hemangiosarcoma development in conditional p53-deficient mice

    PubMed Central

    Farhang Ghahremani, Morvarid; Radaelli, Enrico; Haigh, Katharina; Bartunkova, Sonia; Haenebalcke, Lieven; Marine, Jean-Christophe; Goossens, Steven; Haigh, Jody J

    2014-01-01

    Malignant transformation of the endothelium is rare, and hemangiosarcomas comprise only 1% of all sarcomas. For this reason and due to the lack of appropriate mouse models, the genetic mechanisms of malignant endothelial transformation are poorly understood. Here, we describe a hemangiosarcoma mouse model generated by deleting p53 specifically in the endothelial and hematopoietic lineages. This strategy led to a high incidence of hemangiosarcoma, with an average latency of 25 weeks. To study the in vivo roles of autocrine or endothelial cell autonomous VEGF signaling in the initiation and/or progression of hemangiosarcomas, we genetically deleted autocrine endothelial sources of VEGF in this mouse model. We found that loss of even a single conditional VEGF allele results in substantial rescue from endothelial cell transformation. These findings highlight the important role of threshold levels of autocrine VEGF signaling in endothelial malignancies and suggest a new approach for hemangiosarcoma treatment using targeted autocrine VEGF inhibition. PMID:24626176

  4. Loss of autocrine endothelial-derived VEGF significantly reduces hemangiosarcoma development in conditional p53-deficient mice.

    PubMed

    Farhang Ghahremani, Morvarid; Radaelli, Enrico; Haigh, Katharina; Bartunkova, Sonia; Haenebalcke, Lieven; Marine, Jean-Christophe; Goossens, Steven; Haigh, Jody J

    2014-01-01

    Malignant transformation of the endothelium is rare, and hemangiosarcomas comprise only 1% of all sarcomas. For this reason and due to the lack of appropriate mouse models, the genetic mechanisms of malignant endothelial transformation are poorly understood. Here, we describe a hemangiosarcoma mouse model generated by deleting p53 specifically in the endothelial and hematopoietic lineages. This strategy led to a high incidence of hemangiosarcoma, with an average latency of 25 weeks. To study the in vivo roles of autocrine or endothelial cell autonomous VEGF signaling in the initiation and/or progression of hemangiosarcomas, we genetically deleted autocrine endothelial sources of VEGF in this mouse model. We found that loss of even a single conditional VEGF allele results in substantial rescue from endothelial cell transformation. These findings highlight the important role of threshold levels of autocrine VEGF signaling in endothelial malignancies and suggest a new approach for hemangiosarcoma treatment using targeted autocrine VEGF inhibition.

  5. Deoxyinosine triphosphate induces MLH1/PMS2- and p53-dependent cell growth arrest and DNA instability in mammalian cells

    PubMed Central

    Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku

    2016-01-01

    Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981

  6. Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakagawa, Yosuke; Takahashi, Akihisa; Kajihara, Atsuhisa

    Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggestedmore » that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp53 bearing cancer cells.« less

  7. Novel function of STAT1beta in B cells: induction of cell death by a mechanism different from that of STAT1alpha.

    PubMed

    Najjar, Imen; Schischmanoff, Pierre Olivier; Baran-Marszak, Fanny; Deglesne, Pierre-Antoine; Youlyouz-Marfak, Ibtissam; Pampin, Mathieu; Feuillard, Jean; Bornkamm, Georg W; Chelbi-Alix, Mounira K; Fagard, Remi

    2008-12-01

    Alternate splicing of STAT1 produces two isoforms: alpha, known as the active form, and beta, previously shown to act as a dominant-negative factor. Most studies have dealt with STAT1alpha, showing its involvement in cell growth control and cell death. To examine the specific function of either isoform in cell death, a naturally STAT1-deficient human B cell line was transfected to express STAT1alpha or STAT1beta. STAT1alpha, expressed alone, enhanced cell death, potentiated the fludarabine-induced apoptosis, and enhanced the nuclear location, the phosphorylation, and the transcriptional activity of p53. Unexpectedly, STAT1beta, expressed alone, induced cell death through a mechanism that was independent of the nuclear function of p53. Indeed, in STAT1beta-expressing B cells, p53 was strictly cytoplasmic where it formed clusters, and there was no induction of the transcriptional activity of p53. These data reveal a novel role of STAT1beta in programmed cell death, which is independent of p53.

  8. Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yi Fuming; Saha, Abhik; Murakami, Masanao

    The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less

  9. Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

    PubMed

    Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

    2005-01-20

    Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

  10. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

    PubMed

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

    2017-11-01

    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  11. Nicotine induces cell proliferation in association with cyclin D1 up-regulation and inhibits cell differentiation in association with p53 regulation in a murine pre-osteoblastic cell line

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sato, Tsuyoshi; Abe, Takahiro; Nakamoto, Norimichi

    Recent studies have suggested that nicotine critically affects bone metabolism. Many studies have examined the effects of nicotine on proliferation and differentiation, but the underlying molecular mechanisms remain unclear. We examined cell cycle regulators involved in the proliferation and differentiation of MC3T3-E1 cells. Nicotine induced cell proliferation in association with p53 down-regulation and cyclin D1 up-regulation. In differentiated cells, nicotine reduced alkaline phosphatase activity and mineralized nodule formation in dose-dependent manners. Furthermore, p53 expression was sustained in nicotine-treated cells during differentiation. These findings indicate that nicotine promotes the cell cycle and inhibits differentiation in association with p53 regulation in pre-osteoblasticmore » cells.« less

  12. Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53

    PubMed Central

    York, D.; Withers, S. S.; Watson, K. D.; Seo, K. W.; Rebhun, R. B.

    2016-01-01

    Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. PMID:27333821

  13. Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53.

    PubMed

    York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B

    2017-09-01

    Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.

  14. Cells Comprising the Prostate Cancer Microenvironment Lack Recurrent Clonal Somatic Genomic Aberrations

    PubMed Central

    Bianchi-Frias, Daniella; Basom, Ryan; Delrow, Jeffrey J; Coleman, Ilsa M; Dakhova, Olga; Qu, Xiaoyu; Fang, Min; Franco, Omar E.; Ericson, Nolan G.; Bielas, Jason H.; Hayward, Simon W.; True, Lawrence; Morrissey, Colm; Brown, Lisha; Bhowmick, Neil A.; Rowley, David; Ittmann, Michael; Nelson, Peter S.

    2017-01-01

    Prostate cancer-associated stroma (CAS) plays an active role in malignant transformation, tumor progression, and metastasis. Molecular analyses of CAS have demonstrated significant changes in gene expression; however, conflicting evidence exists on whether genomic alterations in benign cells comprising the tumor microenvironment (TME) underlie gene expression changes and oncogenic phenotypes. This study evaluates the nuclear and mitochondrial DNA integrity of prostate carcinoma cells, CAS, matched benign epithelium and benign epithelium-associated stroma by whole genome copy number analyses, targeted sequencing of TP53, and fluorescence in situ hybridization. Comparative genomic hybridization (aCGH) of CAS revealed a copy-neutral diploid genome with only rare and small somatic copy number aberrations (SCNAs). In contrast, several expected recurrent SCNAs were evident in the adjacent prostate carcinoma cells, including gains at 3q, 7p, and 8q, and losses at 8p and 10q. No somatic TP53 mutations were observed in CAS. Mitochondrial DNA (mtDNA) extracted from carcinoma cells and stroma identified 23 somatic mtDNA mutations in neoplastic epithelial cells but only one mutation in stroma. Finally, genomic analyses identified no SCNAs, no loss of heterozygosity (LOH) or copy-neutral LOH in cultured cancer-associated fibroblasts (CAFs), which are known to promote prostate cancer progression in vivo. PMID:26753621

  15. Zinc Deficiency Induces Apoptosis via Mitochondrial p53- and Caspase-Dependent Pathways in Human Neuronal Precursor Cells

    ERIC Educational Resources Information Center

    Seth, Rohit; Corniola, Rikki S.; Gower-Winter, Shannon D.; Morgan, Thomas J., Jr.; Bishop, Brian; Levenson, Cathy W.

    2015-01-01

    Previous studies have shown that zinc deficiency leads to apoptosis of neuronal precursor cells in vivo and in vitro. In addition to the role of p53 as a nuclear transcription factor in zinc deficient cultured human neuronal precursors (NT-2), we have now identified the translocation of phosphorylated p53 to the mitochondria and p53-dependent…

  16. P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

    PubMed

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-08-27

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  17. P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

    PubMed Central

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-01-01

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy. PMID:20957096

  18. Immunohistochemical expression of p53 and its clinicopathological correlation with modified Anneroth's histological grading system.

    PubMed

    Dave, Kajal V; Chalishazar, Monali; Dave, Vishal R; Panja, Pritam; Singh, Manisha; Modi, Tapan G

    2016-01-01

    Oral squamous cell carcinoma (OSCC) is an epithelial neoplasm generally beginning as focal overgrowth of altered stem cells near the basement membrane, moving upward and laterally, replacing the normal epithelium. Histopathological grading has been used for many decades in an attempt to predict the clinical behavior of oral squamous cell carcinoma. In the present study, Forty biopsies were studied for histological grading and p53 expression. The p53 expression was studied in relation to clinical parameters such as age, sex of patient and site of tumors. Relation between histological grade of malignancy and p53 protein expression was analysed. All cases were classified according to Anneroth's histological malignancy grading system (1987). 40 cases of OSCC were assessed for clinical parameters, Anneroth's histological grading and immunohistochemically stained with p53 protien. The results obtained were analyzed using Spearman's Co-relation. The positive expression of p53 was found in 62% of carcinomas studied. Positivity of p53 showed correlation with histological grade of malignancy and with individual parameters like degree of keratinization, nuclear polymorphism, number of mitoses and lymphoplasmacytic infiltration while showed a negative correlation with pattern of invasion. Our study showed a significant correlation between parameters of tumor cell population, lymphoplasmacytic infiltration and p53 expression. A significant association between high grade of malignancy and p53 overexpression and insignificant correlation of p53 with age, sex of the patient and site of the tumor was found.

  19. Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

    PubMed

    Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

    2011-12-01

    Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and other cancers, who are not sensitive to chemotherapy, radiotherapy, or who lost their chance for surgical treatment. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  20. Characterisation of the p53 pathway in cell lines established from TH-MYCN transgenic mouse tumours.

    PubMed

    Chen, Lindi; Esfandiari, Arman; Reaves, William; Vu, Annette; Hogarty, Michael D; Lunec, John; Tweddle, Deborah A

    2018-03-01

    Cell lines established from the TH-MYCN transgenic murine model of neuroblastoma are a valuable preclinical, immunocompetent, syngeneic model of neuroblastoma, for which knowledge of their p53 pathway status is important. In this study, the Trp53 status and functional response to Nutlin-3 and ionising radiation (IR) were determined in 6 adherent TH-MYCN transgenic cell lines using Sanger sequencing, western blot analysis and flow cytometry. Sensitivity to structurally diverse MDM2 inhibitors (Nutlin-3, MI-63, RG7388 and NDD0005) was determined using XTT proliferation assays. In total, 2/6 cell lines were Trp53 homozygous mutant (NHO2A and 844MYCN+/+) and 1/6 (282MYCN+/-) was Trp53 heterozygous mutant. For 1/6 cell lines (NHO2A), DNA from the corresponding primary tumour was found to be Trp53 wt. In all cases, the presence of a mutation was consistent with aberrant p53 signalling in response to Nutlin-3 and IR. In comparison to TP53 wt human neuroblastoma cells, Trp53 wt murine control and TH-MYCN cell lines were significantly less sensitive to growth inhibition mediated by MI-63 and RG7388. These murine Trp53 wt and mutant TH-MYCN cell lines are useful syngeneic, immunocompetent neuroblastoma models, the former to test p53-dependent therapies in combination with immunotherapies, such as anti-GD2, and the latter as models of chemoresistant relapsed neuroblastoma when aberrations in the p53 pathway are more common. The spontaneous development of Trp53 mutations in 3 cell lines from TH-MYCN mice may have arisen from MYCN oncogenic driven and/or ex vivo selection. The identified species-dependent selectivity of MI-63 and RG7388 should be considered when interpreting in vivo toxicity studies of MDM2 inhibitors.

  1. The ethanol extract of Scutellaria baicalensis and the active compounds induce cell cycle arrest and apoptosis including upregulation of p53 and Bax in human lung cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao Jiayu; Morgan, Winston A.; Sanchez-Medina, Alberto

    2011-08-01

    Despite a lack of scientific authentication, Scutellaria baicalensis is clinically used in Chinese medicine as a traditional adjuvant to chemotherapy of lung cancer. In this study, cytotoxicity assays demonstrated that crude ethanolic extracts of S. baicalensis were selectively toxic to human lung cancer cell lines A549, SK-LU-1 and SK-MES-1 compared with normal human lung fibroblasts. The active compounds baicalin, baicalein and wogonin did not exhibit such selectivity. Following exposure to the crude extracts, cellular protein expression in the cancer cell lines was assessed using 2D gel electrophoresis coupled with MALDI-TOF-MS/Protein Fingerprinting. The altered protein expression indicated that cell growth arrestmore » and apoptosis were potential mechanisms of cytotoxicity. These observations were supported by PI staining cell cycle analysis using flow cytometry and Annexin-V apoptotic analysis by fluorescence microscopy of cancer cells treated with the crude extract and pure active compounds. Moreover, specific immunoblotting identification showed the decreased expression of cyclin A results in the S phase arrest of A549 whereas the G{sub 0}/G{sub 1} phase arrest in SK-MES-1 cells results from the decreased expression of cyclin D1. Following treatment, increased expression in the cancer cells of key proteins related to the enhancement of apoptosis was observed for p53 and Bax. These results provide further insight into the molecular mechanisms underlying the clinical use of this herb as an adjuvant to lung cancer therapy. - Research Highlights: > Scutellaria baicalensis is a clinical adjuvant to lung cancer chemotherapy in China. > Scutellaria ethanol extracts selectively toxic to A549, SK-LU-1 and SK-MES-1. > Baicalin, baicalein and wogonin were toxic to all lung cancer cell lines. > Proteomics identified increased p53 and BAX in response to Scutellaria extracts.« less

  2. Expression screening using a Medaka cDNA library identifies evolutionarily conserved regulators of the p53/Mdm2 pathway.

    PubMed

    Zhang, Ping; Kratz, Anne Sophie; Salama, Mohammed; Elabd, Seham; Heinrich, Thorsten; Wittbrodt, Joachim; Blattner, Christine; Davidson, Gary

    2015-10-08

    The p53 tumor suppressor protein is mainly regulated by alterations in the half-life of the protein, resulting in significant differences in p53 protein levels in cells. The major regulator of this process is Mdm2, which ubiquitinates p53 and targets it for proteasomal degradation. This process can be enhanced or reduced by proteins that associate with p53 or Mdm2 and several proteins have been identified with such an activity. Furthermore, additional ubiquitin ligases for p53 have been identified in recent years. Nevertheless, our understanding of how p53 abundance and Mdm2 activity are regulated remains incomplete. Here we describe a cell culture based overexpression screen to identify evolutionarily conserved regulators of the p53/Mdm2 circuit. The results from this large-scale screening method will contribute to a better understanding of the regulation of these important proteins. Expression screening was based on co-transfection of H1299 cells with pools of cDNA's from a Medaka library together with p53, Mdm2 and, as internal control, Ror2. After cell lysis, SDS-PAGE/WB analysis was used to detect alterations in these proteins. More than one hundred hits that altered the abundance of either p53, Mdm2, or both were identified in the primary screen. Subscreening of the library pools that were identified in the primary screen identified several potential novel regulators of p53 and/or Mdm2. We also tested whether the human orthologues of the Medaka genes regulate p53 and/or Mdm2 abundance. All human orthologues regulated p53 and/or Mdm2 abundance in the same manner as the proteins from Medaka, which underscores the suitability of this screening methodology for the identification of new modifiers of p53 and Mdm2. Despite enormous efforts in the last two decades, many unknown regulators for p53 and Mdm2 abundance are predicted to exist. This cross-species approach to identify evolutionarily conserved regulators demonstrates that our Medaka unigene cDNA library represents a powerful tool to screen for these novel regulators of the p53/Mdm2 pathway.

  3. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    PubMed

    Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM.

  4. Targeting p53 via JNK Pathway: A Novel Role of RITA for Apoptotic Signaling in Multiple Myeloma

    PubMed Central

    Saha, Manujendra N.; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D.; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK activators in the treatment of MM. PMID:22276160

  5. Induction of apoptosis in Ehrlich ascites tumour cells via p53 activation by a novel small-molecule MDM2 inhibitor - LQFM030.

    PubMed

    da Mota, Mariana F; Cortez, Alane P; Benfica, Polyana L; Rodrigues, Bruna Dos S; Castro, Thalyta F; Macedo, Larissa M; Castro, Carlos H; Lião, Luciano M; de Carvalho, Flávio S; Romeiro, Luiz A S; Menegatti, Ricardo; Verli, Hugo; Villavicencio, Bianca; Valadares, Marize C

    2016-09-01

    The activation of the p53 pathway through the inhibition of MDM2 has been proposed as a novel therapeutic strategy against tumours. A series of cis-imidazoline analogues, termed nutlins, were reported to displace the recombinant p53 protein from its complex with MDM2 by binding to MDM2 in the p53 pocket, and exhibited an antitumour activity both in vitro and in vivo. Thus, the purpose of this study was to evaluate the antitumour properties of LQFM030 (2), a nutlin analogue created by employing the strategy of molecular simplification. LQFM030 (2) cytotoxicity was evaluated in Ehrlich ascites tumour (EAT) cells, p53 wild type, by the trypan blue exclusion test, and the mechanisms involved in EAT cell death were investigated by light and fluorescence microscopy, flow cytometry, real-time PCR and Western blotting. Our results demonstrate that LQFM030 has dose-dependent antiproliferative activity and cytotoxic activity on EAT cells, induces the accumulation of p53 protein and promotes cell cycle arrest and apoptosis. p53 gene transcription was unaffected by LQFM030 (2); however, MDM2 mRNA increased and MDM2 protein decreased. These results suggest that the small-molecule p53 activator LQFM030 (2) has the potential for further development as a novel cancer therapeutic agent. © 2016 Royal Pharmaceutical Society.

  6. The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

    PubMed Central

    Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

    2013-01-01

    The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

  7. Influence of P53 on the radiotherapy response of hepatocellular carcinoma

    PubMed Central

    Gomes, Ana R.; Abrantes, Ana M.; Brito, Ana F.; Laranjo, Mafalda; Casalta-Lopes, João E.; Gonçalves, Ana C.; Sarmento-Ribeiro, Ana B.; Tralhão, José G.

    2015-01-01

    Background/Aims Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide, and it has a poor prognosis and few therapeutic options. Radiotherapy is one of the most effective forms of cancer treatment, and P53 protein is one of the key molecules determining how a cell responds to radiotherapy. The aim of this study was to determine the therapeutic efficacy of iodine-131 in three human HCC cell lines. Methods Western blotting was used to measure P53 expression. The effects of radiotherapy with iodine-131 were assessed by using the clonogenic assay to evaluate cell survival. Flow cytometry was carried out to examine the effects of iodine-131 on cell death, oxidative stress, reduced intracellular glutathione expression, the mitochondrial membrane potential, and the cell cycle. Results The P53 protein was not expressed in Hep3B2.1-7 cells, was expressed at normal levels in HepG2 cells, and was overexpressed in HuH7 cells. P53 expression in the HuH7 and HepG2 cell lines increased after internal and external irradiation with iodine-131. Irradiation induced a decrease in cell survival and led to a decrease in cell viability in all of the cell lines studied, accompanied by cell death via late apoptosis/necrosis and necrosis. Irradiation with 131-iodine induced mostly cell-cycle arrest in the G0/G1 phase. Conclusions These results suggest that P53 plays a key role in the radiotherapy response of HCC. PMID:26527121

  8. Minnelide/Triptolide Impairs Mitochondrial Function by Regulating SIRT3 in P53-Dependent Manner in Non-Small Cell Lung Cancer.

    PubMed

    Kumar, Ajay; Corey, Catherine; Scott, Iain; Shiva, Sruti; D'Cunha, Jonathan

    2016-01-01

    Minnelide/Triptolide (TL) has recently emerged as a potent anticancer drug in non-small cell lung cancer (NSCLC). However, the precise mechanism of its action remains ambiguous. In this study, we elucidated the molecular basis for TL-induced cell death in context to p53 status. Cell death was attributed to dysfunction of mitochondrial bioenergetics in p53-deficient cells, which was characterized by decreased mitochondrial respiration, steady-state ATP level and membrane potential, but augmented reactive oxygen species (ROS). Increased ROS production resulted in oxidative stress in TL-treated cells. This was exhibited by elevated nuclear levels of a redox-sensitive transcriptional factor, NF-E2-related factor-2 (NRF2), along with diminished cellular glutathione (GSH) content. We further demonstrated that in the absence of p53, TL blunted the expression of mitochondrial SIRT3 triggering increased acetylation of NDUAF9 and succinate dehydrogenase, components of complexes I and II of the electron transport chain (ETC). TL-mediated hyperacetylation of complexes I and II proteins and these complexes displayed decreased enzymatic activities. We also provide the evidence that P53 regulate steady-state level of SIRT3 through Proteasome-Pathway. Finally, forced overexpression of Sirt3, but not deacetylase-deficient mutant of Sirt3 (H243Y), restored the deleterious effect of TL on p53-deficient cells by rescuing mitochondrial bioenergetics. On contrary, Sirt3 deficiency in the background of wild-type p53 triggered TL-induced mitochondrial impairment that echoed TL effect in p53-deficeint cells. These findings illustrate a novel mechanism by which TL exerts its potent effects on mitochondrial function and ultimately the viability of NSCLC tumor.

  9. Development of an adenoviral vector with robust expression driven by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

    2008-02-05

    Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

  10. Selective Resistance of CD44hi T Cells to p53 Dependent Cell Death Results in Persistence of Immunologic Memory after Total Body Irradiation1,2,3

    PubMed Central

    Yao, Zhenyu; Jones, Jennifer; Kohrt, Holbrook; Strober, Samuel

    2011-01-01

    Our previous studies showed that treatment of mice with total body irradiation (TBI) or total lymphoid tissue irradiation (TLI) markedly changes the balance of residual T cell subsets to favor CD4+CD44hi natural killer T (NKT) cells due to differential resistance of the latter subset to cell death. The object of the current study was to further elucidate the changed balance and mechanisms of differential radioresistance of T cell subsets after graded doses of TBI. The experimental results show that CD4+ T cells were markedly more resistant than CD8+ T cells, and CD44hi T cells including NKT cells and memory T cells were markedly more resistant than CD44lo (naïve) T cells. The memory T cells immunized to alloantigens persisted even after myeloabloative (1,000cGy) TBI, and were able to prevent engraftment of bone marrow transplants. Although T cell death after 1,000cGy was prevented in p53−/− mice, there was progressive T cell death in p53−/− mice at higher doses. Whereas, p53 dependent T cell death changed the balance of subsets, the p53 independent T cell death did not. In conclusion, resistance of CD44hi T cells to p53 dependent cell death results in the persistence of immunological memory after TBI, and can explain the immune mediated rejection of marrow transplants in sensitized recipients. PMID:21930972

  11. RAG-induced DNA lesions activate proapoptotic BIM to suppress lymphomagenesis in p53-deficient mice

    PubMed Central

    Herold, Marco J.

    2016-01-01

    Neoplastic transformation is driven by oncogenic lesions that facilitate unrestrained cell expansion and resistance to antiproliferative signals. These oncogenic DNA lesions, acquired through errors in DNA replication, gene recombination, or extrinsically imposed damage, are thought to activate multiple tumor suppressive pathways, particularly apoptotic cell death. DNA damage induces apoptosis through well-described p53-mediated induction of PUMA and NOXA. However, loss of both these mediators (even together with defects in p53-mediated induction of cell cycle arrest and cell senescence) does not recapitulate the tumor susceptibility observed in p53−/− mice. Thus, potentially oncogenic DNA lesions are likely to also trigger apoptosis through additional, p53-independent processes. We found that loss of the BH3-only protein BIM accelerated lymphoma development in p53-deficient mice. This process was negated by concomitant loss of RAG1/2-mediated antigen receptor gene rearrangement. This demonstrates that BIM is critical for the induction of apoptosis caused by potentially oncogenic DNA lesions elicited by RAG1/2-induced gene rearrangement. Furthermore, this highlights the role of a BIM-mediated tumor suppressor pathway that acts in parallel to the p53 pathway and remains active even in the absence of wild-type p53 function, suggesting this may be exploited in the treatment of p53-deficient cancers. PMID:27621418

  12. Significance of AZD1152 as a potential treatment against Aurora B overexpression in acute promyelocytic leukemia.

    PubMed

    Ghanizadeh-Vesali, Samad; Zekri, Ali; Zaker, Farhad; Zaghal, Azam; Yousefi, Meysam; Alimoghaddam, Kamran; Ghavamzadeh, Ardeshir; Ghaffari, Seyed H

    2016-06-01

    Aurora B kinase as a chromosomal passenger protein plays multiple roles in regulating mitosis and cytokinesis. The function of Aurora B in leukemic cells has made it an important treatment target. In this study, we explored the expressions of Aurora (A, B, and C) kinases in newly diagnosed acute promyelocytic leukemia (APL) patients. In addition, we investigated the effects of AZD1152 as a specific inhibitor of Aurora B on cell survival, DNA synthesis, nuclear morphology, apoptosis induction, cell cycle distribution, and gene expression in an APL-derived NB4 cell line. Our results showed that Aurora B was overexpressed in 88 % of APL patients. AZD1152 treatment of NB4 cells led to viability reduction and G2/M arrest followed by an increase in cell size and polyploidy induction. These giant cells showed morphological evidence of mitotic catastrophe. AZD1152 treatment induced activation of G2/M checkpoint which in turn led to transient G2/M arrest in a p21-independent manner. Lack of functional p53 in NB4 cells might provide an opportunity to escape from G2/M block and to endure repeated rounds of replication and polyploidy. Treated cells were probably eliminated via p73-mediated overexpression of BAX, PUMA, and APAF1 and downregulation of survivin and MCL-1. In summary, AZD1152 treatment led to endomitosis and polyploidy in TP53-mutated NB4 cells. These giant polyploid cells might undergo mitotic catastrophe and p73-mediated apoptosis. It seems that induction of polyploidy via AZD1152 could be a novel form of anti-cancer therapy for APL that may be clinically accessible in the near future.

  13. Treatment of acute lung injury by targeting MG53-mediated cell membrane repair

    PubMed Central

    Lieber, Gissela; Nishi, Miyuki; Yan, Rosalie; Wang, Zhen; Yao, Yonggang; Li, Yu; Whitson, Bryan A.; Duann, Pu; Li, Haichang; Zhou, Xinyu; Zhu, Hua; Takeshima, Hiroshi; Hunter, John C.; McLeod, Robbie L.; Weisleder, Noah; Zeng, Chunyu; Ma, Jianjie

    2014-01-01

    Injury to lung epithelial cells has a role in multiple lung diseases. We previously identified mitsugumin 53 (MG53) as a component of the cell membrane repair machinery in striated muscle cells. Here we show that MG53 also has a physiological role in the lung and may be used as a treatment in animal models of acute lung injury. Mice lacking MG53 show increased susceptibility to ischemia-reperfusion and over-ventilation induced injury to the lung when compared with wild type mice. Extracellular application of recombinant human MG53 (rhMG53) protein protects cultured lung epithelial cells against anoxia/reoxygenation-induced injuries. Intravenous delivery or inhalation of rhMG53 reduces symptoms in rodent models of acute lung injury and emphysema. Repetitive administration of rhMG53 improves pulmonary structure associated with chronic lung injury in mice. Our data indicate a physiological function for MG53 in the lung and suggest that targeting membrane repair may be an effective means for treatment or prevention of lung diseases. PMID:25034454

  14. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    PubMed

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  15. FGF1 protects neuroblastoma SH-SY5Y cells from p53-dependent apoptosis through an intracrine pathway regulated by FGF1 phosphorylation

    PubMed Central

    Pirou, Caroline; Montazer-Torbati, Fatemeh; Jah, Nadège; Delmas, Elisabeth; Lasbleiz, Christelle; Mignotte, Bernard; Renaud, Flore

    2017-01-01

    Neuroblastoma, a sympathetic nervous system tumor, accounts for 15% of cancer deaths in children. In contrast to most human tumors, p53 is rarely mutated in human primary neuroblastoma, suggesting impaired p53 activation in neuroblastoma. Various studies have shown correlations between fgf1 expression levels and both prognosis severity and tumor chemoresistance. As we previously showed that fibroblast growth factor 1 (FGF1) inhibited p53-dependent apoptosis in neuron-like PC12 cells, we initiated the study of the interaction between the FGF1 and p53 pathways in neuroblastoma. We focused on the activity of either extracellular FGF1 by adding recombinant rFGF1 in media, or of intracellular FGF1 by overexpression in human SH-SY5Y and mouse N2a neuroblastoma cell lines. In both cell lines, the genotoxic drug etoposide induced a classical mitochondrial p53-dependent apoptosis. FGF1 was able to inhibit p53-dependent apoptosis upstream of mitochondrial events in SH-SY5Y cells by both extracellular and intracellular pathways. Both rFGF1 addition and etoposide treatment increased fgf1 expression in SH-SY5Y cells. Conversely, rFGF1 or overexpressed FGF1 had no effect on p53-dependent apoptosis and fgf1 expression in neuroblastoma N2a cells. Using different FGF1 mutants (that is, FGF1K132E, FGF1S130A and FGF1S130D), we further showed that the C-terminal domain and phosphorylation of FGF1 regulate its intracrine anti-apoptotic activity in neuroblastoma SH-SY5Y cells. This study provides the first evidence for a role of an intracrine growth factor pathway on p53-dependent apoptosis in neuroblastoma, and could lead to the identification of key regulators involved in neuroblastoma tumor progression and chemoresistance. PMID:29048426

  16. S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

    PubMed

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

    2013-12-05

    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  17. Various stress stimuli rewire the profile of liver secretome in a p53-dependent manner.

    PubMed

    Charni-Natan, Meital; Solomon, Hilla; Molchadsky, Alina; Jacob-Berger, Adi; Goldfinger, Naomi; Rotter, Varda

    2018-05-29

    Liver is an important secretory organ that consistently manages various insults in order to retain whole-body homeostasis. Importantly, it was suggested that the tumor-suppressor p53 plays a role in a variety of liver physiological processes and thus it is being regarded as a systemic homeostasis regulator. Using high-throughput mass spectrometric analysis, we identified various p53-dependent liver secretome profiles. This allowed a global view on the role of p53 in maintaining the harmony of liver and whole-body homeostasis. We found that p53 altered the liver secretome differently under various conditions. Under physiological conditions, p53 controls factors that are related mainly to lipid metabolism and injury response. Upon exposure to various types of cancer therapy agents, the hepatic p53 is activated and induces the secretion of proteins related to additional pathways, such as hemostasis, immune response, and cell adhesion. Interestingly, we identified a possible relationship between p53-dependent liver functions and lung tumors. The latter modify differently liver secretome profile toward the secretion of proteins mainly related to cell migration and immune response. The notion that p53 may rewire the liver secretome profile suggests a new non-cell autonomous role of p53 that affect different liver functions and whole organism homeostasis.

  18. Novel action modality of the diterpenoid anisomelic acid causes depletion of E6 and E7 viral oncoproteins in HPV-transformed cervical carcinoma cells.

    PubMed

    Paul, Preethy; Rajendran, Senthil Kumar; Peuhu, Emilia; Alshatwi, Ali A; Akbarsha, Mohammad A; Hietanen, Sakari; Eriksson, John E

    2014-05-15

    Cervical cancer, the second most common malignancy among women, is mainly caused by human papilloma virus (HPV) infection. In HPV-positive cervical cancer cells, the activity of p53 and the induction of p21 are inhibited by the HPV oncoproteins E6 and E7. Therefore, blocking the activity of E6 and E7 would serve as an important therapeutic target in these cancer cells. In this study, anisomelic acid (AA), a natural compound belonging to the same diterpenoid family of bioactive compounds as taxol, was found to deplete the E6 and E7 proteins in HPV-positive cervical cancer cells. Consequently, p53 and the p53-responsive gene, p21, were dramatically induced, leading to G2/M-phase cell cycle arrest. AA-mediated cell cycle arrest and p21 expression were canceled when p53 was down-regulated by p53-shRNA. AA also induced p53-independent intrinsic apoptosis by depletion of the cellular inhibitor of apoptosis protein 2 (cIAP2) whose proteosomal degradation is inhibited by E6. The in ovo chick embryo chorioallantoic membrane (CAM) assay showed that anisomelic acid inhibited the tumor growth of the cervical cancer SiHa cells. AA is revealed to hold a novel action modality based on specific targeting of the HPV oncoproteins, which restores p53-mediated growth arrest and induces apoptosis by terminating E6-mediated cIAP2 stabilization. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and other stresses

    PubMed Central

    Rubbi, Carlos P.; Milner, Jo

    2003-01-01

    p53 protects against cancer through its capacity to induce cell cycle arrest or apoptosis under a large variety of cellular stresses. It is not known how such diversity of signals can be integrated by a single molecule. However, the literature reveals that a common denominator in all p53-inducing stresses is nucleolar disruption. We thus postulated that the impairment of nucleolar function might stabilize p53 by preventing its degradation. Using micropore irradiation, we demonstrate that large amounts of nuclear DNA damage fail to stabilize p53 unless the nucleolus is also disrupted. Forcing nucleolar disruption by anti-upstream binding factor (UBF) microinjection (in the absence of DNA damage) also causes p53 stabilization. We propose that the nucleolus is a stress sensor responsible for maintenance of low levels of p53, which are automatically elevated as soon as nucleolar function is impaired in response to stress. Our model integrates all known p53-inducing agents and also explains cell cycle-related variations in p53 levels which correlate with established phases of nucleolar assembly/disassembly through the cell cycle. PMID:14609953

  20. Pharmacological activation of a novel p53-dependent S-phase checkpoint involving CHK-1

    PubMed Central

    Ahmed, A; Yang, J; Maya-Mendoza, A; Jackson, D A; Ashcroft, M

    2011-01-01

    We have recently shown that induction of the p53 tumour suppressor protein by the small-molecule RITA (reactivation of p53 and induction of tumour cell apoptosis; 2,5-bis(5-hydroxymethyl-2-thienyl)furan) inhibits hypoxia-inducible factor-1α and vascular endothelial growth factor expression in vivo and induces p53-dependent tumour cell apoptosis in normoxia and hypoxia. Here, we demonstrate that RITA activates the canonical ataxia telangiectasia mutated/ataxia telangiectasia and Rad3-related DNA damage response pathway. Interestingly, phosphorylation of checkpoint kinase (CHK)-1 induced in response to RITA was influenced by p53 status. We found that induction of p53, phosphorylated CHK-1 and γH2AX proteins was significantly increased in S-phase. Furthermore, we found that RITA stalled replication fork elongation, prolonged S-phase progression and induced DNA damage in p53 positive cells. Although CHK-1 knockdown did not significantly affect p53-dependent DNA damage or apoptosis induced by RITA, it did block the ability for DNA integrity to be maintained during the immediate response to RITA. These data reveal the existence of a novel p53-dependent S-phase DNA maintenance checkpoint involving CHK-1. PMID:21593792

  1. RNF38 encodes a nuclear ubiquitin protein ligase that modifies p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sheren, Jamie E.; Kassenbrock, C. Kenneth, E-mail: ken.kassenbrock@ucdenver.edu; Department of Biology, Colorado State University, Fort Collins, CO 80523-1878

    2013-11-01

    Highlights: •RNF38 is shown to be a nuclear protein with a bipartite nuclear localization signal. •RNF38 protein is purified and shown to have ubiquitin protein ligase (E3) activity. •We show that RNF38 binds p53 and can ubiquitinate p53 in vitro. •Overexpression of RNF38 increases p53 ubiquitination in HEK293T cells. •Overexpression of RNF38 in HEK293T cells alters p53 localization. -- Abstract: The RNF38 gene encodes a RING finger protein of unknown function. Here we demonstrate that RNF38 is a functional ubiquitin protein ligase (E3). We show that RNF38 isoform 1 is localized to the nucleus by a bipartite nuclear localization sequencemore » (NLS). We confirm that RNF38 is a binding partner of p53 and demonstrate that RNF38 can ubiquitinate p53 in vitro and in vivo. Finally, we show that overexpression of RNF38 in HEK293T cells results in relocalization of p53 to discrete foci associated with PML nuclear bodies. These results suggest RNF38 is an E3 ubiquitin ligase that may play a role in regulating p53.« less

  2. Mutant p53 proteins counteract autophagic mechanism sensitizing cancer cells to mTOR inhibition.

    PubMed

    Cordani, Marco; Oppici, Elisa; Dando, Ilaria; Butturini, Elena; Dalla Pozza, Elisa; Nadal-Serrano, Mercedes; Oliver, Jordi; Roca, Pilar; Mariotto, Sofia; Cellini, Barbara; Blandino, Giovanni; Palmieri, Marta; Di Agostino, Silvia; Donadelli, Massimo

    2016-08-01

    Mutations in TP53 gene play a pivotal role in tumorigenesis and cancer development. Here, we report that gain-of-function mutant p53 proteins inhibit the autophagic pathway favoring antiapoptotic effects as well as proliferation of pancreas and breast cancer cells. We found that mutant p53 significantly counteracts the formation of autophagic vesicles and their fusion with lysosomes throughout the repression of some key autophagy-related proteins and enzymes as BECN1 (and P-BECN1), DRAM1, ATG12, SESN1/2 and P-AMPK with the concomitant stimulation of mTOR signaling. As a paradigm of this mechanism, we show that atg12 gene repression was mediated by the recruitment of the p50 NF-κB/mutant p53 protein complex onto the atg12 promoter. Either mutant p53 or p50 NF-κB depletion downregulates atg12 gene expression. We further correlated the low expression levels of autophagic genes (atg12, becn1, sesn1, and dram1) with a reduced relapse free survival (RFS) and distant metastasis free survival (DMFS) of breast cancer patients carrying TP53 gene mutations conferring a prognostic value to this mutant p53-and autophagy-related signature. Interestingly, the mutant p53-driven mTOR stimulation sensitized cancer cells to the treatment with the mTOR inhibitor everolimus. All these results reveal a novel mechanism through which mutant p53 proteins promote cancer cell proliferation with the concomitant inhibition of autophagy. Copyright © 2016 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  3. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro

    PubMed Central

    Xing, Fuqiang; Zhan, Qiuqiang; He, Yiduo; Cui, Jiesheng; He, Sailing; Wang, Guanyu

    2016-01-01

    Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR) at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS) generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant). Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor) and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis. PMID:27689798

  4. p53 and Ca(2+) signaling from the endoplasmic reticulum: partners in anti-cancer therapies.

    PubMed

    Bittremieux, Mart; Bultynck, Geert

    2015-01-01

    Ca(2+) transfer from the endoplasmic reticulum (ER) to the mitochondria critically controls cell survival and cell death decisions. Different oncogenes and deregulation of tumor suppressors exploit this mechanism to favor the survival of altered, malignant cells. Two recent studies of the Pinton team revealed a novel, non-transcriptional function of cytosolic p53 in cell death. During cell stress, p53 is recruited to the ER and the ER-mitochondrial contact sites. This results in augmented ER Ca(2+) levels by enhancing sarco/endoplasmic reticulum Ca(2+) ATPase (SERCA) activity, ultimately promoting mitochondrial Ca(2+) overload. The boosting of "toxic" Ca(2+) signaling by p53 appears to be a critical component of the cell death-inducing properties of chemotherapeutic agents and anti-cancer treatments, like photodynamic stress. Strikingly, the resistance of p53-deficient cancer cells to these treatments could be overcome by facilitating Ca(2+) transfer between the ER and the mitochondria via overexpression of SERCA or of the mitochondrial Ca(2+) uniporter (MCU). Importantly, these concepts have also been supported by in vivo Ca(2+) measurements in tumor masses in mice. Collectively, these studies link for the first time the major tumor suppressor, p53, to Ca(2+) signaling in dictating cell-death outcomes and by the success of anti-cancer treatments.

  5. The small molecule 2-phenylethynesulfonamide induces covalent modification of p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jamil, Sarwat; Hojabrpour, Payman; Duronio, Vincent

    p53 is a tumor suppressor protein which is either lost or inactivated in a large majority of tumors. The small molecule 2-phenylethynesulfonamide (PES) was originally identified as the inhibitor of p53 effects on the mitochondrial death pathway. In this report we demonstrate that p53 protein from PES-treated cells was detected in reduced mobility bands between molecular weights 95–220 kDa. Resolution of p53 aggregates on urea gel was unable to reduce the high molecular weight p53 aggregates, which were shown to be primarily located in the nucleus. Therefore, our data suggest that PES exerts its effects through covalent cross-linking and nuclear retentionmore » of p53. - Highlights: • p53 protein is in high molecular weight complexes in the nucleus of PES-treated cells. • PES is a drug that inhibits pro-apoptotic p53 action at the mitochondria. • We propose that PES action involves cross-linking and nuclear retention of p53.« less

  6. Recognition of Local DNA Structures by p53 Protein

    PubMed Central

    Brázda, Václav; Coufal, Jan

    2017-01-01

    p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

  7. Transcriptional repression of epithelial cell adhesion molecule (EpCAM) contributes to p53 control of breast cancer invasion

    PubMed Central

    Sankpal, NV; Willman, MW; Fleming, TP; Mayfield, J; Gillanders, WE

    2014-01-01

    p53 is a tumor suppressor gene with well-characterized roles in cell cycle regulation, apoptosis and the maintenance of genome stability. Recent evidence suggests that p53 may also contribute to the regulation of migration and invasion. Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein that is overexpressed in the majority of human epithelial carcinomas, including breast and colorectal carcinomas. We demonstrate by chromatin immunoprecipitation assays that p53 interacts with a candidate p53 binding site within the EpCAM gene. p53-mediated transcriptional repression of EpCAM was confirmed in gain-of-function, and loss-of-function experimental systems. Induction of wildtype p53 was associated with a significant dose-dependent decrease in EpCAM expression; conversely, specific ablation of p53 was associated with a significant increase in EpCAM expression. At the functional level, specific ablation of p53 expression is associated with increased breast cancer invasion, and this effect is abrogated by concomitant specific ablation of EpCAM expression. Taken together, these biochemical and functional data are the first demonstration that (1) wildtype p53 protein binds to a response element within the EpCAM gene and negatively regulates EpCAM expression, and (2) transcriptional repression of EpCAM contributes to p53 control of breast cancer invasion. PMID:19141643

  8. Dihydroptychantol A, a macrocyclic bisbibenzyl derivative, induces autophagy and following apoptosis associated with p53 pathway in human osteosarcoma U2OS cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li Xia; School of Ocean, Shandong University, Weihai 264209; Wu, William K.K.

    2011-03-01

    Dihydroptychantol A (DHA), a novel macrocyclic bisbibenzyl compound extracted from liverwort Asterella angusta, has antifungal and multi-drug resistance reversal properties. Here, the chemically synthesized DHA was employed to test its anti-cancer activities in human osteosarcoma U2OS cells. Our results demonstrated that DHA induced autophagy followed by apoptotic cell death accompanied with G{sub 2}/M-phase cell cycle arrest in U2OS cells. DHA-induced autophagy was morphologically characterized by the formation of double membrane-bound autophagic vacuoles recognizable at the ultrastructural level. DHA also increased the levels of LC3-II, a marker of autophagy. Surprisingly, DHA-mediated apoptotic cell death was potentiated by the autophagy inhibitor 3-methyladenine,more » suggesting that autophagy may play a protective role that impedes the eventual cell death. Furthermore, p53 was shown to be involved in DHA-meditated autophagy and apoptosis. In this connection, DHA increased nuclear expression of p53, induced p53 phosphorylation, and upregulated p53 target gene p21{sup Waf1/Cip1}. In contrast, cytoplasmic p53 was reduced by DHA, which contributed to the stimulation of autophagy. In relation to the cell cycle, DHA decreased the expression of cyclin B{sub 1}, a cyclin required for progression through the G{sub 2}/M phase. Taken together, DHA induces G{sub 2}/M-phase cell cycle arrest and apoptosis in U2OS cells. DHA-induced apoptosis was preceded by the induction of protective autophagy. DHA-mediated autophagy and apoptosis are associated with the cytoplasmic and nuclear functions of p53.« less

  9. Mutant p53 protein localized in the cytoplasm inhibits autophagy.

    PubMed

    Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

    2008-10-01

    The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

  10. Mutant p53 Promotes Tumor Cell Malignancy by Both Positive and Negative Regulation of the Transforming Growth Factor β (TGF-β) Pathway*

    PubMed Central

    Ji, Lei; Xu, Jinjin; Liu, Jian; Amjad, Ali; Zhang, Kun; Liu, Qingwu; Zhou, Lei; Xiao, Jianru; Li, Xiaotao

    2015-01-01

    Specific p53 mutations abrogate tumor-suppressive functions by gaining new abilities to promote tumorigenesis. Inactivation of p53 is known to distort TGF-β signaling, which paradoxically displays both tumor-suppressive and pro-oncogenic functions. The molecular mechanisms of how mutant p53 simultaneously antagonizes the tumor-suppressive and synergizes the tumor-promoting function of the TGF-β pathway remain elusive. Here we demonstrate that mutant p53 differentially regulates subsets of TGF-β target genes by enhanced binding to the MH2 domain in Smad3 upon the integration of ERK signaling, therefore disrupting Smad3/Smad4 complex formation. Silencing Smad2, inhibition of ERK, or introducing a phosphorylation-defective mutation at Ser-392 in p53 abrogates the R175H mutant p53-dependent regulation of these TGF-β target genes. Our study shows a mechanism to reconcile the seemingly contradictory observations that mutant p53 can both attenuate and cooperate with the TGF-β pathway to promote cancer cell malignancy in the same cell type. PMID:25767119

  11. Non-Thermal Atmospheric Pressure Plasma Preferentially Induces Apoptosis in p53-Mutated Cancer Cells by Activating ROS Stress-Response Pathways

    PubMed Central

    Ma, Yonghao; Ha, Chang Seung; Hwang, Seok Won; Lee, Hae June; Kim, Gyoo Cheon; Lee, Kyo-Won; Song, Kiwon

    2014-01-01

    Non-thermal atmospheric pressure plasma (NTAPP) is an ionized gas at room temperature and has potential as a new apoptosis-promoting cancer therapy that acts by generating reactive oxygen species (ROS). However, it is imperative to determine its selectivity and standardize the components and composition of NTAPP. Here, we designed an NTAPP-generating apparatus combined with a He gas feeding system and demonstrated its high selectivity toward p53-mutated cancer cells. We first determined the proper conditions for NTAPP exposure to selectively induce apoptosis in cancer cells. The apoptotic effect of NTAPP was greater for p53-mutated cancer cells; artificial p53 expression in p53-negative HT29 cells decreased the pro-apoptotic effect of NTAPP. We also examined extra- and intracellular ROS levels in NTAPP-treated cells to deduce the mechanism of NTAPP action. While NTAPP-mediated increases in extracellular nitric oxide (NO) did not affect cell viability, intracellular ROS increased under NTAPP exposure and induced apoptotic cell death. This effect was dose-dependently reduced following treatment with ROS scavengers. NTAPP induced apoptosis even in doxorubicin-resistant cancer cell lines, demonstrating the feasibility of NTAPP as a potent cancer therapy. Collectively, these results strongly support the potential of NTAPP as a selective anticancer treatment, especially for p53-mutated cancer cells. PMID:24759730

  12. Intestinal Cell Proliferation and Senescence Are Regulated by Receptor Guanylyl Cyclase C and p21*

    PubMed Central

    Basu, Nirmalya; Saha, Sayanti; Khan, Imran; Ramachandra, Subbaraya G.; Visweswariah, Sandhya S.

    2014-01-01

    Guanylyl cyclase C (GC-C) is expressed in intestinal epithelial cells and serves as the receptor for bacterial heat-stable enterotoxin (ST) peptides and the guanylin family of gastrointestinal hormones. Activation of GC-C elevates intracellular cGMP, which modulates intestinal fluid-ion homeostasis and differentiation of enterocytes along the crypt-villus axis. GC-C activity can regulate colonic cell proliferation by inducing cell cycle arrest, and mice lacking GC-C display increased cell proliferation in colonic crypts. Activation of GC-C by administration of ST to wild type, but not Gucy2c−/−, mice resulted in a reduction in carcinogen-induced aberrant crypt foci formation. In p53-deficient human colorectal carcinoma cells, ST led to a transcriptional up-regulation of p21, the cell cycle inhibitor, via activation of the cGMP-responsive kinase PKGII and p38 MAPK. Prolonged treatment of human colonic carcinoma cells with ST led to nuclear accumulation of p21, resulting in cellular senescence and reduced tumorigenic potential. Our results, therefore, identify downstream effectors for GC-C that contribute to regulating intestinal cell proliferation. Thus, genomic responses to a bacterial toxin can influence intestinal neoplasia and senescence. PMID:24217248

  13. Pleurotus ostreatus inhibits proliferation of human breast and colon cancer cells through p53-dependent as well as p53-independent pathway

    PubMed Central

    JEDINAK, ANDREJ; SLIVA, DANIEL

    2009-01-01

    In spite of the global consumption of mushrooms, only two epidemiological studies demonstrated an inverse correlation between mushroom intake and the risk of cancer. Therefore, in the present study we evaluated whether extracts from edible mushrooms Agaricus bisporus (portabella), Flammulina velutipes (enoki), Lentinula edodes (shiitake) and Pleurotus ostreatus (oyster) affect the growth of breast and colon cancer cells. Here, we identified as the most potent, P. ostreatus (oyster mushroom) which suppressed proliferation of breast cancer (MCF-7, MDA-MB-231) and colon cancer (HT-29, HCT-116) cells, without affecting proliferation of epithelial mammary MCF-10A and normal colon FHC cells. Flow cytometry revealed that the inhibition of cell proliferation by P. ostreatus was associated with the cell cycle arrest at G0/G1 phase in MCF-7 and HT-29 cells. Moreover, P. ostreatus induced the expression of the tumor suppressor p53 and cyclin-dependent kinase inhibitor p21(CIP1/WAF1), whereas inhibited the phosphorylation of retinoblastoma Rb protein in MCF-7 cells. In addition, P. ostreatus also up-regulated expression of p21 and inhibited Rb phosphorylation in HT-29 cells, suggesting that that P. ostreatus suppresses the proliferation of breast and colon cancer cells via p53-dependent as well as p53-independent pathway. In conclusion, our results indicated that the edible oyster mushroom has potential therapeutic/preventive effects on breast and colon cancer. PMID:19020765

  14. Concordant p53 and mdm-2 protein expression in vulvar squamous cell carcinoma and adjacent lichen sclerosus.

    PubMed

    Carlson, J A; Amin, S; Malfetano, J; Tien, A T; Selkin, B; Hou, J; Goncharuk, V; Wilson, V L; Rohwedder, A; Ambros, R; Ross, J S

    2001-06-01

    To determine if carcinogenic events in vulvar skin precede the onset of morphologic atypia, the authors investigated for derangements in DNA content, cell proliferation, and cell death in vulvar carcinomas and surrounding skin in 140 samples of tumor and surrounding skin collected from 35 consecutive vulvectomy specimen for squamous cell carcinoma (SCC) or vulvar intraepithelial neoplasia (VIN) 3. Vulvar non-cancer excisions were used as controls. Investigations consisted of histologic classification and measurement of 9 variables--epidermal thickness (acanthosis and rete ridge length), immunolabeling index (LI) for 3 proteins (p53 protein, Ki-67, and mdm-2), pattern of p53 expression (dispersed vs. compact), DNA content index, and presence of aneuploidy by image analysis and apoptotic rate by Apotag labeling. Significant positive correlations were found for all nine variables studied versus increasing histologic severity in two proposed histologic stepwise models of vulvar carcinogenesis (lichen sclerosus (LS) and VIN 3 undifferentiated associated SCC groups). High p53 LI (>25) and the compact pattern of p53 expression (suspected oncoprotein) significantly correlated with LS and its associated vulvar samples compared with samples not associated with LS (P < or = 0.001). Furthermore, p53 LI, mdm-2 LI, and pattern of p53 expression were concordant between patient matched samples of LS and SCC. In addition, mdm-2 LI significantly correlated with dispersed pattern p53 LI suggesting a response to wild-type p53 protein accumulation. These findings support the hypothesis that neoplastic transformation occurs in sequential steps and compromises proteins involved in the cell cycle control. Concordance of p53 and mdm-2 protein expression in LS and adjacent SCC provides evidence that LS can act as a precursor lesion in the absence of morphologic atypia. Overexpression of mdm-2 with stabilization and inactivation of p53 protein may provide an alternate pathway for vulvar carcinogenesis.

  15. p53 death signal is mainly mediated by Nuc1(EndoG) in the yeast Saccharomyces cerevisiae.

    PubMed

    Palermo, Vanessa; Mangiapelo, Eleonora; Piloto, Cristina; Pieri, Luisa; Muscolini, Michela; Tuosto, Loretta; Mazzoni, Cristina

    2013-11-01

    The tumor suppressor p53 plays a central role in the regulation of cellular growth and apoptosis. In the yeast Saccharomyces cerevisiae, the overexpression of the human p53 leads to growth inhibition and apoptotic cell death on minimal medium. In the present work, we show that p53-expressing cells are more susceptible to cell death after an apoptotic stimulus such as H2O2. The analysis of mutants involved in yeast apoptosis-like death suggests that the observed cell death is Yca1 independent and mainly mediated through Nuc1p. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  16. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    PubMed

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  17. 53BP1 loss suppresses the radiosensitizing effect of icotinib hydrochloride in colorectal cancer cells.

    PubMed

    Huang, Ai; Yao, Jing; Liu, Tao; Lin, Zhenyu; Zhang, Sheng; Zhang, Tao; Ma, Hong

    2018-04-01

    This study aimed to investigate the influence of the expression of P53-binding protein 1 (53BP1), a key component in DNA damage repair pathways, on the radiosensitizing effect of icotinib hydrochloride in colorectal cancer and to elucidate the mechanisms underlying this influence. Real-time RT-PCR and Western blotting were performed to verify the gene-knockout effect of 53BP1 small hairpin RNA (ShRNA), and colony formation assay was employed to investigate the influence of 53BP1 downregulation on the radiosensitizing effect of icotinib hydrochloride in HCT116 cells. Cell apoptosis, cell cycle distributions, and histone H2AX (γ-H2AX) fluorescence foci after 53BP1 knockdown were evaluated. Relative protein expression in the ataxia telangiectasia mutated kinase (ATM)-checkpoint kinase-2 (CHK2)-P53 pathway was measured by Western blot analysis to unravel the molecular mechanisms linking the pathway to the above phenomena. Icotinib hydrochloride increased the radiosensitivity of HCT116 cells; however, this effect was suppressed by the downregulation of 53BP1 expression, a change that inhibited cell apoptosis, increased the percentage of HCT116 cells arrested in S-phase and inhibited the protein expression of key molecules in the ATM-CHK2-P53 apoptotic pathway. Our studies confirmed that the loss of 53BP1 serves as a negative regulator of the radiosensitizing effect of icotinib in part by suppressing the ATM-CHK2-P53 apoptotic pathway.

  18. Differential programming of p53-deficient embryonic cells during rotenone block

    EPA Science Inventory

    Mitochondrial dysfunction has been implicated in chemical toxicities. The present study used an in vitro model to investigate the differential expression of metabolic pathways during cellular stress in p53- efficient embryonic fibroblasts compared to p53-deficient cells. These c...

  19. Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santhanam, U.; Ray, A.; Sehgal, P.B.

    1991-09-01

    The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less

  20. Cell cycle regulatory gene abnormalities are important determinants of leukemogenesis and disease biology in adult acute lymphoblastic leukemia.

    PubMed

    Stock, W; Tsai, T; Golden, C; Rankin, C; Sher, D; Slovak, M L; Pallavicini, M G; Radich, J P; Boldt, D H

    2000-04-01

    To test the hypothesis that cell cycle regulatory gene abnormalities are determinants of clinical outcome in adult acute lymphoblastic leukemia (ALL), we screened lymphoblasts from patients on a Southwest Oncology Group protocol for abnormalities of the genes, retinoblastoma (Rb), p53, p15(INK4B), and p16(INK4A). Aberrant expression occurred in 33 (85%) patients in the following frequencies: Rb, 51%; p16(INK4A), 41%; p53, 26%. Thirteen patients (33%) had abnormalities in 2 or more genes. Outcomes were compared in patients with 0 to 1 abnormality versus patients with multiple abnormalities. The 2 groups did not differ in a large number of clinical and laboratory characteristics. The CR rates for patients with 0 to 1 and multiple abnormalities were similar (69% and 54%, respectively). Patients with 0 to 1 abnormality had a median survival time of 25 months (n = 26; 95% CI, 13-46 months) versus 8 months (n = 13; 95% CI, 4-12 months) for those with multiple abnormalities (P <.01). Stem cells (CD34+lin-) were isolated from adult ALL bone marrows and tested for p16(INK4A) expression by immunocytochemistry. In 3 of 5 patients lymphoblasts and sorted stem cells lacked p16(INK4A) expression. In 2 other patients only 50% of sorted stem cells expressed p16(INK4A). By contrast, p16 expression was present in the CD34+ lin- compartment in 95% (median) of 9 patients whose lymphoblasts expressed p16(INK4A). Therefore, cell cycle regulatory gene abnormalities are frequently present in adult ALL lymphoblasts, and they may be important determinants of disease outcome. The presence of these abnormalities in the stem compartment suggests that they contribute to leukemogenesis. Eradication of the stem cell subset harboring these abnormalities may be important to achieve cure.

Top