NOTCH1 Is Aberrantly Activated in Chronic Lymphocytic Leukemia Hematopoietic Stem Cells.

PubMed

Di Ianni, Mauro; Baldoni, Stefano; Del Papa, Beatrice; Aureli, Patrizia; Dorillo, Erica; De Falco, Filomena; Albi, Elisa; Varasano, Emanuela; Di Tommaso, Ambra; Giancola, Raffaella; Accorsi, Patrizia; Rotta, Gianluca; Rompietti, Chiara; Silva Barcelos, Estevão Carlos; Campese, Antonio Francesco; Di Bartolomeo, Paolo; Screpanti, Isabella; Rosati, Emanuela; Falzetti, Franca; Sportoletti, Paolo

2018-01-01

To investigate chronic lymphocytic leukemia (CLL)-initiating cells, we assessed NOTCH1 mutation/expression in hematopoietic stem cells (HSCs). In NOTCH1- mutated CLL, we detected subclonal mutations in 57% CD34+/CD38- HSCs. NOTCH1 mutation was present in 66% CD34+/CD38+ progenitor cells displaying an increased mutational burden compared to HSCs. Flow cytometric analysis revealed significantly higher NOTCH1 activation in CD34+/CD38- and CD34+/CD38+ cells from CLL patients, regardless NOTCH1 mutation compared to healthy donors. Activated NOTCH1 resulted in overexpression of the NOTCH1 target c-MYC. We conclude that activated NOTCH1 is an early event in CLL that may contribute to aberrant HSCs in this disease.

Factors affecting the loss of MED12-mutated leiomyoma cells during in vitro growth.

PubMed

Bloch, Jeannine; Holzmann, Carsten; Koczan, Dirk; Helmke, Burkhard Maria; Bullerdiek, Jörn

2017-05-23

Uterine leiomyomas (UL) are the most prevalent symptomatic human tumors at all and somatic mutations of the gene encoding mediator subcomplex 12 (MED12) constitute the most frequent driver mutations in UL. Recently, a rapid loss of mutated cells during in vitro growth of UL-derived cell cultures was reported, resulting in doubts about the benefits of UL-derived cell cultures. To evaluate if the rapid loss of MED12-mutated cells in UL cell cultures depends on in vitro passaging, we set up cell cultures from nine UL from 40-50 year old Caucasian patients with at least one UL. Cultured UL cells were investigated for loss of MED12-mutated cells. Genetic characterization of native tumor samples and adjacent myometrium was done by array analysis. "Aged" primary cultures without passaging were compared to cells of three subsequent passages. Comparative analyses of the mutated/non-mutated ratios between native tissue, primary cells, and cultured tumor cells revealed a clear decrease of MED12-mutated cells. None of the tumors showed gross alterations of the array profiles, excluding the presence of gross genomic imbalances besides the MED12 mutations as a reason for the intertumoral variation in the loss of MED12-mutated cells. Albeit at a lesser rate, loss of MED12-mutated cells from cell cultures of UL occurs even without passaging thus indicating the requirement of soluble factors or matrix components lacking in vitro. Identification of these factors can help to understand the mechanisms of the growth of the most frequent type of uterine leiomyomas and to decipher novel drug targets.

Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

PubMed Central

Cheng, J; Haas, M

1990-01-01

Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

Functionomics of NCC mutations in Gitelman syndrome using a novel mammalian cell-based activity assay.

PubMed

Valdez-Flores, Marco A; Vargas-Poussou, Rosa; Verkaart, Sjoerd; Tutakhel, Omar A Z; Valdez-Ortiz, Angel; Blanchard, Anne; Treard, Cyrielle; Hoenderop, Joost G J; Bindels, René J M; Jeleń, Sabina

2016-12-01

Gitelman syndrome (GS) is an autosomal recessive salt-wasting tubular disorder resulting from loss-of-function mutations in the thiazide-sensitive NaCl cotransporter (NCC). Functional analysis of these mutations has been limited to the use of Xenopus laevis oocytes. The aim of the present study was, therefore, to analyze the functional consequences of NCC mutations in a mammalian cell-based assay, followed by analysis of mutated NCC protein expression as well as glycosylation and phosphorylation profiles using human embryonic kidney (HEK) 293 cells. NCC activity was assessed with a novel assay based on thiazide-sensitive iodide uptake in HEK293 cells expressing wild-type or mutant NCC (N59I, R83W, I360T, C421Y, G463R, G731R, L859P, or R861C). All mutations caused a significantly lower NCC activity. Immunoblot analysis of the HEK293 cells revealed that 1) all NCC mutants have decreased NCC protein expression; 2) mutant N59I, R83W, I360T, C421Y, G463R, and L859P have decreased NCC abundance at the plasma membrane; 3) mutants C421Y and L859P display impaired NCC glycosylation; and 4) mutants N59I, R83W, C421Y, C731R, and L859P show affected NCC phosphorylation. In conclusion, we developed a mammalian cell-based assay in which NCC activity assessment together with a profiling of mutated protein processing aid our understanding of the pathogenic mechanism of the NCC mutations. Copyright © 2016 the American Physiological Society.

CRISPR/Cas9-mediated ASXL1 mutations in U937 cells disrupt myeloid differentiation

PubMed Central

Wu, Zhi-Jie; Zhao, Xin; Banaszak, Lauren G.; Gutierrez-Rodrigues, Fernanda; Keyvanfar, Keyvan; Gao, Shou-Guo; Raffo, Diego Quinones; Kajigaya, Sachiko; Young, Neal S.

2018-01-01

Additional sex combs-like 1 (ASXL1) is a well-known tumor suppressor gene and epigenetic modifier. ASXL1 mutations are frequent in myeloid malignances; these mutations are risk factors for the development of myelodysplasia and also appear as small clones during normal aging. ASXL1 appears to act as an epigenetic regulator of cell survival and myeloid differentiation; however, the molecular mechanisms underlying the malignant transformation of cells with ASXL1 mutations are not well defined. Using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein-9 nuclease (Cas9) genome editing, heterozygous and homozygous ASXL1 mutations were introduced into human U937 leukemic cells. Comparable cell growth and cell cycle progression were observed between wild-type (WT) and ASXL1-mutated U937 cells. Drug-induced cytotoxicity, as measured by growth inhibition and apoptosis in the presence of the cell-cycle active agent 5-fluorouracil, was variable among the mutated clones but was not significantly different from WT cells. In addition, ASXL1-mutated cells exhibited defects in monocyte/macrophage differentiation. Transcriptome analysis revealed that ASXL1 mutations altered differentiation of U937 cells by disturbing genes involved in myeloid differentiation, including cytochrome B-245 β chain and C-type lectin domain family 5, member A. Dysregulation of numerous gene sets associated with cell death and survival were also observed in ASXL1-mutated cells. These data provide evidence regarding the underlying molecular mechanisms induced by mutated ASXL1 in leukemogenesis. PMID:29532865

Somatic mutation detection in human biomonitoring.

PubMed

Olsen, L S; Nielsen, L R; Nexø, B A; Wassermann, K

1996-06-01

Somatic cell gene mutation arising in vivo may be considered to be a biomarker for genotoxicity. Assays detecting mutations of the haemoglobin and glycophorin A genes in red blood cells and of the hypoxanthine-guanine phosphoribosyltransferase and human leucocyte antigenes in T-lymphocytes are available in humans. This MiniReview describes these assays and their application to studies of individuals exposed to genotoxic agents. Moreover, with the implementation of techniques of molecular biology mutation spectra can now be defined in addition to the quantitation of in vivo mutant frequencies. We describe current screening methods for unknown mutations, including the denaturing gradient gel electrophoresis, single strand conformation polymorphism analysis, heteroduplex analysis, chemical modification techniques and enzymatic cleavage methods. The advantage of mutation detection as a biomarker is that it integrates exposure and sensitivity in one measurement. With the analysis of mutation spectra it may thus be possible to identify the causative genotoxic agent.

MOLECULAR ANALYSIS OF MUTATIONS INDUCED BY MUTAGENS IN THE TK GENE OF MOUSE LYMPHOMA CELLS

EPA Science Inventory

MOLECULAR ANALYSIS OF MUTATIONS INDUCED BY BROMATE AND N- ETHYL-N-NITROSOUREA IN THE TK GENE OF MOUSE L YMPHOMA CELLS

The mouse lymphoma assay is widely used to identify chemical mutagens The Tk +1- gene located on an autosome in mouse lymphoma cells may recover a wide ra...

Integrated single-cell genetic and transcriptional analysis suggests novel drivers of chronic lymphocytic leukemia

PubMed Central

Wang, Lili; Fan, Jean; Francis, Joshua M.; Georghiou, George; Hergert, Sarah; Li, Shuqiang; Gambe, Rutendo; Zhou, Chensheng W.; Yang, Chunxiao; Xiao, Sheng; Cin, Paola Dal; Bowden, Michaela; Kotliar, Dylan; Shukla, Sachet A.; Brown, Jennifer R.; Neuberg, Donna; Alessi, Dario R.; Zhang, Cheng-Zhong; Kharchenko, Peter V.; Livak, Kenneth J.; Wu, Catherine J.

2017-01-01

Intra-tumoral genetic heterogeneity has been characterized across cancers by genome sequencing of bulk tumors, including chronic lymphocytic leukemia (CLL). In order to more accurately identify subclones, define phylogenetic relationships, and probe genotype–phenotype relationships, we developed methods for targeted mutation detection in DNA and RNA isolated from thousands of single cells from five CLL samples. By clearly resolving phylogenic relationships, we uncovered mutated LCP1 and WNK1 as novel CLL drivers, supported by functional evidence demonstrating their impact on CLL pathways. Integrative analysis of somatic mutations with transcriptional states prompts the idea that convergent evolution generates phenotypically similar cells in distinct genetic branches, thus creating a cohesive expression profile in each CLL sample despite the presence of genetic heterogeneity. Our study highlights the potential for single-cell RNA-based targeted analysis to sensitively determine transcriptional and mutational profiles of individual cancer cells, leading to increased understanding of driving events in malignancy. PMID:28679620

TET2 mutations in B cells of patients affected by angioimmunoblastic T-cell lymphoma.

PubMed

Schwartz, Friederike H; Cai, Qian; Fellmann, Eva; Hartmann, Sylvia; Mäyränpää, Mikko I; Karjalainen-Lindsberg, Marja-Liisa; Sundström, Christer; Scholtysik, René; Hansmann, Martin-Leo; Küppers, Ralf

2017-06-01

Angioimmunoblastic T-cell lymphomas (AITLs) frequently carry mutations in the TET2 and IDH2 genes. TET2 mutations represent early genetic lesions as they had already been detected in haematopoietic precursor cells of AITL patients. We show by analysis of whole-tissue sections and microdissected PD1 + cells that the frequency of TET2-mutated AITL is presumably even higher than reported (12/13 cases in our collection; 92%). In two-thirds of informative AITLs (6/9), a fraction of B cells was also TET2-mutated. Investigation of four AITLs by TET2 and IGHV gene sequencing of single microdissected B cells showed that between 10% and 60% of polyclonal B cells in AITL lymph nodes harboured the identical TET2 mutations of the respective T-cell lymphoma clone. Thus, TET2-mutated haematopoietic precursor cells in AITL patients not only give rise to the T-cell lymphoma but also generate a large population of mutated mature B cells. Future studies will show whether this is a reason why AITL patients frequently also develop B-cell lymphomas. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

PubMed

Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

2011-11-24

To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

Deleterious CHEK2 1100delC and L303X mutants identified among 38 human breast cancer cell lines.

PubMed

Wasielewski, Marijke; Hanifi-Moghaddam, Pejman; Hollestelle, Antoinette; Merajver, Sofia D; van den Ouweland, Ans; Klijn, Jan G M; Ethier, Stephen P; Schutte, Mieke

2009-01-01

The CHEK2 protein plays a major role in the regulation of DNA damage response pathways. Mutations in the CHEK2 gene, in particular 1100delC, have been associated with increased cancer risks, but the precise function of CHEK2 mutations in carcinogenesis is not known. Human cancer cell lines with CHEK2 mutations are therefore of main interest. Here, we have sequenced 38 breast cancer cell lines for mutations in the CHEK2 gene and identified two cell lines with deleterious CHEK2 mutations. Cell line UACC812 has a nonsense truncating mutation in the CHEK2 kinase domain (L303X) and cell line SUM102PT has the well-known oncogenic CHEK2 1100delC founder mutation. Immunohistochemical analysis revealed that the two CHEK2 mutant cell lines expressed neither CHEK2 nor P-Thr(68) CHEK2 proteins, implying abrogation of normal CHEK2 DNA repair functions. Cell lines UACC812 and SUM102PT thus are the first human CHEK2 null cell lines reported and should therefore be a major help in further unraveling the function of CHEK2 mutations in carcinogenesis.

A novel natural killer cell line (KHYG-1) from a patient with aggressive natural killer cell leukemia carrying a p53 point mutation.

PubMed

Yagita, M; Huang, C L; Umehara, H; Matsuo, Y; Tabata, R; Miyake, M; Konaka, Y; Takatsuki, K

2000-05-01

We present the establishment of a natural killer (NK) leukemia cell line, designated KHYG-1, from the blood of a patient with aggressive NK leukemia, which both possessed the same p53 point mutation. The immunophenotype of the primary leukemia cells was CD2+, surface CD3-, cytoplasmic CD3epsilon+, CD7+, CD8alphaalpha+, CD16+, CD56+, CD57+ and HLA-DR+. A new cell line (KHYG-1) was established by culturing peripheral leukemia cells with 100 units of recombinant interleukin (IL)-2. The KHYG-1 cells showed LGL morphology with a large nucleus, coarse chromatin, conspicuous nucleoli, and abundant basophilic cytoplasm with many azurophilic granules. The immunophenotype of KHYG-1 cells was CD1-, CD2+, surface CD3-, cytoplasmic CD3epsilon+, CD7+, CD8alphaalpha+, CD16-, CD25-, CD33+, CD34-, CD56+, CD57-, CD122+, CD132+, and TdT-. Southern blot analysis of these cells revealed a normal germline configuration for the beta, delta, and gamma chains of the T cell receptor and the immunoglobulin heavy-chain genes. Moreover, the KHYG-1 cells displayed NK cell activity and IL-2-dependent proliferation in vitro, suggesting that they are of NK cell origin. Epstein-Barr virus (EBV) DNA was not detected in KHYG-1 cells by Southern blot analysis with a terminal repeat probe from an EBV genome. A point mutation in exon 7 of the p53 gene was detected in the KHYG-1 cells by PCR/SSCP analysis, and direct sequencing revealed the conversion of C to T at nucleotide 877 in codon 248. The primary leukemia cells also carried the same point mutation. Although the precise role of the p53 point mutation in leukemogenesis remains to be clarified, the establishment of an NK leukemia cell line with a p53 point mutation could be valuable in the study of leukemogenesis.

Mutation site and context dependent effects of ESR1 mutation in genome-edited breast cancer cell models.

PubMed

Bahreini, Amir; Li, Zheqi; Wang, Peilu; Levine, Kevin M; Tasdemir, Nilgun; Cao, Lan; Weir, Hazel M; Puhalla, Shannon L; Davidson, Nancy E; Stern, Andrew M; Chu, David; Park, Ben Ho; Lee, Adrian V; Oesterreich, Steffi

2017-05-23

Mutations in the estrogen receptor alpha (ERα) 1 gene (ESR1) are frequently detected in ER+ metastatic breast cancer, and there is increasing evidence that these mutations confer endocrine resistance in breast cancer patients with advanced disease. However, their functional role is not well-understood, at least in part due to a lack of ESR1 mutant models. Here, we describe the generation and characterization of genome-edited T47D and MCF7 breast cancer cell lines with the two most common ESR1 mutations, Y537S and D538G. Genome editing was performed using CRISPR and adeno-associated virus (AAV) technologies to knock-in ESR1 mutations into T47D and MCF7 cell lines, respectively. Various techniques were utilized to assess the activity of mutant ER, including transactivation, growth and chromatin-immunoprecipitation (ChIP) assays. The level of endocrine resistance was tested in mutant cells using a number of selective estrogen receptor modulators (SERMs) and degraders (SERDs). RNA sequencing (RNA-seq) was employed to study gene targets of mutant ER. Cells with ESR1 mutations displayed ligand-independent ER activity, and were resistant to several SERMs and SERDs, with cell line and mutation-specific differences with respect to magnitude of effect. The SERD AZ9496 showed increased efficacy compared to other drugs tested. Wild-type and mutant cell co-cultures demonstrated a unique evolution of mutant cells under estrogen deprivation and tamoxifen treatment. Transcriptome analysis confirmed ligand-independent regulation of ERα target genes by mutant ERα, but also identified novel target genes, some of which are involved in metastasis-associated phenotypes. Despite significant overlap in the ligand-independent genes between Y537S and D538G, the number of mutant ERα-target genes shared between the two cell lines was limited, suggesting context-dependent activity of the mutant receptor. Some genes and phenotypes were unique to one mutation within a given cell line, suggesting a mutation-specific effect. Taken together, ESR1 mutations in genome-edited breast cancer cell lines confer ligand-independent growth and endocrine resistance. These biologically relevant models can be used for further mechanistic and translational studies, including context-specific and mutation site-specific analysis of the ESR1 mutations.

Extending Jak2V617F and MplW515 mutation analysis to single hematopoietic colonies and B and T lymphocytes.

PubMed

Pardanani, Animesh; Lasho, Terra L; Finke, Christy; Mesa, Ruben A; Hogan, William J; Ketterling, Rhett P; Gilliland, Dwight Gary; Tefferi, Ayalew

2007-09-01

JAK2V617F and MPLW515L/K are myeloproliferative disorder (MPD)-associated mutations. We genotyped 552 individual hematopoietic colonies obtained by CD34+ cell culture from 16 affected patients (13 JAK2V617F and 3 MPLW515L/K) to determine (a) the proportion of colonies harboring a particular mutation in the presence or absence of cytokines, (b) the lineage distribution of endogenous colonies for each mutation, and (c) the differences (if any) in the pattern of mutation among the various MPDs, as established by genotyping of individual colonies. Genotyping analysis revealed cohabitation of mutation-negative and mutation-positive endogenous colonies in polycythemia vera as well as other MPDs. Culture of progenitor cells harboring MPLW515L/K yielded virtually no endogenous erythroid colonies in contrast to JAK2V617F-harboring progenitor cells. The mutation pattern (i.e., relative distribution of homozygous, heterozygous, or wild-type colonies) was not a distinguishing feature among the MPDs, and MPLW515 mutations were detected in B and/or T lymphocytes in all three patients tested. These observations suggest that clonal myelopoiesis antedates acquisition of JAK2V617F or MPLW515L/K mutations and that the latter is acquired in a lympho-myeloid progenitor cell.

Cytology smears as diagnostic material for EGFR gene testing in non-small cell lung cancer.

PubMed

Powrózek, Tomasz; Krawczyk, Paweł; Pankowski, Juliusz; Reszka, Katarzyna; Jakubiak, Magdalena; Obrochta, Anna; Wojas-Krawczyk, Kamila; Buczkowski, Jarosław; Milanowski, Janusz

2015-11-14

Cytology smears can be effectively used for EGFR mutation testing in the qualification of NSCLC patients for EGFR tyrosine kinase inhibitor therapy. However, tissue specimens are preferred for EGFR mutation analysis. The aim of this study was to estimate the effectiveness of the real-time PCR method for EGFR testing in histology and cytology materials obtained simultaneously from NSCLC patients. Fourteen adenocarcinoma patients with EGFR-mutation-positive primary tumor tissues were included in the study. Corresponding cytological smears of metastatic lymph nodes obtained by EBUS-TBNA were examined. EGFR Mutation Analysis Kit (EntroGen, USA) and real-time PCR (m2000rt system, Abbott, USA) were used for EGFR mutation analysis in both types of material. In primary tumor tissues, 12 deletions in exon 19 and 2 substitutions in exon 21 (L858R mutation) of the EGFR gene were found. Except for 1 deletion in exon 19, the same EGFR gene mutations were detected in all corresponding cytology samples. The percentage of tumor cells, DNA concentration, percentage of mutated DNA as well as ΔCt values were similar in cytology slides and histology material. In both types of materials, no significant correlations were found between the percentage of tumor cells and the percentage of mutated DNA nor between the DNA concentration and the percentage of mutated DNA. We demonstrated the high effectiveness of a sensitive real-time PCR method in EGFR gene mutation detection in cytology smears.

The value of mutational profiling of the cytocentrifugation supernatant fluid from fine-needle aspiration of pancreatic solid mass lesions.

PubMed

Deftereos, Georgios; Finkelstein, Sydney D; Jackson, Sara A; Ellsworth, Eric M G; Krishnamurti, Uma; Liu, Yulin; Silverman, Jan F; Binkert, Candy R; Ujevich, Beth A; Mohanty, Alok

2014-04-01

Fine-needle aspiration (FNA) of pancreatic solid masses can be significantly impacted by sampling variation. Molecular analysis of tumor DNA can be an aid for more definitive diagnosis. The aim of this study was to evaluate how molecular analysis of the cell-free cytocentrifugation supernatant DNA can help reduce sampling variability and increase diagnostic yield. Twenty-three FNA smears from pancreatic solid masses were performed. Remaining aspirates were rinsed for preparation of cytocentrifuged slides or cell blocks. DNA was extracted from supernatant fluid and assessed for DNA quantity spectrophotometrically and for amplifiability by quantitative PCR (qPCR). Supernatants with adequate DNA were analyzed for mutations using PCR/capillary electrophoresis for a broad panel of markers (KRAS point mutation by sequencing, microsatellite fragment analysis for loss of heterozygosity (LOH) of 16 markers at 1p, 3p, 5q, 9p, 10q, 17p, 17q, 21q, and 22q). In selected cases, microdissection of stained cytology smears and/or cytocentrifugation cellular slides were analyzed and compared. In all, 5/23 samples cytologically confirmed as adenocarcinoma showed detectable mutations both in the microdissected slide-based cytology cells and in the cytocentrifugation supernatant. While most mutations detected were present in both microdissected slides and supernatant fluid specimens, the latter showed additional mutations supporting greater sensitivity for detecting relevant DNA damage. Clonality for individual marker mutations was higher in the supernatant fluid than in microdissected cells. Cytocentrifugation supernatant fluid contains levels of amplifiable DNA suitable for mutation detection and characterization. The finding of additional detectable mutations at higher clonality indicates that supernatant fluid may be enriched with tumor DNA. Molecular analysis of the supernatant fluid could serve as an adjunct method to reduce sampling variability and increase diagnostic yield, especially in cases with a high clinical suspicion for malignancy and limited number of atypical cells in the smears.

Utility of bronchial lavage fluids for epithelial growth factor receptor mutation assay in lung cancer patients: Comparison between cell pellets, cell blocks and matching tissue specimens

PubMed Central

Asaka, Shiho; Yoshizawa, Akihiko; Nakata, Rie; Negishi, Tatsuya; Yamamoto, Hiroshi; Shiina, Takayuki; Shigeto, Shohei; Matsuda, Kazuyuki; Kobayashi, Yukihiro; Honda, Takayuki

2018-01-01

The detection of epidermal growth factor receptor (EGFR) mutations is necessary for the selection of suitable patients with non-small cell lung cancer (NSCLC) for treatment with EGFR tyrosine kinase inhibitors. Cytology specimens are known to be suitable for EGFR mutation detection, although tissue specimens should be prioritized; however, there are limited studies that examine the utility of bronchial lavage fluid (BLF) in mutation detection. The purpose of the present study was to investigate the utility of BLF specimens for the detection of EGFR mutations using a conventional quantitative EGFR polymerase chain reaction (PCR) assay. Initially, quantification cycle (Cq) values of cell pellets, cell-free supernatants and cell blocks obtained from three series of 1% EGFR mutation-positive lung cancer cell line samples were compared for mutation detection. In addition, PCR analysis of BLF specimens obtained from 77 consecutive NSCLC patients, detecting EGFR mutations was validated, and these results were compared with those for the corresponding formalin-fixed paraffin-embedded (FFPE) tissue specimens obtained by surgical resection or biopsy of 49 of these patients. The Cq values for mutation detection were significantly lower in the cell pellet group (average, 29.58) compared with the other groups, followed by those in cell-free supernatants (average, 34.15) and in cell blocks (average, 37.12) for all three series (P<0.05). Mutational status was successfully analyzed in 77 BLF specimens, and the results obtained were concordant with those of the 49 matching FFPE tissue specimens. Notably, EGFR mutations were even detected in 10 cytological specimens that contained insufficient tumor cells. EGFR mutation testing with BLF specimens is therefore a useful and reliable method, particularly when sufficient cancer cells are not obtained. PMID:29399190

Critical Pitfalls in the use of BRAF Mutation as a Diagnostic Tool in Thyroid Nodules: a Case Report.

PubMed

Kuhn, Elisabetta; Ragazzi, Moira; Zini, Michele; Giordano, Davide; Nicoli, Davide; Piana, Simonetta

2016-09-01

Thyroid fine-needle aspiration (FNA) cytology is the primary tool for the diagnostic evaluation of thyroid nodules. BRAF mutation analysis is employed as an ancillary tool in indeterminate cases, as recommended by the American Thyroid Association management guidelines. Hereby, we report the case of a 73-year-old woman who presented an 8-mm-size, ill-defined, left thyroid nodule. FNA resulted "suspicious for papillary thyroid carcinoma". BRAF mutation status was analyzed, and somatic BRAF (V600E) mutation identified. The patient underwent a total thyroidectomy. At histological examination, the nodule was composed of Langerhans cells, admixed with many eosinophils. A final diagnosis of Langerhans cell histiocytosis of the thyroid was made. Our case emphasizes the critical diagnostic pitfalls due to the use of BRAF (V600E) mutation analysis in thyroid FNA. Notably, BRAF (V600E) mutation is common in melanoma, colorectal carcinoma, lung carcinoma, ovarian carcinoma, brain tumors, hairy cell leukemia, multiple myeloma, and histiocytoses. Therefore, in cases of indeterminate FNA with unclassifiable atypical cells BRAF (V600E) mutated, the possibility of a localization of hystiocytosis or a secondary thyroid malignancy should be taken into account.

Somatic mosaicism containing double mutations in PTCH1 revealed by generation of induced pluripotent stem cells from nevoid basal cell carcinoma syndrome.

PubMed

Ikemoto, Yu; Takayama, Yoshinaga; Fujii, Katsunori; Masuda, Mokuri; Kato, Chise; Hatsuse, Hiromi; Fujitani, Kazuko; Nagao, Kazuaki; Kameyama, Kohzoh; Ikehara, Hajime; Toyoda, Masashi; Umezawa, Akihiro; Miyashita, Toshiyuki

2017-08-01

Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder characterised by developmental defects and tumorigenesis, such as medulloblastomas and basal cell carcinomas, caused by mutations of the patched-1 ( PTCH1 ) gene. In this article, we seek to demonstrate a mosaicism containing double mutations in PTCH1 in an individual with NBCCS. A de novo germline mutation of PTCH1 (c.272delG) was detected in a 31-year-old woman with NBCCS. Gene analysis of two out of four induced pluripotent stem cell (iPSC) clones established from the patient unexpectedly revealed an additional mutation, c.274delT. Deep sequencing confirmed a low-prevalence somatic mutation (5.5%-15.6% depending on the tissue) identical to the one found in iPSC clones. This is the first case of mosaicism unequivocally demonstrated in NBCCS. Furthermore, the mosaicism is unique in that the patient carries one normal and two mutant alleles. Because these mutations are located in close proximity, reversion error is likely to be involved in this event rather than a spontaneous mutation. In addition, this study indicates that gene analysis of iPSC clones can contribute to the detection of mosaicism containing a minor population carrying a second mutation. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Nonselective enrichment for yeast adenine mutants by flow cytometry

NASA Technical Reports Server (NTRS)

Bruschi, C. V.; Chuba, P. J.

1988-01-01

The expression of certain adenine biosynthetic mutations in the yeast Saccharomyces cerevisiae results in a red colony color. This phenomenon has historically provided an ideal genetic marker for the study of mutation, recombination, and aneuploidy in lower eukaryotes by classical genetic analysis. In this paper, it is reported that cells carrying ade1 and/or ade2 mutations exhibit primary fluorescence. Based on this observation, the nonselective enrichment of yeast cultures for viable adenine mutants by using the fluorescence-activated cell sorter has been achieved. The advantages of this approach over conventional genetic analysis of mutation, recombination, and mitotic chromosomal stability include speed and accuracy in acquiring data for large numbers of clones. By using appropriate strains, the cell sorter has been used for the isolation of both forward mutations and chromosomal loss events in S. cerevisiae. The resolving power of this system and its noninvasiveness can easily be extended to more complex organisms, including mammalian cells, in which analogous metabolic mutants are available.

Ineffectiveness of the presence of H-ras/p53 combination of mutations in squamous cell carcinoma cells to induce a conversion of a nontumorigenic to a tumorigenic phenotype.

PubMed

Lee, H; Li, D; Prior, T; Casto, B C; Weghorst, C M; Shuler, C F; Milo, G E

1997-10-01

Human tumor cells have properties in vitro or in surrogate hosts that are distinct from those of normal cells, such as immortality, anchorage independence, and tumor formation in nude mice. However, different cells from individual tumors may exhibit some, but not all of these features. In previous years, human tumor cell lines derived from different tumor and tissue types have been studied to determine those molecular changes that are associated with the in vitro properties listed above and with tumorigenicity in nude mice. In the present study, seven cell lines derived from human tumors were characterized for p53 and ras mutations that may occur in SCC tumor phenotypes and for tumor formation in nude mice. This investigation was designed to examine whether co-occurrence of mutated ras and p53 lead to a malignant stage in the progression process. None of the seven cell lines contained mutations in the recognized "hot spots" of the p53 tumor suppressor gene, but four had a nonsense/splice mutation in codon 126 and a mutation in codon 12 of the H-ras gene. The remaining three cell lines had p53 mutations in intron 5, in codon 193, and a missense mutation in codon 126, respectively. Four of seven cell lines were nontumorigenic; two of these cell lines contained a nonsense p53-126 mutation and mutated ras; one had a missense mutation at codon 126 but no mutated ras; the the fourth had only a p53 mutation at codon 193. Two of the nontumorigenic cell lines were converted to tumorigenicity after treatment with methyl methanesulfonate or N-methyl-N'-nitro-N-nitrosoguanidine with no apparent additional mutations in either gene. Our analysis revealed that there was a high frequency of genetic diversity and mutations in both p53 and H-ras. There was also a lack of a causal relationship in the presence of mutations in p53 and the cells' ability to exhibit a malignant potential in nude mice.

Calreticulin mutation-specific immunostaining in myeloproliferative neoplasms: pathogenetic insight and diagnostic value

PubMed Central

Vannucchi, A M; Rotunno, G; Bartalucci, N; Raugei, G; Carrai, V; Balliu, M; Mannarelli, C; Pacilli, A; Calabresi, L; Fjerza, R; Pieri, L; Bosi, A; Manfredini, R; Guglielmelli, P

2014-01-01

Mutations in the gene calreticulin (CALR) occur in the majority of JAK2- and MPL-unmutated patients with essential thrombocythemia (ET) and primary myelofibrosis (PMF); identifying CALR mutations contributes to the diagnostic pathway of ET and PMF. CALR mutations are heterogeneous spanning over the exon 9, but all result in a novel common protein C terminus. We developed a polyclonal antibody against a 17-amino-acid peptide derived from mutated calreticulin that was used for immunostaining of bone marrow biopsies. We show that this antibody specifically recognized patients harboring different types of CALR mutation with no staining in healthy controls and JAK2- or MPL-mutated ET and PMF. The labeling was mostly localized in megakaryocytes, whereas myeloid and erythroid cells showed faint staining, suggesting a preferential expression of calreticulin in megakaryocytes. Megakaryocytic-restricted expression of calreticulin was also demonstrated using an antibody against wild-type calreticulin and by measuring the levels of calreticulin RNA by gene expression analysis. Immunostaining using an antibody specific for mutated calreticulin may become a rapid, simple and cost-effective method for identifying CALR-mutated patients complementing molecular analysis; furthermore, the labeling pattern supports the preferential expansion of megakaryocytic cell lineage as a result of CALR mutation in an immature hematopoietic stem cell. PMID:24618731

Genetic analysis of mouse embryonic stem cells bearing Msh3 and Msh2 single and compound mutations.

PubMed

Abuin, A; Zhang, H; Bradley, A

2000-01-01

We have previously described the use of homologous recombination and CRE-loxP-mediated marker recycling to generate mouse embryonic stem (ES) cell lines homozygous for mutations at the Msh3, Msh2, and both Msh3 and Msh2 loci (2). In this study, we describe the analysis of these ES cells with respect to processes known to be affected by DNA mismatch repair. ES cells homozygous for the Msh2 mutation displayed increased resistance to killing by the cytotoxic drug 6-thioguanine (6TG), indicating that the 6TG cytotoxic mechanism is mediated by Msh2. The mutation rate of the herpes simplex virus thymidine kinase 1 (HSV-tk1) gene was unchanged in Msh3-deficient ES cell lines but markedly elevated in Msh2-deficient and Msh3 Msh2 double-mutant cells. Notably, the HSV-tk1 mutation rate was 11-fold higher, on average, than that of the hypoxanthine-guanine phosphoribosyl transferase (Hprt) locus in Msh2-deficient cells. Sequence analysis of HSV-tk1 mutants from these cells indicated the presence of a frameshift hotspot within the HSV-tk1 coding region. Msh3-deficient cells displayed a modest (16-fold) elevation in the instability of a dinucleotide repeat, whereas Msh2-deficient and Msh2 Msh3 double-mutant cells displayed markedly increased levels of repeat instability. Targeting frequencies of nonisogenic vectors were elevated in Msh2-deficient ES cell lines, confirming the role of Msh2 in blocking recombination between diverged sequences (homeologous recombination) in mammalian cells. These results are consistent with accumulating data from other laboratories and support the current model of DNA mismatch repair in mammalian cells.

Genetic Analysis of Mouse Embryonic Stem Cells Bearing Msh3 and Msh2 Single and Compound Mutations

PubMed Central

Abuin, Alejandro; Zhang, HeJu; Bradley, Allan

2000-01-01

We have previously described the use of homologous recombination and CRE-loxP-mediated marker recycling to generate mouse embryonic stem (ES) cell lines homozygous for mutations at the Msh3, Msh2, and both Msh3 and Msh2 loci (2). In this study, we describe the analysis of these ES cells with respect to processes known to be affected by DNA mismatch repair. ES cells homozygous for the Msh2 mutation displayed increased resistance to killing by the cytotoxic drug 6-thioguanine (6TG), indicating that the 6TG cytotoxic mechanism is mediated by Msh2. The mutation rate of the herpes simplex virus thymidine kinase 1 (HSV-tk1) gene was unchanged in Msh3-deficient ES cell lines but markedly elevated in Msh2-deficient and Msh3 Msh2 double-mutant cells. Notably, the HSV-tk1 mutation rate was 11-fold higher, on average, than that of the hypoxanthine-guanine phosphoribosyl transferase (Hprt) locus in Msh2-deficient cells. Sequence analysis of HSV-tk1 mutants from these cells indicated the presence of a frameshift hotspot within the HSV-tk1 coding region. Msh3-deficient cells displayed a modest (16-fold) elevation in the instability of a dinucleotide repeat, whereas Msh2-deficient and Msh2 Msh3 double-mutant cells displayed markedly increased levels of repeat instability. Targeting frequencies of nonisogenic vectors were elevated in Msh2-deficient ES cell lines, confirming the role of Msh2 in blocking recombination between diverged sequences (homeologous recombination) in mammalian cells. These results are consistent with accumulating data from other laboratories and support the current model of DNA mismatch repair in mammalian cells. PMID:10594017

Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia

PubMed Central

Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.

2011-01-01

To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML. PMID:21989985

SEQUENCE ANALYSIS OF MUTATIONS INDUCED BY N-ETHYL-N-NITROSOUREA IN THE TK AND HPRT GENES OF MOUSE LYMPHOMA CELLS.

EPA Science Inventory

The mouse lymphoma assay is widely used to identify chemicals that are capable of inducing mutational damages. The Tk+/- gene located on an autosome in mouse lymphoma cells may recover a wider range of mutational events than the X-linked Hprt locus. However, chemical-induced muta...

Comprehensive investigation of oncogenic driver mutations in Chinese non-small cell lung cancer patients.

PubMed

Wang, Rui; Zhang, Yang; Pan, Yunjian; Li, Yuan; Hu, Haichuan; Cai, Deng; Li, Hang; Ye, Ting; Luo, Xiaoyang; Zhang, Yiliang; Li, Bin; Shen, Lei; Sun, Yihua; Chen, Haiquan

2015-10-27

To determine the frequency of driver mutations in Chinese non-small cell lung cancer (NSCLC) patients. Comprehensive mutational analysis was performed in 1356 lung adenocarcinoma, 503 squamous cell carcinoma, 57 adenosquamous lung carcinoma, 19 large cell carcinoma and 8 sarcomatoid carcinoma. The effect of EGFR tyrosine kinase inhibitors (TKIs) on EGFR-mutated lung adenocarcinoma patients after disease recurrence was investigated. Mutations in EGFR kinase domain, HER2 kinase domain, KRAS, BRAF, ALK, ROS1 and RET were mutually exclusive. In lung adenocarcinoma cases "pan-negative" for the seven above-mentioned driver mutations, we also detected two oncogenic EGFR extracellular domain mutations (A289D and R324L), two HER2 extracellular and transmembrane domain mutations (S310Y and V659E), one ARAF S214C mutation and two CD74-NRG1 fusions. Six (1.2%) FGFR3 activating mutations were identified in lung squamous cell carcinoma (five S249C and one R248C). There were three (15.8%) EGFR mutations and four (21.1%) KRAS mutations in large cell carcinoma. Three (37.5%) KRAS mutations were detected in sarcomatoid carcinoma. In EGFR-mutated lung adenocarcinoma patients who experienced disease recurrence, treatment with EGFR TKIs was an independent predictor of better overall survival (HR = 0.299, 95% CI: 0.172-0.519, P < 0.001). We determined the frequency of driver mutations in a large series of Chinese NSCLC patients. EGFR TKIs might improve the survival outcomes of EGFR-mutated lung adenocarcinoma patients who experienced disease recurrence.

Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

PubMed Central

Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

2016-01-01

Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

PubMed

Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

2016-01-12

Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

Identification of different ALK mutations in a pair of neuroblastoma cell lines established at diagnosis and relapse.

PubMed

Chen, Lindi; Humphreys, Angharad; Turnbull, Lisa; Bellini, Angela; Schleiermacher, Gudrun; Salwen, Helen; Cohn, Susan L; Bown, Nick; Tweddle, Deborah A

2016-12-27

Anaplastic Lymphoma Kinase (ALK) is a transmembrane receptor kinase that belongs to the insulin receptor superfamily and has previously been shown to play a role in cell proliferation, migration and invasion in neuroblastoma. Activating ALK mutations are reported in both hereditary and sporadic neuroblastoma tumours, and several ALK inhibitors are currently under clinical evaluation as novel treatments for neuroblastoma. Overall, mutations at codons F1174, R1275 and F1245 together account for ~85% of reported ALK mutations in neuroblastoma. NBLW and NBLW-R are paired cell lines originally derived from an infant with metastatic MYCN amplified Stage IVS (Evans Criteria) neuroblastoma, at diagnosis and relapse, respectively. Using both Sanger and targeted deep sequencing, this study describes the identification of distinct ALK mutations in these paired cell lines, including the rare R1275L mutation, which has not previously been reported in a neuroblastoma cell line. Analysis of the sensitivity of NBLW and NBLW-R cells to a panel of ALK inhibitors (TAE-684, Crizotinib, Alectinib and Lorlatinib) revealed differences between the paired cell lines, and overall NBLW-R cells with the F1174L mutation were more resistant to ALK inhibitor induced apoptosis compared with NBLW cells. This pair of cell lines represents a valuable pre-clinical model of clonal evolution of ALK mutations associated with neuroblastoma progression.

Corin mutations K317E and S472G from preeclamptic patients alter zymogen activation and cell surface targeting. [Corrected].

PubMed

Dong, Ningzheng; Zhou, Tiantian; Zhang, Yue; Liu, Meng; Li, Hui; Huang, Xiaoyi; Liu, Zhenzhen; Wu, Yi; Fukuda, Koichi; Qin, Jun; Wu, Qingyu

2014-06-20

Corin is a membrane-bound serine protease that acts as the atrial natriuretic peptide (ANP) convertase in the heart. Recent studies show that corin also activates ANP in the pregnant uterus to promote spiral artery remodeling and prevent pregnancy-induced hypertension. Two CORIN gene mutations, K317E and S472G, were identified in preeclamptic patients and shown to have reduced activity in vitro. In this study, we carried out molecular modeling and biochemical experiments to understand how these mutations impair corin function. By molecular modeling, the mutation K317E was predicted to alter corin LDL receptor-2 module conformation. Western blot analysis of K317E mutant in HEK293 cells showed that the mutation did not block corin expression on the cell surface but inhibited corin zymogen activation. In contrast, the mutation S472G was predicted to abolish a β-sheet critical for corin frizzled-2 module structure. In Western blot analysis and flow cytometry, S472G mutant was not detected on the cell surface in transfected HEK293 cells. By immunostaining, the S472G mutant was found in the ER, indicating that the mutation S472G disrupted the β-sheet, causing corin misfolding and ER retention. Thus, these results show that mutations in the CORIN gene may impair corin function by entirely different mechanisms. Together, our data provide important insights into the molecular basis underlying corin mutations that may contribute to preeclampsia in patients. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Accuracy of Answers to Cell Lineage Questions Depends on Single-Cell Genomics Data Quality and Quantity.

PubMed

Spiro, Adam; Shapiro, Ehud

2016-06-01

Advances in single-cell (SC) genomics enable commensurate improvements in methods for uncovering lineage relations among individual cells, as determined by phylogenetic analysis of the somatic mutations harbored by each cell. Theoretically, complete and accurate knowledge of the genome of each cell of an individual can produce an extremely accurate cell lineage tree of that individual. However, the reality of SC genomics is that such complete and accurate knowledge would be wanting, in quality and in quantity, for the foreseeable future. In this paper we offer a framework for systematically exploring the feasibility of answering cell lineage questions based on SC somatic mutational analysis, as a function of SC genomics data quality and quantity. We take into consideration the current limitations of SC genomics in terms of mutation data quality, most notably amplification bias and allele dropouts (ADO), as well as cost, which puts practical limits on mutation data quantity obtained from each cell as well as on cell sample density. We do so by generating in silico cell lineage trees using a dedicated formal language, eSTG, and show how the ability to answer correctly a cell lineage question depends on the quality and quantity of the SC mutation data. The presented framework can serve as a baseline for the potential of current SC genomics to unravel cell lineage dynamics, as well as the potential contributions of future advancement, both biochemical and computational, for the task.

Curcumin inhibits growth potential by G1 cell cycle arrest and induces apoptosis in p53-mutated COLO 320DM human colon adenocarcinoma cells.

PubMed

Dasiram, Jade Dhananjay; Ganesan, Ramamoorthi; Kannan, Janani; Kotteeswaran, Venkatesan; Sivalingam, Nageswaran

2017-02-01

Curcumin, a natural polyphenolic compound and it is isolated from the rhizome of Curcuma longa, have been reported to possess anticancer effect against stage I and II colon cancer. However, the effect of curcumin on colon cancer at Dukes' type C metastatic stage III remains still unclear. In the present study, we have investigated the anticancer effects of curcumin on p53 mutated COLO 320DM human colon adenocarcinoma cells derived from Dukes' type C metastatic stage. The cellular viability and proliferation were assessed by trypan blue exclusion assay and MTT assay, respectively. The cytotoxicity effect was examined by lactate dehydrogenase (LDH) cytotoxicity assay. Apoptosis was analyzed by DNA fragmentation analysis, Hoechst and propidium iodide double fluorescent staining and confocal microscopy analysis. Cell cycle distribution was performed by flow cytometry analysis. Here we have observed that curcumin treatment significantly inhibited the cellular viability and proliferation potential of p53 mutated COLO 320DM cells in a dose- and time-dependent manner. In addition, curcumin treatment showed no cytotoxic effects to the COLO 320DM cells. DNA fragmentation analysis, Hoechst and propidium iodide double fluorescent staining and confocal microscopy analysis revealed that curcumin treatment induced apoptosis in COLO 320DM cells. Furthermore, curcumin caused cell cycle arrest at the G1 phase, decreased the cell population in the S phase and induced apoptosis in COLO 320DM colon adenocarcinoma cells. Together, these data suggest that curcumin exerts anticancer effects and induces apoptosis in p53 mutated COLO 320DM human colon adenocarcinoma cells derived from Dukes' type C metastatic stage. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Retroviral expression screening of oncogenes in natural killer cell leukemia.

PubMed

Choi, Young Lim; Moriuchi, Ryozo; Osawa, Mitsujiro; Iwama, Atsushi; Makishima, Hideki; Wada, Tomoaki; Kisanuki, Hiroyuki; Kaneda, Ruri; Ota, Jun; Koinuma, Koji; Ishikawa, Madoka; Takada, Shuji; Yamashita, Yoshihiro; Oshimi, Kazuo; Mano, Hiroyuki

2005-08-01

Aggressive natural killer cell leukemia (ANKL) is an intractable malignancy that is characterized by the outgrowth of NK cells. To identify transforming genes in ANKL, we constructed a retroviral cDNA expression library from an ANKL cell line KHYG-1. Infection of 3T3 cells with recombinant retroviruses yielded 33 transformed foci. Nucleotide sequencing of the DNA inserts recovered from these foci revealed that 31 of them encoded KRAS2 with a glycine-to-alanine mutation at codon 12. Mutation-specific PCR analysis indicated that the KRAS mutation was present only in KHYG-1 cells, not in another ANKL cell line or in clinical specimens (n=8).

Mutational and structural analysis of diffuse large B-cell lymphoma using whole genome sequencing | Office of Cancer Genomics

Cancer.gov

Abstract: Diffuse large B-cell lymphoma (DLBCL) is a genetically heterogeneous cancer comprising at least two molecular subtypes that differ in gene expression and distribution of mutations. Recently, application of genome/exome sequencing and RNA-seq to DLBCL has revealed numerous genes that are recurrent targets of somatic point mutation in this disease.

Comparison of cross-platform technologies for EGFR T790M testing in patients with non-small cell lung cancer

PubMed Central

Li, Xuefei; Zhou, Caicun

2017-01-01

Somatic mutations in the gene encoding epidermal growth factor receptor (EGFR) play an important role in determining targeted treatment modalities in non-small cell lung cancer (NSCLC). The EGFR T790M mutation emerges in approximately 50% of cases who acquire resistance to tyrosine kinase inhibitors. Detecting EGFR T790M mutation in tumor tissue is challenging due to heterogeneity of the tumor, low abundance of the mutation and difficulty for re-biopsy in patients with advanced disease. Alternatively, circulating tumor DNA (ctDNA) has been proposed as a non-invasive method for mutational analysis. The presence of EGFR mutations in ctDNA predicts response to the EGFR TKIs in the first-line setting. Molecular testing is now considered a standard care for NSCLC. The advent of standard commercially available kits and targeted mutational analysis has revolutionized the accuracy of mutation detection platforms for detection of EGFR mutations. Our review provides an overview of various commonly used platforms for detecting EGFR T790M mutation in tumor tissue and plasma. PMID:29246024

Single-Cell Analysis of Human Pancreas Reveals Transcriptional Signatures of Aging and Somatic Mutation Patterns.

PubMed

Enge, Martin; Arda, H Efsun; Mignardi, Marco; Beausang, John; Bottino, Rita; Kim, Seung K; Quake, Stephen R

2017-10-05

As organisms age, cells accumulate genetic and epigenetic errors that eventually lead to impaired organ function or catastrophic transformation such as cancer. Because aging reflects a stochastic process of increasing disorder, cells in an organ will be individually affected in different ways, thus rendering bulk analyses of postmitotic adult cells difficult to interpret. Here, we directly measure the effects of aging in human tissue by performing single-cell transcriptome analysis of 2,544 human pancreas cells from eight donors spanning six decades of life. We find that islet endocrine cells from older donors display increased levels of transcriptional noise and potential fate drift. By determining the mutational history of individual cells, we uncover a novel mutational signature in healthy aging endocrine cells. Our results demonstrate the feasibility of using single-cell RNA sequencing (RNA-seq) data from primary cells to derive insights into genetic and transcriptional processes that operate on aging human tissue. Copyright © 2017 Elsevier Inc. All rights reserved.

ORAI1 mutations abolishing store-operated Ca2+ entry cause anhidrotic ectodermal dysplasia with immunodeficiency.

PubMed

Lian, Jayson; Cuk, Mario; Kahlfuss, Sascha; Kozhaya, Lina; Vaeth, Martin; Rieux-Laucat, Frédéric; Picard, Capucine; Benson, Melina J; Jakovcevic, Antonia; Bilic, Karmen; Martinac, Iva; Stathopulos, Peter; Kacskovics, Imre; Vraetz, Thomas; Speckmann, Carsten; Ehl, Stephan; Issekutz, Thomas; Unutmaz, Derya; Feske, Stefan

2017-11-16

Store-operated Ca 2+ entry (SOCE) through Ca 2+ release-activated Ca 2+ channels is an essential signaling pathway in many cell types. Ca 2+ release-activated Ca 2+ channels are formed by ORAI1, ORAI2, and ORAI3 proteins and activated by stromal interaction molecule (STIM) 1 and STIM2. Mutations in the ORAI1 and STIM1 genes that abolish SOCE cause a combined immunodeficiency (CID) syndrome that is accompanied by autoimmunity and nonimmunologic symptoms. We performed molecular and immunologic analysis of patients with CID, anhidrosis, and ectodermal dysplasia of unknown etiology. We performed DNA sequencing of the ORAI1 gene, modeling of mutations on ORAI1 crystal structure, analysis of ORAI1 mRNA and protein expression, SOCE measurements, immunologic analysis of peripheral blood lymphocyte populations by using flow cytometry, and histologic and ultrastructural analysis of patient tissues. We identified 3 novel autosomal recessive mutations in ORAI1 in unrelated kindreds with CID, autoimmunity, ectodermal dysplasia with anhidrosis, and muscular dysplasia. The patients were homozygous for p.V181SfsX8, p.L194P, and p.G98R mutations in the ORAI1 gene that suppressed ORAI1 protein expression and SOCE in the patients' lymphocytes and fibroblasts. In addition to impaired T-cell cytokine production, ORAI1 mutations were associated with strongly reduced numbers of invariant natural killer T and regulatory T (Treg) cells and altered composition of γδ T-cell and natural killer cell subsets. ORAI1 null mutations are associated with reduced numbers of invariant natural killer T and Treg cells that likely contribute to the patients' immunodeficiency and autoimmunity. ORAI1-deficient patients have dental enamel defects and anhidrosis, representing a new form of anhidrotic ectodermal dysplasia with immunodeficiency that is distinct from previously reported patients with anhidrotic ectodermal dysplasia with immunodeficiency caused by mutations in the nuclear factor κB signaling pathway (IKBKG and NFKBIA). Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Kit receptor tyrosine kinase dysregulations in feline splenic mast cell tumours.

PubMed

Sabattini, S; Barzon, G; Giantin, M; Lopparelli, R M; Dacasto, M; Prata, D; Bettini, G

2017-09-01

This study investigated Kit receptor dysregulations (cytoplasmic immunohistochemical expression and/or c-KIT mutations) in cats affected with splenic mast cell tumours. Twenty-two cats were included. Median survival time was 780 days (range: 1-1219). An exclusive splenic involvement was significantly (P = 0.042) associated with longer survival (807 versus 120 days). Eighteen tumours (85.7%) showed Kit cytoplasmic expression (Kit pattern 2, 3). Mutation analysis was successful in 20 cases. Fourteen missense mutations were detected in 13 out of 20 tumours (65%). Eleven (78.6%) were located in exon 8, and three (21.6%) in exon 9. No mutations were detected in exons 11 and 17. Seven mutations corresponded to the same internal tandem duplication in exon 8 (c.1245_1256dup). Although the association between Kit cytoplasmic expression and mutations was significant, immunohistochemistry cannot be considered a surrogate marker for mutation analysis. No correlation was observed between c-Kit mutations and tumour differentiation, mitotic activity or survival. © 2016 John Wiley & Sons Ltd.

Timing, rates and spectra of human germline mutation.

PubMed

Rahbari, Raheleh; Wuster, Arthur; Lindsay, Sarah J; Hardwick, Robert J; Alexandrov, Ludmil B; Turki, Saeed Al; Dominiczak, Anna; Morris, Andrew; Porteous, David; Smith, Blair; Stratton, Michael R; Hurles, Matthew E

2016-02-01

Germline mutations are a driving force behind genome evolution and genetic disease. We investigated genome-wide mutation rates and spectra in multi-sibling families. The mutation rate increased with paternal age in all families, but the number of additional mutations per year differed by more than twofold between families. Meta-analysis of 6,570 mutations showed that germline methylation influences mutation rates. In contrast to somatic mutations, we found remarkable consistency in germline mutation spectra between the sexes and at different paternal ages. In parental germ line, 3.8% of mutations were mosaic, resulting in 1.3% of mutations being shared by siblings. The number of these shared mutations varied significantly between families. Our data suggest that the mutation rate per cell division is higher during both early embryogenesis and differentiation of primordial germ cells but is reduced substantially during post-pubertal spermatogenesis. These findings have important consequences for the recurrence risks of disorders caused by de novo mutations.

Further Insights into the Allan-Herndon-Dudley Syndrome: Clinical and Functional Characterization of a Novel MCT8 Mutation.

PubMed

Armour, Christine M; Kersseboom, Simone; Yoon, Grace; Visser, Theo J

2015-01-01

Mutations in the thyroid hormone (TH) transporter MCT8 have been identified as the cause for Allan-Herndon-Dudley Syndrome (AHDS), characterized by severe psychomotor retardation and altered TH serum levels. Here we report a novel MCT8 mutation identified in 4 generations of one family, and its functional characterization. Proband and family members were screened for 60 genes involved in X-linked cognitive impairment and the MCT8 mutation was confirmed. Functional consequences of MCT8 mutations were studied by analysis of [125I]TH transport in fibroblasts and transiently transfected JEG3 and COS1 cells, and by subcellular localization of the transporter. The proband and a male cousin demonstrated clinical findings characteristic of AHDS. Serum analysis showed high T3, low rT3, and normal T4 and TSH levels in the proband. A MCT8 mutation (c.869C>T; p.S290F) was identified in the proband, his cousin, and several female carriers. Functional analysis of the S290F mutant showed decreased TH transport, metabolism and protein expression in the three cell types, whereas the S290A mutation had no effect. Interestingly, both uptake and efflux of T3 and T4 was impaired in fibroblasts of the proband, compared to his healthy brother. However, no effect of the S290F mutation was observed on TH efflux from COS1 and JEG3 cells. Immunocytochemistry showed plasma membrane localization of wild-type MCT8 and the S290A and S290F mutants in JEG3 cells. We describe a novel MCT8 mutation (S290F) in 4 generations of a family with Allan-Herndon-Dudley Syndrome. Functional analysis demonstrates loss-of-function of the MCT8 transporter. Furthermore, our results indicate that the function of the S290F mutant is dependent on cell context. Comparison of the S290F and S290A mutants indicates that it is not the loss of Ser but its substitution with Phe, which leads to S290F dysfunction.

Further Insights into the Allan-Herndon-Dudley Syndrome: Clinical and Functional Characterization of a Novel MCT8 Mutation

PubMed Central

Yoon, Grace; Visser, Theo J.

2015-01-01

Background Mutations in the thyroid hormone (TH) transporter MCT8 have been identified as the cause for Allan-Herndon-Dudley Syndrome (AHDS), characterized by severe psychomotor retardation and altered TH serum levels. Here we report a novel MCT8 mutation identified in 4 generations of one family, and its functional characterization. Methods Proband and family members were screened for 60 genes involved in X-linked cognitive impairment and the MCT8 mutation was confirmed. Functional consequences of MCT8 mutations were studied by analysis of [125I]TH transport in fibroblasts and transiently transfected JEG3 and COS1 cells, and by subcellular localization of the transporter. Results The proband and a male cousin demonstrated clinical findings characteristic of AHDS. Serum analysis showed high T3, low rT3, and normal T4 and TSH levels in the proband. A MCT8 mutation (c.869C>T; p.S290F) was identified in the proband, his cousin, and several female carriers. Functional analysis of the S290F mutant showed decreased TH transport, metabolism and protein expression in the three cell types, whereas the S290A mutation had no effect. Interestingly, both uptake and efflux of T3 and T4 was impaired in fibroblasts of the proband, compared to his healthy brother. However, no effect of the S290F mutation was observed on TH efflux from COS1 and JEG3 cells. Immunocytochemistry showed plasma membrane localization of wild-type MCT8 and the S290A and S290F mutants in JEG3 cells. Conclusions We describe a novel MCT8 mutation (S290F) in 4 generations of a family with Allan-Herndon-Dudley Syndrome. Functional analysis demonstrates loss-of-function of the MCT8 transporter. Furthermore, our results indicate that the function of the S290F mutant is dependent on cell context. Comparison of the S290F and S290A mutants indicates that it is not the loss of Ser but its substitution with Phe, which leads to S290F dysfunction. PMID:26426690

New VMD2 gene mutations identified in patients affected by Best vitelliform macular dystrophy

PubMed Central

Marchant, D; Yu, K; Bigot, K; Roche, O; Germain, A; Bonneau, D; Drouin‐Garraud, V; Schorderet, D F; Munier, F; Schmidt, D; Neindre, P Le; Marsac, C; Menasche, M; Dufier, J L; Fischmeister, R; Hartzell, C; Abitbol, M

2007-01-01

Purpose The mutations responsible for Best vitelliform macular dystrophy (BVMD) are found in a gene called VMD2. The VMD2 gene encodes a transmembrane protein named bestrophin‐1 (hBest1) which is a Ca2+‐sensitive chloride channel. This study was performed to identify disease‐specific mutations in 27 patients with BVMD. Because this disease is characterised by an alteration in Cl− channel function, patch clamp analysis was used to test the hypothesis that one of the VMD2 mutated variants causes the disease. Methods Direct sequencing analysis of the 11 VMD2 exons was performed to detect new abnormal sequences. The mutant of hBest1 was expressed in HEK‐293 cells and the associated Cl− current was examined using whole‐cell patch clamp analysis. Results Six new VMD2 mutations were identified, located exclusively in exons four, six and eight. One of these mutations (Q293H) was particularly severe. Patch clamp analysis of human embryonic kidney cells expressing the Q293H mutant showed that this mutant channel is non‐functional. Furthermore, the Q293H mutant inhibited the function of wild‐type bestrophin‐1 channels in a dominant negative manner. Conclusions This study provides further support for the idea that mutations in VMD2 are a necessary factor for Best disease. However, because variable expressivity of VMD2 was observed in a family with the Q293H mutation, it is also clear that a disease‐linked mutation in VMD2 is not sufficient to produce BVMD. The finding that the Q293H mutant does not form functional channels in the membrane could be explained either by disruption of channel conductance or gating mechanisms or by improper trafficking of the protein to the plasma membrane. PMID:17287362

Par-4, a Gene Required for Cytoplasmic Localization and Determination of Specific Cell Types in Caenorhabditis Elegans Embryogenesis

PubMed Central

Morton, D. G.; Roos, J. M.; Kemphues, K. J.

1992-01-01

Specification of some cell fates in the early Caenorhabditis elegans embryo is mediated by cytoplasmic localization under control of the maternal genome. Using nine newly isolated mutations, and two existing mutations, we have analyzed the role of the maternally expressed gene par-4 in cytoplasmic localization. We recovered seven new par-4 alleles in screens for maternal effect lethal mutations that result in failure to differentiate intestinal cells. Two additional par-4 mutations were identified in noncomplementation screens using strains with a high frequency of transposon mobility. All 11 mutations cause defects early in development of embryos produced by homozygous mutant mothers. Analysis with a deficiency in the region indicates that it33 is a strong loss-of-function mutation. par-4(it33) terminal stage embryos contain many cells, but show no morphogenesis, and are lacking intestinal cells. Temperature shifts with the it57ts allele suggest that the critical period for both intestinal differentiation and embryo viability begins during oogenesis, about 1.5 hr before fertilization, and ends before the four-cell stage. We propose that the primary function of the par-4 gene is to act as part of a maternally encoded system for cytoplasmic localization in the first cell cycle, with par-4 playing a particularly important role in the determination of intestine. Analysis of a par-4;par-2 double mutant suggests that par-4 and par-2 gene products interact in this system. PMID:1582558

A new Gsdma3 mutation affecting anagen phase of first hair cycle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Shigekazu; Department of Genetics, School of Life Science, Graduate University for Advanced Studies, 1111 Yata, Mishima, Shizuoka 411-8540; Tamura, Masaru

2007-08-10

Recombination-induced mutation 3 (Rim3) is a spontaneous mouse mutation that exhibits dominant phenotype of hyperkeratosis and hair loss. Fine linkage analysis of Rim3 and sequencing revealed a novel single point mutation, G1124A leading to Ala348Thr, in Gsdma3 in chromosome 11. Transgenesis with BAC DNA harboring the Rim3-type Gsdma3 recaptured the Rim3 phenotype, providing direct evidence that Gsdma3 is the causative gene of Rim3. We examined the spatial expression of Gsdma3 and characterized the Rim3 phenotype in detail. Gsdma3 is expressed in differentiated epidermal cells in the skin, but not in the proliferating epidermal cells. Histological analysis of Rim3 mutant showedmore » hyperplasia of the epidermal cells in the upper hair follicles and abnormal anagen phase at the first hair cycle. Furthermore, immunohistochemical analysis revealed hyperproliferation and misdifferentiation of the upper follicular epidermis in Rim3 mutant. These results suggest that Gsdma3 is involved in the proliferation and differentiation of epidermal stem cells.« less

TERT promoter mutation in adult granulosa cell tumor of the ovary.

PubMed

Pilsworth, Jessica A; Cochrane, Dawn R; Xia, Zhouchunyang; Aubert, Geraldine; Färkkilä, Anniina E M; Horlings, Hugo M; Yanagida, Satoshi; Yang, Winnie; Lim, Jamie L P; Wang, Yi Kan; Bashashati, Ali; Keul, Jacqueline; Wong, Adele; Norris, Kevin; Brucker, Sara Y; Taran, Florin-Andrei; Krämer, Bernhard; Staebler, Annette; Oliva, Esther; Shah, Sohrab P; Kommoss, Stefan; Kommoss, Friedrich; Gilks, C Blake; Baird, Duncan M; Huntsman, David G

2018-02-15

The telomerase reverse transcriptase (TERT) gene is highly expressed in stem cells and silenced upon differentiation. Cancer cells can attain immortality by activating TERT to maintain telomere length and telomerase activity, which is a crucial step of tumorigenesis. Two somatic mutations in the TERT promoter (C228T; C250T) have been identified as gain-of-function mutations that promote transcriptional activation of TERT in multiple cancers, such as melanoma and glioblastoma. A recent study investigating TERT promoter mutations in ovarian carcinomas found C228T and C250T mutations in 15.9% of clear cell carcinomas. However, it is unknown whether these mutations are frequent in other ovarian cancer subtypes, in particular, sex cord-stromal tumors including adult granulosa cell tumors. We performed whole-genome sequencing on ten adult granulosa cell tumors with matched normal blood and identified a TERT C228T promoter mutation in 50% of tumors. We found that adult granulosa cell tumors with mutated TERT promoter have increased expression of TERT mRNA and exhibited significantly longer telomeres compared to those with wild-type TERT promoter. Extension cohort analysis using allelic discrimination revealed the TERT C228T mutation in 51 of 229 primary adult granulosa cell tumors (22%), 24 of 58 recurrent adult granulosa cell tumors (41%), and 1 of 22 other sex cord-stromal tumors (5%). There was a significant difference in overall survival between patients with TERT C228T promoter mutation in the primary tumors and those without it (p = 0.00253, log-rank test). In seven adult granulosa cell tumors, we found the TERT C228T mutation present in recurrent tumors and absent in the corresponding primary tumor. Our data suggest that TERT C228T promoter mutations may have an important role in progression of adult granulosa cell tumors.

In Vivo Rat T-Lymphocyte Pig-a Assay: Detection and Expansion of Cells Deficient in the GPI-Anchored CD48 Surface Marker for Analysis of Mutation in the Endogenous Pig-a Gene.

PubMed

Dobrovolsky, Vasily N; Revollo, Javier; Petibone, Dayton M; Heflich, Robert H

2017-01-01

The Pig-a assay is being developed as an in vivo gene mutation assay for regulatory safety assessments. The assay is based on detecting mutation in the endogenous Pig-a gene of treated rats by using flow cytometry to measure changes in cell surface markers of peripheral blood cells. Here we present a methodology for demonstrating that phenotypically mutant rat T-cells identified by flow cytometry contain mutations in the Pig-a gene, an important step for validating the assay. In our approach, the mutant phenotype T-cells are sorted into individual wells of 96-well plates and expanded into clones. Subsequent sequencing of genomic DNA from the expanded clones confirms that the Pig-a assay detects exactly what it claims to detect-cells with mutations in the endogenous Pig-a gene. In addition, determining the spectra of Pig-a mutations provides information for better understanding the mutational mechanism of compounds of interest. Our methodology of combining phenotypic antibody labeling, magnetic enrichment, sorting, and single-cell clonal expansion can be used in genotoxicity/mutagenicity studies and in other general immunotoxicology research requiring identification, isolation, and expansion of extremely rare subpopulations of T-cells.

A Targeted Q-PCR-Based Method for Point Mutation Testing by Analyzing Circulating DNA for Cancer Management Care.

PubMed

Thierry, Alain R

2016-01-01

Circulating cell-free DNA (cfDNA) is a valuable source of tumor material available with a simple blood sampling enabling a noninvasive quantitative and qualitative analysis of the tumor genome. cfDNA is released by tumor cells and exhibits the genetic and epigenetic alterations of the tumor of origin. Circulating cell-free DNA (cfDNA) analysis constitutes a hopeful approach to provide a noninvasive tumor molecular test for cancer patients. Based upon basic research on the origin and structure of cfDNA, new information on circulating cell-free DNA (cfDNA) structure, and specific determination of cfDNA fragmentation and size, we revisited Q-PCR-based method and recently developed a the allele-specific-Q-PCR-based method with blocker (termed as Intplex) which is the first multiplexed test for cfDNA. This technique, named Intplex(®) and based on a refined Q-PCR method, derived from critical observations made on the specific structure and size of cfDNA. It enables the simultaneous determination of five parameters: the cfDNA total concentration, the presence of a previously known point mutation, the mutant (tumor) cfDNA concentration (ctDNA), the proportion of mutant cfDNA, and the cfDNA fragmentation index. Intplex(®) has enabled the first clinical validation of ctDNA analysis in oncology by detecting KRAS and BRAF point mutations in mCRC patients and has demonstrated that a blood test could replace tumor section analysis for the detection of KRAS and BRAF mutations. The Intplex(®) test can be adapted to all mutations, genes, or cancers and enables rapid, highly sensitive, cost-effective, and repetitive analysis. As regards to the determination of mutations on cfDNA Intplex(®) is limited to the mutational status of known hotspot mutation; it is a "targeted approach." However, it offers the opportunity in detecting quantitatively and dynamically mutation and could constitute a noninvasive attractive tool potentially allowing diagnosis, prognosis, theranostics, therapeutic monitoring, and follow-up of cancer patients expanding the scope of personalized cancer medicine.

Mutation profiles in early-stage lung squamous cell carcinoma with clinical follow-up and correlation with markers of immune function.

PubMed

Choi, M; Kadara, H; Zhang, J; Parra, E R; Rodriguez-Canales, J; Gaffney, S G; Zhao, Z; Behrens, C; Fujimoto, J; Chow, C; Kim, K; Kalhor, N; Moran, C; Rimm, D; Swisher, S; Gibbons, D L; Heymach, J; Kaftan, E; Townsend, J P; Lynch, T J; Schlessinger, J; Lee, J; Lifton, R P; Herbst, R S; Wistuba, I I

2017-01-01

Lung squamous cell carcinoma (LUSC) accounts for 20–30% of non-small cell lung cancers (NSCLCs). There are limited treatment strategies for LUSC in part due to our inadequate understanding of the molecular underpinnings of the disease. We performed whole-exome sequencing (WES) and comprehensive immune profiling of a unique set of clinically annotated early-stage LUSCs to increase our understanding of the pathobiology of this malignancy. Matched pairs of surgically resected stage I-III LUSCs and normal lung tissues (n = 108) were analyzed by WES. Immunohistochemistry and image analysis-based profiling of 10 immune markers were done on a subset of LUSCs (n = 91). Associations among mutations, immune markers and clinicopathological variables were statistically examined using analysis of variance and Fisher’s exact test. Cox proportional hazards regression models were used for statistical analysis of clinical outcome. This early-stage LUSC cohort displayed an average of 209 exonic mutations per tumor. Fourteen genes exhibited significant enrichment for somatic mutation: TP53, MLL2, PIK3CA, NFE2L2, CDH8, KEAP1, PTEN, ADCY8, PTPRT, CALCR, GRM8, FBXW7, RB1 and CDKN2A. Among mutated genes associated with poor recurrence-free survival, MLL2 mutations predicted poor prognosis in both TP53 mutant and wild-type LUSCs. We also found that in treated patients, FBXW7 and KEAP1 mutations were associated with poor response to adjuvant therapy, particularly in TP53-mutant tumors. Analysis of mutations with immune markers revealed that ADCY8 and PIK3CA mutations were associated with markedly decreased tumoral PD-L1 expression, LUSCs with PIK3CA mutations exhibited elevated CD45ro levels and CDKN2A-mutant tumors displayed an up-regulated immune response. Our findings pinpoint mutated genes that may impact clinical outcome as well as personalized strategies for targeted immunotherapies in early-stage LUSC.

Analysis of ESR1 and PIK3CA mutations in plasma cell-free DNA from ER-positive breast cancer patients.

PubMed

Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Tomiguchi, Mai; Sueta, Aiko; Murakami, Keiichi; Omoto, Yoko; Iwase, Hirotaka

2017-08-08

The measurement of ESR1 and PIK3CA mutations in plasma cell-free DNA (cfDNA) has been studied as a non-invasive method to quickly assess and monitor endocrine therapy (ET) resistant metastatic breast cancer (MBC) patients. The subjects of this retrospective study were a total of 185 plasma samples from 86 estrogen receptor-positive BC patients, of which 151 plasma samples were from 69 MBC patients and 34 plasma samples were from 17 primary BC (PBC) patients. We developed multiplex droplet digital PCR assays to verify the clinical significance of ESR1 and PIK3CA mutations both in a snapshot and serially in these patients. cfDNA ESR1 and PIK3CA mutations were found in 28.9% and 24.6 % of MBC patients, respectively. The relation between ESR1 or PIK3CA mutations and clinical features showed that ESR1 mutations occurred mostly in patients previously treated by ET, which was not the case for PIK3CA mutations. The analysis of the clinical impact of those mutations on subsequent lines of treatment for the 69 MBC patients revealed that both ESR1 and PIK3CA mutations detection were related to a shorter duration of ET effectiveness in univariate analysis but only for ESR1 mutations in multivariate analysis. The monitoring of cfDNA in a subset of 52 patients showed that loss of ESR1 mutations was related to a longer duration of response, which was not the case for PIK3CA mutations. We have demonstrated the clinical significance of on-treatment ESR1 mutations both in a snapshot and serially in comparison with PIK3CA mutations.

Analysis of ESR1 and PIK3CA mutations in plasma cell-free DNA from ER-positive breast cancer patients

PubMed Central

Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Tomiguchi, Mai; Sueta, Aiko; Murakami, Keiichi; Omoto, Yoko; Iwase, Hirotaka

2017-01-01

Background The measurement of ESR1 and PIK3CA mutations in plasma cell-free DNA (cfDNA) has been studied as a non-invasive method to quickly assess and monitor endocrine therapy (ET) resistant metastatic breast cancer (MBC) patients. Methods The subjects of this retrospective study were a total of 185 plasma samples from 86 estrogen receptor-positive BC patients, of which 151 plasma samples were from 69 MBC patients and 34 plasma samples were from 17 primary BC (PBC) patients. We developed multiplex droplet digital PCR assays to verify the clinical significance of ESR1 and PIK3CA mutations both in a snapshot and serially in these patients. Results cfDNA ESR1 and PIK3CA mutations were found in 28.9% and 24.6 % of MBC patients, respectively. The relation between ESR1 or PIK3CA mutations and clinical features showed that ESR1 mutations occurred mostly in patients previously treated by ET, which was not the case for PIK3CA mutations. The analysis of the clinical impact of those mutations on subsequent lines of treatment for the 69 MBC patients revealed that both ESR1 and PIK3CA mutations detection were related to a shorter duration of ET effectiveness in univariate analysis but only for ESR1 mutations in multivariate analysis. The monitoring of cfDNA in a subset of 52 patients showed that loss of ESR1 mutations was related to a longer duration of response, which was not the case for PIK3CA mutations. Conclusions We have demonstrated the clinical significance of on-treatment ESR1 mutations both in a snapshot and serially in comparison with PIK3CA mutations. PMID:28881720

Mosaicism of an ELANE mutation in an asymptomatic mother in a familial case of cyclic neutropenia.

PubMed

Hirata, Osamu; Okada, Satoshi; Tsumura, Miyuki; Karakawa, Shuhei; Matsumura, Itaru; Kimura, Yujiro; Maihara, Toshiro; Yasunaga, Shin'ichiro; Takihara, Yoshihiro; Ohara, Osamu; Kobayashi, Masao

2015-07-01

To confirm and characterize mosaicism of the cyclic neutropenia (CyN)-related mutation in the ELANE gene identified in the asymptomatic mother of patients with CyN. We identified sibling cases with CyN due to a novel heterozygous splicing site mutation, IVS4 +5SD G>T, in the ELANE gene, resulting in an internal in-frame deletion of 30 nucleotides (corresponding to a ten amino acid deletion, V161-F170). The mutated allele was also detected in their asymptomatic mother but at low frequency. We measured the frequency of the mutant allele from peripheral blood leukocytes (PBLs) by subcloning, and confirmed the allelic frequency of mosaicism in various cell types by massively parallel DNA sequencing (MPS) analysis. In the subcloning analysis, the mutant allele was identified in 21.36 % of PBLs from the asymptomatic mother, compared with 54.72 % of PBLs from the CyN patient. In the MPS analysis, the mutant allele was observed in approximately 30 % of mononuclear cells, CD3(+) T cells, CD14(+) monocytes and the buccal mucosa. Conversely, it was detected in low frequency in polymorphonuclear leukocytes (PLMLs) (3-4 %) and CD16(+) granulocytes (2-3 %). Mosaicism of the ELANE mutation has only previously been identified in one confirmed and one unconfirmed case of SCN. This is the first report of mosaicism of the ELANE mutation in a case of CyN. The MPS results suggest that this de novo mutation occurred during the two-cell stage of embryogenesis. PLMLs expressing the ELANE mutation were found to be actively undergoing apoptosis.

Differential Reprogramming of Isogenic Colorectal Cancer Cells by Distinct Activating KRAS Mutations

PubMed Central

2015-01-01

Oncogenic mutations of Ras at codons 12, 13, or 61, that render the protein constitutively active, are found in ∼16% of all cancer cases. Among the three major Ras isoforms, KRAS is the most frequently mutated isoform in cancer. Each Ras isoform and tumor type displays a distinct pattern of codon-specific mutations. In colon cancer, KRAS is typically mutated at codon 12, but a significant fraction of patients have mutations at codon 13. Clinical data suggest different outcomes and responsiveness to treatment between these two groups. To investigate the differential effects upon cell status associated with KRAS mutations we performed a quantitative analysis of the proteome and phosphoproteome of isogenic SW48 colon cancer cell lines in which one allele of the endogenous gene has been edited to harbor specific KRAS mutations (G12V, G12D, or G13D). Each mutation generates a distinct signature, with the most variability seen between G13D and the codon 12 KRAS mutants. One notable example of specific up-regulation in KRAS codon 12 mutant SW48 cells is provided by the short form of the colon cancer stem cell marker doublecortin-like Kinase 1 (DCLK1) that can be reversed by suppression of KRAS. PMID:25599653

The prognostic value of KRAS mutation by cell-free DNA in cancer patients: A systematic review and meta-analysis.

PubMed

Zhuang, Rongyuan; Li, Song; Li, Qian; Guo, Xi; Shen, Feng; Sun, Hong; Liu, Tianshu

2017-01-01

KRAS mutation has been found in various types of cancer. However, the prognostic value of KRAS mutation in cell-free DNA (cfDNA) in cancer patients was conflicting. In the present study, a meta-analysis was conducted to clarify its prognostic significance. Literature searches of Cochrane Library, EMBASE, PubMed and Web of Science were performed to identify studies related to KRAS mutation detected by cfDNA and survival in cancer patients. Two evaluators reviewed and extracted the information independently. Review Manager 5.3 software was used to perform the statistical analysis. Thirty studies were included in the present meta-analysis. Our analysis showed that KRAS mutation in cfDNA was associated with a poorer survival in cancer patients for overall survival (OS, HR 2.02, 95% CI 1.63-2.51, P<0.01) and progression-free survival (PFS, HR 1.64, 95% CI 1.27-2.13, P<0.01). In subgroup analyses, KRAS mutation in pancreatic cancer, colorectal cancer, non-small cell lung cancer and ovarian epithelial cancer had HRs of 2.81 (95% CI 1.83-4.30, P<0.01), 1.67 (95% CI 1.25-2.42, P<0.01), 1.64 (95% CI 1.13-2.39, P = 0.01) and 2.17 (95% 1.12-4.21, p = 0.02) for OS, respectively. In addition, the ethnicity didn't influence the prognostic value of KRAS mutation in cfDNA in cancer patients (p = 0.39). Prognostic value of KRAS mutation was slightly higher in plasma than in serum (HR 2.13 vs 1.65), but no difference was observed (p = 0.37). Briefly, KRAS mutation in cfDNA was a survival prognostic biomarker in cancer patients. Its prognostic value was different in various types of cancer.

Common Variable Immunodeficiency Caused by FANC Mutations.

PubMed

Sekinaka, Yujin; Mitsuiki, Noriko; Imai, Kohsuke; Yabe, Miharu; Yabe, Hiromasa; Mitsui-Sekinaka, Kanako; Honma, Kenichi; Takagi, Masatoshi; Arai, Ayako; Yoshida, Kenichi; Okuno, Yusuke; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Miyano, Satoru; Muramatsu, Hideki; Kojima, Seiji; Hira, Asuka; Takata, Minoru; Ohara, Osamu; Ogawa, Seishi; Morio, Tomohiro; Nonoyama, Shigeaki

2017-07-01

Common variable immunodeficiency (CVID) is the most common adult-onset primary antibody deficiency disease due to various causative genes. Several genes, which are known to be the cause of different diseases, have recently been reported as the cause of CVID in patients by performing whole exome sequencing (WES) analysis. Here, we found FANC gene mutations as a cause of adult-onset CVID in two patients. B cells were absent and CD4 + T cells were skewed toward CD45RO + memory T cells. T-cell receptor excision circles (TRECs) and signal joint kappa-deleting recombination excision circles (sjKRECs) were undetectable in both patients. Both patients had no anemia, neutropenia, or thrombocytopenia. Using WES, we identified compound heterozygous mutations of FANCE in one patient and homozygous mutation of FANCA in another patient. The impaired function of FANC protein complex was confirmed by a monoubiquitination assay and by chromosome fragility test. We then performed several immunological evaluations including quantitative lymphocyte analysis and TRECs/sjKRECs analysis for 32 individuals with Fanconi anemia (FA). In total, 22 FA patients (68.8%) were found to have immunological abnormalities, suggesting that such immunological findings may be common in FA patients. These data indicate that FANC mutations are involved in impaired lymphogenesis probably by the accumulation of DNA replication stress, leading to CVID. It is important to diagnose FA because it drastically changes clinical management. We propose that FANC mutations can cause isolated immunodeficiency in addition to bone marrow failure and malignancy.

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carmen Herranz, Ma; Sanchez-Navarro, Jesus-Angel; Sauri, Ana

2005-08-15

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutantsmore » and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.« less

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement.

PubMed

Carmen Herranz, Ma; Sanchez-Navarro, Jesús-Angel; Saurí, Ana; Mingarro, Ismael; Pallás, Vicente

2005-08-15

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.

Diagnosing XLP1 in patients with hemophagocytic lymphohistiocytosis.

PubMed

Meazza, Raffaella; Tuberosa, Claudia; Cetica, Valentina; Falco, Michela; Parolini, Silvia; Grieve, Sam; Griffiths, Gillian M; Sieni, Elena; Marcenaro, Stefania; Micalizzi, Concetta; Montin, Davide; Fagioli, Franca; Moretta, Alessandro; Mingari, Maria C; Moretta, Lorenzo; Notarangelo, Luigi D; Bottino, Cristina; Aricò, Maurizio; Pende, Daniela

2014-12-01

Hemophagocytic lymphohistiocytosis (HLH) is a life-threatening, heterogeneous, hyperinflammmatory disorder. Prompt identification of inherited forms resulting from mutation in genes involved in cellular cytotoxicity can be crucial. X-linked lymphoproliferative disease 1 (XLP1), due to mutations in SH2D1A (Xq25) encoding signaling lymphocyte activation molecule-associated protein (SAP), may present with HLH. Defective SAP induces paradoxical inhibitory function of the 2B4 coreceptor and impaired natural killer (NK) (and T) cell response against EBV-infected cells. To characterize a cohort of patients with HLH and XLP1 for SAP expression and 2B4 function in lymphocytes, proposing a rapid diagnostic screening to direct mutation analysis. We set up rapid assays for 2B4 function (degranulation or (51)Cr-release) to be combined with intracellular SAP expression in peripheral blood NK cells. We studied 12 patients with confirmed mutation in SH2D1A and some family members. The combined phenotypic/functional assays allowed efficient and complete diagnostic evaluation of all patients with XLP1, thus directing mutation analysis and treatment. Nine cases were SAP(-), 2 expressed SAP with mean relative fluorescence intensity values below the range of healthy controls (SAP(dull)), and 1, carrying the R55L mutation, was SAP(+). NK cells from all patients showed inhibitory 2B4 function and defective killing of B-EBV cells. Carriers with SH2D1A mutations abolishing SAP expression and low percentage of SAP(+) cells showed neutral 2B4 function at the polyclonal NK cell level. Three novel SH2D1A mutations have been identified. Study of SAP expression is specific but may have insufficient sensitivity for screening XLP1 as a single tool. Combination with 2B4 functional assay allows identification of all cases. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. All rights reserved.

ESR1 mutations affect anti-proliferative responses to tamoxifen through enhanced cross-talk with IGF signaling.

PubMed

Gelsomino, Luca; Gu, Guowei; Rechoum, Yassine; Beyer, Amanda R; Pejerrey, Sasha M; Tsimelzon, Anna; Wang, Tao; Huffman, Kenneth; Ludlow, Andrew; Andò, Sebastiano; Fuqua, Suzanne A W

2016-06-01

The purpose of this study was to address the role of ESR1 hormone-binding mutations in breast cancer. Soft agar anchorage-independent growth assay, Western blot, ERE reporter transactivation assay, proximity ligation assay (PLA), coimmunoprecipitation assay, silencing assay, digital droplet PCR (ddPCR), Kaplan-Meier analysis, and statistical analysis. It is now generally accepted that estrogen receptor (ESR1) mutations occur frequently in metastatic breast cancers; however, we do not yet know how to best treat these patients. We have modeled the three most frequent hormone-binding ESR1 (HBD-ESR1) mutations (Y537N, Y537S, and D538G) using stable lentiviral transduction in human breast cancer cell lines. Effects on growth were examined in response to hormonal and targeted agents, and mutation-specific changes were studied using microarray and Western blot analysis. We determined that the HBD-ESR1 mutations alter anti-proliferative effects to tamoxifen (Tam), due to cell-intrinsic changes in activation of the insulin-like growth factor receptor (IGF1R) signaling pathway and levels of PIK3R1/PIK3R3. The selective estrogen receptor degrader, fulvestrant, significantly reduced the anchorage-independent growth of ESR1 mutant-expressing cells, while combination treatments with the mTOR inhibitor everolimus, or an inhibitor blocking IGF1R, and the insulin receptor significantly enhanced anti-proliferative responses. Using digital drop (dd) PCR, we identified mutations at high frequencies ranging from 12 % for Y537N, 5 % for Y537S, and 2 % for D538G in archived primary breast tumors from women treated with adjuvant mono-tamoxifen therapy. The HBD-ESR1 mutations were not associated with recurrence-free or overall survival in response in this patient cohort and suggest that knowledge of other cell-intrinsic factors in combination with ESR1 mutation status will be needed determine anti-proliferative responses to Tam.

Antigen S1, encoded by the MIC1 gene, is characterized as an epitope of human CD59, enabling measurement of mutagen-induced intragenic deletions in the AL cell system

NASA Technical Reports Server (NTRS)

Wilson, A. B.; Seilly, D.; Willers, C.; Vannais, D. B.; McGraw, M.; Waldren, C. A.; Hei, T. K.; Davies, A.; Chatterjee, A. (Principal Investigator)

1999-01-01

S1 cell membrane antigen is encoded by the MIC1 gene on human chromosome 11. This antigen has been widely used as a marker for studies in gene mapping or in analysis of mutagen-induced gene deletions/mutations, which utilized the human-hamster hybrid cell-line, AL-J1, carrying human chromosome 11. Evidence is presented here which identifies S1 as an epitope of CD59, a cell membrane complement inhibiting protein. E7.1 monoclonal antibody, specific for the S1 determinant, was found to react strongly with membrane CD59 in Western blotting, and to bind to purified, urinary form of CD59 in ELISAs. Cell membrane expression of S1 on various cell lines always correlated with that of CD59 when examined by immunofluorescent staining. In addition, E7.1 antibody inhibited the complement regulatory function of CD59. Identification of S1 protein as CD59 has increased the scope of the AL cell system by enabling analysis of intragenic mutations, and multiplex PCR analysis of mutated cells is described, showing variable loss of CD59 exons.

No evidence for involvement of SDHD in neuroblastoma pathogenesis

PubMed Central

De Preter, Katleen; Vandesompele, Jo; Hoebeeck, Jasmien; Vandenbroecke, Caroline; Smet, Jöel; Nuyts, Annick; Laureys, Geneviève; Combaret, Valérie; Van Roy, Nadine; Roels, Frank; Van Coster, Rudy; Praet, Marleen; De Paepe, Anne; Speleman, Frank

2004-01-01

Background Deletions in the long arm of chromosome 11 are observed in a subgroup of advanced stage neuroblastomas with poor outcome. The deleted region harbours the tumour suppressor gene SDHD that is frequently mutated in paraganglioma and pheochromocytoma, which are, like neuroblastoma, tumours originating from the neural crest. In this study, we sought for evidence for involvement of SDHD in neuroblastoma. Methods SDHD was investigated on the genome, transcriptome and proteome level using mutation screening, methylation specific PCR, real-time quantitative PCR based homozygous deletion screening and mRNA expression profiling, immunoblotting, functional protein analysis and ultrastructural imaging of the mitochondria. Results Analysis at the genomic level of 67 tumour samples and 37 cell lines revealed at least 2 bona-fide mutations in cell lines without allelic loss at 11q23: a 4bp-deletion causing skip of exon 3 resulting in a premature stop codon in cell line N206, and a Y93C mutation in cell line NMB located in a region affected by germline SDHD mutations causing hereditary paraganglioma. No evidence for hypermethylation of the SDHD promotor region was observed, nor could we detect homozygous deletions. Interestingly, SDHD mRNA expression was significantly reduced in SDHD mutated cell lines and cell lines with 11q allelic loss as compared to both cell lines without 11q allelic loss and normal foetal neuroblast cells. However, protein analyses and assessment of mitochondrial morphology presently do not provide clues as to the possible effect of reduced SDHD expression on the neuroblastoma tumour phenotype. Conclusions Our study provides no indications for 2-hit involvement of SDHD in the pathogenesis of neuroblastoma. Also, although a haplo-insufficient mechanism for SDHD involvement in advanced stage neuroblastoma could be considered, the present data do not provide consistent evidence for this hypothesis. PMID:15331017

Different mechanisms of radiation-induced loss of heterozygosity in two human lymphoid cell lines from a single donor

NASA Technical Reports Server (NTRS)

Wiese, C.; Gauny, S. S.; Liu, W. C.; Cherbonnel-Lasserre, C. L.; Kronenberg, A.

2001-01-01

Allelic loss is an important mutational mechanism in human carcinogenesis. Loss of heterozygosity (LOH) at an autosomal locus is one outcome of the repair of DNA double-strand breaks (DSBs) and can occur by deletion or by mitotic recombination. We report that mitotic recombination between homologous chromosomes occurred in human lymphoid cells exposed to densely ionizing radiation. We used cells derived from the same donor that express either normal TP53 (TK6 cells) or homozygous mutant TP53 (WTK1 cells) to assess the influence of TP53 on radiation-induced mutagenesis. Expression of mutant TP53 (Met 237 Ile) was associated with a small increase in mutation frequencies at the hemizygous HPRT (hypoxanthine phosphoribosyl transferase) locus, but the mutation spectra were unaffected at this locus. In contrast, WTK1 cells (mutant TP53) were 30-fold more susceptible than TK6 cells (wild-type TP53) to radiation-induced mutagenesis at the TK1 (thymidine kinase) locus. Gene dosage analysis combined with microsatellite marker analysis showed that the increase in TK1 mutagenesis in WTK1 cells could be attributed, in part, to mitotic recombination. The microsatellite marker analysis over a 64-cM region on chromosome 17q indicated that the recombinational events could initiate at different positions between the TK1 locus and the centromere. Virtually all of the recombinational LOH events extended beyond the TK1 locus to the most telomeric marker. In general, longer LOH tracts were observed in mutants from WTK1 cells than in mutants from TK6 cells. Taken together, the results demonstrate that the incidence of radi-ation-induced mutations is dependent on the genetic background of the cell at risk, on the locus examined, and on the mechanisms for mutation available at the locus of interest.

Analysis of KRAS and BRAF genes mutation in the central nervous system metastases of non-small cell lung cancer.

PubMed

Nicoś, Marcin; Krawczyk, Paweł; Jarosz, Bożena; Sawicki, Marek; Szumiłło, Justyna; Trojanowski, Tomasz; Milanowski, Janusz

2016-05-01

KRAS mutations are associated with tumor resistance to EGFR TKIs (erlotinib, gefitinib) and to monoclonal antibody against EGFR (cetuximab). Targeted treatment of mutated RAS patients is still considered as a challenge. Inhibitors of c-Met (onartuzumab or tiwantinib) and MEK (selumetinib-a dual inhibitor of MEK1 and MEK2) signaling pathways showed activity in patients with mutations in KRAS that can became an effective approach in carriers of such disorders. BRAF mutation is very rare in patients with NSCLC, and its presence is associated with sensitivity of tumor cells to BRAF inhibitors (vemurafenib, dabrafenib). In the present study, the frequency and type of KRAS and BRAF mutation were assessed in 145 FFPE tissue samples from CNS metastases of NSCLC. In 30 patients, material from the primary tumor was simultaneously available. Real-time PCR technique with allele-specific molecular probe (KRAS/BRAF Mutation Analysis Kit, Entrogen, USA) was used for molecular tests. KRAS mutations were detected in 21.4 % of CNS metastatic lesions and in 23.3 % of corresponding primary tumors. Five mutations were identified both in primary and in metastatic lesions, while one mutation only in primary tumor and one mutation only in the metastatic tumor. Most of mutations were observed in codon 12 of KRAS; however, an individual patient had diagnosed a rare G13D and Q61R substitutions. KRAS mutations were significantly more frequent in adenocarcinoma patients and smokers. Additional analysis indicated one patient with rare coexistence of KRAS and DDR2 mutations. BRAF mutation was not detected in the examined materials. KRAS frequency appears to be similar in primary and CNS.

Functional Analysis of Somatic Mutations in Lung Cancer

DTIC Science & Technology

2015-10-01

antibody cetuximab [11]. Finally, we have developed novel single cell sequencing approaches to uncover EGFR mutational variants in glioblastoma and their...assessed which mutations are epistatic to EGFR or capable of initiating xenograft tumor formation in vivo. Using eVIP, we identified 69% of mutations...analyzed as impactful whereas 31% appear functionally neutral. A subset of the impactful mutations induce xenograft tumor formation in mice and/or

High-resolution Melting Analysis for Gene Scanning of Adenomatous Polyposis Coli (APC) Gene With Oral Squamous Cell Carcinoma Samples.

PubMed

Chang, Ya-Sian; Lin, Chien-Yu; Yang, Shu-Fen; Ho, Cheng Mao; Chang, Jan-Gowth

2016-02-01

There have been many different mutations reported for the large adenomatous polyposis coli (APC) tumor suppressor gene. APC mutations result in inactivation of APC tumor suppressor action, allowing the progression of tumorigenesis. The present study utilized a highly efficient method to identify APC mutations and investigated the association between the APC genetic variants Y486Y, A545A, T1493T, and D1822V and susceptibility to oral squamous cell carcinoma (OSCC). High-resolution melting (HRM) analysis was used to characterize APC mutations. Genomic DNA was extracted from 83 patient specimens of OSCC and 50 blood samples from healthy control subjects. The 14 exons and mutation cluster region of exon 15 were screened by HRM analysis. All mutations were confirmed by direct DNA sequencing. Three mutations and 4 single nucleotide polymorphisms (SNPs) were found in this study. The mutations were c.573T>C (Y191Y) in exon 5, c.1005A>G (L335L) in exon 9, and c.1488A>T (T496T) in exon 11. Two SNPs, c.4479G>A (T1493T) and c.5465A>T (D1822V), were located in exon 15, whereas c.1458T>C (Y486Y) and c.1635G>A (A545A) were located in exon 11 and 13, respectively. There was no observed association between OSCC risk and genotype for any of the 4 APC SNPs. The mutation of APC is rare in Taiwanese patients with OSCC. HRM analysis is a reliable, accurate, and fast screening method for APC mutations.

PAX5 mutations occur frequently in adult B-cell progenitor acute lymphoblastic leukemia and PAX5 haploinsufficiency is associated with BCR-ABL1 and TCF3-PBX1 fusion genes: a GRAALL study.

PubMed

Familiades, J; Bousquet, M; Lafage-Pochitaloff, M; Béné, M-C; Beldjord, K; De Vos, J; Dastugue, N; Coyaud, E; Struski, S; Quelen, C; Prade-Houdellier, N; Dobbelstein, S; Cayuela, J-M; Soulier, J; Grardel, N; Preudhomme, C; Cavé, H; Blanchet, O; Lhéritier, V; Delannoy, A; Chalandon, Y; Ifrah, N; Pigneux, A; Brousset, P; Macintyre, E A; Huguet, F; Dombret, H; Broccardo, C; Delabesse, E

2009-11-01

Adult and child B-cell progenitor acute lymphoblastic leukemia (BCP-ALL) differ in terms of incidence and prognosis. These disparities are mainly due to the molecular abnormalities associated with these two clinical entities. A genome-wide analysis using oligo SNP arrays recently demonstrated that PAX5 (paired-box domain 5) is the main target of somatic mutations in childhood BCP-ALL being altered in 38.9% of the cases. We report here the most extensive analysis of alterations of PAX5 coding sequence in 117 adult BCP-ALL patients in the unique clinical protocol GRAALL-2003/GRAAPH-2003. Our study demonstrates that PAX5 is mutated in 34% of adult BCP-ALL, mutations being partial or complete deletion, partial or complete amplification, point mutation or fusion gene. PAX5 alterations are heterogeneous consisting in complete loss in 17%, focal deletions in 10%, point mutations in 7% and translocations in 1% of the cases. PAX5 complete loss and PAX5 point mutations differ. PAX5 complete loss seems to be a secondary event and is significantly associated with BCR-ABL1 or TCF3-PBX1 fusion genes and a lower white blood cell count.

mtDNA lineage analysis of mouse L-cell lines reveals the accumulation of multiple mtDNA mutants and intermolecular recombination

PubMed Central

Fan, Weiwei; Lin, Chun Shi; Potluri, Prasanth; Procaccio, Vincent; Wallace, Douglas C.

2012-01-01

The role of mitochondrial DNA (mtDNA) mutations and mtDNA recombination in cancer cell proliferation and developmental biology remains controversial. While analyzing the mtDNAs of several mouse L cell lines, we discovered that every cell line harbored multiple mtDNA mutants. These included four missense mutations, two frameshift mutations, and one tRNA homopolymer expansion. The LA9 cell lines lacked wild-type mtDNAs but harbored a heteroplasmic mixture of mtDNAs, each with a different combination of these variants. We isolated each of the mtDNAs in a separate cybrid cell line. This permitted determination of the linkage phase of each mtDNA and its physiological characteristics. All of the polypeptide mutations inhibited their oxidative phosphorylation (OXPHOS) complexes. However, they also increased mitochondrial reactive oxygen species (ROS) production, and the level of ROS production was proportional to the cellular proliferation rate. By comparing the mtDNA haplotypes of the different cell lines, we were able to reconstruct the mtDNA mutational history of the L–L929 cell line. This revealed that every heteroplasmic L-cell line harbored a mtDNA that had been generated by intracellular mtDNA homologous recombination. Therefore, deleterious mtDNA mutations that increase ROS production can provide a proliferative advantage to cancer or stem cells, and optimal combinations of mutant loci can be generated through recombination. PMID:22345519

Agammaglobulinaemia despite terminal B-cell differentiation in a patient with a novel LRBA mutation.

PubMed

Al Sukaiti, Nashat; AbdelRahman, Khwater; AlShekaili, Jalila; Al Oraimi, Sumaya; Al Sinani, Aisha; Al Rahbi, Nasser; Cho, Vicky; Field, Matt; Cook, Matthew C

2017-05-01

Mutations in lipopolysaccharide-responsive vesicle trafficking, beach and anchor-containing protein (LRBA) cause immune deficiency and inflammation. Here, we are reporting a novel homozygous mutation in LRBA allele in 7-year-old Omani boy, born to consanguineous parents. He presented with type 1 diabetes, autoimmune haematological cytopenia, recurrent chest infections and lymphocytic interstitial lung disease. The patient was treated with CTLA4-Ig (abatacept) with good outcome every 2 weeks for a period of 3 months. He developed complete IgG deficiency, but remarkably, histological examination revealed germinal centres and plasma cells in lymphoid and inflamed lung tissue. Further charatecterisation showed these cells to express IgM but not IgG. This ex vivo analysis suggests that LRBA mutation confers a defect in class switching despite plasma cell formation.

Analysis of mutagenic DNA repair in a thermoconditional mutant of Saccharomyces cerevisiae. III. Dose-response pattern of mutation induction in UV-irradiated rev2ts cells.

PubMed

Siede, W; Eckardt, F

1986-01-01

Recent studies regarding the influence of cycloheximide on the temperature-dependent increase in survival and mutation frequencies of a thermoconditional rev2 mutant lead to the suggestion that the REV2-coded mutagenic repair function is UV-inducible. In the present study we show that stationary-phase rev2ts cells are characterized by a biphasic linear-quadratic dose-dependence of mutation induction ("mutation kinetics") of ochre alleles at 23 degrees C (permissive temperature) but linear kinetics at the restrictive temperature of 36 degrees C. Mathematical analysis using a model based on Poisson statistics and a further mathematical procedure, the calculation of "apparent survival", support the assumption that the quadratic component of the reverse mutation kinetics investigated can be attributed to a UV-inducible component of mutagenic DNA repair controlled by the REV2 gene.

Biochemical analysis of respiratory function in cybrid cell lines harbouring mitochondrial DNA mutations

PubMed Central

2004-01-01

We analysed key biochemical features that reflect the balance between glycolysis and glucose oxidation in cybrids (cytoplasmic hybrids) harbouring a representative sample of mitochondrial DNA point mutations and deletions. The cybrids analysed had the same 143B cell nuclear background and were isogenic for the mitochondrial background. The 143B cell line and its ρ0 counterpart were used as controls. All cells analysed were in a dynamic state, and cell number, time of plating, culture medium, extracellular volume and time of harvest and assay were strictly controlled. Intra- and extra-cellular lactate and pyruvate levels were measured in homoplasmic wild-type and mutant cells, and correlated with rates of ATP synthesis and O2 consumption. In all mutant cell lines, except those with the T8993C mutation in the ATPase 6 gene, glycolysis was increased even under conditions of low glucose, as demonstrated by increased levels of extracellular lactate and pyruvate. Extracellular lactate levels were strictly and inversely correlated with rates of ATP synthesis and O2 consumption. These results show increased glycolysis and defective oxidative phosphorylation, irrespective of the type or site of the point mutation or deletion in the mitochondrial genome. The different biochemical consequences of the T8993C mutation suggest a uniquely different pathogenic mechanism for this mutation. However, the distinct clinical features associated with some of these mutations still remain to be elucidated. PMID:15324306

Papillary renal cell carcinoma: a clinicopathological and whole-genome exon sequencing study

PubMed Central

Liu, Kunpeng; Ren, Yuan; Pang, Lijuan; Qi, Yan; Jia, Wei; Tao, Lin; Hu, Zhengyan; Zhao, Jin; Zhang, Haijun; Li, Li; Yue, Haifeng; Han, Juan; Liang, Weihua; Hu, Jianming; Zou, Hong; Yuan, Xianglin; Li, Feng

2015-01-01

Papillary renal cell carcinoma (PRCC) represents the second most common histological subtype of RCC, and comprises 2 subtypes. Prognosis for type 1 PRCC is relatively good, whereas type 2 PRCC is associated with poor clinical outcomes. The aim of the present study was to evaluate the clinicopathological and mutations characteristics of PRCC. Hence, we reported on 13 cases of PRCC analyzed using whole-exome sequencing. Histologically, type 2 PRCC showed a higher nuclear grade and lymphovascular invasion rate versus type 1 PRCC (P < 0.05). Immunostaining revealed type 1 PRCC had higher CK7 and lower Top IIα expression rates (P < 0.05). Whole-exome sequencing data analysis revealed that the mutational statuses of 373 genes (287 missense, 69 silent, 6 nonsense, and 11 synonymous mutations) differed significantly between PRCC and normal renal tissues (P < 0.05). Functional enrichment analysis was used to classify the 287 missense-mutated genes into 11 biological process clusters (comprised of 61 biological processes) and 5 pathways, involved in cell adhesion, microtubule-based movement, the cell cycle, polysaccharide biosynthesis, muscle cell development and differentiation, cell death, and negative regulation. Associated pathways included the ATP-binding cassette transporter, extracellular matrix-receptor interaction, lysosome, complement and coagulation cascades, and glyoxylate and dicarboxylate metabolism pathways. The missense mutation status of 19 genes differed significantly between the groups (P < 0.05), and alterations in the EEF1D, RFNG, GPR142, and RAB37 genes were located in different chromosomal regions in type 1 and 2 PRCC. These mutations may contribute to future studies on pathogenic mechanisms and targeted therapy of PRCC. PMID:26339402

Functional analysis of Discoidin domain receptor 2 mutation and expression in squamous cell lung cancer.

PubMed

Kobayashi-Watanabe, Naomi; Sato, Akemi; Watanabe, Tatsuro; Abe, Tomonori; Nakashima, Chiho; Sueoka, Eisaburo; Kimura, Shinya; Sueoka-Aragane, Naoko

2017-08-01

Discoidin domain receptor (DDR) 2 mutations have recently been reported to be candidate targets of molecular therapy in lung squamous cell carcinoma (SQCC). However, the status of DDR2 expression and mutations, as well as their precise roles in lung SQCC, have not been clarified. We here report DDR2 mutation and expression status in clinical samples and its role of lung SQCC. We investigated DDR2 expression and mutation status in 44 human clinical samples and 7 cell lines. Biological functions of DDR2 were assessed by in vitro cell invasion assay and animal model experiments. Endogenous DDR2 protein expression levels were high in one cell line, PC-1, and immunohistochemistry of lung cancer tissue array showed high levels of DDR2 protein in 29% of lung SQCC patients. A mutation (T681I) identified in lung SQCC and the cell line EBC-1 was detected among 44 primary lung SQCC samples and 7 lung SQCC cell lines. Although Forced expression of DDR2 and its mutant (T681I) led to induce SQCC cell invasion in vitro, only wild type DDR2 enhanced lung metastasis in an animal model. We also found that ectopic expression of DDR2 induced MMP-1 mRNA expression accompanied by phosphorylation of c-Jun after treatment with its ligand, collagen type I, but DDR2 with the T681I mutation did not, suggesting that T681I mutation is an inactivating mutation. Overexpression of DDR2 might contribute to tumor progression in lung SQCC. The overexpression of DDR2 could be potential molecular target of lung SQCC. Copyright © 2017 Elsevier B.V. All rights reserved.

Somatic hypermutation and antigen-driven selection of B cells are altered in autoimmune diseases.

PubMed

Zuckerman, Neta S; Hazanov, Helena; Barak, Michal; Edelman, Hanna; Hess, Shira; Shcolnik, Hadas; Dunn-Walters, Deborah; Mehr, Ramit

2010-12-01

B cells have been found to play a critical role in the pathogenesis of several autoimmune (AI) diseases. A common feature amongst many AI diseases is the formation of ectopic germinal centers (GC) within the afflicted tissue or organ, in which activated B cells expand and undergo somatic hypermutation (SHM) and antigen-driven selection on their immunoglobulin variable region (IgV) genes. However, it is not yet clear whether these processes occurring in ectopic GCs are identical to those in normal GCs. The analysis of IgV mutations has aided in revealing many aspects concerning B cell expansion, mutation and selection in GC reactions. We have applied several mutation analysis methods, based on lineage tree construction, to a large set of data, containing IgV productive and non-productive heavy and light chain sequences from several different tissues, to examine three of the most profoundly studied AI diseases - Rheumatoid Arthritis (RA), Multiple Sclerosis (MS) and Sjögren's Syndrome (SS). We have found that RA and MS sequences exhibited normal mutation spectra and targeting motifs, but a stricter selection compared to normal controls, which was more apparent in RA. SS sequence analysis results deviated from normal controls in both mutation spectra and indications of selection, also showing differences between light and heavy chain IgV and between different tissues. The differences revealed between AI diseases and normal control mutation patterns may result from the different microenvironmental influences to which ectopic GCs are exposed, relative to those in normal secondary lymphoid tissues. Copyright © 2010 Elsevier Ltd. All rights reserved.

Monoallelic mutation analysis (MAMA) for identifying germline mutations.

PubMed

Papadopoulos, N; Leach, F S; Kinzler, K W; Vogelstein, B

1995-09-01

Dissection of germline mutations in a sensitive and specific manner presents a continuing challenge. In dominantly inherited diseases, mutations occur in only one allele and are often masked by the normal allele. Here we report the development of a sensitive and specific diagnostic strategy based on somatic cell hybridization termed MAMA (monoallelic mutation analysis). We have demonstrated the utility of this strategy in two different hereditary colorectal cancer syndromes, one caused by a defective tumour suppressor gene on chromosome 5 (familial adenomatous polyposis, FAP) and the other caused by a defective mismatch repair gene on chromosome 2 (hereditary non-polyposis colorectal cancer, HNPCC).

Targeted mutation analysis of endometrial clear cell carcinoma.

PubMed

Hoang, Lien N; McConechy, Melissa K; Meng, Bo; McIntyre, John B; Ewanowich, Carol; Gilks, Cyril Blake; Huntsman, David G; Köbel, Martin; Lee, Cheng-Han

2015-04-01

Endometrial clear cell carcinomas (CCC) constitute fewer than 5% of all carcinomas of the endometrium. Currently, little is known regarding the genetic basis of endometrial CCC. We performed genomic and immunohistochemical analyses on 14 rigorously reviewed pure endometrial CCC. The genomic analysis consisted of sequencing the coding regions of 26 genes implicated previously in endometrial carcinoma. Twelve of 14 tumours displayed a prototypical CCC immunophenotype [napsin A+, hepatocyte nuclear factor-1β (HNF1β(+) ) and oestrogen receptor(-) ] and all showed intact mismatch repair protein expression. We detected mutations in 11 of 14 tumours, and there was a predominance of mutations involving genes that are mutated more frequently in endometrial serous carcinomas than in endometrioid carcinomas. Two tumours displayed a prototypical serous carcinoma mutation profile (concurrent TP53 and PPP2R1A mutations, without PTEN, CTNNB1 or ARID1A mutation). No mutations in PTEN, CTNNB1 or POLE were identified. The overall mutation profile of this cohort of endometrial CCC appears to be more serous-like than endometrioid-like, with a minor subset in the TP53-mutated CCC showing serous carcinoma profile. These findings provide new insights into the molecular features of morphologically prototypical endometrial CCC, and underscore the need for further investigations into the oncogenesis of endometrial CCC. © 2014 John Wiley & Sons Ltd.

Establishment and characterization of a penile cancer cell line, penl1, with a deleterious TP53 mutation as a paradigm of HPV-negative penile carcinogenesis.

PubMed

Chen, Jieping; Yao, Kai; Li, Zaishang; Deng, Chuangzhong; Wang, Liangjiao; Yu, Xingsu; Liang, Peili; Xie, Qiankun; Chen, Peng; Qin, Zike; Ye, Yunlin; Liu, Zhuowei; Zhou, Fangjian; Zhang, Zhenfeng; Han, Hui

2016-08-09

To establish penile cancer (PeCa) cell lines for the study of molecular mechanisms of carcinogenesis and testing therapeutic reagents. We successfully established two PeCa cell lines from fresh tumor tissues from 21 cases. One cell line named Penl1 was isolated from a lymph node metastasis (LNM) of penile squamous cell carcinoma (PeSCC), usual type and comprehensively characterized here. Our in-depth characterization analysis of the Penl1 cell line included morphology, tumorigenicity, genetic characteristics, protein expression, biology, and chemosensitivity. Penl1 was authenticated by single tandem repeat (STR) DNA typing. Comparative histomorphology, genetic characteristics, and protein expression patterns revealed essential similarities between the cell line and its corresponding LNM. In-depth characterization analysis of Penl1 cell line revealed tumorigenicity in immunodeficient mice, negative human papilloma virus (HPV) and mycoplasma infection, TP53 mutations and sensitivity to cisplatin and epirubicin. STR DNA typing did not match any cell lines within three international cell banks. The limitation of this study is that one patient cannot represent the complete heterogeneity of PeCa, especially primary tumor. We established and characterized an HPV-negative and moderately differentiated PeCa cell model with a TP53 missense mutation from a PeSCC, usual type patient. A preliminarily study of carcinogenesis and chemosensitivity suggests that this cell model carries a tumor suppressor gene mutation and is sensitive to chemotherapy drugs.

Establishment and characterization of a penile cancer cell line, penl1, with a deleterious TP53 mutation as a paradigm of HPV-negative penile carcinogenesis

PubMed Central

Li, Zaishang; Deng, Chuangzhong; Wang, Liangjiao; Yu, Xingsu; Liang, Peili; Xie, Qiankun; Chen, Peng; Qin, Zike; Ye, Yunlin; Liu, Zhuowei; Zhou, Fangjian; Zhang, Zhenfeng; Han, Hui

2016-01-01

Purpose To establish penile cancer (PeCa) cell lines for the study of molecular mechanisms of carcinogenesis and testing therapeutic reagents. Materials and Methods We successfully established two PeCa cell lines from fresh tumor tissues from 21 cases. One cell line named Penl1 was isolated from a lymph node metastasis (LNM) of penile squamous cell carcinoma (PeSCC), usual type and comprehensively characterized here. Our in-depth characterization analysis of the Penl1 cell line included morphology, tumorigenicity, genetic characteristics, protein expression, biology, and chemosensitivity. Penl1 was authenticated by single tandem repeat (STR) DNA typing. Results Comparative histomorphology, genetic characteristics, and protein expression patterns revealed essential similarities between the cell line and its corresponding LNM. In-depth characterization analysis of Penl1 cell line revealed tumorigenicity in immunodeficient mice, negative human papilloma virus (HPV) and mycoplasma infection, TP53 mutations and sensitivity to cisplatin and epirubicin. STR DNA typing did not match any cell lines within three international cell banks. The limitation of this study is that one patient cannot represent the complete heterogeneity of PeCa, especially primary tumor. Conclusions We established and characterized an HPV-negative and moderately differentiated PeCa cell model with a TP53 missense mutation from a PeSCC, usual type patient. A preliminarily study of carcinogenesis and chemosensitivity suggests that this cell model carries a tumor suppressor gene mutation and is sensitive to chemotherapy drugs. PMID:27351128

Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

PubMed

Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

2011-07-01

Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

Experimental design to evaluate directed adaptive mutation in Mammalian cells.

PubMed

Bordonaro, Michael; Chiaro, Christopher R; May, Tobias

2014-12-09

We describe the experimental design for a methodological approach to determine whether directed adaptive mutation occurs in mammalian cells. Identification of directed adaptive mutation would have profound practical significance for a wide variety of biomedical problems, including disease development and resistance to treatment. In adaptive mutation, the genetic or epigenetic change is not random; instead, the presence and type of selection influences the frequency and character of the mutation event. Adaptive mutation can contribute to the evolution of microbial pathogenesis, cancer, and drug resistance, and may become a focus of novel therapeutic interventions. Our experimental approach was designed to distinguish between 3 types of mutation: (1) random mutations that are independent of selective pressure, (2) undirected adaptive mutations that arise when selective pressure induces a general increase in the mutation rate, and (3) directed adaptive mutations that arise when selective pressure induces targeted mutations that specifically influence the adaptive response. The purpose of this report is to introduce an experimental design and describe limited pilot experiment data (not to describe a complete set of experiments); hence, it is an early report. An experimental design based on immortalization of mouse embryonic fibroblast cells is presented that links clonal cell growth to reversal of an inactivating polyadenylation site mutation. Thus, cells exhibit growth only in the presence of both the countermutation and an inducing agent (doxycycline). The type and frequency of mutation in the presence or absence of doxycycline will be evaluated. Additional experimental approaches would determine whether the cells exhibit a generalized increase in mutation rate and/or whether the cells show altered expression of error-prone DNA polymerases or of mismatch repair proteins. We performed the initial stages of characterizing our system and have limited preliminary data from several pilot experiments. Cell growth and DNA sequence data indicate that we have identified a cell clone that exhibits several suitable characteristics, although further study is required to identify a more optimal cell clone. The experimental approach is based on a quantum biological model of basis-dependent selection describing a novel mechanism of adaptive mutation. This project is currently inactive due to lack of funding. However, consistent with the objective of early reports, we describe a proposed study that has not produced publishable results, but is worthy of report because of the hypothesis, experimental design, and protocols. We outline the project's rationale and experimental design, with its strengths and weaknesses, to stimulate discussion and analysis, and lay the foundation for future studies in this field.

Establishment and characterization of a novel uterine carcinosarcoma cell line, TU-ECS-1, with mutations of TP53 and KRAS.

PubMed

Chiba, Yohei; Sato, Seiya; Itamochi, Hiroaki; Suga, Yasuko; Fukagawa, Tomoyuki; Oumi, Nao; Oishi, Tetsuro; Harada, Tasuku; Sugai, Tamotsu; Sugiyama, Toru

2017-04-01

A new human uterine carcinosarcoma (UCS) cell line, TU-ECS-1, was established and characterized. The morphological appearance of the cultured cells was an insular of epithelial-like cells arranged in the form of a jigsaw puzzle and mesenchymal-like cells with a spindle-shaped or fibroblast-like morphology. A relatively high proliferation rate was observed with a doubling time of 18.2 h. The chromosome number ranged from 44 to 49 and had an extra chromosome 12 (trisomy 12). The respective half-maximal inhibitory concentrations of cisplatin, paclitaxel, and doxorubicin were 2.9 µM, 154 nM, and 219 ng/mL, respectively. Mutational analysis revealed that TU-ECS-1 cells have mutations of TP53 in exons 4, 6, and 8 and of KRAS at codon 12 (G12D) in exon 2, which is a mutation hot spot on this gene. Western blot analysis showed that p53 protein was overexpressed in TU-ECS-1 cells. Immunostaining of the cultured cells and in vivo tumors showed that the TU-ECS-1 cells and xenografts were positive for epithelial marker cytokeratin AE1/3 and mesenchymal marker vimentin. These results suggested that TU-ECS-1 cells might have both epithelial and mesenchymal characteristics. This cell line may be useful to study the carcinogenesis of UCS and contribute to the development of novel treatment strategies.

BRD4-targeted therapy induces Myc-independent cytotoxicity in Gnaq/11-mutatant uveal melanoma cells.

PubMed

Ambrosini, Grazia; Sawle, Ashley D; Musi, Elgilda; Schwartz, Gary K

2015-10-20

Uveal melanoma (UM) is an aggressive intraocular malignancy with limited therapeutic options. Both primary and metastatic UM are characterized by oncogenic mutations in the G-protein alpha subunit q and 11. Furthermore, nearly 40% of UM has amplification of the chromosomal arm 8q and monosomy of chromosome 3, with consequent anomalies of MYC copy number. Chromatin regulators have become attractive targets for cancer therapy. In particular, the bromodomain and extra-terminal (BET) inhibitor JQ1 has shown selective inhibition of c-Myc expression with antiproliferative activity in hematopoietic and solid tumors. Here we provide evidence that JQ1 had cytotoxic activity in UM cell lines carrying Gnaq/11 mutations, while in cells without the mutations had little effects. Using microarray analysis, we identified a large subset of genes modulated by JQ1 involved in the regulation of cell cycle, apoptosis and DNA repair. Further analysis of selected genes determined that the concomitant silencing of Bcl-xL and Rad51 represented the minimal requirement to mimic the apoptotic effects of JQ1 in the mutant cells, independently of c-Myc. In addition, administration of JQ1 to mouse xenograft models of Gnaq-mutant UM resulted in significant inhibition of tumor growth.Collectively, our results define BRD4 targeting as a novel therapeutic intervention against UM with Gnaq/Gna11 mutations.

Agammaglobulinaemia despite terminal B-cell differentiation in a patient with a novel LRBA mutation

PubMed Central

Al Sukaiti, Nashat; AbdelRahman, Khwater; AlShekaili, Jalila; Al Oraimi, Sumaya; Al Sinani, Aisha; Al Rahbi, Nasser; Cho, Vicky; Field, Matt; Cook, Matthew C

2017-01-01

Mutations in lipopolysaccharide-responsive vesicle trafficking, beach and anchor-containing protein (LRBA) cause immune deficiency and inflammation. Here, we are reporting a novel homozygous mutation in LRBA allele in 7-year-old Omani boy, born to consanguineous parents. He presented with type 1 diabetes, autoimmune haematological cytopenia, recurrent chest infections and lymphocytic interstitial lung disease. The patient was treated with CTLA4-Ig (abatacept) with good outcome every 2 weeks for a period of 3 months. He developed complete IgG deficiency, but remarkably, histological examination revealed germinal centres and plasma cells in lymphoid and inflamed lung tissue. Further charatecterisation showed these cells to express IgM but not IgG. This ex vivo analysis suggests that LRBA mutation confers a defect in class switching despite plasma cell formation. PMID:28690850

The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

PubMed

Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

2000-03-01

Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

Mutations in a gene encoding the. cap alpha. subunit of a Saccharomyces cerevisiae G protein indicate a role in mating pheromone signaling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jahng, K.Y.; Ferguson, J.; Reed, S.I.

1988-06-01

Mutations which allowed conjugation by Saccharomyces cerevisiae cells lacking a mating pheromone receptor gene were selected. One of the genes defined by such mutations was isolated from a yeast genomic library by complementation of a temperature-sensitive mutation and is identically to the gene GPA1 (also known as SCG1), recently shown to be highly homologous to gene encoding the ..cap alpha.. subunits of mammalian G proteins. Physiological analysis of temperature-sensitive gpal mutations suggests that the encoded G protein is involved in signaling in response to mating pheromones. Mutational disruption of G-protein activity causes cell-cycle arrest in G/sub 1/, deposition of mating-specificmore » cell surface aggultinins, and induction of pheromone-specific mRNa, all of which are responses to pheromone in wild-type cells. In addition, mutants can conjugate without the benefit of mating pheromone or pheromone receptor. A model is presented where the activated G protein has a negative impact on a constitutive signal which normally keeps the pheromone response repressed.« less

Cancer-specific SNPs originate from low-level heteroplasmic variants in human mitochondrial genomes of a matched cell line pair.

PubMed

Hedberg, Annica; Knutsen, Erik; Løvhaugen, Anne Silje; Jørgensen, Tor Erik; Perander, Maria; Johansen, Steinar D

2018-04-19

Low-level mitochondrial heteroplasmy is a common phenomenon in both normal and cancer cells. Here, we investigate the link between low-level heteroplasmy and mitogenome mutations in a human breast cancer matched cell line by high-throughput sequencing. We identified 23 heteroplasmic sites, of which 15 were common between normal cells (Hs578Bst) and cancer cells (Hs578T). Most sites were clustered within the highly conserved Complex IV and ribosomal RNA genes. Two heteroplasmic variants in normal cells were found as fixed mutations in cancer cells. This indicates a positive selection of these variants in cancer cells. RNA-Seq analysis identified upregulated L-strand specific transcripts in cancer cells, which include three mitochondrial long non-coding RNA molecules. We hypothesize that this is due to two cancer cell-specific mutations in the control region.

Molecular methods for the detection of mutations.

PubMed

Monteiro, C; Marcelino, L A; Conde, A R; Saraiva, C; Giphart-Gassler, M; De Nooij-van Dalen, A G; Van Buuren-van Seggelen, V; Van der Keur, M; May, C A; Cole, J; Lehmann, A R; Steinsgrimsdottir, H; Beare, D; Capulas, E; Armour, J A

2000-01-01

We report the results of a collaborative study aimed at developing reliable, direct assays for mutation in human cells. The project used common lymphoblastoid cell lines, both with and without mutagen treatment, as a shared resource to validate the development of new molecular methods for the detection of low-level mutations in the presence of a large excess of normal alleles. As the "gold standard, " hprt mutation frequencies were also measured on the same samples. The methods under development included i) the restriction site mutation (RSM) assay, in which mutations lead to the destruction of a restriction site; ii) minisatellite length-change mutation, in which mutations lead to alleles containing new numbers of tandem repeat units; iii) loss of heterozygosity for HLA epitopes, in which antibodies can be used to direct selection for mutant cells; iv) multiple fluorescence-based long linker arm nucleotides assay (mf-LLA) technology, for the detection of substitutional mutations; v) detection of alterations in the TP53 locus using a (CA) array as the target for the screening; and vi) PCR analysis of lymphocytes for the presence of the BCL2 t(14:18) translocation. The relative merits of these molecular methods are discussed, and a comparison made with more "traditional" methods.

A strongly selected mutation in the HIV-1 genome is independent of T cell responses and neutralizing antibodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Donglai; Wang, Chu; Hora, Bhavna

Mutations rapidly accumulate in the HIV-1 genome after infection. Some of those mutations are selected by host immune responses and often cause viral fitness losses. This study is to investigate whether strongly selected mutations that are not associated with immune responses result in fitness losses. Strongly selected mutations were identified by analyzing 5'-half HIV-1 genome (gag/pol) sequences from longitudinal samples of subject CH0131. The K43R mutation in the gag gene was first detected at day 91 post screening and was fixed in the viral population at day 273 while the synonymous N323tc mutation was first detected at day 177 andmore » fixed at day 670. No conventional or cryptic T cell responses were detected against either mutation sites by ELISpot analysis. However, when fitness costs of both mutations were measured by introducing each mutation into their cognate transmitted/founder (T/F) viral genome, the K43R mutation caused a significant fitness loss while the N323tc mutation had little impact on viral fitness. In conclusion, the rapid fixation, the lack of detectable immune responses and the significant fitness cost of the K43R mutation suggests that it was strongly selected by host factors other than T cell responses and neutralizing antibodies.« less

A strongly selected mutation in the HIV-1 genome is independent of T cell responses and neutralizing antibodies

DOE PAGES

Liu, Donglai; Wang, Chu; Hora, Bhavna; ...

2017-10-10

Mutations rapidly accumulate in the HIV-1 genome after infection. Some of those mutations are selected by host immune responses and often cause viral fitness losses. This study is to investigate whether strongly selected mutations that are not associated with immune responses result in fitness losses. Strongly selected mutations were identified by analyzing 5'-half HIV-1 genome (gag/pol) sequences from longitudinal samples of subject CH0131. The K43R mutation in the gag gene was first detected at day 91 post screening and was fixed in the viral population at day 273 while the synonymous N323tc mutation was first detected at day 177 andmore » fixed at day 670. No conventional or cryptic T cell responses were detected against either mutation sites by ELISpot analysis. However, when fitness costs of both mutations were measured by introducing each mutation into their cognate transmitted/founder (T/F) viral genome, the K43R mutation caused a significant fitness loss while the N323tc mutation had little impact on viral fitness. In conclusion, the rapid fixation, the lack of detectable immune responses and the significant fitness cost of the K43R mutation suggests that it was strongly selected by host factors other than T cell responses and neutralizing antibodies.« less

Non-syndromic hearing loss caused by the dominant cis mutation R75Q with the recessive mutation V37I of the GJB2 (Connexin 26) gene.

PubMed

Kim, Juwon; Jung, Jinsei; Lee, Min Goo; Choi, Jae Young; Lee, Kyung-A

2015-06-19

GJB2 alleles containing two cis mutations have been rarely found in non-syndromic hearing loss. Herein, we present a Korean patient with non-syndromic hearing loss caused by the R75Q cis mutation with V37I, which arose de novo in the father and was inherited by the patient. Biochemical coupling and hemichannel permeability assays were performed after molecular cloning and transfection of HEK293T cells. Student's t-tests or analysis of variance followed by Tukey's multiple comparison test was used as statistical analysis. Biochemical coupling was significantly reduced in connexin 26 (Cx26)-R75Q- and Cx26-V37I-transfected cells, with greater extent in Cx26-R75Q and Cx26-R75Q+V37I cells. Interestingly, our patient and his father with the mutations had more residual hearing compared with patients with the dominant mutation alone. Although the difference in hemichannel activity between R75Q alone and R75Q in combination with V37I failed to reach significance, it is of note that there is a possibility that V37I located upstream of R75Q might have the ability to ameliorate R75Q expression. Our study emphasizes the importance of cis mutations with R75Q, as the gene effect of R75Q can be modulated depending on the type of additional mutation.

Detection of EGFR and KRAS mutations in fine-needle aspirates stored on Whatman FTA cards: is this the tool for biobanking cytological samples in the molecular era?

PubMed

da Cunha Santos, Gilda; Liu, Ni; Tsao, Ming-Sound; Kamel-Reid, Suzanne; Chin, Kayu; Geddie, William R

2010-12-25

The aims of this study were to compare the quality of DNA recovered from fine-needle aspirates (FNAs) stored on Whatman FTA cards with that retrieved from corresponding cell blocks and to determine whether the DNA extracted from the cards is suitable for multiple mutation analyses. FNAs collected from 18 resected lung tumors and cell suspensions from 4 lung cancer cell lines were placed on FTA Indicating Micro Cards and further processed to produce paired formalin-fixed paraffin-embedded (FFPE) cell blocks. Fragment analysis was used for the detection of EGFR exon 19 deletion, and direct sequencing for detection of EGFR exon 21 L858R mutation and exon 2 deletion of KRAS. Corresponding FFPE tissue sections from 2 resection specimens were also tested. Analyses were successful with all FNAs and lung cancer-derived cell lines collected on cards. Polymerase chain reaction failed in 2 cell blocks. For FNAs collected on cards, 5 cases showed EGFR and 3 showed KRAS mutations. Eleven cases were wild type. With cell blocks, 4 cases were found to harbor KRAS and 4 harbored EGFR mutations. All lung cancer-derived cell lines tested positive for their respective mutations, and there was complete agreement between card and cell block FNA samples for EGFR exon 21. For EGFR exon 19, 1 of 18 cases showed discordant results between the card and cell block, and for KRAS 1 of 17. The two resection specimens tested gave concordant results with the FTA card. Storage of cytologic material on FTA cards can maximize and simplify sample procurement for multiple mutational analyses with results similar to those from cell blocks.

Inhibition of the Growth of Papillary Thyroid Carcinoma Cells by CI-1040

PubMed Central

Henderson, Ying C.; Ahn, Soon-Hyun; Clayman, Gary L.

2015-01-01

Background Papillary thyroid carcinoma (PTC), the most common type of thyroid malignancy, usually possesses mutations, either RET/PTC rearrangement or BRAF mutation. Both mutations can activate the mitogen-activated protein kinase kinase/extracellular signal–related kinase signaling transduction pathway, which results in activation of transcription factors that regulate cellular proliferation, differentiation, and apoptosis. Objective To test the effects of CI-1040 (PD184352), a specific MEK1/2 inhibitor, on PTC cells carrying either an RET/PTC1 rearrangement or a BRAF mutation. Design The effects of CI-1040 on PTC cells were evaluated in vitro and in vivo. Main Outcome Measures The effects of CI-1040 on PTC cells were evaluated in vitro using a cell proliferation assay, cell cycle analysis, and immunoblotting. The antitumor effects of CI-1040 in vivo were evaluated in an orthotopic mouse model. Results The concentrations of CI-1040 needed to inhibit 50% cell growth were 0.052μM for PTC cells with a BRAF mutation and 1.1μM for PTC cells with the RET/PTC1 rearrangement. After 3 weeks of oral administration of CI-1040 (300 mg/kg/d) to mice with orthotopic tumor implants of PTC cells, the mean tumor volume of implants bearing the RET/PTC1 rearrangement (n=5) was reduced 47.5% compared with untreated mice (from 701.9 to 368.5 mm3), and the mean volume of implants with a BRAF mutation (n=8) was reduced 31.3% (from 297.3 to 204.2 mm3). Conclusions CI-1040 inhibits PTC cell growth in vitro and in vivo. Because RET/PTC rearrangements are unique to thyroid carcinomas and a high percentage of PTCs possess either mutation, these findings support the clinical evaluation of CI-1040 for patients with PTC. PMID:19380355

Oligonucleotide gap-fill ligation for mutation detection and sequencing in situ

PubMed Central

Mignardi, Marco; Mezger, Anja; Qian, Xiaoyan; La Fleur, Linnea; Botling, Johan; Larsson, Chatarina; Nilsson, Mats

2015-01-01

In clinical diagnostics a great need exists for targeted in situ multiplex nucleic acid analysis as the mutational status can offer guidance for effective treatment. One well-established method uses padlock probes for mutation detection and multiplex expression analysis directly in cells and tissues. Here, we use oligonucleotide gap-fill ligation to further increase specificity and to capture molecular substrates for in situ sequencing. Short oligonucleotides are joined at both ends of a padlock gap probe by two ligation events and are then locally amplified by target-primed rolling circle amplification (RCA) preserving spatial information. We demonstrate the specific detection of the A3243G mutation of mitochondrial DNA and we successfully characterize a single nucleotide variant in the ACTB mRNA in cells by in situ sequencing of RCA products generated by padlock gap-fill ligation. To demonstrate the clinical applicability of our assay, we show specific detection of a point mutation in the EGFR gene in fresh frozen and formalin-fixed, paraffin-embedded (FFPE) lung cancer samples and confirm the detected mutation by in situ sequencing. This approach presents several advantages over conventional padlock probes allowing simpler assay design for multiplexed mutation detection to screen for the presence of mutations in clinically relevant mutational hotspots directly in situ. PMID:26240388

Novel Cell Culture-Adapted Genotype 2a Hepatitis C Virus Infectious Clone

PubMed Central

Date, Tomoko; Kato, Takanobu; Kato, Junko; Takahashi, Hitoshi; Morikawa, Kenichi; Akazawa, Daisuke; Murayama, Asako; Tanaka-Kaneko, Keiko; Sata, Tetsutaro; Tanaka, Yasuhito; Mizokami, Masashi

2012-01-01

Although the recently developed infectious hepatitis C virus system that uses the JFH-1 clone enables the study of whole HCV viral life cycles, limited particular HCV strains have been available with the system. In this study, we isolated another genotype 2a HCV cDNA, the JFH-2 strain, from a patient with fulminant hepatitis. JFH-2 subgenomic replicons were constructed. HuH-7 cells transfected with in vitro transcribed replicon RNAs were cultured with G418, and selected colonies were isolated and expanded. From sequencing analysis of the replicon genome, several mutations were found. Some of the mutations enhanced JFH-2 replication; the 2217AS mutation in the NS5A interferon sensitivity-determining region exhibited the strongest adaptive effect. Interestingly, a full-length chimeric or wild-type JFH-2 genome with the adaptive mutation could replicate in Huh-7.5.1 cells and produce infectious virus after extensive passages of the virus genome-replicating cells. Virus infection efficiency was sufficient for autonomous virus propagation in cultured cells. Additional mutations were identified in the infectious virus genome. Interestingly, full-length viral RNA synthesized from the cDNA clone with these adaptive mutations was infectious for cultured cells. This approach may be applicable for the establishment of new infectious HCV clones. PMID:22787209

Mutational Analysis of Extranodal NK/T-Cell Lymphoma Using Targeted Sequencing with a Comprehensive Cancer Panel.

PubMed

Choi, Seungkyu; Go, Jai Hyang; Kim, Eun Kyung; Lee, Hojung; Lee, Won Mi; Cho, Chun-Sung; Han, Kyudong

2016-09-01

Extranodal natural killer (NK)/T-cell lymphoma, nasal type (NKTCL), is a malignant disorder of cytotoxic lymphocytes of NK or T cells. It is an aggressive neoplasm with a very poor prognosis. Although extranodal NKTCL reportedly has a strong association with Epstein-Barr virus, the molecular pathogenesis of NKTCL has been unexplored. The recent technological advancements in next-generation sequencing (NGS) have made DNA sequencing cost- and time-effective, with more reliable results. Using the Ion Proton Comprehensive Cancer Panel, we sequenced 409 cancer-related genes to identify somatic mutations in five NKTCL tissue samples. The sequencing analysis detected 25 mutations in 21 genes. Among them, KMT2D , a histone modification-related gene, was the most frequently mutated gene (four of the five cases). This result was consistent with recent NGS studies that have suggested KMT2D as a novel driver gene in NKTCL. Mutations were also found in ARID1A , a chromatin remodeling gene, and TP53 , which also recurred in recent NGS studies. We also found mutations in 18 novel candidate genes, with molecular functions that were potentially implicated in cancer development. We suggest that these genes may result in multiple oncogenic events and may be used as potential bio-markers of NKTCL in the future.

Analysis of point mutations in an ultraviolet-irradiated shuttle vector plasmid propagated in cells from Japanese xeroderma pigmentosum patients in complementation groups A and F

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yagi, T.; Tatsumi-Miyajima, J.; Sato, M.

1991-06-15

To assess the contribution to mutagenesis by human DNA repair defects, a UV-treated shuttle vector plasmid, pZ189, was passed through fibroblasts derived from Japanese xeroderma pigmentosum (XP) patients in two different DNA repair complementation groups (A and F). Patients with XP have clinical and cellular UV hypersensitivity, increased frequency of skin cancer, and defects in DNA repair. The XP DNA repair defects represented by complementation groups A (XP-A) and F (XP-F) are more common in Japan than in Europe or the United States. In comparison to results with DNA repair-proficient human cells (W138-VA13), UV-treated pZ189 passed through the XP-A (XP2OS(SV))more » or XP-F (XP2YO(SV)) cells showed fewer surviving plasmids (XP-A less than XP-F) and a higher frequency of mutated plasmids (XP-A greater than XP-F). Base sequence analysis of more than 200 mutated plasmids showed the major type of base substitution mutation to be the G:C----A:T transition with all three cell lines. The XP-A and XP-F cells revealed a higher frequency of G:C----A:T transitions and a lower frequency of transversions among plasmids with single or tandem mutations and a lower frequency of plasmids with multiple point mutations compared to the normal line. The spectrum of mutations in pZ189 with the XP-A cells was similar to that with the XP-F cells. Seventy-six to 91% of the single base substitution mutations occurred at G:C base pairs in which the 5{prime}-neighboring base of the cytosine was thymine or cytosine. These studies indicate that the DNA repair defects in Japanese XP patients in complementation groups A and F result in different frequencies of plasmid survival and mutagenesis but in similar types of mutagenic abnormalities despite marked differences in clinical features.« less

Problem-Solving Test: Analysis of DNA Damage Recognizing Proteins in Yeast and Human Cells

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2013-01-01

The experiment described in this test was aimed at identifying DNA repair proteins in human and yeast cells. Terms to be familiar with before you start to solve the test: DNA repair, germline mutation, somatic mutation, inherited disease, cancer, restriction endonuclease, radioactive labeling, [alpha-[superscript 32]P]ATP, [gamma-[superscript…

Analysis of mutagenic DNA repair in a thermoconditional mutant of Saccharomyces cerevisiae. IV. Influence of DNA replication and excision repair on REV2 dependent UV-mutagenesis and repair.

PubMed

Siede, W; Eckardt, F

1986-01-01

A double mutant being thermoconditionally defective in mutation induction as well as in repair of pre-lethal UV-induced DNA damage (rev2ts) and deficient in excision repair (rad3-2) was studied in temperature-shift experiments. The influence of inhibitors of DNA replication (hydroxyurea, aphidicolin) was determined. Additionally, an analysis of the dose-response pattern of mutation induction ("mutation kinetics") at several ochre alleles was carried out. It was concluded that the UV-inducible REV2 dependent mutagenic repair process is not induced in excision-deficient cells. In excision-deficient cells, REV2 dependent mutation fixation is slow and mostly post-replicative though not dependent on DNA replication. The REV2 mediated mutagenic process could be separated from the repair function.

Multiple independent second-site mutations in two siblings with somatic mosaicism for Wiskott-Aldrich syndrome.

PubMed

Boztug, K; Germeshausen, M; Avedillo Díez, I; Gulacsy, V; Diestelhorst, J; Ballmaier, M; Welte, K; Maródi, L; Chernyshova, Li; Klein, C

2008-07-01

Wiskott-Aldrich syndrome (WAS) is an X-linked primary immunodeficiency disorder associated with microthrombocytopenia, eczema, autoimmunity and predisposition to malignant lymphoma. Although rare, few cases of somatic mosaicism have been published in WAS patients to date. We here report on two Ukrainian siblings who were referred to us at the age of 3 and 4 years, respectively. Both patients suffered from severe WAS caused by a nonsense mutation in exon 1 of the WAS gene. In both siblings, flow cytometric analysis revealed the presence of Wiskott-Aldrich syndrome protein (WASp)-positive and WASp-negative cell populations among T and B lymphocytes as well as natural killer (NK) cells. In contrast to previously described cases of revertant mosaicism in WAS, molecular analyses in both children showed that the WASp-positive T cells, B cells, and NK cells carried multiple different second-site mutations, resulting in different missense mutations. To our knowledge, this is the first report describing somatic mosaicism in WAS patients caused by several independent second-site mutations in the WAS gene.

Genetic defects in PI3Kδ affect B-cell differentiation and maturation leading to hypogammaglobulineamia and recurrent infections.

PubMed

Wentink, Marjolein; Dalm, Virgil; Lankester, Arjan C; van Schouwenburg, Pauline A; Schölvinck, Liesbeth; Kalina, Tomas; Zachova, Radana; Sediva, Anna; Lambeck, Annechien; Pico-Knijnenburg, Ingrid; van Dongen, Jacques J M; Pac, Malgorzata; Bernatowska, Ewa; van Hagen, Martin; Driessen, Gertjan; van der Burg, Mirjam

2017-03-01

Mutations in PIK3CD and PIK3R1 cause activated PI3K-δ syndrome (APDS) by dysregulation of the PI3K-AKT pathway. We studied precursor and peripheral B-cell differentiation and apoptosis via flowcytometry. Furthermore, we performed AKT-phosphorylation assays and somatic hypermutations (SHM) and class switch recombination (CSR) analysis. We identified 13 patients of whom 3 had new mutations in PIK3CD or PIK3R1. Patients had low total B-cell numbers with increased frequencies of transitional B cells and plasmablasts, while the precursor B-cell compartment in bone marrow was relatively normal. Basal AKT phosphorylation was increased in lymphocytes from APDS patients and natural effector B cells where most affected. PI3K mutations resulted in altered SHM and CSR and increased apoptosis. The B-cell compartment in APDS patients is affected by the mutations in PI3K. There is reduced differentiation beyond the transitional stage, increased AKT phosphorylation and increased apoptosis. This B-cell phenotype contributes to the clinical phenotype. Copyright © 2017. Published by Elsevier Inc.

Hot spot mutations in Finnish non-small cell lung cancers.

PubMed

Mäki-Nevala, Satu; Sarhadi, Virinder Kaur; Rönty, Mikko; Kettunen, Eeva; Husgafvel-Pursiainen, Kirsti; Wolff, Henrik; Knuuttila, Aija; Knuutila, Sakari

2016-09-01

Non-small cell lung cancer (NSCLC) is a common cancer with a poor prognosis. The aim of this study was to screen Finnish NSCLC tumor samples for common cancer-related mutations by targeted next generation sequencing and to determine their concurrences and associations with clinical features. Sequencing libraries were prepared from DNA isolated from formalin-fixed, paraffin-embedded tumor material of 425 patients using the AmpliSeq Colon and Lung panel covering mutational hot spot regions of 22 cancer genes. Sequencing was performed with the Ion Torrent Personal Genome Machine (PGM). Data analysis of the hot spot mutations revealed mutations in 77% of the patients, with 7% having 3 or more mutations reported in the Catalogue of Somatic Mutations in Cancer (COSMIC) database. Two of the most frequently mutated genes were TP53 (46%) and KRAS (25%). KRAS codon 12 mutations were the most recurrently occurring mutations. EGFR mutations were significantly associated with adenocarcinoma, female gender and never/light-smoking history; CTNNB1 mutations with light ex-smokers, PIK3CA and TP53 mutations with squamous cell carcinoma, and KRAS with adenocarcinoma. TP53 mutations were most prevalent in current smokers and ERBB2, ERBB4, PIK3CA, NRAS, NOTCH1, FBWX7, PTEN and STK11 mutations occurred exclusively in a group of ever-smokers, however the association was not statistically significant. No mutation was found that associated with asbestos exposure. Finnish NSCLC patients have a similar mutation profile as other Western patients, however with a higher frequency of BRAF mutations but a lower frequency of STK11 and ERBB2 mutations. Moreover, TP53 mutations occurred frequently with other gene mutations, most commonly with KRAS, MET, EGFR and PIK3CA mutations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Mutation Pattern of Paired Immunoglobulin Heavy and Light Variable Domains in Chronic Lymphocytic Leukemia B Cells

PubMed Central

Ghiotto, Fabio; Marcatili, Paolo; Tenca, Claudya; Calevo, Maria Grazia; Yan, Xiao-Jie; Albesiano, Emilia; Bagnara, Davide; Colombo, Monica; Cutrona, Giovanna; Chu, Charles C; Morabito, Fortunato; Bruno, Silvia; Ferrarini, Manlio; Tramontano, Anna; Fais, Franco; Chiorazzi, Nicholas

2011-01-01

B-cell chronic lymphocytic leukemia (CLL) patients display leukemic clones bearing either germline or somatically mutated immunoglobulin heavy variable (IGHV ) genes. Most information on CLL immunoglobulins (Igs), such as the definition of stereotyped B-cell receptors (BCRs), was derived from germline unmutated Igs. In particular, detailed studies on the distribution and nature of mutations in paired heavy- and light-chain domains of CLL clones bearing mutated Igs are lacking. To address the somatic hyper-mutation dynamics of CLL Igs, we analyzed the mutation pattern of paired IGHV–diversity-joining (IGHV-D-J ) and immunoglobulin kappa/lambda variable-joining (IGK/LV-J ) rearrangements of 193 leukemic clones that displayed ≥2% mutations in at least one of the two immunoglobulin variable (IGV ) genes (IGHV and/or IGK/LV ). The relationship between the mutation frequency in IGHV and IGK/LV complementarity determining regions (CDRs) and framework regions (FRs) was evaluated by correlation analysis. Replacement (R) mutation frequency within IGK/LV chain CDRs correlated significantly with mutation frequency of paired IGHV CDRs in λ but not κ isotype CLL clones. CDRs of IGKV-J rearrangements displayed a lower percentage of R mutations than IGHVs. The frequency/pattern of mutations in kappa CLL Igs differed also from that in κ-expressing normal B cells described in the literature. Instead, the mutation frequency within the FRs of IGHV and either IGKV or IGLV was correlated. Notably, the amount of diversity introduced by replaced amino acids was comparable between IGHVs and IGKVs. The data indicate a different mutation pattern between κ and λ isotype CLL clones and suggest an antigenic selection that, in κ samples, operates against CDR variation. PMID:21785810

Identification and functional analysis of CBLB mutations in type 1 diabetes.

PubMed

Yokoi, Norihide; Fujiwara, Yuuka; Wang, He-Yao; Kitao, Mai; Hayashi, Chihiro; Someya, Tomohiro; Kanamori, Masao; Oiso, Yutaka; Tajima, Naoko; Yamada, Yuichiro; Seino, Yutaka; Ikegami, Hiroshi; Seino, Susumu

2008-03-28

Casitas B-lineage lymphoma b (Cblb) is a negative regulator of T-cell activation and dysfunction of Cblb in rats and mice results in autoimmunity. In particular, a nonsense mutation in Cblb has been identified in a rat model of autoimmune type 1 diabetes. To clarify the possible involvement of CBLB mutation in type 1 diabetes in humans, we performed mutation screening of CBLB and characterized functional properties of the mutations in Japanese subjects. Six missense mutations (A155V, F328L, N466D, K837R, T882A, and R968L) were identified in one diabetic subject each, excepting N466D. Of these mutations, F328L showed impaired suppression of T-cell activation and was a loss-of-function mutation. These data suggest that the F328L mutation is involved in the development of autoimmune diseases including type 1 diabetes, and also provide insight into the structure-function relationship of CBLB protein.

The Lambda Select cII Mutation Detection System.

PubMed

Besaratinia, Ahmad; Tommasi, Stella

2018-04-26

A number of transgenic animal models and mutation detection systems have been developed for mutagenicity testing of carcinogens in mammalian cells. Of these, transgenic mice and the Lambda (λ) Select cII Mutation Detection System have been employed for mutagenicity experiments by many research groups worldwide. Here, we describe a detailed protocol for the Lambda Select cII mutation assay, which can be applied to cultured cells of transgenic mice/rats or the corresponding animals treated with a chemical/physical agent of interest. The protocol consists of the following steps: (1) isolation of genomic DNA from the cells or organs/tissues of transgenic animals treated in vitro or in vivo, respectively, with a test compound; (2) recovery of the lambda shuttle vector carrying a mutational reporter gene (i.e., cII transgene) from the genomic DNA; (3) packaging of the rescued vectors into infectious bacteriophages; (4) infecting a host bacteria and culturing under selective conditions to allow propagation of the induced cII mutations; and (5) scoring the cII-mutants and DNA sequence analysis to determine the cII mutant frequency and mutation spectrum, respectively.

In cell mutational interference mapping experiment (in cell MIME) identifies the 5' polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging.

PubMed

Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland

2018-05-18

Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.

In cell mutational interference mapping experiment (in cell MIME) identifies the 5′ polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging

PubMed Central

Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe

2018-01-01

Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260

The application of a linear algebra to the analysis of mutation rates.

PubMed

Jones, M E; Thomas, S M; Clarke, K

1999-07-07

Cells and bacteria growing in culture are subject to mutation, and as this mutation is the ultimate substrate for selection and evolution, the factors controlling the mutation rate are of some interest. The mutational event is not observed directly, but is inferred from the phenotype of the original mutant or of its descendants; the rate of mutation is inferred from the number of such mutant phenotypes. Such inference presumes a knowledge of the probability distribution for the size of a clone arising from a single mutation. We develop a mathematical formulation that assists in the design and analysis of experiments which investigate mutation rates and mutant clone size distribution, and we use it to analyse data for which the classical Luria-Delbrück clone-size distribution must be rejected. Copyright 1999 Academic Press.

Optimizing high-resolution melting analysis for the detection of mutations of GPR30/GPER-1 in breast cancer.

PubMed

Aihara, Masamune; Yamamoto, Shigeru; Nishioka, Hiroko; Inoue, Yutaro; Hamano, Kimikazu; Oka, Masaaki; Mizukami, Yoichi

2012-06-15

G protein-coupled receptor 30/G protein estrogen receptor-1 (GPR30/GPER-1) is a novel membrane receptor for estrogen whose mRNA is expressed at high levels in estrogen-dependent cells such as breast cancer cell lines. However, mutations in GRP30 related to diseases remain unreported. To detect unknown mutations in the GPR30 open reading frame (ORF) quickly, the experimental conditions for high-resolution melting (HRM) analysis were examined for PCR primers, Taq polymerases, saturation DNA binding dyes, Mg(2+) concentration, and normalized temperatures. Nine known SNPs and 13 artificial point mutations within the GPR30 ORF, as well as single nucleotide variants in DNA extracted from subjects with breast cancers were tested under the optimal experimental conditions. The combination of Expand High Fidelity(PLUS) and SYTO9 in the presence of 2.0 mM MgCl(2) produced the best separation in melting curves of mutations in all regions of the GPR30 ORF. Under these experimental conditions, the mutations were clearly detected in both heterozygotes and homozygotes. HRM analysis of GPR30 using genomic DNA from subjects with breast cancers showed a novel single nucleotide variant, 111C>T in GPR30 and 4 known SNPs. The experimental conditions determined in this study for HRM analysis are useful for high throughput assays to detect unknown mutations within the GPR30 ORF. Copyright © 2012 Elsevier B.V. All rights reserved.

DNA Clutch Probes for Circulating Tumor DNA Analysis.

PubMed

Das, Jagotamoy; Ivanov, Ivaylo; Sargent, Edward H; Kelley, Shana O

2016-08-31

Progress toward the development of minimally invasive liquid biopsies of disease is being bolstered by breakthroughs in the analysis of circulating tumor DNA (ctDNA): DNA released from cancer cells into the bloodstream. However, robust, sensitive, and specific methods of detecting this emerging analyte are lacking. ctDNA analysis has unique challenges, since it is imperative to distinguish circulating DNA from normal cells vs mutation-bearing sequences originating from tumors. Here we report the electrochemical detection of mutated ctDNA in samples collected from cancer patients. By developing a strategy relying on the use of DNA clutch probes (DCPs) that render specific sequences of ctDNA accessible, we were able to readout the presence of mutated ctDNA. DCPs prevent reassociation of denatured DNA strands: they make one of the two strands of a dsDNA accessible for hybridization to a probe, and they also deactivate other closely related sequences in solution. DCPs ensure thereby that only mutated sequences associate with chip-based sensors detecting hybridization events. The assay exhibits excellent sensitivity and specificity in the detection of mutated ctDNA: it detects 1 fg/μL of a target mutation in the presence of 100 pg/μL of wild-type DNA, corresponding to detecting mutations at a level of 0.01% relative to wild type. This approach allows accurate analysis of samples collected from lung cancer and melanoma patients. This work represents the first detection of ctDNA without enzymatic amplification.

Random oligonucleotide mutagenesis: application to a large protein coding sequence of a major histocompatibility complex class I gene, H-2DP.

PubMed Central

Murray, R; Pederson, K; Prosser, H; Muller, D; Hutchison, C A; Frelinger, J A

1988-01-01

We have used random oligonucleotide mutagenesis (or saturation mutagenesis) to create a library of point mutations in the alpha 1 protein domain of a Major Histocompatibility Complex (MHC) molecule. This protein domain is critical for T cell and B cell recognition. We altered the MHC class I H-2DP gene sequence such that synthetic mutant alpha 1 exons (270 bp of coding sequence), which contain mutations identified by sequence analysis, can replace the wild type alpha 1 exon. The synthetic exons were constructed from twelve overlapping oligonucleotides which contained an average of 1.3 random point mutations per intact exon. DNA sequence analysis of mutant alpha 1 exons has shown a point mutant distribution that fits a Poisson distribution, and thus emphasizes the utility of this mutagenesis technique to "scan" a large protein sequence for important mutations. We report our use of saturation mutagenesis to scan an entire exon of the H-2DP gene, a cassette strategy to replace the wild type alpha 1 exon with individual mutant alpha 1 exons, and analysis of mutant molecules expressed on the surface of transfected mouse L cells. Images PMID:2903482

Analysis of Transcription Factors Key for Mouse Pancreatic Development Establishes NKX2-2 and MNX1 Mutations as Causes of Neonatal Diabetes in Man

PubMed Central

Flanagan, Sarah E.; De Franco, Elisa; Lango Allen, Hana; Zerah, Michele; Abdul-Rasoul, Majedah M.; Edge, Julie A.; Stewart, Helen; Alamiri, Elham; Hussain, Khalid; Wallis, Sam; de Vries, Liat; Rubio-Cabezas, Oscar; Houghton, Jayne A.L.; Edghill, Emma L.; Patch, Ann-Marie; Ellard, Sian; Hattersley, Andrew T.

2014-01-01

Summary Understanding transcriptional regulation of pancreatic development is required to advance current efforts in developing beta cell replacement therapies for patients with diabetes. Current knowledge of key transcriptional regulators has predominantly come from mouse studies, with rare, naturally occurring mutations establishing their relevance in man. This study used a combination of homozygosity analysis and Sanger sequencing in 37 consanguineous patients with permanent neonatal diabetes to search for homozygous mutations in 29 transcription factor genes important for murine pancreatic development. We identified homozygous mutations in 7 different genes in 11 unrelated patients and show that NKX2-2 and MNX1 are etiological genes for neonatal diabetes, thus confirming their key role in development of the human pancreas. The similar phenotype of the patients with recessive mutations and mice with inactivation of a transcription factor gene support there being common steps critical for pancreatic development and validate the use of rodent models for beta cell development. PMID:24411943

Cancer-associated Isocitrate Dehydrogenase 1 (IDH1) R132H Mutation and d-2-Hydroxyglutarate Stimulate Glutamine Metabolism under Hypoxia*

PubMed Central

Reitman, Zachary J.; Duncan, Christopher G.; Poteet, Ethan; Winters, Ali; Yan, Liang-Jun; Gooden, David M.; Spasojevic, Ivan; Boros, Laszlo G.; Yang, Shao-Hua; Yan, Hai

2014-01-01

Mutations in the cytosolic NADP+-dependent isocitrate dehydrogenase (IDH1) occur in several types of cancer, and altered cellular metabolism associated with IDH1 mutations presents unique therapeutic opportunities. By altering IDH1, these mutations target a critical step in reductive glutamine metabolism, the metabolic pathway that converts glutamine ultimately to acetyl-CoA for biosynthetic processes. While IDH1-mutated cells are sensitive to therapies that target glutamine metabolism, the effect of IDH1 mutations on reductive glutamine metabolism remains poorly understood. To explore this issue, we investigated the effect of a knock-in, single-codon IDH1-R132H mutation on the metabolism of the HCT116 colorectal adenocarcinoma cell line. Here we report the R132H-isobolome by using targeted 13C isotopomer tracer fate analysis to trace the metabolic fate of glucose and glutamine in this system. We show that introduction of the R132H mutation into IDH1 up-regulates the contribution of glutamine to lipogenesis in hypoxia, but not in normoxia. Treatment of cells with a d-2-hydroxyglutarate (d-2HG) ester recapitulated these changes, indicating that the alterations observed in the knocked-in cells were mediated by d-2HG produced by the IDH1 mutant. These studies provide a dynamic mechanistic basis for metabolic alterations observed in IDH1-mutated tumors and uncover potential therapeutic targets in IDH1-mutated cancers. PMID:24986863

A Japanese family with nonautoimmune hyperthyroidism caused by a novel heterozygous thyrotropin receptor gene mutation.

PubMed

Nakamura, Akie; Morikawa, Shuntaro; Aoyagi, Hayato; Ishizu, Katsura; Tajima, Toshihiro

2014-06-01

Hyperthyroidism caused by activating mutations of the thyrotropin receptor gene (TSHR) is rare in the pediatric population. We found a Japanese family with hyperthyroidism without autoantibody. DNA sequence analysis of TSHR was undertaken in this family. The functional consequences for the Gs-adenylyl cyclase and Gq/11-phospholipase C signaling pathways and cell surface expression of receptors were determined in vitro using transiently transfected human embryonic kidney 293 cells. We identified a heterozygous mutation (M453R) in exon 10 of TSHR. In this family, this mutation was found in all individuals who exhibited hyperthyroidism. The results showed that this mutation resulted in constitutive activation of the Gs-adenylyl cyclase system. However, this mutation also caused a reduction in the activation capacity of the Gq/11-phospholipase C pathway, compared with the wild type. We demonstrate that the M453R mutation is the cause of nonautoimmune hyperthyroidism.

Tissue-specific mutation accumulation in human adult stem cells during life

NASA Astrophysics Data System (ADS)

Blokzijl, Francis; de Ligt, Joep; Jager, Myrthe; Sasselli, Valentina; Roerink, Sophie; Sasaki, Nobuo; Huch, Meritxell; Boymans, Sander; Kuijk, Ewart; Prins, Pjotr; Nijman, Isaac J.; Martincorena, Inigo; Mokry, Michal; Wiegerinck, Caroline L.; Middendorp, Sabine; Sato, Toshiro; Schwank, Gerald; Nieuwenhuis, Edward E. S.; Verstegen, Monique M. A.; van der Laan, Luc J. W.; de Jonge, Jeroen; Ijzermans, Jan N. M.; Vries, Robert G.; van de Wetering, Marc; Stratton, Michael R.; Clevers, Hans; Cuppen, Edwin; van Boxtel, Ruben

2016-10-01

The gradual accumulation of genetic mutations in human adult stem cells (ASCs) during life is associated with various age-related diseases, including cancer. Extreme variation in cancer risk across tissues was recently proposed to depend on the lifetime number of ASC divisions, owing to unavoidable random mutations that arise during DNA replication. However, the rates and patterns of mutations in normal ASCs remain unknown. Here we determine genome-wide mutation patterns in ASCs of the small intestine, colon and liver of human donors with ages ranging from 3 to 87 years by sequencing clonal organoid cultures derived from primary multipotent cells. Our results show that mutations accumulate steadily over time in all of the assessed tissue types, at a rate of approximately 40 novel mutations per year, despite the large variation in cancer incidence among these tissues. Liver ASCs, however, have different mutation spectra compared to those of the colon and small intestine. Mutational signature analysis reveals that this difference can be attributed to spontaneous deamination of methylated cytosine residues in the colon and small intestine, probably reflecting their high ASC division rate. In liver, a signature with an as-yet-unknown underlying mechanism is predominant. Mutation spectra of driver genes in cancer show high similarity to the tissue-specific ASC mutation spectra, suggesting that intrinsic mutational processes in ASCs can initiate tumorigenesis. Notably, the inter-individual variation in mutation rate and spectra are low, suggesting tissue-specific activity of common mutational processes throughout life.

Mutation analysis of HIF prolyl hydroxylases (PHD/EGLN) in individuals with features of phaeochromocytoma and renal cell carcinoma susceptibility.

PubMed

Astuti, Dewi; Ricketts, Christopher J; Chowdhury, Rasheduzzaman; McDonough, Michael A; Gentle, Dean; Kirby, Gail; Schlisio, Susanne; Kenchappa, Rajappa S; Carter, Bruce D; Kaelin, William G; Ratcliffe, Peter J; Schofield, Christopher J; Latif, Farida; Maher, Eamonn R

2011-02-01

Germline mutations in the von Hippel-Lindau disease (VHL) and succinate dehydrogenase subunit B (SDHB) genes can cause inherited phaeochromocytoma and/or renal cell carcinoma (RCC). Dysregulation of the hypoxia-inducible factor (HIF) transcription factors has been linked to VHL and SDHB-related RCC; both HIF dysregulation and disordered function of a prolyl hydroxylase domain isoform 3 (PHD3/EGLN3)-related pathway of neuronal apoptosis have been linked to the development of phaeochromocytoma. The 2-oxoglutarate-dependent prolyl hydroxylase enzymes PHD1 (EGLN2), PHD2 (EGLN1) and PHD3 (EGLN3) have a key role in regulating the stability of HIF-α subunits (and hence expression of the HIF-α transcription factors). A germline PHD2 mutation has been reported in association with congenital erythrocytosis and recurrent extra-adrenal phaeochromocytoma. We undertook mutation analysis of PHD1, PHD2 and PHD3 in two cohorts of patients with features of inherited phaeochromocytoma (n=82) and inherited RCC (n=64) and no evidence of germline mutations in known susceptibility genes. No confirmed pathogenic mutations were detected suggesting that mutations in these genes are not a frequent cause of inherited phaeochromocytoma or RCC.

Clear cell papillary renal cell carcinoma: a chromosomal microarray analysis of two cases using a novel Molecular Inversion Probe (MIP) technology.

PubMed

Alexiev, Borislav A; Zou, Ying S

2014-12-01

Chromosomal microarray analysis using novel Molecular Inversion Probe (MIP) technology demonstrated 2,570 kb copy neutral LOH of 10q11.22 in two clear cell papillary renal cell carcinomas. In addition, one of the tumors had a big 29,784 kb deletion of 13q11-q14.2. There were two variants of unknown significance, a 2,509 kb gain of Xp22.33 and a 257 kb homozygous deletion of 8p11.22. The somatic mutation panel containing 74 mutations in nine genes did not reveal any mutations. Besides identification of submicroscopic duplications or deletions, SNP microarrays can reveal abnormal allelic imbalances including LOH and copy neutral LOH, which cannot be recognized by chromosome, FISH, and non-SNP microarray arrays. To the best of our knowledge, this is the first study demonstrating copy neutral LOH of 10q11.22 in clear cell papillary renal cell carcinomas using the new MIP SNP OncoScan FFPE Assay Kit on formalin-fixed paraffin-embedded tumor samples. Copyright © 2014 Elsevier GmbH. All rights reserved.

A PLK4 mutation causing azoospermia in a man with Sertoli cell-only syndrome.

PubMed

Miyamoto, T; Bando, Y; Koh, E; Tsujimura, A; Miyagawa, Y; Iijima, M; Namiki, M; Shiina, M; Ogata, K; Matsumoto, N; Sengoku, K

2016-01-01

About 15% of couples wishing to have children are infertile; approximately half these cases involve a male factor. Polo-like kinase 4 (PLK-4) is a member of the polo protein family and a key regulator of centriole duplication. Male mice with a point mutation in the Plk4 gene show azoospermia associated with germ cell loss. Mutational analysis of 81 patients with azoospermia and Sertoli cell-only syndrome (SCOS) identified one man with a heterozygous 13-bp deletion in the Ser/Thr kinase domain of PLK4. Division of centrioles occurred in wild-type PLK4-transfected cells, but was hampered in PLK-4-mutant transfectants, which also showed abnormal nuclei. Thus, this PLK4 mutation might be a cause of human SCOS and nonobstructive azoospermia. © 2015 American Society of Andrology and European Academy of Andrology.

Personalized Stem Cell Therapy to Correct Corneal Defects Due to a Unique Homozygous-Heterozygous Mosaicism of Ectrodactyly-Ectodermal Dysplasia-Clefting Syndrome.

PubMed

Barbaro, Vanessa; Nasti, Annamaria Assunta; Raffa, Paolo; Migliorati, Angelo; Nespeca, Patrizia; Ferrari, Stefano; Palumbo, Elisa; Bertolin, Marina; Breda, Claudia; Miceli, Francesco; Russo, Antonella; Caenazzo, Luciana; Ponzin, Diego; Palù, Giorgio; Parolin, Cristina; Di Iorio, Enzo

2016-08-01

: Ectrodactyly-ectodermal dysplasia-clefting (EEC) syndrome is a rare autosomal dominant disease caused by mutations in the p63 gene. To date, approximately 40 different p63 mutations have been identified, all heterozygous. No definitive treatments are available to counteract and resolve the progressive corneal degeneration due to a premature aging of limbal epithelial stem cells. Here, we describe a unique case of a young female patient, aged 18 years, with EEC and corneal dysfunction, who was, surprisingly, homozygous for a novel and de novo R311K missense mutation in the p63 gene. A detailed analysis of the degree of somatic mosaicism in leukocytes from peripheral blood and oral mucosal epithelial stem cells (OMESCs) from biopsies of buccal mucosa showed that approximately 80% were homozygous mutant cells and 20% were heterozygous. Cytogenetic and molecular analyses excluded genomic alterations, thus suggesting a de novo mutation followed by an allelic gene conversion of the wild-type allele by de novo mutant allele as a possible mechanism to explain the homozygous condition. R311K-p63 OMESCs were expanded in vitro and heterozygous holoclones selected following clonal analysis. These R311K-p63 OMESCs were able to generate well-organized and stratified epithelia in vitro, resembling the features of healthy tissues. This study supports the rationale for the development of cultured autologous oral mucosal epithelial stem cell sheets obtained by selected heterozygous R311K-p63 stem cells, as an effective and personalized therapy for reconstructing the ocular surface of this unique case of EEC syndrome, thus bypassing gene therapy approaches. This case demonstrates that in a somatic mosaicism context, a novel homozygous mutation in the p63 gene can arise as a consequence of an allelic gene conversion event, subsequent to a de novo mutation. The heterozygous mutant R311K-p63 stem cells can be isolated by means of clonal analysis and given their good regenerative capacity, they may be used to successfully correct the corneal defects present in this unique case of ectrodactyly-ectodermal dysplasia-clefting syndrome. ©AlphaMed Press.

Efficient Generation of Somatic Cell Nuclear Transfer-Competent Porcine Cells with Mutated Alleles at Multiple Target Loci by Using CRISPR/Cas9 Combined with Targeted Toxin-Based Selection System.

PubMed

Sato, Masahiro; Miyoshi, Kazuchika; Nakamura, Shingo; Ohtsuka, Masato; Sakurai, Takayuki; Watanabe, Satoshi; Kawaguchi, Hiroaki; Tanimoto, Akihide

2017-12-04

The recent advancement in genome editing such a CRISPR/Cas9 system has enabled isolation of cells with knocked multiple alleles through a one-step transfection. Somatic cell nuclear transfer (SCNT) has been frequently employed as one of the efficient tools for the production of genetically modified (GM) animals. To use GM cells as SCNT donor, efficient isolation of transfectants with mutations at multiple target loci is often required. The methods for the isolation of such GM cells largely rely on the use of drug selection-based approach using selectable genes; however, it is often difficult to isolate cells with mutations at multiple target loci. In this study, we used a novel approach for the efficient isolation of porcine cells with at least two target loci mutations by one-step introduction of CRISPR/Cas9-related components. A single guide (sg) RNA targeted to GGTA1 gene, involved in the synthesis of cell-surface α-Gal epitope (known as xenogenic antigen), is always a prerequisite. When the transfected cells were reacted with toxin-labeled BS-I-B₄ isolectin for 2 h at 37 C to eliminate α-Gal epitope-expressing cells, the surviving clones lacked α-Gal epitope expression and were highly expected to exhibit induced mutations at another target loci. Analysis of these α-Gal epitope-negative surviving cells demonstrated a 100% occurrence of genome editing at target loci. SCNT using these cells as donors resulted in the production of cloned blastocysts with the genotype similar to that of the donor cells used. Thus, this novel system will be useful for SCNT-mediated acquisition of GM cloned piglets, in which multiple target loci may be mutated.

Aspirin-induced chemoprevention and response kinetics are enhanced by PIK3CA mutations in colorectal cancer cells

PubMed Central

Zumwalt, Timothy J; Wodarz, Dominik; Komarova, Natalia L; Toden, Shusuke; Turner, Jacob; Cardenas, Jacob; Burn, John; Chan, Andrew T; Boland, C Richard; Goel, Ajay

2017-01-01

This study was designed to determine how aspirin influences the growth kinetics and characteristics of cultured colorectal cancer (CRC) cells that harbor a variety of different mutational backgrounds, including PIK3CA and KRAS activating mutations and the presence or absence of microsatellite instability. CRC cell lines (HCT116, HCT116+Chr3/5, RKO, SW480, HCT15, CACO2, HT29, and SW48) were treated with pharmacologically relevant doses of aspirin (0.5–10 mM) and evaluated for proliferation and cell cycle distribution. These parameters were fitted to a mathematical model to quantify the effects and understand the mechanism(s) by which aspirin modifies growth in CRC cells. We also evaluated the effects of aspirin on key G0/G1 cell cycle genes that are regulated by PI3K-Akt pathway. Aspirin decelerated growth rates and disrupted cell cycle dynamics more profoundly in faster growing CRC cell lines, which tended to be PIK3CA-mutants. Additionally, microarray analysis of 151 CRC cell lines identified important cell cycle regulatory genes downstream targets of PIK3, which were dysregulated by aspirin treatment cycle genes (PCNA and RB1, p<0.01). Our study demonstrated what clinical trials have only speculated, that PIK3CA-mutant CRCs are more sensitive to aspirin. Aspirin inhibited cell growth in all CRC cell lines regardless of mutational background, but the effects were exacerbated in cells with PIK3CA mutations. Mathematical modeling combined with bench science revealed that cells with PIK3CA mutations experience significant G0/G1 arrest and explains why patients with PIK3CA-mutant CRCs may benefit from aspirin use after diagnosis. PMID:28154202

Single-cell paired-end genome sequencing reveals structural variation per cell cycle

PubMed Central

Voet, Thierry; Kumar, Parveen; Van Loo, Peter; Cooke, Susanna L.; Marshall, John; Lin, Meng-Lay; Zamani Esteki, Masoud; Van der Aa, Niels; Mateiu, Ligia; McBride, David J.; Bignell, Graham R.; McLaren, Stuart; Teague, Jon; Butler, Adam; Raine, Keiran; Stebbings, Lucy A.; Quail, Michael A.; D’Hooghe, Thomas; Moreau, Yves; Futreal, P. Andrew; Stratton, Michael R.; Vermeesch, Joris R.; Campbell, Peter J.

2013-01-01

The nature and pace of genome mutation is largely unknown. Because standard methods sequence DNA from populations of cells, the genetic composition of individual cells is lost, de novo mutations in cells are concealed within the bulk signal and per cell cycle mutation rates and mechanisms remain elusive. Although single-cell genome analyses could resolve these problems, such analyses are error-prone because of whole-genome amplification (WGA) artefacts and are limited in the types of DNA mutation that can be discerned. We developed methods for paired-end sequence analysis of single-cell WGA products that enable (i) detecting multiple classes of DNA mutation, (ii) distinguishing DNA copy number changes from allelic WGA-amplification artefacts by the discovery of matching aberrantly mapping read pairs among the surfeit of paired-end WGA and mapping artefacts and (iii) delineating the break points and architecture of structural variants. By applying the methods, we capture DNA copy number changes acquired over one cell cycle in breast cancer cells and in blastomeres derived from a human zygote after in vitro fertilization. Furthermore, we were able to discover and fine-map a heritable inter-chromosomal rearrangement t(1;16)(p36;p12) by sequencing a single blastomere. The methods will expedite applications in basic genome research and provide a stepping stone to novel approaches for clinical genetic diagnosis. PMID:23630320

Mutations of NOTCH3 in childhood pulmonary arterial hypertension

PubMed Central

Chida, Ayako; Shintani, Masaki; Matsushita, Yoshihisa; Sato, Hiroki; Eitoku, Takahiro; Nakayama, Tomotaka; Furutani, Yoshiyuki; Hayama, Emiko; Kawamura, Yoichi; Inai, Kei; Ohtsuki, Shinichi; Saji, Tsutomu; Nonoyama, Shigeaki; Nakanishi, Toshio

2014-01-01

Mutations of BMPR2 and other TGF-β superfamily genes have been reported in pulmonary arterial hypertension (PAH). However, 60–90% of idiopathic PAH cases have no mutations in these genes. Recently, the expression of NOTCH3 was shown to be increased in the pulmonary artery smooth muscle cells of PAH patients. We sought to investigate NOTCH3 and its target genes in PAH patients and clarify the role of NOTCH3 signaling. We screened for mutations in NOTCH3, HES1, and HES5 in 41 PAH patients who had no mutations in BMPR2, ALK1, endoglin, SMAD1/4/8, BMPR1B, or Caveolin-1. Two novel missense mutations (c.2519 G>A p.G840E, c.2698 A>C p.T900P) in NOTCH3 were identified in two PAH patients. We performed functional analysis using stable cell lines expressing either wild-type or mutant NOTCH3. The protein-folding chaperone GRP78/BiP was colocalized with wild-type NOTCH3 in the endoplasmic reticulum, whereas the majority of GRP78/BiP was translocated into the nuclei of cells expressing mutant NOTCH3. Cell proliferation and viability were higher for cells expressing mutant NOTCH3 than for those expressing wild-type NOTCH3. We identified novel NOTCH3 mutations in PAH patients and revealed that these mutations were involved in cell proliferation and viability. NOTCH3 mutants induced an impairment in NOTCH3-HES5 signaling. The results may contribute to the elucidation of PAH pathogenesis. PMID:24936512

Transcriptome Meta-Analysis of Lung Cancer Reveals Recurrent Aberrations in NRG1 and Hippo Pathway Genes

PubMed Central

Dhanasekaran, Saravana M.; Balbin, O. Alejandro; Chen, Guoan; Nadal, Ernest; Kalyana-Sundaram, Shanker; Pan, Jincheng; Veeneman, Brendan; Cao, Xuhong; Malik, Rohit; Vats, Pankaj; Wang, Rui; Huang, Stephanie; Zhong, Jinjie; Jing, Xiaojun; Iyer, Matthew; Wu, Yi-Mi; Harms, Paul W.; Lin, Jules; Reddy, Rishindra; Brennan, Christine; Palanisamy, Nallasivam; Chang, Andrew C.; Truini, Anna; Truini, Mauro; Robinson, Dan R.; Beer, David G.; Chinnaiyan, Arul M.

2014-01-01

Lung cancer is emerging as a paradigm for disease molecular subtyping, facilitating targeted therapy based on driving somatic alterations. Here, we perform transcriptome analysis of 153 samples representing lung adenocarcinomas, squamous cell carcinomas, large cell lung cancer, adenoid cystic carcinomas and cell lines. By integrating our data with The Cancer Genome Atlas and published sources, we analyze 753 lung cancer samples for gene fusions and other transcriptomic alterations. We show that higher numbers of gene fusions is an independent prognostic factor for poor survival in lung cancer. Our analysis confirms the recently reported CD74-NRG1 fusion and suggests that NRG1, NF1 and Hippo pathway fusions may play important roles in tumors without known driver mutations. In addition, we observe exon skipping events in c-MET, which are attributable to splice site mutations. These classes of genetic aberrations may play a significant role in the genesis of lung cancers lacking known driver mutations. PMID:25531467

The evolution of cellular deficiency in GATA2 mutation

PubMed Central

Dickinson, Rachel E.; Milne, Paul; Jardine, Laura; Zandi, Sasan; Swierczek, Sabina I.; McGovern, Naomi; Cookson, Sharon; Ferozepurwalla, Zaveyna; Langridge, Alexander; Pagan, Sarah; Gennery, Andrew; Heiskanen-Kosma, Tarja; Hämäläinen, Sari; Seppänen, Mikko; Helbert, Matthew; Tholouli, Eleni; Gambineri, Eleonora; Reykdal, Sigrún; Gottfreðsson, Magnús; Thaventhiran, James E.; Morris, Emma; Hirschfield, Gideon; Richter, Alex G.; Jolles, Stephen; Bacon, Chris M.; Hambleton, Sophie; Haniffa, Muzlifah; Bryceson, Yenan; Allen, Carl; Prchal, Josef T.; Dick, John E.; Bigley, Venetia

2014-01-01

Constitutive heterozygous GATA2 mutation is associated with deafness, lymphedema, mononuclear cytopenias, infection, myelodysplasia (MDS), and acute myeloid leukemia. In this study, we describe a cross-sectional analysis of 24 patients and 6 relatives with 14 different frameshift or substitution mutations of GATA2. A pattern of dendritic cell, monocyte, B, and natural killer (NK) lymphoid deficiency (DCML deficiency) with elevated Fms-like tyrosine kinase 3 ligand (Flt3L) was observed in all 20 patients phenotyped, including patients with Emberger syndrome, monocytopenia with Mycobacterium avium complex (MonoMAC), and MDS. Four unaffected relatives had a normal phenotype indicating that cellular deficiency may evolve over time or is incompletely penetrant, while 2 developed subclinical cytopenias or elevated Flt3L. Patients with GATA2 mutation maintained higher hemoglobin, neutrophils, and platelets and were younger than controls with acquired MDS and wild-type GATA2. Frameshift mutations were associated with earlier age of clinical presentation than substitution mutations. Elevated Flt3L, loss of bone marrow progenitors, and clonal myelopoiesis were early signs of disease evolution. Clinical progression was associated with increasingly elevated Flt3L, depletion of transitional B cells, CD56bright NK cells, naïve T cells, and accumulation of terminally differentiated NK and CD8+ memory T cells. These studies provide a framework for clinical and laboratory monitoring of patients with GATA2 mutation and may inform therapeutic decision-making. PMID:24345756

Integrative genomic and functional analysis of human oral squamous cell carcinoma cell lines reveals synergistic effects of FAT1 and CASP8 inactivation.

PubMed

Hayes, Tyler F; Benaich, Nathan; Goldie, Stephen J; Sipilä, Kalle; Ames-Draycott, Ashley; Cai, Wenjun; Yin, Guangliang; Watt, Fiona M

2016-12-01

Oral squamous cell carcinoma (OSCC) is genetically highly heterogeneous, which contributes to the challenges of treatment. To create an in vitro model that accurately reflects this heterogeneity, we generated a panel of HPV-negative OSCC cell lines. By whole exome sequencing of the lines and matched patient blood samples, we demonstrate that the mutational spectrum of the lines is representative of primary OSCC in The Cancer Genome Atlas. We show that loss of function mutations in FAT1 (an atypical cadherin) and CASP8 (Caspase 8) frequently occur in the same tumour. OSCC cells with inactivating FAT1 mutations exhibited reduced intercellular adhesion. Knockdown of FAT1 and CASP8 individually or in combination in OSCC cells led to increased cell migration and clonal growth, resistance to Staurosporine-induced apoptosis and, in some cases, increased terminal differentiation. The OSCC lines thus represent a valuable resource for elucidating the impact of different mutations on tumour behaviour. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

PIK3CA-mutated melanoma cells rely on cooperative signaling through mTORC1/2 for sustained proliferation.

PubMed

Silva, Jillian M; Deuker, Marian M; Baguley, Bruce C; McMahon, Martin

2017-05-01

Malignant conversion of BRAF- or NRAS-mutated melanocytes into melanoma cells can be promoted by PI3'-lipid signaling. However, the mechanism by which PI3'-lipid signaling cooperates with mutationally activated BRAF or NRAS has not been adequately explored. Using human NRAS- or BRAF-mutated melanoma cells that co-express mutationally activated PIK3CA, we explored the contribution of PI3'-lipid signaling to cell proliferation. Despite mutational activation of PIK3CA, melanoma cells were more sensitive to the biochemical and antiproliferative effects of broader spectrum PI3K inhibitors than to an α-selective PI3K inhibitor. Combined pharmacological inhibition of MEK1/2 and PI3K signaling elicited more potent antiproliferative effects and greater inhibition of the cell division cycle compared to single-agent inhibition of either pathway alone. Analysis of signaling downstream of MEK1/2 or PI3K revealed that these pathways cooperate to regulate cell proliferation through mTORC1-mediated effects on ribosomal protein S6 and 4E-BP1 phosphorylation in an AKT-dependent manner. Although PI3K inhibition resulted in cytostatic effects on xenografted NRAS Q61H /PIK3CA H1047R melanoma, combined inhibition of MEK1/2 plus PI3K elicited significant melanoma regression. This study provides insights as to how mutationally activated PIK3CA acts in concert with MEK1/2 signaling to cooperatively regulate mTORC1/2 to sustain PIK3CA-mutated melanoma proliferation. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Elucidate the Mechanism of Telomere Maintenance in STAG2 Mutated Tumor Cells

DTIC Science & Technology

2017-12-01

recent analysis identified the cohesin subunit STAG2 as one of twelve genes mutated in four or more tumor types including melanoma, pancreatic...conferences, seminars, study groups , and individual study. Include participation in conferences, workshops, and seminars not listed under major...only 12 genes found to be significantly mutated in four or more cancer types (18). Approximately 85% of STAG2 mutations are truncating and often result

Mutational Analysis of Cell Types in Tuberous Sclerosis Complex (TSC)

DTIC Science & Technology

2007-01-01

disorder resulting from mutations in the TSC1 or TSC2 genes that is associated with epilepsy, cognitive disability, and autism . TSC1/TSC2 gene mutations...cognitive disability, and autism . TSC1/TSC2 gene mutations lead to developmental alterations in brain structure known as tubers in over 80% of TSC...TSC (Sparagana and Roach, 2000). Comorbid neuropsychological disorders such as autism , mental retardation (MR), pervasive developmental disorder

Mutations of novel influenza A(H10N8) virus in chicken eggs and MDCK cells.

PubMed

Yang, Jian; Zhang, Ting; Guo, Li; Hu, Yongfeng; Li, Jinlin; Su, Haoxiang; Xiao, Yan; Ren, Xianwen; Dong, Jie; Sun, Lilian; Xiao, Yan; Li, Li; Yang, Fan; Wang, Jianwei; Yuan, Hui; Jin, Qi

2014-09-01

The recent emergence of human infection with influenza A(H10N8) virus is an urgent public health concern. Genomic analysis showed that the virus was conserved in chicken eggs but presented substantial adaptive mutations in MDCK cells. Our results provide additional evidence for the avian origin of this influenza virus.

Molecular analysis of mutations in DNA polymerase η in xeroderma pigmentosum-variant patients

PubMed Central

Broughton, Bernard C.; Cordonnier, Agnes; Kleijer, Wim J.; Jaspers, Nicolaas G. J.; Fawcett, Heather; Raams, Anja; Garritsen, Victor H.; Stary, Anne; Avril, Marie-Françoise; Boudsocq, François; Masutani, Chikahide; Hanaoka, Fumio; Fuchs, Robert P.; Sarasin, Alain; Lehmann, Alan R.

2002-01-01

Xeroderma pigmentosum variant (XP-V) cells are deficient in their ability to synthesize intact daughter DNA strands after UV irradiation. This deficiency results from mutations in the gene encoding DNA polymerase η, which is required for effecting translesion synthesis (TLS) past UV photoproducts. We have developed a simple cellular procedure to identify XP-V cell strains, and have subsequently analyzed the mutations in 21 patients with XP-V. The 16 mutations that we have identified fall into three categories. Many of them result in severe truncations of the protein and are effectively null alleles. However, we have also identified five missense mutations located in the conserved catalytic domain of the protein. Extracts of cells falling into these two categories are defective in the ability to carry out TLS past sites of DNA damage. Three mutations cause truncations at the C terminus such that the catalytic domains are intact, and extracts from these cells are able to carry out TLS. From our previous work, however, we anticipate that protein in these cells will not be localized in the nucleus nor will it be relocalized into replication foci during DNA replication. The spectrum of both missense and truncating mutations is markedly skewed toward the N-terminal half of the protein. Two of the missense mutations are predicted to affect the interaction with DNA, the others are likely to disrupt the three-dimensional structure of the protein. There is a wide variability in clinical features among patients, which is not obviously related to the site or type of mutation. PMID:11773631

Prediction of BRCA1 and BRCA2 mutation status using post-irradiation assays of lymphoblastoid cell lines is compromised by inter-cell-line phenotypic variability.

PubMed

Lovelock, Paul K; Wong, Ee Ming; Sprung, Carl N; Marsh, Anna; Hobson, Karen; French, Juliet D; Southey, Melissa; Sculley, Tom; Pandeya, Nirmala; Brown, Melissa A; Chenevix-Trench, Georgia; Spurdle, Amanda B; McKay, Michael J

2007-09-01

Assays to determine the pathogenicity of unclassified sequence variants in disease-associated genes include the analysis of lymphoblastoid cell lines (LCLs). We assessed the ability of several assays of LCLs to distinguish carriers of germline BRCA1 and BRCA2 gene mutations from mutation-negative controls to determine their utility for use in a diagnostic setting. Post-ionising radiation cell viability and micronucleus formation, and telomere length were assayed in LCLs carrying BRCA1 or BRCA2 mutations, and in unaffected mutation-negative controls. Post-irradiation cell viability and micronucleus induction assays of LCLs from individuals carrying pathogenic BRCA1 mutations, unclassified BRCA1 sequence variants or wildtype BRCA1 sequence showed significant phenotypic heterogeneity within each group. Responses were not consistent with predicted functional consequences of known pathogenic or normal sequences. Telomere length was also highly heterogeneous within groups of LCLs carrying pathogenic BRCA1 or BRCA2 mutations, and normal BRCA1 sequences, and was not predictive of mutation status. Given the significant degree of phenotypic heterogeneity of LCLs after gamma-irradiation, and the lack of association with BRCA1 or BRCA2 mutation status, we conclude that the assays evaluated in this study should not be used as a means of differentiating pathogenic and non-pathogenic sequence variants for clinical application. We suggest that a range of normal controls must be included in any functional assays of LCLs to ensure that any observed differences between samples reflect the genotype under investigation rather than generic inter-individual variation.

The majority of ACTH receptor (MC2R) mutations found in Familial Glucocorticoid Deficiency type 1 lead to defective trafficking of the receptor to the cell surface

PubMed Central

TT, Chung; TR, Webb; LF, Chan; SN, Cooray; LA, Metherell; PJ, King; JP, Chapple; AJL, Clark

2008-01-01

Context: There are at least twenty-four missense, non-conservative mutations found in the ACTH receptor (Melanocortin 2 receptor, MC2R) which have been associated with the autosomal recessive disease Familial Glucocorticoid Deficiency (FGD) type 1. The characterization of these mutations has been hindered by difficulties in establishing a functional heterologous cell transfection system for MC2R. Recently the melanocortin 2 receptor accessory protein (MRAP) was identified as essential for trafficking of MC2R to the cell surface; therefore a functional characterization of MC2R mutations is now possible. Objective: To elucidate the molecular mechanisms responsible for defective MC2R function in FGD. Methods: Stable cell lines expressing human MRAPα were established and transiently transfected with wild-type or mutant MC2R. Functional characterization of mutant MC2R was performed using a cell surface expression assay, a cAMP reporter assay, confocal microscopy and co-immunoprecipitation of MRAPα. Results: Two thirds of all MC2R mutations had a significant reduction in cell surface trafficking even though MRAPα interacted with all mutants. Analysis of those mutant receptors that reached the cell surface indicated that 4/6 failed to signal, following stimulation with ACTH. Conclusion: The majority of MC2R mutations found in FGD fail to function because they fail to traffic to the cell surface. PMID:18840636

Pathways Impacted by Genomic Alterations in Pulmonary Carcinoid Tumors.

PubMed

Asiedu, Michael K; Thomas, Charles F; Dong, Jie; Schulte, Sandra C; Khadka, Prasidda; Sun, Zhifu; Kosari, Farhad; Jen, Jin; Molina, Julian; Vasmatzis, George; Kuang, Ray; Aubry, Marie Christine; Yang, Ping; Wigle, Dennis A

2018-04-01

Purpose: Pulmonary carcinoid tumors account for up to 5% of all lung malignancies in adults, comprise 30% of all carcinoid malignancies, and are defined histologically as typical carcinoid (TC) and atypical carcinoid (AC) tumors. The role of specific genomic alterations in the pathogenesis of pulmonary carcinoid tumors remains poorly understood. We sought to identify genomic alterations and pathways that are deregulated in these tumors to find novel therapeutic targets for pulmonary carcinoid tumors. Experimental Design: We performed integrated genomic analysis of carcinoid tumors comprising whole genome and exome sequencing, mRNA expression profiling and SNP genotyping of specimens from normal lung, TC and AC, and small cell lung carcinoma (SCLC) to fully represent the lung neuroendocrine tumor spectrum. Results: Analysis of sequencing data found recurrent mutations in cancer genes including ATP1A2, CNNM1, MACF1, RAB38, NF1, RAD51C, TAF1L, EPHB2, POLR3B , and AGFG1 The mutated genes are involved in biological processes including cellular metabolism, cell division cycle, cell death, apoptosis, and immune regulation. The top most significantly mutated genes were TMEM41B, DEFB127, WDYHV1, and TBPL1 Pathway analysis of significantly mutated and cancer driver genes implicated MAPK/ERK and amyloid beta precursor protein (APP) pathways whereas analysis of CNV and gene expression data suggested deregulation of the NF-κB and MAPK/ERK pathways. The mutation signature was predominantly C>T and T>C transitions with a minor contribution of T>G transversions. Conclusions: This study identified mutated genes affecting cancer relevant pathways and biological processes that could provide opportunities for developing targeted therapies for pulmonary carcinoid tumors. Clin Cancer Res; 24(7); 1691-704. ©2018 AACR . ©2018 American Association for Cancer Research.

Restricted ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bredberg, A.; Kraemer, K.H.; Seidman, M.M.

1986-11-01

A shuttle vector plasmid, pZ189, carrying a bacterial suppressor tRNA marker gene, was treated with ultraviolet radiation and propagated in cultured skin cells from a patient with the skin-cancer-prone, DNA repair-deficient disease xeroderma pigmentosum and in repair-proficient cells. After replication in the human cells, progeny plasmids were purified. Plasmid survival and mutations inactivating the marker gene were scored by transforming an indicator strain of Escherichia coli carrying a suppressible amber mutation in the beta-galactosidase gene. Plasmid survival in the xeroderma pigmentosum cells was less than that of pZ189 harvested from repair-proficient human cells. The point-mutation frequency in the 150-base-pair tRNAmore » marker gene increased up to 100-fold with ultraviolet dose. Sequence analysis of 150 mutant plasmids revealed that mutations were infrequent at potential thymine-thymine dimer sites. Ninety-three percent of the mutant plasmids from the xeroderma pigmentosum cells showed G X C----A X T transitions, compared to 73% in the normal cells (P less than 0.002). There were significantly fewer transversions (P less than 0.002) (especially G X C----T X A) and multiple base substitutions (P less than 0.00001) than when pZ189 was passaged in repair-proficient cells. The subset of mutational changes that are common to ultraviolet-treated plasmids propagated in both repair-proficient and xeroderma pigmentosum skin cells may be associated with the development of ultraviolet-induced skin cancer in humans.« less

Reproducibility of Digital PCR Assays for Circulating Tumor DNA Analysis in Advanced Breast Cancer

PubMed Central

Hrebien, Sarah; O’Leary, Ben; Beaney, Matthew; Schiavon, Gaia; Fribbens, Charlotte; Bhambra, Amarjit; Johnson, Richard; Turner, Nicholas

2016-01-01

Circulating tumor DNA (ctDNA) analysis has the potential to allow non-invasive analysis of tumor mutations in advanced cancer. In this study we assessed the reproducibility of digital PCR (dPCR) assays of circulating tumor DNA in a cohort of patients with advanced breast cancer and assessed delayed plasma processing using cell free DNA preservative tubes. We recruited a cohort of 96 paired samples from 71 women with advanced breast cancer who had paired blood samples processed either immediately or delayed in preservative tubes with processing 48–72 hours after collection. Plasma DNA was analysed with multiplex digital PCR (mdPCR) assays for hotspot mutations in PIK3CA, ESR1 and ERBB2, and for AKT1 E17K. There was 94.8% (91/96) agreement in mutation calling between immediate and delayed processed tubes, kappa 0.88 95% CI 0.77–0.98). Discordance in mutation calling resulted from low allele frequency and likely stochastic effects. In concordant samples there was high correlation in mutant copies per ml plasma (r2 = 0.98; p<0.0001). There was elevation of total cell free plasma DNA concentrations in 10.3% of delayed processed tubes, although overall quantification of total cell free plasma DNA had similar prognostic effects in immediate (HR 3.6) and delayed (HR 3.0) tubes. There was moderate agreement in changes in allele fraction between sequential samples in quantitative mutation tracking (r = 0.84, p = 0.0002). Delayed processing of samples using preservative tubes allows for centralized ctDNA digital PCR mutation screening in advanced breast cancer. The potential of preservative tubes in quantitative mutation tracking requires further research. PMID:27760227

Reproducibility of Digital PCR Assays for Circulating Tumor DNA Analysis in Advanced Breast Cancer.

PubMed

Hrebien, Sarah; O'Leary, Ben; Beaney, Matthew; Schiavon, Gaia; Fribbens, Charlotte; Bhambra, Amarjit; Johnson, Richard; Garcia-Murillas, Isaac; Turner, Nicholas

2016-01-01

Circulating tumor DNA (ctDNA) analysis has the potential to allow non-invasive analysis of tumor mutations in advanced cancer. In this study we assessed the reproducibility of digital PCR (dPCR) assays of circulating tumor DNA in a cohort of patients with advanced breast cancer and assessed delayed plasma processing using cell free DNA preservative tubes. We recruited a cohort of 96 paired samples from 71 women with advanced breast cancer who had paired blood samples processed either immediately or delayed in preservative tubes with processing 48-72 hours after collection. Plasma DNA was analysed with multiplex digital PCR (mdPCR) assays for hotspot mutations in PIK3CA, ESR1 and ERBB2, and for AKT1 E17K. There was 94.8% (91/96) agreement in mutation calling between immediate and delayed processed tubes, kappa 0.88 95% CI 0.77-0.98). Discordance in mutation calling resulted from low allele frequency and likely stochastic effects. In concordant samples there was high correlation in mutant copies per ml plasma (r2 = 0.98; p<0.0001). There was elevation of total cell free plasma DNA concentrations in 10.3% of delayed processed tubes, although overall quantification of total cell free plasma DNA had similar prognostic effects in immediate (HR 3.6) and delayed (HR 3.0) tubes. There was moderate agreement in changes in allele fraction between sequential samples in quantitative mutation tracking (r = 0.84, p = 0.0002). Delayed processing of samples using preservative tubes allows for centralized ctDNA digital PCR mutation screening in advanced breast cancer. The potential of preservative tubes in quantitative mutation tracking requires further research.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaneko, Mika Kato; Molecular Tumor Marker Research Team, Global COE Program, Yamagata University Faculty of Medicine, 2-2-2 Iida-nishi, Yamagata 990-9585; Morita, Shunpei

Highlights: ► IDH1/2 mutations are early and frequent genetic alterations in gliomas. ► We established anti-mutated IDH2-specific mAbs KMab-1 and MMab-1. ► KMab-1 or MMab-1 specifically reacted with mutated IDH2 in ELISA. ► MMab-1 specifically stained IDH2-R172M-expressing CHO cells in ICC. ► MMab-1 specifically stained IDH2-R172M-expressing gliomas in IHC. - Abstract: Isocitrate dehydrogenase 1/2 (IDH1/2) mutations have been detected in gliomas, cartilaginous tumors, and leukemias. IDH1/2 mutations are early and frequent genetic alterations, are specific to a single codon in the conserved and functionally important Arginine 132 (R132) in IDH1 and Arginine 172 (R172) in IDH2. We previously established severalmore » monoclonal antibodies (mAbs), which are specific for IDH1 mutations: clones IMab-1 or HMab-1 against IDH1-R132H or clone SMab-1 against IDH1-R132S. However, specific mAbs against IDH2 mutations have not been reported. To establish IDH2-mutation-specific mAbs, we immunized mice or rats with each mutation-containing IDH2 peptides including IDH2-R172K and IDH2-R172M. After cell fusion, IDH2 mutation-specific mAbs were screened in Enzyme-Linked Immunosorbent Assay (ELISA). Established mAbs KMab-1 and MMab-1 reacted with the IDH2-R172K and IDH2-R172M peptides, respectively, but not with IDH2-wild type (WT) in ELISA. Western-blot analysis also showed that KMab-1 and MMab-1 reacted with the IDH2-R172K and IDH2-R172M recombinant proteins, respectively, not with IDH2-WT or other IDH2 mutants, indicating that KMab-1 and MMab-1 are IDH2-mutation-specific. Furthermore, MMab-1 specifically stained the IDH2-R172M-expressing cells in immunocytochemistry, but did not stain IDH2-WT and other IDH2-mutation-containing cells. In immunohistochemical analysis, MMab-1 specifically stained IDH2-R172M-expressing glioma. This is the first report to establish anti-IDH2-mutation-specific mAbs, which could be useful in diagnosis of mutation-bearing tumors.« less

Mutational analysis of PI3K/AKT and RAS/RAF pathway activation in malignant salivary gland tumours with a new mutation of PIK3CA.

PubMed

Shalmon, B; Drendel, M; Wolf, M; Hirshberg, A; Cohen, Y

2016-06-01

The phosphoinositide 3-kinase (PIK3)/v-akt murine thymoma (AKT) oncogene pathway and the RAS/RAF pathway are involved in regulating the signalling of multiple biological processes, including apoptosis, metabolism, cell proliferation, and cell growth. Mutations in the genes within these pathways are frequently found in several tumours. The aim of this study was to investigate the frequency of mutations in the PIK3CA, BRAF, and KRAS genes in cases of malignant salivary gland tumours. Mutational analysis of the PIK3CA, KRAS, and BRAF genes was performed by direct sequencing of material from 21 patients with malignant salivary gland tumours who underwent surgery between 1992 and 2001. No mutations were found in the KRAS exon 2, BRAF exon 15, or PIK3CA exon 9 genes. However, an unpublished mutation of the PIK3CA gene in exon 20 (W1051 stop mutation) was found in one case of adenocarcinoma NOS. The impact of this mutation on the biological behaviour of the tumour has yet to be explored, however the patient with adenocarcinoma NOS harbouring this mutation has survived for over 20 years following surgery despite a high stage at presentation. Further studies with more homogeneous patient cohorts are needed to address whether this mutation reflects a different clinical presentation and may benefit from targeted treatment strategies. Copyright © 2015 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Microarray pathway analysis indicated that mitogen-activated protein kinase/extracellular signal-regulated kinase and insulin growth factor 1 signaling pathways were inhibited by small interfering RNA against AT-rich interactive domain 1A in endometrial cancer

PubMed Central

Yang, Ye; Bao, Wei; Sang, Zhengyu; Yang, Yongbing; Lu, Meng; Xi, Xiaowei

2018-01-01

Mutations in the gene encoding AT-rich interactive domain 1A (ARID1A) are frequently observed in endometrial cancer (EC) but the molecular mechanisms linking the genetic changes remain to be fully understood. The present study aimed to elucidate the influence of ARID1A mutations on signaling pathways. Missense, synonymous and nonsense heterozygous ARID1A mutations in the EC HEC-1-A cell line were verified by Sanger sequencing. Mutated ARID1A small interfering RNA was transfected into HEC-1-A cells. Biochemical microarray analysis revealed 13 upregulated pathways, 17 downregulated pathways, 14 significantly affected disease states and functions, 662 upstream and 512 downstream genes in mutated ARID1A-depleted HEC-1-A cells, among which the mitogen-activated protein kinase/extracellular signal-regulated kinase and insulin-like growth factor-1 (IGF1) signaling pathways were the 2 most downregulated pathways. Furthermore, the forkhead box protein O1 pathway was upregulated, while the IGF1 receptor, insulin receptor substrate 1 and phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit b pathways were downregulated. Carcinoma tumorigenesis, tumor cell mitosis and tumor cell death were significantly upregulated disease states and functions, while cell proliferation and tumor growth were significantly downregulated. The results of the present study suggested that ARID1A may be a potential prognostic and therapeutic molecular drug target for the prevention of EC progression. PMID:29399196

Common and Rare EGFR and KRAS Mutations in a Dutch Non-Small-Cell Lung Cancer Population and Their Clinical Outcome

PubMed Central

Kerner, Gerald S. M. A.; Schuuring, Ed; Sietsma, Johanna; Hiltermann, Thijo J. N.; Pieterman, Remge M.; de Leede, Gerard P. J.; van Putten, John W. G.; Liesker, Jeroen; Renkema, Tineke E. J.; van Hengel, Peter; Platteel, Inge; Timens, Wim; Groen, Harry J. M.

2013-01-01

Introduction In randomly assigned studies with EGFR TKI only a minor proportion of patients with NSCLC have genetically profiled biopsies. Guidelines provide evidence to perform EGFR and KRAS mutation analysis in non-squamous NSCLC. We explored tumor biopsy quality offered for mutation testing, different mutations distribution, and outcome with EGFR TKI. Patient and Methods Clinical data from 8 regional hospitals were studied for patient and tumor characteristics, treatment and overall survival. Biopsies sent to the central laboratory were evaluated for DNA quality and subsequently analyzed for mutations in exons 18–21 of EGFR and exon 2 of KRAS by bidirectional sequence analysis. Results Tumors from 442 subsequent patients were analyzed. For 74 patients (17%) tumors were unsuitable for mutation analysis. Thirty-eight patients (10.9%) had EGFR mutations with 79% known activating mutations. One hundred eight patients (30%) had functional KRAS mutations. The mutation spectrum was comparable to the Cosmic database. Following treatment in the first or second line with EGFR TKI median overall survival for patients with EGFR (n = 14), KRAS (n = 14) mutations and wild type EGFR/KRAS (n = 31) was not reached, 20 and 9 months, respectively. Conclusion One out of every 6 tumor samples was inadequate for mutation analysis. Patients with EGFR activating mutations treated with EGFR-TKI have the longest survival. PMID:23922984

Role of Human DNA Polymerase and Its Accessory Proteins in Breast Cancer

DTIC Science & Technology

2002-04-01

the POLD1 gene in breast cancer tissues using a Non-Isotopic RNase Cleavage Assay (NIRCA) and DNA sequencing techniques. Four novel mutations , P327L...M.Y.W.T. Mutational Analysis of the Exo Motif of POLD1 gene in human Breast Cancer cells (in preparation) 9. Jaime, C., Mazloum N., and Lee, M.Y.W. T...Cold Spring Harbor 1999 8. Xu, H., and Lee, M.Y.W.T. Analyzes of POLD1 gene mutation and study of its transcriptional regulation in Breast Cancer Cells

ITK Gene Mutation: Effect on Survival of Children with Severe Hemophagocytic Lymphohistiocytosis.

PubMed

Zheng, Fang; Li, Juan; Zha, Hui; Zhang, Jue; Zhang, Zhiquan; Cheng, Fangjun

2016-11-01

Hemophagocytic lymphohistiocytosis (HLH) is characterized by deadly hyperinflammatory syndrome, but data on severe HLH with multi-organ dysfunction in children are scant. The authors report a retrospective study of 8 cases with severe HLH from a pediatric intensive care unit (PICU) over a 1-y period and found that Epstein barr virus (EBV) -infection was the most common etiology. All patients had genetic analysis, which showed that four patients with EBV -infection had one homozygous mutation, c.985+75G>A (at position chr5:156667232) in exon10 of the ITK gene with poor survival rates. ITK + mutation group had higher percentages of CD3 + CD8 + T cells (36.0 ± 8.4 %) than those in ITK - mutation group (28.8 ± 5.5 %), while they had similar levels of CD3 + CD4 + T cells. ITK + mutation group had lower proportion of CD3 - CD19 + B cells (16.3 ± 2.9 %) and CD16 + CD56 + NK cells (8.4 ± 2.6 %) than ITK - mutation group (29.6 ± 5.1 % and 15.9 ± 9.0 % respectively). Most importantly, patients with EBV infection with c.985+75G>A mutation in ITK had lower survival rates than ITK - mutation group which it may be related with cellular immune dysfunction.

Quantitative evaluation of DNA damage and mutation rate by atmospheric and room-temperature plasma (ARTP) and conventional mutagenesis.

PubMed

Zhang, Xue; Zhang, Chong; Zhou, Qian-Qian; Zhang, Xiao-Fei; Wang, Li-Yan; Chang, Hai-Bo; Li, He-Ping; Oda, Yoshimitsu; Xing, Xin-Hui

2015-07-01

DNA damage is the dominant source of mutation, which is the driving force of evolution. Therefore, it is important to quantitatively analyze the DNA damage caused by different mutagenesis methods, the subsequent mutation rates, and their relationship. Atmospheric and room temperature plasma (ARTP) mutagenesis has been used for the mutation breeding of more than 40 microorganisms. However, ARTP mutagenesis has not been quantitatively compared with conventional mutation methods. In this study, the umu test using a flow-cytometric analysis was developed to quantify the DNA damage in individual viable cells using Salmonella typhimurium NM2009 as the model strain and to determine the mutation rate. The newly developed method was used to evaluate four different mutagenesis systems: a new ARTP tool, ultraviolet radiation, 4-nitroquinoline-1-oxide (4-NQO), and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) mutagenesis. The mutation rate was proportional to the corresponding SOS response induced by DNA damage. ARTP caused greater DNA damage to individual living cells than the other conventional mutagenesis methods, and the mutation rate was also higher. By quantitatively comparing the DNA damage and consequent mutation rate after different types of mutagenesis, we have shown that ARTP is a potentially powerful mutagenesis tool with which to improve the characteristics of microbial cell factories.

Combined hereditary and somatic mutations of replication error repair genes result in rapid onset of ultra-hypermutated cancers.

PubMed

Shlien, Adam; Campbell, Brittany B; de Borja, Richard; Alexandrov, Ludmil B; Merico, Daniele; Wedge, David; Van Loo, Peter; Tarpey, Patrick S; Coupland, Paul; Behjati, Sam; Pollett, Aaron; Lipman, Tatiana; Heidari, Abolfazl; Deshmukh, Shriya; Avitzur, Na'ama; Meier, Bettina; Gerstung, Moritz; Hong, Ye; Merino, Diana M; Ramakrishna, Manasa; Remke, Marc; Arnold, Roland; Panigrahi, Gagan B; Thakkar, Neha P; Hodel, Karl P; Henninger, Erin E; Göksenin, A Yasemin; Bakry, Doua; Charames, George S; Druker, Harriet; Lerner-Ellis, Jordan; Mistry, Matthew; Dvir, Rina; Grant, Ronald; Elhasid, Ronit; Farah, Roula; Taylor, Glenn P; Nathan, Paul C; Alexander, Sarah; Ben-Shachar, Shay; Ling, Simon C; Gallinger, Steven; Constantini, Shlomi; Dirks, Peter; Huang, Annie; Scherer, Stephen W; Grundy, Richard G; Durno, Carol; Aronson, Melyssa; Gartner, Anton; Meyn, M Stephen; Taylor, Michael D; Pursell, Zachary F; Pearson, Christopher E; Malkin, David; Futreal, P Andrew; Stratton, Michael R; Bouffet, Eric; Hawkins, Cynthia; Campbell, Peter J; Tabori, Uri

2015-03-01

DNA replication-associated mutations are repaired by two components: polymerase proofreading and mismatch repair. The mutation consequences of disruption to both repair components in humans are not well studied. We sequenced cancer genomes from children with inherited biallelic mismatch repair deficiency (bMMRD). High-grade bMMRD brain tumors exhibited massive numbers of substitution mutations (>250/Mb), which was greater than all childhood and most cancers (>7,000 analyzed). All ultra-hypermutated bMMRD cancers acquired early somatic driver mutations in DNA polymerase ɛ or δ. The ensuing mutation signatures and numbers are unique and diagnostic of childhood germ-line bMMRD (P < 10(-13)). Sequential tumor biopsy analysis revealed that bMMRD/polymerase-mutant cancers rapidly amass an excess of simultaneous mutations (∼600 mutations/cell division), reaching but not exceeding ∼20,000 exonic mutations in <6 months. This implies a threshold compatible with cancer-cell survival. We suggest a new mechanism of cancer progression in which mutations develop in a rapid burst after ablation of replication repair.

Shared Oncogenic Pathways Implicated in Both Virus-Positive and UV-Induced Merkel Cell Carcinomas.

PubMed

González-Vela, María Del Carmen; Curiel-Olmo, Soraya; Derdak, Sophia; Beltran, Sergi; Santibañez, Miguel; Martínez, Nerea; Castillo-Trujillo, Alfredo; Gut, Martha; Sánchez-Pacheco, Roxana; Almaraz, Carmen; Cereceda, Laura; Llombart, Beatriz; Agraz-Doblas, Antonio; Revert-Arce, José; López Guerrero, José Antonio; Mollejo, Manuela; Marrón, Pablo Isidro; Ortiz-Romero, Pablo; Fernandez-Cuesta, Lynnette; Varela, Ignacio; Gut, Ivo; Cerroni, Lorenzo; Piris, Miguel Ángel; Vaqué, José Pedro

2017-01-01

Merkel cell carcinoma (MCC) is a highly malignant neuroendocrine tumor of the skin whose molecular pathogenesis is not completely understood, despite the role that Merkel cell polyomavirus can play in 55-90% of cases. To study potential mechanisms driving this disease in clinically characterized cases, we searched for somatic mutations using whole-exome sequencing, and extrapolated our findings to study functional biomarkers reporting on the activity of the mutated pathways. Confirming previous results, Merkel cell polyomavirus-negative tumors had higher mutational loads with UV signatures and more frequent mutations in TP53 and RB compared with their Merkel cell polyomavirus-positive counterparts. Despite important genetic differences, the two Merkel cell carcinoma etiologies both exhibited nuclear accumulation of oncogenic transcription factors such as NFAT or nuclear factor of activated T cells (NFAT), P-CREB, and P-STAT3, indicating commonly deregulated pathogenic mechanisms with the potential to serve as targets for therapy. A multivariable analysis identified phosphorylated CRE-binding protein as an independent survival factor with respect to clinical variables and Merkel cell polyomavirus status in our cohort of Merkel cell carcinoma patients. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Overlapping hotspots in CDRs are critical sites for V region diversification.

PubMed

Wei, Lirong; Chahwan, Richard; Wang, Shanzhi; Wang, Xiaohua; Pham, Phuong T; Goodman, Myron F; Bergman, Aviv; Scharff, Matthew D; MacCarthy, Thomas

2015-02-17

Activation-induced deaminase (AID) mediates the somatic hypermutation (SHM) of Ig variable (V) regions that is required for the affinity maturation of the antibody response. An intensive analysis of a published database of somatic hypermutations that arose in the IGHV3-23*01 human V region expressed in vivo by human memory B cells revealed that the focus of mutations in complementary determining region (CDR)1 and CDR2 coincided with a combination of overlapping AGCT hotspots, the absence of AID cold spots, and an abundance of polymerase eta hotspots. If the overlapping hotspots in the CDR1 or CDR2 did not undergo mutation, the frequency of mutations throughout the V region was reduced. To model this result, we examined the mutation of the human IGHV3-23*01 biochemically and in the endogenous heavy chain locus of Ramos B cells. Deep sequencing revealed that IGHV3-23*01 in Ramos cells accumulates AID-induced mutations primarily in the AGCT in CDR2, which was also the most frequent site of mutation in vivo. Replacing the overlapping hotspots in CDR1 and CDR2 with neutral or cold motifs resulted in a reduction in mutations within the modified motifs and, to some degree, throughout the V region. In addition, some of the overlapping hotspots in the CDRs were at sites in which replacement mutations could change the structure of the CDR loops. Our analysis suggests that the local sequence environment of the V region, and especially of the CDR1 and CDR2, is highly evolved to recruit mutations to key residues in the CDRs of the IgV region.

Biallelic mutations in IRF8 impair human NK cell maturation and function

PubMed Central

Mace, Emily M.; Gunesch, Justin T.; Chinn, Ivan K.; Angelo, Laura S.; Maisuria, Sheetal; Keller, Michael D.; Togi, Sumihito; Watkin, Levi B.; LaRosa, David F.; Jhangiani, Shalini N.; Muzny, Donna M.; Stray-Pedersen, Asbjørg; Coban Akdemir, Zeynep; Smith, Jansen B.; Hernández-Sanabria, Mayra; Le, Duy T.; Hogg, Graham D.; Cao, Tram N.; Freud, Aharon G.; Szymanski, Eva P.; Collin, Matthew; Cant, Andrew J.; Gibbs, Richard A.; Holland, Steven M.; Caligiuri, Michael A.; Ozato, Keiko; Paust, Silke; Doody, Gina M.; Lupski, James R.; Orange, Jordan S.

2016-01-01

Human NK cell deficiencies are rare yet result in severe and often fatal disease, particularly as a result of viral susceptibility. NK cells develop from hematopoietic stem cells, and few monogenic errors that specifically interrupt NK cell development have been reported. Here we have described biallelic mutations in IRF8, which encodes an interferon regulatory factor, as a cause of familial NK cell deficiency that results in fatal and severe viral disease. Compound heterozygous or homozygous mutations in IRF8 in 3 unrelated families resulted in a paucity of mature CD56dim NK cells and an increase in the frequency of the immature CD56bright NK cells, and this impairment in terminal maturation was also observed in Irf8–/–, but not Irf8+/–, mice. We then determined that impaired maturation was NK cell intrinsic, and gene expression analysis of human NK cell developmental subsets showed that multiple genes were dysregulated by IRF8 mutation. The phenotype was accompanied by deficient NK cell function and was stable over time. Together, these data indicate that human NK cells require IRF8 for development and functional maturation and that dysregulation of this function results in severe human disease, thereby emphasizing a critical role for NK cells in human antiviral defense. PMID:27893462

Biallelic mutations in IRF8 impair human NK cell maturation and function.

PubMed

Mace, Emily M; Bigley, Venetia; Gunesch, Justin T; Chinn, Ivan K; Angelo, Laura S; Care, Matthew A; Maisuria, Sheetal; Keller, Michael D; Togi, Sumihito; Watkin, Levi B; LaRosa, David F; Jhangiani, Shalini N; Muzny, Donna M; Stray-Pedersen, Asbjørg; Coban Akdemir, Zeynep; Smith, Jansen B; Hernández-Sanabria, Mayra; Le, Duy T; Hogg, Graham D; Cao, Tram N; Freud, Aharon G; Szymanski, Eva P; Savic, Sinisa; Collin, Matthew; Cant, Andrew J; Gibbs, Richard A; Holland, Steven M; Caligiuri, Michael A; Ozato, Keiko; Paust, Silke; Doody, Gina M; Lupski, James R; Orange, Jordan S

2017-01-03

Human NK cell deficiencies are rare yet result in severe and often fatal disease, particularly as a result of viral susceptibility. NK cells develop from hematopoietic stem cells, and few monogenic errors that specifically interrupt NK cell development have been reported. Here we have described biallelic mutations in IRF8, which encodes an interferon regulatory factor, as a cause of familial NK cell deficiency that results in fatal and severe viral disease. Compound heterozygous or homozygous mutations in IRF8 in 3 unrelated families resulted in a paucity of mature CD56dim NK cells and an increase in the frequency of the immature CD56bright NK cells, and this impairment in terminal maturation was also observed in Irf8-/-, but not Irf8+/-, mice. We then determined that impaired maturation was NK cell intrinsic, and gene expression analysis of human NK cell developmental subsets showed that multiple genes were dysregulated by IRF8 mutation. The phenotype was accompanied by deficient NK cell function and was stable over time. Together, these data indicate that human NK cells require IRF8 for development and functional maturation and that dysregulation of this function results in severe human disease, thereby emphasizing a critical role for NK cells in human antiviral defense.

A single mutation in Securin induces chromosomal instability and enhances cell invasion.

PubMed

Mora-Santos, Mar; Castilla, Carolina; Herrero-Ruiz, Joaquín; Giráldez, Servando; Limón-Mortés, M Cristina; Sáez, Carmen; Japón, Miguel Á; Tortolero, Maria; Romero, Francisco

2013-01-01

Pituitary tumour transforming gene (pttg1) encodes Securin, a protein involved in the inhibition of sister chromatid separation binding to Separase until the onset of anaphase. Separase is a cysteine-protease that degrades cohesin to segregate the sister chromatids to opposite poles of the cell. The amount of Securin is strongly regulated because it should allow Separase activation when it is degraded by the anaphase promoting complex/cyclosome, should arrest the cell cycle after DNA damage, when it is degraded through SKP1-CUL1-βTrCP ubiquitin ligase, and its overexpression induces tumour formation and correlates with metastasis in multiple tumours. Securin is a phosphoprotein that contains 32 potentially phosphorylatable residues. We mutated and analysed most of them, and found a single mutant, hSecT60A, that showed enhanced oncogenic properties. Our fluorescence activated cell sorting analysis, fluorescence in situ hybridisation assays, tumour cell migration and invasion experiments and gene expression by microarrays analysis clearly involved hSecT60A in chromosomal instability and cell invasion. These results show, for the first time, that a single mutation in pttg1 is sufficient to trigger the oncogenic properties of Securin. The finding of this point mutation in patients might be used as an effective strategy for early detection of cancer. Copyright © 2012 Elsevier Ltd. All rights reserved.

Fixation effect of SurePath preservative fluids using epidermal growth factor receptor mutation-specific antibodies for immunocytochemistry.

PubMed

Kawahara, Akihiko; Taira, Tomoki; Abe, Hideyuki; Watari, Kosuke; Murakami, Yuichi; Fukumitsu, Chihiro; Takase, Yorihiko; Yamaguchi, Tomohiko; Azuma, Koichi; Akiba, Jun; Ono, Mayumi; Kage, Masayoshi

2014-02-01

Cytological diagnosis of respiratory disease has become important, not only for histological typing using immunocytochemistry (ICC) but also for molecular DNA analysis of cytological material. The aim of this study was to investigate the fixation effect of SurePath preservative fluids. Human lung cancer PC9 and 11-18 cell lines, and lung adenocarcinoma cells in pleural effusion, were fixed in CytoRich Blue, CytoRich Red, 15% neutral-buffered formalin, and 95% ethanol, respectively. PC9 and 11-18 cell lines were examined by ICC with epidermal growth factor receptor (EGFR) mutation-specific antibodies, the EGFR mutation DNA assay, and fluorescence in situ hybridization. The effect of antigenic storage time was investigated in lung adenocarcinoma cells in pleural effusion by ICC using the lung cancer detection markers. PC9 and 11-18 cell lines in formalin-based fixatives showed strong staining of EGFR mutation-specific antibodies and lung cancer detection markers by ICC as compared with ethanol-based fixatives. DNA preservation with CytoRich Blue and CytoRich Red was superior to that achieved with 95% ethanol and 15% neutral-buffered formalin fixatives, whereas EGFR mutations by DNA assay and EGFR gene amplification by fluorescence in situ hybridization were successfully identified in all fixative samples. Although cytoplasmic antigens maintained high expression levels, expression levels in nuclear antigens fell as storage time increased. These results indicate that CytoRich Red is not only suitable for ICC with EGFR mutation-specific antibodies, but also for DNA analysis of cytological material, and is useful in molecular testing of lung cancer, for which various types of analyses will be needed in future. © 2013 American Cancer Society.

Quantitative metabolome analysis profiles activation of glutaminolysis in glioma with IDH1 mutation.

PubMed

Ohka, Fumiharu; Ito, Maki; Ranjit, Melissa; Senga, Takeshi; Motomura, Ayako; Motomura, Kazuya; Saito, Kaori; Kato, Keiko; Kato, Yukinari; Wakabayashi, Toshihiko; Soga, Tomoyoshi; Natsume, Atsushi

2014-06-01

Isocitrate dehydrogenase 1 (IDH1), which localizes to the cytosol and peroxisomes, catalyzes the oxidative decarboxylation of isocitrate to α-ketoglutarate (α-KG) and in parallel converts NADP(+) to NADPH. IDH1 mutations are frequently detected in grades 2-4 gliomas and in acute myeloid leukemias (AML). Mutations of IDH1 have been identified at codon 132, with arginine being replaced with histidine in most cases. Mutant IDH1 gains novel enzyme activity converting α-KG to D-2-hydroxyglutarate (2-HG) which acts as a competitive inhibitor of α-KG. As a result, the activity of α-KG-dependent enzyme is reduced. Based on these findings, 2-HG has been proposed to be an oncometabolite. In this study, we established HEK293 and U87 cells that stably expressed IDH1-WT and IDH1-R132H and investigated the effect of glutaminase inhibition on cell proliferation with 6-diazo-5-oxo-L-norleucine (DON). We found that cell proliferation was suppressed in IDH1-R132H cells. The addition of α-KG restored cell proliferation. The metabolic features of 33 gliomas with wild type IDH1 (IDH1-WT) and with IDH1-R132H mutation were examined by global metabolome analysis using capillary electrophoresis time-of-flight mass spectrometry (CE-TOFMS). We showed that the 2-HG levels were highly elevated in gliomas with IDH1-R132H mutation. Intriguingly, in gliomas with IDH1-R132H, glutamine and glutamate levels were significantly reduced which implies replenishment of α-KG by glutaminolysis. Based on these results, we concluded that glutaminolysis is activated in gliomas with IDH1-R132H mutation and that development of novel therapeutic approaches targeting activated glutaminolysis is warranted.

EGFR and KRAS mutation status in non-small-cell lung cancer occurring in HIV-infected patients.

PubMed

Créquit, Perrine; Ruppert, Anne-Marie; Rozensztajn, Nathalie; Gounant, Valérie; Vieira, T; Poulot, Virginie; Antoine, Martine; Chouaid, Christos; Wislez, Marie; Cadranel, Jacques; Lavole, Armelle

2016-06-01

Non-small-cell lung cancer (NSCLC) is the most common non-acquired immune deficiency syndrome-related malignancy responsible for death. Mutational status is crucial for choosing treatment of advanced NSCLC, yet no data is available on the frequency of epidermal growth factor receptor (EGFR) and Kirsten ras (KRAS) mutations and their impact on NSCLC in human immunodeficiency virus (HIV)-infected patients (HIV-NSCLC). All consecutive HIV-NSCLC patients diagnosed between June 1996 and August 2013 at two Paris university hospitals were reviewed, with tumor samples analyzed for EGFR and KRAS mutational status. Overall, 63 tumor samples were analyzed out of 73 HIV-NSCLC cases, with 63% of advanced NSCLC. There were 60 non-squamous and nine squamous cell carcinomas, with EGFR and KRAS mutations identified in two (3.3%) and seven (11.5%) tumors, respectively. The proportion of KRAS mutations was 29% if solely the more sensitive molecular techniques were considered. The two patients with advanced adenocarcinoma harboring EGFR mutations exhibited lasting partial response to EGFR-tyrosine kinase inhibitors. Overall survival for patients with advanced NSCLC were >30 months for those with EGFR mutations, <3 months for KRAS mutations (n=2), and the median was 9 months [4.1-14.3] for wild-type (n=34). In multivariate analysis, KRAS mutation and CD4<200 cells/μL were associated with poor prognosis (hazard ratio (HR): 24 [4.1-140.2], p=0.0004; HR: 3.1 [1.3-7.5], p=0.01, respectively). EGFR mutation must be investigated in HIV-NSCLC cases due to its predictive and prognostic impact, whereas KRAS mutation is of poor prognostic value. Clinicians should search for drugs dedicated to this target population. Copyright © 2016. Published by Elsevier Ireland Ltd.

Induction of mutations by bismuth-212 alpha particles at two genetic loci in human B-lymphoblasts.

PubMed

Metting, N F; Palayoor, S T; Macklis, R M; Atcher, R W; Liber, H L; Little, J B

1992-12-01

The human lymphoblast cell line TK6 was exposed to the alpha-particle-emitting radon daughter 212Bi by adding DTPA-chelated 212Bi directly to the cell suspension. Cytotoxicity and mutagenicity at two genetic loci were measured, and the molecular nature of mutant clones was studied by Southern blot analysis. Induced mutant fractions were 2.5 x 10(-5)/Gy at the hprt locus and 3.75 x 10(-5)/Gy at the tk locus. Molecular analysis of HPRT- mutant DNAs showed a high frequency (69%) of clones with partial or full deletions of the hprt gene among radiation-induced mutants compared with spontaneous mutants (31%). Chi-squared analyses of mutational spectra show a significant difference (P < or = 0.005) between spontaneous mutants and alpha-particle-induced mutants. Comparison with published studies of accelerator-produced heavy-ion exposures of TK6 cells indicates that the induction of mutations at the hprt locus, and perhaps a subset of mutations at the tk locus, is a simple linear function of particle fluence regardless of the ion species or its LET.

Infrequent widespread microsatellite instability in hepatocellular carcinomas.

PubMed

Yamamoto, H; Itoh, F; Fukushima, H; Kaneto, H; Sasaki, S; Ohmura, T; Satoh, T; Karino, Y; Endo, T; Toyota, J; Imai, K

2000-03-01

Widespread or high-frequency microsatellite instability (MSI) due to the defective DNA mismatch repair (MMR) occurs in the majority of hereditary non-polyposis colorectal cancer and a subset of sporadic malignant tumors. The incidence of MSI and underlying DNA MMR defects have been well characterized in gastrointestinal carcinogenesis, but not in hepatocarcinogenesis. To address the issue, we analyzed 55 Japanese hepatocellular carcinomas using several indicators of DNA MMR defects, such as microsatellite analysis, loss of heterozygosity (LOH) and mutation analysis of MMR genes, methylation of hMLH1 promoter, and frameshift mutations of mononucleotide repeat sequences within possible target genes. Mutation of beta2-microglobulin gene, which is presumably involved in MSI-positive tumor cell escape from immune surveillance was also examined. Some of these analyses were also carried out in 9 human liver cancer cell lines. None of the 3 quasi-monomorphic mononucleotide markers sensitive for MSI, BAT26, BAT25, and BAT34C4 presented shortened unstable alleles in any of the carcinoma, cirrhosis, chronic hepatitis tissues, or cell lines. LOH at MMR genes was infrequent (4.4 approximately 7.1%), and no mutations were detected. Neither hMLH1 hypermethylation nor frameshift mutation in the target genes was detected. No mutations were found in beta2-microglobulin. Widespread MSI due to the defective DNA MMR appears to play little if any part in Japanese hepatocarcinogenesis.

Dielectrophoretic Capture and Genetic Analysis of Single Neuroblastoma Tumor Cells

PubMed Central

Carpenter, Erica L.; Rader, JulieAnn; Ruden, Jacob; Rappaport, Eric F.; Hunter, Kristen N.; Hallberg, Paul L.; Krytska, Kate; O’Dwyer, Peter J.; Mosse, Yael P.

2014-01-01

Our understanding of the diversity of cells that escape the primary tumor and seed micrometastases remains rudimentary, and approaches for studying circulating and disseminated tumor cells have been limited by low throughput and sensitivity, reliance on single parameter sorting, and a focus on enumeration rather than phenotypic and genetic characterization. Here, we utilize a highly sensitive microfluidic and dielectrophoretic approach for the isolation and genetic analysis of individual tumor cells. We employed fluorescence labeling to isolate 208 single cells from spiking experiments conducted with 11 cell lines, including 8 neuroblastoma cell lines, and achieved a capture sensitivity of 1 tumor cell per 106 white blood cells (WBCs). Sample fixation or freezing had no detectable effect on cell capture. Point mutations were accurately detected in the whole genome amplification product of captured single tumor cells but not in negative control WBCs. We applied this approach to capture 144 single tumor cells from 10 bone marrow samples of patients suffering from neuroblastoma. In this pediatric malignancy, high-risk patients often exhibit wide-spread hematogenous metastasis, but access to primary tumor can be difficult or impossible. Here, we used flow-based sorting to pre-enrich samples with tumor involvement below 0.02%. For all patients for whom a mutation in the Anaplastic Lymphoma Kinase gene had already been detected in their primary tumor, the same mutation was detected in single cells from their marrow. These findings demonstrate a novel, non-invasive, and adaptable method for the capture and genetic analysis of single tumor cells from cancer patients. PMID:25133137

Expansion of donor-derived hematopoietic stem cells with PIGA mutation associated with late graft failure after allogeneic stem cell transplantation.

PubMed

Mochizuki, Kanako; Sugimori, Chiharu; Qi, Zhirong; Lu, Xuzhang; Takami, Akiyoshi; Ishiyama, Ken; Kondo, Yukio; Yamazaki, Hirohito; Okumura, Hirokazu; Nakao, Shinji

2008-09-01

A small population of CD55(-)CD59(-) blood cells was detected in a patient who developed donor-type late graft failure after allogeneic stem cell transplantation (SCT) for treatment of aplastic anemia (AA). Chimerism and PIGA gene analyses showed the paroxysmal nocturnal hemoglobinuria (PNH)-type granulocytes to be of a donor-derived stem cell with a thymine insertion in PIGA exon 2. A sensitive mutation-specific polymerase chain reaction (PCR)-based analysis detected the mutation exclusively in DNA derived from the donor bone marrow (BM) cells. The patient responded to immunosuppressive therapy and achieved transfusion independence. The small population of PNH-type cells was undetectable in any of the 50 SCT recipients showing stable engraftment. The de novo development of donor cell-derived AA with a small population of PNH-type cells in this patient supports the concept that glycosyl phosphatidylinositol-anchored protein-deficient stem cells have a survival advantage in the setting of immune-mediated BM injury.

Resolving rates of mutation in the brain using single-neuron genomics

PubMed Central

Evrony, Gilad D; Lee, Eunjung; Park, Peter J; Walsh, Christopher A

2016-01-01

Whether somatic mutations contribute functional diversity to brain cells is a long-standing question. Single-neuron genomics enables direct measurement of somatic mutation rates in human brain and promises to answer this question. A recent study (Upton et al., 2015) reported high rates of somatic LINE-1 element (L1) retrotransposition in the hippocampus and cerebral cortex that would have major implications for normal brain function, and suggested that these events preferentially impact genes important for neuronal function. We identify aspects of the single-cell sequencing approach, bioinformatic analysis, and validation methods that led to thousands of artifacts being interpreted as somatic mutation events. Our reanalysis supports a mutation frequency of approximately 0.2 events per cell, which is about fifty-fold lower than reported, confirming that L1 elements mobilize in some human neurons but indicating that L1 mosaicism is not ubiquitous. Through consideration of the challenges identified, we provide a foundation and framework for designing single-cell genomics studies. DOI: http://dx.doi.org/10.7554/eLife.12966.001 PMID:26901440

Detection and Characterization of Circulating Tumor Associated Cells in Metastatic Breast Cancer.

PubMed

Mu, Zhaomei; Benali-Furet, Naoual; Uzan, Georges; Znaty, Anaëlle; Ye, Zhong; Paolillo, Carmela; Wang, Chun; Austin, Laura; Rossi, Giovanna; Fortina, Paolo; Yang, Hushan; Cristofanilli, Massimo

2016-09-30

The availability of blood-based diagnostic testing using a non-invasive technique holds promise for real-time monitoring of disease progression and treatment selection. Circulating tumor cells (CTCs) have been used as a prognostic biomarker for the metastatic breast cancer (MBC). The molecular characterization of CTCs is fundamental to the phenotypic identification of malignant cells and description of the relevant genetic alterations that may change according to disease progression and therapy resistance. However, the molecular characterization of CTCs remains a challenge because of the rarity and heterogeneity of CTCs and technological difficulties in the enrichment, isolation and molecular characterization of CTCs. In this pilot study, we evaluated circulating tumor associated cells in one blood draw by size exclusion technology and cytological analysis. Among 30 prospectively enrolled MBC patients, CTCs, circulating tumor cell clusters (CTC clusters), CTCs of epithelial-mesenchymal transition (EMT) and cancer associated macrophage-like cells (CAMLs) were detected and analyzed. For molecular characterization of CTCs, size-exclusion method for CTC enrichment was tested in combination with DEPArray™ technology, which allows the recovery of single CTCs or pools of CTCs as a pure CTC sample for mutation analysis. Genomic mutations of TP53 and ESR1 were analyzed by targeted sequencing on isolated 7 CTCs from a patient with MBC. The results of genomic analysis showed heterozygous TP53 R248W mutation from one single CTC and pools of three CTCs, and homozygous TP53 R248W mutation from one single CTC and pools of two CTCs. Wild-type ESR1 was detected in the same isolated CTCs. The results of this study reveal that size-exclusion method can be used to enrich and identify circulating tumor associated cells, and enriched CTCs were characterized for genetic alterations in MBC patients, respectively.

ZAP-70 expression in B-cell chronic lymphocytic leukemia: evaluation by external (isotypic) or internal (T/NK cells) controls and correlation with IgV(H) mutations.

PubMed

Zucchetto, Antonella; Bomben, Riccardo; Bo, Michele Dal; Nanni, Paola; Bulian, Pietro; Rossi, Francesca Maria; Del Principe, Maria Ilaria; Santini, Simone; Del Poeta, Giovanni; Degan, Massimo; Gattei, Valter

2006-07-15

Expression of T cell specific zeta-associated protein 70 (ZAP-70) by B-cell chronic lymphocytic leukemia (B-CLL) cells, as investigated by flow cytometry, has both prognostic relevance and predictive power as surrogate for immunoglobulin heavy chain variable region (IgV(H)) mutations, although a standardization of the cytometric protocol is still lacking. Flow cytometric analyses for ZAP-70 were performed in peripheral blood samples from 145 B-CLL (124 with IgV(H) mutations) by a standard three-color protocol. Identification of ZAP-70(+) cell population was based on an external negative control, i.e., the isotypic control (ISO method) or an internal positive control, i.e., the population of residual normal T/NK cells (TNK method). A comparison between these two approaches was performed. While 86/145 cases were concordant as for ZAP-70 expression according to the two methods (ISO(+)TNK(+) or ISO(-)TNK(-)), 59/145 cases had discordant ZAP-70 expression, mainly (56/59) showing a ISO(+)TNK(-) profile. These latter cases express higher levels of ZAP-70 in their normal T cell component. Moreover, discordant ISO(+)TNK(-) cases had a IgV(H) gene mutation profile similar to that of concordantly positive cases and different from ZAP-70 concordantly negative B-CLL. Analysis of ZAP-70 expression by B-CLL cells by using the ISO method allows to overcome the variability in the expression of ZAP-70 by residual T cells and yields a better correlation with IgV(H) gene mutations. A receiver operating characteristic analysis suggests to employ a higher cut-off than the commonly used 20%. A parallel evaluation of the prognostic value of ZAP-70 expression, as determined according to the ISO and TNK methods, is still needed. (c) 2006 International Society for Analytical Cytology.

Cancer-associated isocitrate dehydrogenase 1 (IDH1) R132H mutation and d-2-hydroxyglutarate stimulate glutamine metabolism under hypoxia.

PubMed

Reitman, Zachary J; Duncan, Christopher G; Poteet, Ethan; Winters, Ali; Yan, Liang-Jun; Gooden, David M; Spasojevic, Ivan; Boros, Laszlo G; Yang, Shao-Hua; Yan, Hai

2014-08-22

Mutations in the cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDH1) occur in several types of cancer, and altered cellular metabolism associated with IDH1 mutations presents unique therapeutic opportunities. By altering IDH1, these mutations target a critical step in reductive glutamine metabolism, the metabolic pathway that converts glutamine ultimately to acetyl-CoA for biosynthetic processes. While IDH1-mutated cells are sensitive to therapies that target glutamine metabolism, the effect of IDH1 mutations on reductive glutamine metabolism remains poorly understood. To explore this issue, we investigated the effect of a knock-in, single-codon IDH1-R132H mutation on the metabolism of the HCT116 colorectal adenocarcinoma cell line. Here we report the R132H-isobolome by using targeted (13)C isotopomer tracer fate analysis to trace the metabolic fate of glucose and glutamine in this system. We show that introduction of the R132H mutation into IDH1 up-regulates the contribution of glutamine to lipogenesis in hypoxia, but not in normoxia. Treatment of cells with a d-2-hydroxyglutarate (d-2HG) ester recapitulated these changes, indicating that the alterations observed in the knocked-in cells were mediated by d-2HG produced by the IDH1 mutant. These studies provide a dynamic mechanistic basis for metabolic alterations observed in IDH1-mutated tumors and uncover potential therapeutic targets in IDH1-mutated cancers. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Androgen Receptor Functional Analyses by High Throughput Imaging: Determination of Ligand, Cell Cycle, and Mutation-Specific Effects

PubMed Central

Szafran, Adam T.; Szwarc, Maria; Marcelli, Marco; Mancini, Michael A.

2008-01-01

Background Understanding how androgen receptor (AR) function is modulated by exposure to steroids, growth factors or small molecules can have important mechanistic implications for AR-related disease therapies (e.g., prostate cancer, androgen insensitivity syndrome, AIS), and in the analysis of environmental endocrine disruptors. Methodology/Principal Findings We report the development of a high throughput (HT) image-based assay that quantifies AR subcellular and subnuclear distribution, and transcriptional reporter gene activity on a cell-by-cell basis. Furthermore, simultaneous analysis of DNA content allowed determination of cell cycle position and permitted the analysis of cell cycle dependent changes in AR function in unsynchronized cell populations. Assay quality for EC50 coefficients of variation were 5–24%, with Z' values reaching 0.91. This was achieved by the selective analysis of cells expressing physiological levels of AR, important because minor over-expression resulted in elevated nuclear speckling and decreased transcriptional reporter gene activity. A small screen of AR-binding ligands, including known agonists, antagonists, and endocrine disruptors, demonstrated that nuclear translocation and nuclear “speckling” were linked with transcriptional output, and specific ligands were noted to differentially affect measurements for wild type versus mutant AR, suggesting differing mechanisms of action. HT imaging of patient-derived AIS mutations demonstrated a proof-of-principle personalized medicine approach to rapidly identify ligands capable of restoring multiple AR functions. Conclusions/Significance HT imaging-based multiplex screening will provide a rapid, systems-level analysis of compounds/RNAi that may differentially affect wild type AR or clinically relevant AR mutations. PMID:18978937

Detection of EML4-ALK fusion gene and features associated with EGFR mutations in Chinese patients with non-small-cell lung cancer.

PubMed

Wen, Miaomiao; Wang, Xuejiao; Sun, Ying; Xia, Jinghua; Fan, Liangbo; Xing, Hao; Zhang, Zhipei; Li, Xiaofei

2016-01-01

Echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK) and epidermal growth factor receptor (EGFR) define specific molecular subsets of lung cancer with distinct clinical features. We aimed at revealing the clinical features of EML4-ALK fusion gene and EGFR mutation in non-small-cell lung cancer (NSCLC). We enrolled 694 Chinese patients with NSCLC for analysis. EML4-ALK fusion gene was analyzed by real-time polymerase chain reaction, and EGFR mutations were analyzed by amplified refractory mutation system. Among the 694 patients, 60 (8.65%) patients had EML4-ALK fusions. In continuity correction χ (2) test analysis, EML4-ALK fusion gene was correlated with sex, age, smoking status, and histology, but no significant association was observed between EML4-ALK fusion gene and clinical stage. A total of 147 (21.18%) patients had EGFR mutations. In concordance with previous reports, EGFR mutation was correlated with age, smoking status, histology, and clinical stage, whereas patient age was not significantly associated with EGFR mutation. Meanwhile, to our surprise, six (0.86%) patients had coexisting EML4-ALK fusions and EGFR mutations. EML4-ALK fusion gene defines a new molecular subset in patients with NSCLC. Six patients who harbored both EML4-ALK fusion genes and EGFR mutations were identified in our study. The EGFR mutations and the EML4-ALK fusion genes are coexistent.

Detection of EML4-ALK fusion gene and features associated with EGFR mutations in Chinese patients with non-small-cell lung cancer

PubMed Central

Wen, Miaomiao; Wang, Xuejiao; Sun, Ying; Xia, Jinghua; Fan, Liangbo; Xing, Hao; Zhang, Zhipei; Li, Xiaofei

2016-01-01

Purpose Echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (EML4-ALK) and epidermal growth factor receptor (EGFR) define specific molecular subsets of lung cancer with distinct clinical features. We aimed at revealing the clinical features of EML4-ALK fusion gene and EGFR mutation in non-small-cell lung cancer (NSCLC). Methods We enrolled 694 Chinese patients with NSCLC for analysis. EML4-ALK fusion gene was analyzed by real-time polymerase chain reaction, and EGFR mutations were analyzed by amplified refractory mutation system. Results Among the 694 patients, 60 (8.65%) patients had EML4-ALK fusions. In continuity correction χ2 test analysis, EML4-ALK fusion gene was correlated with sex, age, smoking status, and histology, but no significant association was observed between EML4-ALK fusion gene and clinical stage. A total of 147 (21.18%) patients had EGFR mutations. In concordance with previous reports, EGFR mutation was correlated with age, smoking status, histology, and clinical stage, whereas patient age was not significantly associated with EGFR mutation. Meanwhile, to our surprise, six (0.86%) patients had coexisting EML4-ALK fusions and EGFR mutations. Conclusion EML4-ALK fusion gene defines a new molecular subset in patients with NSCLC. Six patients who harbored both EML4-ALK fusion genes and EGFR mutations were identified in our study. The EGFR mutations and the EML4-ALK fusion genes are coexistent. PMID:27103824

Mutation Analysis in Cultured Cells of Transgenic Rodents

PubMed Central

Zheng, Albert; Bates, Steven E.; Tommasi, Stella

2018-01-01

To comply with guiding principles for the ethical use of animals for experimental research, the field of mutation research has witnessed a shift of interest from large-scale in vivo animal experiments to small-sized in vitro studies. Mutation assays in cultured cells of transgenic rodents constitute, in many ways, viable alternatives to in vivo mutagenicity experiments in the corresponding animals. A variety of transgenic rodent cell culture models and mutation detection systems have been developed for mutagenicity testing of carcinogens. Of these, transgenic Big Blue® (Stratagene Corp., La Jolla, CA, USA, acquired by Agilent Technologies Inc., Santa Clara, CA, USA, BioReliance/Sigma-Aldrich Corp., Darmstadt, Germany) mouse embryonic fibroblasts and the λ Select cII Mutation Detection System have been used by many research groups to investigate the mutagenic effects of a wide range of chemical and/or physical carcinogens. Here, we review techniques and principles involved in preparation and culturing of Big Blue® mouse embryonic fibroblasts, treatment in vitro with chemical/physical agent(s) of interest, determination of the cII mutant frequency by the λ Select cII assay and establishment of the mutation spectrum by DNA sequencing. We describe various approaches for data analysis and interpretation of the results. Furthermore, we highlight representative studies in which the Big Blue® mouse cell culture model and the λ Select cII assay have been used for mutagenicity testing of diverse carcinogens. We delineate the advantages of this approach and discuss its limitations, while underscoring auxiliary methods, where applicable. PMID:29337872

Comparative analysis of KRAS codon 12, 13, 18, 61, and 117 mutations using human MCF10A isogenic cell lines

PubMed Central

Stolze, Britta; Reinhart, Stefanie; Bulllinger, Lars; Fröhling, Stefan; Scholl, Claudia

2015-01-01

KRAS mutations occur in one third of human cancers and cluster in several hotspots, with codons 12 and 13 being most commonly affected. It has been suggested that the position and type of amino acid exchange influence the transforming capacity of mutant KRAS proteins. We used MCF10A human mammary epithelial cells to establish isogenic cell lines that express different cancer-associated KRAS mutations (G12C, G12D, G12V, G13C, G13D, A18D, Q61H, K117N) at physiological or elevated levels, and investigated the biochemical and functional consequences of the different variants. The overall effects of low-expressing mutants were moderate compared to overexpressed variants, but allowed delineation of biological functions that were related to specific alleles rather than KRAS expression level. None of the mutations induced morphological changes, migratory abilities, or increased phosphorylation of ERK, PDK1, and AKT. KRAS-G12D, G12V, G13D, and K117N mediated EGF-independent proliferation, whereas anchorage-independent growth was primarily induced by K117N and Q61H. Both codon 13 mutations were associated with increased EGFR expression. Finally, global gene expression analysis of MCF10A-G13D versus MCF10A-G12D revealed distinct transcriptional changes. Together, we describe a useful resource for investigating the function of multiple KRAS mutations and provide insights into the differential effects of these variants in MCF10A cells. PMID:25705018

Highly sensitive detection of mutations in CHO cell recombinant DNA using multi-parallel single molecule real-time DNA sequencing.

PubMed

Cartwright, Joseph F; Anderson, Karin; Longworth, Joseph; Lobb, Philip; James, David C

2018-06-01

High-fidelity replication of biologic-encoding recombinant DNA sequences by engineered mammalian cell cultures is an essential pre-requisite for the development of stable cell lines for the production of biotherapeutics. However, immortalized mammalian cells characteristically exhibit an increased point mutation frequency compared to mammalian cells in vivo, both across their genomes and at specific loci (hotspots). Thus unforeseen mutations in recombinant DNA sequences can arise and be maintained within producer cell populations. These may affect both the stability of recombinant gene expression and give rise to protein sequence variants with variable bioactivity and immunogenicity. Rigorous quantitative assessment of recombinant DNA integrity should therefore form part of the cell line development process and be an essential quality assurance metric for instances where synthetic/multi-component assemblies are utilized to engineer mammalian cells, such as the assessment of recombinant DNA fidelity or the mutability of single-site integration target loci. Based on Pacific Biosciences (Menlo Park, CA) single molecule real-time (SMRT™) circular consensus sequencing (CCS) technology we developed a rDNA sequence analysis tool to process the multi-parallel sequencing of ∼40,000 single recombinant DNA molecules. After statistical filtering of raw sequencing data, we show that this analytical method is capable of detecting single point mutations in rDNA to a minimum single mutation frequency of 0.0042% (<1/24,000 bases). Using a stable CHO transfectant pool harboring a randomly integrated 5 kB plasmid construct encoding GFP we found that 28% of recombinant plasmid copies contained at least one low frequency (<0.3%) point mutation. These mutations were predominantly found in GC base pairs (85%) and that there was no positional bias in mutation across the plasmid sequence. There was no discernable difference between the mutation frequencies of coding and non-coding DNA. The putative ratio of non-synonymous and synonymous changes within the open reading frames (ORFs) in the plasmid sequence indicates that natural selection does not impact upon the prevalence of these mutations. Here we have demonstrated the abundance of mutations that fall outside of the reported range of detection of next generation sequencing (NGS) and second generation sequencing (SGS) platforms, providing a methodology capable of being utilized in cell line development platforms to identify the fidelity of recombinant genes throughout the production process. © 2018 Wiley Periodicals, Inc.

Analysis of p53 gene mutations in human gliomas by polymerase chain reaction-based single-strand conformation polymorphism and DNA sequencing.

PubMed

Sarkar, F H; Kupsky, W J; Li, Y W; Sreepathi, P

1994-03-01

Mutations in the p53 gene have been recognized in brain tumors, and clonal expansion of p53 mutant cells has been shown to be associated with glioma progression. However, studies on the p53 gene have been limited by the need for frozen tissues. We have developed a method utilizing polymerase chain reaction (PCR) for the direct analysis of p53 mutation by single-strand conformation polymorphism (SSCP) and by direct DNA sequencing of the p53 gene using a single 10-microns paraffin-embedded tissue section. We applied this method to screen for p53 gene mutations in exons 5-8 in human gliomas utilizing paraffin-embedded tissues. Twenty paraffin blocks containing tumor were selected from surgical specimens from 17 different adult patients. Tumors included six anaplastic astrocytomas (AAs), nine glioblastomas (GBs), and two mixed malignant gliomas (MMGs). The tissue section on the stained glass slide was used to guide microdissection of an unstained adjacent tissue section to ensure > 90% of the tumor cell population for p53 mutational analysis. Simultaneously, microdissection of the tissue was also carried out to obtain normal tissue from adjacent areas as a control. Mutations in the p53 gene were identified in 3 of 17 (18%) patients by PCR-SSCP analysis and subsequently confirmed by PCR-based DNA sequencing. Mutations in exon 5 resulting in amino acid substitution were found in one thalamic AA (codon 158, CGC > CTT: Arg > Leu) and one cerebral hemispheric GB (codon 151, CCG > CTG: Pro > Leu).(ABSTRACT TRUNCATED AT 250 WORDS)

A reversion of an IL2RG mutation in combined immunodeficiency providing competitive advantage to the majority of CD8+ T cells

PubMed Central

Kuijpers, Taco W.; van Leeuwen, Ester M.M.; Barendregt, Barbara H.; Klarenbeek, Paul; aan de Kerk, Daan J.; Baars, Paul A.; Jansen, Machiel H.; de Vries, Niek; van Lier, René A.W.; van der Burg, Mirjam

2013-01-01

Mutations in the common gamma chain (γc, CD132, encoded by the IL2RG gene) can lead to B+T−NK− X-linked severe combined immunodeficiency, as a consequence of unresponsiveness to γc-cytokines such as interleukins-2, -7 and -15. Hypomorphic mutations in CD132 may cause combined immunodeficiencies with a variety of clinical presentations. We analyzed peripheral blood mononuclear cells of a 6-year-old boy with normal lymphocyte counts, who suffered from recurrent pneumonia and disseminated mollusca contagiosa. Since proliferative responses of T cells and NK cells to γc -cytokines were severely impaired, we performed IL2RG gene analysis, showing a heterozygous mutation in the presence of a single X-chromosome. Interestingly, an IL2RG reversion to normal predominated in both naïve and antigen-primed CD8+ T cells and increased over time. Only the revertant CD8+ T cells showed normal expression of CD132 and the various CD8+ T cell populations had a different T-cell receptor repertoire. Finally, a fraction of γδ+ T cells and differentiated CD4+CD27− effector-memory T cells carried the reversion, whereas NK or B cells were repeatedly negative. In conclusion, in a patient with a novel IL2RG mutation, gene-reverted CD8+ T cells accumulated over time. Our data indicate that selective outgrowth of particular T-cell subsets may occur following reversion at the level of committed T progenitor cells. PMID:23403317

A reversion of an IL2RG mutation in combined immunodeficiency providing competitive advantage to the majority of CD8+ T cells.

PubMed

Kuijpers, Taco W; van Leeuwen, Ester M M; Barendregt, Barbara H; Klarenbeek, Paul; aan de Kerk, Daan J; Baars, Paul A; Jansen, Machiel H; de Vries, Niek; van Lier, René A W; van der Burg, Mirjam

2013-07-01

Mutations in the common gamma chain (γc, CD132, encoded by the IL2RG gene) can lead to B(+)T(-)NK(-) X-linked severe combined immunodeficiency, as a consequence of unresponsiveness to γc-cytokines such as interleukins-2, -7 and -15. Hypomorphic mutations in CD132 may cause combined immunodeficiencies with a variety of clinical presentations. We analyzed peripheral blood mononuclear cells of a 6-year-old boy with normal lymphocyte counts, who suffered from recurrent pneumonia and disseminated mollusca contagiosa. Since proliferative responses of T cells and NK cells to γc -cytokines were severely impaired, we performed IL2RG gene analysis, showing a heterozygous mutation in the presence of a single X-chromosome. Interestingly, an IL2RG reversion to normal predominated in both naïve and antigen-primed CD8(+) T cells and increased over time. Only the revertant CD8(+) T cells showed normal expression of CD132 and the various CD8(+) T cell populations had a different T-cell receptor repertoire. Finally, a fraction of γδ(+) T cells and differentiated CD4(+)CD27(-) effector-memory T cells carried the reversion, whereas NK or B cells were repeatedly negative. In conclusion, in a patient with a novel IL2RG mutation, gene-reverted CD8(+) T cells accumulated over time. Our data indicate that selective outgrowth of particular T-cell subsets may occur following reversion at the level of committed T progenitor cells.

Transcriptional alterations in skin fibroblasts from Parkinson's disease patients with parkin mutations.

PubMed

González-Casacuberta, Ingrid; Morén, Constanza; Juárez-Flores, Diana-Luz; Esteve-Codina, Anna; Sierra, Cristina; Catalán-García, Marc; Guitart-Mampel, Mariona; Tobías, Ester; Milisenda, José César; Pont-Sunyer, Claustre; Martí, María José; Cardellach, Francesc; Tolosa, Eduard; Artuch, Rafael; Ezquerra, Mario; Fernández-Santiago, Rubén; Garrabou, Glòria

2018-05-01

Mutations in the parkin gene (PRKN) are the most common cause of autosomal-recessive juvenile Parkinson's disease (PD). PRKN encodes an E3 ubiquitin ligase that is involved in multiple regulatory functions including proteasomal-mediated protein turnover, mitochondrial function, mitophagy, and cell survival. However, the precise molecular events mediated by PRKN mutations in PRKN-associated PD (PRKN-PD) remain unknown. To elucidate the cellular impact of parkin mutations, we performed an RNA sequencing study in skin fibroblasts from PRKN-PD patients carrying different PRKN mutations (n = 4) and genetically unrelated healthy subjects (n = 4). We identified 343 differentially expressed genes in PRKN-PD fibroblasts. Gene ontology and canonical pathway analysis revealed enrichment of differentially expressed genes in processes such as cell adhesion, cell growth, and amino acid and folate metabolism among others. Our findings indicate that PRKN mutations are associated with large global gene expression changes as observed in fibroblasts from PRKN-PD patients and support the view of PD as a systemic disease affecting also non-neural peripheral tissues such as the skin. Copyright © 2018 Elsevier Inc. All rights reserved.

Deleterious Mutations in LRBA Are Associated with a Syndrome of Immune Deficiency and Autoimmunity

PubMed Central

Lopez-Herrera, Gabriela; Tampella, Giacomo; Pan-Hammarström, Qiang; Herholz, Peer; Trujillo-Vargas, Claudia M.; Phadwal, Kanchan; Simon, Anna Katharina; Moutschen, Michel; Etzioni, Amos; Mory, Adi; Srugo, Izhak; Melamed, Doron; Hultenby, Kjell; Liu, Chonghai; Baronio, Manuela; Vitali, Massimiliano; Philippet, Pierre; Dideberg, Vinciane; Aghamohammadi, Asghar; Rezaei, Nima; Enright, Victoria; Du, Likun; Salzer, Ulrich; Eibel, Hermann; Pfeifer, Dietmar; Veelken, Hendrik; Stauss, Hans; Lougaris, Vassilios; Plebani, Alessandro; Gertz, E. Michael; Schäffer, Alejandro A.; Hammarström, Lennart; Grimbacher, Bodo

2012-01-01

Most autosomal genetic causes of childhood-onset hypogammaglobulinemia are currently not well understood. Most affected individuals are simplex cases, but both autosomal-dominant and autosomal-recessive inheritance have been described. We performed genetic linkage analysis in consanguineous families affected by hypogammaglobulinemia. Four consanguineous families with childhood-onset humoral immune deficiency and features of autoimmunity shared genotype evidence for a linkage interval on chromosome 4q. Sequencing of positional candidate genes revealed that in each family, affected individuals had a distinct homozygous mutation in LRBA (lipopolysaccharide responsive beige-like anchor protein). All LRBA mutations segregated with the disease because homozygous individuals showed hypogammaglobulinemia and autoimmunity, whereas heterozygous individuals were healthy. These mutations were absent in healthy controls. Individuals with homozygous LRBA mutations had no LRBA, had disturbed B cell development, defective in vitro B cell activation, plasmablast formation, and immunoglobulin secretion, and had low proliferative responses. We conclude that mutations in LRBA cause an immune deficiency characterized by defects in B cell activation and autophagy and by susceptibility to apoptosis, all of which are associated with a clinical phenotype of hypogammaglobulinemia and autoimmunity. PMID:22608502

Integrated genomic sequencing reveals mutational landscape of T-cell prolymphocytic leukemia

PubMed Central

Kiel, Mark J.; Velusamy, Thirunavukkarasu; Rolland, Delphine; Sahasrabuddhe, Anagh A.; Chung, Fuzon; Bailey, Nathanael G.; Schrader, Alexandra; Li, Bo; Li, Jun Z.; Ozel, Ayse B.; Betz, Bryan L.; Miranda, Roberto N.; Medeiros, L. Jeffrey; Zhao, Lili; Herling, Marco

2014-01-01

The comprehensive genetic alterations underlying the pathogenesis of T-cell prolymphocytic leukemia (T-PLL) are unknown. To address this, we performed whole-genome sequencing (WGS), whole-exome sequencing (WES), high-resolution copy-number analysis, and Sanger resequencing of a large cohort of T-PLL. WGS and WES identified novel mutations in recurrently altered genes not previously implicated in T-PLL including EZH2, FBXW10, and CHEK2. Strikingly, WGS and/or WES showed largely mutually exclusive mutations affecting IL2RG, JAK1, JAK3, or STAT5B in 38 of 50 T-PLL genomes (76.0%). Notably, gain-of-function IL2RG mutations are novel and have not been reported in any form of cancer. Further, high-frequency mutations in STAT5B have not been previously reported in T-PLL. Functionally, IL2RG-JAK1-JAK3-STAT5B mutations led to signal transducer and activator of transcription 5 (STAT5) hyperactivation, transformed Ba/F3 cells resulting in cytokine-independent growth, and/or enhanced colony formation in Jurkat T cells. Importantly, primary T-PLL cells exhibited constitutive activation of STAT5, and targeted pharmacologic inhibition of STAT5 with pimozide induced apoptosis in primary T-PLL cells. These results for the first time provide a portrait of the mutational landscape of T-PLL and implicate deregulation of DNA repair and epigenetic modulators as well as high-frequency mutational activation of the IL2RG-JAK1-JAK3-STAT5B axis in the pathogenesis of T-PLL. These findings offer opportunities for novel targeted therapies in this aggressive leukemia. PMID:24825865

Integrated genomic sequencing reveals mutational landscape of T-cell prolymphocytic leukemia.

PubMed

Kiel, Mark J; Velusamy, Thirunavukkarasu; Rolland, Delphine; Sahasrabuddhe, Anagh A; Chung, Fuzon; Bailey, Nathanael G; Schrader, Alexandra; Li, Bo; Li, Jun Z; Ozel, Ayse B; Betz, Bryan L; Miranda, Roberto N; Medeiros, L Jeffrey; Zhao, Lili; Herling, Marco; Lim, Megan S; Elenitoba-Johnson, Kojo S J

2014-08-28

The comprehensive genetic alterations underlying the pathogenesis of T-cell prolymphocytic leukemia (T-PLL) are unknown. To address this, we performed whole-genome sequencing (WGS), whole-exome sequencing (WES), high-resolution copy-number analysis, and Sanger resequencing of a large cohort of T-PLL. WGS and WES identified novel mutations in recurrently altered genes not previously implicated in T-PLL including EZH2, FBXW10, and CHEK2. Strikingly, WGS and/or WES showed largely mutually exclusive mutations affecting IL2RG, JAK1, JAK3, or STAT5B in 38 of 50 T-PLL genomes (76.0%). Notably, gain-of-function IL2RG mutations are novel and have not been reported in any form of cancer. Further, high-frequency mutations in STAT5B have not been previously reported in T-PLL. Functionally, IL2RG-JAK1-JAK3-STAT5B mutations led to signal transducer and activator of transcription 5 (STAT5) hyperactivation, transformed Ba/F3 cells resulting in cytokine-independent growth, and/or enhanced colony formation in Jurkat T cells. Importantly, primary T-PLL cells exhibited constitutive activation of STAT5, and targeted pharmacologic inhibition of STAT5 with pimozide induced apoptosis in primary T-PLL cells. These results for the first time provide a portrait of the mutational landscape of T-PLL and implicate deregulation of DNA repair and epigenetic modulators as well as high-frequency mutational activation of the IL2RG-JAK1-JAK3-STAT5B axis in the pathogenesis of T-PLL. These findings offer opportunities for novel targeted therapies in this aggressive leukemia. © 2014 by The American Society of Hematology.

An application of LOH analysis for detecting the genetic influences of space environmental radiation

NASA Astrophysics Data System (ADS)

Yatagai, F.; Umebayashi, Y.; Honma, M.; Abe, T.; Suzuki, H.; Shimazu, T.; Ishioka, N.; Iwaki, M.

To detect the genetic influence of space environmental radiation at the chromosome level we proposed an application of loss of heterozygosity LOH analysis system for the mutations induced in human lymphoblastoid TK6 cells Surprisingly we succeeded the mutation detection in the frozen dells which were exposed to a low-dose 10 cGy of carbon-ion beam irradiation Mutation assays were performed within a few days or after about one month preservation at --80 r C following irradiation The results showed an increase in mutation frequency at the thymidine kinase TK gene locus 1 6-fold 2 5 X 10 -6 to 3 9 X 10 -6 and 2 1-fold 2 5 X 10 -6 to 5 3 X 10 -6 respectively Although the relative distributions of mutation classes were not changed by the radiation exposure in either assay an interesting characteristic was detected using this LOH analysis system two TK locus markers and eleven microsatellite loci spanning chromosome 17 The radiation-specific patterns of interstitial deletions were observed in the hemizygous LOH mutants which were considered as a result of end-joining repair of carbon ion-induced DNA double-strand breaks These results clearly demonstrate that this analysis can be used for the detection of low-dose ionizing radiation effects in the frozen cells In addition we performed so called adaptive response experiments in which TK6 cells were pre-irradiated with low-dose 2 5 sim 10 cGy of X-ray and then exposed to challenging dose 2Gy of X-rays Interestingly the

Comparative lesion sequencing provides insights into tumor evolution.

PubMed

Jones, Siân; Chen, Wei-Dong; Parmigiani, Giovanni; Diehl, Frank; Beerenwinkel, Niko; Antal, Tibor; Traulsen, Arne; Nowak, Martin A; Siegel, Christopher; Velculescu, Victor E; Kinzler, Kenneth W; Vogelstein, Bert; Willis, Joseph; Markowitz, Sanford D

2008-03-18

We show that the times separating the birth of benign, invasive, and metastatic tumor cells can be determined by analysis of the mutations they have in common. When combined with prior clinical observations, these analyses suggest the following general conclusions about colorectal tumorigenesis: (i) It takes approximately 17 years for a large benign tumor to evolve into an advanced cancer but <2 years for cells within that cancer to acquire the ability to metastasize; (ii) it requires few, if any, selective events to transform a highly invasive cancer cell into one with the capacity to metastasize; (iii) the process of cell culture ex vivo does not introduce new clonal mutations into colorectal tumor cell populations; and (iv) the rates at which point mutations develop in advanced cancers are similar to those of normal cells. These results have important implications for understanding human tumor pathogenesis, particularly those associated with metastasis.

PCR amplification and genetic analysis in a microwell cell culturing chip.

PubMed

Lindström, Sara; Hammond, Maria; Brismar, Hjalmar; Andersson-Svahn, Helene; Ahmadian, Afshin

2009-12-21

We have previously described a microwell chip designed for high throughput, long-term single-cell culturing and clonal analysis in individual wells providing a controlled way of studying high numbers of individual adherent or non-adherent cells. Here we present a method for the genetic analysis of cells cultured on-chip by PCR and minisequencing, demonstrated using two human adherent cell lines: one wild type and one with a single-base mutation in the p53 gene. Five wild type or mutated cells were seeded per well (in a defined set of wells, each holding 500 nL of culture medium) in a 672-microwell chip. The cell chip was incubated overnight, or cultured for up to five days, depending on the desired colony size, after which the cells were lysed and subjected to PCR directly in the wells. PCR products were detected, in the wells, using a biotinylated primer and a fluorescently labelled primer, allowing the products to be captured on streptavidin-coated magnetic beads and detected by a fluorescence microscope. In addition, to enable genetic analysis by minisequencing, the double-stranded PCR products were denatured and the immobilized strands were kept in the wells by applying a magnetic field from the bottom of the wells while the wells were washed, a minisequencing reaction mixture was added, and after incubation in appropriate conditions the expected genotypes were detected in the investigated microwells, simultaneously, by an array scanner. We anticipate that the technique could be used in mutation frequency screening, providing the ability to correlate cells' proliferative heterogeneity to their genetic heterogeneity, in hundreds of samples simultaneously. The presented method of single-cell culture and DNA amplification thus offers a potentially powerful alternative to single-cell PCR, with advantageous robustness and sensitivity.

Determination of EGFR and KRAS mutational status in Greek non-small-cell lung cancer patients

PubMed Central

PAPADOPOULOU, EIRINI; TSOULOS, NIKOLAOS; TSIRIGOTI, ANGELIKI; APESSOS, ANGELA; AGIANNITOPOULOS, KONSTANTINOS; METAXA-MARIATOU, VASILIKI; ZAROGOULIDIS, KONSTANTINOS; ZAROGOULIDIS, PAVLOS; KASARAKIS, DIMITRIOS; KAKOLYRIS, STYLIANOS; DAHABREH, JUBRAIL; VLASTOS, FOTIS; ZOUBLIOS, CHARALAMPOS; RAPTI, AGGELIKI; PAPAGEORGIOU, NIKI GEORGATOU; VELDEKIS, DIMITRIOS; GAGA, MINA; ARAVANTINOS, GERASIMOS; KARAVASILIS, VASILEIOS; KARAGIANNIDIS, NAPOLEON; NASIOULAS, GEORGE

2015-01-01

It has been reported that certain patients with non-small-cell lung cancer (NSCLC) that harbor activating somatic mutations within the tyrosine kinase domain of the epidermal growth factor receptor (EGFR) gene may be effectively treated using targeted therapy. The use of EGFR inhibitors in patient therapy has been demonstrated to improve response and survival rates; therefore, it was suggested that clinical screening for EGFR mutations should be performed for all patients. Numerous clinicopathological factors have been associated with EGFR and Kirsten-rat sarcoma oncogene homolog (KRAS) mutational status including gender, smoking history and histology. In addition, it was reported that EGFR mutation frequency in NSCLC patients was ethnicity-dependent, with an incidence rate of ~30% in Asian populations and ~15% in Caucasian populations. However, limited data has been reported on intra-ethnic differences throughout Europe. The present study aimed to investigate the frequency and spectrum of EGFR mutations in 1,472 Greek NSCLC patients. In addition, KRAS mutation analysis was performed in patients with known smoking history in order to determine the correlation of type and mutation frequency with smoking. High-resolution melting curve (HRM) analysis followed by Sanger sequencing was used to identify mutations in exons 18–21 of the EGFR gene and in exon 2 of the KRAS gene. A sensitive next-generation sequencing (NGS) technology was also employed to classify samples with equivocal results. The use of sensitive mutation detection techniques in a large study population of Greek NSCLC patients in routine diagnostic practice revealed an overall EGFR mutation frequency of 15.83%. This mutation frequency was comparable to that previously reported in other European populations. Of note, there was a 99.8% concordance between the HRM method and Sanger sequencing. NGS was found to be the most sensitive method. In addition, female non-smokers demonstrated a high prevalence of EGFR mutations. Furthermore, KRAS mutation analysis in patients with a known smoking history revealed no difference in mutation frequency according to smoking status; however, a different mutation spectrum was observed. PMID:26622815

Change in IgHV Mutational Status of CLL Suggests Origin From Multiple Clones.

PubMed

Osman, Afaf; Gocke, Christopher D; Gladstone, Douglas E

2017-02-01

Fluorescence in situ hybridization and immunoglobulin (Ig) heavy-chain variable-region (IgHV) mutational status are used to predict outcome in chronic lymphocytic leukemia (CLL). Although DNA aberrations change over time, IgHV sequences and mutational status are considered stable. In a retrospective review, 409 CLL patients, between 2008 and 2015, had IgHV analysis: 56 patients had multiple analyses performed. Seven patients' IgHV results changed: 2 from unmutated to mutated and 5 from mutated to unmutated IgHV sequence. Three concurrently changed their variable heavy-chain sequence. Secondary to allelic exclusion, 2 of the new variable heavy chains produced were biologically nonplausible. The existence of these new nonplausible heavy-chain variable regions suggests either the CLL cancer stem-cell maintains the ability to rearrange a previously silenced IgH allele or more likely that the cancer stem-cell produced at least 2 subclones, suggesting that the CLL cancer stem cell exists before the process of allelic exclusion occurs. Copyright © 2016 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Toki, Hideaki; Minowa, Osamu; Inoue, Maki

Dominant mutations in the Serca2 gene, which encodes sarco(endo)plasmic reticulum calcium-ATPase, predispose mice to gastrointestinal epithelial carcinoma [1–4] and humans to Darier disease (DD) [14–17]. In this study, we generated mice harboring N-ethyl-N-nitrosourea (ENU)-induced allelic mutations in Serca2: three missense mutations and one nonsense mutation. Mice harboring these Serca2 mutations developed tumors that were categorized as either early onset squamous cell tumors (SCT), with development similar to null-type knockout mice [2,4] (aggressive form; M682, M814), or late onset tumors (mild form; M1049, M1162). Molecular analysis showed no aberration in Serca2 mRNA or protein expression levels in normal esophageal cells ofmore » any of the four mutant heterozygotes. There was no loss of heterozygosity at the Serca2 locus in the squamous cell carcinomas in any of the four lines. The effect of each mutation on Ca{sup 2+}-ATPase activity was predicted using atomic-structure models and accumulated mutated protein studies, suggesting that putative complete loss of Serca2 enzymatic activity may lead to early tumor onset, whereas mutations in which Serca2 retains residual enzymatic activity result in late onset. We propose that impaired Serca2 gene product activity has a long-term effect on squamous cell carcinogenesis from onset to the final carcinoma stage through an as-yet unrecognized but common regulatory pathway. -- Highlights: •Novel mutations in murine Serca2 caused early onset or late onset of tumorigenesis. •They also caused higher or lower incidence of Darier Disease phenotype. •3D structure model suggested the former mutations led to severer defect on ATPase. •Driver gene mutations via long-range effect on Ca2+ distributions are suggested.« less

Single-cell transcriptomics uncovers distinct molecular signatures of stem cells in chronic myeloid leukemia.

PubMed

Giustacchini, Alice; Thongjuea, Supat; Barkas, Nikolaos; Woll, Petter S; Povinelli, Benjamin J; Booth, Christopher A G; Sopp, Paul; Norfo, Ruggiero; Rodriguez-Meira, Alba; Ashley, Neil; Jamieson, Lauren; Vyas, Paresh; Anderson, Kristina; Segerstolpe, Åsa; Qian, Hong; Olsson-Strömberg, Ulla; Mustjoki, Satu; Sandberg, Rickard; Jacobsen, Sten Eirik W; Mead, Adam J

2017-06-01

Recent advances in single-cell transcriptomics are ideally placed to unravel intratumoral heterogeneity and selective resistance of cancer stem cell (SC) subpopulations to molecularly targeted cancer therapies. However, current single-cell RNA-sequencing approaches lack the sensitivity required to reliably detect somatic mutations. We developed a method that combines high-sensitivity mutation detection with whole-transcriptome analysis of the same single cell. We applied this technique to analyze more than 2,000 SCs from patients with chronic myeloid leukemia (CML) throughout the disease course, revealing heterogeneity of CML-SCs, including the identification of a subgroup of CML-SCs with a distinct molecular signature that selectively persisted during prolonged therapy. Analysis of nonleukemic SCs from patients with CML also provided new insights into cell-extrinsic disruption of hematopoiesis in CML associated with clinical outcome. Furthermore, we used this single-cell approach to identify a blast-crisis-specific SC population, which was also present in a subclone of CML-SCs during the chronic phase in a patient who subsequently developed blast crisis. This approach, which might be broadly applied to any malignancy, illustrates how single-cell analysis can identify subpopulations of therapy-resistant SCs that are not apparent through cell-population analysis.

Genetic analysis of microglandular adenosis and acinic cell carcinomas of the breast provides evidence for the existence of a low-grade triple-negative breast neoplasia family.

PubMed

Geyer, Felipe C; Berman, Samuel H; Marchiò, Caterina; Burke, Kathleen A; Guerini-Rocco, Elena; Piscuoglio, Salvatore; Ng, Charlotte Ky; Pareja, Fresia; Wen, Hannah Y; Hodi, Zoltan; Schnitt, Stuart J; Rakha, Emad A; Ellis, Ian O; Norton, Larry; Weigelt, Britta; Reis-Filho, Jorge S

2017-01-01

Acinic cell carcinoma is an indolent form of invasive breast cancer, whereas microglandular adenosis has been shown to be a neoplastic proliferation. Both entities display a triple-negative phenotype, and may give rise to and display somatic genomic alterations typical of high-grade triple-negative breast cancers. Here we report on a comparison of previously published data on eight carcinoma-associated microglandular adenosis and eight acinic cell carcinomas subjected to targeted massively parallel sequencing targeting all exons of 236 genes recurrently mutated in breast cancer and/or DNA repair-related. Somatic mutations, insertions/ deletions, and copy number alterations were detected using state-of-the-art bioinformatic algorithms. All cases were of triple-negative phenotype. A median of 4.5 (1-13) and 4.0 (1-7) non-synonymous somatic mutations per carcinoma-associated microglandular adenosis and acinic cell carcinoma were identified, respectively. TP53 was the sole highly recurrently mutated gene (75% in microglandular adenosis versus 88% in acinic cell carcinomas), and TP53 mutations were consistently coupled with loss of heterozygosity of the wild-type allele. Additional somatic mutations shared by both groups included those in BRCA1, PIK3CA, and INPP4B. Recurrent (n=2) somatic mutations restricted to microglandular adenosis or acinic cell carcinomas included those affecting PTEN and MED12 or ERBB4, respectively. No significant differences in the repertoire of somatic mutations were detected between microglandular adenosis and acinic cell carcinomas, and between this group of lesions and 77 triple-negative carcinomas from The Cancer Genome Atlas. Microglandular adenosis and acinic cell carcinomas, however, were genetically distinct from estrogen receptor-positive and/or HER2-positive breast cancers from The Cancer Genome Atlas. Our findings support the contention that microglandular adenosis and acinic cell carcinoma are part of the same spectrum of lesions harboring frequent TP53 somatic mutations, and likely represent low-grade forms of triple-negative disease with no/minimal metastatic potential, of which a subset has the potential to progress to high-grade triple-negative breast cancer.

Genetic Analysis of Microglandular Adenosis and Acinic Cell Carcinomas of the Breast Provides Evidence for the Existence of a Low-grade Triple-Negative Breast Neoplasia Family

PubMed Central

Geyer, Felipe C; Berman, Samuel H.; Marchiò, Caterina; Burke, Kathleen A; Guerini-Rocco, Elena; Piscuoglio, Salvatore; Ng, Charlotte K Y; Pareja, Fresia; Wen, Hannah Y; Hodi, Zoltan; Schnitt, Stuart J; Rakha, Emad A; Ellis, Ian O; Norton, Larry; Weigelt, Britta; Reis-Filho, Jorge S

2016-01-01

Acinic cell carcinoma is an indolent form of invasive breast cancer, whereas microglandular adenosis has been shown to be a neoplastic proliferation. Both entities display a triple-negative phenotype, and may give rise to and display somatic genomic alterations typical of high-grade triple-negative breast cancers. Here we report on a comparison of previously published data on eight carcinoma-associated microglandular adenosis and eight acinic cell carcinomas subjected to targeted massively parallel sequencing targeting all exons of 236 genes recurrently mutated in breast cancer and/or DNA repair-related. Somatic mutations, insertions/deletions and copy number alterations were detected using state-of-the-art bioinformatic algorithms. All cases were of triple-negative phenotype. A median of 4.5 (1–13) and 4.0 (1–7) non-synonymous somatic mutations per carcinoma-associated microglandular adenosis and acinic cell carcinoma were identified, respectively. TP53 was the sole highly recurrently mutated gene (75% in microglandular adenosis versus 88% in acinic cell carcinomas), and TP53 mutations were consistently coupled with loss of heterozygosity of the wild-type allele. Additional somatic mutations shared by both groups included those in BRCA1, PIK3CA and INPP4B. Recurrent (n=2) somatic mutations restricted to microglandular adenosis or acinic cell carcinomas included those affecting PTEN and MED12, or ERBB4, respectively. No significant differences in the repertoire of somatic mutations were detected between microglandular adenosis and acinic cell carcinomas, and between this group of lesions and 77 triple-negative carcinomas from The Cancer Genome Atlas. Microglandular adenosis and acinic cell carcinomas, however, were genetically distinct from estrogen receptor-positive and/or HER2-positive breast cancers from The Cancer Genome Atlas. Our findings support the contention that microglandular adenosis and acinic cell carcinoma are part of the same spectrum of lesions harboring frequent TP53 somatic mutations, and likely represent low-grade forms of triple-negative disease with no/minimal metastatic potential, of which a subset has the potential to progress to high-grade triple-negative breast cancer. PMID:27713419

Treatment with a Small Molecule Mutant IDH1 Inhibitor Suppresses Tumorigenic Activity and Decreases Production of the Oncometabolite 2-Hydroxyglutarate in Human Chondrosarcoma Cells

PubMed Central

Li, Luyuan; Paz, Ana C.; Wilky, Breelyn A.; Johnson, Britt; Galoian, Karina; Rosenberg, Andrew; Hu, Guozhi; Tinoco, Gabriel; Bodamer, Olaf; Trent, Jonathan C.

2015-01-01

Chondrosarcomas are malignant bone tumors that produce cartilaginous matrix. Mutations in isocitrate dehydrogenase enzymes (IDH1/2) were recently described in several cancers including chondrosarcomas. The IDH1 inhibitor AGI-5198 abrogates the ability of mutant IDH1 to produce the oncometabolite D-2 hydroxyglutarate (D-2HG) in gliomas. We sought to determine if treatment with AGI-5198 would similarly inhibit tumorigenic activity and D-2HG production in IDH1-mutant human chondrosarcoma cells. Two human chondrosarcoma cell lines, JJ012 and HT1080 with endogenous IDH1 mutations and a human chondrocyte cell line C28 with wild type IDH1 were employed in our study. Mutation analysis of IDH was performed by PCR-based DNA sequencing, and D-2HG was detected using tandem mass spectrometry. We confirmed that JJ012 and HT1080 harbor IDH1 R132G and R132C mutation, respectively, while C28 has no mutation. D-2HG was detectable in cell pellets and media of JJ012 and HT1080 cells, as well as plasma and urine from an IDH-mutant chondrosarcoma patient, which decreased after tumor resection. AGI-5198 treatment decreased D-2HG levels in JJ012 and HT1080 cells in a dose-dependent manner, and dramatically inhibited colony formation and migration, interrupted cell cycling, and induced apoptosis. In conclusion, our study demonstrates anti-tumor activity of a mutant IDH1 inhibitor in human chondrosarcoma cell lines, and suggests that D-2HG is a potential biomarker for IDH mutations in chondrosarcoma cells. Thus, clinical trials of mutant IDH inhibitors are warranted for patients with IDH-mutant chondrosarcomas. PMID:26368816

Truncation- and motif-based pan-cancer analysis reveals tumor-suppressing kinases.

PubMed

Hudson, Andrew M; Stephenson, Natalie L; Li, Cynthia; Trotter, Eleanor; Fletcher, Adam J; Katona, Gitta; Bieniasz-Krzywiec, Patrycja; Howell, Matthew; Wirth, Chris; Furney, Simon; Miller, Crispin J; Brognard, John

2018-04-17

A major challenge in cancer genomics is identifying "driver" mutations from the many neutral "passenger" mutations within a given tumor. To identify driver mutations that would otherwise be lost within mutational noise, we filtered genomic data by motifs that are critical for kinase activity. In the first step of our screen, we used data from the Cancer Cell Line Encyclopedia and The Cancer Genome Atlas to identify kinases with truncation mutations occurring within or before the kinase domain. The top 30 tumor-suppressing kinases were aligned, and hotspots for loss-of-function (LOF) mutations were identified on the basis of amino acid conservation and mutational frequency. The functional consequences of new LOF mutations were biochemically validated, and the top 15 hotspot LOF residues were used in a pan-cancer analysis to define the tumor-suppressing kinome. A ranked list revealed MAP2K7, an essential mediator of the c-Jun N-terminal kinase (JNK) pathway, as a candidate tumor suppressor in gastric cancer, despite its mutational frequency falling within the mutational noise for this cancer type. The majority of mutations in MAP2K7 abolished its catalytic activity, and reactivation of the JNK pathway in gastric cancer cells harboring LOF mutations in MAP2K7 or the downstream kinase JNK suppressed clonogenicity and growth in soft agar, demonstrating the functional relevance of inactivating the JNK pathway in gastric cancer. Together, our data highlight a broadly applicable strategy to identify functional cancer driver mutations and define the JNK pathway as tumor-suppressive in gastric cancer. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Clock-like mutational processes in human somatic cells

DOE PAGES

Alexandrov, Ludmil B.; Jones, Philip H.; Wedge, David C.; ...

2015-11-09

During the course of a lifetime, somatic cells acquire mutations. Different mutational processes may contribute to the mutations accumulated in a cell, with each imprinting a mutational signature on the cell's genome. Some processes generate mutations throughout life at a constant rate in all individuals, and the number of mutations in a cell attributable to these processes will be proportional to the chronological age of the person. Using mutations from 10,250 cancer genomes across 36 cancer types, we investigated clock-like mutational processes that have been operating in normal human cells. Two mutational signatures show clock-like properties. Both exhibit different mutationmore » rates in different tissues. However, their mutation rates are not correlated, indicating that the underlying processes are subject to different biological influences. For one signature, the rate of cell division may influence its mutation rate. This paper provides the first survey of clock-like mutational processes operating in human somatic cells.« less

A CACNA1D mutation in a patient with persistent hyperinsulinaemic hypoglycaemia, heart defects, and severe hypotonia.

PubMed

Flanagan, S E; Vairo, F; Johnson, M B; Caswell, R; Laver, T W; Lango Allen, H; Hussain, K; Ellard, S

2017-06-01

Congenital hyperinsulinaemic hypoglycaemia (HH) can occur in isolation or it may present as part of a wider syndrome. For approximately 40%-50% of individuals with this condition, sequence analysis of the known HH genes identifies a causative mutation. Identifying the underlying genetic aetiology in the remaining cases is important as a genetic diagnosis will inform on recurrence risk, may guide medical management and will provide valuable insights into β-cell physiology. We sequenced the exome of a child with persistent diazoxide-responsive HH, mild aortic insufficiency, severe hypotonia, and developmental delay as well as the unaffected parents. This analysis identified a de novo mutation, p.G403D, in the proband's CACNA1D gene. CACNA1D encodes the main L-type voltage-gated calcium channel in the pancreatic β-cell, a key component of the insulin secretion pathway. The p.G403D mutation had been reported previously as an activating mutation in an individual with primary hyper-aldosteronism, neuromuscular abnormalities, and transient hypoglycaemia. Sequence analysis of the CACNA1D gene in 60 further cases with HH did not identify a pathogenic mutation. Identification of an activating CACNA1D mutation in a second patient with congenital HH confirms the aetiological role of CACNA1D mutations in this disorder. A genetic diagnosis is important as treatment with a calcium channel blocker may be an option for the medical management of this patient. © 2017 The Authors. Pediatric Diabetes published by John Wiley & Sons Ltd.

A novel mutation of α-galactosidase A gene causes Fabry disease mimicking primary erythromelalgia in a Chinese family.

PubMed

Ge, Wei; Wei, Bin; Zhu, Hao; Miao, Zhigang; Zhang, Weimin; Leng, Cuihua; Li, Jizhen; Zhang, Dan; Sun, Miao; Xu, Xingshun

2017-05-01

Fabry disease is an X-linked genetic disorder caused by the mutations of α-galactosidase A (GLA, MIM 300644) gene presenting with various clinical symptoms including small-fiber peripheral neuropathy and limb burning pain. Here, we reported a Chinese pedigree with the initial diagnosis of primary erythromelalgia in an autosomal dominant (AD)-inherited pattern. Mutation analysis of SCN9A and GLA genes by direct sequencing and functional analysis of a novel mutation of GLA in cells were performed. Our data did not show any pathological mutations in SCN9A gene; however, a novel missense mutation c.139T>C (p.W47R) of GLA was identified in a male proband as well as two female carriers in this family. Enzyme assay of α-galactosidase A activity showed deficient enzyme activity in male patients and female carriers, further confirming the diagnosis of Fabry disease. Finally, a functional analysis indicated that the replacement of the 47th amino acid tryptophan (W47) with arginine (W47R) or glycine (W47G) led to reduced activity of α-galactosidase A in 293T cells. Therefore, these findings demonstrated that the novel mutation p.W47R of GLA is the cause of Fabry disease. Because Fabry disease and primary erythromelalgia share similar symptoms, it is a good strategy for clinical physicians to perform genetic mutation screenings on both SCN9A and GLA genes in those patients with limb burning pain but without a clear inheritant pattern.

Using the MCF10A/MCF10CA1a Breast Cancer Progression Cell Line Model to Investigate the Effect of Active, Mutant Forms of EGFR in Breast Cancer Development and Treatment Using Gefitinib

PubMed Central

Bessette, Darrell C.; Tilch, Erik; Seidens, Tatjana; Quinn, Michael C. J.; Wiegmans, Adrian P.; Shi, Wei; Cocciardi, Sibylle; McCart-Reed, Amy; Saunus, Jodi M.; Simpson, Peter T.; Grimmond, Sean M.; Lakhani, Sunil R.; Khanna, Kum Kum; Waddell, Nic; Al-Ejeh, Fares; Chenevix-Trench, Georgia

2015-01-01

Background Basal-like and triple negative breast cancer (TNBC) share common molecular features, poor prognosis and a propensity for metastasis to the brain. Amplification of epidermal growth factor receptor (EGFR) occurs in ~50% of basal-like breast cancer, and mutations in the epidermal growth factor receptor (EGFR) have been reported in up to ~ 10% of Asian TNBC patients. In non-small cell lung cancer several different mutations in the EGFR tyrosine kinase domain confer sensitivity to receptor tyrosine kinase inhibitors, but the tumourigenic potential of EGFR mutations in breast cells and their potential for targeted therapy is unknown. Materials and Methods Constructs containing wild type, G719S or E746-A750 deletion mutant forms of EGFR were transfected into the MCF10A breast cells and their tumorigenic derivative, MCF10CA1a. The effects of EGFR over-expression and mutation on proliferation, migration, invasion, response to gefitinib, and tumour formation in vivo was investigated. Copy number analysis and whole exome sequencing of the MCF10A and MCF10CA1a cell lines were also performed. Results Mutant EGFR increased MCF10A and MCF10CA1a proliferation and MCF10A gefitinib sensitivity. The EGFR-E746-A750 deletion increased MCF10CA1a cell migration and invasion, and greatly increased MCF10CA1a xenograft tumour formation and growth. Compared to MCF10A cells, MCF10CA1a cells exhibited large regions of gain on chromosomes 3 and 9, deletion on chromosome 7, and mutations in many genes implicated in cancer. Conclusions Mutant EGFR enhances the oncogenic properties of MCF10A cell line, and increases sensitivity to gefitinib. Although the addition of EGFR E746-A750 renders the MCF10CA1a cells more tumourigenic in vivo it is not accompanied by increased gefitinib sensitivity, perhaps due to additional mutations, including the PIK3CA H1047R mutation, that the MCF10CA1a cell line has acquired. Screening TNBC/basal-like breast cancer for EGFR mutations may prove useful for directing therapy but, as in non-small cell lung cancer, accompanying mutations in PIK3CA may confer gefitinib resistance. PMID:25969993

Kolmogorov-Smirnov statistical test for analysis of ZAP-70 expression in B-CLL, compared with quantitative PCR and IgV(H) mutation status.

PubMed

Van Bockstaele, Femke; Janssens, Ann; Piette, Anne; Callewaert, Filip; Pede, Valerie; Offner, Fritz; Verhasselt, Bruno; Philippé, Jan

2006-07-15

ZAP-70 has been proposed as a surrogate marker for immunoglobulin heavy-chain variable region (IgV(H)) mutation status, which is known as a prognostic marker in B-cell chronic lymphocytic leukemia (CLL). The flow cytometric analysis of ZAP-70 suffers from difficulties in standardization and interpretation. We applied the Kolmogorov-Smirnov (KS) statistical test to make analysis more straightforward. We examined ZAP-70 expression by flow cytometry in 53 patients with CLL. Analysis was performed as initially described by Crespo et al. (New England J Med 2003; 348:1764-1775) and alternatively by application of the KS statistical test comparing T cells with B cells. Receiver-operating-characteristics (ROC)-curve analyses were performed to determine the optimal cut-off values for ZAP-70 measured by the two approaches. ZAP-70 protein expression was compared with ZAP-70 mRNA expression measured by a quantitative PCR (qPCR) and with the IgV(H) mutation status. Both flow cytometric analyses correlated well with the molecular technique and proved to be of equal value in predicting the IgV(H) mutation status. Applying the KS test is reproducible, simple, straightforward, and overcomes a number of difficulties encountered in the Crespo-method. The KS statistical test is an essential part of the software delivered with modern routine analytical flow cytometers and is well suited for analysis of ZAP-70 expression in CLL. (c) 2006 International Society for Analytical Cytology.

Analysis of transcription factors key for mouse pancreatic development establishes NKX2-2 and MNX1 mutations as causes of neonatal diabetes in man.

PubMed

Flanagan, Sarah E; De Franco, Elisa; Lango Allen, Hana; Zerah, Michele; Abdul-Rasoul, Majedah M; Edge, Julie A; Stewart, Helen; Alamiri, Elham; Hussain, Khalid; Wallis, Sam; de Vries, Liat; Rubio-Cabezas, Oscar; Houghton, Jayne A L; Edghill, Emma L; Patch, Ann-Marie; Ellard, Sian; Hattersley, Andrew T

2014-01-07

Understanding transcriptional regulation of pancreatic development is required to advance current efforts in developing beta cell replacement therapies for patients with diabetes. Current knowledge of key transcriptional regulators has predominantly come from mouse studies, with rare, naturally occurring mutations establishing their relevance in man. This study used a combination of homozygosity analysis and Sanger sequencing in 37 consanguineous patients with permanent neonatal diabetes to search for homozygous mutations in 29 transcription factor genes important for murine pancreatic development. We identified homozygous mutations in 7 different genes in 11 unrelated patients and show that NKX2-2 and MNX1 are etiological genes for neonatal diabetes, thus confirming their key role in development of the human pancreas. The similar phenotype of the patients with recessive mutations and mice with inactivation of a transcription factor gene support there being common steps critical for pancreatic development and validate the use of rodent models for beta cell development. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Clock-like mutational processes in human somatic cells

PubMed Central

Alexandrov, Ludmil B.; Jones, Philip H.; Wedge, David C.; Sale, Julian E.; Campbell, Peter J.; Nik-Zainal, Serena; Stratton, Michael R.

2016-01-01

During the course of a lifetime somatic cells acquire mutations. Different mutational processes may contribute to the mutations accumulated in a cell, with each imprinting a mutational signature on the cell’s genome. Some processes generate mutations throughout life at a constant rate in all individuals and the number of mutations in a cell attributable to these processes will be proportional to the chronological age of the person. Using mutations from 10,250 cancer genomes across 36 cancer types, we investigated clock-like mutational processes that have been operating in normal human cells. Two mutational signatures show clock-like properties. Both exhibit different mutation rates in different tissues. However, their mutation rates are not correlated indicating that the underlying processes are subject to different biological influences. For one signature, the rate of cell division may influence its mutation rate. This study provides the first survey of clock-like mutational processes operative in human somatic cells. PMID:26551669

Diversity of glycosphingolipid GM2 and cholesterol accumulation in NPC1 patient-specific iPSC-derived neurons.

PubMed

Trilck, Michaela; Peter, Franziska; Zheng, Chaonan; Frank, Marcus; Dobrenis, Kostantin; Mascher, Hermann; Rolfs, Arndt; Frech, Moritz J

2017-02-15

Niemann-Pick disease Type C1 (NPC1) is a rare progressive neurodegenerative disorder caused by mutations in the NPC1 gene. On the cellular level NPC1 mutations lead to an accumulation of cholesterol and gangliosides. As a thorough analysis of the severely affected neuronal cells is unfeasible in NPC1 patients, we recently described the cellular phenotype of neuronal cells derived from NPC1 patient iPSCs carrying the compound heterozygous mutation c.1836A>C/c.1628delC. Here we expanded the analysis to cell lines carrying the prevalent mutation c.3182T>C and the novel mutation c.1180T>C, as well as to the determination of GM2 and GM3 gangliosides in NPC1 patient-specific iPSC-derived neurons and glia cells. Immunocytochemical detection of GM2 revealed punctated staining pattern predominantly localized in neurons. Detection of cholesterol by filipin staining showed a comparable staining pattern, colocalized with GM2, indicating a deposit of GM2 and cholesterol in the same cellular compartments. Accumulations were not only restricted to cell bodies, but were also found in the neuronal extensions. A quantification of the GM2 amount by HPLC-MS/MS confirmed significantly higher amounts in neurons carrying a mutation. Additionally, these cells displayed a lowered activity of the catabolic enzyme Hex A, but not B4GALNT1. Molecular docking simulations indicated binding of cholesterol to Hex A, suggesting cholesterol influences the GM2 degradation pathway and, subsequently, leading to the accumulation of GM2. Taken together, this is the first study showing an accumulation of GM2 in neuronal derivatives of patient-specific iPSCs and thus proving further disease-specific hallmarks in this human in vitro model of NPC1. Copyright © 2016 Elsevier B.V. All rights reserved.

Factor V Leiden G1691A and prothrombin G20210A mutations among Palestinian patients with sickle cell disease.

PubMed

Samarah, Fekri; Srour, Mahmoud A

2018-01-01

Vascular thrombosis is an important pathophysiological aspect of sickle cell disease (SCD). This study aimed to investigate the prevalence and clinical impact of factor V Leiden G1691A (FVL) and prothrombin G20210A mutations among Palestinian sickle cell disease (SCD) patients. A total of 117 SCD patients, including 59 patients with sickle cell anemia (SS), 33 patients with sickle β-thalassemia and 25 individuals with sickle cell trait (AS) were studied. The control group consisted of 118 healthy individuals. FVL and prothrombin G20210A mutations were determined by RFLP PCR. Analysis of the clinical history of SCD patients revealed that seven patients have had vascular complications such as ischemic stroke or deep vein thrombosis. In SCD patients, the inheritance of the FVL mutation showed a significantly higher incidence of pain in joints, chest and abdomen as well as regular dependence on blood transfusion compared to SCD with the wild type. Age- and sex-adjusted logistic regression analysis revealed a significant association between FVL and sickle cell anemia with an odds ratio (OR) of 5.6 (95% confidence intervals [CI] of 1.91-39.4, P  = 0.039) in SS patients. However, increased prevalence of the FVL in AS subjects and sickle β-thalassemia patients was not statistically significant compared to controls (OR 3.97, 95% CI 0.51-28.6, P  = 0.17 and OR 3.59, 95% CI 0.35-41.6, P  = 0.26, respectively). The distribution of prothrombin G20210A mutation among SCD patients compared to controls was not significantly different, thus our findings do not support an association of this mutation with SCD. FVL was more prevalent among SS patients compared to controls and it was associated with higher incidence of disease complications among SCD patients.

ITGB6 loss-of-function mutations cause autosomal recessive amelogenesis imperfecta.

PubMed

Wang, Shih-Kai; Choi, Murim; Richardson, Amelia S; Reid, Bryan M; Lin, Brent P; Wang, Susan J; Kim, Jung-Wook; Simmer, James P; Hu, Jan C-C

2014-04-15

Integrins are cell-surface adhesion receptors that bind to extracellular matrices (ECM) and mediate cell-ECM interactions. Some integrins are known to play critical roles in dental enamel formation. We recruited two Hispanic families with generalized hypoplastic amelogenesis imperfecta (AI). Analysis of whole-exome sequences identified three integrin beta 6 (ITGB6) mutations responsible for their enamel malformations. The female proband of Family 1 was a compound heterozygote with an ITGB6 transition mutation in Exon 4 (g.4545G > A c.427G > A p.Ala143Thr) and an ITGB6 transversion mutation in Exon 6 (g.27415T > A c.825T > A p.His275Gln). The male proband of Family 2 was homozygous for an ITGB6 transition mutation in Exon 11 (g.73664C > T c.1846C > T p.Arg616*) and hemizygous for a transition mutation in Exon 6 of Nance-Horan Syndrome (NHS Xp22.13; g.355444T > C c.1697T > C p.Met566Thr). These are the first disease-causing ITGB6 mutations to be reported. Immunohistochemistry of mouse mandibular incisors localized ITGB6 to the distal membrane of differentiating ameloblasts and pre-ameloblasts, and then ITGB6 appeared to be internalized by secretory stage ameloblasts. ITGB6 expression was strongest in the maturation stage and its localization was associated with ameloblast modulation. Our findings demonstrate that early and late amelogenesis depend upon cell-matrix interactions. Our approach (from knockout mouse phenotype to human disease) demonstrates the power of mouse reverse genetics in mutational analysis of human genetic disorders and attests to the need for a careful dental phenotyping in large-scale knockout mouse projects.

[The absence of cyclin-dependent protein kinase Pho85 affects stability of mitochondrial DNA in yeast Saccharomyces cerevisiae].

PubMed

Fizikova, A Iu; Padkina, M V; Sambuk, E V

2009-06-01

The cyclin-dependent protein kinase Pho85 is involved in the regulation of phosphate metabolism in yeast Saccharomyces cerevisiae. Mutations in the PH085 gene lead to constitutive synthesis of Pho5 acidic phosphatase, a delay in cell growth on media containing nonfermentable carbon sources, and other pleiotropic effects. In this work, it was shown that the accumulation of respiratory incompetent cells occurs with high frequency in strains carrying pho85 mutations as early as during the first cell divisions, and the number of these cells at the early logarithmic growth phase of the culture promptly reaches virtually 100%. Cytological analysis revealed a high accumulation rate of [rho(0)] cells the background of gene pho85 that may be related to disturbances in the distribution of mitochondrial nucleoids rather than to changes in morphology of mitochondria and a delay in their transport into the bud. Genetic analysis revealed that the appearing secondary mutations pho4, pho81, pho84, and pho87 stabilize nucleoids and hamper the loss of mitochondrial DNA caused by pho85. These results provide evidence for the influence of intracellular phosphate concentration on the inheritance of mitochondrial nucleoids, but it is fully probable that the occurrence of mutation pho4 in the background of gene pho85 may change the expression level of other genes required for the stabilization of mitochondrial functions.

Maternally-inherited Leigh syndrome-related mutations bolster mitochondrial-mediated apoptosis.

PubMed

Carrozzo, Rosalba; Rizza, Teresa; Stringaro, Annarita; Pierini, Roberta; Mormone, Elisabetta; Santorelli, Filippo M; Malorni, Walter; Matarrese, Paola

2004-07-01

The key role of mitochondria in the apoptotic process is well understood, but not many data are available regarding the specific role of mitochondrial DNA mutations in determining cell fate. We investigated whether two mitochondrial DNA mutations (L217R and L156R) associated with maternally-inherited Leigh syndrome may play a specific role in triggering the apoptotic cascade. Considering that different nuclear genetic factors may influence the expression of mtDNA mutations, we used a 143BTK(-) osteosarcoma cell line deprived from its own mtDNA in order to insert mutated mtDNAs. Analysis of mitochondrial features in these cybrids indicated that both mitochondrial DNA mutations produced evidence of biochemical, functional and ultrastructural modifications of mitochondria, and that these modifications were associated with an increased apoptotic proneness. Cybrids were highly susceptible to two different apoptotic stimuli, tumour necrosis factor-alpha and Staurosporin. The mechanism involved was the mitochondrial 'intrinsic' pathway, i.e. the caspase 9-driven cascade. More importantly, our results also indicated that the polarization state of the mitochondrial membrane, i.e. a constitutive hyperpolarization detected in cybrid clones, played a specific role. Interestingly, the different effects of the two mutations in terms of susceptibility to apoptosis probably reflect the deeper bioenergetic defect associated with the L217R mutation. This work provides the first evidence that hyperpolarization of mitochondria may be a 'risk factor' for cells with a deep ATPase dysfunction, such as cells from patients with maternally-inherited Leigh syndrome.

Expression of leukemia inhibitory factor and leukemia inhibitory factor receptor in the canine pituitary gland and corticotrope adenomas.

PubMed

Hanson, J M; Mol, J A; Meij, B P

2010-05-01

Leukemia inhibitory factor (LIF) is a pleiotropic cytokine of the IL-6 family that activates the hypothalamic-pituitary-adrenal axis and promotes corticotrope cell differentiation during development. The aim of this study was to investigate the expression of LIF and its receptor (LIFR) in the canine pituitary gland and in corticotrope adenomas, and to perform a mutation analysis of LIFR. Using immunohistochemistry, immunofluorescence, and quantitative expression analysis, LIF and LIFR expression were studied in pituitary glands of control dogs and in specimens of corticotrope adenoma tissue collected through hypophysectomy in dogs with pituitary-dependent hypercortisolism (PDH, Cushing's disease). Using sequence analysis, cDNA was screened for mutations in the LIFR. In the control pituitary tissues and corticotrope adenomas, there was a low magnitude of LIF expression. The LIFR, however, was highly expressed and co-localized with ACTH(1-24) expression. Cytoplasmatic immunoreactivity of LIFR was preserved in corticotrope adenomas and adjacent nontumorous cells of pars intermedia. No mutation was found on mutation analysis of the complete LIFR cDNA. Surprisingly, nuclear to perinuclear immunoreactivity for LIFR was present in nontumorous pituitary cells of the pars distalis in 10 of 12 tissue specimens from PDH dogs. These data show that LIFR is highly co-expressed with adrenocorticotropic hormone (ACTH) and alpha-melanocyte-stimulating hormone (alpha-MSH) in the canine pituitary gland and in corticotrope adenomas. Nuclear immunoreactivity for LIFR in nontumorous cells of the pars distalis may indicate the presence of a corticotrope adenoma. Copyright (c) 2009 Elsevier Inc. All rights reserved.

Germline mutations in lysine specific demethylase 1 (LSD1/KDM1A) confer susceptibility to multiple myeloma.

PubMed

Wei, Xiaomu; Calvo-Vidal, M Nieves; Chen, Siwei; Wu, Gang; Revuelta, Maria V; Sun, Jian; Zhang, Jinghui; Walsh, Michael F; Nichols, Kim E; Joseph, Vijai; Snyder, Carrie; Vachon, Celine M; McKay, James D; Wang, Shu-Ping; Jayabalan, David S; Jacobs, Lauren M; Becirovic, Dina; Waller, Rosalie G; Artomov, Mykyta; Viale, Agnes; Patel, Jayeshkumar; Phillip, Jude M; Chen-Kiang, Selina; Curtin, Karen; Salama, Mohamed; Atanackovic, Djordje; Niesvizky, Ruben; Landgren, Ola; Slager, Susan L; Godley, Lucy A; Churpek, Jane; Garber, Judy E; Anderson, Kenneth C; Daly, Mark J; Roeder, Robert G; Dumontet, Charles; Lynch, Henry T; Mullighan, Charles G; Camp, Nicola J; Offit, Kenneth; Klein, Robert J; Yu, Haiyuan; Cerchietti, Leandro; Lipkin, Steven M

2018-03-20

Given the frequent and largely incurable occurrence of multiple myeloma (MM), identification of germline genetic mutations that predispose cells to MM may provide insight into disease etiology and the developmental mechanisms of its cell of origin, the plasma cell. Here we identified familial and early-onset MM kindreds with truncating mutations in lysine-specific demethylase 1 (LSD1/KDM1A), an epigenetic transcriptional repressor that primarily demethylates histone H3 on lysine 4 and regulates hematopoietic stem cell self-renewal. Additionally, we found higher rates of germline truncating and predicted deleterious missense KDM1A mutations in MM patients unselected for family history compared to controls. Both monoclonal gammopathy of unknown significance (MGUS) and MM cells have significantly lower KDM1A transcript levels compared with normal plasma cells. Transcriptome analysis of MM cells from KDM1A mutation carriers shows enrichment of pathways and MYC target genes previously associated with myeloma pathogenesis. In mice, antigen challenge followed by pharmacological inhibition of KDM1A promoted plasma cell expansion, enhanced secondary immune response, elicited appearance of serum paraprotein, and mediated upregulation of MYC transcriptional targets. These changes are consistent with the development of MGUS. Collectively, our findings show KDM1A is the first autosomal dominant MM germline predisposition gene, providing new insights into its mechanistic roles as a tumor suppressor during post-germinal center B cell differentiation. Copyright ©2018, American Association for Cancer Research.

Oncogenic roles of PRL-3 in FLT3-ITD induced acute myeloid leukaemia

PubMed Central

Park, Jung Eun; Yuen, Hiu Fung; Zhou, Jian Biao; Al-aidaroos, Abdul Qader O; Guo, Ke; Valk, Peter J; Zhang, Shu Dong; Chng, Wee Joo; Hong, Cheng William; Mills, Ken; Zeng, Qi

2013-01-01

FLT3-ITD mutations are prevalent mutations in acute myeloid leukaemia (AML). PRL-3, a metastasis-associated phosphatase, is a downstream target of FLT3-ITD. This study investigates the regulation and function of PRL-3 in leukaemia cell lines and AML patients associated with FLT3-ITD mutations. PRL-3 expression is upregulated by the FLT3-STAT5 signalling pathway in leukaemia cells, leading an activation of AP-1 transcription factors via ERK and JNK pathways. PRL-3-depleted AML cells showed a significant decrease in cell growth. Clinically, high PRL-3 mRNA expression was associated with FLT3-ITD mutations in four independent AML datasets with 1158 patients. Multivariable Cox-regression analysis on our Cohort 1 with 221 patients identified PRL-3 as a novel prognostic marker independent of other clinical parameters. Kaplan–Meier analysis showed high PRL-3 mRNA expression was significantly associated with poorer survival among 491 patients with normal karyotype. Targeting PRL-3 reversed the oncogenic effects in FLT3-ITD AML models in vitro and in vivo. Herein, we suggest that PRL-3 could serve as a prognostic marker to predict poorer survival and as a promising novel therapeutic target for AML patients. PMID:23929599

An immuno-wall microdevice exhibits rapid and sensitive detection of IDH1-R132H mutation specific to grade II and III gliomas

NASA Astrophysics Data System (ADS)

Yamamichi, Akane; Kasama, Toshihiro; Ohka, Fumiharu; Suzuki, Hiromichi; Kato, Akira; Motomura, Kazuya; Hirano, Masaki; Ranjit, Melissa; Chalise, Lushun; Kurimoto, Michihiro; Kondo, Goro; Aoki, Kosuke; Kaji, Noritada; Tokeshi, Manabu; Matsubara, Toshio; Senga, Takeshi; Kaneko, Mika K.; Suzuki, Hidenori; Hara, Masahito; Wakabayashi, Toshihiko; Baba, Yoshinobu; Kato, Yukinari; Natsume, Atsushi

2016-01-01

World Health Organization grade II and III gliomas most frequently occur in the central nervous system (CNS) in adults. Gliomas are not circumscribed; tumor edges are irregular and consist of tumor cells, normal brain tissue, and hyperplastic reactive glial cells. Therefore, the tumors are not fully resectable, resulting in recurrence, malignant progression, and eventual death. Approximately 69-80% of grade II and III gliomas harbor mutations in the isocitrate dehydrogenase 1 gene (IDH1), of which 83-90% are found to be the IDH1-R132H mutation. Detection of the IDH1-R132H mutation should help in the differential diagnosis of grade II and III gliomas from other types of CNS tumors and help determine the boundary between the tumor and normal brain tissue. In this study, we established a highly sensitive antibody-based device, referred to as the immuno-wall, to detect the IDH1-R132H mutation in gliomas. The immuno-wall causes an immunoreaction in microchannels fabricated using a photo-polymerizing polymer. This microdevice enables the analysis of the IDH1 status with a small sample within 15 min with substantially high sensitivity. Our results suggested that 10% content of the IDH1-R132H mutation in a sample of 0.33 μl volume, with 500 ng protein, or from 500 cells is theoretically sufficient for the analysis. The immuno-wall device will enable the rapid and highly sensitive detection of the IDH1-R132H mutation in routine clinical practice.

Functional studies of RYR1 mutations in the skeletal muscle ryanodine receptor using human RYR1 complementary DNA.

PubMed

Sato, Keisaku; Pollock, Neil; Stowell, Kathryn M

2010-06-01

Malignant hyperthermia is associated with mutations within the gene encoding the skeletal muscle ryanodine receptor, the calcium channel that releases Ca from sarcoplasmic reticulum stores triggering muscle contraction, and other metabolic activities. More than 200 variants have been identified in the ryanodine receptor, but only some of these have been shown to functionally affect the calcium channel. To implement genetic testing for malignant hyperthermia, variants must be shown to alter the function of the channel. A number of different ex vivo methods can be used to demonstrate functionality, as long as cells from human patients can be obtained and cultured from at least two unrelated families. Because malignant hyperthermia is an uncommon disorder and many variants seem to be private, including the newly identified H4833Y mutation, these approaches are limited. The authors cloned the human skeletal muscle ryanodine receptor complementary DNA and expressed both normal and mutated forms in HEK-293 cells and carried out functional analysis using ryanodine binding assays in the presence of a specific agonist, 4-chloro-m-cresol, and the antagonist Mg. Transiently expressed human ryanodine receptor proteins colocalized with an endoplasmic reticulum marker in HEK-293 cells. Ryanodine binding assays confirmed that mutations causing malignant hyperthermia resulted in a hypersensitive channel, while those causing central core disease resulted in a hyposensitive channel. The functional assays validate recombinant human skeletal muscle ryanodine receptor for analysis of variants and add an additional mutation (H4833Y) to the repertoire of mutations that can be used for the genetic diagnosis of malignant hyperthermia.

COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.

PubMed

Mauger, Florence; How-Kit, Alexandre; Tost, Jörg

2017-06-01

Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.

An immuno-wall microdevice exhibits rapid and sensitive detection of IDH1-R132H mutation specific to grade II and III gliomas.

PubMed

Yamamichi, Akane; Kasama, Toshihiro; Ohka, Fumiharu; Suzuki, Hiromichi; Kato, Akira; Motomura, Kazuya; Hirano, Masaki; Ranjit, Melissa; Chalise, Lushun; Kurimoto, Michihiro; Kondo, Goro; Aoki, Kosuke; Kaji, Noritada; Tokeshi, Manabu; Matsubara, Toshio; Senga, Takeshi; Kaneko, Mika K; Suzuki, Hidenori; Hara, Masahito; Wakabayashi, Toshihiko; Baba, Yoshinobu; Kato, Yukinari; Natsume, Atsushi

2016-01-01

World Health Organization grade II and III gliomas most frequently occur in the central nervous system (CNS) in adults. Gliomas are not circumscribed; tumor edges are irregular and consist of tumor cells, normal brain tissue, and hyperplastic reactive glial cells. Therefore, the tumors are not fully resectable, resulting in recurrence, malignant progression, and eventual death. Approximately 69-80% of grade II and III gliomas harbor mutations in the isocitrate dehydrogenase 1 gene ( IDH1 ), of which 83-90% are found to be the IDH1-R132H mutation. Detection of the IDH1-R132H mutation should help in the differential diagnosis of grade II and III gliomas from other types of CNS tumors and help determine the boundary between the tumor and normal brain tissue. In this study, we established a highly sensitive antibody-based device, referred to as the immuno-wall, to detect the IDH1-R132H mutation in gliomas. The immuno-wall causes an immunoreaction in microchannels fabricated using a photo-polymerizing polymer. This microdevice enables the analysis of the IDH1 status with a small sample within 15 min with substantially high sensitivity. Our results suggested that 10% content of the IDH1-R132H mutation in a sample of 0.33 μl volume, with 500 ng protein, or from 500 cells is theoretically sufficient for the analysis. The immuno-wall device will enable the rapid and highly sensitive detection of the IDH1-R132H mutation in routine clinical practice.

Value and limitations of immunohistochemistry and gene sequencing for detection of the IDH1-R132H mutation in diffuse glioma biopsy specimens.

PubMed

Preusser, Matthias; Wöhrer, Adelheid; Stary, Susanne; Höftberger, Romana; Streubel, Berthold; Hainfellner, Johannes A

2011-08-01

To assess the value of anti-isocitrate dehydrogenase 1 (IDH1) immunohistochemistry for evaluating diffuse gliomas, we analyzed anti-IDH1-R132H immunohistochemistry using monoclonal antibodies DIA-H09 and IMab-1 and IDH1 gene sequencing in formalin-fixed and paraffin-embedded biopsy samples of 95 diffuse gliomas. We found concordant immunostaining results using the 2 antibodies in 94 (98.9%) of the 95 cases, but DIA-H09 generally showed a higher signal-to-background ratio than IMab-1 did. Fifty-five percent of cases showed anti-IDH1-R132H immunostaining of virtually all tumor cells and 15% of only a fraction of tumor cells. All cases with complete or partial immunostaining of the tumor tissue carried the IDH1-R132H mutation. In all cases with negative immunostaining results (approximately 30%), genetic analysis showed IDH1 wild-type or non-R132H-IDH1 mutations. In a single tiny biopsy, both anti-IDH1-R132H antibodies showed immunoreactivity, but genetic testing was inconclusive. Our data confirm anti-IDH1-R132H immunostaining as a reliable method for evaluation of IDH1 gene mutation status. They also suggest the following: (i) in some cases, nonspecific background staining or regional heterogeneity of IDH1-R132H protein expression may necessitate confirmatory genetic analysis; (ii) for individual cases, anti-IDH1-R132H immunostaining may not reliably identify infiltrating tumor cells admixed with preexisting or reactive glial cells; and (iii) in tiny biopsies, immunohistochemistry may be more sensitive for detection of IDH1-R132H mutation than genetic analysis.

Landscape of somatic mutations and clonal evolution in mantle cell lymphoma.

PubMed

Beà, Sílvia; Valdés-Mas, Rafael; Navarro, Alba; Salaverria, Itziar; Martín-Garcia, David; Jares, Pedro; Giné, Eva; Pinyol, Magda; Royo, Cristina; Nadeu, Ferran; Conde, Laura; Juan, Manel; Clot, Guillem; Vizán, Pedro; Di Croce, Luciano; Puente, Diana A; López-Guerra, Mónica; Moros, Alexandra; Roue, Gael; Aymerich, Marta; Villamor, Neus; Colomo, Lluís; Martínez, Antonio; Valera, Alexandra; Martín-Subero, José I; Amador, Virginia; Hernández, Luis; Rozman, Maria; Enjuanes, Anna; Forcada, Pilar; Muntañola, Ana; Hartmann, Elena M; Calasanz, María J; Rosenwald, Andreas; Ott, German; Hernández-Rivas, Jesús M; Klapper, Wolfram; Siebert, Reiner; Wiestner, Adrian; Wilson, Wyndham H; Colomer, Dolors; López-Guillermo, Armando; López-Otín, Carlos; Puente, Xose S; Campo, Elías

2013-11-05

Mantle cell lymphoma (MCL) is an aggressive tumor, but a subset of patients may follow an indolent clinical course. To understand the mechanisms underlying this biological heterogeneity, we performed whole-genome and/or whole-exome sequencing on 29 MCL cases and their respective matched normal DNA, as well as 6 MCL cell lines. Recurrently mutated genes were investigated by targeted sequencing in an independent cohort of 172 MCL patients. We identified 25 significantly mutated genes, including known drivers such as ataxia-telangectasia mutated (ATM), cyclin D1 (CCND1), and the tumor suppressor TP53; mutated genes encoding the anti-apoptotic protein BIRC3 and Toll-like receptor 2 (TLR2); and the chromatin modifiers WHSC1, MLL2, and MEF2B. We also found NOTCH2 mutations as an alternative phenomenon to NOTCH1 mutations in aggressive tumors with a dismal prognosis. Analysis of two simultaneous or subsequent MCL samples by whole-genome/whole-exome (n = 8) or targeted (n = 19) sequencing revealed subclonal heterogeneity at diagnosis in samples from different topographic sites and modulation of the initial mutational profile at the progression of the disease. Some mutations were predominantly clonal or subclonal, indicating an early or late event in tumor evolution, respectively. Our study identifies molecular mechanisms contributing to MCL pathogenesis and offers potential targets for therapeutic intervention.

Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

PubMed Central

McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

2015-01-01

Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

Identification of somatic mutations in non-small cell lung carcinomas using whole-exome sequencing

PubMed Central

Liu, Pengyuan; Morrison, Carl; Wang, Liang; Xiong, Donghai; Vedell, Peter; Cui, Peng; Hua, Xing; Ding, Feng; Lu, Yan; James, Michael; Ebben, John D.; Xu, Haiming; Adjei, Alex A.; Head, Karen; Andrae, Jaime W.; Tschannen, Michael R.; Jacob, Howard; Pan, Jing; Zhang, Qi; Van den Bergh, Francoise; Xiao, Haijie; Lo, Ken C.; Patel, Jigar; Richmond, Todd; Watt, Mary-Anne; Albert, Thomas; Selzer, Rebecca; Anderson, Marshall; Wang, Jiang; Wang, Yian; Starnes, Sandra; Yang, Ping; You, Ming

2012-01-01

Lung cancer is the leading cause of cancer-related death, with non-small cell lung cancer (NSCLC) being the predominant form of the disease. Most lung cancer is caused by the accumulation of genomic alterations due to tobacco exposure. To uncover its mutational landscape, we performed whole-exome sequencing in 31 NSCLCs and their matched normal tissue samples. We identified both common and unique mutation spectra and pathway activation in lung adenocarcinomas and squamous cell carcinomas, two major histologies in NSCLC. In addition to identifying previously known lung cancer genes (TP53, KRAS, EGFR, CDKN2A and RB1), the analysis revealed many genes not previously implicated in this malignancy. Notably, a novel gene CSMD3 was identified as the second most frequently mutated gene (next to TP53) in lung cancer. We further demonstrated that loss of CSMD3 results in increased proliferation of airway epithelial cells. The study provides unprecedented insights into mutational processes, cellular pathways and gene networks associated with lung cancer. Of potential immediate clinical relevance, several highly mutated genes identified in our study are promising druggable targets in cancer therapy including ALK, CTNNA3, DCC, MLL3, PCDHIIX, PIK3C2B, PIK3CG and ROCK2. PMID:22510280

Functional mutation analysis of EGFR family genes and corresponding lymph node metastases in head and neck squamous cell carcinoma.

PubMed

Hama, Takanori; Yuza, Yuki; Suda, Toshihito; Saito, Yoshimichi; Norizoe, Chihiro; Kato, Takakuni; Moriyama, Hiroshi; Urashima, Mitsuyoshi

2012-01-01

Tumors with certain mutations in the epidermal growth factor receptor (EGFR) family genes dramatically respond to EGFR inhibitors. Therefore, these mutations are important factors that influence disease progression and patient survival. We previously studied the mutation status of EGFR in patients with head and neck squamous cell carcinoma (HNSCC). However, the mutation status of lymph node metastases and the frequency of mutations in EGFR family genes have not been extensively studied. In this study, we sequenced the catalytic domains of the three other members of the EGFR family, HER2, HER3, and HER4 in 92 clinical samples of HNSCC. We identified a HER2 mutation (K716E) in one sample but no mutations were found in HER3 or HER4. Next to investigate the relationship between EGFR mutations and tumor metastasis, we compared the DNA sequences of the EGFR gene between the primary tumor and the lymph node metastasis in 31 clinical samples. Only one of the patients with an EGFR mutation in the primary HNSCC carried the same mutation (L858R) in the lymph node metastasis. Finally, we explored the tumorigenic potential of the EGFR mutations that we had previously identified and their sensitivity to two different EGFR tyrosine kinase inhibitors (CL-387785, OSI-420). Ba/F3 cells transformed with mutant EGFR genes were sensitive to treatment with lower concentrations of CL-387785 than of OSI-420. These results contribute to our understanding of the genetic basis of drug sensitivity and will help design drugs that specifically target different subtypes of HNSCC.

A population-based analysis of germline BAP1 mutations in melanoma.

PubMed

O'Shea, Sally J; Robles-Espinoza, Carla Daniela; McLellan, Lauren; Harrigan, Jeanine; Jacq, Xavier; Hewinson, James; Iyer, Vivek; Merchant, Will; Elliott, Faye; Harland, Mark; Bishop, D Timothy; Newton-Bishop, Julia A; Adams, David J

2017-02-15

Germline mutation of the BRCA1 associated protein-1 (BAP1) gene has been linked to uveal melanoma, mesothelioma, meningioma, renal cell carcinoma and basal cell carcinoma. Germline variants have also been found in familial cutaneous melanoma pedigrees, but their contribution to sporadic melanoma has not been fully assessed. We sequenced BAP1 in 1,977 melanoma cases and 754 controls and used deubiquitinase assays, a pedigree analysis, and a histopathological review to assess the consequences of the mutations found. Sequencing revealed 30 BAP1 variants in total, of which 27 were rare (ExAc allele frequency <0.002). Of the 27 rare variants, 22 were present in cases (18 missense, one splice acceptor, one frameshift and two near splice regions) and five in controls (all missense). A missense change (S98R) in a case that completely abolished BAP1 deubiquitinase activity was identified. Analysis of cancers in the pedigree of the proband carrying the S98R variant and in two other pedigrees carrying clear loss-of-function alleles showed the presence of BAP1-associated cancers such as renal cell carcinoma, mesothelioma and meningioma, but not uveal melanoma. Two of these three probands carrying BAP1 loss-of-function variants also had melanomas with histopathological features suggestive of a germline BAP1 mutation. The remaining cases with germline mutations, which were predominantly missense mutations, were associated with less typical pedigrees and tumours lacking a characteristic BAP1-associated histopathological appearances, but may still represent less penetrant variants. Germline BAP1 alleles defined as loss-of-function or predicted to be deleterious/damaging are rare in cutaneous melanoma. © The Author 2017. Published by Oxford University Press.

A population-based analysis of germline BAP1 mutations in melanoma

PubMed Central

O’Shea, Sally J.; Robles-Espinoza, Carla Daniela; Harrigan, Jeanine; Jacq, Xavier; Hewinson, James; Iyer, Vivek; Merchant, Will; Elliott, Faye; Harland, Mark; Bishop, D. Timothy; Newton-Bishop, Julia A.

2017-01-01

Abstract Germline mutation of the BRCA1 associated protein-1 (BAP1) gene has been linked to uveal melanoma, mesothelioma, meningioma, renal cell carcinoma and basal cell carcinoma. Germline variants have also been found in familial cutaneous melanoma pedigrees, but their contribution to sporadic melanoma has not been fully assessed. We sequenced BAP1 in 1,977 melanoma cases and 754 controls and used deubiquitinase assays, a pedigree analysis, and a histopathological review to assess the consequences of the mutations found. Sequencing revealed 30 BAP1 variants in total, of which 27 were rare (ExAc allele frequency <0.002). Of the 27 rare variants, 22 were present in cases (18 missense, one splice acceptor, one frameshift and two near splice regions) and five in controls (all missense). A missense change (S98R) in a case that completely abolished BAP1 deubiquitinase activity was identified. Analysis of cancers in the pedigree of the proband carrying the S98R variant and in two other pedigrees carrying clear loss-of-function alleles showed the presence of BAP1-associated cancers such as renal cell carcinoma, mesothelioma and meningioma, but not uveal melanoma. Two of these three probands carrying BAP1 loss-of-function variants also had melanomas with histopathological features suggestive of a germline BAP1 mutation. The remaining cases with germline mutations, which were predominantly missense mutations, were associated with less typical pedigrees and tumours lacking a characteristic BAP1-associated histopathological appearances, but may still represent less penetrant variants. Germline BAP1 alleles defined as loss-of-function or predicted to be deleterious/damaging are rare in cutaneous melanoma. PMID:28062663

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

PubMed Central

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

PubMed

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-07-15

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

Impact of KRAS codon subtypes from a randomised phase II trial of selumetinib plus docetaxel in KRAS mutant advanced non-small-cell lung cancer.

PubMed

Jänne, P A; Smith, I; McWalter, G; Mann, H; Dougherty, B; Walker, J; Orr, M C M; Hodgson, D R; Shaw, A T; Pereira, J R; Jeannin, G; Vansteenkiste, J; Barrios, C H; Franke, F A; Crinò, L; Smith, P

2015-07-14

Selumetinib (AZD6244, ARRY-142886)+docetaxel increases median overall survival (OS) and significantly improves progression-free survival (PFS) and objective response rate (ORR) compared with docetaxel alone in patients with KRAS mutant, stage IIIB/IV non-small-cell lung cancer (NSCLC; NCT00890825). Retrospective analysis of OS, PFS, ORR and change in tumour size at week 6 for different sub-populations of KRAS codon mutations. In patients receiving selumetinib+docetaxel and harbouring KRAS G12C or G12V mutations there were trends towards greater improvement in OS, PFS and ORR compared with other KRAS mutations. Different KRAS mutations in NSCLC may influence selumetinib/docetaxel sensitivity.

LKB1/STK11 mutations in non-small cell lung cancer patients: Descriptive analysis and prognostic value.

PubMed

Facchinetti, Francesco; Bluthgen, Maria Virginia; Tergemina-Clain, Gabrielle; Faivre, Laura; Pignon, Jean-Pierre; Planchard, David; Remon, Jordi; Soria, Jean-Charles; Lacroix, Ludovic; Besse, Benjamin

2017-10-01

LKB1/STK11 (STK11) is among the most inactivated tumor-suppressor genes in non-small cell lung cancer (NSCLC). While evidence concerning the biologic role of STK11 is accumulating, its prognostic significance in advanced NSCLC has not been envisaged yet. This retrospective analysis included consecutive NSCLC patients with available STK11 information who underwent a platinum-based chemotherapy. STK11 mutational status was correlated to clinico-pathological and mutational features. Kaplan-Meier and Cox models were used for survival curves and multivariate analyses, respectively. Among the 302 patients included, 267 (89%) were diagnosed with stage IIIB/IV NSCLC and 25 (8%) harbored a STK11 mutation (STK11mut). No statistical differences were observed between STK11 status and clinico-pathological variables. We detected a significant correlation between STK11 and KRAS status (p=0.008); among the 25 STK11mut patients, 13 (52%) harbored a concomitant KRAS mutation. Overall survival (OS) was shorter for STK11mut (median OS=10.4months) compared to wild-type patients (STK11wt; median OS=17.3months) in univariate analysis (p=0.085). STK11 status did not impact upon OS in multivariate analysis (p=0.45) and non-significant results were observed for progression-free survival. The co-occurrence of KRAS and STK11 mutations suggest a trend toward detrimental effect in OS (p=0.12). In our cohort enriched for advanced NSCLC patients who received platinum-based chemotherapy, STK11 mutations were not specifically associated with clinico-pathological features and they did not impact upon survival. We confirm the positive correlation between STK11 and KRAS mutations. The co-occurrence of KRAS and STK11 mutations could label a more aggressive molecular subtype of NSCLC. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterizing the Molecular Pathology of Arrhythmogenic Cardiomyopathy in Patient Buccal Mucosa Cells

PubMed Central

Asimaki, Angeliki; Protonotarios, Alexandros; James, Cynthia A.; Chelko, Stephen P.; Tichnell, Crystal; Murray, Brittney; Tsatsopoulou, Adalena; Anastasakis, Aris; te Riele, Anneline; Kléber, André G.; Judge, Daniel P.; Calkins, Hugh; Saffitz, Jeffrey E.

2016-01-01

Background Analysis of myocardium has revealed mechanistic insights into arrhythmogenic cardiomyopathy but cardiac samples are difficult to obtain from probands and especially from family members. To identify a potential surrogate tissue, we characterized buccal mucosa cells. Methods and Results Buccal cells from patients, mutation carriers and controls were immunostained and analyzed in a blinded fashion. In additional studies, buccal cells were grown in vitro and incubated with SB216763. Immunoreactive signals for the desmosomal protein plakoglobin and the major cardiac gap junction protein Cx43 were markedly diminished in buccal mucosa cells from arrhythmogenic cardiomyopathy patients with known desmosomal mutations when compared with controls. Plakoglobin and Cx43 signals were also reduced in most family members who carried disease alleles but showed no evidence of heart disease. Signal for the desmosomal protein plakophilin-1 was reduced in buccal mucosa cells in patients with PKP2 mutations but not in those with mutations in other desmosomal genes. Signal for the desmosomal protein desmoplakin was reduced in buccal mucosa cells from patients with mutations in DSP, DSG2 or DSC2 but not in PKP2 or JUP. Abnormal protein distributions were reversed in cultured cells incubated with SB216763, a small molecule that rescues the disease phenotype in cardiac myocytes. Conclusions Buccal mucosa cells from arrhythmogenic cardiomyopathy patients exhibit changes in the distribution of cell junction proteins similar to those seen in the heart. These cells may prove useful in future studies of disease mechanisms and drug screens for effective therapies in arrhythmogenic cardiomyopathy. PMID:26850880

Characterizing the Molecular Pathology of Arrhythmogenic Cardiomyopathy in Patient Buccal Mucosa Cells.

PubMed

Asimaki, Angeliki; Protonotarios, Alexandros; James, Cynthia A; Chelko, Stephen P; Tichnell, Crystal; Murray, Brittney; Tsatsopoulou, Adalena; Anastasakis, Aris; te Riele, Anneline; Kléber, André G; Judge, Daniel P; Calkins, Hugh; Saffitz, Jeffrey E

2016-02-01

Analysis of myocardium has revealed mechanistic insights into arrhythmogenic cardiomyopathy but cardiac samples are difficult to obtain from probands and especially from family members. To identify a potential surrogate tissue, we characterized buccal mucosa cells. Buccal cells from patients, mutation carriers, and controls were immunostained and analyzed in a blinded fashion. In additional studies, buccal cells were grown in vitro and incubated with SB216763. Immunoreactive signals for the desmosomal protein plakoglobin and the major cardiac gap junction protein Cx43 were markedly diminished in buccal mucosa cells from arrhythmogenic cardiomyopathy patients with known desmosomal mutations when compared with controls. Plakoglobin and Cx43 signals were also reduced in most family members who carried disease alleles but showed no evidence of heart disease. Signal for the desmosomal protein plakophilin-1 was reduced in buccal mucosa cells in patients with PKP2 mutations but not in those with mutations in other desmosomal genes. Signal for the desmosomal protein desmoplakin was reduced in buccal mucosa cells from patients with mutations in DSP, DSG2, or DSC2 but not in PKP2 or JUP. Abnormal protein distributions were reversed in cultured cells incubated with SB216763, a small molecule that rescues the disease phenotype in cardiac myocytes. Buccal mucosa cells from arrhythmogenic cardiomyopathy patients exhibit changes in the distribution of cell junction proteins similar to those seen in the heart. These cells may prove useful in future studies of disease mechanisms and drug screens for effective therapies in arrhythmogenic cardiomyopathy. © 2016 American Heart Association, Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boustany, R.M.; Qian, W.H.; Suzuki, K.

The authors describe four new mutations in the [beta]-galactosidase gene. These are the first mutations causing infantile and juvenile GM[sub 1]-gangliosidosis to be described in American patients. Cell lines from two patients with juvenile and from six patients with infantile GM[sub 1]-gangliosidosis were analyzed. Northern blot analysis showed the acid [beta]-galactosidase message to be of normal size and quantity in two juvenile and four infantile cases and of normal size but reduced quantity in two infantile cases. The mutations are distinct from the Japanese mutations. All are point mutations leading to amino acid substitutions: Lys[sup 577] [yields] Arg, Arg[sup 590]more » [yields] His, and Glu[sup 632] [yields] Gly. The fourth mutation, Arg[sup 208] [yields] Cys, accounts for 10 of 16 possible alleles. Two infantile cases from Puerto Rico of Spanish ancestry are homozygous for this mutation, suggesting that this allele may have come to South America and North America via Puerto Rico. That these mutations cause clinical disease was confirmed by marked reduction in catalytic activity of the mutant proteins in the Cos-1 cell expression system. 12 refs., 5 figs., 2 tabs.« less

Mutational Analysis of Cell Types in TSC

DTIC Science & Technology

2008-01-01

disability, and autism . TSC1/TSC2 gene mutations lead to developmental alterations in brain structure known as tubers in over 80% of TSC patients. Loss of...that is associated with epilepsy, cognitive disability, and autism . TSC1/TSC2 gene mutations lead to developmental alterations in brain structure...2000). Comorbid neuropsychological disorders such as autism , mental retardation (MR), pervasive developmental disorder, attention deficit disorder (ADD

Differential sensitivity of melanoma cell lines with BRAFV600E mutation to the specific Raf inhibitor PLX4032

PubMed Central

2010-01-01

Blocking oncogenic signaling induced by the BRAFV600E mutation is a promising approach for melanoma treatment. We tested the anti-tumor effects of a specific inhibitor of Raf protein kinases, PLX4032/RG7204, in melanoma cell lines. PLX4032 decreased signaling through the MAPK pathway only in cell lines with the BRAFV600E mutation. Seven out of 10 BRAFV600E mutant cell lines displayed sensitivity based on cell viability assays and three were resistant at concentrations up to 10 μM. Among the sensitive cell lines, four were highly sensitive with IC50 values below 1 μM, and three were moderately sensitive with IC50 values between 1 and 10 μM. There was evidence of MAPK pathway inhibition and cell cycle arrest in both sensitive and resistant cell lines. Genomic analysis by sequencing, genotyping of close to 400 oncogeninc mutations by mass spectrometry, and SNP arrays demonstrated no major differences in BRAF locus amplification or in other oncogenic events between sensitive and resistant cell lines. However, metabolic tracer uptake studies demonstrated that sensitive cell lines had a more profound inhibition of FDG uptake upon exposure to PLX4032 than resistant cell lines. In conclusion, BRAFV600E mutant melanoma cell lines displayed a range of sensitivities to PLX4032 and metabolic imaging using PET probes can be used to assess sensitivity. PMID:20406486

Shifted termination assay (STA) fragment analysis to detect BRAF V600 mutations in papillary thyroid carcinomas

PubMed Central

2013-01-01

Background BRAF mutation is an important diagnostic and prognostic marker in patients with papillary thyroid carcinoma (PTC). To be applicable in clinical laboratories with limited equipment, diverse testing methods are required to detect BRAF mutation. Methods A shifted termination assay (STA) fragment analysis was used to detect common V600 BRAF mutations in 159 PTCs with DNAs extracted from formalin-fixed paraffin-embedded tumor tissue. The results of STA fragment analysis were compared to those of direct sequencing. Serial dilutions of BRAF mutant cell line (SNU-790) were used to calculate limit of detection (LOD). Results BRAF mutations were detected in 119 (74.8%) PTCs by STA fragment analysis. In direct sequencing, BRAF mutations were observed in 118 (74.2%) cases. The results of STA fragment analysis had high correlation with those of direct sequencing (p < 0.00001, κ = 0.98). The LOD of STA fragment analysis and direct sequencing was 6% and 12.5%, respectively. In PTCs with pT3/T4 stages, BRAF mutation was observed in 83.8% of cases. In pT1/T2 carcinomas, BRAF mutation was detected in 65.9% and this difference was statistically significant (p = 0.007). Moreover, BRAF mutation was more frequent in PTCs with extrathyroidal invasion than tumors without extrathyroidal invasion (84.7% versus 62.2%, p = 0.001). To prepare and run the reactions, direct sequencing required 450 minutes while STA fragment analysis needed 290 minutes. Conclusions STA fragment analysis is a simple and sensitive method to detect BRAF V600 mutations in formalin-fixed paraffin-embedded clinical samples. Virtual Slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/5684057089135749 PMID:23883275

EZH2 and CD79B mutational status over time in B-cell non-Hodgkin lymphomas detected by high-throughput sequencing using minimal samples

PubMed Central

Saieg, Mauro Ajaj; Geddie, William R; Boerner, Scott L; Bailey, Denis; Crump, Michael; da Cunha Santos, Gilda

2013-01-01

BACKGROUND: Numerous genomic abnormalities in B-cell non-Hodgkin lymphomas (NHLs) have been revealed by novel high-throughput technologies, including recurrent mutations in EZH2 (enhancer of zeste homolog 2) and CD79B (B cell antigen receptor complex-associated protein beta chain) genes. This study sought to determine the evolution of the mutational status of EZH2 and CD79B over time in different samples from the same patient in a cohort of B-cell NHLs, through use of a customized multiplex mutation assay. METHODS: DNA that was extracted from cytological material stored on FTA cards as well as from additional specimens, including archived frozen and formalin-fixed histological specimens, archived stained smears, and cytospin preparations, were submitted to a multiplex mutation assay specifically designed for the detection of point mutations involving EZH2 and CD79B, using MassARRAY spectrometry followed by Sanger sequencing. RESULTS: All 121 samples from 80 B-cell NHL cases were successfully analyzed. Mutations in EZH2 (Y646) and CD79B (Y196) were detected in 13.2% and 8% of the samples, respectively, almost exclusively in follicular lymphomas and diffuse large B-cell lymphomas. In one-third of the positive cases, a wild type was detected in a different sample from the same patient during follow-up. CONCLUSIONS: Testing multiple minimal tissue samples using a high-throughput multiplex platform exponentially increases tissue availability for molecular analysis and might facilitate future studies of tumor progression and the related molecular events. Mutational status of EZH2 and CD79B may vary in B-cell NHL samples over time and support the concept that individualized therapy should be based on molecular findings at the time of treatment, rather than on results obtained from previous specimens. Cancer (Cancer Cytopathol) 2013;121:377–386. © 2013 American Cancer Society. PMID:23361872

Phosphorylation status modulates Bcl-2 function during glucocorticoid-induced apoptosis in T lymphocytes.

PubMed

Huang, Se-Te J; Cidlowski, John A

2002-06-01

Glucocorticoids are known to induce apoptosis in lymphoid cells, and Bcl-2 overexpression can block the apoptosis-inducing action of glucocorticoids. Since phosphorylation of Bcl-2 is implicated in regulating Bcl-2 function, we considered the role of Bcl-2 phosphorylation in protecting lymphoid cells from glucocorticoid-induced cell death. Five stably transfected cell lines of WEHI 7.1 cells expressing either wild-type Bcl-2 or alanine mutants of Bcl-2 at amino acids threonine 56, serine 70, threonine 74, or serine 87 were created. Expression of the mutant Bcl-2 proteins was documented by flow cytometry and Western blot analysis. Mutation of Bcl-2 on T56 and S87 eliminated the ability of Bcl-2 to inhibit glucocorticoid-induced cell shrinkage, mitochondrial depolarization, DNA fragmentation, and cell death. Mutation of T74 only partially impaired the ability of Bcl-2 to block glucocorticoid-induced apoptosis whereas mutation of S70 in Bcl-2 did not alter its ability to block glucocorticoid-induced apoptosis.

Phenotypic and genomic analysis of serotype 3 Sabin poliovirus vaccine produced in MRC-5 cell substrate.

PubMed

Alirezaie, Behnam; Taqavian, Mohammad; Aghaiypour, Khosrow; Esna-Ashari, Fatemeh; Shafyi, Abbas

2011-05-01

The cell substrate has a pivotal role in live virus vaccines production. It is necessary to evaluate the effects of the cell substrate on the properties of the propagated viruses, especially in the case of viruses which are unstable genetically such as polioviruses, by monitoring the molecular and phenotypical characteristics of harvested viruses. To investigate the presence/absence of mutation(s), the near full-length genomic sequence of different harvests of the type 3 Sabin strain of poliovirus propagated in MRC-5 cells were determined. The sequences were compared with genomic sequences of different virus seeds, vaccines, and OPV-like isolates. Nearly complete genomic sequencing results, however, revealed no detectable mutations throughout the genome RNA-plaque purified (RSO)-derived monopool of type 3 OPVs manufactured in MRC-5. Thirty-six years of experience in OPV production, trend analysis, and vaccine surveillance also suggest that: (i) different monopools of serotype 3 OPV produced in MRC-5 retained their phenotypic characteristics (temperature sensitivity and neuroattenuation), (ii) MRC-5 cells support the production of acceptable virus yields, (iii) OPV replicated in the MRC-5 cell substrate is a highly efficient and safe vaccine. These results confirm previous reports that MRC-5 is a desirable cell substrate for the production of OPV. Copyright © 2011 Wiley-Liss, Inc.

Adult high-grade B-cell lymphoma with Burkitt lymphoma signature: genomic features and potential therapeutic targets.

PubMed

Bouska, Alyssa; Bi, Chengfeng; Lone, Waseem; Zhang, Weiwei; Kedwaii, Ambreen; Heavican, Tayla; Lachel, Cynthia M; Yu, Jiayu; Ferro, Roberto; Eldorghamy, Nanees; Greiner, Timothy C; Vose, Julie; Weisenburger, Dennis D; Gascoyne, Randy D; Rosenwald, Andreas; Ott, German; Campo, Elias; Rimsza, Lisa M; Jaffe, Elaine S; Braziel, Rita M; Siebert, Reiner; Miles, Rodney R; Dave, Sandeep; Reddy, Anupama; Delabie, Jan; Staudt, Louis M; Song, Joo Y; McKeithan, Timothy W; Fu, Kai; Green, Michael; Chan, Wing C; Iqbal, Javeed

2017-10-19

The adult high-grade B-cell lymphomas sharing molecular features with Burkitt lymphoma (BL) are highly aggressive lymphomas with poor clinical outcome. High-resolution structural and functional genomic analysis of adult Burkitt lymphoma (BL) and high-grade B-cell lymphoma with BL gene signature (adult-molecularly defined BL [mBL]) revealed the MYC-ARF-p53 axis as the primary deregulated pathway. Adult-mBL had either unique or more frequent genomic aberrations (del13q14, del17p, gain8q24, and gain18q21) compared with pediatric-mBL, but shared commonly mutated genes. Mutations in genes promoting the tonic B-cell receptor (BCR)→PI3K pathway ( TCF3 and ID3 ) did not differ by age, whereas effectors of chronic BCR→NF-κB signaling were associated with adult-mBL. A subset of adult-mBL had BCL2 translocation and mutation and elevated BCL2 mRNA and protein expression, but had a mutation profile similar to mBL. These double-hit lymphomas may have arisen from a tumor precursor that acquired both BCL2 and MYC translocations and/or KMT2D ( MLL2 ) mutation. Gain/amplification of MIR17HG and its paralogue loci was observed in 50% of adult-mBL. In vitro studies suggested miR-17∼92 's role in constitutive activation of BCR signaling and sensitivity to ibrutinib. Overall integrative analysis identified an interrelated gene network affected by copy number and mutation, leading to disruption of the p53 pathway and the BCR→PI3K or NF-κB activation, which can be further exploited in vivo by small-molecule inhibitors for effective therapy in adult-mBL.

Identification of a novel loss-of-function PHEX mutation, Ala720Ser, in a sporadic case of adult-onset hypophosphatemic osteomalacia.

PubMed

Goljanek-Whysall, Katarzyna; Tridimas, Andreas; McCormick, Rachel; Russell, Nicki-Jayne; Sloman, Melissa; Sorani, Alan; Fraser, William D; Hannan, Fadil M

2018-01-01

Adults presenting with sporadic hypophosphatemia and elevations in circulating fibroblast growth factor-23 (FGF23) concentrations are usually investigated for an acquired disorder of FGF23 excess such as tumor induced osteomalacia (TIO). However, in some cases the underlying tumor is not detected, and such patients may harbor other causes of FGF23 excess. Indeed, coding-region and 3'UTR mutations of phosphate-regulating neutral endopeptidase (PHEX), which encodes a cell-surface protein that regulates circulating FGF23 concentrations, can lead to alterations in phosphate homeostasis, which are not detected until adulthood. Here, we report an adult female who presented with hypophosphatemic osteomalacia and raised serum FGF23 concentrations. The patient and her parents, who were her only first-degree relatives, had no history of rickets. The patient was thus suspected of having TIO. However, no tumor had been identified following extensive localization studies. Mutational analysis of the PHEX coding-region and 3'UTR was undertaken, and this revealed the patient to be heterozygous for a novel germline PHEX mutation (c.2158G>T; p.Ala720Ser). In vitro studies involving the expression of WT and mutant PHEX proteins in HEK293 cells demonstrated the Ala720Ser mutation to impair trafficking of PHEX, with ~20% of the mutant protein being expressed at the cell surface, compared to ~80% cell surface expression for WT PHEX (p<0.05). Thus, our studies have identified a pathogenic PHEX mutation in a sporadic case of adult-onset hypophosphatemic osteomalacia, and these findings highlight a role for PHEX gene analysis in some cases of suspected TIO, particularly when no tumor has been identified. Copyright © 2017 Elsevier Inc. All rights reserved.

CNS germinomas are characterized by global demethylation, chromosomal instability and mutational activation of the Kit-, Ras/Raf/Erk- and Akt-pathways

PubMed Central

Schulte, Simone Laura; Waha, Andreas; Steiger, Barbara; Denkhaus, Dorota; Dörner, Evelyn; Calaminus, Gabriele; Leuschner, Ivo; Pietsch, Torsten

2016-01-01

CNS germinomas represent a unique germ cell tumor entity characterized by undifferentiated tumor cells and a high response rate to current treatment protocols. Limited information is available on their underlying genomic, epigenetic and biological alterations. We performed a genome-wide analysis of genomic copy number alterations in 49 CNS germinomas by molecular inversion profiling. In addition, CpG dinucleotide methylation was studied by immunohistochemistry for methylated cytosine residues. Mutational analysis was performed by resequencing of candidate genes including KIT and RAS family members. Ras/Erk and Akt pathway activation was analyzed by immunostaining with antibodies against phospho-Erk, phosho-Akt, phospho-mTOR and phospho-S6. All germinomas coexpressed Oct4 and Kit but showed an extensive global DNA demethylation compared to other tumors and normal tissues. Molecular inversion profiling showed predominant genomic instability in all tumors with a high frequency of regional gains and losses including high level gene amplifications. Activating mutations of KIT exons 11, 13, and 17 as well as a case with genomic KIT amplification and activating mutations or amplifications of RAS gene family members including KRAS, NRAS and RRAS2 indicated mutational activation of crucial signaling pathways. Co-activation of Ras/Erk and Akt pathways was present in 83% of germinomas. These data suggest that CNS germinoma cells display a demethylated nuclear DNA similar to primordial germ cells in early development. This finding has a striking coincidence with extensive genomic instability. In addition, mutational activation of Kit-, Ras/Raf/Erk- and Akt- pathways indicate the biological importance of these pathways and their components as potential targets for therapy. PMID:27391150

Confirmation of Pig-a mutation in flow cytometry-identified CD48-deficient T-lymphocytes from F344 rats.

PubMed

Revollo, Javier; Pearce, Mason G; Petibone, Dayton M; Mittelstaedt, Roberta A; Dobrovolsky, Vasily N

2015-05-01

The Pig-a assay is used for monitoring somatic cell mutation in laboratory animals and humans. The assay detects haematopoietic cells deficient in glycosylphosphatidylinositol (GPI)-anchored protein surface markers using flow cytometry. However, given that synthesis of the protein markers (and the expression of their genes) is independent of the expression of the X-linked Pig-a gene and the function of its enzyme product, the deficiency of markers at the surface of the cells may be caused by a number of events (e.g. by mutation or epigenetic silencing in the marker gene itself or in any of about two dozen autosomal genes involved in the synthesis of GPI). Here we provide direct evidence that the deficiency of the GPI-anchored surface marker CD48 in rat T-cells is accompanied by mutation in the endogenous X-linked Pig-a gene. We treated male F344 rats with N-ethyl-N-nitrosourea (ENU), and established colonies from flow cytometry-identified and sorted CD48-deficient spleen T-lymphocytes. Molecular analysis confirmed that the expanded sorted cells have mutations in the Pig-a gene. The spectrum of Pig-a mutation in our model was consistent with the spectrum of ENU-induced mutation determined in other in vivo models, mostly base-pair substitutions at A:T with the mutated T on the non-transcribed strand of Pig-a genomic DNA. We also used next generation sequencing to derive a similar mutational spectrum from a pool of 64 clones developed from flow-sorted CD48-deficient lymphocytes. Our findings confirm that Pig-a assays detect what they are designed to detect-gene mutation in the Pig-a gene. © The Author 2015. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Modeling the dynamics of chromosomal alteration progression in cervical cancer: A computational model

PubMed Central

2017-01-01

Computational modeling has been applied to simulate the heterogeneity of cancer behavior. The development of Cervical Cancer (CC) is a process in which the cell acquires dynamic behavior from non-deleterious and deleterious mutations, exhibiting chromosomal alterations as a manifestation of this dynamic. To further determine the progression of chromosomal alterations in precursor lesions and CC, we introduce a computational model to study the dynamics of deleterious and non-deleterious mutations as an outcome of tumor progression. The analysis of chromosomal alterations mediated by our model reveals that multiple deleterious mutations are more frequent in precursor lesions than in CC. Cells with lethal deleterious mutations would be eliminated, which would mitigate cancer progression; on the other hand, cells with non-deleterious mutations would become dominant, which could predispose them to cancer progression. The study of somatic alterations through computer simulations of cancer progression provides a feasible pathway for insights into the transformation of cell mechanisms in humans. During cancer progression, tumors may acquire new phenotype traits, such as the ability to invade and metastasize or to become clinically important when they develop drug resistance. Non-deleterious chromosomal alterations contribute to this progression. PMID:28723940

Usefulness of circulating free DNA for monitoring epidermal growth factor receptor mutations in advanced non-small cell lung cancer patients: a case report

PubMed Central

Gonzalez-Cao, Maria; Ramirez, Santiago Viteri; Ariza, Nuria Jordana; Balada, Ariadna; Garzón, Mónica; Teixidó, Cristina; Karachaliou, Niki; Morales-Espinosa, Daniela; Molina-Vila, Miguel Ángel; Rosell, Rafael

2016-01-01

Genomic analysis of circulating tumor DNA (ctDNA) released from cancer cells into the bloodstream has been proposed as a useful method to capture dynamic changes during the course of the disease. In particular, the ability to monitor epidermal growth factor receptor (EGFR) mutation status in cell-free circulating DNA (cfDNA) isolated from advanced non-small cell lung cancer (NSCLC) patients EGFR can help to the correct management of the disease and overcome the challenges associated with tumor heterogeneity and insufficient biopsied material to perform key molecular diagnosis. Here, we report a case of long term monitorization of EGFR mutation status in cfDNA from peripheral blood in an NSCLC patient in, with excellent correlation with clinical evolution. PMID:27826535

Lung-MAP: Talazoparib in Treating Patients With HRRD Positive Recurrent Stage IV Squamous Cell Lung Cancer

ClinicalTrials.gov

2018-05-31

ATM Gene Mutation; ATR Gene Mutation; BARD1 Gene Mutation; BRCA1 Gene Mutation; BRCA2 Gene Mutation; BRIP1 Gene Mutation; CHEK1 Gene Mutation; CHEK2 Gene Mutation; FANCA Gene Mutation; FANCC Gene Mutation; FANCD2 Gene Mutation; FANCF Gene Mutation; FANCM Gene Mutation; NBN Gene Mutation; PALB2 Gene Mutation; RAD51 Gene Mutation; RAD51B Gene Mutation; RAD54L Gene Mutation; Recurrent Squamous Cell Lung Carcinoma; RPA1 Gene Mutation; Stage IV Squamous Cell Lung Carcinoma AJCC v7

Identification of a point mutation in the catalytic domain of the protooncogene c-kit in peripheral blood mononuclear cells of patients who have mastocytosis with an associated hematologic disorder.

PubMed Central

Nagata, H; Worobec, A S; Oh, C K; Chowdhury, B A; Tannenbaum, S; Suzuki, Y; Metcalfe, D D

1995-01-01

Both stem cells and mast cells express c-kit and proliferate after exposure to c-kit ligand. Mutations in c-kit may enhance or interfere with the ability of c-kit receptor to initiate the intracellular pathways resulting in cell proliferation. These observations suggested to us that mastocytosis might in some patients result from mutations in c-kit. cDNA synthesized from peripheral blood mononuclear cells of patients with indolent mastocytosis, mastocytosis with an associated hematologic disorder, aggressive mastocytosis, solitary mastocytoma, and chronic myelomonocytic leukemia unassociated with mastocytosis was thus screened for a mutation of c-kit. This analysis revealed that four of four mastocytosis patients with an associated hematologic disorder with predominantly myelodysplastic features had an A-->T substitution at nt 2468 of c-kit mRNA that causes an Asp-816-->Val substitution. One of one patient examined who had mastocytosis with an associated hematologic disorder had the corresponding mutation in genomic DNA. Identical or similar amino acid substitutions in mast cell lines result in ligand-independent autophosphorylation of the c-kit receptor. This mutation was not identified in the patients within the other disease categories or in 67 of 67 controls. The identification of the point mutation Asp816Val in c-kit in patients with mastocytosis with an associated hematologic disorder provides insight not only into the pathogenesis of this form of mastocytosis but also into how hematopoiesis may become dysregulated and may serve to provide a means of confirming the diagnosis, assessing prognosis, and developing intervention strategies. Images Fig. 1 Fig. 2 Fig. 3 PMID:7479840

Identification of a point mutation in the catalytic domain of the protooncogene c-kit in peripheral blood mononuclear cells of patients who have mastocytosis with an associated hematologic disorder.

PubMed

Nagata, H; Worobec, A S; Oh, C K; Chowdhury, B A; Tannenbaum, S; Suzuki, Y; Metcalfe, D D

1995-11-07

Both stem cells and mast cells express c-kit and proliferate after exposure to c-kit ligand. Mutations in c-kit may enhance or interfere with the ability of c-kit receptor to initiate the intracellular pathways resulting in cell proliferation. These observations suggested to us that mastocytosis might in some patients result from mutations in c-kit. cDNA synthesized from peripheral blood mononuclear cells of patients with indolent mastocytosis, mastocytosis with an associated hematologic disorder, aggressive mastocytosis, solitary mastocytoma, and chronic myelomonocytic leukemia unassociated with mastocytosis was thus screened for a mutation of c-kit. This analysis revealed that four of four mastocytosis patients with an associated hematologic disorder with predominantly myelodysplastic features had an A-->T substitution at nt 2468 of c-kit mRNA that causes an Asp-816-->Val substitution. One of one patient examined who had mastocytosis with an associated hematologic disorder had the corresponding mutation in genomic DNA. Identical or similar amino acid substitutions in mast cell lines result in ligand-independent autophosphorylation of the c-kit receptor. This mutation was not identified in the patients within the other disease categories or in 67 of 67 controls. The identification of the point mutation Asp816Val in c-kit in patients with mastocytosis with an associated hematologic disorder provides insight not only into the pathogenesis of this form of mastocytosis but also into how hematopoiesis may become dysregulated and may serve to provide a means of confirming the diagnosis, assessing prognosis, and developing intervention strategies.

DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

PubMed

Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

2006-02-01

Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I.

PubMed

Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Millán, José M; Kimberling, William J

2012-01-01

PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I

PubMed Central

Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Kimberling, William J.

2012-01-01

Purpose PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Methods Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Results Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Conclusions Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment. PMID:22815625

KRAS driven expression signature has prognostic power superior to mutation status in non-small cell lung cancer.

PubMed

Nagy, Ádám; Pongor, Lőrinc Sándor; Szabó, András; Santarpia, Mariacarmela; Győrffy, Balázs

2017-02-15

KRAS is the most frequently mutated oncogene in non-small cell lung cancer (NSCLC). However, the prognostic role of KRAS mutation status in NSCLC still remains controversial. We hypothesize that the expression changes of genes affected by KRAS mutation status will have the most prominent effect and could be used as a prognostic signature in lung cancer. We divided NSCLC patients with mutation and RNA-seq data into KRAS mutated and wild type groups. Mann-Whitney test was used to identify genes showing altered expression between these cohorts. Mean expression of the top five genes was designated as a "transcriptomic fingerprint" of the mutation. We evaluated the effect of this signature on clinical outcome in 2,437 NSCLC patients using univariate and multivariate Cox regression analysis. Mutation of KRAS was most common in adenocarcinoma. Mutation status and KRAS expression were not correlated to prognosis. The transcriptomic fingerprint of KRAS include FOXRED2, KRAS, TOP1, PEX3 and ABL2. The KRAS signature had a high prognostic power. Similar results were achieved when using the second and third set of strongest genes. Moreover, all cutoff values delivered significant prognostic power (p < 0.01). The KRAS signature also remained significant (p < 0.01) in a multivariate analysis including age, gender, smoking history and tumor stage. We generated a "surrogate signature" of KRAS mutation status in NSCLC patients by computationally linking genotype and gene expression. We show that secondary effects of a mutation can have a higher prognostic relevance than the primary genetic alteration itself. © 2016 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

Clinical correlates of the presence of the Asp816Val c-kit mutation in the peripheral blood mononuclear cells of patients with mastocytosis.

PubMed

Worobec, A S; Semere, T; Nagata, H; Metcalfe, D D

1998-11-15

The Asp816Val mutation in the catalytic domain of the c-kit receptor has been identified in patients with systemic mastocytosis. To determine whether this mutation is associated with identifiable clinical patterns of disease and prognosis, a total of 65 patients with mastocytosis were screened for the presence of the Asp816Val mutation in peripheral blood mononuclear cells (PBMCs). By analysis of HinfI digestion products, the authors found that the overall prevalence of this mutation in the current patient series was 25%. The presence of the Asp816Val mutation in PBMCs was observed in 15 adults (of 16 Asp816Val mutation positive patients) and 1 infant, but not in any children with mastocytosis. Patients whose PBMCs were positive for this mutation (category II and a subset of category Ib mastocytosis patients) manifested a more severe disease pattern, with clinical features ranging in severity from early to advanced myelodysplastic or myeloproliferative syndromes. These patients more commonly had osteosclerotic bone involvement (a clinical feature primarily observed in mastocytosis patients with an associated hematologic disorder) as well as immunoglobulin dysregulation and peripheral blood abnormalities. Furthermore, pedigree analysis of three families provided evidence that the mutation was somatic. Twenty-five percent of all patients with mastocytosis had the Asp816Val mutation in PBMCs; 56% of these patients had evidence of a myelodysplastic or myeloproliferative syndrome, and 44% had been clinically placed in the indolent mastocytosis category, suggesting that the current classification scheme used to assign prognosis may be inadequate. Therefore, determination of the presence or absence of this mutation in PBMCs of mastocytosis patients offers a useful adjunct in determining the extent of workup and assigning prognosis in this complex and heterogeneous disease.

Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma.

PubMed

Coco, Simona; De Mariano, Marilena; Valdora, Francesca; Servidei, Tiziana; Ridola, Vita; Andolfo, Immacolata; Oberthuer, André; Tonini, Gian Paolo; Longo, Luca

2012-10-01

The anaplastic lymphoma kinase (ALK) gene has been found either rearranged or mutated in several neoplasms such as anaplastic large-cell lymphoma, non-small-cell lung cancer, neuroblastoma and anaplastic thyroid cancer. Medulloblastoma (MB) is an embryonic pediatric cancer arising from nervous system, a tissue in which ALK is expressed during embryonic development. We performed an ALK mutation screening in 52 MBs and we found a novel heterozygous germline deletion of a single base in exon 23 (3605delG) in a case with marked anaplasia. This G deletion results in a frameshift mutation producing a premature stop codon in exon 25 of ALK tyrosine kinase domain. We also screened three human MB cell lines without finding any mutation of ALK gene. Quantitative expression analysis of 16 out of 52 samples showed overexpression of ALK mRNA in three MBs. In the present study, we report the first mutation of ALK found in MB. Moreover, a deletion of ALK gene producing a stop codon has not been detected in human tumors up to now. Further investigations are now required to elucidate whether the truncated form of ALK may have a role in signal transduction.

Identifying EGFR-Expressed Cells and Detecting EGFR Multi-Mutations at Single-Cell Level by Microfluidic Chip

NASA Astrophysics Data System (ADS)

Li, Ren; Zhou, Mingxing; Li, Jine; Wang, Zihua; Zhang, Weikai; Yue, Chunyan; Ma, Yan; Peng, Hailin; Wei, Zewen; Hu, Zhiyuan

2018-03-01

EGFR mutations companion diagnostics have been proved to be crucial for the efficacy of tyrosine kinase inhibitor targeted cancer therapies. To uncover multiple mutations occurred in minority of EGFR-mutated cells, which may be covered by the noises from majority of un-mutated cells, is currently becoming an urgent clinical requirement. Here we present the validation of a microfluidic-chip-based method for detecting EGFR multi-mutations at single-cell level. By trapping and immunofluorescently imaging single cells in specifically designed silicon microwells, the EGFR-expressed cells were easily identified. By in situ lysing single cells, the cell lysates of EGFR-expressed cells were retrieved without cross-contamination. Benefited from excluding the noise from cells without EGFR expression, the simple and cost-effective Sanger's sequencing, but not the expensive deep sequencing of the whole cell population, was used to discover multi-mutations. We verified the new method with precisely discovering three most important EGFR drug-related mutations from a sample in which EGFR-mutated cells only account for a small percentage of whole cell population. The microfluidic chip is capable of discovering not only the existence of specific EGFR multi-mutations, but also other valuable single-cell-level information: on which specific cells the mutations occurred, or whether different mutations coexist on the same cells. This microfluidic chip constitutes a promising method to promote simple and cost-effective Sanger's sequencing to be a routine test before performing targeted cancer therapy.[Figure not available: see fulltext.

High resolution melting analysis for epidermal growth factor receptor mutations in formalin-fixed paraffin-embedded tissue and plasma free DNA from non-small cell lung cancer patients.

PubMed

Jing, Chang-Wen; Wang, Zhuo; Cao, Hai-Xia; Ma, Rong; Wu, Jian-Zhong

2014-01-01

The aim of the research was to explore a cost effective, fast, easy to perform, and sensitive method for epidermal growth factor receptor (EGFR) mutation testing. High resolution melting analysis (HRM) was introduced to evaluate the efficacy of the analysis for dectecting EGFR mutations in exons 18 to 21 using formalin-fixed paraffin-embedded (FFPE) tissues and plasma free DNA from 120 patients. The total EGFR mutation rate was 37.5% (45/120) detected by direct sequencing. There were 48 mutations in 120 FFPE tissues assessed by HRM. For plasma free DNA, the EGFR mutation rate was 25.8% (31/120). The sensitivity of HRM assays in FFPE samples was 100% by HRM. There was a low false-positive mutation rate but a high false-negative rate in plasma free DNA detected by HRM. Our results show that HRM analysis has the advantage of small tumor sample need. HRM applied with plasma free DNA showed a high false-negative rate but a low false-positive rate. Further research into appropriate methods and analysis needs to be performed before HRM for plasma free DNA could be accepted as an option in diagnostic or screening settings.

Single-cell codetection of metabolic activity, intracellular functional proteins, and genetic mutations from rare circulating tumor cells.

PubMed

Zhang, Yu; Tang, Yin; Sun, Shuai; Wang, Zhihua; Wu, Wenjun; Zhao, Xiaodong; Czajkowsky, Daniel M; Li, Yan; Tian, Jianhui; Xu, Ling; Wei, Wei; Deng, Yuliang; Shi, Qihui

2015-10-06

The high glucose uptake and activation of oncogenic signaling pathways in cancer cells has long made these features, together with the mutational spectrum, prime diagnostic targets of circulating tumor cells (CTCs). Further, an ability to characterize these properties at a single cell resolution is widely believed to be essential, as the known extensive heterogeneity in CTCs can obscure important correlations in data obtained from cell population-based methods. However, to date, it has not been possible to quantitatively measure metabolic, proteomic, and genetic data from a single CTC. Here we report a microchip-based approach that allows for the codetection of glucose uptake, intracellular functional proteins, and genetic mutations at the single-cell level from rare tumor cells. The microchip contains thousands of nanoliter grooves (nanowells) that isolate individual CTCs and allow for the assessment of their glucose uptake via imaging of a fluorescent glucose analog, quantification of a panel of intracellular signaling proteins using a miniaturized antibody barcode microarray, and retrieval of the individual cell nuclei for subsequent off-chip genome amplification and sequencing. This approach integrates molecular-scale information on the metabolic, proteomic, and genetic status of single cells and permits the inference of associations between genetic signatures, energy consumption, and phosphoproteins oncogenic signaling activities in CTCs isolated from blood samples of patients. Importantly, this microchip chip-based approach achieves this multidimensional molecular analysis with minimal cell loss (<20%), which is the bottleneck of the rare cell analysis.

Heavy ion induced mutations in mammalian cells: Cross sections and molecular analysis

NASA Technical Reports Server (NTRS)

Stoll, U.; Schmidt, P.; Schneider, E.; Kiefer, J.

1994-01-01

Our investigations of heavy ion-induced mutations in mammalian cells, which had been begun a few years ago, were systematically continued. For the first time, it was possible to cover a large LET range with a few kinds of ions. To do this, both UNILAC and SIS were used to yield comparable data for a large energy range. This is a necessary condition for a comprehensive description of the influence of such ion parameters as energy and LET. In these experiments, the induced resistance against the poison 6-thioguanin (6-TG), which is linked to the HPRT locus on the genome, is being used as mutation system. In addition to the mutation-induction cross-section measurements, the molecular changes of the DNA are being investigated by means of Multiplex PCR ('Polymerase Chain Reaction') gene amplification. From these experiments we expect further elucidation of the mutation-inducing mechanisms composing the biological action of heavy-ion radiation.

Autosomal dominant polycystic kidney disease caused by somatic and germline mosaicism.

PubMed

Tan, A Y; Blumenfeld, J; Michaeel, A; Donahue, S; Bobb, W; Parker, T; Levine, D; Rennert, H

2015-04-01

Autosomal dominant polycystic kidney disease (ADPKD) is a heterogeneous genetic disorder caused by loss of function mutations of PKD1 or PKD2 genes. Although PKD1 is highly polymorphic and the new mutation rate is relatively high, the role of mosaicism is incompletely defined. Herein, we describe the molecular analysis of ADPKD in a 19-year-old female proband and her father. The proband had a PKD1 truncation mutation c.10745dupC (p.Val3584ArgfsX43), which was absent in paternal peripheral blood lymphocytes (PBL). However, very low quantities of this mutation were detected in the father's sperm DNA, but not in DNA from his buccal cells or urine sediment. Next generation sequencing (NGS) analysis determined the level of this mutation in the father's PBL, buccal cells and sperm to be ∼3%, 4.5% and 10%, respectively, consistent with somatic and germline mosaicism. The PKD1 mutation in ∼10% of her father's sperm indicates that it probably occurred early in embryogenesis. In ADPKD cases where a de novo mutation is suspected because of negative PKD gene testing of PBL, additional evaluation with more sensitive methods (e.g. NGS) of the proband PBL and paternal sperm can enhance detection of mosaicism and facilitate genetic counseling. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

TP53, STK11 and EGFR Mutations Predict Tumor Immune Profile and the Response to anti-PD-1 in Lung Adenocarcinoma.

PubMed

Biton, Jerome; Mansuet-Lupo, Audrey; Pécuchet, Nicolas; Alifano, Marco; Ouakrim, Hanane; Arrondeau, Jennifer; Boudou-Rouquette, Pascaline; Goldwasser, Francois; Leroy, Karen; Goc, Jeremy; Wislez, Marie; Germain, Claire; Laurent-Puig, Pierre; Dieu-Nosjean, Marie-Caroline; Cremer, Isabelle; Herbst, Ronald; Blons, Hélène F; Damotte, Diane

2018-05-15

By unlocking anti-tumor immunity, antibodies targeting programmed cell death 1 (PD-1) exhibit impressive clinical results in non-small cell lung cancer, underlining the strong interactions between tumor and immune cells. However, factors that can robustly predict long-lasting responses are still needed. We performed in depth immune profiling of lung adenocarcinoma using an integrative analysis based on immunohistochemistry, flow-cytometry and transcriptomic data. Tumor mutational status was investigated using next-generation sequencing. The response to PD-1 blockers was analyzed from a prospective cohort according to tumor mutational profiles and to PD-L1 expression, and a public clinical database was used to validate the results obtained. We showed that distinct combinations of STK11 , EGFR and TP53 mutations, were major determinants of the tumor immune profile (TIP) and of the expression of PD-L1 by malignant cells. Indeed, the presence of TP53 mutations without co-occurring STK11 or EGFR alterations ( TP53 -mut/ STK11 - EGFR -WT), independently of KRAS mutations, identified the group of tumors with the highest CD8 T cell density and PD-L1 expression. In this tumor subtype, pathways related to T cell chemotaxis, immune cell cytotoxicity, and antigen processing were up-regulated. Finally, a prolonged progression-free survival (PFS: HR=0.32; 95% CI, 0.16-0.63, p <0.001) was observed in anti-PD-1 treated patients harboring TP53 -mut/ STK11 - EGFR -WT tumors. This clinical benefit was even more remarkable in patients with associated strong PD-L1 expression. Our study reveals that different combinations of TP53 , EGFR and STK11 mutations , together with PD-L1 expression by tumor cells, represent robust parameters to identify best responders to PD-1 blockade. Copyright ©2018, American Association for Cancer Research.

Comparative analysis of cell killing and autosomal mutation in mouse kidney epithelium exposed to 1 GeV protons in vitro or in vivo.

PubMed

Kronenberg, Amy; Gauny, Stacey; Kwoh, Ely; Grossi, Gianfranco; Dan, Cristian; Grygoryev, Dmytro; Lasarev, Michael; Turker, Mitchell S

2013-05-01

Human exposure to high-energy protons occurs in space flight scenarios or, where necessary, during radiotherapy for cancer or benign conditions. However, few studies have assessed the mutagenic effectiveness of high-energy protons, which may contribute to cancer risk. Mutations cause cancer and most cancer-associated mutations occur at autosomal loci. This study addresses the cytotoxic and mutagenic effects of 1 GeV protons in mouse kidney epithelium. Mutant fractions were measured for an endogenous autosomal locus (Aprt) that detects all types of mutagenic events. Results for kidneys irradiated in vivo are compared with the results for kidney cells from the same strain exposed in vitro. The results demonstrate dose-dependent cell killing in vitro and for cells explanted 3-4 months postirradiation in vivo. Incubation in vivo for longer periods (8-9 months) further attenuates proton-induced cell killing. Protons are mutagenic to cells in vitro and for in vivo irradiated kidneys. The dose-response for Aprt mutation is curvilinear after in vitro or in vivo exposure, bending upward at the higher doses. While the absolute mutant fractions are higher in vivo, the fold-increase over background is similar for both in vitro and in situ exposures. Results are also presented for a limited study on the effect of dose fractionation on the induction of Aprt mutations in kidney epithelial cells. Dose-fractionation reduces the fraction of proton-induced Aprt mutants in vitro and in vivo and also results in less cell killing. Taken together, the mutation burden in the epithelium is slightly reduced by dose-fractionation. Autosomal mutations accumulated during clinical exposure to high-energy protons may contribute to the risk of treatment-associated neoplasms, thereby highlighting the need for rigorous treatment planning to reduce the dose to normal tissues. For low dose exposures that occur during most space flight scenarios, the mutagenic effects of protons appear to be modest.

Detection of somatic mutations by high-resolution DNA melting (HRM) analysis in multiple cancers.

PubMed

Gonzalez-Bosquet, Jesus; Calcei, Jacob; Wei, Jun S; Garcia-Closas, Montserrat; Sherman, Mark E; Hewitt, Stephen; Vockley, Joseph; Lissowska, Jolanta; Yang, Hannah P; Khan, Javed; Chanock, Stephen

2011-01-17

Identification of somatic mutations in cancer is a major goal for understanding and monitoring the events related to cancer initiation and progression. High resolution melting (HRM) curve analysis represents a fast, post-PCR high-throughput method for scanning somatic sequence alterations in target genes. The aim of this study was to assess the sensitivity and specificity of HRM analysis for tumor mutation screening in a range of tumor samples, which included 216 frozen pediatric small rounded blue-cell tumors as well as 180 paraffin-embedded tumors from breast, endometrial and ovarian cancers (60 of each). HRM analysis was performed in exons of the following candidate genes known to harbor established commonly observed mutations: PIK3CA, ERBB2, KRAS, TP53, EGFR, BRAF, GATA3, and FGFR3. Bi-directional sequencing analysis was used to determine the accuracy of the HRM analysis. For the 39 mutations observed in frozen samples, the sensitivity and specificity of HRM analysis were 97% and 87%, respectively. There were 67 mutation/variants in the paraffin-embedded samples, and the sensitivity and specificity for the HRM analysis were 88% and 80%, respectively. Paraffin-embedded samples require higher quantity of purified DNA for high performance. In summary, HRM analysis is a promising moderate-throughput screening test for mutations among known candidate genomic regions. Although the overall accuracy appears to be better in frozen specimens, somatic alterations were detected in DNA extracted from paraffin-embedded samples.

Detection of Somatic Mutations by High-Resolution DNA Melting (HRM) Analysis in Multiple Cancers

PubMed Central

Gonzalez-Bosquet, Jesus; Calcei, Jacob; Wei, Jun S.; Garcia-Closas, Montserrat; Sherman, Mark E.; Hewitt, Stephen; Vockley, Joseph; Lissowska, Jolanta; Yang, Hannah P.; Khan, Javed; Chanock, Stephen

2011-01-01

Identification of somatic mutations in cancer is a major goal for understanding and monitoring the events related to cancer initiation and progression. High resolution melting (HRM) curve analysis represents a fast, post-PCR high-throughput method for scanning somatic sequence alterations in target genes. The aim of this study was to assess the sensitivity and specificity of HRM analysis for tumor mutation screening in a range of tumor samples, which included 216 frozen pediatric small rounded blue-cell tumors as well as 180 paraffin-embedded tumors from breast, endometrial and ovarian cancers (60 of each). HRM analysis was performed in exons of the following candidate genes known to harbor established commonly observed mutations: PIK3CA, ERBB2, KRAS, TP53, EGFR, BRAF, GATA3, and FGFR3. Bi-directional sequencing analysis was used to determine the accuracy of the HRM analysis. For the 39 mutations observed in frozen samples, the sensitivity and specificity of HRM analysis were 97% and 87%, respectively. There were 67 mutation/variants in the paraffin-embedded samples, and the sensitivity and specificity for the HRM analysis were 88% and 80%, respectively. Paraffin-embedded samples require higher quantity of purified DNA for high performance. In summary, HRM analysis is a promising moderate-throughput screening test for mutations among known candidate genomic regions. Although the overall accuracy appears to be better in frozen specimens, somatic alterations were detected in DNA extracted from paraffin-embedded samples. PMID:21264207

A Homozygous Missense Mutation in TGM5 Abolishes Epidermal Transglutaminase 5 Activity and Causes Acral Peeling Skin Syndrome

PubMed Central

Cassidy, Andrew J.; van Steensel, Maurice A. M.; Steijlen, Peter M.; van Geel, Michel; Velden, Jaap van der; Morley, Susan M.; Terrinoni, Alessandro; Melino, Gerry; Candi, Eleonora; McLean, W. H. Irwin

2005-01-01

Peeling skin syndrome is an autosomal recessive genodermatosis characterized by the shedding of the outer epidermis. In the acral form, the dorsa of the hands and feet are predominantly affected. Ultrastructural analysis has revealed tissue separation at the junction between the granular cells and the stratum corneum in the outer epidermis. Genomewide linkage analysis in a consanguineous Dutch kindred mapped the gene to 15q15.2 in the interval between markers D15S1040 and D15S1016. Two homozygous missense mutations, T109M and G113C, were found in TGM5, which encodes transglutaminase 5 (TG5), in all affected persons in two unrelated families. The mutation was present on the same haplotype in both kindreds, indicating a probable ancestral mutation. TG5 is strongly expressed in the epidermal granular cells, where it cross-links a variety of structural proteins in the terminal differentiation of the epidermis to form the cornified cell envelope. An established, in vitro, biochemical cross-linking assay revealed that, although T109M is not pathogenic, G113C completely abolishes TG5 activity. Three-dimensional modeling of TG5 showed that G113C lies close to the catalytic domain, and, furthermore, that this glycine residue is conserved in all known transglutaminases, which is consistent with pathogenicity. Other families with more-widespread peeling skin phenotypes lacked TGM5 mutations. This study identifies the first causative gene in this heterogeneous group of skin disorders and demonstrates that the protein cross-linking function performed by TG5 is vital for maintaining cell-cell adhesion between the outermost layers of the epidermis. PMID:16380904

Investigation of binding phenomenon of NSP3 and p130Cas mutants and their effect on cell signalling.

PubMed

Balu K; Rajendran, Vidya; Sethumadhavan, Rao; Purohit, Rituraj

2013-11-01

Members of the novel SH2-containing protein (NSP3) and Crk-associated substrate (p130Cas) protein families form a multi-domain signalling platforms that mediate cell signalling process. We analysed the damaging consequences of three mutations, each from NSP3 (NSP3(L469R), NSP3(L623E), NSP3(R627E)) and p130Cas (p130Cas(F794R), p130Cas(L787E), p130Cas(D797R)) protein with respect to their native biological partners. Mutations depicted notable loss in interaction affinity towards their corresponding biological partners. NSP3(L469R) and p130Cas(D797R) mutations were predicted as most prominent in docking analysis. Molecular dynamics (MD) studies were conducted to evaluate structural consequences of most prominent mutation in NSP3 and p130Cas obtained from the docking analysis. MD analysis confirmed that mutation in NSP3(L469R) and p130Cas(D797R) showed significant structural deviation, changes in conformations and increased flexibility, which in turn affected the binding affinity with their biological partners. Moreover, the root mean square fluctuation has indicated a rise in fluctuation of residues involved in moderate interaction acquired between the NSP3 and p130Cas. It has significantly affected the binding interaction in mutant complexes. The results obtained in this work present a detailed overview of molecular mechanisms involved in the loss of cell signalling associated with NSP3 and p130Cas protein.

Differential chemosensitivity to antifolate drugs between RAS and BRAF melanoma cells

PubMed Central

2014-01-01

Background The importance of the genetic background of cancer cells for the individual susceptibility to cancer treatments is increasingly apparent. In melanoma, the existence of a BRAF mutation is a main predictor for successful BRAF-targeted therapy. However, despite initial successes with these therapies, patients relapse within a year and have to move on to other therapies. Moreover, patients harbouring a wild type BRAF gene (including 25% with NRAS mutations) still require alternative treatment such as chemotherapy. Multiple genetic parameters have been associated with response to chemotherapy, but despite their high frequency in melanoma nothing is known about the impact of BRAF or NRAS mutations on the response to chemotherapeutic agents. Methods Using cell proliferation and DNA methylation assays, FACS analysis and quantitative-RT-PCR we have characterised the response of a panel of NRAS and BRAF mutant melanoma cell lines to various chemotherapy drugs, amongst them dacarbazine (DTIC) and temozolomide (TMZ) and DNA synthesis inhibitors. Results Although both, DTIC and TMZ act as alkylating agents through the same intermediate, NRAS and BRAF mutant cells responded differentially only to DTIC. Further analysis revealed that the growth-inhibitory effects mediated by DTIC were rather due to interference with nucleotide salvaging, and that NRAS mutant melanoma cells exhibit higher activity of the nucleotide synthesis enzymes IMPDH and TK1. Importantly, the enhanced ability of RAS mutant cells to use nucleotide salvaging resulted in resistance to DHFR inhibitors. Conclusion In summary, our data suggest that the genetic background in melanoma cells influences the response to inhibitors blocking de novo DNA synthesis, and that defining the RAS mutation status could be used to stratify patients for the use of antifolate drugs. PMID:24941944

Association of expression of the hedgehog signal with Merkel cell polyomavirus infection and prognosis of Merkel cell carcinoma.

PubMed

Kuromi, Teruyuki; Matsushita, Michiko; Iwasaki, Takeshi; Nonaka, Daisuke; Kuwamoto, Satoshi; Nagata, Keiko; Kato, Masako; Akizuki, Gen; Kitamura, Yukisato; Hayashi, Kazuhiko

2017-11-01

Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer that mostly occurs in the elderly. Merkel cell polyomavirus (MCPyV) is detected in approximately 80% of MCCs and is associated with carcinogenesis. Hedgehog signaling pathway plays a role in human embryogenesis and organogenesis. In addition, reactivation of this pathway later in life can cause tumors. Twenty-nineMCPyV-positive and 21 MCPyV-negative MCCs were immunohistochemically stained with primary antibodies for hedgehog signaling (SHH, IHH, PTCH1, SMO, GLI1, GLI2, and GLI3) and evaluated using H-score. Polymerase chain reaction and sequence analysis for SHH and GLI1 exons were also performed. Expression of SHH was higher in MCPyV-positive MCCs than in MCPyV-negative MCCs (P<.001). Higher expression of GLI1, MCPyV infection, male sex, and Japanese ethnicity were associated with better overall survival (P=.034, P=.001, P=.042, and P=.036, respectively). Higher expression of SHH and MCPyV infection were associated with improved MCC-specific survival (P=.037 and P=.002, respectively). The mutation analysis of prognosis-related GLI1 and SHH genes in our study revealed a low frequency of mutations in the 10 exons examined, except GLI1 exon 5 (18/22 cases), all having the same silent mutation of c.576G>A. Only 2 mutations with amino acid changes were detected in MCPyV-negative MCCs only: 1 missense mutation in GLI1 exon 4 and 1 nonsense mutation in SHH-3B. Expression of SHH and GLI1 may be useful prognostic markers of MCC because increased expression was associated with better prognosis. The high rate of c.576G>A silent mutation in GLI1 exon 5 was a feature of MCC. Copyright © 2017 Elsevier Inc. All rights reserved.

Multiplex picoliter-droplet digital PCR for quantitative assessment of EGFR mutations in circulating cell-free DNA derived from advanced non-small cell lung cancer patients

PubMed Central

Yu, Qian; Huang, Fei; Zhang, Meilin; Ji, Haiying; Wu, Shenchao; Zhao, Ying; Zhang, Chunyan; Wu, Jiong; Wang, Beili; Pan, Baisheng; Zhang, Xin; Guo, Wei

2017-01-01

To explore the possible diagnostic value of liquid biopsy, two multiplex panels using picoliter-droplet digital polymerase chain reaction (ddPCR) were established to quantitatively assess the epidermal growth factor receptor (EGFR) mutations in cell-free DNA (cfDNA) extracted from the plasma of advanced non-small cell lung cancer (NSCLC) patients. Plasma samples derived from 22 patients with stage IIIB/IV NSCLC harboring EGFR mutations in matched tumor tissues confirmed by amplification refractory mutation system (ARMS) analysis were subjected to two multiplex ddPCR panels to assess the abundance of tyrosine kinase inhibitor (TKI) -sensitive (19DEL, L858R) and TKI-resistant (T790 M) mutations. Fluctuations in EGFR mutant abundance were monitored by either of the multiplex ddPCR panels for three patients undergoing EGFR-TKI treatment, with serial plasma sample collections over 2 months. The multiplex ddPCR panels applied to plasma cfDNA from advanced NSCLC patients achieved a total concordance rate of 80% with the EGFR mutation profiles obtained by ARMS from matched biopsy tumor specimens (90% for 19DEL, 95% for L858R, 95% for T790M, respectively) and revealed additional mutant alleles in two subjects. The respective sensitivity and specificity were 90.9 and 88.9% for 19DEL, 87.5 and 100% for L858R, 100 and 93.8% for T790M. The fluctuations of EGFR mutant abundance in serial plasma cfDNA were in accordance with the changes in tumor size as assessed by imaging scans. The authors demonstrated the utility of multiplex ddPCR panels with ultra-sensitivity for quantitative analysis of EGFR mutations in plasma cfDNA and obtained promising usefulness in EGFR-TKI decision-making for advanced NSCLC patients. PMID:29067441

Mutational analysis of cutaneous squamous cell carcinomas and verrucal keratosis in patients taking BRAF inhibitors.

PubMed

Anforth, Rachael; Tembe, Varsha; Blumetti, Tatiana; Fernandez-Peñas, Pablo

2012-09-01

B-RAF inhibitors (BRAFi) have been shown to improve rates of overall and progression-free survival in patients with stage IV metastatic melanoma positive for the BRAF V600E mutation. However, the main drawback is the development of verrucal keratosis (hyperkeratotic papules with verruca-like characteristics with benign histological findings) and cutaneous squamous cell carcinomas (cuSCC). We have found upstream mutations in RAS as well as PIK3CA in both verrucal keratosis and cuSCC. This suggests that verrucal keratosis is an early clinical presentation of cuSCC in patients on BRAFi. © 2012 John Wiley & Sons A/S.

Mutations in valosin-containing protein (VCP) decrease ADP/ATP translocation across the mitochondrial membrane and impair energy metabolism in human neurons

PubMed Central

Arber, Charles; Bartolome, Fernando; de Vicente, Macarena; Houlden, Henry

2017-01-01

Mutations in the gene encoding valosin-containing protein (VCP) lead to multisystem proteinopathies including frontotemporal dementia. We have previously shown that patient-derived VCP mutant fibroblasts exhibit lower mitochondrial membrane potential, uncoupled respiration, and reduced ATP levels. This study addresses the underlying basis for mitochondrial uncoupling using VCP knockdown neuroblastoma cell lines, induced pluripotent stem cells (iPSCs), and iPSC-derived cortical neurons from patients with pathogenic mutations in VCP. Using fluorescent live cell imaging and respiration analysis we demonstrate a VCP mutation/knockdown-induced dysregulation in the adenine nucleotide translocase, which results in a slower rate of ADP or ATP translocation across the mitochondrial membranes. This deregulation can explain the mitochondrial uncoupling and lower ATP levels in VCP mutation-bearing neurons via reduced ADP availability for ATP synthesis. This study provides evidence for a role of adenine nucleotide translocase in the mechanism underlying altered mitochondrial function in VCP-related degeneration, and this new insight may inform efforts to better understand and manage neurodegenerative disease and other proteinopathies. PMID:28360103

[Stress-induced cellular adaptive mutagenesis].

PubMed

Zhu, Linjiang; Li, Qi

2014-04-01

The adaptive mutations exist widely in the evolution of cells, such as antibiotic resistance mutations of pathogenic bacteria, adaptive evolution of industrial strains, and cancerization of human somatic cells. However, how these adaptive mutations are generated is still controversial. Based on the mutational analysis models under the nonlethal selection conditions, stress-induced cellular adaptive mutagenesis is proposed as a new evolutionary viewpoint. The hypothetic pathway of stress-induced mutagenesis involves several intracellular physiological responses, including DNA damages caused by accumulation of intracellular toxic chemicals, limitation of DNA MMR (mismatch repair) activity, upregulation of general stress response and activation of SOS response. These responses directly affect the accuracy of DNA replication from a high-fidelity manner to an error-prone one. The state changes of cell physiology significantly increase intracellular mutation rate and recombination activity. In addition, gene transcription under stress condition increases the instability of genome in response to DNA damage, resulting in transcription-associated DNA mutagenesis. In this review, we summarize these two molecular mechanisms of stress-induced mutagenesis and transcription-associated DNA mutagenesis to help better understand the mechanisms of adaptive mutagenesis.

Mutational profiles of Brenner tumors show distinctive features uncoupling urothelial carcinomas and ovarian carcinoma with transitional cell histology.

PubMed

Pfarr, Nicole; Darb-Esfahani, Silvia; Leichsenring, Jonas; Taube, Eliane; Boxberg, Melanie; Braicu, Ioana; Jesinghaus, Moritz; Penzel, Roland; Endris, Volker; Noske, Aurelia; Weichert, Wilko; Schirmacher, Peter; Denkert, Carsten; Stenzinger, Albrecht

2017-10-01

Brenner tumors (BT) are rare ovarian tumors encompassing benign, borderline, and malignant variants. While the histopathology of BTs and their clinical course is well described, little is known about the underlying genetic defects. We employed targeted next generation sequencing to analyze the mutational landscape in a cohort of 23 BT cases (17 benign, 2 borderline, and 4 malignant) and 3 ovarian carcinomas with transitional cell histology (TCC). Copy number variations (CNV) were validated by fluorescence in-situ hybridization (FISH) and quantitative PCR-based copy number assays. Additionally, we analyzed the TERT promotor region by conventional Sanger sequencing. We identified 25 different point mutations in 23 of the analyzed genes in BTs and 10 mutations in 8 genes in TCCs. About 57% percent of mutations occurred in genes involved in cell cycle control, DNA repair, and epigenetic regulation processes. All TCC cases harbored TP53 mutations whereas all BTs were negative and none of the mutations observed in BTs were present in TCCs. CNV analysis revealed recurrent MDM2 amplifications in 3 out of 4 of the malignant BT cases with one case harboring a concomitant amplification of CCND1. No mutations were observed in the TERT promoter region in BTs and TCCs, which is mutated in about 50%-75% of urothelial carcinoma and in 16% of ovarian clear-cell carcinomas. In conclusion, our study highlights distinct genetic features of BTs, and detection of the triplet phenotype MDM2 amplification/TP53 wt/TERT wt may aid diagnosis of malignant BT in difficult cases. Moreover, selected genetic lesions may be clinically exploitable in a metastatic setting. © 2017 Wiley Periodicals, Inc.

The impact of KRAS mutations on VEGF-A production and tumour vascular network

PubMed Central

2013-01-01

Background The malignant potential of tumour cells may be influenced by the molecular nature of KRAS mutations being codon 13 mutations less aggressive than codon 12 ones. Their metabolic profile is also different, with an increased anaerobic glycolytic metabolism in cells harbouring codon 12 KRAS mutations compared with cells containing codon 13 mutations. We hypothesized that this distinct metabolic behaviour could be associated with different HIF-1α expression and a distinct angiogenic profile. Methods Codon13 KRAS mutation (ASP13) or codon12 KRAS mutation (CYS12) NIH3T3 transfectants were analyzed in vitro and in vivo. Expression of HIF-1α, and VEGF-A was studied at RNA and protein levels. Regulation of VEGF-A promoter activity was assessed by means of luciferase assays using different plasmid constructs. Vascular network was assessed in tumors growing after subcutaneous inoculation. Non parametric statistics were used for analysis of results. Results Our results show that in normoxic conditions ASP13 transfectants exhibited less HIF-1α protein levels and activity than CYS12. In contrast, codon 13 transfectants exhibited higher VEGF-A mRNA and protein levels and enhanced VEGF-A promoter activity. These differences were due to a differential activation of Sp1/AP2 transcription elements of the VEGF-A promoter associated with increased ERKs signalling in ASP13 transfectants. Subcutaneous CYS12 tumours expressed less VEGF-A and showed a higher microvessel density (MVD) than ASP13 tumours. In contrast, prominent vessels were only observed in the latter. Conclusion Subtle changes in the molecular nature of KRAS oncogene activating mutations occurring in tumour cells have a major impact on the vascular strategy devised providing with new insights on the role of KRAS mutations on angiogenesis. PMID:23506169

Sequencing analysis of mutations induced by N-ethyl-N-nitrosourea at different sampling times in mouse bone marrow.

PubMed

Wang, Jianyong; Chen, Tao

2010-03-01

In our previous study (Wang et al., 2004, Toxicol. Sci. 82: 124-128), we observed that the cII gene mutant frequency (MF) in the bone marrow of Big Blue mice showed significant increase as early as day 1, reached the maximum at day 3 and then decreased to a plateau by day 15 after a single dose of carcinogen N-ethyl-N-nitrosourea (ENU) treatment, which is different from the longer mutation manifestation time and the constancy of MFs after reaching their maximum in some other tissues. To determine the mechanism underlying the quick increase in MF and the peak formation in the mutant manifestation, we examined the mutation frequencies and spectra of the ENU-induced mutants collected from different sampling times in this study. The cII mutants from days 1, 3 and 120 after ENU treatment were randomly selected from different animals. The mutation frequencies were 33, 217, 305 and 144 x 10(-6) for control, days 1, 3, and 120, respectively. The mutation spectra at days 1 and 3 were significantly different from that at day 120. Considering that stem cells are responsible for the ultimate MF plateau (day 120) and transit cells are accountable for the earlier MF induction (days 1 or 3) in mouse bone marrow, we conclude that transit cells are much more sensitive to mutation induction than stem cells in mouse bone marrow, which resulted in the specific mutation manifestation induced by ENU.

Mutational analysis using Sanger and next generation sequencing in sporadic spindle cell hemangiomas: A study of 19 cases.

PubMed

Ten Broek, Roel W; Bekers, Elise M; de Leng, Wendy W J; Strengman, Eric; Tops, Bastiaan B J; Kutzner, Heinz; Leeuwis, Jan Willem; van Gorp, Joost M; Creytens, David H; Mentzel, Thomas; van Diest, Paul J; Eijkelenboom, Astrid; Flucke, Uta

2017-12-01

Spindle cell hemangioma (SCH) is a distinct vascular soft-tissue lesion characterized by cavernous blood vessels and a spindle cell component mainly occurring in the distal extremities of young adults. The majority of cases harbor heterozygous mutations in IDH1/2 sporadically or rarely in association with Maffucci syndrome. However, based on mosaicism and accordingly a low percentage of lesional cells harboring a mutant allele, detection can be challenging. We tested 19 sporadic SCHs by Sanger sequencing, multiplex ligation-dependent probe amplification (MLPA), conventional next generation sequencing (NGS), and NGS using a single molecule molecular inversion probes (smMIP)-based library preparation to compare their diagnostic value. Out of 10 cases tested by Sanger sequencing and 2 analyzed using MLPA, 4 and 1, respectively, revealed a mutation in IDH1 (p.R132C). The 7 remaining negative cases and additional 6 cases were investigated using smMIP/NGS, showing hot spot mutations in IDH1 (p.R132C) (8 cases) and IDH2 (3 cases; twice p.R172S and once p.R172G, respectively). One case was negative. Owing to insufficient DNA quality and insufficient coverage, 2 cases were excluded. In total, in 16 out of 17 cases successfully tested, an IDH1/2 mutation was found. Given that IDH1/2 mutations were absent in 161 other vascular lesions tested by smMIP/NGS, the mutation can be considered as highly specific for SCH. © 2017 Wiley Periodicals, Inc.

A Hypertension-Associated tRNAAla Mutation Alters tRNA Metabolism and Mitochondrial Function

PubMed Central

Jiang, Pingping; Wang, Meng; Xue, Ling; Xiao, Yun; Yu, Jialing; Wang, Hui; Yao, Juan; Liu, Hao; Peng, Yanyan; Liu, Hanqing; Li, Haiying; Chen, Ye

2016-01-01

In this report, we investigated the pathophysiology of a novel hypertension-associated mitochondrial tRNAAla 5655A → G (m.5655A → G) mutation. The destabilization of a highly conserved base pairing (A1-U72) at the aminoacyl acceptor stem by an m.5655A → G mutation altered the tRNAAla function. An in vitro processing analysis showed that the m.5655A → G mutation reduced the efficiency of tRNAAla precursor 5′ end cleavage catalyzed by RNase P. By using cybrids constructed by transferring mitochondria from lymphoblastoid cell lines derived from a Chinese family into mitochondrial DNA (mtDNA)-less (ρo) cells, we showed a 41% reduction in the steady-state level of tRNAAla in mutant cybrids. The mutation caused an improperly aminoacylated tRNAAla, as suggested by aberrantly aminoacylated tRNAAla and slower electrophoretic mobility of mutated tRNA. A failure in tRNAAla metabolism contributed to variable reductions in six mtDNA-encoded polypeptides in mutant cells, ranging from 21% to 37.5%, with an average of a 29.1% reduction, compared to levels of the controls. The impaired translation caused reduced activities of mitochondrial respiration chains. Furthermore, marked decreases in the levels of mitochondrial ATP and membrane potential were observed in mutant cells. These caused increases in the production of reactive oxygen species in the mutant cybrids. The data provide evidence for the association of the tRNAAla 5655A → G mutation with hypertension. PMID:27161322

A Restricted Repertoire of De Novo Mutations in ITPR1 Cause Gillespie Syndrome with Evidence for Dominant-Negative Effect

PubMed Central

McEntagart, Meriel; Williamson, Kathleen A.; Rainger, Jacqueline K.; Wheeler, Ann; Seawright, Anne; De Baere, Elfride; Verdin, Hannah; Bergendahl, L. Therese; Quigley, Alan; Rainger, Joe; Dixit, Abhijit; Sarkar, Ajoy; López Laso, Eduardo; Sanchez-Carpintero, Rocio; Barrio, Jesus; Bitoun, Pierre; Prescott, Trine; Riise, Ruth; McKee, Shane; Cook, Jackie; McKie, Lisa; Ceulemans, Berten; Meire, Françoise; Temple, I. Karen; Prieur, Fabienne; Williams, Jonathan; Clouston, Penny; Németh, Andrea H.; Banka, Siddharth; Bengani, Hemant; Handley, Mark; Freyer, Elisabeth; Ross, Allyson; van Heyningen, Veronica; Marsh, Joseph A.; Elmslie, Frances; FitzPatrick, David R.

2016-01-01

Gillespie syndrome (GS) is characterized by bilateral iris hypoplasia, congenital hypotonia, non-progressive ataxia, and progressive cerebellar atrophy. Trio-based exome sequencing identified de novo mutations in ITPR1 in three unrelated individuals with GS recruited to the Deciphering Developmental Disorders study. Whole-exome or targeted sequence analysis identified plausible disease-causing ITPR1 mutations in 10/10 additional GS-affected individuals. These ultra-rare protein-altering variants affected only three residues in ITPR1: Glu2094 missense (one de novo, one co-segregating), Gly2539 missense (five de novo, one inheritance uncertain), and Lys2596 in-frame deletion (four de novo). No clinical or radiological differences were evident between individuals with different mutations. ITPR1 encodes an inositol 1,4,5-triphosphate-responsive calcium channel. The homo-tetrameric structure has been solved by cryoelectron microscopy. Using estimations of the degree of structural change induced by known recessive- and dominant-negative mutations in other disease-associated multimeric channels, we developed a generalizable computational approach to indicate the likely mutational mechanism. This analysis supports a dominant-negative mechanism for GS variants in ITPR1. In GS-derived lymphoblastoid cell lines (LCLs), the proportion of ITPR1-positive cells using immunofluorescence was significantly higher in mutant than control LCLs, consistent with an abnormality of nuclear calcium signaling feedback control. Super-resolution imaging supports the existence of an ITPR1-lined nucleoplasmic reticulum. Mice with Itpr1 heterozygous null mutations showed no major iris defects. Purkinje cells of the cerebellum appear to be the most sensitive to impaired ITPR1 function in humans. Iris hypoplasia is likely to result from either complete loss of ITPR1 activity or structure-specific disruption of multimeric interactions. PMID:27108798

An immuno-wall microdevice exhibits rapid and sensitive detection of IDH1-R132H mutation specific to grade II and III gliomas

PubMed Central

Yamamichi, Akane; Kasama, Toshihiro; Ohka, Fumiharu; Suzuki, Hiromichi; Kato, Akira; Motomura, Kazuya; Hirano, Masaki; Ranjit, Melissa; Chalise, Lushun; Kurimoto, Michihiro; Kondo, Goro; Aoki, Kosuke; Kaji, Noritada; Tokeshi, Manabu; Matsubara, Toshio; Senga, Takeshi; Kaneko, Mika K.; Suzuki, Hidenori; Hara, Masahito; Wakabayashi, Toshihiko; Baba, Yoshinobu; Kato, Yukinari; Natsume, Atsushi

2016-01-01

Abstract World Health Organization grade II and III gliomas most frequently occur in the central nervous system (CNS) in adults. Gliomas are not circumscribed; tumor edges are irregular and consist of tumor cells, normal brain tissue, and hyperplastic reactive glial cells. Therefore, the tumors are not fully resectable, resulting in recurrence, malignant progression, and eventual death. Approximately 69–80% of grade II and III gliomas harbor mutations in the isocitrate dehydrogenase 1 gene (IDH1), of which 83–90% are found to be the IDH1-R132H mutation. Detection of the IDH1-R132H mutation should help in the differential diagnosis of grade II and III gliomas from other types of CNS tumors and help determine the boundary between the tumor and normal brain tissue. In this study, we established a highly sensitive antibody-based device, referred to as the immuno-wall, to detect the IDH1-R132H mutation in gliomas. The immuno-wall causes an immunoreaction in microchannels fabricated using a photo-polymerizing polymer. This microdevice enables the analysis of the IDH1 status with a small sample within 15 min with substantially high sensitivity. Our results suggested that 10% content of the IDH1-R132H mutation in a sample of 0.33 μl volume, with 500 ng protein, or from 500 cells is theoretically sufficient for the analysis. The immuno-wall device will enable the rapid and highly sensitive detection of the IDH1-R132H mutation in routine clinical practice. PMID:27877908

Effect of KCNJ5 Mutations on Gene Expression in Aldosterone-Producing Adenomas and Adrenocortical Cells

PubMed Central

Monticone, Silvia; Hattangady, Namita G.; Nishimoto, Koshiro; Mantero, Franco; Rubin, Beatrice; Cicala, Maria Verena; Pezzani, Raffaele; Auchus, Richard J.; Ghayee, Hans K.; Shibata, Hirotaka; Kurihara, Isao; Williams, Tracy A.; Giri, Judith G.; Bollag, Roni J.; Edwards, Michael A.; Isales, Carlos M.

2012-01-01

Context: Primary aldosteronism is a heterogeneous disease that includes both sporadic and familial forms. A point mutation in the KCNJ5 gene is responsible for familial hyperaldosteronism type III. Somatic mutations in KCNJ5 also occur in sporadic aldosterone producing adenomas (APA). Objective: The objective of the study was to define the effect of the KCNJ5 mutations on gene expression and aldosterone production using APA tissue and human adrenocortical cells. Methods: A microarray analysis was used to compare the transcriptome profiles of female-derived APA samples with and without KCNJ5 mutations and HAC15 adrenal cells overexpressing either mutated or wild-type KCNJ5. Real-time PCR validated a set of differentially expressed genes. Immunohistochemical staining localized the KCNJ5 expression in normal adrenals and APA. Results: We report a 38% (18 of 47) prevalence of KCNJ5 mutations in APA. KCNJ5 immunostaining was highest in the zona glomerulosa of NA and heterogeneous in APA tissue, and KCNJ5 mRNA was 4-fold higher in APA compared with normal adrenals (P < 0.05). APA with and without KCNJ5 mutations displayed slightly different gene expression patterns, notably the aldosterone synthase gene (CYP11B2) was more highly expressed in APA with KCNJ5 mutations. Overexpression of KCNJ5 mutations in HAC15 increased aldosterone production and altered expression of 36 genes by greater than 2.5-fold (P < 0.05). Real-time PCR confirmed increases in CYP11B2 and its transcriptional regulator, NR4A2. Conclusions: KCNJ5 mutations are prevalent in APA, and our data suggest that these mutations increase expression of CYP11B2 and NR4A2, thus increasing aldosterone production. PMID:22628608

Prognostic Implications of Multiplex Detection of KRAS Mutations in Cell-Free DNA from Patients with Pancreatic Ductal Adenocarcinoma.

PubMed

Kim, Min Kyeong; Woo, Sang Myung; Park, Boram; Yoon, Kyong-Ah; Kim, Yun-Hee; Joo, Jungnam; Lee, Woo Jin; Han, Sung-Sik; Park, Sang-Jae; Kong, Sun-Young

2018-04-01

Cell-free DNA (cfDNA) is known to provide potential biomarkers for predicting clinical outcome, but its value in pancreatic ductal adenocarcinoma (PDAC) has not been fully evaluated. The aim of this study was to evaluate the clinical applicability of quantitative analysis of multiplex KRAS mutations in cell-free DNA from patients with PDAC. A total of 106 patients with PDAC were enrolled in this prospective study. The concentration and fraction of KRAS mutations were determined through multiplex detection of KRAS mutations in plasma samples by use of a droplet digital PCR kit (Bio-Rad). KRAS mutations were detected in 96.1% of tissue samples. Eighty patients (80.5%) harbored KRAS mutations in cfDNA, with a median KRAS mutation concentration of 0.165 copies/μL and a median fractional abundance of 0.415%. Multivariable analyses demonstrated that the KRAS mutation concentration [hazard ratio (HR), 2.08; 95% CI, 1.20-3.63] and KRAS fraction (HR, 1.73; 95% CI, 1.02-2.95) were significant factors for progression-free survival. KRAS mutation concentration (HR, 1.97; 95% CI, 1.05-3.67) also had prognostic implications for overall survival. Subgroup analyses showed that KRAS mutation concentration and fractional abundance significantly affected progression-free survival in resectable PDAC ( P = 0.016). Moreover, when combined with the cancer biomarker CA19-9, the KRAS mutation concentration in cfDNA showed additive benefits for the prediction of overall survival. This study demonstrates that multiplex detection of KRAS mutations in plasma cfDNA is clinically relevant, providing a potential candidate biomarker for prognosis of PDAC. © 2018 American Association for Clinical Chemistry.

Impact of KRAS codon subtypes from a randomised phase II trial of selumetinib plus docetaxel in KRAS mutant advanced non-small-cell lung cancer

PubMed Central

Jänne, P A; Smith, I; McWalter, G; Mann, H; Dougherty, B; Walker, J; Orr, M C M; Hodgson, D R; Shaw, A T; Pereira, J R; Jeannin, G; Vansteenkiste, J; Barrios, C H; Franke, F A; Crinò, L; Smith, P

2015-01-01

Background: Selumetinib (AZD6244, ARRY-142886)+docetaxel increases median overall survival (OS) and significantly improves progression-free survival (PFS) and objective response rate (ORR) compared with docetaxel alone in patients with KRAS mutant, stage IIIB/IV non-small-cell lung cancer (NSCLC; NCT00890825). Methods: Retrospective analysis of OS, PFS, ORR and change in tumour size at week 6 for different sub-populations of KRAS codon mutations. Results: In patients receiving selumetinib+docetaxel and harbouring KRAS G12C or G12V mutations there were trends towards greater improvement in OS, PFS and ORR compared with other KRAS mutations. Conclusion: Different KRAS mutations in NSCLC may influence selumetinib/docetaxel sensitivity. PMID:26125448

Development of an Ammonium Sulfate DNA Extraction Method for Obtaining Amplifiable DNA in a Small Number of Cells and Its Application to Clinical Specimens

PubMed Central

Oh, Seo Young; Kim, Wook Youn; Hwang, Tae Sook; Han, Hye Seung; Lim, So Dug; Kim, Wan Seop

2013-01-01

DNA extraction from microdissected cells has become essential for handling clinical specimens with advances in molecular pathology. Conventional methods have limitations for extracting amplifiable DNA from specimens containing a small number of cells. We developed an ammonium sulfate DNA extraction method (A) and compared it with two other methods (B and C). DNA quality and quantity, β-globin amplification, and detectability of two cancer associated gene mutations were evaluated. Method A showed the best DNA yield, particularly when the cell number was very low. Amplification of the β-globin gene using DNA from the SNU 790 cell line and papillary thyroid carcinoma (PTC) cells extracted with Method A demonstrated the strongest band. BRAF V600E mutation analysis using ethanol-fixed PTC cells from a patient demonstrated both a “T” peak increase and an adjacent “A” peak decrease when 25 and 50 cells were extracted, whereas mutant peaks were too low to be analyzed using the other two methods. EGFR mutation analysis using formalin-fixed paraffin-embedded lung cancer tissues demonstrated a mutant peak with Method A, whereas the mutant peak was undetectable with Methods B or C. Method A yielded the best DNA quantity and quality with outstanding efficiency, particularly when paucicellular specimens were used. PMID:23691506

Snowball: resampling combined with distance-based regression to discover transcriptional consequences of a driver mutation

PubMed Central

Xu, Yaomin; Guo, Xingyi; Sun, Jiayang; Zhao, Zhongming

2015-01-01

Motivation: Large-scale cancer genomic studies, such as The Cancer Genome Atlas (TCGA), have profiled multidimensional genomic data, including mutation and expression profiles on a variety of cancer cell types, to uncover the molecular mechanism of cancerogenesis. More than a hundred driver mutations have been characterized that confer the advantage of cell growth. However, how driver mutations regulate the transcriptome to affect cellular functions remains largely unexplored. Differential analysis of gene expression relative to a driver mutation on patient samples could provide us with new insights in understanding driver mutation dysregulation in tumor genome and developing personalized treatment strategies. Results: Here, we introduce the Snowball approach as a highly sensitive statistical analysis method to identify transcriptional signatures that are affected by a recurrent driver mutation. Snowball utilizes a resampling-based approach and combines a distance-based regression framework to assign a robust ranking index of genes based on their aggregated association with the presence of the mutation, and further selects the top significant genes for downstream data analyses or experiments. In our application of the Snowball approach to both synthesized and TCGA data, we demonstrated that it outperforms the standard methods and provides more accurate inferences to the functional effects and transcriptional dysregulation of driver mutations. Availability and implementation: R package and source code are available from CRAN at http://cran.r-project.org/web/packages/DESnowball, and also available at http://bioinfo.mc.vanderbilt.edu/DESnowball/. Contact: zhongming.zhao@vanderbilt.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25192743

IgVH gene analysis suggests that peritoneal B cells do not contribute to the gut immune system in man.

PubMed

Boursier, Laurent; Farstad, Inger Nina; Mellembakken, Jan Roar; Brandtzaeg, Per; Spencer, Jo

2002-09-01

The contribution of peritoneal B cells to the intestinal lamina propria plasma cell population is well documented in mice, but unknown in humans. We have analyzed immunoglobulin (Ig) genes of human peritoneal B cells, because such genes show distinctive characteristics in mucosal B cells, particularly highly mutated variable regions. Here, we report the characteristics of variable region genes used by IgM, IgA and IgG in peritoneal cells. We focused on the properties of IgV(H)4-34 to allow comparisons of like-with-like between different isotypes and cells from different immune compartments. We observed that the IgM genes were mostly unmutated, and that the mutated subset had less mutations than would be expected in a mucosal B cell population. Likewise, the IgV(H)4-34 genes used by IgA and IgG from peritoneal B cells had significantly lower numbers of mutations than observed in the mucosal counterparts. Other trends observed, while not reaching statistical significance, followed the trend of peripheral B cells. The peritoneal B cell population had more IgA1 than IgA2 sequences, and there was no dominance of J(H)4 in the IgA from peritoneum or spleen, in contrast to the mucosal sequences. Overall, this study suggested that human peritoneal B cell are either peripheral or mixed in origin; they are unlikely to represent an inductive compartment for the mucosal B cell system.

In silico investigation of molecular effects caused by missense mutations in creatine transporter protein

NASA Astrophysics Data System (ADS)

Zhang, Zhe; Schwatz, Charles; Alexov, Emil

2011-03-01

Creatine transporter (CT) protein, which is encoded by SLC6A8 gene, is essential for taking up the creatine in the cell, which in turn plays a key role in the spatial and temporal maintenance of energy in skeletal and cardiac muscle cells. It was shown that some missense mutations in CT cause mental retardation, while others are harmless non-synonymous single nucleoside polymorphism (nsSNP). Currently fifteen missense mutations in CT are known, among which twelve are disease-causing. Sequence analysis reveals that there is no clear trend distinguishing disease-causing from harmless missense mutations. Because of that, we built 3D model of the CT using highly homologous template and use the model to investigate the effects of mutations of CT stability and hydrogen bond network. It is demonstrated that disease-causing mutations affect the folding free energy and ionization states of titratable group in much greater extend as compared with harmless mutations. Supported by grants from NLM, NIH, grant numbers 1R03LM009748 and 1R03LM009748-S1.

Genomic Characterization of Non–Small-Cell Lung Cancer in African Americans by Targeted Massively Parallel Sequencing

PubMed Central

Araujo, Luiz H.; Timmers, Cynthia; Bell, Erica Hlavin; Shilo, Konstantin; Lammers, Philip E.; Zhao, Weiqiang; Natarajan, Thanemozhi G.; Miller, Clinton J.; Zhang, Jianying; Yilmaz, Ayse S.; Liu, Tom; Coombes, Kevin; Amann, Joseph; Carbone, David P.

2015-01-01

Purpose Technologic advances have enabled the comprehensive analysis of genetic perturbations in non–small-cell lung cancer (NSCLC); however, African Americans have often been underrepresented in these studies. This ethnic group has higher lung cancer incidence and mortality rates, and some studies have suggested a lower incidence of epidermal growth factor receptor mutations. Herein, we report the most in-depth molecular profile of NSCLC in African Americans to date. Methods A custom panel was designed to cover the coding regions of 81 NSCLC-related genes and 40 ancestry-informative markers. Clinical samples were sequenced on a massively parallel sequencing instrument, and anaplastic lymphoma kinase translocation was evaluated by fluorescent in situ hybridization. Results The study cohort included 99 patients (61% males, 94% smokers) comprising 31 squamous and 68 nonsquamous cell carcinomas. We detected 227 nonsilent variants in the coding sequence, including 24 samples with nonoverlapping, classic driver alterations. The frequency of driver mutations was not significantly different from that of whites, and no association was found between genetic ancestry and the presence of somatic mutations. Copy number alteration analysis disclosed distinguishable amplifications in the 3q chromosome arm in squamous cell carcinomas and pointed toward a handful of targetable alterations. We also found frequent SMARCA4 mutations and protein loss, mostly in driver-negative tumors. Conclusion Our data suggest that African American ancestry may not be significantly different from European/white background for the presence of somatic driver mutations in NSCLC. Furthermore, we demonstrated that using a comprehensive genotyping approach could identify numerous targetable alterations, with potential impact on therapeutic decisions. PMID:25918285

Mutagenesis in human cells with accelerated H and Fe ions

NASA Technical Reports Server (NTRS)

Kronenberg, Amy

1994-01-01

The overall goals of this research were to determine the risks of mutation induction and the spectra of mutations induced by energetic protons and iron ions at two loci in human lymphoid cells. During the three year grant period the research has focused in three major areas: (1) the acquisition of sufficient statistics for human TK6 cell mutation experiments using Fe ions (400 MeV/amu), Fe ions (600 MeV/amu) and protons (250 MeV/amu); (2) collection of thymidine kinase- deficient (tk) mutants or hypoxanthine phosphoribosyltransferase deficient (hprt) mutants induced by either Fe 400 MeV/amu, Fe 600 MeV/amu, or H 250 MeV/amu for subsequent molecular analysis; and (3) molecular characterization of mutants isolated after exposure to Fe ions (600 MeV/amu). As a result of the shutdown of the BEVALAC heavy ion accelerator in December 1992, efforts were rearranged somewhat in time to complete our dose-response studies and to complete mutant collections in particular for the Fe ion beams prior to the shutdown. These goals have been achieved. A major effort was placed on collection, re-screening, and archiving of 3 different series of mutants for the various particle beam exposures: tk-ng mutants, tk-sg mutants, and hprt-deficient mutants. Where possible, groups of mutants were isolated for several particle fluences. Comparative analysis of mutation spectra has occured with characterization of the mutation spectrum for hprt-deficient mutants obtained after exposure of TK6 cells to Fe ions (600 MeV/amu) and a series of spontaneous mutants.

Trinity | Informatics Technology for Cancer Research (ITCR)

Cancer.gov

Trinity Cancer Transcriptome Analysis Toolkit (CTAT) including de novo transcriptome assembly with downstream support for expression analysis and focused analyses on cancer transcriptomes, incorporating mutation and fusion transcript discovery, and single cell analysis.

Unique volatolomic signatures of TP53 and KRAS in lung cells

PubMed Central

Davies, M P A; Barash, O; Jeries, R; Peled, N; Ilouze, M; Hyde, R; Marcus, M W; Field, J K; Haick, H

2014-01-01

Background: Volatile organic compounds (VOCs) are potential biomarkers for cancer detection in breath, but it is unclear if they reflect specific mutations. To test this, we have compared human bronchial epithelial cell (HBEC) cell lines carrying the KRASV12 mutation, knockdown of TP53 or both with parental HBEC cells. Methods: VOC from headspace above cultured cells were collected by passive sampling and analysed by thermal desorption gas chromatography mass spectrometry (TD-GC–MS) or sensor array with discriminant factor analysis (DFA). Results: In TD-GC–MS analysis, individual compounds had limited ability to discriminate between cell lines, but by applying DFA analysis combinations of 20 VOCs successfully discriminated between all cell types (accuracies 80–100%, with leave-one-out cross validation). Sensor array detection DFA demonstrated the ability to discriminate samples based on their cell type for all comparisons with accuracies varying between 77% and 93%. Conclusions: Our results demonstrate that minimal genetic changes in bronchial airway cells lead to detectable differences in levels of specific VOCs identified by TD-GC–MS or of patterns of VOCs identified by sensor array output. From the clinical aspect, these results suggest the possibility of breath analysis for detection of minimal genetic changes for earlier diagnosis or for genetic typing of lung cancers. PMID:25051409

Urine-derived podocytes-lineage cells: A promising tool for precision medicine in Alport Syndrome.

PubMed

Daga, Sergio; Baldassarri, Margherita; Lo Rizzo, Caterina; Fallerini, Chiara; Imperatore, Valentina; Longo, Ilaria; Frullanti, Elisa; Landucci, Elisa; Massella, Laura; Pecoraro, Carmine; Garosi, Guido; Ariani, Francesca; Mencarelli, Maria Antonietta; Mari, Francesca; Renieri, Alessandra; Pinto, Anna Maria

2018-02-01

Alport Syndrome (ATS) is a rare genetic disorder caused by collagen IV genes mutations, leading to glomerular basement membrane damage up to end-stage renal disease. Podocytes, the main component of the glomerular structure, are the only cells able to produce all the three collagens IV alpha chains associated with ATS and thus, they are key players in ATS pathogenesis. However, podocytes-targeted therapeutic strategies have been hampered by the difficulty of non-invasively isolating them and transcripts-based diagnostic approaches are complicated by the inaccessibility of other COL4 chains-expressing cells. We firstly isolated podocyte-lineage cells from ATS patients' urine samples, in a non-invasive way. RT-PCR analysis revealed COL4A3, COL4A4, and COL4A5 expression. Transcripts analysis on RNA extracted from patient's urine derived podocyte-lineage cells allowed defining the pathogenic role of intronic variants, namely one mutation in COL4A3 (c.3882+5G>A), three mutations in COL4A4 (c.1623+2T>A, c.3699_3706+1del, c.2545+143T>A), and one mutation in COL4A5 (c.3454+2T>C). Therefore, our cellular model represents a novel tool, essential to unequivocally prove the effect of spliceogenic intronic variants on transcripts expressed exclusively at a glomerular level. This process is a key step for providing the patient with a definite molecular diagnosis and with a proper recurrence risk. The established system also opens up the possibility of testing personalized therapeutic approaches on disease-relevant cells. © 2017 Wiley Periodicals, Inc.

INPP4B promotes cell survival via SGK3 activation in NPM1-mutated leukemia.

PubMed

Jin, Hongjun; Yang, Liyuan; Wang, Lu; Yang, Zailin; Zhan, Qian; Tao, Yao; Zou, Qin; Tang, Yuting; Xian, Jingrong; Zhang, Shuaishuai; Jing, Yipei; Zhang, Ling

2018-01-17

Acute myeloid leukemia (AML) with mutated nucleophosmin (NPM1) has been recognized as a distinct leukemia entity in the 2016 World Health Organization (WHO) classification. The genetic events underlying oncogenesis in NPM1-mutated AML that is characterized by a normal karyotype remain unclear. Inositol polyphosphate 4-phosphatase type II (INPP4B), a new factor in the phosphoinositide-3 kinase (PI3K) pathway-associated cancers, has been recently found a clinically relevant role in AML. However, little is known about the specific mechanistic function of INPP4B in NPM1-mutated AML. The INPP4B expression levels in NPM1-mutated AML primary blasts and AML OCI-AML3 cell lines were determined by qRT-PCR and western blotting. The effect of INPP4B knockdown on OCI-AML3 leukemia cell proliferation was evaluated, using the Cell Counting Kit-8 and colony formation assay. After INPP4B overexpression or knockdown, the activation of serum and glucocorticoid-regulated kinase 3 (SGK3) and AKT was assessed. The effects of PI3K signaling pathway inhibitors on the levels of p-SGK3 in OCI-AML3 cells were tested. The mass of PI (3,4) P 2 and PI (3) P was analyzed by ELISA upon INPP4B overexpression. Knockdown of SGK3 by RNA interference and a rescue assay were performed to confirm the critical role of SGK3 in INPP4B-mediated cell survival. In addition, the molecular mechanism underlying INPP4B expression in NPM1-mutated leukemia cells was explored. Finally, Kaplan-Meier survival analysis was conducted on the NPM1-mutated AML cohort stratified into quartiles for INPP4B expression in The Cancer Genome Atlas (TCGA) dataset. High expression of INPP4B was observed in NPM1-mutated AML. Knockdown of INPP4B repressed cell proliferation in OCI-AML3 cells, whereas recovered INPP4B rescued this inhibitory effect in vitro. Mechanically, INPP4B enhanced phosphorylated SGK3 (p-SGK3) status, but did not affect AKT activation. SGK3 was required for INPP4B-induced cell proliferation in OCI-AML3 cells. High levels of INPP4B were at least partially caused by the NPM1 mutant via ERK/Ets-1 signaling. Finally, high expression of INPP4B showed a trend towards lower overall survival and event-free survival in NPM1-mutated AML patients. Our results indicate that INPP4B promotes leukemia cell survival via SGK3 activation, and INPP4B might be a potential target in the treatment of NPM1-mutated AML.

Resistance to cyclosporin A derives from mutations in hepatitis C virus nonstructural proteins.

PubMed

Arai, Masaaki; Tsukiyama-Kohara, Kyoko; Takagi, Asako; Tobita, Yoshimi; Inoue, Kazuaki; Kohara, Michinori

2014-05-23

Cyclosporine A (CsA) is an immunosuppressive drug that targets cyclophilins, cellular cofactors that regulate the immune system. Replication of hepatitis C virus (HCV) is suppressed by CsA, but the molecular basis of this suppression is still not fully understood. To investigate this suppression, we cultured HCV replicon cells (Con1, HCV genotype 1b, FLR-N cell) in the presence of CsA and obtained nine CsA-resistant FLR-N cell lines. We determined full-length HCV sequences for all nine clones, and chose two (clones #6 and #7) of the nine clones that have high replication activity in the presence of CsA for further analysis. Both clones showed two consensus mutations, one in NS3 (T1280V) and the other in NS5A (D2292E). Characterization of various mutants indicated that the D2292E mutation conferred resistance to high concentrations of CsA (up to 2 μM). In addition, the missense mutation T1280V contributed to the recovery of colony formation activity. The effects of these mutations are also evident in two established HCV replicon cell lines-HCV-RMT ([1], genotype 1a) and JFH1 (genotype 2a). Moreover, three other missense mutations in NS5A-D2303H, S2362G, and E2414K-enhanced the resistance to CsA conferred by D2292E; these double or all quadruple mutants could resist approximately 8- to 25-fold higher concentrations of CsA than could wild-type Con1. These four mutations, either as single or combinations, also made Con1 strain resistant to two other cyclophilin inhibitors, N-methyl-4-isoleucine-cyclosporin (NIM811) or Debio-025. Interestingly, the changes in IC50 values that resulted from each of these mutations were the lowest in the Debio-025-treated cells, indicating its highest resistant activity against the adaptive mutation. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Cell cloning-based transcriptome analysis in Rett patients: relevance to the pathogenesis of Rett syndrome of new human MeCP2 target genes.

PubMed

Nectoux, J; Fichou, Y; Rosas-Vargas, H; Cagnard, N; Bahi-Buisson, N; Nusbaum, P; Letourneur, F; Chelly, J; Bienvenu, T

2010-07-01

More than 90% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked methyl-CpG binding protein 2 (MECP2) gene that encodes the methyl-CpG-binding protein 2, a transcriptional modulator. Because MECP2 is subjected to X chromosome inactivation (XCI), girls with RTT either express the wild-type or mutant allele in each individual cell. To test the consequences of MECP2 mutations resulting from a genome-wide transcriptional dysregulation and to identify its target genes in a system that circumvents the functional mosaicism resulting from XCI, we carried out gene expression profiling of clonal populations derived from fibroblast primary cultures expressing exclusively either the wild-type or the mutant MECP2 allele. Clonal cultures were obtained from skin biopsy of three RTT patients carrying either a non-sense or a frameshift MECP2 mutation. For each patient, gene expression profiles of wild-type and mutant clones were compared by oligonucleotide expression microarray analysis. Firstly, clustering analysis classified the RTT patients according to their genetic background and MECP2 mutation. Secondly, expression profiling by microarray analysis and quantitative RT-PCR indicated four up-regulated genes and five down-regulated genes significantly dysregulated in all our statistical analysis, including excellent potential candidate genes for the understanding of the pathophysiology of this neurodevelopmental disease. Thirdly, chromatin immunoprecipitation analysis confirmed MeCP2 binding to respective CpG islands in three out of four up-regulated candidate genes and sequencing of bisulphite-converted DNA indicated that MeCP2 preferentially binds to methylated-DNA sequences. Most importantly, the finding that at least two of these genes (BMCC1 and RNF182) were shown to be involved in cell survival and/or apoptosis may suggest that impaired MeCP2 function could alter the survival of neurons thus compromising brain function without inducing cell death.

The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy

PubMed Central

Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng

2014-01-01

Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055

A study of the mutational landscape of pediatric-type follicular lymphoma and pediatric nodal marginal zone lymphoma.

PubMed

Ozawa, Michael G; Bhaduri, Aparna; Chisholm, Karen M; Baker, Steven A; Ma, Lisa; Zehnder, James L; Luna-Fineman, Sandra; Link, Michael P; Merker, Jason D; Arber, Daniel A; Ohgami, Robert S

2016-10-01

Pediatric-type follicular lymphoma and pediatric marginal zone lymphoma are two of the rarest B-cell lymphomas. These lymphomas occur predominantly in the pediatric population and show features distinct from their more common counterparts in adults: adult-type follicular lymphoma and adult-type nodal marginal zone lymphoma. Here we report a detailed whole-exome deep sequencing analysis of a cohort of pediatric-type follicular lymphomas and pediatric marginal zone lymphomas. This analysis revealed a recurrent somatic variant encoding p.Lys66Arg in the transcription factor interferon regulatory factor 8 (IRF8) in 3 of 6 cases (50%) of pediatric-type follicular lymphoma. This specific point mutation was not detected in pediatric marginal zone lymphoma or in adult-type follicular lymphoma. Additional somatic point mutations in pediatric-type follicular lymphoma were observed in genes involved in transcription, intracellular signaling, and cell proliferation. In pediatric marginal zone lymphoma, no recurrent mutation was identified; however, somatic point mutations were observed in genes involved in cellular adhesion, cytokine regulatory elements, and cellular proliferation. A somatic variant in AMOTL1, a recurrently mutated gene in splenic marginal zone lymphoma, was also identified in a case of pediatric marginal zone lymphoma. The overall non-synonymous mutational burden was low in both pediatric-type follicular lymphoma and pediatric marginal zone lymphoma (4.6 mutations per exome). Altogether, these findings support a distinctive genetic basis for pediatric-type follicular lymphoma and pediatric marginal zone lymphoma when compared with adult subtypes and to one another. Moreover, identification of a recurrent point mutation in IRF8 provides insight into a potential driver mutation in the pathogenesis of pediatric-type follicular lymphoma with implications for novel diagnostic or therapeutic strategies.

A study of the mutational landscape of pediatric-type follicular lymphoma and pediatric nodal marginal zone lymphoma

PubMed Central

Ozawa, Michael G; Bhaduri, Aparna; Chisholm, Karen M; Baker, Steven A; Ma, Lisa; Zehnder, James L; Luna-Fineman, Sandra; Link, Michael P; Merker, Jason D; Arber, Daniel A; Ohgami, Robert S

2016-01-01

Pediatric-type follicular lymphoma and pediatric marginal zone lymphoma are two of the rarest B-cell lymphomas. These lymphomas occur predominantly in the pediatric population and show features distinct from their more common counterparts in adults: adult-type follicular lymphoma and adult-type nodal marginal zone lymphoma. Here we report a detailed whole-exome deep sequencing analysis of a cohort of pediatric-type follicular lymphomas and pediatric marginal zone lymphomas. This analysis revealed a recurrent somatic variant encoding p.Lys66Arg in the transcription factor interferon regulatory factor 8 (IRF8) in 3 of 6 cases (50%) of pediatric-type follicular lymphoma. This specific point mutation was not detected in pediatric marginal zone lymphoma or in adult-type follicular lymphoma. Additional somatic point mutations in pediatric-type follicular lymphoma were observed in genes involved in transcription, intracellular signaling, and cell proliferation. In pediatric marginal zone lymphoma, no recurrent mutation was identified; however, somatic point mutations were observed in genes involved in cellular adhesion, cytokine regulatory elements, and cellular proliferation. A somatic variant in AMOTL1, a recurrently mutated gene in splenic marginal zone lymphoma, was also identified in a case of pediatric marginal zone lymphoma. The overall non-synonymous mutational burden was low in both pediatric-type follicular lymphoma and pediatric marginal zone lymphoma (4.6 mutations per exome). Altogether, these findings support a distinctive genetic basis for pediatric-type follicular lymphoma and pediatric marginal zone lymphoma when compared with adult subtypes and to one another. Moreover, identification of a recurrent point mutation in IRF8 provides insight into a potential driver mutation in the pathogenesis of pediatric-type follicular lymphoma with implications for novel diagnostic or therapeutic strategies. PMID:27338637

Hodgkin's disease biology: recent advances.

PubMed

Jox, A; Wolf, J; Diehl, V

1997-11-01

The cellular origin of H-RS cells has been questioned for a long time. Recently, using single cell amplification of Ig genes evidence was obtained that H-RS cells clonally arise from B-cells. Sequence analysis of rearranged Ig genes demonstrated that H-RS cells develop within the germinal centre. H-RS cells in classical HD grow despite loss of function of their rearranged Ig genes. In contrast, the mutation pattern of rearranged Ig genes in L & H cells of lymphocyte-predominant HD frequently shows ongoing mutations indicating that these cell are still antigen selected. These molecular differences show that LP HD genetically differs from classical HD. H-RS cells escape from apoptosis within the germinal centre. However, the events leading to malignant transformation are still unknown. The association between EBV and HD has been repeatedly described, but the occurrence of EBV negative cases is hard to explain just by loss of EBV. The analysis of chromosomal aberrations in H-RS cells did not result in the description of a specific 'HD-gene'. Also the role of the T-lymphocytes surrounding the H-RS cells has remained an open question.

Multilayer-omics analysis of renal cell carcinoma, including the whole exome, methylome and transcriptome.

PubMed

Arai, Eri; Sakamoto, Hiromi; Ichikawa, Hitoshi; Totsuka, Hirohiko; Chiku, Suenori; Gotoh, Masahiro; Mori, Taisuke; Nakatani, Tamao; Ohnami, Sumiko; Nakagawa, Tohru; Fujimoto, Hiroyuki; Wang, Linghua; Aburatani, Hiroyuki; Yoshida, Teruhiko; Kanai, Yae

2014-09-15

The aim of this study was to identify pathways that have a significant impact during renal carcinogenesis. Sixty-seven paired samples of both noncancerous renal cortex tissue and cancerous tissue from patients with clear cell renal cell carcinomas (RCCs) were subjected to whole-exome, methylome and transcriptome analyses using Agilent SureSelect All Exon capture followed by sequencing on an Illumina HiSeq 2000 platform, Illumina Infinium HumanMethylation27 BeadArray and Agilent SurePrint Human Gene Expression microarray, respectively. Sanger sequencing and quantitative reverse transcription-PCR were performed for technical verification. MetaCore software was used for pathway analysis. Somatic nonsynonymous single-nucleotide mutations, insertions/deletions and intragenic breaks of 2,153, 359 and 8 genes were detected, respectively. Mutations of GCN1L1, MED12 and CCNC, which are members of CDK8 mediator complex directly regulating β-catenin-driven transcription, were identified in 16% of the RCCs. Mutations of MACF1, which functions in the Wnt/β-catenin signaling pathway, were identified in 4% of the RCCs. A combination of methylome and transcriptome analyses further highlighted the significant role of the Wnt/β-catenin signaling pathway in renal carcinogenesis. Genetic aberrations and reduced expression of ERC2 and ABCA13 were frequent in RCCs, and MTOR mutations were identified as one of the major disrupters of cell signaling during renal carcinogenesis. Our results confirm that multilayer-omics analysis can be a powerful tool for revealing pathways that play a significant role in carcinogenesis. © 2014 The Authors. Published by Wiley Periodicals, Inc. on behalf of UICC.

Multilayer-omics analysis of renal cell carcinoma, including the whole exome, methylome and transcriptome

PubMed Central

Arai, Eri; Sakamoto, Hiromi; Ichikawa, Hitoshi; Totsuka, Hirohiko; Chiku, Suenori; Gotoh, Masahiro; Mori, Taisuke; Nakatani, Tamao; Ohnami, Sumiko; Nakagawa, Tohru; Fujimoto, Hiroyuki; Wang, Linghua; Aburatani, Hiroyuki; Yoshida, Teruhiko; Kanai, Yae

2014-01-01

The aim of this study was to identify pathways that have a significant impact during renal carcinogenesis. Sixty-seven paired samples of both noncancerous renal cortex tissue and cancerous tissue from patients with clear cell renal cell carcinomas (RCCs) were subjected to whole-exome, methylome and transcriptome analyses using Agilent SureSelect All Exon capture followed by sequencing on an Illumina HiSeq 2000 platform, Illumina Infinium HumanMethylation27 BeadArray and Agilent SurePrint Human Gene Expression microarray, respectively. Sanger sequencing and quantitative reverse transcription-PCR were performed for technical verification. MetaCore software was used for pathway analysis. Somatic nonsynonymous single-nucleotide mutations, insertions/deletions and intragenic breaks of 2,153, 359 and 8 genes were detected, respectively. Mutations of GCN1L1, MED12 and CCNC, which are members of CDK8 mediator complex directly regulating β-catenin-driven transcription, were identified in 16% of the RCCs. Mutations of MACF1, which functions in the Wnt/β-catenin signaling pathway, were identified in 4% of the RCCs. A combination of methylome and transcriptome analyses further highlighted the significant role of the Wnt/β-catenin signaling pathway in renal carcinogenesis. Genetic aberrations and reduced expression of ERC2 and ABCA13 were frequent in RCCs, and MTOR mutations were identified as one of the major disrupters of cell signaling during renal carcinogenesis. Our results confirm that multilayer-omics analysis can be a powerful tool for revealing pathways that play a significant role in carcinogenesis. PMID:24504440

Abnormal RNA splicing and genomic instability after induction of DNMT3A mutations by CRISPR/Cas9 gene editing.

PubMed

Banaszak, Lauren G; Giudice, Valentina; Zhao, Xin; Wu, Zhijie; Gao, Shouguo; Hosokawa, Kohei; Keyvanfar, Keyvan; Townsley, Danielle M; Gutierrez-Rodrigues, Fernanda; Fernandez Ibanez, Maria Del Pilar; Kajigaya, Sachiko; Young, Neal S

2018-03-01

DNA methyltransferase 3A (DNMT3A) mediates de novo DNA methylation. Mutations in DNMT3A are associated with hematological malignancies, most frequently acute myeloid leukemia. DNMT3A mutations are hypothesized to establish a pre-leukemic state, rendering cells vulnerable to secondary oncogenic mutations and malignant transformation. However, the mechanisms by which DNMT3A mutations contribute to leukemogenesis are not well-defined. Here, we successfully created four DNMT3A-mutated K562 cell lines with frameshift mutations resulting in truncated DNMT3A proteins. DNMT3A-mutated cell lines exhibited significantly impaired growth and increased apoptotic activity compared to wild-type (WT) cells. Consistent with previous studies, DNMT3A-mutated cells displayed impaired differentiation capacity. RNA-seq was used to compare transcriptomes of DNMT3A-mutated and WT cells; DNMT3A ablation resulted in downregulation of genes involved in spliceosome function, causing dysfunction of RNA splicing. Unexpectedly, we observed DNMT3A-mutated cells to exhibit marked genomic instability and an impaired DNA damage response compared to WT. CRISPR/Cas9-mediated DNMT3A-mutated K562 cells may be used to model effects of DNMT3A mutations in human cells. Our findings implicate aberrant splicing and induction of genomic instability as potential mechanisms by which DNMT3A mutations might predispose to malignancy. Published by Elsevier Inc.

A somatic T15091C mutation in the Cytb gene of mouse mitochondrial DNA dominantly induces respiration defects.

PubMed

Hayashi, Chisato; Takibuchi, Gaku; Shimizu, Akinori; Mito, Takayuki; Ishikawa, Kaori; Nakada, Kazuto; Hayashi, Jun-Ichi

2015-08-07

Our previous studies provided evidence that mammalian mitochondrial DNA (mtDNA) mutations that cause mitochondrial respiration defects behave in a recessive manner, because the induction of respiration defects could be prevented with the help of a small proportion (10%-20%) of mtDNA without the mutations. However, subsequent studies found the induction of respiration defects by the accelerated accumulation of a small proportion of mtDNA with various somatic mutations, indicating the presence of mtDNA mutations that behave in a dominant manner. Here, to provide the evidence for the presence of dominant mutations in mtDNA, we used mouse lung carcinoma P29 cells and examined whether some mtDNA molecules possess somatic mutations that dominantly induce respiration defects. Cloning and sequence analysis of 40-48 mtDNA molecules from P29 cells was carried out to screen for somatic mutations in protein-coding genes, because mutations in these genes could dominantly regulate respiration defects by formation of abnormal polypeptides. We found 108 missense mutations existing in one or more of 40-48 mtDNA molecules. Of these missense mutations, a T15091C mutation in the Cytb gene was expected to be pathogenic due to the presence of its orthologous mutation in mtDNA from a patient with cardiomyopathy. After isolation of many subclones from parental P29 cells, we obtained subclones with various proportions of T15091C mtDNA, and showed that the respiration defects were induced in a subclone with only 49% T15091C mtDNA. Because the induction of respiration defects could not be prevented with the help of the remaining 51% mtDNA without the T15091C mutation, the results indicate that the T15091C mutation in mtDNA dominantly induced the respiration defects. Copyright © 2015 Elsevier Inc. All rights reserved.

Single-nucleotide polymorphisms in the SEPTIN12 gene may be a genetic risk factor for Japanese patients with Sertoli cell-only syndrome.

PubMed

Miyakawa, Hiroe; Miyamoto, Toshinobu; Koh, Eitetsu; Tsujimura, Akira; Miyagawa, Yasushi; Saijo, Yasuaki; Namiki, Mikio; Sengoku, Kazuo

2012-01-01

Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, 10 novel genes involved in human spermatogenesis, including human SEPTIN12, were identified by expression microarray analysis of human testicular tissue. Septin12 is a member of the septin family of conserved cytoskeletal GTPases that form heteropolymeric filamentous structures in interphase cells. It is expressed specifically in the testis. Therefore, we hypothesized that mutation or polymorphisms of SEPTIN12 participate in male infertility, especially Sertoli cell-only syndrome (SCOS). To investigate whether SEPTIN12 gene defects are associated with azoospermia caused by SCOS, mutational analysis was performed in 100 Japanese patients by direct sequencing of coding regions. Statistical analysis was performed in patients with SCOS and in 140 healthy control men. No mutations were found in SEPTIN12 ; however, 8 coding single-nucleotide polymorphisms (SNP1-SNP8) could be detected in the patients with SCOS. The genotype and allele frequencies in SNP3, SNP4, and SNP6 were notably higher in the SCOS group than in the control group (P < .001). These results suggest that SEPTIN12 might play a critical role in human spermatogenesis.

Mutational dynamics of the SARS coronavirus in cell culture and human populations isolated in 2003

PubMed Central

Vega, Vinsensius B; Ruan, Yijun; Liu, Jianjun; Lee, Wah Heng; Wei, Chia Lin; Se-Thoe, Su Yun; Tang, Kin Fai; Zhang, Tao; Kolatkar, Prasanna R; Ooi, Eng Eong; Ling, Ai Ee; Stanton, Lawrence W; Long, Philip M; Liu, Edison T

2004-01-01

Background The SARS coronavirus is the etiologic agent for the epidemic of the Severe Acute Respiratory Syndrome. The recent emergence of this new pathogen, the careful tracing of its transmission patterns, and the ability to propagate in culture allows the exploration of the mutational dynamics of the SARS-CoV in human populations. Methods We sequenced complete SARS-CoV genomes taken from primary human tissues (SIN3408, SIN3725V, SIN3765V), cultured isolates (SIN848, SIN846, SIN842, SIN845, SIN847, SIN849, SIN850, SIN852, SIN3408L), and five consecutive Vero cell passages (SIN2774_P1, SIN2774_P2, SIN2774_P3, SIN2774_P4, SIN2774_P5) arising from SIN2774 isolate. These represented individual patient samples, serial in vitro passages in cell culture, and paired human and cell culture isolates. Employing a refined mutation filtering scheme and constant mutation rate model, the mutation rates were estimated and the possible date of emergence was calculated. Phylogenetic analysis was used to uncover molecular relationships between the isolates. Results Close examination of whole genome sequence of 54 SARS-CoV isolates identified before 14th October 2003, including 22 from patients in Singapore, revealed the mutations engendered during human-to-Vero and Vero-to-human transmission as well as in multiple Vero cell passages in order to refine our analysis of human-to-human transmission. Though co-infection by different quasipecies in individual tissue samples is observed, the in vitro mutation rate of the SARS-CoV in Vero cell passage is negligible. The in vivo mutation rate, however, is consistent with estimates of other RNA viruses at approximately 5.7 × 10-6 nucleotide substitutions per site per day (0.17 mutations per genome per day), or two mutations per human passage (adjusted R-square = 0.4014). Using the immediate Hotel M contact isolates as roots, we observed that the SARS epidemic has generated four major genetic groups that are geographically associated: two Singapore isolates, one Taiwan isolate, and one North China isolate which appears most closely related to the putative SARS-CoV isolated from a palm civet. Non-synonymous mutations are centered in non-essential ORFs especially in structural and antigenic genes such as the S and M proteins, but these mutations did not distinguish the geographical groupings. However, no non-synonymous mutations were found in the 3CLpro and the polymerase genes. Conclusions Our results show that the SARS-CoV is well adapted to growth in culture and did not appear to undergo specific selection in human populations. We further assessed that the putative origin of the SARS epidemic was in late October 2002 which is consistent with a recent estimate using cases from China. The greater sequence divergence in the structural and antigenic proteins and consistent deletions in the 3' – most portion of the viral genome suggest that certain selection pressures are interacting with the functional nature of these validated and putative ORFs. PMID:15347429

CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations.

PubMed

Guernet, Alexis; Mungamuri, Sathish Kumar; Cartier, Dorthe; Sachidanandam, Ravi; Jayaprakash, Anitha; Adriouch, Sahil; Vezain, Myriam; Charbonnier, Françoise; Rohkin, Guy; Coutant, Sophie; Yao, Shen; Ainani, Hassan; Alexandre, David; Tournier, Isabelle; Boyer, Olivier; Aaronson, Stuart A; Anouar, Youssef; Grumolato, Luca

2016-08-04

Intratumor genetic heterogeneity underlies the ability of tumors to evolve and adapt to different environmental conditions. Using CRISPR/Cas9 technology and specific DNA barcodes, we devised a strategy to recapitulate and trace the emergence of subpopulations of cancer cells containing a mutation of interest. We used this approach to model different mechanisms of lung cancer cell resistance to EGFR inhibitors and to assess effects of combined drug therapies. By overcoming intrinsic limitations of current approaches, CRISPR-barcoding also enables investigation of most types of genetic modifications, including repair of oncogenic driver mutations. Finally, we used highly complex barcodes inserted at a specific genome location as a means of simultaneously tracing the fates of many thousands of genetically labeled cancer cells. CRISPR-barcoding is a straightforward and highly flexible method that should greatly facilitate the functional investigation of specific mutations, in a context that closely mimics the complexity of cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

Non-canonical IDH1 and IDH2 mutations: a clonal and relevant event in an Italian cohort of gliomas classified according to the 2016 World Health Organization (WHO) criteria.

PubMed

Visani, Michela; Acquaviva, Giorgia; Marucci, Gianluca; Paccapelo, Alexandro; Mura, Antonella; Franceschi, Enrico; Grifoni, Daniela; Pession, Annalisa; Tallini, Giovanni; Brandes, Alba A; de Biase, Dario

2017-11-01

According to the 2016 World Health Organization (WHO) classification of tumors of the central nervous system, assessment of exon 4 mutations in isocitrate dehydrogenase 1 or 2 genes (IDH1 or IDH2) is an essential step in the characterization of gliomas. The p.R132H mutation is the most frequent alteration in IDH genes, however other non-canonical IDH mutations can be identified. The aim of this study is to investigate in depth the prevalence of non-R132H IDH ("non-canonical") mutations in brain tumors classified according to the 2016 WHO scheme and their clonal distribution in neoplastic cells. A total of 288 consecutive cases of brain gliomas (grade II-IV) were analyzed for exon 4 IDH1 and IDH2 mutations. IDH1 and IDH2 analysis was performed using next generation sequencing. Non-canonical IDH mutations were identified in 13/52 (25.0%) grade II gliomas (astrocytomas: 8/31, 25.8%; oligodendrogliomas: 5/21, 23.8%) and in 5/40 (12.5%) grade III gliomas (astrocytomas: 3/25, 12.0%; oligodendrogliomas: 2/15, 13.3%). They were not identified in 196 grade IV gliomas (192 glioblastomas, 4 gliosarcomas). In the large majority (>80%) of tumors IDH mutations, both IDH1-R132H and the non-canonical ones, were present in the large majority (>80%) of neoplastic cells. Our data highlight the importance of investigating not only the IDH1-R132H mutation but also the non-canonical ones. These mutations are clonally distributed, with proportions of mutated neoplastic cells overlapping with those of p.R132H, a finding consistent with their driver role in gliomagenesis.

Gene editing rescue of a novel MPL mutant associated with congenital amegakaryocytic thrombocytopenia.

PubMed

Cleyrat, Cédric; Girard, Romain; Choi, Eun H; Jeziorski, Éric; Lavabre-Bertrand, Thierry; Hermouet, Sylvie; Carillo, Serge; Wilson, Bridget S

2017-09-26

Thrombopoietin (Tpo) and its receptor (Mpl) are the principal regulators of early and late thrombopoiesis and hematopoietic stem cell maintenance. Mutations in MPL can drastically impair its function and be a contributing factor in multiple hematologic malignancies, including congenital amegakaryocytic thrombocytopenia (CAMT). CAMT is characterized by severe thrombocytopenia at birth, which progresses to bone marrow failure and pancytopenia. Here we report unique familial cases of CAMT that presented with a previously unreported MPL mutation: T814C (W272R) in the background of the activating MPL G117T (K39N or Baltimore) mutation. Confocal microscopy, proliferation and surface biotinylation assays, co-immunoprecipitation, and western blotting analysis were used to elucidate the function and trafficking of Mpl mutants. Results showed that Mpl protein bearing the W272R mutation, alone or together with the K39N mutation, lacks detectable surface expression while being strongly colocalized with the endoplasmic reticulum (ER) marker calreticulin. Both WT and K39N-mutated Mpl were found to be signaling competent, but single or double mutants bearing W272R were unresponsive to Tpo. Function of the deficient Mpl receptor could be rescued by using 2 separate approaches: (1) GRASP55 overexpression, which partially restored Tpo-induced signaling of mutant Mpl by activating an autophagy-dependent secretory pathway and thus forcing ER-trapped immature receptors to traffic to the cell surface; and (2) CRISPR-Cas9 gene editing used to repair MPL T814C mutation in transfected cell lines and primary umbilical cord blood-derived CD34 + cells. We demonstrate proof of principle for rescue of mutant Mpl function by using gene editing of primary hematopoietic stem cells, which indicates direct therapeutic applications for CAMT patients.

Gene editing rescue of a novel MPL mutant associated with congenital amegakaryocytic thrombocytopenia

PubMed Central

Girard, Romain; Choi, Eun H.; Jeziorski, Éric; Lavabre-Bertrand, Thierry; Hermouet, Sylvie; Carillo, Serge; Wilson, Bridget S.

2017-01-01

Thrombopoietin (Tpo) and its receptor (Mpl) are the principal regulators of early and late thrombopoiesis and hematopoietic stem cell maintenance. Mutations in MPL can drastically impair its function and be a contributing factor in multiple hematologic malignancies, including congenital amegakaryocytic thrombocytopenia (CAMT). CAMT is characterized by severe thrombocytopenia at birth, which progresses to bone marrow failure and pancytopenia. Here we report unique familial cases of CAMT that presented with a previously unreported MPL mutation: T814C (W272R) in the background of the activating MPL G117T (K39N or Baltimore) mutation. Confocal microscopy, proliferation and surface biotinylation assays, co-immunoprecipitation, and western blotting analysis were used to elucidate the function and trafficking of Mpl mutants. Results showed that Mpl protein bearing the W272R mutation, alone or together with the K39N mutation, lacks detectable surface expression while being strongly colocalized with the endoplasmic reticulum (ER) marker calreticulin. Both WT and K39N-mutated Mpl were found to be signaling competent, but single or double mutants bearing W272R were unresponsive to Tpo. Function of the deficient Mpl receptor could be rescued by using 2 separate approaches: (1) GRASP55 overexpression, which partially restored Tpo-induced signaling of mutant Mpl by activating an autophagy-dependent secretory pathway and thus forcing ER-trapped immature receptors to traffic to the cell surface; and (2) CRISPR-Cas9 gene editing used to repair MPL T814C mutation in transfected cell lines and primary umbilical cord blood–derived CD34+ cells. We demonstrate proof of principle for rescue of mutant Mpl function by using gene editing of primary hematopoietic stem cells, which indicates direct therapeutic applications for CAMT patients. PMID:29296828

Microfluidic screening and whole-genome sequencing identifies mutations associated with improved protein secretion by yeast.

PubMed

Huang, Mingtao; Bai, Yunpeng; Sjostrom, Staffan L; Hallström, Björn M; Liu, Zihe; Petranovic, Dina; Uhlén, Mathias; Joensson, Haakan N; Andersson-Svahn, Helene; Nielsen, Jens

2015-08-25

There is an increasing demand for biotech-based production of recombinant proteins for use as pharmaceuticals in the food and feed industry and in industrial applications. Yeast Saccharomyces cerevisiae is among preferred cell factories for recombinant protein production, and there is increasing interest in improving its protein secretion capacity. Due to the complexity of the secretory machinery in eukaryotic cells, it is difficult to apply rational engineering for construction of improved strains. Here we used high-throughput microfluidics for the screening of yeast libraries, generated by UV mutagenesis. Several screening and sorting rounds resulted in the selection of eight yeast clones with significantly improved secretion of recombinant α-amylase. Efficient secretion was genetically stable in the selected clones. We performed whole-genome sequencing of the eight clones and identified 330 mutations in total. Gene ontology analysis of mutated genes revealed many biological processes, including some that have not been identified before in the context of protein secretion. Mutated genes identified in this study can be potentially used for reverse metabolic engineering, with the objective to construct efficient cell factories for protein secretion. The combined use of microfluidics screening and whole-genome sequencing to map the mutations associated with the improved phenotype can easily be adapted for other products and cell types to identify novel engineering targets, and this approach could broadly facilitate design of novel cell factories.

Patients with Exon 19 Deletion Were Associated with Longer Progression-Free Survival Compared to Those with L858R Mutation after First-Line EGFR-TKIs for Advanced Non-Small Cell Lung Cancer: A Meta-Analysis

PubMed Central

Fang, Wenfeng; Yan, Yue; Hu, Zhihuang; Hong, Shaodong; Wu, Xuan; Qin, Tao; Liang, Wenhua; Zhang, Li

2014-01-01

Backgrounds It has been extensively proved that the efficacy of epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) is superior to that of cytotoxic chemotherapy in advanced non-small cell lung cancer (NSCLC) patients harboring sensitive EGFR mutations. However, the question of whether the efficacy of EGFR-TKIs differs between exon 19 deletion and exon 21 L858R mutation has not been yet statistically answered. Methods Subgroup data on hazard ratio (HR) for progression-free survival (PFS) of correlative studies were extracted and synthesized based on random-effect model. Comparison of outcomes between specific mutations was estimated through indirect and direct methods, respectively. Results A total of 13 studies of advanced NSCLC patients with either 19 or 21 exon alteration receiving first-line EGFR-TKIs were included. Based on the data from six clinical trials for indirect meta-analysis, the pooled HRTKI/chemotherapy for PFS were 0.28 (95% CI 0.20–0.38, P<0.001) in patients with 19 exon deletion and 0.47 (95% CI 0.35–0.64, P<0.001) in those with exon 21 L858R mutation. Indirect comparison revealed that the patients with exon 19 deletion had longer PFS than those with exon 21 L858R mutation (HR19 exon deletion/exon 21 L858R mutation  = 0.59, 95% CI 0.38–0.92; P = 0.019). Additionally, direct meta-analysis showed similar result (HR19 exon deletion/exon 21 L858R mutation  = 0.75, 95% CI 0.65 to 0.85; P<0.001) by incorporating another seven studies. Conclusions For advanced NSCLC patients, exon 19 deletion might be associated with longer PFS compared to L858 mutation at exon 21 after first-line EGFR-TKIs. PMID:25222496

The multifunctional RNA-binding protein hnRNPK is critical for the proliferation and differentiation of myoblasts.

PubMed

Xu, Yongjie; Li, Rui; Zhang, Kaili; Wu, Wei; Wang, Suying; Zhang, Pengpeng; Xu, Haixia

2018-06-14

HnRNPK is a multifunctional protein that participates in chromatin remodeling, transcrip-tion, RNA splicing, mRNA stability and translation. Here, we uncovered the function of hnRNPK in regulating the proliferation and differentiation of myoblasts. hnRNPK was mutated in the C2C12 myoblast cell line using the CRISPR/Cas9 system. A decreased proliferation rate was observed in hnRNPK-mutated cells, suggesting an impaired prolif-eration phenotype. Furthermore, increased G2/M phase, decreased S phase and increased sub-G1 phase cells were detected in the hnRNPK-mutated cell lines. The expression analysis of key cell cycle regulators indicated mRNA of Cyclin A2 was significantly in-creased in the mutant myoblasts compared to the control cells, while Cyclin B1, Cdc25b and Cdc25c were decreased sharply. In addition to the myoblast proliferation defect, the mutant cells exhibited defect in myotube formation. The myotube formation marker, my-osin heavy chain (MHC), was decreased sharply in hnRNPK-mutated cells compared to control myoblasts during differentiation. The deficiency in hnRNPK also resulted in the repression of Myog expression, a key myogenic regulator during differentiation. Together, our data demonstrate that hnRNPK is required for myoblast proliferation and differentia-tion and may be an essential regulator of myoblast function.

Natural gene therapy in monozygotic twins with Fanconi anemia.

PubMed

Mankad, Anuj; Taniguchi, Toshiyasu; Cox, Barbara; Akkari, Yassmine; Rathbun, R Keaney; Lucas, Lora; Bagby, Grover; Olson, Susan; D'Andrea, Alan; Grompe, Markus

2006-04-15

Monozygotic twin sisters, with nonhematologic symptoms of Fanconi anemia (FA), were discovered to be somatic mosaics for mutations in the FANCA gene. Skin fibroblasts, but not lymphocytes or committed hematopoietic progenitors, were sensitive to DNA cross-linking agents. Molecular analysis revealed, in skin cells of both twins, a frameshift causing deletion in exon 27 (2555deltaT) and an exon 28 missense mutation (2670G>A/R880Q). The latter resulted in primarily cytoplasmic expression and reduced function of the mutant FANCA (R880Q) protein. Surprisingly, the same acquired exon 30 missense change (2927G>A/E966K) was detected in the hematopoietic cells of both sisters, but not in their fibroblasts, nor in either parent. This compensatory mutation existed in cis with the maternal exon 28 mutation, and it restored function and nuclear localization of the resulting protein. Both sisters have been free of hematologic symptoms for more than 2 decades, suggesting that this de novo mutation occurred prenatally in a single hematopoietic stem cell (HSC) in one twin and that descendants of this functionally corrected HSC, via intra-uterine circulation, repopulated the blood lineages of both sisters. This finding suggests that treating FA patients with gene therapy might require transduction of only a few hematopoietic stem cells.

Heavy-ion induced genetic changes and evolution processes

NASA Technical Reports Server (NTRS)

Yang, C. H.; Craise, L. M.; Durante, M.; Mei, M.

1994-01-01

On Moon and Mars, there will be more galactic cosmic rays and higher radiation doses than on Earth. Our experimental studies showed that heavy ion radiation can effectively cause mutation and chromosome aberrations and that high Linear Energy Transfer (LET) heavy-ion induced mutants can be irreversible. Chromosome translocations and deletions are common in cells irradiated by heavy particles, and ionizing radiations are effective in causing hyperploidy. The importance of the genetic changes in the evolution of life is an interesting question. Through evolution, there is an increase of DNA content in cells from lower forms of life to higher organisms. The DNA content, however, reached a plateau in vertebrates. By increasing DNA content, there can be an increase of information in the cell. For a given DNA content, the quality of information can be changed by rearranging the DNA. Because radiation can cause hyperploidy, an increase of DNA content in cells, and can induce DNA rearrangement, it is likely that the evolution of life on Mars will be effected by its radiation environment. A simple analysis shows that the radiation level on Mars may cause a mutation frequency comparable to that of the spontaneous mutation rate on Earth. To the extent that mutation plays a role in adaptation, radiation alone on Mars may thus provide sufficient mutation for the evolution of life.

Impact of family history of cancer on the incidence of mutation in epidermal growth factor receptor gene in non-small cell lung cancer patients.

PubMed

He, Yayi; Li, Shuai; Ren, Shengxiang; Cai, Weijing; Li, Xuefei; Zhao, Chao; Li, Jiayu; Chen, Xiaoxia; Gao, Guanghui; Li, Wei; Zhou, Fei; Zhou, Caicun

2013-08-01

Epidermal growth factor receptor (EGFR) activating mutation is an important predictive biomarker of EGFR tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer (NSCLC), while family history of cancer also plays an important role in the neoplasia of lung cancer. This study aimed to investigate the association between family history of cancer and EGFR mutation status in NSCLC population. From February 2008 to May 2012, 538 consecutive NSCLC patients with known EGFR mutation status were included into this study. Amplification refractory mutation system (ARMS) method was used to detect EGFR mutation. The associations between EGFR mutation and family history of cancer were evaluated using logistic regression models. EGFR activating mutation was found in 220 patients and 117 patients had family cancer histories among first-degree relatives. EGFR mutation was more frequently detected in adenocarcinoma patients (p < 0.001), never-smoker (p < 0.001) and with family history of cancer (p = 0.031), especially who had family history of lung cancer (p = 0.008). In multivariate analysis, the association of EGFR mutation with family history of cancer also existed (p = 0.027). NSCLC patients with family history of cancer, especially family history of lung cancer, might have a significantly higher incidence of EGFR activating mutation. Crown Copyright © 2013. Published by Elsevier Ireland Ltd. All rights reserved.

Cancerouspdomains: comprehensive analysis of cancer type-specific recurrent somatic mutations in proteins and domains.

PubMed

Hashemi, Seirana; Nowzari Dalini, Abbas; Jalali, Adrin; Banaei-Moghaddam, Ali Mohammad; Razaghi-Moghadam, Zahra

2017-08-16

Discriminating driver mutations from the ones that play no role in cancer is a severe bottleneck in elucidating molecular mechanisms underlying cancer development. Since protein domains are representatives of functional regions within proteins, mutations on them may disturb the protein functionality. Therefore, studying mutations at domain level may point researchers to more accurate assessment of the functional impact of the mutations. This article presents a comprehensive study to map mutations from 29 cancer types to both sequence- and structure-based domains. Statistical analysis was performed to identify candidate domains in which mutations occur with high statistical significance. For each cancer type, the corresponding type-specific domains were distinguished among all candidate domains. Subsequently, cancer type-specific domains facilitated the identification of specific proteins for each cancer type. Besides, performing interactome analysis on specific proteins of each cancer type showed high levels of interconnectivity among them, which implies their functional relationship. To evaluate the role of mitochondrial genes, stem cell-specific genes and DNA repair genes in cancer development, their mutation frequency was determined via further analysis. This study has provided researchers with a publicly available data repository for studying both CATH and Pfam domain regions on protein-coding genes. Moreover, the associations between different groups of genes/domains and various cancer types have been clarified. The work is available at http://www.cancerouspdomains.ir .

Copy-number analysis and inference of subclonal populations in cancer genomes using Sclust.

PubMed

Cun, Yupeng; Yang, Tsun-Po; Achter, Viktor; Lang, Ulrich; Peifer, Martin

2018-06-01

The genomes of cancer cells constantly change during pathogenesis. This evolutionary process can lead to the emergence of drug-resistant mutations in subclonal populations, which can hinder therapeutic intervention in patients. Data derived from massively parallel sequencing can be used to infer these subclonal populations using tumor-specific point mutations. The accurate determination of copy-number changes and tumor impurity is necessary to reliably infer subclonal populations by mutational clustering. This protocol describes how to use Sclust, a copy-number analysis method with a recently developed mutational clustering approach. In a series of simulations and comparisons with alternative methods, we have previously shown that Sclust accurately determines copy-number states and subclonal populations. Performance tests show that the method is computationally efficient, with copy-number analysis and mutational clustering taking <10 min. Sclust is designed such that even non-experts in computational biology or bioinformatics with basic knowledge of the Linux/Unix command-line syntax should be able to carry out analyses of subclonal populations.

Compared effects of missense mutations in Very-Long-Chain Acyl-CoA Dehydrogenase deficiency: Combined analysis by structural, functional and pharmacological approaches.

PubMed

Gobin-Limballe, Stéphanie; McAndrew, Ryan P; Djouadi, Fatima; Kim, Jung-Ja; Bastin, Jean

2010-05-01

Very-Long-Chain Acyl-CoA Dehydrogenase deficiency (VLCADD) is an autosomal recessive disorder considered as one of the more common ss-oxidation defects, possibly associated with neonatal cardiomyopathy, infantile hepatic coma, or adult-onset myopathy. Numerous gene missense mutations have been described in these VLCADD phenotypes, but only few of them have been structurally and functionally analyzed, and the molecular basis of disease variability is still poorly understood. To address this question, we first analyzed fourteen disease-causing amino acid changes using the recently described crystal structure of VLCAD. The predicted effects varied from the replacement of amino acid residues lining the substrate binding cavity, involved in holoenzyme-FAD interactions or in enzyme dimerisation, predicted to have severe functional consequences, up to amino acid substitutions outside key enzyme domains or lying on near enzyme surface, with predicted milder consequences. These data were combined with functional analysis of residual fatty acid oxidation (FAO) and VLCAD protein levels in patient cells harboring these mutations, before and after pharmacological stimulation by bezafibrate. Mutations identified as detrimental to the protein structure in the 3-D model were generally associated to profound FAO and VLCAD protein deficiencies in the patient cells, however, some mutations affecting FAD binding or monomer-monomer interactions allowed a partial response to bezafibrate. On the other hand, bezafibrate restored near-normal FAO rates in some mutations predicted to have milder consequences on enzyme structure. Overall, combination of structural, biochemical, and pharmacological analysis allowed assessment of the relative severity of individual mutations, with possible applications for disease management and therapeutic approach. Copyright 2010 Elsevier B.V. All rights reserved.

ESR1 Mutations Affect Anti-proliferative Responses to Tamoxifen through Enhanced Cross-Talk with IGF Signaling

PubMed Central

Gelsomino, Luca; Gu, Guowei; Rechoum, Yassine; Beyer, Amanda R; Pejerrey, Sasha M; Tsimelzon, Anna; Wang, Tao; Huffman, Kenneth; Ludlow, Andrew; Ando’, Sebastiano; Fuqua, Suzanne AW

2017-01-01

It is now generally accepted that estrogen receptor (ESR1) mutations occur frequently in metastatic breast cancers, however we do not yet know how to best treat these patients. We have modeled the three most frequent hormone binding ESR1 (HBD-ESR1) mutations (Y537N, Y537S, and D538G) using stable lentiviral transduction in human breast cancer cell lines. Effects on growth were examined in response to hormonal and targeted agents, and mutation-specific changes were studied using microarray and western blot analysis. We determined that the HBD-ESR1 mutations alter anti-proliferative effects to tamoxifen (Tam), due to cell-intrinsic changes in activation of the insulin-like growth factor receptor (IGF1R) signaling pathway and levels of PIK3R1/PIK3R3. The selective estrogen receptor degrader, fulvestrant, significantly reduced the anchorage-independent growth of ESR1 mutant-expressing cells, while combination treatments with the mTOR inhibitor everolimus, or an inhibitor blocking IGF1R and the insulin receptor significantly enhanced anti-proliferative responses. Using digital drop (dd) PCR we identified mutations at high frequencies ranging from 12% for Y537N, 5% for Y537S, and 2% for D538G in archived primary breast tumors from women treated with adjuvant mono-tamoxifen therapy. The HBD-ESR1 mutations were not associated with recurrence-free or overall survival in response in this patient cohort, and suggest that knowledge of other cell-intrinsic factors in combination with ESR1 mutation status will be needed determine anti-proliferative responses to Tam. PMID:27178332

Detection of Activating Estrogen Receptor Gene (ESR1) Mutations in Single Circulating Tumor Cells.

PubMed

Paolillo, Carmela; Mu, Zhaomei; Rossi, Giovanna; Schiewer, Matthew J; Nguyen, Thomas; Austin, Laura; Capoluongo, Ettore; Knudsen, Karen; Cristofanilli, Massimo; Fortina, Paolo

2017-10-15

Purpose: Early detection is essential for treatment plans before onset of metastatic disease. Our purpose was to demonstrate feasibility to detect and monitor estrogen receptor 1 ( ESR1 ) gene mutations at the single circulating tumor cell (CTC) level in metastatic breast cancer (MBC). Experimental Design: We used a CTC molecular characterization approach to investigate heterogeneity of 14 hotspot mutations in ESR1 and their correlation with endocrine resistance. Combining the CellSearch and DEPArray technologies allowed recovery of 71 single CTCs and 12 WBC from 3 ER-positive MBC patients. Forty CTCs and 12 WBC were subjected to whole genome amplification by MALBAC and Sanger sequencing. Results: Among 3 selected patients, 2 had an ESR1 mutation (Y537). One showed two different ESR1 variants in a single CTC and another showed loss of heterozygosity. All mutations were detected in matched cell-free DNA (cfDNA). Furthermore, one had 2 serial blood samples analyzed and showed changes in both cfDNA and CTCs with emergence of mutations in ESR1 (Y537S and T570I), which has not been reported previously. Conclusions: CTCs are easily accessible biomarkers to monitor and better personalize management of patients with previously demonstrated ER-MBC who are progressing on endocrine therapy. We showed that single CTC analysis can yield important information on clonal heterogeneity and can be a source of discovery of novel and potential driver mutations. Finally, we also validate a workflow for liquid biopsy that will facilitate early detection of ESR1 mutations, the emergence of endocrine resistance and the choice of further target therapy. Clin Cancer Res; 23(20); 6086-93. ©2017 AACR . ©2017 American Association for Cancer Research.

SEMA3A, a Gene Involved in Axonal Pathfinding, Is Mutated in Patients with Kallmann Syndrome

PubMed Central

Parkash, Jyoti; Espy, Cécile; Fouveaut, Corinne; Leroy, Chrystel; Baron, Stéphanie; Campagne, Céline; Vanacker, Charlotte; Collier, Francis; Cruaud, Corinne; Meyer, Vincent; García-Piñero, Alfons; Dewailly, Didier; Cortet-Rudelli, Christine; Gersak, Ksenija; Metz, Chantal; Chabrier, Gérard; Pugeat, Michel; Young, Jacques; Hardelin, Jean-Pierre; Prevot, Vincent; Dodé, Catherine

2012-01-01

Kallmann syndrome (KS) associates congenital hypogonadism due to gonadotropin-releasing hormone (GnRH) deficiency and anosmia. The genetics of KS involves various modes of transmission, including oligogenic inheritance. Here, we report that Nrp1 sema/sema mutant mice that lack a functional semaphorin-binding domain in neuropilin-1, an obligatory coreceptor of semaphorin-3A, have a KS–like phenotype. Pathohistological analysis of these mice indeed showed abnormal development of the peripheral olfactory system and defective embryonic migration of the neuroendocrine GnRH cells to the basal forebrain, which results in increased mortality of newborn mice and reduced fertility in adults. We thus screened 386 KS patients for the presence of mutations in SEMA3A (by Sanger sequencing of all 17 coding exons and flanking splice sites) and identified nonsynonymous mutations in 24 patients, specifically, a frameshifting small deletion (D538fsX31) and seven different missense mutations (R66W, N153S, I400V, V435I, T688A, R730Q, R733H). All the mutations were found in heterozygous state. Seven mutations resulted in impaired secretion of semaphorin-3A by transfected COS-7 cells (D538fsX31, R66W, V435I) or reduced signaling activity of the secreted protein in the GN11 cell line derived from embryonic GnRH cells (N153S, I400V, T688A, R733H), which strongly suggests that these mutations have a pathogenic effect. Notably, mutations in other KS genes had already been identified, in heterozygous state, in five of these patients. Our findings indicate that semaphorin-3A signaling insufficiency contributes to the pathogenesis of KS and further substantiate the oligogenic pattern of inheritance in this developmental disorder. PMID:22927827

SEMA3A, a gene involved in axonal pathfinding, is mutated in patients with Kallmann syndrome.

PubMed

Hanchate, Naresh Kumar; Giacobini, Paolo; Lhuillier, Pierre; Parkash, Jyoti; Espy, Cécile; Fouveaut, Corinne; Leroy, Chrystel; Baron, Stéphanie; Campagne, Céline; Vanacker, Charlotte; Collier, Francis; Cruaud, Corinne; Meyer, Vincent; García-Piñero, Alfons; Dewailly, Didier; Cortet-Rudelli, Christine; Gersak, Ksenija; Metz, Chantal; Chabrier, Gérard; Pugeat, Michel; Young, Jacques; Hardelin, Jean-Pierre; Prevot, Vincent; Dodé, Catherine

2012-08-01

Kallmann syndrome (KS) associates congenital hypogonadism due to gonadotropin-releasing hormone (GnRH) deficiency and anosmia. The genetics of KS involves various modes of transmission, including oligogenic inheritance. Here, we report that Nrp1(sema/sema) mutant mice that lack a functional semaphorin-binding domain in neuropilin-1, an obligatory coreceptor of semaphorin-3A, have a KS-like phenotype. Pathohistological analysis of these mice indeed showed abnormal development of the peripheral olfactory system and defective embryonic migration of the neuroendocrine GnRH cells to the basal forebrain, which results in increased mortality of newborn mice and reduced fertility in adults. We thus screened 386 KS patients for the presence of mutations in SEMA3A (by Sanger sequencing of all 17 coding exons and flanking splice sites) and identified nonsynonymous mutations in 24 patients, specifically, a frameshifting small deletion (D538fsX31) and seven different missense mutations (R66W, N153S, I400V, V435I, T688A, R730Q, R733H). All the mutations were found in heterozygous state. Seven mutations resulted in impaired secretion of semaphorin-3A by transfected COS-7 cells (D538fsX31, R66W, V435I) or reduced signaling activity of the secreted protein in the GN11 cell line derived from embryonic GnRH cells (N153S, I400V, T688A, R733H), which strongly suggests that these mutations have a pathogenic effect. Notably, mutations in other KS genes had already been identified, in heterozygous state, in five of these patients. Our findings indicate that semaphorin-3A signaling insufficiency contributes to the pathogenesis of KS and further substantiate the oligogenic pattern of inheritance in this developmental disorder.

Molecular analysis of hprt mutations induced by chromium picolinate in CHO AA8 cells.

PubMed

Coryell, Virginia H; Stearns, Diane M

2006-11-07

Chromium picolinate (CrPic) is a popular dietary supplement, marketed to the public for weight loss, bodybuilding, and control of blood sugar. Recommendations for long-term use at high dosages have led to questions regarding its safety. Previous studies have reported that CrPic can cause chromosomal aberrations and mutations. The purpose of the current work was to compare the mutagenicity of CrPic as a suspension in acetone versus a solution in DMSO, and to characterize the hprt mutations induced by CrPic in CHO AA8 cells. Treatments of 2% acetone or 2% DMSO alone produced no significant increase in 6-thioguanine (6-TG)-resistant mutants after 48 h exposures. Mutants resistant to 6-TG were generated by exposing cells for 48 h to 80 microg/cm(2) CrPic in acetone or to 1.0mM CrPic in DMSO. CrPic in acetone produced an average induced mutation frequency (MF) of 56 per 10(6) surviving cells relative to acetone solvent. CrPic in acetone was 3.5-fold more mutagenic than CrPic in DMSO, which produced an MF of 16.2. Characterization of 61 total mutations in 48 mutants generated from exposure to CrPic in acetone showed that base substitutions comprised 33% of the mutations, with transversions being predominant; deletions made up 62% of the mutations, with one-exon deletions predominating; and 1-4 bp insertions made up 5% of the characterized mutations. CrPic induced a statistically greater number of deletions and a statistically smaller number of base substitutions than have been measured in spontaneously generated mutants. These data confirm previous studies showing that CrPic is mutagenic, and support the contention that further study is needed to verify the safety of CrPic for human consumption.

Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia

PubMed Central

Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.

2013-01-01

BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein structures, and assessment on the basis of in vitro expression showed that familial hypocalciuric hypercalcemia type 2–associated mutations decreased the sensitivity of cells expressing calcium-sensing receptors to changes in extracellular calcium concentrations, whereas autosomal dominant hypocalcemia type 2–associated mutations increased cell sensitivity. CONCLUSIONS Gα11 mutants with loss of function cause familial hypocalciuric hypercalcemia type 2, and Gα11 mutants with gain of function cause a clinical disorder designated as autosomal dominant hypocalcemia type 2. (Funded by the United Kingdom Medical Research Council and others.) PMID:23802516

Small-Cell Carcinomas of the Bladder and Lung Are Characterized by a Convergent but Distinct Pathogenesis.

PubMed

Chang, Matthew T; Penson, Alexander; Desai, Neil B; Socci, Nicholas D; Shen, Ronglai; Seshan, Venkatraman E; Kundra, Ritika; Abeshouse, Adam; Viale, Agnes; Cha, Eugene K; Hao, Xueli; Reuter, Victor E; Rudin, Charles M; Bochner, Bernard H; Rosenberg, Jonathan E; Bajorin, Dean F; Schultz, Nikolaus; Berger, Michael F; Iyer, Gopa; Solit, David B; Al-Ahmadie, Hikmat A; Taylor, Barry S

2018-04-15

Purpose: Small-cell carcinoma of the bladder (SCCB) is a rare and aggressive neuroendocrine tumor with a dismal prognosis and limited treatment options. As SCCB is histologically indistinguishable from small-cell lung cancer, a shared pathogenesis and cell of origin has been proposed. The aim of this study is to determine whether SCCBs arise from a preexisting urothelial carcinoma or share a molecular pathogenesis in common with small-cell lung cancer. Experimental Design: We performed an integrative analysis of 61 SCCB tumors to identify histology- and organ-specific similarities and differences. Results: SCCB has a high somatic mutational burden driven predominantly by an APOBEC-mediated mutational process. TP53, RB1 , and TERT promoter mutations were present in nearly all samples. Although these events appeared to arise early in all affected tumors and likely reflect an evolutionary branch point that may have driven small-cell lineage differentiation, they were unlikely the founding transforming event, as they were often preceded by diverse and less common driver mutations, many of which are common in bladder urothelial cancers, but not small-cell lung tumors. Most patient tumors (72%) also underwent genome doubling (GD). Although arising at different chronologic points in the evolution of the disease, GD was often preceded by biallelic mutations in TP53 with retention of two intact copies. Conclusions: Our findings indicate that small-cell cancers of the bladder and lung have a convergent but distinct pathogenesis, with SCCBs arising from a cell of origin shared with urothelial bladder cancer. Clin Cancer Res; 24(8); 1965-73. ©2017 AACR See related commentary by Oser and Jänne, p. 1775 . ©2017 American Association for Cancer Research.

Whole-exome sequencing and immune profiling of early-stage lung adenocarcinoma with fully annotated clinical follow-up

PubMed Central

Kadara, H; Choi, M; Zhang, J; Parra, E R; Rodriguez-Canales, J; Gaffney, S G; Zhao, Z; Behrens, C; Fujimoto, J; Chow, C; Yoo, Y; Kalhor, N; Moran, C; Rimm, D; Swisher, S; Gibbons, D L; Heymach, J; Kaftan, E; Townsend, J P; Lynch, T J; Schlessinger, J; Lee, J; Lifton, R P; Wistuba, I I; Herbst, R S

2017-01-01

Abstract Background Lung adenocarcinomas (LUADs) lead to the majority of deaths attributable to lung cancer. We performed whole-exome sequencing (WES) and immune profiling analyses of a unique set of clinically annotated early-stage LUADs to better understand the pathogenesis of this disease and identify clinically relevant molecular markers. Methods We performed WES of 108 paired stage I-III LUADs and normal lung tissues using the Illumina HiSeq 2000 platform. Ten immune markers (PD-L1, PD-1, CD3, CD4, CD8, CD45ro, CD57, CD68, FOXP3 and Granzyme B) were profiled by imaging-based immunohistochemistry (IHC) in a subset of LUADs (n = 92). Associations among mutations, immune markers and clinicopathological variables were analyzed using ANOVA and Fisher’s exact test. Cox proportional hazards regression models were used for multivariate analysis of clinical outcome. Results LUADs in this cohort exhibited an average of 243 coding mutations. We identified 28 genes with significant enrichment for mutation. SETD2-mutated LUADs exhibited relatively poor recurrence- free survival (RFS) and mutations in STK11 and ATM were associated with poor RFS among KRAS-mutant tumors. EGFR, KEAP1 and PIK3CA mutations were predictive of poor response to adjuvant therapy. Immune marker analysis revealed that LUADs in smokers and with relatively high mutation burdens exhibited increased levels of immune markers. Analysis of immunophenotypes revealed that LUADs with STK11 mutations exhibited relatively low levels of infiltrating CD4+/CD8+ T-cells indicative of a muted immune response. Tumoral PD-L1 was significantly elevated in TP53 mutant LUADs whereas PIK3CA mutant LUADs exhibited markedly down-regulated PD-L1 expression. LUADs with TP53 or KEAP1 mutations displayed relatively increased CD57 and Granzyme B levels indicative of augmented natural killer (NK) cell infiltration. Conclusion(s) Our study highlights molecular and immune phenotypes that warrant further analysis for their roles in clinical outcomes and personalized immune-based therapy of LUAD. PMID:27687306

Whole-exome sequencing and immune profiling of early-stage lung adenocarcinoma with fully annotated clinical follow-up.

PubMed

Kadara, H; Choi, M; Zhang, J; Parra, E R; Rodriguez-Canales, J; Gaffney, S G; Zhao, Z; Behrens, C; Fujimoto, J; Chow, C; Yoo, Y; Kalhor, N; Moran, C; Rimm, D; Swisher, S; Gibbons, D L; Heymach, J; Kaftan, E; Townsend, J P; Lynch, T J; Schlessinger, J; Lee, J; Lifton, R P; Wistuba, I I; Herbst, R S

2017-01-01

Lung adenocarcinomas (LUADs) lead to the majority of deaths attributable to lung cancer. We performed whole-exome sequencing (WES) and immune profiling analyses of a unique set of clinically annotated early-stage LUADs to better understand the pathogenesis of this disease and identify clinically relevant molecular markers. We performed WES of 108 paired stage I-III LUADs and normal lung tissues using the Illumina HiSeq 2000 platform. Ten immune markers (PD-L1, PD-1, CD3, CD4, CD8, CD45ro, CD57, CD68, FOXP3 and Granzyme B) were profiled by imaging-based immunohistochemistry (IHC) in a subset of LUADs (n = 92). Associations among mutations, immune markers and clinicopathological variables were analyzed using ANOVA and Fisher's exact test. Cox proportional hazards regression models were used for multivariate analysis of clinical outcome. LUADs in this cohort exhibited an average of 243 coding mutations. We identified 28 genes with significant enrichment for mutation. SETD2-mutated LUADs exhibited relatively poor recurrence- free survival (RFS) and mutations in STK11 and ATM were associated with poor RFS among KRAS-mutant tumors. EGFR, KEAP1 and PIK3CA mutations were predictive of poor response to adjuvant therapy. Immune marker analysis revealed that LUADs in smokers and with relatively high mutation burdens exhibited increased levels of immune markers. Analysis of immunophenotypes revealed that LUADs with STK11 mutations exhibited relatively low levels of infiltrating CD4+/CD8+ T-cells indicative of a muted immune response. Tumoral PD-L1 was significantly elevated in TP53 mutant LUADs whereas PIK3CA mutant LUADs exhibited markedly down-regulated PD-L1 expression. LUADs with TP53 or KEAP1 mutations displayed relatively increased CD57 and Granzyme B levels indicative of augmented natural killer (NK) cell infiltration. Our study highlights molecular and immune phenotypes that warrant further analysis for their roles in clinical outcomes and personalized immune-based therapy of LUAD. © The Author 2016. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

The cornerstone K-RAS mutation in pancreatic adenocarcinoma: From cell signaling network, target genes, biological processes to therapeutic targeting.

PubMed

Jonckheere, Nicolas; Vasseur, Romain; Van Seuningen, Isabelle

2017-03-01

RAS belongs to the super family of small G proteins and plays crucial roles in signal transduction from membrane receptors in the cell. Mutations of K-RAS oncogene lead to an accumulation of GTP-bound proteins that maintains an active conformation. In the pancreatic ductal adenocarcinoma (PDAC), one of the most deadly cancers in occidental countries, mutations of the K-RAS oncogene are nearly systematic (>90%). Moreover, K-RAS mutation is the earliest genetic alteration occurring during pancreatic carcinogenetic sequence. In this review, we discuss the central role of K-RAS mutations and their tremendous diversity of biological properties by the interconnected regulation of signaling pathways (MAPKs, NF-κB, PI3K, Ral…). In pancreatic ductal adenocarcinoma, transcriptome analysis and preclinical animal models showed that K-RAS mutation alters biological behavior of PDAC cells (promoting proliferation, migration and invasion, evading growth suppressors, regulating mucin pattern, and miRNA expression). K-RAS also impacts tumor microenvironment and PDAC metabolism reprogramming. Finally we discuss therapeutic targeting strategies of K-RAS that have been developed without significant clinical success so far. As K-RAS is considered as the undruggable target, targeting its multiple effectors and target genes should be considered as potential alternatives. Copyright © 2017 Elsevier B.V. All rights reserved.

Assessment of cytology based molecular analysis to guide targeted therapy in advanced non-small-cell lung cancer.

PubMed

Li, Wenbin; Zhang, Zhihui; Guo, Lei; Qiu, Tian; Ling, Yun; Cao, Jian; Guo, Huiqin; Zhao, Huan; Li, Lin; Ying, Jianming

2016-02-16

To investigate the use of molecular testing on cytological specimens in selecting advanced non-small cell lung cancer (NSCLC) patients who are adequate for targeted treatment, a total of 137 NSCLC cases were analyzed by fluorescence in situ hybridization (FISH) for anaplastic lymphoma kinase (ALK) rearrangements, and Epidermal growth factor receptor (EGFR), kirsten rat sarcoma viral oncogene homolog (KRAS) mutations were evaluated by quantitative real-time PCR (qRT-PCR) platform combining amplification refractory mutation system (ARMS) primers and TaqMan probes. Cytological specimens included 91 fine-needle aspirates, 5 fibreoptic bronchoscopic derived samples and 41 pleural effusions. Among 137 NSCLCs analyzed for ALK FISH, 16 (11.7%, of 137) were detected to harbor ALK rearrangement. FISH positive cases were all defined as adenocarcinoma (ADC) histologic subtype and the FNA samples showed the highest ALK positive rate (13.2%, 12/91). Of the 9 ALK FISH positive patients who received crizotinib treatment, 8 (88.9%) patients exhibited tumor regression. In addition, 60 (44.8%, of 134) cases were found to harbor EGFR mutations and 22 patients with EGFR sensitive mutations who received gefitinib or erlotinib treatment showed a median PFS of 16.0 months. Mutations of KRAS occurred in 8 (6.0%, of 134) cases and this was mutually exclusive from EGFR mutation. Our results demonstrated that ALK FISH and EGFR, KRAS mutational analysis on cytological specimens are sensitive methods for screening advanced stage NSCLC patients who are adequate for targeted treatment.

The spectrum and clinical impact of epigenetic modifier mutations in myeloma

PubMed Central

Pawlyn, Charlotte; Kaiser, Martin F; Heuck, Christoph; Melchor, Lorenzo; Wardell, Christopher P; Murison, Alex; Chavan, Shweta; Johnson, David C; Begum, Dil; Dahir, Nasrin; Proszek, Paula; Cairns, David A; Boyle, Eileen M; Jones, John R; Cook, Gordon; Drayson, Mark T; Owen, Roger G; Gregory, Walter M; Jackson, Graham H; Barlogie, Bart; Davies, Faith E; Walker, Brian A; Morgan, Gareth J

2016-01-01

Purpose Epigenetic dysregulation is known to be an important contributor to myeloma pathogenesis but, unlike in other B cell malignancies, the full spectrum of somatic mutations in epigenetic modifiers has not been previously reported. We sought to address this using results from whole-exome sequencing in the context of a large prospective clinical trial of newly diagnosed patients and targeted sequencing in a cohort of previously treated patients for comparison. Experimental Design Whole-exome sequencing analysis of 463 presenting myeloma cases entered in the UK NCRI Myeloma XI study and targeted sequencing analysis of 156 previously treated cases from the University of Arkansas for Medical Sciences. We correlated the presence of mutations with clinical outcome from diagnosis and compared the mutations found at diagnosis with later stages of disease. Results In diagnostic myeloma patient samples we identify significant mutations in genes encoding the histone 1 linker protein, previously identified in other B-cell malignancies. Our data suggest an adverse prognostic impact from the presence of lesions in genes encoding DNA methylation modifiers and the histone demethylase KDM6A/UTX. The frequency of mutations in epigenetic modifiers appears to increase following treatment most notably in genes encoding histone methyltransferases and DNA methylation modifiers. Conclusions Numerous mutations identified raise the possibility of targeted treatment strategies for patients either at diagnosis or relapse supporting the use of sequencing-based diagnostics in myeloma to help guide therapy as more epigenetic targeted agents become available. PMID:27235425

Dynamic interactions between Pit-1 and C/EBPalpha in the pituitary cell nucleus.

PubMed

Demarco, Ignacio A; Voss, Ty C; Booker, Cynthia F; Day, Richard N

2006-11-01

The homeodomain (HD) transcription factors are a structurally conserved family of proteins that, through networks of interactions with other nuclear proteins, control patterns of gene expression during development. For example, the network interactions of the pituitary-specific HD protein Pit-1 control the development of anterior pituitary cells and regulate the expression of the hormone products in the adult cells. Inactivating mutations in Pit-1 disrupt these processes, giving rise to the syndrome of combined pituitary hormone deficiency. Pit-1 interacts with CCAAT/enhancer-binding protein alpha (C/EBPalpha) to regulate prolactin transcription. Here, we used the combination of biochemical analysis and live-cell microscopy to show that two different point mutations in Pit-1, which disrupted distinct activities, affected the dynamic interactions between Pit-1 and C/EBPalpha in different ways. The results showed that the first alpha-helix of the POU-S domain is critical for the assembly of Pit-1 with C/EBPalpha, and they showed that DNA-binding activity conferred by the HD is critical for the final intranuclear positioning of the metastable complex. This likely reflects more general mechanisms that govern cell-type-specific transcriptional control, and the results from the analysis of the point mutations could indicate an important link between the mislocalization of transcriptional complexes and disease processes.

Intronic splicing mutations in PTCH1 cause Gorlin syndrome.

PubMed

Bholah, Zaynab; Smith, Miriam J; Byers, Helen J; Miles, Emma K; Evans, D Gareth; Newman, William G

2014-09-01

Gorlin syndrome is an autosomal dominant disorder characterized by multiple early-onset basal cell carcinoma, odontogenic keratocysts and skeletal abnormalities. It is caused by heterozygous mutations in the tumour suppressor PTCH1. Routine clinical genetic testing, by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA) to confirm a clinical diagnosis of Gorlin syndrome, identifies a mutation in 60-90 % of cases. We undertook RNA analysis on lymphocytes from ten individuals diagnosed with Gorlin syndrome, but without known PTCH1 mutations by exonic sequencing or MLPA. Two altered PTCH1 transcripts were identified. Genomic DNA sequence analysis identified an intron 7 mutation c.1068-10T>A, which created a strong cryptic splice acceptor site, leading to an intronic insertion of eight bases; this is predicted to create a frameshift p.(His358Alafs*12). Secondly, a deep intronic mutation c.2561-2057A>G caused an inframe insertion of 78 intronic bases in the cDNA transcript, leading to a premature stop codon p.(Gly854fs*3). The mutations are predicted to cause loss of function of PTCH1, consistent with its tumour suppressor function. The findings indicate the importance of RNA analysis to detect intronic mutations in PTCH1 not identified by routine screening techniques.

Noninvasive prenatal diagnosis of hemophilia by microfluidics digital PCR analysis of maternal plasma DNA.

PubMed

Tsui, Nancy B Y; Kadir, Rezan A; Chan, K C Allen; Chi, Claudia; Mellars, Gillian; Tuddenham, Edward G; Leung, Tak Y; Lau, Tze K; Chiu, Rossa W K; Lo, Y M Dennis

2011-03-31

Hemophilia is a bleeding disorder with X-linked inheritance. Current prenatal diagnostic methods for hemophilia are invasive and pose a risk to the fetus. Cell-free fetal DNA analysis in maternal plasma provides a noninvasive mean of assessing fetal sex in such pregnancies. However, the disease status of male fetuses remains unknown if mutation-specific confirmatory analysis is not performed. Here we have developed a noninvasive test to diagnose whether the fetus has inherited a causative mutation for hemophilia from its mother. The strategy is based on a relative mutation dosage approach, which we have previously established for determining the mutational status of fetuses for autosomal disease mutations. In this study, the relative mutation dosage method is used to deduce whether a fetus has inherited a hemophilia mutation on chromosome X by detecting whether the concentration of the mutant or wild-type allele is overrepresented in the plasma of heterozygous women carrying male fetuses. We correctly detected fetal genotypes for hemophilia mutations in all of the 12 studied maternal plasma samples obtained from at-risk pregnancies from as early as the 11th week of gestation. This development would make the decision to undertake prenatal testing less traumatic and safer for at-risk families.

Pyrosequencing analysis for detection of a BRAFV600E mutation in an FNAB specimen of thyroid nodules.

PubMed

Kim, Suk Kyeong; Kim, Dong-Lim; Han, Hye Seung; Kim, Wan Seop; Kim, Seung Ja; Moon, Won Jin; Oh, Seo Young; Hwang, Tae Sook

2008-06-01

Fine-needle aspiration biopsy (FNAB) is the primary means of distinguishing benign from malignant and of guiding therapeutic intervention in thyroid nodules. However, 10% to 30% of cases with indeterminate cytology in FNAB need other diagnostic tools to refine diagnosis. We compared the pyrosequencing method with the conventional direct DNA sequencing analysis and investigated the usefulness of preoperative BRAF mutation analysis as an adjunct diagnostic tool with routine FNAB. A total of 103 surgically confirmed patients' FNA slides were recruited and DNA was extracted after atypical cells were scraped from the slides. BRAF mutation was analyzed by pyrosequencing and direct DNA sequencing. Sixty-three (77.8%) of 81 histopathologically diagnosed malignant nodules revealed positive BRAF mutation on pyrosequencing analysis. In detail, 63 (84.0%) of 75 papillary thyroid carcinoma (PTC) samples showed positive BRAF mutation, whereas 3 follicular thyroid carcinomas, 1 anaplastic carcinoma, 1 medullary thyroid carcinoma, and 1 metastatic lung carcinoma did not show BRAF mutation. None of 22 benign nodules had BRAF mutation in both pyrosequencing and direct DNA sequencing. Out of 27 thyroid nodules classified as 'indeterminate' on cytologic examination preoperatively, 21 (77.8%) cases turned out to be malignant: 18 PTCs (including 2 follicular variant types) and 3 follicular thyroid carcinomas. Among these, 13 (61.9%) classic PTCs had BRAF mutation. None of 6 benign nodules, including 3 follicular adenomas and 3 nodular hyperplasias, had BRAF mutation. Among 63 PTCs with positive BRAF mutation detected by pyrosequencing analysis, 3 cases did not show BRAF mutation by direct DNA sequencing. Although it was not statistically significant, pyrosequencing was superior to direct DNA sequencing in detecting the BRAF mutation of thyroid nodules (P=0.25). Detecting BRAF mutation by pyrosequencing is more sensitive, faster, and less expensive than direct DNA sequencing and is proposed as an adjunct diagnostic tool in evaluating thyroid nodules of indeterminate cytology.

Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

PubMed

Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

2015-04-23

With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

Parameters affecting frequency of CRISPR/Cas9 mediated targeted mutagenesis in rice.

PubMed

Mikami, Masafumi; Toki, Seiichi; Endo, Masaki

2015-10-01

Frequency of CRISPR/Cas9-mediated targeted mutagenesis varies depending on Cas9 expression level and culture period of rice callus. Recent reports have demonstrated that the CRISPR/Cas9 system can function as a sequence-specific nuclease in various plant species. Induction of mutation in proliferating tissue during embryogenesis or in germline cells is a practical means of generating heritable mutations. In the case of plant species in which cultured cells are used for transformation, non-chimeric plants can be obtained when regeneration occurs from mutated cells. Since plantlets are regenerated from both mutated and non-mutated cells in a random manner, any increment in the proportion of mutated cells in Cas9- and guide RNA (gRNA)-expressing cells will help increase the number of plants containing heritable mutations. In this study, we examined factors affecting mutation frequency in rice calli. Following sequential transformation of rice calli with Cas9- and gRNA- expression constructs, the mutation frequency in independent Cas9 transgenic lines was analyzed. A positive correlation between Cas9 expression level and mutation frequency was found. This positive relationship was observed regardless of whether the transgene or an endogenous gene was used as the target for CRISPR/Cas9-mediated mutagenesis. Furthermore, we found that extending the culture period increased the proportion of mutated cells as well as the variety of mutations obtained. Because mutated and non-mutated cells might proliferate equally, these results suggest that a prolonged tissue culture period increases the chance of inducing de novo mutations in non-mutated cells. This fundamental knowledge will help improve systems for obtaining non-chimeric regenerated plants in many plant species.

Platelet-mediated transformation of mtDNA-less human cells: Analysis of phenotypic variability among clones from normal individuals-and complementation behavior of the tRNA[sup Lys] mutation causing myoclonic epilepsy and ragged red fibers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chomyn, A.; Lai, S.T.; Shakeley, R.

1994-06-01

In the present work, the authors demonstrate the possibility of using human blood platelets as mitochondrial donors for the repopulation of mtDNA-less ([rho][sup o]) cells. The noninvasive nature of platelet isolation, combined with the prolonged viability of platelet mitochondria and the simplicity and efficiency of the mitochondria-transfer procedure, has substantially increased the applicability of the [rho][sup o] cell transformation approach for mitochondrial genetic analysis and for the study of mtDNA-linked diseases. This approach has been applied to platelets from several normal human individuals and one individual affected by the myoclonic-epilepsy-and-ragged-red-fibers (MERRF) encephalomyopathy. A certain variability in respiratory capacity was observedmore » among the platelet-derived [rho][sup o] cell transformants from a given normal subject, and it was shown to be unrelated to their mtDNA content. The results of sequential transfer of mitochondria from selected transformants into a [rho][sup o] cell line different from the first [rho][sup o] acceptor strongly suggest that this variability reflected, at least in part, differences in nuclear gene content and/or activity among the original recipient cells. A much greater variability in respiratory capacity was observed among the transformants derived from the MERRF patient and was found to be related to the presence and amount of the mitochondrial tRNA[sup Lys] mutation associated with the MERRF syndrome. An analysis of the relationship between proportion of mtDNA carrying the MERRF mutation and degree of respiratory activity in various transformations derived from the MERRF patient revealed an unusual complementation behavior of the tRNA[sup Lys] mutation, possibly reflecting the distribution of mutant mtDNA among the platelet mitochondria. 29 refs., 4 figs., 1 tab.« less

[Myofibroma/myofibromatosis: a clinicopathologic analysis of 9 cases].

PubMed

Fu, Y; Guan, W Y; Wu, H Y; Wu, H Y; Fan, Z W; Ye, Q; Meng, F Q

2018-01-08

Objective: To investigate the clinical and histological features, diagnosis and differential diagnosis of myofibroma/myofibromatosis. Methods: The clinical data and pathology features of nine cases of myofibroma/myofibromatosis were collected from August 2011 to November 2016 in Affiliated Drum Tower Hospital, Nanjing University Medical School and Children's Hospital of Nanjing Medical University. Immunohistochemistry(IHC), PDGFRB molecular analysis and ETV6-NTRK3 gene fusion were performed and relevant literature reviewed. Results: There were 7 males and 2 females, with age ranging from 3 days to 18 years (mean 5 years). The tumors were located in head and neck (eight cases) and trunk (one case). Clinically, the tumors presented as freely movable nodules. Microscopically, they appeared biphasic with alternating light- and dark-staining areas. The light-staining area consisted mainly of plump myoid spindle cells with eosinophilic cytoplasm arranged in nodules, short fascicles, or whorls.The dark-staining area was composed of round or polygonal cells with slightly hyperchromatic nuclei or small spindle cells arranged around a distinct hemangiopericytoma-like vascular pattern. IHC showed the tumor cells in the light-staining area were strongly positive for vimentin and SMA, while cells in dark-staining area were strongly positive for vimentin, and weakly for SMA. Tumor cells were negative for desmin, S-100 protein, h-Caldesmon, CD34 and STAT6. Analysis of PDGFRB mutations was performed in seven cases. Two cases showed 12 exon point mutation c. 1681 c>T(p.R561C), one case showed 14 exon point mutation c. 1998C>G (p.N666K). ETV6-NTRK3 gene fusion was not detected by fluorescence in situ hybridization in four patients under three years old. All cases were followed for 6 to 68 months, with two recurrences. Conclusions: Myofibroma/myofibromatosis is an uncommon benign myofibroblastic tumor of infancy and childhood. The tumor can appear biphasic, and may show PDGFRB point mutation which is of potential diagnostic value.

TBECH, 1,2-dibromo-4-(1,2 dibromoethyl) cyclohexane, alters androgen receptor regulation in response to mutations associated with prostate cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kharlyngdoh, Joubert Banjop; Asnake, Solomon; Prad

Point mutations in the AR ligand-binding domain (LBD) can result in altered AR structures leading to changes of ligand specificity and functions. AR mutations associated to prostate cancer (PCa) have been shown to result in receptor activation by non-androgenic substances and anti-androgenic drugs. Two AR mutations known to alter the function of anti-androgens are the AR{sub T877A} mutation, which is frequently detected mutation in PCa tumors and the AR{sub W741C} that is rare and has been derived in vitro following exposure of cells to the anti-androgen bicalutamide. AR activation by non-androgenic environmental substances has been suggested to affect PCa progression.more » In the present study we investigated the effect of AR mutations (AR{sub W741C} and AR{sub T877A}) on the transcriptional activation following exposure of cells to an androgenic brominated flame retardant, 1,2-dibromo-4-(1,2 dibromoethyl) cyclohexane (TBECH, also named DBE-DBCH). The AR mutations resulted in higher interaction energies and increased transcriptional activation in response to TBECH diastereomer exposures. The AR{sub T877A} mutation rendered AR highly responsive to low levels of DHT and TBECH and led to increased AR nuclear translocation. Gene expression analysis showed a stronger induction of AR target genes in LNCaP cells (AR{sub T877A}) compared to T-47D cells (AR{sub WT}) following TBECH exposure. Furthermore, AR knockdown experiments confirmed the AR dependency of these responses. The higher sensitivity of AR{sub T877A} and AR{sub W741C} to low levels of TBECH suggests that cells with these AR mutations are more susceptible to androgenic endocrine disrupters. - Highlights: • TBECH, is an endocrine disrupting compound that differ in activity depending on AR structure and sequence. • TBECH interaction with the human AR-LBD containing the mutations W741C and T877A is increased compared to the wild type receptor • The mutations, W741C and T877A, are more potent than the wild type receptor at inducing AR nuclear translocation and transcriptional activation following TBECH exposure. • TBECH mediates action on androgen response genes via AR signaling.« less

Application of advanced cytometric and molecular technologies to minimal residual disease monitoring

NASA Astrophysics Data System (ADS)

Leary, James F.; He, Feng; Reece, Lisa M.

2000-04-01

Minimal residual disease monitoring presents a number of theoretical and practical challenges. Recently it has been possible to meet some of these challenges by combining a number of new advanced biotechnologies. To monitor the number of residual tumor cells requires complex cocktails of molecular probes that collectively provide sensitivities of detection on the order of one residual tumor cell per million total cells. Ultra-high-speed, multi parameter flow cytometry is capable of analyzing cells at rates in excess of 100,000 cells/sec. Residual tumor selection marker cocktails can be optimized by use of receiver operating characteristic analysis. New data minimizing techniques when combined with multi variate statistical or neural network classifications of tumor cells can more accurately predict residual tumor cell frequencies. The combination of these techniques can, under at least some circumstances, detect frequencies of tumor cells as low as one cell in a million with an accuracy of over 98 percent correct classification. Detection of mutations in tumor suppressor genes requires insolation of these rare tumor cells and single-cell DNA sequencing. Rare residual tumor cells can be isolated at single cell level by high-resolution single-cell cell sorting. Molecular characterization of tumor suppressor gene mutations can be accomplished using a combination of single- cell polymerase chain reaction amplification of specific gene sequences followed by TA cloning techniques and DNA sequencing. Mutations as small as a single base pair in a tumor suppressor gene of a single sorted tumor cell have been detected using these methods. Using new amplification procedures and DNA micro arrays it should be possible to extend the capabilities shown in this paper to screening of multiple DNA mutations in tumor suppressor and other genes on small numbers of sorted metastatic tumor cells.

The Bim deletion polymorphism clinical profile and its relation with tyrosine kinase inhibitor resistance in Chinese patients with non-small cell lung cancer.

PubMed

Zhao, Mingchuan; Zhang, Yishi; Cai, Weijing; Li, Jiayu; Zhou, Fei; Cheng, Ningning; Ren, Ruixin; Zhao, Chao; Li, Xuefei; Ren, Shengxiang; Zhou, Caicun; Hirsch, Fred R

2014-08-01

Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) are widely used for the treatment of patients with advanced non-small cell lung cancer (NSCLC) who have EGFR mutations. Recent studies have indicated that some patients with positive mutations were refractory to EGFR TKIs if they harbored a B-cell chronic lymphocytic leukemia/lymphoma (Bcl-2)-like 11 (Bim) deletion polymorphism. The objective of the current work was to retrospectively study the Bim deletion polymorphism in Chinese patients with NSCLC and its correlation with the efficacy of EGFR TKIs. Distribution of the Bim polymorphism was detected using polymerase chain reaction analysis and direct sequencing of DNA from peripheral neutrophils in samples from 352 patients with NSCLC. Of the 352 patients, 166 who received TKI therapy and had an activating mutation identified were involved in further analysis. Progression-free survival (PFS) was the primary endpoint of the subsequent analyses, and the incidence of the Bim polymorphism and its relation to clinical benefit from EGFR TKIs also were investigated. In total, 45 of 352 patient samples (12.8%) had the Bim deletion polymorphism, which was distributed randomly with regard to various clinical characteristics. In patients with EGFR mutations who received treatment with TKIs, the median PFS and the median objective response rate were 4.7 months and 25%, respectively, for those with the Bim deletion polymorphism versus 11 months (P = .003) and 66% (P = .001), respectively, for those with wild-type Bim. Cox regression analysis identified Bim status (P = .016) and sex (P = .002) as independent factors predicting clinical benefit from EGFR TKIs in patients with EGFR-mutated NSCLC. The incidence of the Bim deletion polymorphism was approximately 13% in this study, and it was associated with a poor clinical response to EGFR TKIs in patients who had NSCLC with EGFR mutations. © 2014 American Cancer Society.

Somatic mutations in cancer: Stochastic versus predictable.

PubMed

Gold, Barry

2017-02-01

The origins of human cancers remain unclear except for a limited number of potent environmental mutagens, such as tobacco and UV light, and in rare cases, familial germ line mutations that affect tumor suppressor genes or oncogenes. A significant component of cancer etiology has been deemed stochastic and correlated with the number of stem cells in a tissue, the number of times the stem cells divide and a low incidence of random DNA polymerase errors that occur during each cell division. While somatic mutations occur during each round of DNA replication, mutations in cancer driver genes are not stochastic. Out of a total of 2843 codons, 1031 can be changed to stop codons by a single base substitution in the tumor suppressor APC gene, which is mutated in 76% of colorectal cancers (CRC). However, the nonsense mutations, which comprise 65% of all the APC driver mutations in CRC, are not random: 43% occur at Arg CGA codons, although they represent <3% of the codons. In TP53, CGA codons comprise <3% of the total 393 codons but they account for 72% and 39% of the mutations in CRC and ovarian cancer OVC, respectively. This mutation pattern is consistent with the kinetically slow, but not stochastic, hydrolytic deamination of 5-methylcytosine residues at specific methylated CpG sites to afford T·G mismatches that lead to C→T transitions and stop codons at CGA. Analysis of nonsense mutations in CRC, OVC and a number of other cancers indicates the need to expand the predictable risk factors for cancer to include, in addition to random polymerase errors, the methylation status of gene body CGA codons in tumor suppressor genes. Copyright © 2017. Published by Elsevier B.V.

Genome-wide network analysis of Wnt signaling in three pediatric cancers

NASA Astrophysics Data System (ADS)

Bao, Ju; Lee, Ho-Jin; Zheng, Jie J.

2013-10-01

Genomic structural alteration is common in pediatric cancers, and analysis of data generated by the Pediatric Cancer Genome Project reveals such tumor-related alterations in many Wnt signaling-associated genes. Most pediatric cancers are thought to arise within developing tissues that undergo substantial expansion during early organ formation, growth and maturation, and Wnt signaling plays an important role in this development. We examined three pediatric tumors--medullobastoma, early T-cell precursor acute lymphoblastic leukemia, and retinoblastoma--that show multiple genomic structural variations within Wnt signaling pathways. We mathematically modeled this pathway to investigate the effects of cancer-related structural variations on Wnt signaling. Surprisingly, we found that an outcome measure of canonical Wnt signaling was consistently similar in matched cancer cells and normal cells, even in the context of different cancers, different mutations, and different Wnt-related genes. Our results suggest that the cancer cells maintain a normal level of Wnt signaling by developing multiple mutations.

Quantification of mutant SPOP proteins in prostate cancer using mass spectrometry-based targeted proteomics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Hui; Barbieri, Christopher E.; He, Jintang

Speckle-type POZ protein (SPOP) is an E3 ubiquitin ligase adaptor protein that functions as a potential tumor suppressor, and SPOP mutations have been identified in ~10% of human prostate cancers. However, it remains unclear if mutant SPOP proteins can be utilized as biomarkers for early detection, diagnosis, prognosis or targeted therapy of prostate cancer. Moreover, the SPOP mutation sites are distributed in a relatively short region where multiple lysine residues, posing significant challenges for bottom-up proteomics analysis of the SPOP mutations. To address this issue, PRISM (high-pressure, high-resolution separations coupled with intelligent selection and multiplexing)-SRM (selected reaction monitoring) mass spectrometrymore » assays have been developed for quantifying wild-type SPOP protein and 11 prostate cancer-derived SPOP mutations. Despite inherent limitations due to amino acid sequence constraints, all the PRISM-SRM assays developed using Arg-C digestion showed a linear dynamic range of at least two orders of magnitude, with limits of quantification range from 0.1 to 1 fmol/μg of total protein in the cell lysate. Applying these SRM assays to analyze HEK293T cells with and without expression of the three most frequent SPOP mutations in prostate cancer (Y87N, F102C or F133V) led to confident detection of all three SPOP mutations in corresponding positive cell lines but not in the negative cell lines. Expression of the F133V mutation and wild-type SPOP was at much lower levels compared to that of F102C and Y87N mutations; however, at present it is unknown if this also affects the activity of the SPOP protein. In summary, PRISM-SRM enables multiplexed, isoform-specific detection of mutant SPOP proteins in cell lysates, which holds great potential in biomarker development for prostate cancer.« less

Noninvasive detection of activating estrogen receptor 1 (ESR1) mutations in estrogen receptor-positive metastatic breast cancer.

PubMed

Guttery, David S; Page, Karen; Hills, Allison; Woodley, Laura; Marchese, Stephanie D; Rghebi, Basma; Hastings, Robert K; Luo, Jinli; Pringle, J Howard; Stebbing, Justin; Coombes, R Charles; Ali, Simak; Shaw, Jacqueline A

2015-07-01

Activating mutations in the estrogen receptor 1 (ESR1) gene are acquired on treatment and can drive resistance to endocrine therapy. Because of the spatial and temporal limitations of needle core biopsies, our goal was to develop a highly sensitive, less invasive method of detecting activating ESR1 mutations via circulating cell-free DNA (cfDNA) and tumor cells as a "liquid biopsy." We developed a targeted 23-amplicon next-generation sequencing (NGS) panel for detection of hot-spot mutations in ESR1, phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha (PIK3CA), tumor protein p53 (TP53), fibroblast growth factor receptor 1 (FGFR1), and fibroblast growth factor receptor 2 (FGFR2) in 48 patients with estrogen receptor-α-positive metastatic breast cancer who were receiving systemic therapy. Selected mutations were validated using droplet digital PCR (ddPCR). Nine baseline cfDNA samples had an ESR1 mutation. NGS detected 3 activating mutations in ESR1, and 3 hot-spot mutations in PIK3CA, and 3 in TP53 in baseline cfDNA, and the ESR1 p.D538G mutation in 1 matched circulating tumor cell sample. ddPCR analysis was more sensitive than NGS and identified 6 additional baseline cfDNA samples with the ESR1 p.D538G mutation at a frequency of <1%. In serial blood samples from 11 patients, 4 showed changes in cfDNA, 2 with emergence of a mutation in ESR1. We also detected a low frequency ESR1 mutation (1.3%) in cfDNA of 1 primary patient who was thought to have metastatic disease but was clear by scans. Early identification of ESR1 mutations by liquid biopsy might allow for cessation of ineffective endocrine therapies and switching to other treatments, without the need for tissue biopsy and before the emergence of metastatic disease. © 2015 American Association for Clinical Chemistry.

Single-Cell Sequencing for Precise Cancer Research: Progress and Prospects.

PubMed

Zhang, Xiaoyan; Marjani, Sadie L; Hu, Zhaoyang; Weissman, Sherman M; Pan, Xinghua; Wu, Shixiu

2016-03-15

Advances in genomic technology have enabled the faithful detection and measurement of mutations and the gene expression profile of cancer cells at the single-cell level. Recently, several single-cell sequencing methods have been developed that permit the comprehensive and precise analysis of the cancer-cell genome, transcriptome, and epigenome. The use of these methods to analyze cancer cells has led to a series of unanticipated discoveries, such as the high heterogeneity and stochastic changes in cancer-cell populations, the new driver mutations and the complicated clonal evolution mechanisms, and the novel identification of biomarkers of variant tumors. These methods and the knowledge gained from their utilization could potentially improve the early detection and monitoring of rare cancer cells, such as circulating tumor cells and disseminated tumor cells, and promote the development of personalized and highly precise cancer therapy. Here, we discuss the current methods for single cancer-cell sequencing, with a strong focus on those practically used or potentially valuable in cancer research, including single-cell isolation, whole genome and transcriptome amplification, epigenome profiling, multi-dimensional sequencing, and next-generation sequencing and analysis. We also examine the current applications, challenges, and prospects of single cancer-cell sequencing. ©2016 American Association for Cancer Research.

CT Radiogenomic Characterization of EGFR, K-RAS, and ALK Mutations in Non-Small Cell Lung Cancer.

PubMed

Rizzo, Stefania; Petrella, Francesco; Buscarino, Valentina; De Maria, Federica; Raimondi, Sara; Barberis, Massimo; Fumagalli, Caterina; Spitaleri, Gianluca; Rampinelli, Cristiano; De Marinis, Filippo; Spaggiari, Lorenzo; Bellomi, Massimo

2016-01-01

To assess the association between CT features and EGFR, ALK, KRAS mutations in non-small cell lung cancer. Patients undergoing chest CT and testing for the above gene mutations were included. Qualitative evaluation of CTs included: lobe; lesion diameter; shape; margins; ground-glass opacity; density; cavitation; air bronchogram; pleural thickening; intratumoral necrosis; nodules in tumour lobe; nodules in non-tumour lobes; pleural retraction; location; calcifications; emphysema; fibrosis; pleural contact; pleural effusion. Statistical analysis was performed to assess association of features with each gene mutation. ROC curves for gene mutations were drawn; the corresponding area under the curve was calculated. P-values <0.05 were considered significant. Of 285 patients, 60/280 (21.43 %) were positive for EGFR mutation; 31/270 (11.48 %) for ALK rearrangement; 64/240 (26.67 %) for KRAS mutation. EGFR mutation was associated with air bronchogram, pleural retraction, females, non-smokers, small lesion size, and absence of fibrosis. ALK rearrangements were associated with age and pleural effusion. KRAS mutation was associated with round shape, nodules in non-tumour lobes, and smoking. This study disclosed associations between CT features and alterations of EGFR (air bronchogram, pleural retraction, small lesion size, absence of fibrosis), ALK (pleural effusion) and KRAS (round lesion shape, nodules in non-tumour lobes). Air bronchogram, pleural retraction, small size relate to EGFR mutation in NSCLC. Pleural effusion and younger age relate to ALK mutation. Round lesion shape, nodules in non-tumour lobes relate to KRAS mutation.

Recurrent hotspot mutations in HRAS Q61 and PI3K-AKT pathway genes as drivers of breast adenomyoepitheliomas.

PubMed

Geyer, Felipe C; Li, Anqi; Papanastasiou, Anastasios D; Smith, Alison; Selenica, Pier; Burke, Kathleen A; Edelweiss, Marcia; Wen, Huei-Chi; Piscuoglio, Salvatore; Schultheis, Anne M; Martelotto, Luciano G; Pareja, Fresia; Kumar, Rahul; Brandes, Alissa; Fan, Dan; Basili, Thais; Da Cruz Paula, Arnaud; Lozada, John R; Blecua, Pedro; Muenst, Simone; Jungbluth, Achim A; Foschini, Maria P; Wen, Hannah Y; Brogi, Edi; Palazzo, Juan; Rubin, Brian P; Ng, Charlotte K Y; Norton, Larry; Varga, Zsuzsanna; Ellis, Ian O; Rakha, Emad A; Chandarlapaty, Sarat; Weigelt, Britta; Reis-Filho, Jorge S

2018-05-08

Adenomyoepithelioma of the breast is a rare tumor characterized by epithelial-myoepithelial differentiation, whose genetic underpinning is largely unknown. Here we show through whole-exome and targeted massively parallel sequencing analysis that whilst estrogen receptor (ER)-positive adenomyoepitheliomas display PIK3CA or AKT1 activating mutations, ER-negative adenomyoepitheliomas harbor highly recurrent codon Q61 HRAS hotspot mutations, which co-occur with PIK3CA or PIK3R1 mutations. In two- and three-dimensional cell culture models, forced expression of HRAS Q61R in non-malignant ER-negative breast epithelial cells with or without a PIK3CA H1047R somatic knock-in results in transformation and the acquisition of the cardinal features of adenomyoepitheliomas, including the expression of myoepithelial markers, a reduction in E-cadherin expression, and an increase in AKT signaling. Our results demonstrate that adenomyoepitheliomas are genetically heterogeneous, and qualify mutations in HRAS, a gene whose mutations are vanishingly rare in common-type breast cancers, as likely drivers of ER-negative adenomyoepitheliomas.

Somatic mutations reveal asymmetric cellular dynamics in the early human embryo

DOE PAGES

Ju, Young Seok; Martincorena, Inigo; Gerstung, Moritz; ...

2017-03-22

Somatic cells acquire mutations throughout the course of an individual’s life. Mutations occurring early in embryogenesis are often present in a substantial proportion of, but not all, cells in postnatal humans and thus have particular characteristics and effects. Depending on their location in the genome and the proportion of cells they are present in, these mosaic mutations can cause a wide range of genetic disease syndromes and predispose carriers to cancer. They have a high chance of being transmitted to offspring as de novo germline mutations and, in principle, can provide insights into early human embryonic cell lineages and theirmore » contributions to adult tissues. Although it is known that gross chromosomal abnormalities are remarkably common in early human embryos, our understanding of early embryonic somatic mutations is very limited. Here we use whole-genome sequences of normal blood from 241 adults to identify 163 early embryonic mutations. We estimate that approximately three base substitution mutations occur per cell per cell-doubling event in early human embryogenesis and these are mainly attributable to two known mutational signatures. We used the mutations to reconstruct developmental lineages of adult cells and demonstrate that the two daughter cells of many early embryonic cell-doubling events contribute asymmetrically to adult blood at an approximately 2:1 ratio. As a result, this study therefore provides insights into the mutation rates, mutational processes and developmental outcomes of cell dynamics that operate during early human embryogenesis.« less

Somatic mutations reveal asymmetric cellular dynamics in the early human embryo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ju, Young Seok; Martincorena, Inigo; Gerstung, Moritz

Somatic cells acquire mutations throughout the course of an individual’s life. Mutations occurring early in embryogenesis are often present in a substantial proportion of, but not all, cells in postnatal humans and thus have particular characteristics and effects. Depending on their location in the genome and the proportion of cells they are present in, these mosaic mutations can cause a wide range of genetic disease syndromes and predispose carriers to cancer. They have a high chance of being transmitted to offspring as de novo germline mutations and, in principle, can provide insights into early human embryonic cell lineages and theirmore » contributions to adult tissues. Although it is known that gross chromosomal abnormalities are remarkably common in early human embryos, our understanding of early embryonic somatic mutations is very limited. Here we use whole-genome sequences of normal blood from 241 adults to identify 163 early embryonic mutations. We estimate that approximately three base substitution mutations occur per cell per cell-doubling event in early human embryogenesis and these are mainly attributable to two known mutational signatures. We used the mutations to reconstruct developmental lineages of adult cells and demonstrate that the two daughter cells of many early embryonic cell-doubling events contribute asymmetrically to adult blood at an approximately 2:1 ratio. As a result, this study therefore provides insights into the mutation rates, mutational processes and developmental outcomes of cell dynamics that operate during early human embryogenesis.« less

Mutations in valosin-containing protein (VCP) decrease ADP/ATP translocation across the mitochondrial membrane and impair energy metabolism in human neurons.

PubMed

Ludtmann, Marthe H R; Arber, Charles; Bartolome, Fernando; de Vicente, Macarena; Preza, Elisavet; Carro, Eva; Houlden, Henry; Gandhi, Sonia; Wray, Selina; Abramov, Andrey Y

2017-05-26

Mutations in the gene encoding valosin-containing protein (VCP) lead to multisystem proteinopathies including frontotemporal dementia. We have previously shown that patient-derived VCP mutant fibroblasts exhibit lower mitochondrial membrane potential, uncoupled respiration, and reduced ATP levels. This study addresses the underlying basis for mitochondrial uncoupling using VCP knockdown neuroblastoma cell lines, induced pluripotent stem cells (iPSCs), and iPSC-derived cortical neurons from patients with pathogenic mutations in VCP Using fluorescent live cell imaging and respiration analysis we demonstrate a VCP mutation/knockdown-induced dysregulation in the adenine nucleotide translocase, which results in a slower rate of ADP or ATP translocation across the mitochondrial membranes. This deregulation can explain the mitochondrial uncoupling and lower ATP levels in VCP mutation-bearing neurons via reduced ADP availability for ATP synthesis. This study provides evidence for a role of adenine nucleotide translocase in the mechanism underlying altered mitochondrial function in VCP-related degeneration, and this new insight may inform efforts to better understand and manage neurodegenerative disease and other proteinopathies. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Exome Sequencing Identifies Potentially Druggable Mutations in Nasopharyngeal Carcinoma.

PubMed

Chow, Yock Ping; Tan, Lu Ping; Chai, San Jiun; Abdul Aziz, Norazlin; Choo, Siew Woh; Lim, Paul Vey Hong; Pathmanathan, Rajadurai; Mohd Kornain, Noor Kaslina; Lum, Chee Lun; Pua, Kin Choo; Yap, Yoke Yeow; Tan, Tee Yong; Teo, Soo Hwang; Khoo, Alan Soo-Beng; Patel, Vyomesh

2017-03-03

In this study, we first performed whole exome sequencing of DNA from 10 untreated and clinically annotated fresh frozen nasopharyngeal carcinoma (NPC) biopsies and matched bloods to identify somatically mutated genes that may be amenable to targeted therapeutic strategies. We identified a total of 323 mutations which were either non-synonymous (n = 238) or synonymous (n = 85). Furthermore, our analysis revealed genes in key cancer pathways (DNA repair, cell cycle regulation, apoptosis, immune response, lipid signaling) were mutated, of which those in the lipid-signaling pathway were the most enriched. We next extended our analysis on a prioritized sub-set of 37 mutated genes plus top 5 mutated cancer genes listed in COSMIC using a custom designed HaloPlex target enrichment panel with an additional 88 NPC samples. Our analysis identified 160 additional non-synonymous mutations in 37/42 genes in 66/88 samples. Of these, 99/160 mutations within potentially druggable pathways were further selected for validation. Sanger sequencing revealed that 77/99 variants were true positives, giving an accuracy of 78%. Taken together, our study indicated that ~72% (n = 71/98) of NPC samples harbored mutations in one of the four cancer pathways (EGFR-PI3K-Akt-mTOR, NOTCH, NF-κB, DNA repair) which may be potentially useful as predictive biomarkers of response to matched targeted therapies.

Exome Sequencing Identifies Potentially Druggable Mutations in Nasopharyngeal Carcinoma

PubMed Central

Chow, Yock Ping; Tan, Lu Ping; Chai, San Jiun; Abdul Aziz, Norazlin; Choo, Siew Woh; Lim, Paul Vey Hong; Pathmanathan, Rajadurai; Mohd Kornain, Noor Kaslina; Lum, Chee Lun; Pua, Kin Choo; Yap, Yoke Yeow; Tan, Tee Yong; Teo, Soo Hwang; Khoo, Alan Soo-Beng; Patel, Vyomesh

2017-01-01

In this study, we first performed whole exome sequencing of DNA from 10 untreated and clinically annotated fresh frozen nasopharyngeal carcinoma (NPC) biopsies and matched bloods to identify somatically mutated genes that may be amenable to targeted therapeutic strategies. We identified a total of 323 mutations which were either non-synonymous (n = 238) or synonymous (n = 85). Furthermore, our analysis revealed genes in key cancer pathways (DNA repair, cell cycle regulation, apoptosis, immune response, lipid signaling) were mutated, of which those in the lipid-signaling pathway were the most enriched. We next extended our analysis on a prioritized sub-set of 37 mutated genes plus top 5 mutated cancer genes listed in COSMIC using a custom designed HaloPlex target enrichment panel with an additional 88 NPC samples. Our analysis identified 160 additional non-synonymous mutations in 37/42 genes in 66/88 samples. Of these, 99/160 mutations within potentially druggable pathways were further selected for validation. Sanger sequencing revealed that 77/99 variants were true positives, giving an accuracy of 78%. Taken together, our study indicated that ~72% (n = 71/98) of NPC samples harbored mutations in one of the four cancer pathways (EGFR-PI3K-Akt-mTOR, NOTCH, NF-κB, DNA repair) which may be potentially useful as predictive biomarkers of response to matched targeted therapies. PMID:28256603

Mutational analysis of single circulating tumor cells by next generation sequencing in metastatic breast cancer.

PubMed

De Luca, Francesca; Rotunno, Giada; Salvianti, Francesca; Galardi, Francesca; Pestrin, Marta; Gabellini, Stefano; Simi, Lisa; Mancini, Irene; Vannucchi, Alessandro Maria; Pazzagli, Mario; Di Leo, Angelo; Pinzani, Pamela

2016-05-03

Circulating Tumor Cells (CTCs) represent a "liquid biopsy" of the tumor potentially allowing real-time monitoring of cancer biology and therapies in individual patients.The purpose of the study was to explore the applicability of a protocol for the molecular characterization of single CTCs by Next Generation Sequencing (NGS) in order to investigate cell heterogeneity and provide a tool for a personalized medicine approach.CTCs were enriched and enumerated by CellSearch in blood from four metastatic breast cancer patients and singularly isolated by DEPArray. Upon whole genome amplification 3-5 single CTCs per patient were analyzed by NGS for 50 cancer-related genes.We found 51 sequence variants in 25 genes. We observed inter- and intra-patient heterogeneity in the mutational status of CTCs.The highest number of somatic deleterious mutations was found in the gene TP53, whose mutation is associated with adverse prognosis in breast cancer.The discordance between the mutational status of the primary tumor and CTCs observed in 3 patients suggests that, in advanced stages of cancer, CTC characteristics are more closely linked to the dynamic modifications of the disease status.In one patient the mutational profiles of CTCs before and during treatment shared only few sequence variants.This study supports the applicability of a non-invasive approach based on the liquid biopsy in metastatic breast cancer patients which, in perspective, should allow investigating the clonal evolution of the tumor for the development of new therapeutic strategies in precision medicine.

Genetics and Pathogenesis of Diffuse Large B-Cell Lymphoma.

PubMed

Schmitz, Roland; Wright, George W; Huang, Da Wei; Johnson, Calvin A; Phelan, James D; Wang, James Q; Roulland, Sandrine; Kasbekar, Monica; Young, Ryan M; Shaffer, Arthur L; Hodson, Daniel J; Xiao, Wenming; Yu, Xin; Yang, Yandan; Zhao, Hong; Xu, Weihong; Liu, Xuelu; Zhou, Bin; Du, Wei; Chan, Wing C; Jaffe, Elaine S; Gascoyne, Randy D; Connors, Joseph M; Campo, Elias; Lopez-Guillermo, Armando; Rosenwald, Andreas; Ott, German; Delabie, Jan; Rimsza, Lisa M; Tay Kuang Wei, Kevin; Zelenetz, Andrew D; Leonard, John P; Bartlett, Nancy L; Tran, Bao; Shetty, Jyoti; Zhao, Yongmei; Soppet, Dan R; Pittaluga, Stefania; Wilson, Wyndham H; Staudt, Louis M

2018-04-12

Diffuse large B-cell lymphomas (DLBCLs) are phenotypically and genetically heterogeneous. Gene-expression profiling has identified subgroups of DLBCL (activated B-cell-like [ABC], germinal-center B-cell-like [GCB], and unclassified) according to cell of origin that are associated with a differential response to chemotherapy and targeted agents. We sought to extend these findings by identifying genetic subtypes of DLBCL based on shared genomic abnormalities and to uncover therapeutic vulnerabilities based on tumor genetics. We studied 574 DLBCL biopsy samples using exome and transcriptome sequencing, array-based DNA copy-number analysis, and targeted amplicon resequencing of 372 genes to identify genes with recurrent aberrations. We developed and implemented an algorithm to discover genetic subtypes based on the co-occurrence of genetic alterations. We identified four prominent genetic subtypes in DLBCL, termed MCD (based on the co-occurrence of MYD88 L265P and CD79B mutations), BN2 (based on BCL6 fusions and NOTCH2 mutations), N1 (based on NOTCH1 mutations), and EZB (based on EZH2 mutations and BCL2 translocations). Genetic aberrations in multiple genes distinguished each genetic subtype from other DLBCLs. These subtypes differed phenotypically, as judged by differences in gene-expression signatures and responses to immunochemotherapy, with favorable survival in the BN2 and EZB subtypes and inferior outcomes in the MCD and N1 subtypes. Analysis of genetic pathways suggested that MCD and BN2 DLBCLs rely on "chronic active" B-cell receptor signaling that is amenable to therapeutic inhibition. We uncovered genetic subtypes of DLBCL with distinct genotypic, epigenetic, and clinical characteristics, providing a potential nosology for precision-medicine strategies in DLBCL. (Funded by the Intramural Research Program of the National Institutes of Health and others.).

HCK is a survival determinant transactivated by mutated MYD88, and a direct target of ibrutinib.

PubMed

Yang, Guang; Buhrlage, Sara J; Tan, Li; Liu, Xia; Chen, Jie; Xu, Lian; Tsakmaklis, Nicholas; Chen, Jiaji G; Patterson, Christopher J; Brown, Jennifer R; Castillo, Jorge J; Zhang, Wei; Zhang, Xiaofeng; Liu, Shuai; Cohen, Philip; Hunter, Zachary R; Gray, Nathanael; Treon, Steven P

2016-06-23

Activating mutations in MYD88 are present in ∼95% of patients with Waldenström macroglobulinemia (WM), as well as other B-cell malignancies including activated B-cell (ABC) diffuse large B-cell lymphoma (DLBCL). In WM, mutated MYD88 triggers activation of Bruton tyrosine kinase (BTK). Ibrutinib, a pleiotropic kinase inhibitor that targets BTK, is highly active in patients with mutated MYD88. We observed that mutated MYD88 WM and ABC DLBCL cell lines, as well as primary WM cells show enhanced hematopoietic cell kinase (HCK) transcription and activation, and that HCK is activated by interleukin 6 (IL-6). Over-expression of mutated MYD88 triggers HCK and IL-6 transcription, whereas knockdown of HCK reduced survival and attenuated BTK, phosphoinositide 3-kinase/AKT, and mitogen-activated protein kinase/extracellular signal-regulated kinase signaling in mutated MYD88 WM and/or ABC DLBCL cells. Ibrutinib and the more potent HCK inhibitor A419259, blocked HCK activation and induced apoptosis in mutated MYD88 WM and ABC DLBCL cells. Docking and pull-down studies confirmed that HCK was a target of ibrutinib. Ibrutinib and A419259 also blocked adenosine triphosphate binding to HCK, whereas transduction of mutated MYD88 expressing WM cells with a mutated HCK gatekeeper greatly increased the half maximal effective concentration for ibrutinib and A419259. The findings support that HCK expression and activation is triggered by mutated MYD88, supports the growth and survival of mutated MYD88 WM and ABC DLBCL cells, and is a direct target of ibrutinib. HCK represents a novel target for therapeutic development in MYD88-mutated WM and ABC DLBCL, and possibly other diseases driven by mutated MYD88. © 2016 by The American Society of Hematology.

Comprehensive molecular profiling of 718 Multiple Myelomas reveals significant differences in mutation frequencies between African and European descent cases

PubMed Central

Christofferson, Austin; Aldrich, Jessica; Jewell, Scott; Kittles, Rick A.; Derome, Mary; Craig, David Wesley; Carpten, John D.

2017-01-01

Multiple Myeloma (MM) is a plasma cell malignancy with significantly greater incidence and mortality rates among African Americans (AA) compared to Caucasians (CA). The overall goal of this study is to elucidate differences in molecular alterations in MM as a function of self-reported race and genetic ancestry. Our study utilized somatic whole exome, RNA-sequencing, and correlated clinical data from 718 MM patients from the Multiple Myeloma Research Foundation CoMMpass study Interim Analysis 9. Somatic mutational analyses based upon self-reported race corrected for ancestry revealed significant differences in mutation frequency between groups. Of interest, BCL7A, BRWD3, and AUTS2 demonstrate significantly higher mutation frequencies among AA cases. These genes are all involved in translocations in B-cell malignancies. Moreover, we detected a significant difference in mutation frequency of TP53 and IRF4 with frequencies higher among CA cases. Our study provides rationale for interrogating diverse tumor cohorts to best understand tumor genomics across populations. PMID:29166413

A shower of second hit events as the cause of multifocal renal cell carcinoma in tuberous sclerosis complex

PubMed Central

Tyburczy, Magdalena E.; Jozwiak, Sergiusz; Malinowska, Izabela A.; Chekaluk, Yvonne; Pugh, Trevor J.; Wu, Chin-Lee; Nussbaum, Robert L.; Seepo, Sara; Dzik, Tomasz; Kotulska, Katarzyna; Kwiatkowski, David J.

2015-01-01

Tuberous sclerosis complex (TSC) is a genetic disorder characterized by seizures and tumor formation in multiple organs, mainly in the brain, skin, kidney, lung and heart. Renal cell carcinoma (RCC) occurs in ∼3% of TSC patients, and typically develops at age <50. Here we describe genetic findings in two TSC patients with multiple renal tumors, each of whom had the germline mutation TSC2 p.R905Q. The first (female) TSC patient had a left followed by a right nephrectomy at ages 24 and 27. Both kidneys showed multifocal TSC-associated papillary RCC (PRCC). Targeted, next-generation sequencing (NGS) analysis of TSC2 in five tumors (four from the left kidney, one from the right) showed loss of heterozygosity in one tumor, and four different TSC2 point mutations (p.E1351*, p.R1032*, p.R1713H, c.4178_4179delCT) in the other four samples. Only one of the 11 other tumors available from this patient had one of the TSC2 second hit mutations identified. Whole-exome analysis of the five tumors identified a very small number of additional mutated genes, with an average of 3.4 nonsilent coding, somatic mutations per tumor, none of which were seen in >1 tumor. The second (male) TSC patient had bilateral partial nephrectomies (both at age 36), with similar findings of multifocal PRCC. NGS analysis of TSC2 in two of these tumors identified a second hit mutation c.2355+1G>T in one sample that was not seen in other tumors. In conclusion, we report the first detailed genetic analysis of RCCs in TSC patients. Molecular studies indicate that tumors developed independently due to various second hit events, suggesting that these patients experienced a ‘shower’ of second hit mutations in TSC2 during kidney development leading to this severe phenotype. PMID:25432535

Alterations of p53 in tumorigenic human bronchial epithelial cells correlate with metastatic potential

NASA Technical Reports Server (NTRS)

Piao, C. Q.; Willey, J. C.; Hei, T. K.; Hall, E. J. (Principal Investigator)

1999-01-01

The cellular and molecular mechanisms of radiation-induced lung cancer are not known. In the present study, alterations of p53 in tumorigenic human papillomavirus-immortalized human bronchial epithelial (BEP2D) cells induced by a single low dose of either alpha-particles or 1 GeV/nucleon (56)Fe were analyzed by PCR-single-stranded conformation polymorphism (SSCP) coupled with sequencing analysis and immunoprecipitation assay. A total of nine primary and four secondary tumor cell lines, three of which were metastatic, together with the parental BEP2D and primary human bronchial epithelial (NHBE) cells were studied. The immunoprecipitation assay showed overexpression of mutant p53 proteins in all the tumor lines but not in NHBE and BEP2D cells. PCR-SSCP and sequencing analysis found band shifts and gene mutations in all four of the secondary tumors. A G-->T transversion in codon 139 in exon 5 that replaced Lys with Asn was detected in two tumor lines. One mutation each, involving a G-->T transversion in codon 215 in exon 6 (Ser-->lle) and a G-->A transition in codon 373 in exon 8 (Arg-->His), was identified in the remaining two secondary tumors. These results suggest that p53 alterations correlate with tumorigenesis in the BEP2D cell model and that mutations in the p53 gene may be indicative of metastatic potential.

Mutational analysis of amino acid residues involved in catalytic activity of a family 18 chitinase from tulip bulbs.

PubMed

Suzukawa, Keisuke; Yamagami, Takeshi; Ohnuma, Takayuki; Hirakawa, Hideki; Kuhara, Satoru; Aso, Yoichi; Ishiguro, Masatsune

2003-02-01

We expressed chitinase-1 (TBC-1) from tulip bulbs (Tulipa bakeri) in E. coli cells and used site-directed mutagenesis to identify amino acid residues essential for catalytic activity. Mutations at Glu-125 and Trp-251 completely abolished enzyme activity, and activity decreased with mutations at Asp-123 and Trp-172 when glycolchitin was the substrate. Activity changed with the mutations of Trp-251 to one of several amino acids with side-chains of little hydrophobicity, suggesting that hydrophobic interaction of Trp-251 is important for the activity. Molecular dynamics (MD) simulation analysis with hevamine as the model compound showed that the distance between Asp-123 and Glu-125 was extended by mutation of Trp-251. Kinetic studies of Trp-251-mutated chitinases confirmed these various phenomena. The results suggested that Glu-125 and Trp-251 are essential for enzyme activity and that Trp-251 had a direct role in ligand binding.

Amino acid changes within the E protein hinge region that affect dengue virus type 2 infectivity and fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Butrapet, Siritorn; Childers, Thomas; Moss, Kelley J.

Fifteen mutant dengue viruses were engineered and used to identify AAs in the molecular hinge of the envelope protein that are critical to viral infection. Substitutions at Q52, A54, or E133 reduced infectivity in mammalian cells and altered the pH threshold of fusion. Mutations at F193, G266, I270, or G281 affected viral replication in mammalian and mosquito cells, but only I270W had reduced fusion activity. T280Y affected the pH threshold for fusion and reduced replication in C6/36 cells. Three different mutations at L135 were lethal in mammalian cells. Among them, L135G abrogated fusion and reduced replication in C6/36 cells, butmore » only slightly reduced the mosquito infection rate. Conversely, L135W replicated well in C6/36 cells, but had the lowest mosquito infection rate. Possible interactions between hinge residues 52 and 277, or among 53, 135, 170, 186, 265, and 276 required for hinge function were discovered by sequence analysis to identify compensatory mutations.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saito, Kayoko; Ikeya, Kiyoko; Kondo, Eri

Mosaicism is a mixed state, with two cell populations of different genetic origins caused by a cell mutation occurring after fertilization. In the present case, DNA analysis of lymphocytes led to a DMD diagnosis before death. Postmortem immunocytochemical and DNA analysis showed somatic mosaicism. At age 18 years, blood lymphocyte DNA analysis showed a DMD gene deletion, upstream from exon 7 to the 5{prime} end containing both muscle and brain promoters. As the patient`s mother and elder sister had no deletions, he was considered to have a new mutation. Immunocytochemical studies of postmortem tissues showed that dystrophin was absent frommore » the tongue, deltoid, intercostal, psoas and rectus femoris muscles, but there was a mix of dystrophin-positive and negative fibers in the rectus abdominis, cardiac, temporalis and sternocleidomastoid muscles. All diaphragm cells were dystrophin positive. Polymerase chain reaction (PCR) amplification from all tissues except the temporalis and sternocleidomastoid muscles, diaphragm and kidney, in which no deletion was found, showed the deletion from at least exon 6 to the 5{prime} end containing both muscle and brain promoters. In this case, a genomic deletion of the DMD gene contributed to the formation of tissues derived from both ectoderm and endoderm, and cells of mesodermal origin showed genotypic and phenotypic heterogeneity. Our results indicate a mutation of the present case may have occurred just before the period of germ layer formation. 34 refs., 7 figs.« less

Elevated heart rate triggers action potential alternans and sudden death. translational study of a homozygous KCNH2 mutation.

PubMed

Schweigmann, Ulrich; Biliczki, Peter; Ramirez, Rafael J; Marschall, Christoph; Takac, Ina; Brandes, Ralf P; Kotzot, Dieter; Girmatsion, Zenawit; Hohnloser, Stefan H; Ehrlich, Joachim R

2014-01-01

Long QT syndrome (LQTS) leads to arrhythmic events and increased risk for sudden cardiac death (SCD). Homozygous KCNH2 mutations underlying LQTS-2 have previously been termed "human HERG knockout" and typically express severe phenotypes. We studied genotype-phenotype correlations of an LQTS type 2 mutation identified in the homozygous index patient from a consanguineous Turkish family after his brother died suddenly during febrile illness. Clinical work-up, DNA sequencing, mutagenesis, cell culture, patch-clamp, in silico mathematical modelling, protein biochemistry, confocal microscopy were performed. Genetic analysis revealed a homozygous C-terminal KCNH2 mutation (p.R835Q) in the index patient (QTc ∼506 ms with notched T waves). Parents were I° cousins - both heterozygous for the mutation and clinically unremarkable (QTc ∼447 ms, father and ∼396 ms, mother). Heterologous expression of KCNH2-R835Q showed mildly reduced current amplitudes. Biophysical properties of ionic currents were also only nominally changed with slight acceleration of deactivation and more negative V50 in R835Q-currents. Protein biochemistry and confocal microscopy revealed similar expression patterns and trafficking of WT and R835Q, even at elevated temperature. In silico analysis demonstrated mildly prolonged ventricular action potential duration (APD) compared to WT at a cycle length of 1000 ms. At a cycle length of 350 ms M-cell APD remained stable in WT, but displayed APD alternans in R835Q. Kv11.1 channels affected by the C-terminal R835Q mutation display mildly modified biophysical properties, but leads to M-cell APD alternans with elevated heart rate and could precipitate SCD under specific clinical circumstances associated with high heart rates.

Diploid yeast cells yield homozygous spontaneous mutations

NASA Technical Reports Server (NTRS)

Esposito, M. S.; Bruschi, C. V.; Brushi, C. V. (Principal Investigator)

1993-01-01

A leucine-requiring hybrid of Saccharomyces cerevisiae, homoallelic at the LEU1 locus (leu1-12/leu1-12) and heterozygous for three chromosome-VII genetic markers distal to the LEU1 locus, was employed to inquire: (1) whether spontaneous gene mutation and mitotic segregation of heterozygous markers occur in positive nonrandom association and (2) whether homozygous LEU1/LEU1 mutant diploids are generated. The results demonstrate that gene mutation of leu1-12 to LEU1 and mitotic segregation of heterozygous chromosome-VII markers occur in strong positive nonrandom association, suggesting that the stimulatory DNA lesion is both mutagenic and recombinogenic. In addition, genetic analysis of diploid Leu+ revertants revealed that approximately 3% of mutations of leu1-12 to LEU1 result in LEU1/LEU1 homozygotes. Red-white sectored Leu+ colonies exhibit genotypes that implicate post-replicational chromatid breakage and exchange near the site of leu1-12 reversion, chromosome loss, and subsequent restitution of diploidy, in the sequence of events leading to mutational homozygosis. By analogy, diploid cell populations can yield variants homozygous for novel recessive gene mutations at biologically significant rates. Mutational homozygosis may be relevant to both carcinogenesis and the evolution of asexual diploid organisms.

New mutations and an updated database for the patched-1 (PTCH1) gene.

PubMed

Reinders, Marie G; van Hout, Antonius F; Cosgun, Betûl; Paulussen, Aimée D; Leter, Edward M; Steijlen, Peter M; Mosterd, Klara; van Geel, Michel; Gille, Johan J

2018-05-01

Basal cell nevus syndrome (BCNS) is an autosomal dominant disorder characterized by multiple basal cell carcinomas (BCCs), maxillary keratocysts, and cerebral calcifications. BCNS most commonly is caused by a germline mutation in the patched-1 (PTCH1) gene. PTCH1 mutations are also described in patients with holoprosencephaly. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). We included 117 new PTCH1 variations, in addition to 331 previously published unique PTCH1 mutations. These new mutations were found in 141 patients who had a positive PTCH1 mutation analysis in either the VU University Medical Centre (VUMC) or Maastricht University Medical Centre (MUMC) between 1995 and 2015. The database contains 331 previously published unique PTCH1 mutations and 117 new PTCH1 variations. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). The database provides an open collection for both clinicians and researchers and is accessible online at http://www.lovd.nl/PTCH1. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Cost-effectiveness analysis of EGFR mutation testing in patients with non-small cell lung cancer (NSCLC) with gefitinib or carboplatin-paclitaxel.

PubMed

Arrieta, Oscar; Anaya, Pablo; Morales-Oyarvide, Vicente; Ramírez-Tirado, Laura Alejandra; Polanco, Ana C

2016-09-01

Assess the cost-effectiveness of an EGFR-mutation testing strategy for advanced NSCLC in first-line therapy with either gefitinib or carboplatin-paclitaxel in Mexican institutions. Cost-effectiveness analysis using a discrete event simulation (DES) model to simulate two therapeutic strategies in patients with advanced NSCLC. Strategy one included patients tested for EGFR-mutation and therapy given accordingly. Strategy two included chemotherapy for all patients without testing. All results are presented in 2014 US dollars. The analysis was made with data from the Mexican frequency of EGFR-mutation. A univariate sensitivity analysis was conducted on EGFR prevalence. Progression-free survival (PFS) transition probabilities were estimated on data from the IPASS and simulated with a Weibull distribution, run with parallel trials to calculate a probabilistic sensitivity analysis. PFS of patients in the testing strategy was 6.76 months (95 % CI 6.10-7.44) vs 5.85 months (95 % CI 5.43-6.29) in the non-testing group. The one-way sensitivity analysis showed that PFS has a direct relationship with EGFR-mutation prevalence, while the ICER and testing cost have an inverse relationship with EGFR-mutation prevalence. The probabilistic sensitivity analysis showed that all iterations had incremental costs and incremental PFS for strategy 1 in comparison with strategy 2. There is a direct relationship between the ICER and the cost of EGFR testing, with an inverse relationship with the prevalence of EGFR-mutation. When prevalence is >10 % ICER remains constant. This study could impact Mexican and Latin American health policies regarding mutation detection testing and treatment for advanced NSCLC.

Tumor Mutational Load and Immune Parameters across Metastatic Renal Cell Carcinoma Risk Groups.

PubMed

de Velasco, Guillermo; Miao, Diana; Voss, Martin H; Hakimi, A Ari; Hsieh, James J; Tannir, Nizar M; Tamboli, Pheroze; Appleman, Leonard J; Rathmell, W Kimryn; Van Allen, Eliezer M; Choueiri, Toni K

2016-10-01

Patients with metastatic renal cell carcinoma (mRCC) have better overall survival when treated with nivolumab, a cancer immunotherapy that targets the immune checkpoint inhibitor programmed cell death 1 (PD-1), rather than everolimus (a chemical inhibitor of mTOR and immunosuppressant). Poor-risk mRCC patients treated with nivolumab seemed to experience the greatest overall survival benefit, compared with patients with favorable or intermediate risk, in an analysis of the CheckMate-025 trial subgroup of the Memorial Sloan Kettering Cancer Center (MSKCC) prognostic risk groups. Here, we explore whether tumor mutational load and RNA expression of specific immune parameters could be segregated by prognostic MSKCC risk strata and explain the survival seen in the poor-risk group. We queried whole-exome transcriptome data in renal cell carcinoma patients (n = 54) included in The Cancer Genome Atlas who ultimately developed metastatic disease or were diagnosed with metastatic disease at presentation and did not receive immune checkpoint inhibitors. Nonsynonymous mutational load did not differ significantly by the MSKCC risk group, nor was the expression of cytolytic genes-granzyme A and perforin-or selected immune checkpoint molecules different across MSKCC risk groups. In conclusion, this analysis revealed that mutational load and expression of markers of an active tumor microenvironment did not correlate with MSKCC risk prognostic classification in mRCC. Cancer Immunol Res; 4(10); 820-2. ©2016 AACR. ©2016 American Association for Cancer Research.

Molecular alterations in endometrial and ovarian clear cell carcinomas: clinical impacts of telomerase reverse transcriptase promoter mutation.

PubMed

Huang, Hsien-Neng; Chiang, Ying-Cheng; Cheng, Wen-Fang; Chen, Chi-An; Lin, Ming-Chieh; Kuo, Kuan-Ting

2015-02-01

Recently, mutations of telomerase reverse transcriptase (TERT) promoter were found in several types of cancer. A few reports demonstrate TERT promoter mutations in ovarian clear cell carcinomas but endometrial clear cell carcinoma has not been studied. The aims of this study were to compare differences of molecular alterations and clinical factors, and identify their prognostic impact in endometrial and ovarian clear cell carcinomas. We evaluated mutations of the TERT promoter and PIK3CA, expression of ARID1A, and other clinicopathological factors in 56 ovarian and 14 endometrial clear cell carcinomas. We found that TERT promoter mutations were present in 21% (3/14) of endometrial clear cell carcinomas and 16% (9/56) of ovarian clear cell carcinomas. Compared with ovarian clear cell carcinomas, endometrial clear cell carcinomas showed older mean patient age (P<0.001), preserved ARID1A immunoreactivity (P=0.017) and infrequent PIK3CA mutation (P=0.025). In ovarian clear cell carcinomas, TERT promoter mutations were correlated with patient age >45 (P=0.045) and preserved ARID1A expression (P=0.003). In cases of endometrial clear cell carcinoma, TERT promoter mutations were not statistically associated with any other clinicopathological factors. In ovarian clear cell carcinoma patients with early FIGO stage (stages I and II), TERT promoter mutation was an independent prognostic factor and correlated with a shorter disease-free survival and overall survival (P=0.015 and 0.009, respectively). In recurrent ovarian clear cell carcinoma patients with early FIGO stage, TERT promoter mutations were associated with early relapse within 6 months (P=0.018). We concluded that TERT promoter mutations were present in endometrial and ovarian clear cell carcinomas. Distinct molecular alteration patterns in endometrial and ovarian clear cell carcinomas implied different processes of tumorigenesis in these morphologically similar tumors. In ovarian clear cell carcinoma of early FIGO stage, patients with TERT promoter mutation require close follow-up during the initial 6 months following chemotherapy.

Synergistic Effects of Targeted PI3K Signaling Inhibition and Chemotherapy in Liposarcoma

PubMed Central

Guo, Shang; Lopez-Marquez, Hector; Fan, Kenneth C.; Choy, Edwin; Cote, Gregory; Harmon, David; Nielsen, G. Petur; Yang, Cao; Zhang, Changqing; Mankin, Henry; Hornicek, Francis J.; Borger, Darrell R.; Duan, Zhenfeng

2014-01-01

While liposarcoma is the second most common soft tissue malignant tumor, the molecular pathogenesis in this malignancy is poorly understood. Our goal was therefore to expand the understanding of molecular mechanisms that drive liposarcoma and identify therapeutically-susceptible genetic alterations. We studied a cohort of high-grade liposarcomas and benign lipomas across multiple disease sites, as well as two liposarcoma cell lines, using multiplexed mutational analysis. Nucleic acids extracted from diagnostic patient tissue were simultaneously interrogated for 150 common mutations across 15 essential cancer genes using a clinically-validated platform for cancer genotyping. Western blot analysis was implemented to detect activation of downstream pathways. Liposarcoma cell lines were used to determine the effects of PI3K targeted drug treatment with or without chemotherapy. We identified mutations in the PIK3CA gene in 4 of 18 human liposarcoma patients (22%). No PIK3CA mutations were identified in benign lipomas. Western blot analysis confirmed downstream activation of AKT in both PIK3CA mutant and non-mutant liposarcoma samples. PI-103, a dual PI3K/mTOR inhibitor, effectively inhibited the activation of the PI3K/AKT in liposarcoma cell lines and induced apoptosis. Importantly, combination with PI-103 treatment strongly synergized the growth-inhibitory effects of the chemotherapy drugs doxorubicin and cisplatin in liposarcoma cells. Taken together, these findings suggest that activation of the PI3K/AKT pathway is an important cancer mechanism in liposarcoma. Targeting the PI3K/AKT/pathway with small molecule inhibitors in combination with chemotherapy could be exploited as a novel strategy in the treatment of liposarcoma. PMID:24695632

Two-stage model of radon-induced malignant lung tumors in rats: effects of cell killing

NASA Technical Reports Server (NTRS)

Luebeck, E. G.; Curtis, S. B.; Cross, F. T.; Moolgavkar, S. H.

1996-01-01

A two-stage stochastic model of carcinogenesis is used to analyze lung tumor incidence in 3750 rats exposed to varying regimens of radon carried on a constant-concentration uranium ore dust aerosol. New to this analysis is the parameterization of the model such that cell killing by the alpha particles could be included. The model contains parameters characterizing the rate of the first mutation, the net proliferation rate of initiated cells, the ratio of the rates of cell loss (cell killing plus differentiation) and cell division, and the lag time between the appearance of the first malignant cell and the tumor. Data analysis was by standard maximum likelihood estimation techniques. Results indicate that the rate of the first mutation is dependent on radon and consistent with in vitro rates measured experimentally, and that the rate of the second mutation is not dependent on radon. An initial sharp rise in the net proliferation rate of initiated cell was found with increasing exposure rate (denoted model I), which leads to an unrealistically high cell-killing coefficient. A second model (model II) was studied, in which the initial rise was attributed to promotion via a step function, implying that it is due not to radon but to the uranium ore dust. This model resulted in values for the cell-killing coefficient consistent with those found for in vitro cells. An "inverse dose-rate" effect is seen, i.e. an increase in the lifetime probability of tumor with a decrease in exposure rate. This is attributed in large part to promotion of intermediate lesions. Since model II is preferable on biological grounds (it yields a plausible cell-killing coefficient), such as uranium ore dust. This analysis presents evidence that a two-stage model describes the data adequately and generates hypotheses regarding the mechanism of radon-induced carcinogenesis.

The frequency of EGFR and KRAS mutations in non-small cell lung cancer (NSCLC): routine screening data for central Europe from a cohort study

PubMed Central

Boch, Christian; Kollmeier, Jens; Roth, Andreas; Stephan-Falkenau, Susann; Misch, Daniel; Grüning, Wolfram; Bauer, Torsten Thomas; Mairinger, Thomas

2013-01-01

Objectives Owing to novel therapy strategies in epidermal growth factor receptor (EGFR)-mutated patients, molecular analysis of the EGFR and KRAS genome has become crucial for routine diagnostics. Till date these data have been derived mostly from clinical trials, and thus collected in pre-selected populations. We therefore screened ‘allcomers’ with a newly diagnosed non-small cell lung carcinoma (NSCLC) for the frequencies of these mutations. Design A cohort study. Setting Lung cancer centre in a tertiary care hospital. Participants Within 15 months, a total of 552 cases with NSCLC were eligible for analysis. Primary and secondary outcome measures Frequency of scrutinising exons 18, 19 and 21 for the presence of activating EGFR mutation and secondary codon 12 and 13 for activating KRAS mutations. Results Of the 552 patients, 27 (4.9%) showed a mutation of EGFR. 19 of these patients (70%) had deletion E746-A750 in codon 19 or deletion L858R in codon 21. Adenocarcinoma (ACA) was the most frequent histology among patients with EGFR mutations (ACA, 22/254 (8.7%) vs non-ACA, 5/298 (1.7%); p<0.001). Regarding only ACA, the percentage of EGFR mutations was higher in women (16/116 (14%) women vs 6/138 (4.3%) men; p=0.008). Tumours with an activating EGFR mutation were more likely to be from non-smokers (18/27; 67%) rather than smoker (9/27; 33%). KRAS mutation was present in 85 (15%) of all cases. In 73 patients (86%), the mutation was found in exon 12 and in 12 cases (14%) in exon 13. Similarly, ACA had a higher frequency of KRAS mutations than non-ACA (67/254 (26%) vs 18/298 (6.0%); p<0.001). Conclusions We found a lower frequency for EGFR and KRAS mutations in an unselected Caucasian patient cohort as previously published. Taking our results into account, clinical trials may overestimate the mutation frequency for EGFR and KRAS in NSCLC due to important selection biases. PMID:23558737

Ancient genes establish stress-induced mutation as a hallmark of cancer.

PubMed

Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

2017-01-01

Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to stress that evolved among prokaryotes was co-opted to maintain diversity in the germline and immune system, while the original phenotype is restored in cancer. Reversion to a stress-induced mutational response is a hallmark of cancer that allows for effectively searching "protected" genome space where genes causally implicated in cancer are located and underlies the high adaptive potential and concomitant therapeutic resistance that is characteristic of cancer.

Ancient genes establish stress-induced mutation as a hallmark of cancer

PubMed Central

Orr, Adam J.; Miočević, Milica; Lineweaver, Charles H.; Davies, Paul

2017-01-01

Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to stress that evolved among prokaryotes was co-opted to maintain diversity in the germline and immune system, while the original phenotype is restored in cancer. Reversion to a stress-induced mutational response is a hallmark of cancer that allows for effectively searching “protected” genome space where genes causally implicated in cancer are located and underlies the high adaptive potential and concomitant therapeutic resistance that is characteristic of cancer. PMID:28441401

Germline stem cell competition, mutation hot spots, genetic disorders and older dads

PubMed Central

Arnheim, Norman; Calabrese, Peter

2016-01-01

Some de novo human mutations arise at frequencies far exceeding the genome average mutation rate. Examples are the common mutations at one or a few sites in the genes causing achondroplasia, Noonan syndrome, multiple endocrine neoplasia 2B and Apert syndrome. These mutations are recurrent, provide a gain of function, are paternally derived and are more likely transmitted as the father ages. Recent experiments tested whether the high mutation frequencies are due to an elevated mutation rate per cell division, as expected, or an advantage of the mutant spermatogonial stem cells over wild-type stem cells. The evidence, which includes the surprising discovery of testis mutation clusters, rejects the former model but not the latter. We propose how the mutations might alter spermatogonial stem cell function and discuss how germline selection contributes to the paternal age effect, the human mutational load and adaptive evolution. PMID:27070266

COMPREHENSIVE MOLECULAR CHARACTERIZATION OF CLEAR CELL RENAL CELL CARCINOMA

PubMed Central

2013-01-01

Genetic changes underlying clear cell renal cell carcinoma (ccRCC) include alterations in genes controlling cellular oxygen sensing (e.g. VHL) and the maintenance of chromatin states (e.g. PBRM1). We surveyed more than 400 tumors using different genomic platforms and identified 19 significantly mutated genes. The PI3K/Akt pathway was recurrently mutated, suggesting this pathway as a potential therapeutic target. Widespread DNA hypomethylation was associated with mutation of the H3K36 methyltransferase SETD2, and integrative analysis suggested that mutations involving the SWI/SNF chromatin remodeling complex (PBRM1, ARID1A, SMARCA4) could have far-reaching effects on other pathways. Aggressive cancers demonstrated evidence of a metabolic shift, involving down-regulation of genes involved in the TCA cycle, decreased AMPK and PTEN protein levels, up-regulation of the pentose phosphate pathway and the glutamine transporter genes, increased acetyl-CoA carboxylase protein, and altered promoter methylation of miR-21 and GRB10. Remodeling cellular metabolism thus constitutes a recurrent pattern in ccRCC that correlates with tumor stage and severity and offers new views on the opportunities for disease treatment. PMID:23792563

Glucose-6-Phosphate Dehydrogenase: Update and Analysis of New Mutations around the World

PubMed Central

Gómez-Manzo, Saúl; Marcial-Quino, Jaime; Vanoye-Carlo, America; Serrano-Posada, Hugo; Ortega-Cuellar, Daniel; González-Valdez, Abigail; Castillo-Rodríguez, Rosa Angélica; Hernández-Ochoa, Beatriz; Sierra-Palacios, Edgar; Rodríguez-Bustamante, Eduardo; Arreguin-Espinosa, Roberto

2016-01-01

Glucose-6-phosphate dehydrogenase (G6PD) is a key regulatory enzyme in the pentose phosphate pathway which produces nicotinamide adenine dinucleotide phosphate (NADPH) to maintain an adequate reducing environment in the cells and is especially important in red blood cells (RBC). Given its central role in the regulation of redox state, it is understandable that mutations in the gene encoding G6PD can cause deficiency of the protein activity leading to clinical manifestations such as neonatal jaundice and acute hemolytic anemia. Recently, an extensive review has been published about variants in the g6pd gene; recognizing 186 mutations. In this work, we review the state of the art in G6PD deficiency, describing 217 mutations in the g6pd gene; we also compile information about 31 new mutations, 16 that were not recognized and 15 more that have recently been reported. In order to get a better picture of the effects of new described mutations in g6pd gene, we locate the point mutations in the solved three-dimensional structure of the human G6PD protein. We found that class I mutations have the most deleterious effects on the structure and stability of the protein. PMID:27941691

Mitochondrial DNA mutations in single human blood cells.

PubMed

Yao, Yong-Gang; Kajigaya, Sachiko; Young, Neal S

2015-09-01

Determination mitochondrial DNA (mtDNA) sequences from extremely small amounts of DNA extracted from tissue of limited amounts and/or degraded samples is frequently employed in medical, forensic, and anthropologic studies. Polymerase chain reaction (PCR) amplification followed by DNA cloning is a routine method, especially to examine heteroplasmy of mtDNA mutations. In this review, we compare the mtDNA mutation patterns detected by three different sequencing strategies. Cloning and sequencing methods that are based on PCR amplification of DNA extracted from either single cells or pooled cells yield a high frequency of mutations, partly due to the artifacts introduced by PCR and/or the DNA cloning process. Direct sequencing of PCR product which has been amplified from DNA in individual cells is able to detect the low levels of mtDNA mutations present within a cell. We further summarize the findings in our recent studies that utilized this single cell method to assay mtDNA mutation patterns in different human blood cells. Our data show that many somatic mutations observed in the end-stage differentiated cells are found in hematopoietic stem cells (HSCs) and progenitors within the CD34(+) cell compartment. Accumulation of mtDNA variations in the individual CD34+ cells is affected by both aging and family genetic background. Granulocytes harbor higher numbers of mutations compared with the other cells, such as CD34(+) cells and lymphocytes. Serial assessment of mtDNA mutations in a population of single CD34(+) cells obtained from the same donor over time suggests stability of some somatic mutations. CD34(+) cell clones from a donor marked by specific mtDNA somatic mutations can be found in the recipient after transplantation. The significance of these findings is discussed in terms of the lineage tracing of HSCs, aging effect on accumulation of mtDNA mutations and the usage of mtDNA sequence in forensic identification. Copyright © 2015 Elsevier B.V. All rights reserved.

Mutational Analysis of Cell Types in Tuberous Sclerosis Complex (TSC)

DTIC Science & Technology

2009-01-01

from mutations in the TSC1 or TSC2 genes that is associated with epilepsy, cognitive disability, and autism . TSC1/TSC2 gene mutations lead to...gene inactivation and leads to activation of the mTOR cascade as evidenced by phosphorylation of ribosomal S6 protein (P-S6). We demonstrate that...phosphorylation of the ribosomal S6 protein (phospho-S6 or P-S6), a marker for enhanced mTOR signaling. We find P-S6 expression in cortex as well as

The population dynamics of cancer: a Darwinian perspective.

PubMed

Vineis, Paolo; Berwick, Marianne

2006-10-01

Carcinogenesis, at least for some types of cancer, can be interpreted as the consequence of selection of mutated cells similar to what, in the theory of evolution, occurs at the population level. Instead of considering a population of organisms, we can refer to a population of cells belonging to multicellular organisms. Many carcinogens are mutagens, and the observed geographic distribution of cancer is, at least in part, attributable to environmental mutagens. However, the rapid change in risk for some cancers after migration suggests that carcinogenesis involves--in addition to mutations--some late event that most probably consists of the selection of cells already carrying mutations. We review a few examples of such selective pressures: finasteride in prostate cancer, vitamin supplementation in smokers, acquired resistance to chemotherapy, peripheral resistance to insulin, and sunlight and mutations in melanoma. A disease model for such a hypothesis is represented by Paroxysmal Nocturnal Hemoglobinuria (PNH). Mutations can be present at birth, as in the case of PNH, and can have a frequency much higher than the occurrence of the corresponding disease (PNH or lymphocytic leukaemia in children). However, PNH does not require a mutator phenotype, only a mutant phenotype followed by selection. A characteristic feature of cancer, instead, is likely to be the development of the mutator phenotype. We propose a 'Darwinian' model of carcinogenesis. If the model is correct, it suggests that prevention is more complex than avoiding exposure to mutagens. Mutations and genetic instability can be already present at birth. Mutations can be selected in the course of life if they increase survival advantage of the cell under certain environmental circumstances. In addition, gene-environment interactions cannot be interpreted according to a simplified linear model (based on the 'analysis of variance' concept); experimental work suggests that a more comprehensive non-linear interpretation based on the idea of 'norm of reaction' is needed.

Nutlin‐3a selects for cells harbouring TP 53 mutations

PubMed Central

Hollstein, Monica; Arlt, Volker M.; Phillips, David H.

2016-01-01

TP53 mutations occur in half of all human tumours. Mutagen‐induced or spontaneous TP53 mutagenesis can be studied in vitro using the human TP53 knock‐in (Hupki) mouse embryo fibroblast (HUF) immortalisation assay (HIMA). TP53 mutations arise in up to 30% of mutagen‐treated, immortalised HUFs; however, mutants are not identified until TP53 sequence analysis following immortalisation (2–5 months) and much effort is expended maintaining TP53‐WT cultures. In order to improve the selectivity of the HIMA for HUFs harbouring TP53 mutations, we explored the use of Nutlin‐3a, an MDM2 inhibitor that leads to stabilisation and activation of wild‐type (WT) p53. First, we treated previously established immortal HUF lines carrying WT or mutated TP53 with Nutlin‐3a to examine the effect on cell growth and p53 activation. Nutlin‐3a induced the p53 pathway in TP53‐WT HUFs and inhibited cell growth, whereas most TP53‐mutated HUFs were resistant to Nutlin‐3a. We then assessed whether Nutlin‐3a treatment could discriminate between TP53‐WT and TP53‐mutated cells during the HIMA (n = 72 cultures). As immortal clones emerged from senescent cultures, each was treated with 10 µM Nutlin‐3a for 5 days and observed for sensitivity or resistance. TP53 was subsequently sequenced from all immortalised clones. We found that all Nutlin‐3a‐resistant clones harboured TP53 mutations, which were diverse in position and functional impact, while all but one of the Nutlin‐3a‐sensitive clones were TP53‐WT. These data suggest that including a Nutlin‐3a counter‐screen significantly improves the specificity and efficiency of the HIMA, whereby TP53‐mutated clones are selected prior to sequencing and TP53‐WT clones can be discarded. PMID:27813088

Amplicon-based next-generation sequencing of plasma cell-free DNA for detection of driver and resistance mutations in advanced non-small cell lung cancer.

PubMed

Guibert, N; Hu, Y; Feeney, N; Kuang, Y; Plagnol, V; Jones, G; Howarth, K; Beeler, J F; Paweletz, C P; Oxnard, G R

2018-04-01

Genomic analysis of plasma cell-free DNA is transforming lung cancer care; however, available assays are limited by cost, turnaround time, and imperfect accuracy. Here, we study amplicon-based plasma next-generation sequencing (NGS), rather than hybrid-capture-based plasma NGS, hypothesizing this would allow sensitive detection and monitoring of driver and resistance mutations in advanced non-small cell lung cancer (NSCLC). Plasma samples from patients with NSCLC and a known targetable genotype (EGFR, ALK/ROS1, and other rare genotypes) were collected while on therapy and analyzed blinded to tumor genotype. Plasma NGS was carried out using enhanced tagged amplicon sequencing of hotspots and coding regions from 36 genes, as well as intronic coverage for detection of ALK/ROS1 fusions. Diagnostic accuracy was compared with plasma droplet digital PCR (ddPCR) and tumor genotype. A total of 168 specimens from 46 patients were studied. Matched plasma NGS and ddPCR across 120 variants from 80 samples revealed high concordance of allelic fraction (R2 = 0.95). Pretreatment, sensitivity of plasma NGS for the detection of EGFR driver mutations was 100% (30/30), compared with 87% for ddPCR (26/30). A full spectrum of rare driver oncogenic mutations could be detected including sensitive detection of ALK/ROS1 fusions (8/9 detected, 89%). Studying 25 patients positive for EGFR T790M that developed resistance to osimertinib, 15 resistance mechanisms could be detected including tertiary EGFR mutations (C797S, Q791P) and mutations or amplifications of non-EGFR genes, some of which could be detected pretreatment or months before progression. This blinded analysis demonstrates the ability of amplicon-based plasma NGS to detect a full range of targetable genotypes in NSCLC, including fusion genes, with high accuracy. The ability of plasma NGS to detect a range of preexisting and acquired resistance mechanisms highlights its potential value as an alternative to single mutation digital PCR-based plasma assays for personalizing treatment of TKI resistance in lung cancer.

In vivo analysis of replication and immunogenicity of proviral clones of human T-lymphotropic virus type 1 with selective envelope surface-unit mutations

PubMed Central

Silverman, Lee R.; Phipps, Andrew J.; Montgomery, Andy; Fernandez, Soledad; Tsukahara, Tomonori; Ratner, Lee; Lairmore, Michael D.

2005-01-01

Human T-cell leukemia virus type 1 (HTLV-1) is the causative agent of adult T-cell lymphoma/leukemia (ATL). The HTLV-1 envelope gene exhibits limited variability when examined from infected individuals, but has not been tested using infectious clones of the virus in animal models. In vitro assays indicate that HTLV-1 envelope (Env) Ser75Ile, Asn95Asp, and Asn195Asp surface unit (SU) mutants are able to replicate in and immortalize lymphocytes. Herein, we examined the effects of these Env mutants in rabbits inoculated with HTLV-1 immortalized ACH.75, ACH.95, or ACH.195 cell lines (expressing full-length molecular clones with the SU mutations) or the ACH.1 cell line (expressing wild-type SU). All rabbits became infected, and the fidelity of the mutations was maintained throughout the 8-week study. However, SU point mutations resulted in decreased antibody responses to viral group-associated antigen (Gag) and Env antigens. ACH.195 rabbits had a selective decreased antibody response to SU, and one ACH.195 rabbit had an antibody response to both HTLV-1 and HTLV-2 SUs. Some mutant inoculation groups had altered proviral loads. However, peripheral-blood mononuclear cell (PBMC) proviral loads did not correlate with antibody responses. Our data are the first to demonstrate that mutations in critical determinants of HTLV-1 Env SU altered antibody responses and proviral loads, but do not prevent viral replication in vivo. PMID:16046523

Generation of gene-corrected iPSC line from Parkinson's disease patient iPSC line with alpha-SNCA A53T mutation.

PubMed

Lee, Seo-Young; Jeong, SangKyun; Kim, Janghwan; Chung, Sun-Ku

2018-06-09

Parkinson's disease (PD) is the second most common age-related neurodegenerative disorder. PD can result from a mutation of alpha-synuclein (α-SNCA), such as α-SNCA A53T. Using episomal vectors, induced pluripotent stem cells (iPSCs) were generated from skin fibroblasts with the α-SNCA A53T mutation. A huge bacterial artificial chromosome (BAC) harboring the normal α-SNCA gene successfully corrected the α-SNCA A53T-mutant iPSCs. Melting curve analysis for allelic composition indicated that the BAC DNA was precisely targeted to the α-SNCA A53T mutation allele, without random integration. The corrected PD-iPSCs displayed the normal karyotype and pluripotency, with the capability to differentiate to any cell type. Copyright © 2018 The Author(s). Published by Elsevier B.V. All rights reserved.

[Analysis of EML4-ALK gene fusion mutation in patients 
with non-small cell lung cancer].

PubMed

Wang, Xuzhou; Chen, Weisheng; Yu, Yinghao

2015-02-01

Non-small cell lung cancer (NSCLC) is the main type of lung cancer, and the related locus mutation detection research has become a hot direction of molecular targeted therapy, studying on gene mutation status of echinodem microtubule associated protein like 4-Anaplastic lymphoma kinase (EML4-ALK) and epidermal growth factor receptor (EGFR), detecting the sensitivity of EML4-ALK gene fusion and gene mutation of EGFR. EML4-ALK gene fusion in 85 cases of paraffin embedded tumor tissue and adjacent lung tissue was detected with the application of immunohistochemistry (IHC), Scorpions amplification refractory mutation system (Scorpions ARMS) fluorescence quantitative PCR and fluorescence in situ hybridization (FISH) technology, and EGFR gene in 18, 19, 20 and 21 exon mutation status was detected with the application of ARMS method. In 115 cases of NSCLC, IHC showed 32 cases with ALK (D5F3) expression, the expression rate was 27.8%; ARMS showed 27 cases with EML4-ALK fusion gene mutation, the mutation detection rate was 23.5%; 53 cases were detected with EGFR mutation, the mutation rate was 46%. While FISH showed 23 cases with EML4-ALK fusion gene mutation, the detection rate was 20%, slightly lower than the ARMS detection results, suggesting that ARMS more sensitive. The application of IHC, ARMS fluorescence quantitative PCR and FISH technology can make a rapid and accurate evaluation of EML4-ALK gene fusion.

Is high pressure liquid chromatography an effective screening tool for characterization of molecular defects in hemoglobinopathies?

PubMed

Moorchung, Nikhil; Phillip, Joseph; Sarkar, Ravi Shankar; Prasad, Rupesh; Dutta, Vibha

2013-01-01

Hemoglobinopathies constitute entities that are generated by either abnormal hemoglobin or thalassemias. high pressure liquid chromatography (HPLC) is one of the best methods for screening and detection of various hemoglobinopathies but it has intrinsic interpretive problems. The study was designed to evaluate the different mutations seen in cases of hemoglobinopathies and compare the same with screening tests. 68 patients of hemoglobinopathies were screened by HPLC. Mutation studies in the beta globin gene was performed using the polymerase chain reaction (PCR)-based allele-specific Amplification Refractory Mutation System (ARMS). Molecular analysis for the sickle cell mutation was done by standard methods. The IVS 1/5 mutation was the commonest mutation seen and it was seen in 26 (38.23%) of the cases. This was followed by the IVS 1/1, codon 41/42, codon 8/9, del 22 mutation, codon 15 mutation and the -619 bp deletion. No mutation was seen in eight cases. There was a 100% concordance between the sickle cell trait as diagnosed by HPLC and genetic testing. Our study underlies the importance of molecular testing in all cases of hemoglobinopathies. Although HPLC is a useful screening tool, molecular testing is very useful in accurately diagnosing the mutations. Molecular testing is especially applicable in cases with an abnormal hemoglobin (HbD, HbE and HbS) because there may be a concomitant inheritance of a beta thalassemia mutation. Molecular testing is the gold standard when it comes to the diagnosis of hemoglobinopathies.

Mapping Polymerization and Allostery of Hemoglobin S Using Point Mutations

PubMed Central

Weinkam, Patrick; Sali, Andrej

2014-01-01

Hemoglobin is a complex system that undergoes conformational changes in response to oxygen, allosteric effectors, mutations, and environmental changes. Here, we study allostery and polymerization of hemoglobin and its variants by application of two previously described methods: (i) AllosMod for simulating allostery dynamics given two allosterically related input structures and (ii) a machine-learning method for dynamics- and structure-based prediction of the mutation impact on allostery (Weinkam et al. J. Mol. Biol. 2013), now applicable to systems with multiple coupled binding sites such as hemoglobin. First, we predict the relative stabilities of substates and microstates of hemoglobin, which are determined primarily by entropy within our model. Next, we predict the impact of 866 annotated mutations on hemoglobin’s oxygen binding equilibrium. We then discuss a subset of 30 mutations that occur in the presence of the sickle cell mutation and whose effects on polymerization have been measured. Seven of these HbS mutations occur in three predicted druggable binding pockets that might be exploited to directly inhibit polymerization; one of these binding pockets is not apparent in the crystal structure but only in structures generated by AllosMod. For the 30 mutations, we predict that mutation-induced conformational changes within a single tetramer tend not to significantly impact polymerization; instead, these mutations more likely impact polymerization by directly perturbing a polymerization interface. Finally, our analysis of allostery allows us to hypothesize why hemoglobin evolved to have multiple subunits and a persistent low frequency sickle cell mutation. PMID:23957820

A single cell high content assay detects mitochondrial dysfunction in iPSC-derived neurons with mutations in SNCA.

PubMed

Little, Daniel; Luft, Christin; Mosaku, Olukunbi; Lorvellec, Maëlle; Yao, Zhi; Paillusson, Sébastien; Kriston-Vizi, Janos; Gandhi, Sonia; Abramov, Andrey Y; Ketteler, Robin; Devine, Michael J; Gissen, Paul

2018-06-13

Mitochondrial dysfunction is implicated in many neurodegenerative diseases including Parkinson's disease (PD). Induced pluripotent stem cells (iPSCs) provide a unique cell model for studying neurological diseases. We have established a high-content assay that can simultaneously measure mitochondrial function, morphology and cell viability in iPSC-derived dopaminergic neurons. iPSCs from PD patients with mutations in SNCA and unaffected controls were differentiated into dopaminergic neurons, seeded in 384-well plates and stained with the mitochondrial membrane potential dependent dye TMRM, alongside Hoechst-33342 and Calcein-AM. Images were acquired using an automated confocal screening microscope and single cells were analysed using automated image analysis software. PD neurons displayed reduced mitochondrial membrane potential and altered mitochondrial morphology compared to control neurons. This assay demonstrates that high content screening techniques can be applied to the analysis of mitochondria in iPSC-derived neurons. This technique could form part of a drug discovery platform to test potential new therapeutics for PD and other neurodegenerative diseases.

Isolation and mutational analysis of circulating tumor cells from lung cancer patients with magnetic sifters and biochips†

PubMed Central

Earhart, Christopher M.; Hughes, Casey E.; Gaster, Richard S.; Ooi, Chin Chun; Wilson, Robert J.; Zhou, Lisa Y.; Humke, Eric W.; Xu, Lingyun; Wong, Dawson J.; Willingham, Stephen B.; Schwartz, Erich J.; Weissman, Irving L.; Jeffrey, Stefanie S.; Neal, Joel W.; Rohatgi, Rajat; Wakelee, Heather A.; Wang, Shan X.

2014-01-01

Detection and characterization of circulating tumor cells (CTCs) may reveal insights into the diagnosis and treatment of malignant disease. Technologies for isolating CTCs developed thus far suffer from one or more limitations, such as low throughput, inability to release captured cells, and reliance on expensive instrumentation for enrichment or subsequent characterization. We report a continuing development of a magnetic separation device, the magnetic sifter, which is a miniature microfluidic chip with a dense array of magnetic pores. It offers high efficiency capture of tumor cells, labeled with magnetic nanoparticles, from whole blood with high throughput and efficient release of captured cells. For subsequent characterization of CTCs, an assay, using a protein chip with giant magnetoresistive nanosensors, has been implemented for mutational analysis of CTCs enriched with the magnetic sifter. The use of these magnetic technologies, which are separate devices, may lead the way to routine preparation and characterization of “liquid biopsies” from cancer patients. PMID:23969419

Actin cytoskeleton organization, cell surface modification and invasion rate of 5 glioblastoma cell lines differing in PTEN and p53 status

DOE Office of Scientific and Technical Information (OSTI.GOV)

Djuzenova, Cholpon S., E-mail: djuzenova_t@ukw.de; Fiedler, Vanessa; Memmel, Simon

Glioblastoma cells exhibit highly invasive behavior whose mechanisms are not yet fully understood. The present study explores the relationship between the invasion capacity of 5 glioblastoma cell lines differing in p53 and PTEN status, expression of mTOR and several other marker proteins involved in cell invasion, actin cytoskeleton organization and cell morphology. We found that two glioblastoma lines mutated in both p53 and PTEN genes (U373-MG and SNB19) exhibited the highest invasion rates through the Matrigel or collagen matrix. In DK-MG (p53wt/PTENwt) and GaMG (p53mut/PTENwt) cells, F-actin mainly occurred in the numerous stress fibers spanning the cytoplasm, whereas U87-MG (p53wt/PTENmut),more » U373-MG and SNB19 (both p53mut/PTENmut) cells preferentially expressed F-actin in filopodia and lamellipodia. Scanning electron microscopy confirmed the abundant filopodia and lamellipodia in the PTEN mutated cell lines. Interestingly, the gene profiling analysis revealed two clusters of cell lines, corresponding to the most (U373-MG and SNB19, i.e. p53 and PTEN mutated cells) and less invasive phenotypes. The results of this study might shed new light on the mechanisms of glioblastoma invasion. - Highlights: • We examine 5 glioblastoma lines on the invasion capacity and actin cytoskeleton. • Glioblastoma cell lines mutated in both p53 and PTEN were the most invasive. • Less invasive cells showed much less lamellipodia, but more actin stress fibers. • A mechanism for the differences in tumor cell invasion is proposed.« less

Prevalence of EGFR mutations in newly diagnosed locally advanced or metastatic non-small cell lung cancer Spanish patients and its association with histological subtypes and clinical features: The Spanish REASON study.

PubMed

Esteban, E; Majem, M; Martinez Aguillo, M; Martinez Banaclocha, N; Dómine, M; Gómez Aldaravi, L; Juan, O; Cajal, R; Gonzalez Arenas, M C; Provencio, M

2015-06-01

The aim of the REASON study is to determine the frequency of EGFR mutation in advanced non-small cell lung cancer (aNSCLC) patients in Spain (all histologies), and to better understand the clinical factors (gender, smoking habits and histological subtypes) that may be associated with EGFR mutations, in an unselected sample of aNSCLC patients. All newly diagnosed aNSCLC patients from 40 selected centers in Spain were prospectively included for a 6-month period. Patient characteristics were obtained from clinical records. Mutation testing was performed on available tumor samples. Exploratory analyses were performed to characterize the clinico-pathological factors associated with presence of EGFR mutations. From March 2010 to March 2011, 1113 patients were included in the study, of which 1009 patients provided sample for EGFR mutation analysis (90.7%). Mutation analysis was not feasible in 146/1113 patients (13.1%) due to either sample unavailability (79/1113; 7.1%) or sample inadequacy (67/1113; 6.0%). Twenty-five out of 1113 patients (2.3%) were excluded due to unavailable information. Most patients (99.5%) were Caucasian, 74.5% were male, and predominantly were current (38.1%) or former smokers (44.0%). Median age was 66 years (range 25-90) and 70.7% of patients had non-squamous histology (57.8% adenocarcinoma, 1.8% bronchoalveolar, 11.1% large-cell carcinoma). Exon 19 deletions and the exon 21 L858R point mutation were analyzed in 942/1009 (93.4%) samples. Mutation rate was 11.6% (82.6% exon 19 dels and 17.4% L858R). To be never smoker (38.1%), female (25.4%), with bronchioloalveolar carcinoma (22.2%) or adenocarcinoma (15.4%) histology was associated with a higher prevalence of EGFR mutations. Exons 18, 20 and 21 (excluding L858R) were analyzed in 505/942 samples, and EGFR mutations were found in 22/505 samples (4.4%). The estimated prevalence of sensitizing EGFR mutations (exon 19 del, exon 21 L858R) in an unselected samples of newly diagnosed aNSCLC patients in Spain (all histologies) is consistent with previous published data in Caucasian patients. When a sample is available, EGFR mutation testing is feasible in over 90% of cases, and may therefore be suitable for routine clinical practice. CLINICALTRIALS. NCT01081496. Copyright © 2015 Elsevier Ltd. All rights reserved.

Zebrafish narrowminded suggests a genetic link between formation of neural crest and primary sensory neurons

PubMed Central

Bruk Artinger, Kristin; Chitnis, Ajay B.; Mercola, Mark; Driever, Wolfgang

2014-01-01

SUMMARY In the developing vertebrate nervous system, both neural crest and sensory neurons form at the boundary between non-neural ectoderm and the neural plate. From an in situ hybridization based expression analysis screen, we have identified a novel zebrafish mutation, narrowminded (nrd), which reduces the number of early neural crest cells and eliminates Rohon-Beard (RB) sensory neurons. Mosaic analysis has shown that the mutation acts cell autonomously suggesting that nrd is involved in either the reception or interpretation of signals at the lateral neural plate boundary. Characterization of the mutant phenotype indicates that nrd is required for a primary wave of neural crest cell formation during which progenitors generate both RB sensory neurons and neural crest cells. Moreover, the early deficit in neural crest cells in nrd homozygotes is compensated later in development. Thus, we propose that a later wave can compensate for the loss of early neural crest cells but, interestingly, not the RB sensory neurons. We discuss the implications of these findings for the possibility that RB sensory neurons and neural crest cells share a common evolutionary origin. PMID:10457007

BRCA1 Mutation Status and Follicular Fluid Exposure Alters NFκB Signaling and ISGylation in Human Fallopian Tube Epithelial Cells.

PubMed

Hollingsworth, Julia; Lau, Angela; Tone, Alicia; Kollara, Alexandra; Allen, Lisa; Colgan, Terence J; Dube, Valerie; Rosen, Barry; Murphy, K Joan; Greenblatt, Ellen M; Feigenberg, Tomer; Virtanen, Carl; Brown, Theodore J

2018-05-28

Germline BRCA1 or BRCA2 mutations (mtBRCA1 and mtBRCA2) increase risk for high-grade serous ovarian cancer (HGSOC), the most commonly diagnosed epithelial ovarian cancer histotype. Other identified risk factors for this cancer, which originates primarily in the distal fallopian tube epithelium (FTE), implicate ovulation, during which the FTE cells become transiently exposed to follicular fluid (FF). To test whether mtBRCA1 or mtBRCA2 nonmalignant FTE cells respond differently to periovulatory FF exposure than control patient FTE cells, gene expression profiles from primary FTE cultures derived from BRCA1 or BRCA2 mutation carriers or control patients were compared at baseline, 24 hours after FF exposure, and 24 hours after FF replacement with culture medium. Hierarchical clustering revealed both FF exposure and BRCA mutation status affect gene expression, with BRCA1 mutation having the greatest impact. Gene set enrichment analysis revealed increased NFκB and EGFR signaling at baseline in mtBRCA1 samples, with increased interferon target gene expression, including members of the ISGylation pathway, observed after recovery from FF exposure. Gene set enrichment analysis did not identify altered pathway signaling in mtBRCA2 samples. An inverse relationship between EGFR signaling and ISGylation with BRCA1 protein levels was verified in an immortalized FTE cell line, OE-E6/E7, stably transfected with BRCA1 cDNA. Suppression of ISG15 and ISGylated protein levels by increased BRCA1 expression was found to be mediated by decreased NFκB signaling. These studies indicate that increased NFκB signaling associated with decreased BRCA1 expression results in increased ISG15 and protein ISGylation following FF exposure, which may be involved in predisposition to HGSOC. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Effects of icotinib on advanced non-small cell lung cancer with different EGFR phenotypes.

PubMed

Pan, Huiyun; Liu, Rong; Li, Shengjie; Fang, Hui; Wang, Ziwei; Huang, Sheng; Zhou, Jianying

2014-09-01

Icotinib is the first oral epidermal growth factor receptor (EGFR) tyrosine kinase receptor inhibitor, which has been proven to exert significant inhibitory effects on non-small cell lung cancer in vitro. Clinical evidence has showed that the efficacy of Icotinib on retreating advanced non-small cell lung cancer is comparable to Gefitinib. However, different phenotypes of EGFR can affect the therapeutic outcomes of EGFR tyrosine kinase receptor inhibitor. Therefore, our study focused on efficacy and safety of Icotinib in patients with advanced non-small cell lung cancer of different EGPR phenotypes. Clinical data of patients with advanced non-small cell lung cancer who received Icotinib treatment from August, 2011 to May, 2013 were retrospectively analyzed. Kaplan-Meier analysis was used for survival analysis and comparison. 18 wild-type EGFR and 51 mutant type were found in a total of 69 patients. Objective response rate of patients with mutant type EGFR was 54.9 % and disease control rate was 86.3 %. Objective response rate of wild-type patients was 11.1 % (P = 0.0013 vs mutant type), disease control rate was 50.0 % (P = 0.0017). Median progression-free survival (PFS) of mutant type and wild-type patients were 9.7 and 2.6 months, respectively (P < 0.001). Median PFS of exon 19 mutated mutant patients was 11.3 months, mean PFS of exon 21 L858R mutated mutant patients was 8.7 months (P = 0.3145). Median overall survival (OS) of EGFR mutated patients had not reached. OS time of 13 wild-type patients was 12.9 months (P < 0.001). The common adverse reactions of Icotinib included rash, diarrhea, itching skin with occurrence rates of 24.6 % (17/69), 13.0 % (9/69), and 11.6 % (8/69), respectively. Most adverse reactions were grade I-II. Icotinib has great efficacy in EGFR mutated patients, making it an optimal regimen to treat EGFR mutated patients. Furthermore, most of adverse reactions associated with Icotinib treatment were tolerable.

Effects of icotinib, a novel epidermal growth factor receptor tyrosine kinase inhibitor, in EGFR-mutated non-small cell lung cancer.

PubMed

Yang, Guangdie; Yao, Yinan; Zhou, Jianya; Zhao, Qiong

2012-06-01

Epidermal growth factor receptor (EGFR) is one of the most promising targets for non-small cell lung cancer (NSCLC). Our study demonstrated the antitumor effects of icotinib hydrochloride, a highly selective epidermal growth factor receptor tyrosine kinase inhibitor (EGFR TKI), in two EGFR-mutated lung cancer cell lines compared to A549, a cell line without EGFR mutations. We incubated PC-9 and HCC827 human lung cancer cell lines both with (E746-A750) mutations with various concentrations of icotinib and gefitinib for 48 h. Cell proliferation and migration were determined using a real-time cell invasion and migration assay and cytotoxicity assay. Apoptosis was assessed by measuring Annexin V staining using flow cytometry. The antitumor effects of icotinib compared to gefitinib were similar and were most effective in reducing the proliferation of EGFR-mutated cells compared to non-mutated controls. Our results suggest the possibility of icotinib as a new therapeutic agent of EGFR-mutated cancer cells, which has the potential to be used in the first-line treatment of EGFR-mutated NSCLC.

Molecular analysis of urothelial cancer cell lines for modeling tumor biology and drug response.

PubMed

Nickerson, M L; Witte, N; Im, K M; Turan, S; Owens, C; Misner, K; Tsang, S X; Cai, Z; Wu, S; Dean, M; Costello, J C; Theodorescu, D

2017-01-05

The utility of tumor-derived cell lines is dependent on their ability to recapitulate underlying genomic aberrations and primary tumor biology. Here, we sequenced the exomes of 25 bladder cancer (BCa) cell lines and compared mutations, copy number alterations (CNAs), gene expression and drug response to BCa patient profiles in The Cancer Genome Atlas (TCGA). We observed a mutation pattern associated with altered CpGs and APOBEC-family cytosine deaminases similar to mutation signatures derived from somatic alterations in muscle-invasive (MI) primary tumors, highlighting a major mechanism(s) contributing to cancer-associated alterations in the BCa cell line exomes. Non-silent sequence alterations were confirmed in 76 cancer-associated genes, including mutations that likely activate oncogenes TERT and PIK3CA, and alter chromatin-associated proteins (MLL3, ARID1A, CHD6 and KDM6A) and established BCa genes (TP53, RB1, CDKN2A and TSC1). We identified alterations in signaling pathways and proteins with related functions, including the PI3K/mTOR pathway, altered in 60% of lines; BRCA DNA repair, 44%; and SYNE1-SYNE2, 60%. Homozygous deletions of chromosome 9p21 are known to target the cell cycle regulators CDKN2A and CDKN2B. This loci was commonly lost in BCa cell lines and we show the deletions extended to the polyamine enzyme methylthioadenosine (MTA) phosphorylase (MTAP) in 36% of lines, transcription factor DMRTA1 (27%) and antiviral interferon epsilon (IFNE, 19%). Overall, the BCa cell line genomic aberrations were concordant with those found in BCa patient tumors. We used gene expression and copy number data to infer pathway activities for cell lines, then used the inferred pathway activities to build a predictive model of cisplatin response. When applied to platinum-treated patients gathered from TCGA, the model predicted treatment-specific response. Together, these data and analysis represent a valuable community resource to model basic tumor biology and to study the pharmacogenomics of BCa.

Recombinant EphB4-HSA Fusion Protein and Pembrolizumab, MK-3475

ClinicalTrials.gov

2018-03-30

ALK Gene Mutation; BRAF Gene Mutation; EGFR Gene Mutation; Head and Neck Squamous Cell Carcinoma; Metastatic Head and Neck Carcinoma; Recurrent Head and Neck Carcinoma; Recurrent Non-Small Cell Lung Carcinoma; ROS1 Gene Mutation; Stage III Non-Small Cell Lung Cancer; Stage IIIA Non-Small Cell Lung Cancer; Stage IIIB Non-Small Cell Lung Cancer; Stage IV Non-Small Cell Lung Cancer

Uncommon BRAF mutations in the follicular variant of thyroid papillary carcinoma: New insights.

PubMed

Rossi, Esther Diana; Martini, Maurizio; Bizzarro, Tommaso; Capodimonti, Sara; Cenci, Tonia; Lombardi, Celestino Pio; Pontecorvi, Alfredo; Fadda, Guido; Larocca, Luigi Maria

2015-10-01

Mutational analysis is reshaping the practice of fine-needle aspiration cytology for the diagnosis of thyroid nodules. The v-Raf murine sarcoma viral oncogene homolog B1 (BRAF) valine (V) to glutamic acid (E) substitution at codon 600 (BRAF(V600E)) is the most effective diagnostic/prognostic marker and is used mainly for papillary thyroid carcinomas (PTCs). Although BRAF(V600E) represents 95% of all BRAF mutations, uncommon BRAF mutations have been identified in thyroid carcinomas. For the current study, the authors evaluated morphologic (plump pink cells and sickle-shaped nuclei) anti-BRAF(V600E) antibody (VE1) immunocytochemical and molecular findings of BRAF mutations in PTCs and in the follicular variant of PTC (FVPC). Between January 2013 and June 2014, there were 150 cytologic samples with surgical follow-up at the authors' institution. BRAF mutations, which were identified using liquid-based cytology, were classified into wild-type BRAF, BRAF(V600E), and uncommon BRAF mutations. All clinicopathologic correlations between BRAF and FVPCs were analyzed. Forty-four of 150 samples were identified as benign histologic lesions, and the authors focused on the 106 cytologic samples from patients who had malignant outcomes (60 PTCs and 46 FVPCs). The series included 16 follicular neoplasms, 36 samples diagnosed as suspicious of malignancy, and 54 samples diagnosed as positive for malignancy. The BRAF(V600E) mutation was detected in 17.4% of FVPCs and in 66.6% of PTCs, whereas uncommon BRAF mutations were detected only in FVPCs. Plump pink cells and VE1 expression were not identified in samples that had uncommon BRAF mutations. VE1 immunocytochemistry yielded positive results in all 36 samples that had the BRAF(V600E) mutation. Uncommon BRAF mutations were observed only in FVPCs and were linked to less aggressive behavior. Negative/weak VE1 expression was observed in both wild-type and uncommon BRAF mutations. The current investigation did not reveal any plump cells or morphologic BRAF findings in samples that had uncommon BRAF mutations. In the authors' experience, BRAF mutations detected by DNA methods were more accurate in identifying FVPCs. © 2015 American Cancer Society.

Preexisting compensatory amino acids compromise fitness costs of a HIV-1 T cell escape mutation

DOE PAGES

Liu, Donglai; Zuo, Tao; Hora, Bhavna; ...

2014-01-01

Background: Fitness costs and slower disease progression are associated with a cytolytic T lymphocyte (CTL) escape mutation T242N in Gag in HIV-1-infected individuals carrying HLA-B*57/5801 alleles. However, the impact of different context in diverse HIV-1 strains on the fitness costs due to the T242N mutation has not been well characterized. To better understand the extent of fitness costs of the T242N mutation and the repair of fitness loss through compensatory amino acids, we investigated its fitness impact in different transmitted/founder (T/F) viruses. Results: The T242N mutation resulted in various levels of fitness loss in four different T/F viruses. However, themore » fitness costs were significantly compromised by preexisting compensatory amino acids in (Isoleucine at position 247) or outside (glutamine at position 219) the CTL epitope. Moreover, the transmitted T242N escape mutant in subject CH131 was as fit as the revertant N242T mutant and the elimination of the compensatory amino acid I247 in the T/F viral genome resulted in significant fitness cost, suggesting the fitness loss caused by the T242N mutation had been fully repaired in the donor at transmission. Analysis of the global circulating HIV-1 sequences in the Los Alamos HIV Sequence Database showed a high prevalence of compensatory amino acids for the T242N mutation and other T cell escape mutations. Conclusions: Our results show that the preexisting compensatory amino acids in the majority of circulating HIV-1 strains could significantly compromise the fitness loss due to CTL escape mutations and thus increase challenges for T cell based vaccines.« less

Cancer heterogeneity: converting a limitation into a source of biologic information.

PubMed

Rübben, Albert; Araujo, Arturo

2017-09-08

Analysis of spatial and temporal genetic heterogeneity in human cancers has revealed that somatic cancer evolution in most cancers is not a simple linear process composed of a few sequential steps of mutation acquisitions and clonal expansions. Parallel evolution has been observed in many early human cancers resulting in genetic heterogeneity as well as multilineage progression. Moreover, aneuploidy as well as structural chromosomal aberrations seems to be acquired in a non-linear, punctuated mode where most aberrations occur at early stages of somatic cancer evolution. At later stages, the cancer genomes seem to get stabilized and acquire only few additional rearrangements. While parallel evolution suggests positive selection of driver mutations at early stages of somatic cancer evolution, stabilization of structural aberrations at later stages suggests that negative selection takes effect when cancer cells progressively lose their tolerance towards additional mutation acquisition. Mixing of genetically heterogeneous subclones in cancer samples reduces sensitivity of mutation detection. Moreover, driver mutations present only in a fraction of cancer cells are more likely to be mistaken for passenger mutations. Therefore, genetic heterogeneity may be considered a limitation negatively affecting detection sensitivity of driver mutations. On the other hand, identification of subclones and subclone lineages in human cancers may lead to a more profound understanding of the selective forces which shape somatic cancer evolution in human cancers. Identification of parallel evolution by analyzing spatial heterogeneity may hint to driver mutations which might represent additional therapeutic targets besides driver mutations present in a monoclonal state. Likewise, stabilization of cancer genomes which can be identified by analyzing temporal genetic heterogeneity might hint to genes and pathways which have become essential for survival of cancer cell lineages at later stages of cancer evolution. These genes and pathways might also constitute patient specific therapeutic targets.

Deciphering KRAS and NRAS mutated clone dynamics in MLL-AF4 paediatric leukaemia by ultra deep sequencing analysis.

PubMed

Trentin, Luca; Bresolin, Silvia; Giarin, Emanuela; Bardini, Michela; Serafin, Valentina; Accordi, Benedetta; Fais, Franco; Tenca, Claudya; De Lorenzo, Paola; Valsecchi, Maria Grazia; Cazzaniga, Giovanni; Kronnie, Geertruy Te; Basso, Giuseppe

2016-10-04

To induce and sustain the leukaemogenic process, MLL-AF4+ leukaemia seems to require very few genetic alterations in addition to the fusion gene itself. Studies of infant and paediatric patients with MLL-AF4+ B cell precursor acute lymphoblastic leukaemia (BCP-ALL) have reported mutations in KRAS and NRAS with incidences ranging from 25 to 50%. Whereas previous studies employed Sanger sequencing, here we used next generation amplicon deep sequencing for in depth evaluation of RAS mutations in 36 paediatric patients at diagnosis of MLL-AF4+ leukaemia. RAS mutations including those in small sub-clones were detected in 63.9% of patients. Furthermore, the mutational analysis of 17 paired samples at diagnosis and relapse revealed complex RAS clone dynamics and showed that the mutated clones present at relapse were almost all originated from clones that were already detectable at diagnosis and survived to the initial therapy. Finally, we showed that mutated patients were indeed characterized by a RAS related signature at both transcriptional and protein levels and that the targeting of the RAS pathway could be of beneficial for treatment of MLL-AF4+ BCP-ALL clones carrying somatic RAS mutations.

Multiplex picoliter-droplet digital PCR for quantitative assessment of EGFR mutations in circulating cell-free DNA derived from advanced non-small cell lung cancer patients.

PubMed

Yu, Qian; Huang, Fei; Zhang, Meilin; Ji, Haiying; Wu, Shenchao; Zhao, Ying; Zhang, Chunyan; Wu, Jiong; Wang, Beili; Pan, Baisheng; Zhang, Xin; Guo, Wei

2017-08-01

To explore the possible diagnostic value of liquid biopsy, two multiplex panels using picoliter-droplet digital polymerase chain reaction (ddPCR) were established to quantitatively assess the epidermal growth factor receptor (EGFR) mutations in cell‑free DNA (cfDNA) extracted from the plasma of advanced non‑small cell lung cancer (NSCLC) patients. Plasma samples derived from 22 patients with stage IIIB/IV NSCLC harboring EGFR mutations in matched tumor tissues confirmed by amplification refractory mutation system (ARMS) analysis were subjected to two multiplex ddPCR panels to assess the abundance of tyrosine kinase inhibitor (TKI) ‑sensitive (19DEL, L858R) and TKI‑resistant (T790 M) mutations. Fluctuations in EGFR mutant abundance were monitored by either of the multiplex ddPCR panels for three patients undergoing EGFR‑TKI treatment, with serial plasma sample collections over 2 months. The multiplex ddPCR panels applied to plasma cfDNA from advanced NSCLC patients achieved a total concordance rate of 80% with the EGFR mutation profiles obtained by ARMS from matched biopsy tumor specimens (90% for 19DEL, 95% for L858R, 95% for T790M, respectively) and revealed additional mutant alleles in two subjects. The respective sensitivity and specificity were 90.9 and 88.9% for 19DEL, 87.5 and 100% for L858R, 100 and 93.8% for T790M. The fluctuations of EGFR mutant abundance in serial plasma cfDNA were in accordance with the changes in tumor size as assessed by imaging scans. The authors demonstrated the utility of multiplex ddPCR panels with ultra‑sensitivity for quantitative analysis of EGFR mutations in plasma cfDNA and obtained promising usefulness in EGFR‑TKI decision‑making for advanced NSCLC patients.

Biological and Clinical Relevance of Associated Genomic Alterations in MYD88 L265P and non-L265P-Mutated Diffuse Large B-Cell Lymphoma: Analysis of 361 Cases.

PubMed

Dubois, Sydney; Viailly, Pierre-Julien; Bohers, Elodie; Bertrand, Philippe; Ruminy, Philippe; Marchand, Vinciane; Maingonnat, Catherine; Mareschal, Sylvain; Picquenot, Jean-Michel; Penther, Dominique; Jais, Jean-Philippe; Tesson, Bruno; Peyrouze, Pauline; Figeac, Martin; Desmots, Fabienne; Fest, Thierry; Haioun, Corinne; Lamy, Thierry; Copie-Bergman, Christiane; Fabiani, Bettina; Delarue, Richard; Peyrade, Frédéric; André, Marc; Ketterer, Nicolas; Leroy, Karen; Salles, Gilles; Molina, Thierry J; Tilly, Hervé; Jardin, Fabrice

2017-05-01

Purpose: MYD88 mutations, notably the recurrent gain-of-function L265P variant, are a distinguishing feature of activated B-cell like (ABC) diffuse large B-cell lymphoma (DLBCL), leading to constitutive NFκB pathway activation. The aim of this study was to examine the distinct genomic profiles of MYD88 -mutant DLBCL, notably according to the presence of the L265P or other non-L265P MYD88 variants. Experimental Design: A cohort of 361 DLBCL cases (94 MYD88 mutant and 267 MYD88 wild-type) was submitted to next-generation sequencing (NGS) focusing on 34 genes to analyze associated mutations and copy number variations, as well as gene expression profiling, and clinical and prognostic analyses. Results: Importantly, we highlighted different genomic profiles for MYD88 L265P and MYD88 non-L265P-mutant DLBCL, shedding light on their divergent backgrounds. Clustering analysis also segregated subgroups according to associated genetic alterations among patients with the same MYD88 mutation. We showed that associated CD79B and MYD88 L265P mutations act synergistically to increase NFκB pathway activation, although the majority of MYD88 L265P-mutant cases harbors downstream NFκB alterations, which can predict BTK inhibitor resistance. Finally, although the MYD88 L265P variant was not an independent prognostic factor in ABC DLBCL, associated CD79B mutations significantly improved the survival of MYD88 L265P-mutant ABC DLBCL in our cohort. Conclusions: This study highlights the relative heterogeneity of MYD88 -mutant DLBCL, adding to the field's knowledge of the theranostic importance of MYD88 mutations, but also of associated alterations, emphasizing the usefulness of genomic profiling to best stratify patients for targeted therapy. Clin Cancer Res; 23(9); 2232-44. ©2016 AACR . ©2016 American Association for Cancer Research.

The head and neck cancer cell oncogenome: a platform for the development of precision molecular therapies

PubMed Central

Martin, Daniel; Abba, Martin C.; Molinolo, Alfredo A.; Vitale-Cross, Lynn; Wang, Zhiyong; Zaida, Moraima; Delic, Naomi C.; Samuels, Yardena; Lyons, J. Guy; Gutkind, J. Silvio

2014-01-01

The recent elucidation of the genomic landscape of head and neck squamous cell carcinoma (HNSCC) has provided a unique opportunity to develop selective cancer treatment options. These efforts will require the establishment of relevant HNSCC models for preclinical testing. Here, we performed full exome and transcriptome sequencing of a large panel of HNSCC-derived cells from different anatomical locations and human papillomavirus (HPV) infection status. These cells exhibit typical mutations in TP53, FAT1, CDK2NA, CASP8, and NOTCH1, and copy number variations (CNVs) and mutations in PIK3CA, HRAS, and PTEN that reflect the widespread activation of the PI3K-mTOR pathway. SMAD4 alterations were observed that may explain the decreased tumor suppressive effect of TGF-β in HNSCC. Surprisingly, we identified HPV+ HNSCC cells harboring TP53 mutations, and documented aberrant TP53 expression in a subset of HPV+ HNSCC cases. This analysis also revealed that most HNSCC cells harbor multiple mutations and CNVs in epigenetic modifiers (e.g., EP300, CREBP, MLL1, MLL2, MLL3, KDM6A, and KDM6B) that may contribute to HNSCC initiation and progression. These genetically-defined experimental HNSCC cellular systems, together with the identification of novel actionable molecular targets, may now facilitate the pre-clinical evaluation of emerging therapeutic agents in tumors exhibiting each precise genomic alteration. PMID:25275298

Mutant quantity and quality in mammalian cells (AL) exposed to cesium-137 gamma radiation: effect of caffeine

NASA Technical Reports Server (NTRS)

McGuinness, S. M.; Shibuya, M. L.; Ueno, A. M.; Vannais, D. B.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)

1995-01-01

We examined the effect of caffeine (1,3,7-trimethylxanthine) on the quantity and quality of mutations in cultured mammalian AL human-hamster hybrid cells exposed to 137Cs gamma radiation. At a dose (1.5 mg/ml for 16 h) that reduced the plating efficiency (PE) by 20%, caffeine was not itself a significant mutagen, but it increased by approximately twofold the slope of the dose-response curve for induction of S1- mutants by 137Cs gamma radiation. Molecular analysis of 235 S1- mutants using a series of DNA probes mapped to the human chromosome 11 in the AL hybrid cells revealed that 73 to 85% of the mutations in unexposed cells and in cells treated with caffeine alone, 137Cs gamma rays alone or 137Cs gamma rays plus caffeine were large deletions involving millions of base pairs of DNA. Most of these deletions were contiguous with the region of the MIC1 gene at 11p13 that encodes the S1 cell surface antigen. In other mutants that had suffered multiple marker loss, the deletions were intermittent along chromosome 11. These "complex" mutations were rare for 137Cs gamma irradiation (1/63 = 1.5%) but relatively prevalent (23-50%) for other exposure conditions. Thus caffeine appears to alter both the quantity and quality of mutations induced by 137Cs gamma irradiation.

A comparative analysis of EGFR mutation status in association with the efficacy of TKI in combination with WBRT/SRS/surgery plus chemotherapy in brain metastasis from non-small cell lung cancer.

PubMed

Cai, Ling; Zhu, Jian-fei; Zhang, Xue-wen; Lin, Su-xia; Su, Xiao-dong; Lin, Peng; Chen, Kai; Zhang, Lan-jun

2014-11-01

We proposed to identify the efficacy of an epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) using whole brain radiotherapy (WBRT)/stereotactic radiosurgery (SRS)/surgery in brain metastases from patients with non-small cell lung cancer (NSCLC) and clarify the association between treatment outcome and EGFR gene mutation status. A total of 282 patients with NSCLC brain metastases who underwent WBRT/SRS/surgery alone or in combination with TKI were enrolled in our study from 2003-2013. Amplification mutation refractory system technology was used to determine the EGFR mutation status in 109 tissue samples. EGFR mutation detection was performed in 109 patients with tumor tissues. The EGFR positive rate was 50 % (55/109), including 26 exon 19 deletions and 24 L858R mutations. The median follow-up time was 28 months. The median overall survival, median progression-free survival of intracranial disease, and median progression-free survival of extracranial disease was significantly longer for patients with TKI treatment (31.9 vs 17.0 months, P < 0.0001; 19.8 vs 12.0 months, P < 0.0001; and 19.6 vs 12.3 months, P < 0.0001; respectively). In subgroup analysis within the TKI group, patients harboring EGFR mutations had better extracranial disease control (20.4 vs 14.1 months, P = 0.032). Administration of TKI agents with conventional therapy compared with conventional therapy alone might be beneficial for overall survival, progression-free survival of intracranial disease and progression-free survival of extracranial disease in patients with brain metastases from NSCLC independent of EGFR mutations.

Clinical Factors Predicting Detection of T790M Mutation in Rebiopsy for EGFR-Mutant Non-small-cell Lung Cancer.

PubMed

Kawamura, Takahisa; Kenmotsu, Hirotsugu; Omori, Shota; Nakashima, Kazuhisa; Wakuda, Kazushige; Ono, Akira; Naito, Tateaki; Murakami, Haruyasu; Omae, Katsuhiro; Mori, Keita; Tanigawara, Yusuke; Nakajima, Takashi; Ohde, Yasuhisa; Endo, Masahiro; Takahashi, Toshiaki

2018-03-01

T790M, a secondary epidermal growth factor receptor (EGFR) mutation, accounts for approximately 50% of acquired resistance to EGFR-tyrosine kinase inhibitors (TKIs). To facilitate the use of third-generation EGFR-TKIs to potentially overcome T790M-mediated resistance, we evaluated the clinical factors influencing the incidence of T790M mutation. We retrospectively screened patients with non-small-cell lung cancer harboring EGFR mutations with progressive disease who were rebiopsied between January 2013 and December 2016. Factors influencing T790M status were evaluated by univariate and multivariate analysis. Among 131 rebiopsied patients for whom EGFR mutation status was available, 58 (44%) had T790M mutations. Patient characteristics at rebiopsy were not significantly different between T790M-positive and -negative groups, except for surgical history (postsurgery recurrence). Total duration of EGFR-TKI treatment before rebiopsy, TKI-free interval, EGFR-TKI treatment history immediately before rebiopsy, continuation of initial EGFR-TKI beyond progressive disease, progression-free survival after initial TKI treatment, and rebiopsy site (other than fluid samples) significantly influenced T790M status. The incidence of T790M mutation was shown by multivariate analysis to be significantly higher in patients with postsurgery recurrence and total duration of EGFR-TKI treatment ≥ 1 year before rebiopsy (odds ratio, 4.2; 95% confidence interval, 1.3-15.7 and odds ratio, 4.4; 95% confidence interval, 1.1-19.8, respectively). Postsurgery recurrence and longer total duration of EGFR-TKI treatment before rebiopsy may represent useful predictive markers for T790M detection. In patients with these clinical factors, rebiopsies are more recommended to detect T790M mutation. Copyright © 2017 Elsevier Inc. All rights reserved.

Prognostic impact of EGFR mutation in non-small-cell lung cancer patients with family history of lung cancer.

PubMed

Kim, Jung Soo; Cho, Min Seong; Nam, Jong Hyeon; Kim, Hyun-Jung; Choi, Kyeng-Won; Ryu, Jeong-Seon

2017-01-01

A family history can be a valuable tool in the era of precision medicine. Although a few studies have described an association of family history of lung cancer with EGFR activating mutation, their impact on survival of lung cancer patients is unclear. The study included consecutive 829 non-small-cell lung cancer patients who received analysis of EGFR mutation in a prospective lung cancer cohort. Family history of lung cancer was obtained by face-to-face interviews at the time of diagnosis. An association of EGFR activating mutation with a family history of lung cancer in first-degree relatives was evaluated with multivariate logistic regression analysis, and its association with survival was estimated with Cox's proportional hazards model. Seventy five (9.0%) patients had family history of lung cancer. The EGFR mutation was commonly observed in patients with positive family history compared to those with no family history (46.7% v 31.3%, χ2 p = 0.007). The family history was significantly associated with the EGFR mutation (aOR and 95% CI: 2.01 and 1.18-3.60, p = 0.011). Patients with the positive family history survived longer compared to those without (MST, 17.9 v 13.0 months, log-rank p = 0.037). The presence of the EGFR mutation was associated with better survival in patients without the family history (aHR and 95% CI: 0.72 and 0.57-0.90, p = 0.005). However, this prognostic impact was not observed in patients with the positive family history (aHR and 95% CI: 1.01 and 0.50-2.36, p = 0.832). In comparison to patients without the family history, EGFR activating mutation was common, and it did not affect prognosis in patients with positive family history.

Expression of ALS/FTD-linked mutant CCNF in zebrafish leads to increased cell death in the spinal cord and an aberrant motor phenotype.

PubMed

Hogan, Alison L; Don, Emily K; Rayner, Stephanie L; Lee, Albert; Laird, Angela S; Watchon, Maxinne; Winnick, Claire; Tarr, Ingrid S; Morsch, Marco; Fifita, Jennifer A; Gwee, Serene S L; Formella, Isabel; Hortle, Elinor; Yuan, Kristy C; Molloy, Mark P; Williams, Kelly L; Nicholson, Garth A; Chung, Roger S; Blair, Ian P; Cole, Nicholas J

2017-07-15

Amyotrophic lateral sclerosis (ALS) is a rapidly progressive, fatal neurodegenerative disease characterised by the death of upper and lower motor neurons. Approximately 10% of cases have a known family history of ALS and disease-linked mutations in multiple genes have been identified. ALS-linked mutations in CCNF were recently reported, however the pathogenic mechanisms associated with these mutations are yet to be established. To investigate possible disease mechanisms, we developed in vitro and in vivo models based on an ALS-linked missense mutation in CCNF. Proteomic analysis of the in vitro models identified the disruption of several cellular pathways in the mutant model, including caspase-3 mediated cell death. Transient overexpression of human CCNF in zebrafish embryos supported this finding, with fish expressing the mutant protein found to have increased levels of cleaved (activated) caspase-3 and increased cell death in the spinal cord. The mutant CCNF fish also developed a motor neuron axonopathy consisting of shortened primary motor axons and increased frequency of aberrant axonal branching. Importantly, we demonstrated a significant correlation between the severity of the CCNF-induced axonopathy and a reduced motor response to a light stimulus (photomotor response). This is the first report of an ALS-linked CCNF mutation in vivo and taken together with the in vitro model identifies the disruption of cell death pathways as a significant consequence of this mutation. Additionally, this study presents a valuable new tool for use in ongoing studies investigating the pathobiology of ALS-linked CCNF mutations. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

In vivo and in vitro functional characterization of Andersen's syndrome mutations.

PubMed

Bendahhou, Saïd; Fournier, Emmanuel; Sternberg, Damien; Bassez, Guillaume; Furby, Alain; Sereni, Carole; Donaldson, Matthew R; Larroque, Marie-Madeleine; Fontaine, Bertrand; Barhanin, Jacques

2005-06-15

The inward rectifier K(+) channel Kir2.1 carries all Andersen's syndrome mutations identified to date. Patients exhibit symptoms of periodic paralysis, cardiac dysrhythmia and multiple dysmorphic features. Here, we report the clinical manifestations found in three families with Andersen's syndrome. Molecular genetics analysis identified two novel missense mutations in the KCNJ2 gene leading to amino acid changes C154F and T309I of the Kir2.1 open reading frame. Patch clamp experiments showed that the two mutations produced a loss of channel function. When co-expressed with Kir2.1 wild-type (WT) channels, both mutations exerted a dominant-negative effect leading to a loss of the inward rectifying K(+) current. Confocal microscopy imaging in HEK293 cells is consistent with a co-assembly of the EGFP-fused mutant proteins with WT channels and proper traffick to the plasma membrane to produce silent channels alone or as hetero-tetramers with WT. Functional expression in C2C12 muscle cell line of newly as well as previously reported Andersen's syndrome mutations confirmed that these mutations act through a dominant-negative effect by altering channel gating or trafficking. Finally, in vivo electromyographic evaluation showed a decrease in muscle excitability in Andersen's syndrome patients. We hypothesize that Andersen's syndrome-associated mutations and hypokalaemic periodic paralysis-associated calcium channel mutations may lead to muscle membrane hypoexcitability via a common mechanism.

In vivo and in vitro functional characterization of Andersen's syndrome mutations

PubMed Central

Bendahhou, Saïd; Fournier, Emmanuel; Sternberg, Damien; Bassez, Guillaume; Furby, Alain; Sereni, Carole; Donaldson, Matthew R; Larroque, Marie-Madeleine; Fontaine, Bertrand; Barhanin, Jacques

2005-01-01

The inward rectifier K+ channel Kir2.1 carries all Andersen's syndrome mutations identified to date. Patients exhibit symptoms of periodic paralysis, cardiac dysrhythmia and multiple dysmorphic features. Here, we report the clinical manifestations found in three families with Andersen's syndrome. Molecular genetics analysis identified two novel missense mutations in the KCNJ2 gene leading to amino acid changes C154F and T309I of the Kir2.1 open reading frame. Patch clamp experiments showed that the two mutations produced a loss of channel function. When co-expressed with Kir2.1 wild-type (WT) channels, both mutations exerted a dominant-negative effect leading to a loss of the inward rectifying K+ current. Confocal microscopy imaging in HEK293 cells is consistent with a co-assembly of the EGFP-fused mutant proteins with WT channels and proper traffick to the plasma membrane to produce silent channels alone or as hetero-tetramers with WT. Functional expression in C2C12 muscle cell line of newly as well as previously reported Andersen's syndrome mutations confirmed that these mutations act through a dominant-negative effect by altering channel gating or trafficking. Finally, in vivo electromyographic evaluation showed a decrease in muscle excitability in Andersen's syndrome patients. We hypothesize that Andersen's syndrome-associated mutations and hypokalaemic periodic paralysis-associated calcium channel mutations may lead to muscle membrane hypoexcitability via a common mechanism. PMID:15831539

IgV(H) and bcl6 somatic mutation analysis reveals the heterogeneity of cutaneous B-cell lymphoma, and indicates the presence of undisclosed local antigens.

PubMed

Franco, Renato; Camacho, Francisca I; Fernández-Vázquez, Amalia; Algara, Patrocinio; Rodríguez-Peralto, José L; De Rosa, Gaetano; Piris, Miguel A

2004-06-01

Our understanding of the ontology of B-cell lymphomas (BCL) has been improved by the study of mutational status of IgV(H) and bcl6 genes, but only a few cases of cutaneous BCL have been examined for this status. We analyzed IgV(H) and bcl6 somatic mutations in 10 cutaneous BCL, classified as follicular (three primary and one secondary), primary marginal zone (two cases), and diffuse large BCL (three primary and one secondary). We observed a lower rate (<2%) of IgV(H) mutation in all marginal zone lymphomas, and a preferential usage of V(H)2-70 (one primary follicular and two primary diffuse large BCL). Fewer than expected replacement mutations in framework regions (FR) were observed in three primary follicular lymphomas (FLs) and in all diffuse large BCL, indicating a negative antigen selection pressure. Ongoing mutations were observed in eight of 10 cases. Only two primary FLs and two diffuse large BCL showed bcl6 somatic mutation. These data support the heterogeneous nature of the different cutaneous BCL, and specifically the distinction between cutaneous follicular and marginal zone lymphomas. The biased usage of V(H)2-70, the low rate of replacement mutation in the FR, and the presence of ongoing mutation imply that local antigens could modulate the growth of primary cutaneous BCL.

Molecular characterization of circulating colorectal tumor cells defines genetic signatures for individualized cancer care.

PubMed

Kong, Say Li; Liu, Xingliang; Suhaimi, Nur-Afidah Mohamed; Koh, Kenneth Jia Hao; Hu, Min; Lee, Daniel Yoke San; Cima, Igor; Phyo, Wai Min; Lee, Esther Xing Wei; Tai, Joyce A; Foong, Yu Miin; Vo, Jess Honganh; Koh, Poh Koon; Zhang, Tong; Ying, Jackie Y; Lim, Bing; Tan, Min-Han; Hillmer, Axel M

2017-09-15

Studies on circulating tumor cells (CTCs) have largely focused on platform development and CTC enumeration rather than on the genomic characterization of CTCs. To address this, we performed targeted sequencing of CTCs of colorectal cancer patients and compared the mutations with the matched primary tumors. We collected preoperative blood and matched primary tumor samples from 48 colorectal cancer patients. CTCs were isolated using a label-free microfiltration device on a silicon microsieve. Upon whole genome amplification, we performed amplicon-based targeted sequencing on a panel of 39 druggable and frequently mutated genes on both CTCs and fresh-frozen tumor samples. We developed an analysis pipeline to minimize false-positive detection of somatic mutations in amplified DNA. In 60% of the CTC-enriched blood samples, we detected primary tumor matching mutations. We found a significant positive correlation between the allele frequencies of somatic mutations detected in CTCs and abnormal CEA serum level. Strikingly, we found driver mutations and amplifications in cancer and druggable genes such as APC, KRAS, TP53, ERBB3 , FBXW7 and ERBB2 . In addition, we found that CTCs carried mutation signatures that resembled the signatures of their primary tumors. Cumulatively, our study defined genetic signatures and somatic mutation frequency of colorectal CTCs. The identification of druggable mutations in CTCs of preoperative colorectal cancer patients could lead to more timely and focused therapeutic interventions.

Molecular characterization of circulating colorectal tumor cells defines genetic signatures for individualized cancer care

PubMed Central

Kong, Say Li; Liu, Xingliang; Suhaimi, Nur-Afidah Mohamed; Koh, Kenneth Jia Hao; Hu, Min; Lee, Daniel Yoke San; Cima, Igor; Phyo, Wai Min; Lee, Esther Xing Wei; Tai, Joyce A.; Foong, Yu Miin; Vo, Jess Honganh; Koh, Poh Koon; Zhang, Tong; Ying, Jackie Y.; Lim, Bing; Tan, Min-Han; Hillmer, Axel M.

2017-01-01

Studies on circulating tumor cells (CTCs) have largely focused on platform development and CTC enumeration rather than on the genomic characterization of CTCs. To address this, we performed targeted sequencing of CTCs of colorectal cancer patients and compared the mutations with the matched primary tumors. We collected preoperative blood and matched primary tumor samples from 48 colorectal cancer patients. CTCs were isolated using a label-free microfiltration device on a silicon microsieve. Upon whole genome amplification, we performed amplicon-based targeted sequencing on a panel of 39 druggable and frequently mutated genes on both CTCs and fresh-frozen tumor samples. We developed an analysis pipeline to minimize false-positive detection of somatic mutations in amplified DNA. In 60% of the CTC-enriched blood samples, we detected primary tumor matching mutations. We found a significant positive correlation between the allele frequencies of somatic mutations detected in CTCs and abnormal CEA serum level. Strikingly, we found driver mutations and amplifications in cancer and druggable genes such as APC, KRAS, TP53, ERBB3, FBXW7 and ERBB2. In addition, we found that CTCs carried mutation signatures that resembled the signatures of their primary tumors. Cumulatively, our study defined genetic signatures and somatic mutation frequency of colorectal CTCs. The identification of druggable mutations in CTCs of preoperative colorectal cancer patients could lead to more timely and focused therapeutic interventions. PMID:28978093

Expression and Mutational Analysis of c-kit in Ovarian Surface Epithelial Tumors

PubMed Central

Lee, Myung-Hoon; Park, Tae-In; Bae, Han-Ik

2006-01-01

Coexpression of Kit ligand and c-kit has been reported in some gynecologic tumors. To determine whether imatinib mesylate is useful in ovarian epithelial tumors, we performed immunohistochemical and mutational analysis. The cases consisted of 33 cases, which included 13 serous cystadenocarcinomas, 1 borderline serous tumor, 8 mucinous cystadenocarcinomas, 6 borderline mucinous tumors and 5 clear cell carcinomas. Five cases of serous cystadenoma and 5 cases of mucinous cystadenoma were also included. In the immunohistochemical study, 3 cases (3/6, 50%) of borderline mucinous cystic tumor and two cases (2/8, 25%) of mucinous cystadenocarcinoma show positive staining for KIT protein. Only one case (1/13, 7.7%) of serous cystadenocarcinoma had positive staining. On mutational analysis, no mutation was identified at exon 11. However, two cases of borderline mucinous tumors and one case of mucinous cystadenocarcinoma had mutations at exon 17. In these cases, the immunohistochemistry also shows focal positive staining at epithelial component. Although, KIT protein expression showed higher incidence in mucinous tumors than serous tumors, they lack KIT-activating mutations in exon 11. Thus, ovarian surface epithelial tumors are unlikely to respond to imatinib mesylate. PMID:16479070

The Efficiency of Dentin Sialoprotein-Phosphophoryn Processing Is Affected by Mutations Both Flanking and Distant from the Cleavage Site*

PubMed Central

Yang, Robert T.; Lim, Glendale L.; Dong, Zhihong; Lee, Arthur M.; Yee, Colin T.; Fuller, Robert S.; Ritchie, Helena H.

2013-01-01

Normal dentin mineralization requires two highly acidic proteins, dentin sialoprotein (DSP) and phosphophoryn (PP). DSP and PP are synthesized as part of a single secreted precursor, DSP-PP, which is conserved in marsupial and placental mammals. Using a baculovirus expression system, we previously found that DSP-PP is accurately cleaved into DSP and PP after secretion into medium by an endogenous, secreted, zinc-dependent Sf9 cell activity. Here we report that mutation of conserved residues near and distant from the G447↓D448 cleavage site in DSP-PP240 had dramatic effects on cleavage efficiency by the endogenous Sf9 cell processing enzyme. We found that: 1) mutation of residues flanking the cleavage site from P4 to P4′ blocked, impaired, or enhanced DSP-PP240 cleavage; 2) certain conserved amino acids distant from the cleavage site were important for precursor cleavage; 3) modification of the C terminus by appending a C-terminal tag altered the pattern of processing; and 4) mutations in DSP-PP240 had similar effects on cleavage by recombinant human BMP1, a candidate physiological processing enzyme, as was seen with the endogenous Sf9 cell activity. An analysis of a partial TLR1 cDNA from Sf9 cells indicates that residues that line the substrate-binding cleft of Sf9 TLR1 and human BMP1 are nearly perfectly conserved, offering an explanation of why Sf9 cells so accurately process mammalian DSP-PP. The fact that several mutations in DSP-PP240 significantly modified the amount of PP240 product generated from DSP-PP240 precursor protein cleavage suggests that such mutation may affect the mineralization process. PMID:23297400

The efficiency of dentin sialoprotein-phosphophoryn processing is affected by mutations both flanking and distant from the cleavage site.

PubMed

Yang, Robert T; Lim, Glendale L; Dong, Zhihong; Lee, Arthur M; Yee, Colin T; Fuller, Robert S; Ritchie, Helena H

2013-02-22

Normal dentin mineralization requires two highly acidic proteins, dentin sialoprotein (DSP) and phosphophoryn (PP). DSP and PP are synthesized as part of a single secreted precursor, DSP-PP, which is conserved in marsupial and placental mammals. Using a baculovirus expression system, we previously found that DSP-PP is accurately cleaved into DSP and PP after secretion into medium by an endogenous, secreted, zinc-dependent Sf9 cell activity. Here we report that mutation of conserved residues near and distant from the G(447)↓D(448) cleavage site in DSP-PP(240) had dramatic effects on cleavage efficiency by the endogenous Sf9 cell processing enzyme. We found that: 1) mutation of residues flanking the cleavage site from P(4) to P(4)' blocked, impaired, or enhanced DSP-PP(240) cleavage; 2) certain conserved amino acids distant from the cleavage site were important for precursor cleavage; 3) modification of the C terminus by appending a C-terminal tag altered the pattern of processing; and 4) mutations in DSP-PP(240) had similar effects on cleavage by recombinant human BMP1, a candidate physiological processing enzyme, as was seen with the endogenous Sf9 cell activity. An analysis of a partial TLR1 cDNA from Sf9 cells indicates that residues that line the substrate-binding cleft of Sf9 TLR1 and human BMP1 are nearly perfectly conserved, offering an explanation of why Sf9 cells so accurately process mammalian DSP-PP. The fact that several mutations in DSP-PP(240) significantly modified the amount of PP(240) product generated from DSP-PP(240) precursor protein cleavage suggests that such mutation may affect the mineralization process.

Mutations in epigenetic regulators are involved in acute lymphoblastic leukemia relapse following allogeneic hematopoietic stem cell transplantation.

PubMed

Xiao, Haowen; Wang, Li-Mengmeng; Luo, Yi; Lai, Xiaoyu; Li, Caihua; Shi, Jimin; Tan, Yamin; Fu, Shan; Wang, Yebo; Zhu, Ni; He, Jingsong; Zheng, Weiyan; Yu, Xiaohong; Cai, Zhen; Huang, He

2016-01-19

Although steady improvements to chemotherapeutic treatments has helped cure 80% of childhood acute lymphoblastic leukemia (ALL) cases, chemotherapy has proven to be less effective in treating the majority of adult patients, leaving allogeneic hematopoietic stem cell transplantation (allo-HSCT) as the primary adult treatment option. Nevertheless relapse are the leading cause of death following allo-HSCT. The genetic pathogenesis of relapse following allo-HSCT in Philadelphia chromosome- negative ALL (Ph- ALL) remains unexplored. We performed longitudinal whole-exome sequencing analysis in three adult patients with Ph- B-cell ALL (Ph- B-ALL) on samples collected from diagnosis to relapse after allo-HSCT. Based on these data, we performed target gene sequencing on 23 selected genes in 58 adult patients undergoing allo-HSCT with Ph- B-ALL. Our results revealed a significant enrichment of mutations in epigenetic regulators from relapsed samples, with recurrent somatic mutations in SETD2, CREBBP, KDM6A and NR3C1. The relapsed samples were also enriched in signaling factor mutations, including KRAS, PTPN21, MYC and USP54. Furthermore, we are the first to reveal the clonal evolution patterns during leukemia relapse after allo-HSCT. Cells present in relapsed specimens were genetically related to the diagnosed tumor, these cells therefore arose from either an existing subclone that was not eradicated by allo-HSCT therapy, or from the same progenitor that acquired new mutations. In some cases, however, it is possible that leukemia recurrence following allo-HSCT could result from a secondary malignancy with a distinct set of mutations. We identified novel genetic causes of leukemia relapse after allo-HSCT using the largest generated data set to date from adult patients with Ph- B-ALL.

Mutations in epigenetic regulators are involved in acute lymphoblastic leukemia relapse following allogeneic hematopoietic stem cell transplantation

PubMed Central

Lai, Xiaoyu; Li, Caihua; Shi, Jimin; Tan, Yamin; Fu, Shan; Wang, Yebo; Zhu, Ni; He, Jingsong; Zheng, Weiyan; Yu, Xiaohong; Cai, Zhen; Huang, He

2016-01-01

Although steady improvements to chemotherapeutic treatments has helped cure 80% of childhood acute lymphoblastic leukemia (ALL) cases, chemotherapy has proven to be less effective in treating the majority of adult patients, leaving allogeneic hematopoietic stem cell transplantation (allo-HSCT) as the primary adult treatment option. Nevertheless relapse are the leading cause of death following allo-HSCT. The genetic pathogenesis of relapse following allo-HSCT in Philadelphia chromosome- negative ALL (Ph− ALL) remains unexplored. We performed longitudinal whole-exome sequencing analysis in three adult patients with Ph− B-cell ALL (Ph− B-ALL) on samples collected from diagnosis to relapse after allo-HSCT. Based on these data, we performed target gene sequencing on 23 selected genes in 58 adult patients undergoing allo-HSCT with Ph− B-ALL. Our results revealed a significant enrichment of mutations in epigenetic regulators from relapsed samples, with recurrent somatic mutations in SETD2, CREBBP, KDM6A and NR3C1. The relapsed samples were also enriched in signaling factor mutations, including KRAS, PTPN21, MYC and USP54. Furthermore, we are the first to reveal the clonal evolution patterns during leukemia relapse after allo-HSCT. Cells present in relapsed specimens were genetically related to the diagnosed tumor, these cells therefore arose from either an existing subclone that was not eradicated by allo-HSCT therapy, or from the same progenitor that acquired new mutations. In some cases, however, it is possible that leukemia recurrence following allo-HSCT could result from a secondary malignancy with a distinct set of mutations. We identified novel genetic causes of leukemia relapse after allo-HSCT using the largest generated data set to date from adult patients with Ph− B-ALL. PMID:26527318

Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.

PubMed

Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B

2018-05-23

TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.

Busulfan, Fludarabine, Donor Stem Cell Transplant, and Cyclophosphamide in Treating Patients With Multiple Myeloma or Myelofibrosis

ClinicalTrials.gov

2018-01-31

Anemia; ASXL1 Gene Mutation; EZH2 Gene Mutation; IDH1 Gene Mutation; IDH2 Gene Mutation; Plasma Cell Myeloma; Primary Myelofibrosis; Recurrent Plasma Cell Myeloma; Secondary Myelofibrosis; Thrombocytopenia

Male Hypogonadism and Germ Cell Loss Caused by a Mutation in Polo-Like Kinase 4

PubMed Central

Harris, Rebecca M.; Weiss, Jeffrey

2011-01-01

The genetic etiologies of male infertility remain largely unknown. To identify genes potentially involved in spermatogenesis and male infertility, we performed genome-wide mutagenesis in mice with N-ethyl-N-nitrosourea and identified a line with dominant hypogonadism and patchy germ cell loss. Genomic mapping and DNA sequence analysis identified a novel heterozygous missense mutation in the kinase domain of Polo-like kinase 4 (Plk4), altering an isoleucine to asparagine at residue 242 (I242N). Genetic complementation studies using a gene trap line with disruption in the Plk4 locus confirmed that the putative Plk4 missense mutation was causative. Plk4 is known to be involved in centriole formation and cell cycle progression. However, a specific role in mammalian spermatogenesis has not been examined. PLK4 was highly expressed in the testes both pre- and postnatally. In the adult, PLK4 expression was first detected in stage VIII pachytene spermatocytes and was present through step 16 elongated spermatids. Because the homozygous Plk4I242N/I242N mutation was embryonic lethal, all analyses were performed using the heterozygous Plk4+/I242N mice. Testis size was reduced by 17%, and histology revealed discrete regions of germ cell loss, leaving only Sertoli cells in these defective tubules. Testis cord formation (embryonic day 13.5) was normal. Testis histology was also normal at postnatal day (P)1, but germ cell loss was detected at P10 and subsequent ages. We conclude that the I242N heterozygous mutation in PLK4 is causative for patchy germ cell loss beginning at P10, suggesting a role for PLK4 during the initiation of spermatogenesis. PMID:21791561

Transcriptomic analysis and mutational status of IDH1 in paired primary-recurrent intrahepatic cholangiocarcinoma.

PubMed

Peraldo-Neia, C; Ostano, P; Cavalloni, G; Pignochino, Y; Sangiolo, D; De Cecco, L; Marchesi, E; Ribero, D; Scarpa, A; De Rose, A M; Giuliani, A; Calise, F; Raggi, C; Invernizzi, P; Aglietta, M; Chiorino, G; Leone, F

2018-06-05

Effective target therapies for intrahepatic cholangiocarcinoma (ICC) have not been identified so far. One of the reasons may be the genetic evolution from primary (PR) to recurrent (REC) tumors. We aim to identify peculiar characteristics and to select potential targets specific for recurrent tumors. Eighteen ICC paired PR and REC tumors were collected from 5 Italian Centers. Eleven pairs were analyzed for gene expression profiling and 16 for mutational status of IDH1. For one pair, deep mutational analysis by Next Generation Sequencing was also carried out. An independent cohort of patients was used for validation. Two class-paired comparison yielded 315 differentially expressed genes between REC and PR tumors. Up-regulated genes in RECs are involved in RNA/DNA processing, cell cycle, epithelial to mesenchymal transition (EMT), resistance to apoptosis, and cytoskeleton remodeling. Down-regulated genes participate to epithelial cell differentiation, proteolysis, apoptotic, immune response, and inflammatory processes. A 24 gene signature is able to discriminate RECs from PRs in an independent cohort; FANCG is statistically associated with survival in the chol-TCGA dataset. IDH1 was mutated in the RECs of five patients; 4 of them displayed the mutation only in RECs. Deep sequencing performed in one patient confirmed the IDH1 mutation in REC. RECs are enriched for genes involved in EMT, resistance to apoptosis, and cytoskeleton remodeling. Key players of these pathways might be considered druggable targets in RECs. IDH1 is mutated in 30% of RECs, becoming both a marker of progression and a target for therapy.

Transcriptional specificity in various p53-mutant cells.

PubMed

Okaichi, Kumio; Izumi, Nanaka; Takamura, Yuma; Fukui, Shoichi; Kudo, Takashi

2013-03-01

Mutation of the tumor suppressor gene p53 is the most common genetic alteration observed in human tumors. However, the relationship between the mutation point of p53 and the transcriptional specificity is not so obvious. We prepared Saos-2 cells with various mutations of p53 that are found in human tumors, and examined the resulting transcriptional alterations in the cells. Loss of function and gain of function were observed in all p53 mutants. Hot-spot mutations of p53 are frequently found in tumor cells. We compared hot-spot mutations and other mutations of p53 and found that a more than 2-fold transcription of CADPS2, PIWIL4 and TRIM9 was induced by hot spot mutations, but not by other mutations. As PIWIL4 suppresses the p16(INK4A) and ARF pathway, restraining cell growth and genomic instability, induction of PIWIL4 expression may be one reason why hot-spot mutations are frequently found in tumor cells.

Genome-Wide Mutation Avalanches Induced in Diploid Yeast Cells by a Base Analog or an APOBEC Deaminase

PubMed Central

Lada, Artem G.; Stepchenkova, Elena I.; Waisertreiger, Irina S. R.; Noskov, Vladimir N.; Dhar, Alok; Eudy, James D.; Boissy, Robert J.; Hirano, Masayuki; Rogozin, Igor B.; Pavlov, Youri I.

2013-01-01

Genetic information should be accurately transmitted from cell to cell; conversely, the adaptation in evolution and disease is fueled by mutations. In the case of cancer development, multiple genetic changes happen in somatic diploid cells. Most classic studies of the molecular mechanisms of mutagenesis have been performed in haploids. We demonstrate that the parameters of the mutation process are different in diploid cell populations. The genomes of drug-resistant mutants induced in yeast diploids by base analog 6-hydroxylaminopurine (HAP) or AID/APOBEC cytosine deaminase PmCDA1 from lamprey carried a stunning load of thousands of unselected mutations. Haploid mutants contained almost an order of magnitude fewer mutations. To explain this, we propose that the distribution of induced mutation rates in the cell population is uneven. The mutants in diploids with coincidental mutations in the two copies of the reporter gene arise from a fraction of cells that are transiently hypersensitive to the mutagenic action of a given mutagen. The progeny of such cells were never recovered in haploids due to the lethality caused by the inactivation of single-copy essential genes in cells with too many induced mutations. In diploid cells, the progeny of hypersensitive cells survived, but their genomes were saturated by heterozygous mutations. The reason for the hypermutability of cells could be transient faults of the mutation prevention pathways, like sanitization of nucleotide pools for HAP or an elevated expression of the PmCDA1 gene or the temporary inability of the destruction of the deaminase. The hypothesis on spikes of mutability may explain the sudden acquisition of multiple mutational changes during evolution and carcinogenesis. PMID:24039593

Tumor mutational load and immune parameters across metastatic Renal Cell Carcinoma (mRCC) risk groups

PubMed Central

de Velasco, Guillermo; Miao, Diana; Voss, Martin H.; Hakimi, A. Ari; Hsieh, James J.; Tannir, Nizar M.; Tamboli, Pheroze; Appleman, Leonard J.; Rathmell, W. Kimryn; Van Allen, Eliezer M.; Choueiri, Toni K.

2016-01-01

Patients with metastatic renal cell carcinoma (mRCC) have better overall survival when treated with nivolumab, a cancer immunotherapy that targets the immune checkpoint inhibitor programmed cell death 1 (PD-1), rather than everolimus (a chemical inhibitor of mTOR and immunosuppressant). Poor-risk mRCC patients treated with nivolumab seemed to experience the greatest overall survival benefit, compared to patients with favorable or intermediate-risk, in an analysis of the CheckMate-025 trial subgroup of the Memorial Sloan Kettering Cancer Center (MSKCC) prognostic risk groups. Here we explore whether tumor mutational load and RNA expression of specific immune parameters could be segregated by prognostic MSKCC risk strata and explain the survival seen in the poor-risk group. We queried whole exome transcriptome data in RCC patients (n = 54) included in The Cancer Genome Atlas that ultimately developed metastatic disease or were diagnosed with metastatic disease at presentation and did not receive immune checkpoint inhibitors. Nonsynonymous mutational load did not differ significantly by MSKCC risk group, nor was the expression of cytolytic genes –granzyme A and perforin – or selected immune checkpoint molecules different across MSKCC risk groups. In conclusion, this analysis found that mutational load and expression of markers of an active tumor microenvironment did not correlate with MSKCC risk prognostic classification in mRCC. PMID:27538576

Manifestations of Gorlin-Goltz syndrome.

PubMed

Larsen, Anne Kristine; Mikkelsen, Dorthe Bisgaard; Hertz, Jens Michael; Bygum, Anette

2014-05-01

Gorlin-Goltz syndrome is an uncommon hereditary condition caused by mutations in the PTCH1 gene causing a wide range of developmental abnormalities. Multiple basal cell carcinomas, palmoplantar pits and jaw cysts are cardinal features. Many clinicians are unfamiliar with the different manifestations and the fact that patients are especially sensitive to ionizing radiation. This was a retrospective analysis of patients with Gorlin-Goltz syndrome seen at the Department of Dermatology and Allergy Centre or at Department of Plastic Surgery, Odense University Hospital, Denmark, in the period from 1994 to 2013. A total of 17 patients from eight families fulfilled the diagnostic criteria. In all, 14 patients had basal cell carcinomas, 12 patients had jaw cysts and ten patients had calcification of the falx cerebri. Other clinical features were frontal bossing, kyphoscoliosis, rib anomalies, coalitio, cleft lip/palate, eye anomalies, milia and syndactyly. In one family, medulloblastoma and astrocytoma occurred. Traditional treatment principles of basal cell carcinomas were used including radiotherapy performed in six patients. PTCH1 mutations were identified in five families and none of these mutations had previously been described. The patient cohort illustrates classic and rare disease manifestations. It is necessary to remind clinicians that radiation therapy in Gorlin-Goltz syndrome is relatively contraindicated. Today, mutation analysis can be used for confirmation of the diagnosis and for predictive genetic testing. Patients should be offered genetic counselling and life-long surveillance. not relevant. not relevant.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

The CodY regulator is essential for virulence in Streptococcus suis serotype 2

PubMed Central

Feng, Liping; Zhu, Jiawen; Chang, Haitao; Gao, Xiaoping; Gao, Cheng; Wei, Xiaofeng; Yuan, Fangyan; Bei, Weicheng

2016-01-01

The main role of CodY, a global regulatory protein in most low G + C gram-positive bacteria, is in transcriptional repression. To study the functions of CodY in Streptococcus suis serotype 2 (S. suis 2), a mutant codY clone named ∆codY was constructed to explore the phenotypic variation between ∆codY and the wild-type strain. The result showed that the codY mutation significantly inhibited cell growth, adherence and invasion ability of S. suis 2 to HEp-2 cells. The codY mutation led to decreased binding of the pathogen to the host cells, easier clearance by RAW264.7 macrophages and decreased growth ability in fresh blood of Cavia porcellus. The codY mutation also attenuated the virulence of S. suis 2 in BALB/c mice. Morphological analysis revealed that the codY mutation decreased the thickness of the capsule of S. suis 2 and changed the surface structures analylized by SDS-PAGE. Finally, the codY mutation altered the expressions of many virulence related genes, including sialic acid synthesis genes, leading to a decreased sialic acid content in capsule. Overall, mutation of codY modulated bacterial virulence by affecting the growth and colonization of S. suis 2, and at least via regulating sialic acid synthesis and capsule thickness. PMID:26883762

Comparative analysis of charged particle-induced autosomal mutations in murine cells and tissues

NASA Astrophysics Data System (ADS)

Kronenberg, Amy; Gauny, Stacey; Turker, Mitchell; Dan, Cristian; Kwoh, Ely

Carcinogenesis requires the accumulation of mutations and most of these mutations of occur on autosomes. This study seeks to determine the effect of the tissue microenvironment on the frequency and types of autosomal mutations in epithelial cells exposed to the types of charged particles in space radiation environments. Epithelial cells are the principal cells at risk for the development of solid cancers in humans. Aprt heterozygous mice from a cross between C57BL/6 and DBA/2 mice (B6D2F1) are used for these studies. The tissue of interest here is the kidney. We evaluated the effects of Fe ion on cytotoxicity, mutant frequency, and mutant spectra in kidney epithelium exposed in vivo. In vitro studies use primary kidney clones from B6D2F1 mice. Animals or cells were exposed to graded doses (0-2 Gy) of 1 GeV/amu Fe ions at the NASA Space Radiation Laboratories at Brookhaven National Laboratory. Animals were given whole body exposure in plexiglas holders. Cells were irradiated in T-75 flasks as monolayers. Cytotoxicity for cells exposed as monolayers were performed immediately post-irradiation. In vitro mutation assays were performed after a 5-6 day expression period post-irradiation, at which time cells were seeded in standard medium supplemented with 2,6 diaminopurine to screen for Aprt mutants. Colony formation was assessed in parallel in standard medium. In contrast, mice were euthanized after 2-4 months post-irradiation (early) or 8-10 months post-irradiation (late) to determine the cytotoxic and mutagenic response to Fe ion irradiation. Once the kidneys were digested, the cytotoxicity and mutation assays were performed using the same methodology employed for cells in vitro. Individual Apr t mutant colonies were collected from separate flasks exposed in vitro to 2 Gy of Fe ions. A similar group of Aprt mutants were collected from separate, un-irradiated flasks Aprt mutant colonies were also collected from individual kidneys for un-irradiated mice and for mice exposed to 2 Gy of Fe ions. Mutant spectra were analyzed via PCR using a series of heterozygous markers along mouse chromosome 8. Cytotoxicity assays were performed immediately after Fe ion exposure of cells from two primary clones. Cells irradiated in vitro demonstrated a dose-dependent decrement in cloning efficiency with no evidence of a shoulder. The results demonstrate the two clones behave similarly (unpaired t-test, p>0.3) with a D0 of 84.3 cGy for the combined data set. Mutation data were obtained using cells from one of the primary clones. In three experiments, we observed a linear dose-response for Aprt mutation with an induced mutant frzction of 1.06 x 10-3 /Gy. Kidney epithelial cells irradiated in vivo and incubated for 2-4 months in situ prior to harvest also showed an exponential reduction of cloning efficiency. Cells harvested 8-10 months postirradiation showed evidence of recovery for doses up to 1.5 Gy, but there was no improvement in cloning efficiency for kidney cells exposed to 2 Gy Fe ions in vivo evaluated at the late time point. Results for Aprt mutation induction in vivo indicated considerable inter-animal variation within each dose group (0, 1.0, 1.5 and 2 Gy). Fe ion exposures were mutagenic to the kidney, even at the lowest dose (p<0.01). A comparison of the mutant frequency results at the two harvest times indicates that the dose response did not vary with incubation time in vivo. Analysis of the pooled data from the 2-4 months harvests and the 8-10 month harvests indicated an increase in mutant frequency of 1.49 fold per Gy (p=0.01, CI 1.11-2.01). Molecular analysis of Aprtdeficient cells collected after a 2 Gy exposure to Fe ions in vitro showed an increased proportion of mutants arising via interstitial deletion or mitotic recombination, with an indication of an increase in chromosome loss. Similar results have been obtained for Aprt mutants isolated from mice exposed to 2 Gy of Fe ions, as compared with mutants collected from sham-irradiated mice. Taken together, the results to date demonstrate that Fe ions are mutagenic to mouse kidney epithelium exposed in vitro assayed at short times post-irradiation and they are also mutagenic to kidney epithelium exposed in vivo. While cytotoxicity is somewhat ameliorated in vivo, toxicity was evident at the highest dose up to 8-10 months post-exposure. A comparison of the Aprt mutant frequency analyses (in vitro vs. in vivo) and mutation spectra analyses (in vitro vs. in vivo) reflect similar trends. Supported by NASA grant T-403X to A. Kronenberg.

Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

PubMed

Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

2018-01-10

Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Tissue or blood: which is more suitable for detection of EGFR mutations in non-small cell lung cancer?

PubMed

Biaoxue, Rong; Shuanying, Yang

2018-01-01

Many studies have evaluated the accuracy of EGFR mutation status in blood against that in tumor tissues as the reference. We conducted this systematic review and meta-analysis to assess whether blood can be used as a substitute for tumor tissue in detecting EGFR mutations. Investigations that provided data on EGFR mutation status in blood were searched in the databases of Medline, Embase, Ovid Technologies and Web of Science. The detect efficiency of EGFR mutations in paired blood and tissues was compared using a random-effects model of meta-analysis. Pooled sensitivity and specificity and diagnostic accuracy were calculated by receiver operating characteristic curve. A total of 19 studies with 2,922 individuals were involved in this meta-analysis. The pooled results showed the positive detection rate of EGFR mutations in lung cancer tissues was remarkably higher than that of paired blood samples (odds ratio [OR] = 1.47, p<0.001). The pooled sensitivity and specificity of blood were 0.65 and 0.91, respectively, and the area under the receiver operating characteristic curve was 0.89. Although blood had a better specificity for detecting EGFR mutations, the absence of blood positivity should not necessarily be construed as confirmed negativity. Patients with negative results for blood should decidedly undergo further biopsies to ascertain EGFR mutations.

Analysis of MSH3 in endometrial cancers with defective DNA mismatch repair.

PubMed

Swisher, E M; Mutch, D G; Herzog, T J; Rader, J S; Kowalski, L D; Elbendary, A; Goodfellow, P J

1998-01-01

To clarify the origin of defective mismatch repair (MMR) in sporadic endometrial cancers with microsatellite instability (MSI), a thorough mutation analysis was performed on the human mismatch repair gene MSH3. Twenty-eight MSI-positive endometrial cancers were investigated for mutations in the human mismatch repair gene MSH3 using single-strand conformation variant (SSCV) analysis of all 24 exons. All variants were sequenced. Loss of heterozygosity was investigated at all MSH3 polymorphisms discovered. A subset of tumors were investigated for methylation of the 5' promoter region of MSH3 using Southern blot hybridization. An identical single-base deletion (delta A) predicted to result in a truncated proteins was discovered in six tumors (21.4%). This deletion occurs in a string of eight consecutive adenosine residues (A8). Because simple repeat sequences are unstable in cells with defective MMR, the observed mutation may be an effect, rather than a cause, of MSI. Evidence of inactivation of the second MSH3 allele in tumors with the delta A mutation would strongly support a causal role for these MSH3 mutations. However, there was no evidence of a second mutation, loss of sequences, or methylation of the promoter region in any of the tumors with the delta A mutation. Although the delta A mutation is a frequent event in sporadic MSI-positive endometrial cancers, it may not be causally associated with defective DNA MMR.

A Homozygous Mutation in the Tight-Junction Protein JAM3 Causes Hemorrhagic Destruction of the Brain, Subependymal Calcification, and Congenital Cataracts

PubMed Central

Mochida, Ganeshwaran H.; Ganesh, Vijay S.; Felie, Jillian M.; Gleason, Danielle; Hill, R. Sean; Clapham, Katie Rose; Rakiec, Daniel; Tan, Wen-Hann; Akawi, Nadia; Al-Saffar, Muna; Partlow, Jennifer N.; Tinschert, Sigrid; Barkovich, A. James; Ali, Bassam; Al-Gazali, Lihadh; Walsh, Christopher A.

2010-01-01

The tight junction, or zonula occludens, is a specialized cell-cell junction that regulates epithelial and endothelial permeability, and it is an essential component of the blood-brain barrier in the cerebrovascular endothelium. In addition to functioning as a diffusion barrier, tight junctions are also involved in signal transduction. In this study, we identified a homozygous mutation in the tight-junction protein gene JAM3 in a large consanguineous family from the United Arab Emirates. Some members of this family had a rare autosomal-recessive syndrome characterized by severe hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Their clinical presentation overlaps with some reported cases of pseudo-TORCH syndrome as well as with cases involving mutations in occludin, another component of the tight-junction complex. However, massive intracranial hemorrhage distinguishes these patients from others. Homozygosity mapping identified the disease locus in this family on chromosome 11q25 with a maximum multipoint LOD score of 6.15. Sequence analysis of genes in the candidate interval uncovered a mutation in the canonical splice-donor site of intron 5 of JAM3. RT-PCR analysis of a patient lymphoblast cell line confirmed abnormal splicing, leading to a frameshift mutation with early termination. JAM3 is known to be present in vascular endothelium, although its roles in cerebral vasculature have not been implicated. Our results suggest that JAM3 is essential for maintaining the integrity of the cerebrovascular endothelium as well as for normal lens development in humans. PMID:21109224

Mutations in PTRH2 cause novel infantile-onset multisystem disease with intellectual disability, microcephaly, progressive ataxia, and muscle weakness.

PubMed

Hu, Hao; Matter, Michelle L; Issa-Jahns, Lina; Jijiwa, Mayumi; Kraemer, Nadine; Musante, Luciana; de la Vega, Michelle; Ninnemann, Olaf; Schindler, Detlev; Damatova, Natalia; Eirich, Katharina; Sifringer, Marco; Schrötter, Sandra; Eickholt, Britta J; van den Heuvel, Lambert; Casamina, Chanel; Stoltenburg-Didinger, Gisela; Ropers, Hans-Hilger; Wienker, Thomas F; Hübner, Christoph; Kaindl, Angela M

2014-12-01

To identify the cause of a so-far unreported phenotype of infantile-onset multisystem neurologic, endocrine, and pancreatic disease (IMNEPD). We characterized a consanguineous family of Yazidian-Turkish descent with IMNEPD. The two affected children suffer from intellectual disability, postnatal microcephaly, growth retardation, progressive ataxia, distal muscle weakness, peripheral demyelinating sensorimotor neuropathy, sensorineural deafness, exocrine pancreas insufficiency, hypothyroidism, and show signs of liver fibrosis. We performed whole-exome sequencing followed by bioinformatic analysis and Sanger sequencing on affected and unaffected family members. The effect of mutations in the candidate gene was studied in wild-type and mutant mice and in patient and control fibroblasts. In a consanguineous family with two individuals with IMNEPD, we identified a homozygous frameshift mutation in the previously not disease-associated peptidyl-tRNA hydrolase 2 (PTRH2) gene. PTRH2 encodes a primarily mitochondrial protein involved in integrin-mediated cell survival and apoptosis signaling. We show that PTRH2 is highly expressed in the developing brain and is a key determinant in maintaining cell survival during human tissue development. Moreover, we link PTRH2 to the mTOR pathway and thus the control of cell size. The pathology suggested by the human phenotype and neuroimaging studies is supported by analysis of mutant mice and patient fibroblasts. We report a novel disease phenotype, show that the genetic cause is a homozygous mutation in the PTRH2 gene, and demonstrate functional effects in mouse and human tissues. Mutations in PTRH2 should be considered in patients with undiagnosed multisystem neurologic, endocrine, and pancreatic disease.

CVID-associated TACI mutations affect autoreactive B cell selection and activation

PubMed Central

Romberg, Neil; Chamberlain, Nicolas; Saadoun, David; Gentile, Maurizio; Kinnunen, Tuure; Ng, Yen Shing; Virdee, Manmeet; Menard, Laurence; Cantaert, Tineke; Morbach, Henner; Rachid, Rima; Martinez-Pomar, Natalia; Matamoros, Nuria; Geha, Raif; Grimbacher, Bodo; Cerutti, Andrea; Cunningham-Rundles, Charlotte; Meffre, Eric

2013-01-01

Common variable immune deficiency (CVID) is an assorted group of primary diseases that clinically manifest with antibody deficiency, infection susceptibility, and autoimmunity. Heterozygous mutations in the gene encoding the tumor necrosis factor receptor superfamily member TACI are associated with CVID and autoimmune manifestations, whereas two mutated alleles prevent autoimmunity. To assess how the number of TACI mutations affects B cell activation and tolerance checkpoints, we analyzed healthy individuals and CVID patients carrying one or two TACI mutations. We found that TACI interacts with the cleaved, mature forms of TLR7 and TLR9 and plays an important role during B cell activation and the central removal of autoreactive B cells in healthy donors and CVID patients. However, only subjects with a single TACI mutation displayed a breached immune tolerance and secreted antinuclear antibodies (ANAs). These antibodies were associated with the presence of circulating B cell lymphoma 6–expressing T follicular helper (Tfh) cells, likely stimulating autoreactive B cells. Thus, TACI mutations may favor CVID by altering B cell activation with coincident impairment of central B cell tolerance, whereas residual B cell responsiveness in patients with one, but not two, TACI mutations enables autoimmune complications. PMID:24051380

S100A9+ MDSC and TAM-mediated EGFR-TKI resistance in lung adenocarcinoma: the role of RELB.

PubMed

Feng, Po-Hao; Yu, Chih-Teng; Chen, Kuan-Yuan; Luo, Ching-Shan; Wu, Shen Ming; Liu, Chien-Ying; Kuo, Lu Wei; Chan, Yao-Fei; Chen, Tzu-Tao; Chang, Chih-Cheng; Lee, Chun-Nin; Chuang, Hsiao-Chi; Lin, Chiou-Feng; Han, Chia-Li; Lee, Wei-Hwa; Lee, Kang-Yun

2018-01-26

Monocytic myeloid-derived suppressor cells (MDSCs), particularly the S100A9+ subset, has been shown initial clinical relevance. However, its role in EGFR-mutated lung adenocarcinoma, especially to EGFR-tyrosine kinase inhibitor (EGFR-TKI) is not clear. In a clinical setting of EGFR mutated lung adenocarcinoma, a role of the MDSC apart from T cell suppression was also investigated. Blood monocytic S100A9 + MDSC counts were higher in lung cancer patients than healthy donors, and were associated with poor treatment response and shorter progression-free survival (PFS). S100A9 + MDSCs in PBMC were well correlated to tumor infiltrating CD68 + and S100A9 + cells, suggesting an origin of TAMs. Patient's MDMs, mostly from S100A9 + MDSC, similar to primary alveolar macrophages from patients, both expressed S100A9 and CD206, attenuated EGFR-TKI cytotoxicity. Microarray analysis identified up-regulation of the RELB signaling genes, confirmed by Western blotting and functionally by RELB knockdown. In conclusion, blood S100A9 + MDSC is a predictor of poor treatment response to EGFR-TKI, possibly via its derived TAMs through activation of the non-canonical NF-κB RELB pathway. Patients with activating EGFR mutation lung adenocarcinoma receiving first line EGFR TKIs were prospectively enrolled. Peripheral blood mononuclear cells (PBMCs) were collected for MDSCs analysis and for monocyte-derived macrophages (MDMs) and stored tissue for TAM analysis by IHC. A transwell co-culture system of MDMs/macrophages and H827 cells was used to detect the effect of macrophages on H827 and microarray analysis to explore the underlying molecular mechanisms, functionally confirmed by RNA interference.

Clonal status of actionable driver events and the timing of mutational processes in cancer evolution

PubMed Central

McGranahan, Nicholas; Favero, Francesco; de Bruin, Elza C.; Birkbak, Nicolai Juul; Szallasi, Zoltan; Swanton, Charles

2015-01-01

Deciphering whether actionable driver mutations are found in all or a subset of tumor cells will likely be required to improve drug development and precision medicine strategies. We analyzed nine cancer types to determine the subclonal frequencies of driver events, to time mutational processes during cancer evolution, and to identify drivers of subclonal expansions. Although mutations in known driver genes typically occurred early in cancer evolution, we also identified later subclonal “actionable” mutations, including BRAF(V600E), IDH1(R132H), PIK3CA(E545K), EGFR(L858R), and KRAS(G12D), which may compromise the efficacy of targeted therapy approaches. More than 20% of IDH1 mutations in glioblastomas, and 15% of mutations in genes in the PI3K(phosphatidylinositol 3-kinase)–AKT–mTOR (mammalian target of rapamycin) signaling axis across all tumor types were subclonal. Mutations in the RAS–MEK (mitogen-activated protein kinase kinase) signaling axis were less likely to be subclonal than mutations in genes associated with PI3K-AKT-mTORsignaling. Analysis of late mutations revealed a link between APOBEC-mediated mutagenesis and the acquisition of subclonal driver mutations and uncovered putative cancer genes involved in subclonal expansions, including CTNNA2 and ATXN1. Our results provide a pan-cancer census of driver events within the context of intratumor heterogeneity and reveal patterns of tumor evolution across cancers. The frequent presence of subclonal driver mutations suggests the need to stratify targeted therapy response according to the proportion of tumor cells in which the driver is identified. PMID:25877892

HPV-negative penile squamous cell carcinoma: disruptive mutations in the TP53 gene are common.

PubMed

Kashofer, Karl; Winter, Elke; Halbwedl, Iris; Thueringer, Andrea; Kreiner, Marisa; Sauer, Stefan; Regauer, Sigrid

2017-07-01

The majority of penile squamous cell carcinomas is caused by transforming human papilloma virus (HPV) infection. The etiology of HPV-negative cancers is unclear, but TP53 mutations have been implicated. Archival tissues of 108 invasive squamous cell carcinoma from a single pathology institution in a low-incidence area were analyzed for HPV-DNA and p16 ink4a overexpression and for TP53 mutations by ion torrent next-generation sequencing. Library preparation failed in 32/108 squamous cell carcinomas. Institutional review board approval was obtained. Thirty of 76 squamous cell carcinomas (43%; average 63 years) were HPV-negative with 8/33 squamous cell carcinomas being TP53 wild-type (24%; average 63 years). Twenty-five of 33 squamous cell carcinomas (76%; average 65 years) showed 32 different somatic TP53 mutations (23 missense mutations in exons 5-8, 6 nonsense, 1 frameshift and 2 splice-site mutations). Several hotspot mutations were detected multiple times (R175H, R248, R282, and R273). Eighteen of 19 squamous cell carcinomas with TP53 expression in immunohistochemistry had TP53 mutations. Fifty percent of TP53-negative squamous cell carcinomas showed mostly truncating loss-of-function TP53 mutations. Patients without mutations had longer survival (5 years: 86% vs 61%; 10 years: 60% vs 22%), but valid clinically relevant conclusions cannot be drawn due to different tumor stages and heterogeneous treatment of the cases presented in this study. Somatic TP53 mutations are a common feature in HPV-negative penile squamous cell carcinomas and offer an explanation for HPV-independent penile carcinogenesis. About half of HPV-negative penile cancers are driven by oncogenic activation of TP53, while a quarter is induced by loss of TP53 tumor suppressor function. Detection of TP53 mutations should be carried out by sequencing, as immunohistochemical TP53 staining could not identify all squamous cell carcinomas with TP53 mutations.

Mutation of the NPM1 gene contributes to the development of donor cell-derived acute myeloid leukemia after unrelated cord blood transplantation for acute lymphoblastic leukemia.

PubMed

Rodríguez-Macías, Gabriela; Martínez-Laperche, Carolina; Gayoso, Jorge; Noriega, Víctor; Serrano, David; Balsalobre, Pascual; Muñoz-Martínez, Cristina; Díez-Martín, José L; Buño, Ismael

2013-08-01

Donor cell leukemia (DCL) is a rare but severe complication after allogeneic stem cell transplantation. Its true incidence is unknown because of a lack of correct recognition and reporting, although improvements in molecular analysis of donor-host chimerism are contributing to a better diagnosis of this complication. The mechanisms of leukemogenesis are unclear, and multiple factors can contribute to the development of DCL. In recent years, cord blood has emerged as an alternative source of hematopoietic progenitor cells, and at least 12 cases of DCL have been reported after unrelated cord blood transplantation. We report a new case of DCL after unrelated cord blood transplantation in a 44-year-old woman diagnosed as having acute lymphoblastic leukemia with t(1;19) that developed acute myeloid leukemia with normal karyotype and nucleophosmin (NPM1) mutation in donor cells. To our knowledge, this is the first report of NPM1 mutation contributing to DCL development. Copyright © 2013 Elsevier Inc. All rights reserved.

Combining magnetic sorting of mother cells and fluctuation tests to analyze genome instability during mitotic cell aging in Saccharomyces cerevisiae.

PubMed

Patterson, Melissa N; Maxwell, Patrick H

2014-10-16

Saccharomyces cerevisiae has been an excellent model system for examining mechanisms and consequences of genome instability. Information gained from this yeast model is relevant to many organisms, including humans, since DNA repair and DNA damage response factors are well conserved across diverse species. However, S. cerevisiae has not yet been used to fully address whether the rate of accumulating mutations changes with increasing replicative (mitotic) age due to technical constraints. For instance, measurements of yeast replicative lifespan through micromanipulation involve very small populations of cells, which prohibit detection of rare mutations. Genetic methods to enrich for mother cells in populations by inducing death of daughter cells have been developed, but population sizes are still limited by the frequency with which random mutations that compromise the selection systems occur. The current protocol takes advantage of magnetic sorting of surface-labeled yeast mother cells to obtain large enough populations of aging mother cells to quantify rare mutations through phenotypic selections. Mutation rates, measured through fluctuation tests, and mutation frequencies are first established for young cells and used to predict the frequency of mutations in mother cells of various replicative ages. Mutation frequencies are then determined for sorted mother cells, and the age of the mother cells is determined using flow cytometry by staining with a fluorescent reagent that detects bud scars formed on their cell surfaces during cell division. Comparison of predicted mutation frequencies based on the number of cell divisions to the frequencies experimentally observed for mother cells of a given replicative age can then identify whether there are age-related changes in the rate of accumulating mutations. Variations of this basic protocol provide the means to investigate the influence of alterations in specific gene functions or specific environmental conditions on mutation accumulation to address mechanisms underlying genome instability during replicative aging.

Expedited quantification of mutant ribosomal RNA by binary deoxyribozyme (BiDz) sensors.

PubMed

Gerasimova, Yulia V; Yakovchuk, Petro; Dedkova, Larisa M; Hecht, Sidney M; Kolpashchikov, Dmitry M

2015-10-01

Mutations in ribosomal RNA (rRNA) have traditionally been detected by the primer extension assay, which is a tedious and multistage procedure. Here, we describe a simple and straightforward fluorescence assay based on binary deoxyribozyme (BiDz) sensors. The assay uses two short DNA oligonucleotides that hybridize specifically to adjacent fragments of rRNA, one of which contains a mutation site. This hybridization results in the formation of a deoxyribozyme catalytic core that produces the fluorescent signal and amplifies it due to multiple rounds of catalytic action. This assay enables us to expedite semi-quantification of mutant rRNA content in cell cultures starting from whole cells, which provides information useful for optimization of culture preparation prior to ribosome isolation. The method requires less than a microliter of a standard Escherichia coli cell culture and decreases analysis time from several days (for primer extension assay) to 1.5 h with hands-on time of ∼10 min. It is sensitive to single-nucleotide mutations. The new assay simplifies the preliminary analysis of RNA samples and cells in molecular biology and cloning experiments and is promising in other applications where fast detection/quantification of specific RNA is required. © 2015 Gerasimova et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Insights into the pathogenesis of dominant retinitis pigmentosa associated with a D477G mutation in RPE65.

PubMed

Choi, Elliot H; Suh, Susie; Sander, Christopher L; Hernandez, Christian J Ortiz; Bulman, Elizabeth R; Khadka, Nimesh; Dong, Zhiqian; Shi, Wuxian; Palczewski, Krzysztof; Kiser, Philip D

2018-04-12

RPE65 is the essential trans-cis isomerase of the classical retinoid (visual) cycle. Mutations in RPE65 give rise to severe retinal dystrophies, most of which are associated with loss of protein function and recessive inheritance. The only known exception is a c.1430G>A (D477G) mutation that gives rise to dominant retinitis pigmentosa with delayed onset and choroidal and macular involvement. Position 477 is distant from functionally critical regions of RPE65. Hence, the mechanism of D477G pathogenicity remains unclear, although protein misfolding and aggregation mechanisms have been suggested. We characterized a D477G knock-in mouse model which exhibited mild age-dependent changes in retinal structure and function. Immunoblot analysis of protein extracts from the eyes of the knock-in mice demonstrated the presence of ubiquitinated RPE65 and reduced RPE65 expression. We observed an accumulation of retinyl esters in the knock-in mice as well as a delay in rhodopsin regeneration kinetics and diminished electroretinography responses, indicative of RPE65 functional impairment induced by the D477G mutation in vivo. However, a cell line expressing D477G RPE65 revealed protein expression levels, cellular localization, and retinoid isomerase activity comparable to cells expressing wild-type protein. Structural analysis of an RPE65 chimera suggested that the D477G mutation does not perturb protein folding or tertiary structure. Instead, the mutation generates an aggregation-prone surface that could induce cellular toxicity through abnormal complex formation as suggested by crystal packing analysis. These results indicate that a toxic gain-of-function induced by the D477G RPE65 substitution may play a role in the pathogenesis of this form of dominant retinitis pigmentosa.

Triple Gene Analysis Using Samples Obtained by Endobronchial Ultrasound-guided Transbronchial Needle Aspiration

PubMed Central

Lee, Kyungjong; Um, Sang-Won; Jeong, Byeong-Ho; Yang, Jung Wook; Choi, Yoon-La; Han, Joungho; Kim, Hojoong; Kwon, O Jung

2016-01-01

Objective A mutational analysis of tumor tissue samples is an important part of advanced lung cancer treatment strategies. This study evaluated the efficacy of a triple gene analysis using samples obtained via endobronchial ultrasound-guided transbronchial needle aspiration (EBUS-TBNA). Methods Either metastatic lymph nodes or primary lung mass samples obtained by EBUS-TBNA were collected between May 2011 and May 2013. We consecutively analyzed epidermal growth factor receptor (EGFR), V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), and anaplastic lymphoma kinase (ALK) fusion genes using remnant tissue samples. Results A total of 109 patients were diagnosed with non-small cell lung cancer (NSCLC). Of these, 70% were adenocarcinoma, 27% squamous cell carcinoma with NSCLC, and 3% were related to other types of lung cancer. EGFR mutations were detected in 23 cases (21.1%), KRAS mutations in 13 cases (11.9%), and ALK fusion genes in 5 cases (4.9%). The ALK fusion genes could not be analyzed in four cases because of insufficient tissue samples remaining after routine histochemistry and an EGFR/KRAS mutation analysis. We found that small biopsy samples from EBUS-TBNA were adequate for performing a triple gene analysis in 97 patients (96%). ALK fusion protein immunohistochemistry (IHC) was 100% consistent with fluorescence in situ hybridization (FISH). Conclusion Small samples obtained by EBUS-TBNA were found to be sufficient for performing a triple gene analysis following routine histology and IHC. ALK IHC showed a very good concordance with FISH for detecting ALK fusion genes. PMID:27803402

Clinical features and treatment outcome of non-small cell lung cancer (NSCLC) patients with uncommon or complex epidermal growth factor receptor (EGFR) mutations

PubMed Central

Fassan, Matteo; Indraccolo, Stefano; Calabrese, Fiorella; Favaretto, Adolfo; Bonanno, Laura; Polo, Valentina; Zago, Giulia; Lunardi, Francesca; Attili, Ilaria; Pavan, Alberto; Rugge, Massimo; Guarneri, Valentina; Conte, PierFranco; Pasello, Giulia

2017-01-01

Introduction Tyrosine-kinase inhibitors (TKIs) represent the best treatment for advanced non-small cell lung cancer (NSCLC) with common exon 19 deletion or exon 21 epidermal growth factor receptor mutation (EGFRm). This is an observational study investigating epidemiology, clinical features and treatment outcome of NSCLC cases harbouring rare/complex EGFRm. Results Among 764 non-squamous NSCLC cases with known EGFRm status, 26(3.4%) harboured rare/complex EGFRm. Patients receiving first-line TKIs (N = 17) achieved median Progression Free Survival (PFS) and Overall Survival (OS) of 53 (IC 95%, 2–105) and 84 (CI 95%, 27–141) weeks respectively, without significant covariate impact. Response Rate and Disease Control Rate (DCR) were 47% and 65%, respectively. Uncommon exon 19 mutations achieved longer OS and PFS and higher DCR compared with exon 18 and 20 mutations. No additional gene mutation was discovered by MassARRAY analysis. TKIs were globally well tolerated. Materials and methods A retrospective review of advanced non-squamous NSCLC harbouring rare/complex EGFRm referred to our Center between 2010 and 2015 was performed. Additional molecular pathways disregulation was explored in selected cases, through MassARRAY analysis. Conclusions Peculiar clinical features and lower TKIs sensitivity of uncommon/complex compared with common EGFRm were shown. Exon 19 EGFRm achieved the best TKIs treatment outcome, while the optimal treatment of exon 18 and 20 mutations should be further clarified. PMID:28427238

Molecular profiling of single circulating tumor cells from lung cancer patients.

PubMed

Park, Seung-Min; Wong, Dawson J; Ooi, Chin Chun; Kurtz, David M; Vermesh, Ophir; Aalipour, Amin; Suh, Susie; Pian, Kelsey L; Chabon, Jacob J; Lee, Sang Hun; Jamali, Mehran; Say, Carmen; Carter, Justin N; Lee, Luke P; Kuschner, Ware G; Schwartz, Erich J; Shrager, Joseph B; Neal, Joel W; Wakelee, Heather A; Diehn, Maximilian; Nair, Viswam S; Wang, Shan X; Gambhir, Sanjiv S

2016-12-27

Circulating tumor cells (CTCs) are established cancer biomarkers for the "liquid biopsy" of tumors. Molecular analysis of single CTCs, which recapitulate primary and metastatic tumor biology, remains challenging because current platforms have limited throughput, are expensive, and are not easily translatable to the clinic. Here, we report a massively parallel, multigene-profiling nanoplatform to compartmentalize and analyze hundreds of single CTCs. After high-efficiency magnetic collection of CTC from blood, a single-cell nanowell array performs CTC mutation profiling using modular gene panels. Using this approach, we demonstrated multigene expression profiling of individual CTCs from non-small-cell lung cancer (NSCLC) patients with remarkable sensitivity. Thus, we report a high-throughput, multiplexed strategy for single-cell mutation profiling of individual lung cancer CTCs toward minimally invasive cancer therapy prediction and disease monitoring.

RNA sequencing-based cell proliferation analysis across 19 cancers identifies a subset of proliferation-informative cancers with a common survival signature.

PubMed

Ramaker, Ryne C; Lasseigne, Brittany N; Hardigan, Andrew A; Palacio, Laura; Gunther, David S; Myers, Richard M; Cooper, Sara J

2017-06-13

Despite advances in cancer diagnosis and treatment strategies, robust prognostic signatures remain elusive in most cancers. Cell proliferation has long been recognized as a prognostic marker in cancer, but the generation of comprehensive, publicly available datasets allows examination of the links between cell proliferation and cancer characteristics such as mutation rate, stage, and patient outcomes. Here we explore the role of cell proliferation across 19 cancers (n = 6,581 patients) by using tissue-based RNA sequencing data from The Cancer Genome Atlas Project and calculating a 'proliferative index' derived from gene expression associated with Proliferating Cell Nuclear Antigen (PCNA) levels. This proliferative index is significantly associated with patient survival (Cox, p-value < 0.05) in 7 of 19 cancers, which we have defined as "proliferation-informative cancers" (PICs). In PICs, the proliferative index is strongly correlated with tumor stage and nodal invasion. PICs demonstrate reduced baseline expression of proliferation machinery relative to non-PICs. Additionally, we find the proliferative index is significantly associated with gross somatic mutation burden (Spearman, p = 1.76 x 10-23) as well as with mutations in individual driver genes. This analysis provides a comprehensive characterization of tumor proliferation indices and their association with disease progression and prognosis in multiple cancer types and highlights specific cancers that may be particularly susceptible to improved targeting of this classic cancer hallmark.

Spontaneous Mutation at Amino Acid 544 of the Ebola Virus Glycoprotein Potentiates Virus Entry and Selection in Tissue Culture

PubMed Central

Ladner, Jason T.; Ettinger, Chelsea R.; Palacios, Gustavo

2017-01-01

ABSTRACT Ebolaviruses have a surface glycoprotein (GP1,2) that is required for virus attachment and entry into cells. Mutations affecting GP1,2 functions can alter virus growth properties. We generated a recombinant vesicular stomatitis virus encoding Ebola virus Makona variant GP1,2 (rVSV-MAK-GP) and observed emergence of a T544I mutation in the Makona GP1,2 gene during tissue culture passage in certain cell lines. The T544I mutation emerged within two passages when VSV-MAK-GP was grown on Vero E6, Vero, and BS-C-1 cells but not when it was passaged on Huh7 and HepG2 cells. The mutation led to a marked increase in virus growth kinetics and conferred a robust growth advantage over wild-type rVSV-MAK-GP on Vero E6 cells. Analysis of complete viral genomes collected from patients in western Africa indicated that this mutation was not found in Ebola virus clinical samples. However, we observed the emergence of T544I during serial passage of various Ebola Makona isolates on Vero E6 cells. Three independent isolates showed emergence of T544I from undetectable levels in nonpassaged virus or virus passaged once to frequencies of greater than 60% within a single passage, consistent with it being a tissue culture adaptation. Intriguingly, T544I is not found in any Sudan, Bundibugyo, or Tai Forest ebolavirus sequences. Furthermore, T544I did not emerge when we serially passaged recombinant VSV encoding GP1,2 from these ebolaviruses. This report provides experimental evidence that the spontaneous mutation T544I is a tissue culture adaptation in certain cell lines and that it may be unique for the species Zaire ebolavirus. IMPORTANCE The Ebola virus (Zaire) species is the most lethal species of all ebolaviruses in terms of mortality rate and number of deaths. Understanding how the Ebola virus surface glycoprotein functions to facilitate entry in cells is an area of intense research. Recently, three groups independently identified a polymorphism in the Ebola glycoprotein (I544) that enhanced virus entry, but they did not agree in their conclusions regarding its impact on pathogenesis. Our findings here address the origins of this polymorphism and provide experimental evidence showing that it is the result of a spontaneous mutation (T544I) specific to tissue culture conditions, suggesting that it has no role in pathogenesis. We further show that this mutation may be unique to the species Zaire ebolavirus, as it does not occur in Sudan, Bundibugyo, and Tai Forest ebolaviruses. Understanding the mechanism behind this mutation can provide insight into functional differences that exist in culture conditions and among ebolavirus glycoproteins. PMID:28539437

Investigating Novel Resistance Mechanisms to Third-Generation EGFR Tyrosine Kinase Inhibitor Osimertinib in Non-Small Cell Lung Cancer Patients.

PubMed

Yang, Zhe; Yang, Nong; Ou, Qiuxiang; Xiang, Yi; Jiang, Tao; Wu, Xue; Bao, Hua; Tong, Xiaoling; Wang, Xiaonan; Shao, Yang W; Liu, Yunpeng; Wang, Yan; Zhou, Caicun

2018-03-05

Background: The third-generation EGFR tyrosine kinase inhibitor osimertinib is approved to treat patients with EGFR T790M-positive non-small cell lung cancer (NSCLC) who have developed resistance to earlier-generation drugs. Acquired EGFR C797S mutation has been reported to mediate osimertinib resistance in some patients. However, the remaining resistance mechanisms are largely unknown. Methods: We performed mutation profiling using targeted next-generation sequencing (NGS) for 416 cancer-relevant genes on 93 osimertinib-resistant lung cancer patients' samples, mainly cell-free DNAs (cfDNAs), and matched pretreatment samples of 12 patients. In vitro experiments were conducted to functionally study the secondary EGFR mutations identified. Results: EGFR G796/C797, L792, and L718/G719 mutations were identified in 24.7%, 10.8%, and 9.7% of the cases, respectively, with certain mutations coexisting in one patient with different prevalence. L792 and L718 mutants markedly increased the half inhibitory concentration (IC 50 ) of osimertinib in vitro , among which the L718Q mutation conferred the greatest resistance to osimertinib, as well as gefitinib resistance when not coexisting with T790M. Further analysis of the 12 matched pretreatment samples confirmed that these EGFR mutations were acquired during osimertinib treatment. Alterations in parallel or downstream oncogenes such as MET, KRAS , and PIK3CA were also discovered, potentially contributing to the osimertinib-resistance in patients without EGFR secondary mutations. Conclusions: We present comprehensive mutation profiles of a large cohort of osimertinib-resistance lung cancer patients using mainly cfDNA. Besides C797 mutations, novel secondary mutations of EGFR L718 and L792 residues confer osimertinib resistance, both in vitro and in vivo , and are of great clinical and pharmaceutical relevance. Clin Cancer Res; 1-11. ©2018 AACR. ©2018 American Association for Cancer Research.

POLE proofreading mutations elicit an anti-tumor immune response in endometrial cancer

PubMed Central

van Gool, Inge C; Eggink, Florine A; Freeman-Mills, Luke; Stelloo, Ellen; Marchi, Emanuele; de Bruyn, Marco; Palles, Claire; Nout, Remi A; de Kroon, Cor D; Osse, Elisabeth M; Klenerman, Paul; Creutzberg, Carien L; Tomlinson, Ian PM; Smit, Vincent THBM; Nijman, Hans W

2015-01-01

Purpose Recent studies have shown that 7-12% of endometrial cancers (ECs) are ultramutated due to somatic mutation in the proofreading exonuclease domain of the DNA replicase POLE. Interestingly, these tumors have an excellent prognosis. In view of the emerging data linking mutation burden, immune response and clinical outcome in cancer, we investigated whether POLE-mutant ECs showed evidence of increased immunogenicity. Experimental design We examined immune infiltration and activation according to tumor POLE proofreading mutation in a molecularly defined EC cohort including 47 POLE-mutant tumors. We sought to confirm our results by analysis of RNAseq data from the TCGA EC series and used the same series to examine whether differences in immune infiltration could be explained by an enrichment of immunogenic neoepitopes in POLE-mutant ECs. Results Compared to other ECs, POLE-mutants displayed an enhanced cytotoxic T cell response, evidenced by increased numbers of CD8+ tumor infiltrating lymphocytes and CD8A expression, enrichment for a tumor-infiltrating T cell gene signature, and strong upregulation of the T cell cytotoxic differentiation and effector markers T-bet, Eomes, IFNG, PRF and granzyme B. This was accompanied by upregulation of T cell exhaustion markers, consistent with chronic antigen exposure. In-silico analysis confirmed that POLE-mutant cancers are predicted to display more antigenic neo-epitopes than other ECs, providing a potential explanation for our findings. Conclusions Ultramutated POLE proofreading-mutant ECs are characterized by a robust intratumoral T cell response, which correlates with, and may be caused by an enrichment of antigenic neo-peptides. Our study provides a plausible mechanism for the excellent prognosis of these cancers. PMID:25878334

POLE Proofreading Mutations Elicit an Antitumor Immune Response in Endometrial Cancer.

PubMed

van Gool, Inge C; Eggink, Florine A; Freeman-Mills, Luke; Stelloo, Ellen; Marchi, Emanuele; de Bruyn, Marco; Palles, Claire; Nout, Remi A; de Kroon, Cor D; Osse, Elisabeth M; Klenerman, Paul; Creutzberg, Carien L; Tomlinson, Ian Pm; Smit, Vincent Thbm; Nijman, Hans W; Bosse, Tjalling; Church, David N

2015-07-15

Recent studies have shown that 7% to 12% of endometrial cancers are ultramutated due to somatic mutation in the proofreading exonuclease domain of the DNA replicase POLE. Interestingly, these tumors have an excellent prognosis. In view of the emerging data linking mutation burden, immune response, and clinical outcome in cancer, we investigated whether POLE-mutant endometrial cancers showed evidence of increased immunogenicity. We examined immune infiltration and activation according to tumor POLE proofreading mutation in a molecularly defined endometrial cancer cohort including 47 POLE-mutant tumors. We sought to confirm our results by analysis of RNAseq data from the TCGA endometrial cancer series and used the same series to examine whether differences in immune infiltration could be explained by an enrichment of immunogenic neoepitopes in POLE-mutant endometrial cancers. Compared with other endometrial cancers, POLE mutants displayed an enhanced cytotoxic T-cell response, evidenced by increased numbers of CD8(+) tumor-infiltrating lymphocytes and CD8A expression, enrichment for a tumor-infiltrating T-cell gene signature, and strong upregulation of the T-cell cytotoxic differentiation and effector markers T-bet, Eomes, IFNG, PRF, and granzyme B. This was accompanied by upregulation of T-cell exhaustion markers, consistent with chronic antigen exposure. In silico analysis confirmed that POLE-mutant cancers are predicted to display more antigenic neoepitopes than other endometrial cancers, providing a potential explanation for our findings. Ultramutated POLE proofreading-mutant endometrial cancers are characterized by a robust intratumoral T-cell response, which correlates with, and may be caused by an enrichment of antigenic neopeptides. Our study provides a plausible mechanism for the excellent prognosis of these cancers. ©2015 American Association for Cancer Research.

Molecular Diagnostics in Colorectal Carcinoma: Advances and Applications for 2018.

PubMed

Bhalla, Amarpreet; Zulfiqar, Muhammad; Bluth, Martin H

2018-06-01

The molecular pathogenesis and classification of colorectal carcinoma are based on the traditional adenomaecarcinoma sequence, serrated polyp pathway, and microsatellite instability (MSI). The genetic basis for hereditary nonpolyposis colorectal cancer is the detection of mutations in the MLH1, MSH2, MSH6, PMS2, and EPCAM genes. Genetic testing for Lynch syndrome includes MSI testing, methylator phenotype testing, BRAF mutation testing, and molecular testing for germline mutations in MMR genes. Molecular makers with predictive and prognostic implications include quantitative multigene reverse transcriptase polymerase chain reaction assay and KRAS and BRAF mutation analysis. Mismatch repair-deficient tumors have higher rates of programmed death-ligand 1 expression. Cell-free DNA analysis in fluids are proving beneficial for diagnosis and prognosis in these disease states towards effective patient management. Copyright © 2018 Elsevier Inc. All rights reserved.

K-ras mutations and HLA-DR expression in large bowel adenomas.

PubMed Central

Norheim Andersen, S.; Breivik, J.; Løvig, T.; Meling, G. I.; Gaudernack, G.; Clausen, O. P.; Schjölberg, A.; Fausa, O.; Langmark, F.; Lund, E.; Rognum, T. O.

1996-01-01

A total of 72 sporadic colorectal adenomas in 56 patients were studied for the presence of point mutations in codons 12 and 13 of the K-ras gene and for HLA-DR antigen expression related to clinicopathological variables. Forty K-ras mutations in 39 adenomas were found (54%): 31 (77%) in codon 12 and nine (23%) in codon 13. There was a strong relationship between the incidence of K-ras mutations and adenoma type, degree of dysplasia and sex. The highest frequency of K-ras mutations was seen in large adenomas of the villous type with high-grade dysplasia. Fourteen out of 15 adenomas obtained from 14 women above 65 years of age carried mutations. HLA-DR positivity was found in 38% of the adenomas, large tumours and those with high-grade dysplasia having the strongest staining. Coexpression of K-ras mutations and HLA-DR was found significantly more frequently in large and highly dysplastic adenomas, although two-way analysis of variance showing size and grade of dysplasia to be the most important variable. None of the adenomas with low-grade dysplasia showed both K-ras mutation and HLA-DR positivity (P = 0.004). K-ras mutation is recognised as an early event in colorectal carcinogenesis. The mutation might give rise to peptides that may be presented on the tumour cell surface by class II molecules, and thereby induce immune responses against neoplastic cells. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8679466

EGFR mutation detection in circulating cell-free DNA of lung adenocarcinoma patients: analysis of LUX-Lung 3 and 6

PubMed Central

Wu, Yi-Long; Sequist, Lecia V; Hu, Cheng-Ping; Feng, Jifeng; Lu, Shun; Huang, Yunchao; Li, Wei; Hou, Mei; Schuler, Martin; Mok, Tony; Yamamoto, Nobuyuki; O'Byrne, Kenneth; Hirsh, Vera; Gibson, Neil; Massey, Dan; Kim, Miyoung; Yang, James Chih-Hsin

2017-01-01

Background: In the Phase III LUX-Lung 3/6 (LL3/LL6) trials in epidermal growth factor receptor (EGFR) mutation-positive lung adenocarcinoma patients, we evaluated feasibility of EGFR mutation detection using circulating cell-free DNA (cfDNA) and prognostic and predictive utility of cfDNA positivity (cfDNA+). Methods: Paired tumour and blood samples were prospectively collected from randomised patients. Mutations were detected using cfDNA from serum (LL3) or plasma (LL6) by a validated allele-specific quantitative real-time PCR kit. Results: EGFR mutation detection rates in cfDNA were 28.6% (serum) and 60.5% (plasma). Mutation detection in blood was associated with advanced disease characteristics, including higher performance score, number of metastatic sites and bone/liver metastases, and poorer prognosis. In patients with common EGFR mutations, afatinib improved progression-free survival vs chemotherapy in cfDNA+ (LL3: HR, 0.35; P=0.0009; LL6: HR, 0.25; P<0.0001) and cfDNA− (LL3: HR, 0.46; P<0.0001; LL6: HR, 0.12; P<0.0001) cohorts. A trend towards overall survival benefit with afatinib was observed in cfDNA+ patients. Conclusions: Plasma cfDNA is a promising alternative to biopsy for EGFR testing. Detectable mutation in blood was associated with more advanced disease and poorer prognosis. Afatinib improved outcomes in EGFR mutation-positive patients regardless of blood mutation status. PMID:28006816

A Comparison between CHEK2*1100delC/I157T Mutation Carrier and Noncarrier Breast Cancer Patients: A Clinicopathological Analysis.

PubMed

Huszno, Joanna; Budryk, Magdalena; Kołosza, Zofia; Tęcza, Karolina; Pamuła Piłat, Jolanta; Nowara, Elżbieta; Grzybowska, Ewa

2016-01-01

The suppressor gene CHEK2 encodes a cell cycle checkpoint kinase, involved in cell cycle regulation, apoptosis and response to DNA damage. The aim of this study was to analyze the differences between CHEK2 mutation carriers (CHEK2*1100delC/I157T) and noncarriers with respect to clinicopathological factors. We reviewed the medical records of 100 early breast cancer patients (46 mutation carriers and 54 noncarriers) who were treated with chemotherapy, hormonotherapy or trastuzumab. CHEK2 mutation carriers were older (>65 years) than noncarriers (17 vs. 7%; p = 0.215). Twenty-five (54%) of them had a history of cancer in the family. Gastric cancer in the family history was detected in 11% of mutation carriers and in 2% of noncarriers (p = 0.092). There was a trend for more frequent lymph node metastases in patients without the mutation in comparison to mutation carriers (46 vs. 28%; p = 0.098). Luminal B type breast cancer was detected more often in carriers (39 vs. 20%; p = 0.048). Breast-conserving treatment was also conducted more often in mutation carriers (57 vs. 31%; p = 0.015). Histologic grades G1/G2 were detected more frequently in mutation carriers (82 vs. 70%; p = 0.212). Mutation carriers were characterized by older age, a history of gastric cancer in the family, locally advanced disease, lower histologic grade and luminal B type breast cancer. © 2016 S. Karger AG, Basel.

Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation.

PubMed

Harms, Paul W; Collie, Angela M B; Hovelson, Daniel H; Cani, Andi K; Verhaegen, Monique E; Patel, Rajiv M; Fullen, Douglas R; Omata, Kei; Dlugosz, Andrzej A; Tomlins, Scott A; Billings, Steven D

2016-03-01

Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin 20 (CK20) is expressed in ~95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small-cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (10 Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high-confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping genetic changes with CK20-positive Merkel cell carcinoma, including RB1 mutations restricted to Merkel cell polyomavirus-negative tumors. However, some CK20-negative Merkel cell carcinomas harbor mutations not previously described in Merkel cell carcinoma. Hence, CK20-negative Merkel cell carcinomas harbor diverse oncogenic drivers which may represent therapeutic targets in individual tumors.

Next Generation Sequencing of Cytokeratin 20-Negative Merkel Cell Carcinoma Reveals Ultraviolet Signature Mutations and Recurrent TP53 and RB1 Inactivation

PubMed Central

Harms, Paul W.; Collie, Angela M. B.; Hovelson, Daniel H.; Cani, Andi K.; Verhaegen, Monique E.; Patel, Rajiv M.; Fullen, Douglas R.; Omata, Kei; Dlugosz, Andrzej A.; Tomlins, Scott A.; Billings, Steven D.

2016-01-01

Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin-20 (CK20) is expressed in approximately 95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (ten Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%)) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping genetic changes with CK20-positive Merkel cell carcinoma, including RB1 mutations restricted to Merkel cell polyomavirus-negative tumors. However, some CK20-negative Merkel cell carcinomas harbor mutations not previously described in Merkel cell carcinoma. Hence, CK20-negative Merkel cell carcinomas harbor diverse oncogenic drivers which may represent therapeutic targets in individual tumors. PMID:26743471

Congenital amegakaryocytic thrombocytopenia in three siblings: molecular analysis of atypical clinical presentation.

PubMed

Gandhi, Manish J; Pendergrass, Thomas W; Cummings, Carrie C; Ihara, Kenji; Blau, C Anthony; Drachman, Jonathan G

2005-10-01

An 11-year-old girl, presenting with fatigue and bruising, was found to be profoundly pancytopenic. Bone marrow exam and clinical evaluation were consistent with aplastic anemia. Family members were studied as potential stem cell donors, revealing that both younger siblings displayed significant thrombocytopenia, whereas both parents had normal blood counts. We evaluated this pedigree to understand the unusually late presentation of congenital amegakaryocytic thrombocytopenia (CAMT). The coding region and the intron/exon junctions of MPL were sequenced from each family member. Vectors representing each of the mutations were constructed and tested for the ability to support growth of Baf3/Mpl(mutant) cells. All three siblings had elevated thrombopoietin levels. Analysis of genomic DNA demonstrated that each parent had mutations/polymorphisms in a single MPL allele and that each child was a compound heterozygote, having inherited both abnormal alleles. The maternal allele encoded a mutation of the donor splice-junction at the exon-3/intron-3 boundary. A mini-gene construct encoding normal vs mutant versions of the intron-3 donor-site demonstrated that physiologic splicing was significantly reduced in the mutant construct. Mutations that incompletely eliminate Mpl expression/function may result in delayed diagnosis of CAMT and confusion with aplastic anemia.

Identification of residues in ABCG2 affecting protein trafficking and drug transport, using co-evolutionary analysis of ABCG sequences.

PubMed

Haider, Ameena J; Cox, Megan H; Jones, Natalie; Goode, Alice J; Bridge, Katherine S; Wong, Kelvin; Briggs, Deborah; Kerr, Ian D

2015-07-17

ABCG2 is an ABC (ATP-binding cassette) transporter with a physiological role in urate transport in the kidney and is also implicated in multi-drug efflux from a number of organs in the body. The trafficking of the protein and the mechanism by which it recognizes and transports diverse drugs are important areas of research. In the current study, we have made a series of single amino acid mutations in ABCG2 on the basis of sequence analysis. Mutant isoforms were characterized for cell surface expression and function. One mutant (I573A) showed disrupted glycosylation and reduced trafficking kinetics. In contrast with many ABC transporter folding mutations which appear to be 'rescued' by chemical chaperones or low temperature incubation, the I573A mutation was not enriched at the cell surface by either treatment, with the majority of the protein being retained in the endoplasmic reticulum (ER). Two other mutations (P485A and M549A) showed distinct effects on transport of ABCG2 substrates reinforcing the role of TM helix 3 in drug recognition and transport and indicating the presence of intracellular coupling regions in ABCG2. © 2015 Authors.

A Novel Workflow to Enrich and Isolate Patient-Matched EpCAMhigh and EpCAMlow/negative CTCs Enables the Comparative Characterization of the PIK3CA Status in Metastatic Breast Cancer

PubMed Central

Lampignano, Rita; Yang, Liwen; Neumann, Martin H. D.; Franken, André; Fehm, Tanja; Niederacher, Dieter; Neubauer, Hans

2017-01-01

Circulating tumor cells (CTCs), potential precursors of most epithelial solid tumors, are mainly enriched by epithelial cell adhesion molecule (EpCAM)-dependent technologies. Hence, these approaches may overlook mesenchymal CTCs, considered highly malignant. Our aim was to establish a workflow to enrich and isolate patient-matched EpCAMhigh and EpCAMlow/negative CTCs within the same blood samples, and to investigate the phosphatidylinositol 3-kinase catalytic subunit alpha (PIK3CA) mutational status within single CTCs. We sequentially processed metastatic breast cancer (MBC) blood samples via CellSearch® (EpCAM-based) and via Parsortix™ (size-based) systems. After enrichment, cells captured in Parsortix™ cassettes were stained in situ for nuclei, cytokeratins, EpCAM and CD45. Afterwards, sorted cells were isolated via CellCelector™ micromanipulator and their genomes were amplified. Lastly, PIK3CA mutational status was analyzed by combining an amplicon-based approach with Sanger sequencing. In 54% of patients′ blood samples both EpCAMhigh and EpCAMlow/negative cells were identified and successfully isolated. High genomic integrity was observed in 8% of amplified genomes of EpCAMlow/negative cells vs. 28% of EpCAMhigh cells suggesting an increased apoptosis in the first CTC-subpopulation. Furthermore, PIK3CA hotspot mutations were detected in both EpCAMhigh and EpCAMlow/negative CTCs. Our workflow is suitable for single CTC analysis, permitting—for the first time—assessment of the heterogeneity of PIK3CA mutational status within patient-matched EpCAMhigh and EpCAMlow/negative CTCs. PMID:28858218

Novel homozygous mutation, c.400C>T (p.Arg134*), in the PVRL1 gene underlies cleft lip/palate-ectodermal dysplasia syndrome in an Asian patient.

PubMed

Yoshida, Kazue; Hayashi, Ryota; Fujita, Hideki; Kubota, Masaya; Kondo, Mai; Shimomura, Yutaka; Niizeki, Hironori

2015-07-01

Cleft lip/palate-ectodermal dysplasia syndrome is a rare, autosomal recessive disorder caused by homozygous loss-of-function mutations of the poliovirus receptor-like 1 (PVRL1) gene encoding nectin-1. Nectin-1 is a cell-cell adhesion molecule that is important for the initial step in the formation of adherens junctions and tight junctions; it is expressed in keratinocytes, neurons, and the developing face and palate. Clinical manifestations comprise a unique facial appearance with cleft lip/palate, ectodermal dysplasia, cutaneous syndactyly of the fingers and/or toes, and in some cases, mental retardation. We present the first report, to our knowledge, of an Asian individual with cleft lip/palate-ectodermal dysplasia syndrome with a novel PVRL1 mutation. A 7-year-old Japanese boy, the first child of a consanguineous marriage, showed hypohidrotic ectodermal dysplasia with sparse, brittle, fine, dry hair and hypodontia, the unique facial appearance with cleft lip/palate, cutaneous syndactyly of the fingers and mild mental retardation. Scanning electron microscopic examination of the hair demonstrated pili torti and pili trianguli et canaliculi. Mutation analysis of exon 2 of PVRL1 revealed a novel homozygous nonsense mutation, c.400C>T (p.Arg134*). His parents were heterozygous for the mutant alleles. All four PVRL1 mutations identified in cleft lip/palate-ectodermal dysplasia syndrome to date, including this study, resulted in truncated proteins that lack the transmembrane domain and intracellular domain of nectin-1, which is necessary to initiate the cell-cell adhesion process. © 2015 Japanese Dermatological Association.

Expanded CAG/CTG Repeat DNA Induces a Checkpoint Response That Impacts Cell Proliferation in Saccharomyces cerevisiae

PubMed Central

Sundararajan, Rangapriya; Freudenreich, Catherine H.

2011-01-01

Repetitive DNA elements are mutational hotspots in the genome, and their instability is linked to various neurological disorders and cancers. Although it is known that expanded trinucleotide repeats can interfere with DNA replication and repair, the cellular response to these events has not been characterized. Here, we demonstrate that an expanded CAG/CTG repeat elicits a DNA damage checkpoint response in budding yeast. Using microcolony and single cell pedigree analysis, we found that cells carrying an expanded CAG repeat frequently experience protracted cell division cycles, persistent arrests, and morphological abnormalities. These phenotypes were further exacerbated by mutations in DSB repair pathways, including homologous recombination and end joining, implicating a DNA damage response. Cell cycle analysis confirmed repeat-dependent S phase delays and G2/M arrests. Furthermore, we demonstrate that the above phenotypes are due to the activation of the DNA damage checkpoint, since expanded CAG repeats induced the phosphorylation of the Rad53 checkpoint kinase in a rad52Δ recombination deficient mutant. Interestingly, cells mutated for the MRX complex (Mre11-Rad50-Xrs2), a central component of DSB repair which is required to repair breaks at CAG repeats, failed to elicit repeat-specific arrests, morphological defects, or Rad53 phosphorylation. We therefore conclude that damage at expanded CAG/CTG repeats is likely sensed by the MRX complex, leading to a checkpoint response. Finally, we show that repeat expansions preferentially occur in cells experiencing growth delays. Activation of DNA damage checkpoints in repeat-containing cells could contribute to the tissue degeneration observed in trinucleotide repeat expansion diseases. PMID:21437275

[B lymphocyte clonal evolution of human reactive lymph nodes revealed by lineage tree analysis].

PubMed

Tabibian-Keissar, Hilla; Schiby, Ginette; Azogui-Rosenthal, Noemie; Hazanov, Helena; Rakovsky, Aviya Shapira; Michaeli, Miri; Rosenblatt, Kinneret; Mehr, Ramit; Barshack, Iris

2013-06-01

Hypermutation and selection processes, characterizing T-dependent B cell responses taking place in germinal centers of lymph nodes, lead to B cell receptor affinity maturation. Those immune responses lead to the development of memory B cells and plasma cells that secrete high amounts of antibody molecules. The dynamics of B cell clonal evolution during affinity maturation has significant importance in infectious and autoimmune diseases, malignancies and aging. Immunoglobulin (Ig) gene mutational Lineage tree construction by comparing variable regions of Ig-gene sequences to the Ig germline gene is an interesting approach for studying B cell cLonal evolution. Lineage tree shapes and Ig gene mutations can be evaluated not only qualitatively and intuitively, but also quantitatively, and thus reveal important information related to hypermutation and selection. In this paper we describe the experimental protocols that we used for PCR amplification of Igvariable region genes from human formalin fixed paraffin embedded reactive lymph node tissues and the subsequent bioinformatical analyses of sequencing data using Ig mutational lineage trees. B cell populations of three out of four reactive Lymph node tissues were composed of several clones. Most of the Ig gene mutational lineage trees were small and narrow. Significant differences were not detected by quantification of Lineage trees. B lymphocyte clones that were detected in human reactive lymph node tissues represent major responding clones in normal polyclonal immune response. This result is in line with the polyclonal profile of B Lymphocyte populations that reside in reactive lymph node tissues.

The first liquid biopsy test approved. Is it a new era of mutation testing for non-small cell lung cancer?

PubMed Central

2017-01-01

Specific mutations in epidermal growth factor receptor (EGFR) gene are predictive for response to the EGFR tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer patients (NSCLC). According to international guidelines, the molecular testing in patients with advanced NSCLC of a non-squamous subtype is recommended. However, obtain a tissue sample could be challenging. Liquid biopsy allows to determine patients suitable for EGFR-targeted therapy by analysis of circulating-free tumor DNA (cfDNA) in peripheral blood samples and might replace tissue biopsy. It allows to acquire a material in convenient minimally invasive manner, is easily repeatable, could be used for molecular identification and molecular changes monitoring. Many studies show a high concordance rate between tissue and plasma samples testing. When U.S. Food and Drug Administration (FDA) approved the first liquid biopsy test, analysis of driver gene mutation from cfDNA becomes a reality in clinical practice for patients with NSCLC. PMID:28251125

Genetic stability of Rift Valley fever virus MP-12 vaccine during serial passages in culture cells.

PubMed

Lokugamage, Nandadeva; Ikegami, Tetsuro

2017-01-01

Rift Valley fever (RVF) is a mosquito-borne zoonotic disease endemic to Africa which affects both ruminants and humans. RVF causes serious damage to the livestock industry and is also a threat to public health. The Rift Valley fever virus has a segmented negative-stranded RNA genome consisting of Large (L)-, Medium (M)-, and Small (S)-segments. The live-attenuated MP-12 vaccine is immunogenic in livestock and humans, and is conditionally licensed for veterinary use in the U.S. The MP-12 strain encodes 23 mutations (nine amino acid substitutions) and is attenuated through a combination of mutations in the L-, M-, and S-segments. Among them, the M-U795C, M-A3564G, and L-G3104A mutations contribute to viral attenuation through the L- and M-segments. The M-U795C, M-A3564G, L-U533C, and L-G3750A mutations are also independently responsible for temperature-sensitive (ts) phenotype. We hypothesized that a serial passage of the MP-12 vaccine in culture cells causes reversions of the MP-12 genome. The MP-12 vaccine and recombinant rMP12-ΔNSs16/198 were serially passaged 25 times. Droplet digital PCR analysis revealed that the reversion occurred at L-G3750A during passages of MP-12 in Vero or MRC-5 cells. The reversion also occurred at M-A3564G and L-U533C of rMP12-ΔNSs16/198 in Vero cells. Reversion mutations were not found in MP-12 or the variant, rMP12-TOSNSs, in the brains of mice with encephalitis. This study characterized genetic stability of the MP-12 vaccine and the potential risk of reversion mutation at the L-G3750A ts mutation after excessive viral passages in culture cells.

STAT3 is a critical cell-intrinsic regulator of human unconventional T cell numbers and function

PubMed Central

Wilson, Robert P.; Ives, Megan L.; Rao, Geetha; Lau, Anthony; Payne, Kathryn; Kobayashi, Masao; Arkwright, Peter D.; Peake, Jane; Wong, Melanie; Adelstein, Stephen; Smart, Joanne M.; French, Martyn A.; Fulcher, David A.; Picard, Capucine; Bustamante, Jacinta; Boisson-Dupuis, Stephanie; Gray, Paul; Stepensky, Polina; Warnatz, Klaus; Freeman, Alexandra F.; Rossjohn, Jamie; McCluskey, James; Holland, Steven M.; Casanova, Jean-Laurent; Uzel, Gulbu; Ma, Cindy S.

2015-01-01

Unconventional T cells such as γδ T cells, natural killer T cells (NKT cells) and mucosal-associated invariant T cells (MAIT cells) are a major component of the immune system; however, the cytokine signaling pathways that control their development and function in humans are unknown. Primary immunodeficiencies caused by single gene mutations provide a unique opportunity to investigate the role of specific molecules in regulating human lymphocyte development and function. We found that individuals with loss-of-function mutations in STAT3 had reduced numbers of peripheral blood MAIT and NKT but not γδ T cells. Analysis of STAT3 mosaic individuals revealed that this effect was cell intrinsic. Surprisingly, the residual STAT3-deficient MAIT cells expressed normal levels of the transcription factor RORγt. Despite this, they displayed a deficiency in secretion of IL-17A and IL-17F, but were able to secrete normal levels of cytokines such as IFNγ and TNF. The deficiency in MAIT and NKT cells in STAT3-deficient patients was mirrored by loss-of-function mutations in IL12RB1 and IL21R, respectively. Thus, these results reveal for the first time the essential role of STAT3 signaling downstream of IL-23R and IL-21R in controlling human MAIT and NKT cell numbers. PMID:25941256

Multiplex KRASG12/G13 mutation testing of unamplified cell-free DNA from the plasma of patients with advanced cancers using droplet digital polymerase chain reaction.

PubMed

Janku, F; Huang, H J; Fujii, T; Shelton, D N; Madwani, K; Fu, S; Tsimberidou, A M; Piha-Paul, S A; Wheler, J J; Zinner, R G; Naing, A; Hong, D S; Karp, D D; Cabrilo, G; Kopetz, E S; Subbiah, V; Luthra, R; Kee, B K; Eng, C; Morris, V K; Karlin-Neumann, G A; Meric-Bernstam, F

2017-03-01

Cell-free DNA (cfDNA) from plasma offers easily obtainable material for KRAS mutation analysis. Novel, multiplex, and accurate diagnostic systems using small amounts of DNA are needed to further the use of plasma cfDNA testing in personalized therapy. Samples of 16 ng of unamplified plasma cfDNA from 121 patients with diverse progressing advanced cancers were tested with a KRASG12/G13 multiplex assay to detect the seven most common mutations in the hotspot of exon 2 using droplet digital polymerase chain reaction (ddPCR). The results were retrospectively compared to mutation analysis of archival primary or metastatic tumor tissue obtained at different points of clinical care. Eighty-eight patients (73%) had KRASG12/G13 mutations in archival tumor specimens collected on average 18.5 months before plasma analysis, and 78 patients (64%) had KRASG12/G13 mutations in plasma cfDNA samples. The two methods had initial overall agreement in 103 (85%) patients (kappa, 0.66; ddPCR sensitivity, 84%; ddPCR specificity, 88%). Of the 18 discordant cases, 12 (67%) were resolved by increasing the amount of cfDNA, using mutation-specific probes, or re-testing the tumor tissue, yielding overall agreement in 115 patients (95%; kappa 0.87; ddPCR sensitivity, 96%; ddPCR specificity, 94%). The presence of ≥ 6.2% of KRASG12/G13 cfDNA in the wild-type background was associated with shorter survival (P = 0.001). Multiplex detection of KRASG12/G13 mutations in a small amount of unamplified plasma cfDNA using ddPCR has good sensitivity and specificity and good concordance with conventional clinical mutation testing of archival specimens. A higher percentage of mutant KRASG12/G13 in cfDNA corresponded with shorter survival. © The Author 2016. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Reality of Single Circulating Tumor Cell Sequencing for Molecular Diagnostics in Pancreatic Cancer.

PubMed

Court, Colin M; Ankeny, Jacob S; Sho, Shonan; Hou, Shuang; Li, Qingyu; Hsieh, Carolyn; Song, Min; Liao, Xinfang; Rochefort, Matthew M; Wainberg, Zev A; Graeber, Thomas G; Tseng, Hsian-Rong; Tomlinson, James S

2016-09-01

To understand the potential and limitations of circulating tumor cell (CTC) sequencing for molecular diagnostics, we investigated the feasibility of identifying the ubiquitous KRAS mutation in single CTCs from pancreatic cancer (PC) patients. We used the NanoVelcro/laser capture microdissection CTC platform, combined with whole genome amplification and KRAS Sanger sequencing. We assessed both KRAS codon-12 coverage and the degree that allele dropout during whole genome amplification affected the detection of KRAS mutations from single CTCs. We isolated 385 single cells, 163 from PC cell lines and 222 from the blood of 12 PC patients, and obtained KRAS sequence coverage in 218 of 385 single cells (56.6%). For PC cell lines with known KRAS mutations, single mutations were detected in 67% of homozygous cells but only 37.4% of heterozygous single cells, demonstrating that both coverage and allele dropout are important causes of mutation detection failure from single cells. We could detect KRAS mutations in CTCs from 11 of 12 patients (92%) and 33 of 119 single CTCs sequenced, resulting in a KRAS mutation detection rate of 27.7%. Importantly, KRAS mutations were never found in the 103 white blood cells sequenced. Sequencing of groups of cells containing between 1 and 100 cells determined that at least 10 CTCs are likely required to reliably assess KRAS mutation status from CTCs. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Mutation rates among RNA viruses

PubMed Central

Drake, John W.; Holland, John J.

1999-01-01

The rate of spontaneous mutation is a key parameter in modeling the genetic structure and evolution of populations. The impact of the accumulated load of mutations and the consequences of increasing the mutation rate are important in assessing the genetic health of populations. Mutation frequencies are among the more directly measurable population parameters, although the information needed to convert them into mutation rates is often lacking. A previous analysis of mutation rates in RNA viruses (specifically in riboviruses rather than retroviruses) was constrained by the quality and quantity of available measurements and by the lack of a specific theoretical framework for converting mutation frequencies into mutation rates in this group of organisms. Here, we describe a simple relation between ribovirus mutation frequencies and mutation rates, apply it to the best (albeit far from satisfactory) available data, and observe a central value for the mutation rate per genome per replication of μg ≈ 0.76. (The rate per round of cell infection is twice this value or about 1.5.) This value is so large, and ribovirus genomes are so informationally dense, that even a modest increase extinguishes the population. PMID:10570172

A microdissection approach to detect molecular markers during progression of prostate cancer.

PubMed Central

Berthon, P.; Dimitrov, T.; Stower, M.; Cussenot, O.; Maitland, N. J.

1995-01-01

To investigate the underlying mechanisms of carcinogenesis, we have developed a technique to determine the frequency of genetic changes in prostatic carcinoma tissue. We have demonstrated that at a ratio of between 1:4 and 1:9 mutant-normal alleles, the signal from a mutant TP53 allele is not apparent after polymerase chain reaction (PCR) amplification and further direct sequencing or single-strand conformation polymorphism (SSCP) analysis. To bypass this problem, which is inherent in the heterogeneity of the prostate tissue and of the tumour, we selected areas of graded prostate tumours (Gleason score) from cryosectioned preparations and microdissected these cells (20-100 cells). After anionic resin removal of proteins, PCR amplification of TP53 gene exons 5/6 and SSCP analysis, an abnormal SSCP band shift was observed in suspected tumour cells, compared with microdissected stromal cells used as an internal control, while (1) a crude preparation of tissue DNA carrying the tumour did not show any abnormality and (2) immunostaining by a set of monoclonal antibodies against TP53 protein remained negative. Nucleotide sequence analysis of the different bands confirmed the presence of a mutation in the TP53 gene exon 6 position 13,336 in an abnormal band for one specimen, while no mutation was detected in the normal SSCP band. By targeting recognised tumour cells we can find DNA mutations which are undetectable using the standard technique of whole-tissue DNA extraction, particularly in a heterogeneous tumour such as carcinoma of the prostate. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:7547246

Craniofacial divergence by distinct prenatal growth patterns in Fgfr2 mutant mice

PubMed Central

2014-01-01

Background Differences in cranial morphology arise due to changes in fundamental cell processes like migration, proliferation, differentiation and cell death driven by genetic programs. Signaling between fibroblast growth factors (FGFs) and their receptors (FGFRs) affect these processes during head development and mutations in FGFRs result in congenital diseases including FGFR-related craniosynostosis syndromes. Current research in model organisms focuses primarily on how these mutations change cell function local to sutures under the hypothesis that prematurely closing cranial sutures contribute to skull dysmorphogenesis. Though these studies have provided fundamentally important information contributing to the understanding of craniosynostosis conditions, knowledge of changes in cell function local to the sutures leave change in overall three-dimensional cranial morphology largely unexplained. Here we investigate growth of the skull in two inbred mouse models each carrying one of two gain-of-function mutations in FGFR2 on neighboring amino acids (S252W and P253R) that in humans cause Apert syndrome, one of the most severe FGFR-related craniosynostosis syndromes. We examine late embryonic skull development and suture patency in Fgfr2 Apert syndrome mice between embryonic day 17.5 and birth and quantify the effects of these mutations on 3D skull morphology, suture patency and growth. Results We show in mice what studies in humans can only infer: specific cranial growth deviations occur prenatally and worsen with time in organisms carrying these FGFR2 mutations. We demonstrate that: 1) distinct skull morphologies of each mutation group are established by E17.5; 2) cranial suture patency patterns differ between mice carrying these mutations and their unaffected littermates; 3) the prenatal skull grows differently in each mutation group; and 4) unique Fgfr2-related cranial morphologies are exacerbated by late embryonic growth patterns. Conclusions Our analysis of mutation-driven changes in cranial growth provides a previously missing piece of knowledge necessary for explaining variation in emergent cranial morphologies and may ultimately be helpful in managing human cases carrying these same mutations. This information is critical to the understanding of craniofacial development, disease and evolution and may contribute to the evaluation of incipient therapeutic strategies. PMID:24580805

Effects on survival of BAP1 and PBRM1 mutations in sporadic clear-cell renal-cell carcinoma: a retrospective analysis with independent validation.

PubMed

Kapur, Payal; Peña-Llopis, Samuel; Christie, Alana; Zhrebker, Leah; Pavía-Jiménez, Andrea; Rathmell, W Kimryn; Xie, Xian-Jin; Brugarolas, James

2013-02-01

Clear-cell renal-cell carcinomas display divergent clinical behaviours. However, the molecular genetic events driving these behaviours are unknown. We discovered that BAP1 is mutated in about 15% of clear-cell renal-cell carcinoma, and that BAP1 and PBRM1 mutations are largely mutually exclusive. The aim of this study was to investigate the clinicopathological significance of these molecular subtypes and to determine whether patients with BAP1-mutant and PBRM1-mutant tumours had different overall survival. In this retrospective analysis, we assessed 145 patients with primary clear-cell renal-cell carcinoma and defined PBRM1 and BAP1 mutation status from the University of Texas Southwestern Medical Center (UTSW), TX, USA, between 1998 and 2011. We classified patients into those with BAP1-mutant tumours and those with tumours exclusively mutated for PBRM1 (PBRM1-mutant). We used a second independent cohort (n=327) from The Cancer Genome Atlas (TCGA) for validation. In both cohorts, more than 80% of patients had localised or locoregional disease at presentation. Overall both cohorts were similar, although the TCGA had more patients with metastatic and higher-grade disease, and more TCGA patients presented before molecularly targeted therapies became available. The median overall survival in the UTSW cohort was significantly shorter for patients with BAP1-mutant tumours (4·6 years; 95% CI 2·1-7·2), than for patients with PBRM1-mutant tumours (10·6 years; 9·8-11·5), corresponding to a HR of 2·7 (95% CI 0·99-7·6, p=0·044). Median overall survival in the TCGA cohort was 1·9 years (95% CI 0·6-3·3) for patients with BAP1-mutant tumours and 5·4 years (4·0-6·8) for those with PBRM1-mutant tumours. A HR similar to the UTSW cohort was noted in the TCGA cohort (2·8; 95% CI 1·4-5·9; p=0·004). Patients with mutations in both BAP1 and PBRM1, although a minority (three in UTSW cohort and four in TCGA cohort), had the worst overall survival (median 2·1 years, 95% CI 0·3-3·8, for the UTSW cohort, and 0·2 years, 0·0-1·2, for the TCGA cohort). Our findings identify mutation-defined subtypes of clear-cell renal-cell carcinoma with distinct clinical outcomes, a high-risk BAP1-mutant group and a favourable PBRM1-mutant group. These data establish the basis for a molecular genetic classification of clear-cell renal-cell carcinoma that could influence treatment decisions in the future. The existence of different molecular subtypes with disparate outcomes should be considered in the design and assessment of clinical studies. Cancer Prevention and Research Institution of Texas and National Cancer Institute. Copyright © 2013 Elsevier Ltd. All rights reserved.

Molecular profiling of appendiceal epithelial tumors using massively parallel sequencing to identify somatic mutations.

PubMed

Liu, Xiaoying; Mody, Kabir; de Abreu, Francine B; Pipas, J Marc; Peterson, Jason D; Gallagher, Torrey L; Suriawinata, Arief A; Ripple, Gregory H; Hourdequin, Kathryn C; Smith, Kerrington D; Barth, Richard J; Colacchio, Thomas A; Tsapakos, Michael J; Zaki, Bassem I; Gardner, Timothy B; Gordon, Stuart R; Amos, Christopher I; Wells, Wendy A; Tsongalis, Gregory J

2014-07-01

Some epithelial neoplasms of the appendix, including low-grade appendiceal mucinous neoplasm and adenocarcinoma, can result in pseudomyxoma peritonei (PMP). Little is known about the mutational spectra of these tumor types and whether mutations may be of clinical significance with respect to therapeutic selection. In this study, we identified somatic mutations using the Ion Torrent AmpliSeq Cancer Hotspot Panel v2. Specimens consisted of 3 nonneoplastic retention cysts/mucocele, 15 low-grade mucinous neoplasms (LAMNs), 8 low-grade/well-differentiated mucinous adenocarcinomas with pseudomyxoma peritonei, and 12 adenocarcinomas with/without goblet cell/signet ring cell features. Barcoded libraries were prepared from up to 10 ng of extracted DNA and multiplexed on single 318 chips for sequencing. Data analysis was performed using Golden Helix SVS. Variants that remained after the analysis pipeline were individually interrogated using the Integrative Genomics Viewer. A single Janus kinase 3 (JAK3) mutation was detected in the mucocele group. Eight mutations were identified in the V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) and GNAS complex locus (GNAS) genes among LAMN samples. Additional gene mutations were identified in the AKT1 (v-akt murine thymoma viral oncogene homolog 1), APC (adenomatous polyposis coli), JAK3, MET (met proto-oncogene), phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA), RB1 (retinoblastoma 1), STK11 (serine/threonine kinase 11), and tumor protein p53 (TP53) genes. Among the PMPs, 6 mutations were detected in the KRAS gene and also in the GNAS, TP53, and RB1 genes. Appendiceal cancers showed mutations in the APC, ATM (ataxia telangiectasia mutated), KRAS, IDH1 [isocitrate dehydrogenase 1 (NADP+)], NRAS [neuroblastoma RAS viral (v-ras) oncogene homolog], PIK3CA, SMAD4 (SMAD family member 4), and TP53 genes. Our results suggest molecular heterogeneity among epithelial tumors of the appendix. Next generation sequencing efforts have identified mutational spectra in several subtypes of these tumors that may suggest a phenotypic heterogeneity showing mutations that are relevant for targeted therapies. © 2014 The American Association for Clinical Chemistry.

A Large-scale Cross-sectional Study of ALK Rearrangements and EGFR Mutations in Non-small-cell Lung Cancer in Chinese Han Population

PubMed Central

Hong, Shaodong; Fang, Wenfeng; Hu, Zhihuang; Zhou, Ting; Yan, Yue; Qin, Tao; Tang, Yanna; Ma, Yuxiang; Zhao, Yuanyuan; Xue, Cong; Huang, Yan; Zhao, Hongyun; Zhang, Li

2014-01-01

The predictive power of age at diagnosis and smoking history for ALK rearrangements and EGFR mutations in non-small-cell lung cancer (NSCLC) remains not fully understood. In this cross-sectional study, 1160 NSCLC patients were prospectively enrolled and genotyped for EML4-ALK rearrangements and EGFR mutations. Multivariate logistic regression analysis was performed to explore the association between clinicopathological features and these two genetic aberrations. Receiver operating characteristic (ROC) curves methodology was applied to evaluate the predictive value. We showed that younger age at diagnosis was the only independent variable associated with EML4-ALK rearrangements (odds ratio (OR) per 5 years' increment, 0.68; p < 0.001), while lower tobacco exposure (OR per 5 pack-years' increment, 0.88; p < 0.001), adenocarcinoma (OR, 6.61; p < 0.001), and moderate to high differentiation (OR, 2.05; p < 0.001) were independently associated with EGFR mutations. Age at diagnosis was a very strong predictor of ALK rearrangements but poorly predicted EGFR mutations, while smoking pack-years may predict the presence of EGFR mutations and ALK rearrangements but with rather limited power. These findings should assist clinicians in assessing the likelihood of EML4-ALK rearrangements and EGFR mutations and understanding their biological implications in NSCLC. PMID:25434695

A novel point mutation in CD18 causing the expression of dysfunctional CD11/CD18 leucocyte integrins in a patient with leucocyte adhesion deficiency (LAD)

PubMed Central

Mathew, E C; Shaw, J M; Bonilla, F A; Law, S K A; Wright, D A

2000-01-01

Leucocyte adhesion deficiency type 1 (LAD-1) is characterized by the incapacity of leucocytes to carry out their adhesion functions via their CD11/CD18 antigens, which are also referred to as the leucocyte integrins. The patients generally suffer from poor wound healing and recurrent bacterial and fungal infections. In severe cases, the infections are often systemic and life-threatening. A LAD patient (AW) of moderate phenotype has been identified but, unlike most other cases, the level of CD11/CD18 antigens on her leucocytes are uncharacteristically high for a LAD patient. Molecular analysis revealed that she is a compound heterozygote for CD18 mutations. She has inherited a D231H mutation from her father and a G284S mutation from her mother. By transfection studies, it was established that the G284S mutation does not support CD11/CD18 antigen expression on the cell surface. In contrast, the D231H mutation does not affect CD18 forming integrin heterodimers with the CD11 antigens on the cell surface. However, the expressed integrins with the D231H mutation are not adhesive to ligands. PMID:10886250

Determining the Origin of Human Germinal Center B Cell-Derived Malignancies.

PubMed

Seifert, Marc; Küppers, Ralf

2017-01-01

Most human B cell lymphomas originate from germinal center (GC) B cells. This is partly caused by the high proliferative activity of GC B cells and the remodeling processes acting at the immunoglobulin (Ig) loci of these cells, i.e., somatic hypermutation and class-switching. Mistargeting of these processes can cause chromosomal translocations, and the hypermutation machinery may also target non-Ig genes. As somatic hypermutation is exclusively active in GC B cells, the presence of somatic mutations in rearranged IgV genes is a standard criterium for a GC or post-GC B cell origin of lymphomas. Beyond this, ongoing somatic hypermutation during lymphoma clone expansion indicates that the lymphoma has an active GC B cell differentiation program. The proto-oncogene BCL6 is specifically expressed in GC B cells and also acquires somatic mutations as a physiological by-product of the somatic hypermutation process, albeit at a lower level than IgV genes. Thus, detection of BCL6 mutations is a further genetic trait of a GC experience of a B cell lymphoma. Typically, B cell lymphomas retain key features of their specific cells of origin, including a differentiation stage-specific gene expression pattern. This is at least partly due to genetic lesions, which "freeze" the lymphoma cells at the differentiation stage at which the transformation occurred. Therefore, identification of the normal B cell subset with the most similar gene expression pattern to a particular type of B cell lymphoma has been instrumental to deduce the precise cell of origin of lymphomas.We present here protocols to analyze human B cell lymphomas for a potential origin from GC B cells by determining the presence of mutations in rearranged IgV genes and the BCL6 gene, and by comparing the gene expression pattern of lymphoma cells with those of normal B cell subsets by genechip or RNA-sequencing analysis.

p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

PubMed

Cox, Darren P

2012-01-01

Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

Novel POC1A mutation in primordial dwarfism reveals new insights for centriole biogenesis.

PubMed

Koparir, Asuman; Karatas, Omer F; Yuceturk, Betul; Yuksel, Bayram; Bayrak, Ali O; Gerdan, Omer F; Sagiroglu, Mahmut S; Gezdirici, Alper; Kirimtay, Koray; Selcuk, Ece; Karabay, Arzu; Creighton, Chad J; Yuksel, Adnan; Ozen, Mustafa

2015-10-01

POC1A encodes a WD repeat protein localizing to centrioles and spindle poles and is associated with short stature, onychodysplasia, facial dysmorphism and hypotrichosis (SOFT) syndrome. These main features are related to the defect in cell proliferation of chondrocytes in growth plate. In the current study, we aimed at identifying the molecular basis of two patients with primordial dwarfism (PD) in a single family through utilization of whole-exome sequencing. A novel homozygous p.T120A missense mutation was detected in POC1A in both patients, a known causative gene of SOFT syndrome, and confirmed using Sanger sequencing. To test the pathogenicity of the detected mutation, primary fibroblast cultures obtained from the patients and a control individual were used. For evaluating the global gene expression profile of cells carrying p.T120A mutation in POC1A, we performed the gene expression array and compared their expression profiles to those of control fibroblast cells. The gene expression array analysis showed that 4800 transcript probes were significantly deregulated in cells with p.T120A mutation in comparison to the control. GO term association results showed that deregulated genes are mostly involved in the extracellular matrix and cytoskeleton. Furthermore, the p.T120A missense mutation in POC1A caused the formation of abnormal mitotic spindle structure, including supernumerary centrosomes, and changes in POC1A were accompanied by alterations in another centrosome-associated WD repeat protein p80-katanin. As a result, we identified a novel mutation in POC1A of patients with PD and showed that this mutation causes the formation of multiple numbers of centrioles and multipolar spindles with abnormal chromosome arrangement. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A novel start codon mutation of the MERTK gene in a patient with retinitis pigmentosa

PubMed Central

Jinda, Worapoj; Poungvarin, Naravat; Taylor, Todd D.; Suzuki, Yutaka; Thongnoppakhun, Wanna; Limwongse, Chanin; Lertrit, Patcharee; Suriyaphol, Prapat

2016-01-01

Purpose Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous group of inherited retinal degenerations characterized by progressive loss of photoreceptor cells and RPE functions. More than 70 causative genes are known to be responsible for RP. This study aimed to identify the causative gene in a patient from a consanguineous family with childhood-onset severe retinal dystrophy. Methods To identify the defective gene, whole exome sequencing was performed. Candidate causative variants were selected and validated using Sanger sequencing. Segregation analysis of the causative gene was performed in additional family members. To verify that the mutation has an effect on protein synthesis, an expression vector containing the first ten amino acids of the mutant protein fused with the DsRed2 fluorescent protein was constructed and transfected into HEK293T cells. Expression of the fusion protein in the transfected cells was measured using fluorescence microscopy. Results By filtering against public variant databases, a novel homozygous missense mutation (c.3G>A) localized in the start codon of the MERTK gene was detected as a potentially pathogenic mutation for autosomal recessive RP. The c.3G>A mutation cosegregated with the disease phenotype in the family. No expression of the first ten amino acids of the MerTK mutant fused with the DsRed2 fluorescent protein was detected in HEK293T cells, indicating that the mutation affects the translation initiation site of the gene that may lead to loss of function of the MerTK signaling pathway. Conclusions We report a novel missense mutation (c.3G>A, p.0?) in the MERTK gene that causes severe vision impairment in a patient. Taken together with previous reports, our results expand the spectrum of MERTK mutations and extend our understanding of the role of the MerTK protein in the pathogenesis of retinitis pigmentosa. PMID:27122965

CCDC65 Mutation Causes Primary Ciliary Dyskinesia with Normal Ultrastructure and Hyperkinetic Cilia

PubMed Central

Horani, Amjad; Brody, Steven L.; Ferkol, Thomas W.; Shoseyov, David; Wasserman, Mollie G.; Ta-shma, Asaf; Wilson, Kate S.; Bayly, Philip V.; Amirav, Israel; Cohen-Cymberknoh, Malena; Dutcher, Susan K.; Elpeleg, Orly; Kerem, Eitan

2013-01-01

Background Primary ciliary dyskinesia (PCD) is a genetic disorder characterized by impaired ciliary function, leading to chronic sinopulmonary disease. The genetic causes of PCD are still evolving, while the diagnosis is often dependent on finding a ciliary ultrastructural abnormality and immotile cilia. Here we report a novel gene associated with PCD but without ciliary ultrastructural abnormalities evident by transmission electron microscopy, but with dyskinetic cilia beating. Methods Genetic linkage analysis was performed in a family with a PCD subject. Gene expression was studied in Chlamydomonas reinhardtii and human airway epithelial cells, using RNA assays and immunostaining. The phenotypic effects of candidate gene mutations were determined in primary culture human tracheobronchial epithelial cells transduced with gene targeted shRNA sequences. Video-microscopy was used to evaluate cilia motion. Results A single novel mutation in CCDC65, which created a termination codon at position 293, was identified in a subject with typical clinical features of PCD. CCDC65, an orthologue of the Chlamydomonas nexin-dynein regulatory complex protein DRC2, was localized to the cilia of normal nasal epithelial cells but was absent in those from the proband. CCDC65 expression was up-regulated during ciliogenesis in cultured airway epithelial cells, as was DRC2 in C. reinhardtii following deflagellation. Nasal epithelial cells from the affected individual and CCDC65-specific shRNA transduced normal airway epithelial cells had stiff and dyskinetic cilia beating patterns compared to control cells. Moreover, Gas8, a nexin-dynein regulatory complex component previously identified to associate with CCDC65, was absent in airway cells from the PCD subject and CCDC65-silenced cells. Conclusion Mutation in CCDC65, a nexin-dynein regulatory complex member, resulted in a frameshift mutation and PCD. The affected individual had altered cilia beating patterns, and no detectable ultrastructural defects of the ciliary axoneme, emphasizing the role of the nexin-dynein regulatory complex and the limitations of certain methods for PCD diagnosis. PMID:23991085

Effect of Mutation Order on Myeloproliferative Neoplasms

PubMed Central

Nangalia, Jyoti; Silber, Yvonne; Wedge, David C.; Grinfeld, Jacob; Baxter, E. Joanna; Massie, Charles E.; Papaemmanuil, Elli; Menon, Suraj; Godfrey, Anna L.; Dimitropoulou, Danai; Guglielmelli, Paola; Bellosillo, Beatriz; Besses, Carles; Döhner, Konstanze; Harrison, Claire N.; Vassiliou, George S.; Vannucchi, Alessandro; Campbell, Peter J.; Green, Anthony R.

2015-01-01

BACKGROUND Cancers result from the accumulation of somatic mutations, and their properties are thought to reflect the sum of these mutations. However, little is known about the effect of the order in which mutations are acquired. METHODS We determined mutation order in patients with myeloproliferative neoplasms by genotyping hematopoietic colonies or by means of next-generation sequencing. Stem cells and progenitor cells were isolated to study the effect of mutation order on mature and immature hematopoietic cells. RESULTS The age at which a patient presented with a myeloproliferative neoplasm, acquisition of JAK2 V617F homozygosity, and the balance of immature progenitors were all influenced by mutation order. As compared with patients in whom the TET2 mutation was acquired first (hereafter referred to as “TET2-first patients”), patients in whom the Janus kinase 2 (JAK2) mutation was acquired first (“JAK2-first patients”) had a greater likelihood of presenting with polycythemia vera than with essential thrombocythemia, an increased risk of thrombosis, and an increased sensitivity of JAK2-mutant progenitors to ruxolitinib in vitro. Mutation order influenced the proliferative response to JAK2 V617F and the capacity of double-mutant hematopoietic cells and progenitor cells to generate colony-forming cells. Moreover, the hematopoietic stem-and-progenitor-cell compartment was dominated by TET2 single-mutant cells in TET2-first patients but by JAK2–TET2 double-mutant cells in JAK2-first patients. Prior mutation of TET2 altered the transcriptional consequences of JAK2 V617F in a cell-intrinsic manner and prevented JAK2 V617F from up-regulating genes associated with proliferation. CONCLUSIONS The order in which JAK2 and TET2 mutations were acquired influenced clinical features, the response to targeted therapy, the biology of stem and progenitor cells, and clonal evolution in patients with myeloproliferative neoplasms. (Funded by Leukemia and Lymphoma Research and others.) PMID:25671252

Ancestral trees for modeling stem cell lineages genetically rather than functionally: understanding mutation accumulation and distinguishing the restrictive cancer stem cell propagation theory and the unrestricted cell propagation theory of human tumorigenesis.

PubMed

Shibata, Darryl K; Kern, Scott E

2008-01-01

Cancer stem cells either could be rare or common in tumors, constituting the major distinction between the two fundamentally opposed theoretical models of tumor progression: A newer and restrictive stem cell propagation model, in which the stem cells are a small and special minority of the tumor cells, and a standard older model, an unrestricted cell proliferation theory, in which many or most tumor cells are capable of indefinite generations of cell division. Stem cells of tumors are difficult to quantitate using functional assays, and the validity of the most common assays is seriously questioned. Nonetheless, stem cells are an essential component of any tumorigenesis model. Alternative approaches to studying tumor stem cells should be explored. Cell populations can be conceived of as having a genealogy, a relationship of cells to their ancestral lineage, from the zygote to the adult cells or neoplasms. Models using ancestral trees thus offer an anatomic and genetic means to "observe" stem cells independent of artificial conditions. Ancestral trees broaden our attention backward along a lineage, to the zygote stage, and thereby add insight into how the mutations of tumors accumulate. It is possible that a large fraction of mutations in a tumor originate from normal, endogenous, replication errors (nearly all being passenger mutations) occurring prior to the emergence of the first transformed cell. Trees can be constructed from experimental measurements - molecular clocks - of real human tissues and tumors. Detailed analysis of single-cell methylation patterns, heritable yet slightly plastic, now can provide this information in the necessary depth. Trees based on observations of molecular clocks may help us to distinguish between competing theories regarding the proliferative properties among cells of actual human tumors, to observe subtle and difficult phenomena such as the extinction of stem lineages, and to address the origins and rates of mutations in various normal, hormone-stimulated, aging, or neoplastic tissues. The simple concept that cancers arise from the transformation of a normal stem cell, the stem cell origination theory, is sometimes superficially and confusingly referred to as "the stem cell theory". This concept is compatible with but not a requisite assumption for both of the major competing theories of tumor progression, and plays essentially no role in clarifying the nature of tumor progression.

Functional characterization of mutations in the myosin Vb gene associated with microvillus inclusion disease

PubMed Central

Szperl, Agata M.; Golachowska, Magdalena R.; Bruinenberg, Marcel; Prekeris, Rytis; Thunnissen, Andy-Mark W. H.; Karrenbeld, Arend; Dijkstra, Gerard; Hoekstra, Dick; Mercer, David; Ksiazyk, Janusz; Wijmenga, Cisca; Wapenaar, Martin C.; Rings, Edmond H. H. M.; van IJzendoorn, Sven C. D.

2010-01-01

Objectives Microvillus inclusion disease (MVID) is a rare autosomal recessive enteropathy characterized by intractable diarrhea and malabsorption. Recently, various MYO5B gene mutations have been identified in MVID patients. Interestingly, several MVID patients showed only a MYO5B mutation in one allele (heterozygous) or no mutations in the MYO5B gene, illustrating the need to further functionally characterize the cell biological effects of the MYO5B mutations. Methods The genomic DNA of nine patients diagnosed with microvillus inclusion disease was screened for MYO5B mutations, and qPCR and immunohistochemistry on the material of two patients was performed to investigate resultant cellular consequences. Results We demonstrate for the first time that MYO5B mutations can be correlated with altered myosin Vb mRNA expression and with an aberrant subcellular distribution of the myosin Vb protein. Moreover, we demonstrate that the typical and myosin Vb–controlled accumulation of rab11a-and FIP5-positive recycling endosomes in the apical cytoplasm of the cells is abolished in MVID enterocytes, which is indicative for altered myosin Vb function. Also, we report 8 novel MYO5B mutations in 9 MVID patients of various etnic backgrounds, including compound heterozygous mutations. Conclusions Our functional analysis indicate that MYO5B mutations can be correlated with an aberrant subcellular distribution of the myosin Vb protein and apical recycling endosomes which, together with the additional compound heterozygous mutations, significantly strengthen the link between MYO5B and MVID. PMID:21206382

Correlation of EGFR or KRAS mutation status with 18F-FDG uptake on PET-CT scan in lung adenocarcinoma.

PubMed

Takamochi, Kazuya; Mogushi, Kaoru; Kawaji, Hideya; Imashimizu, Kota; Fukui, Mariko; Oh, Shiaki; Itoh, Masayoshi; Hayashizaki, Yoshihide; Ko, Weijey; Akeboshi, Masao; Suzuki, Kenji

2017-01-01

18F-fluoro-2-deoxy-glucose (18F-FDG) positron emission tomography (PET) is a functional imaging modality based on glucose metabolism. The correlation between EGFR or KRAS mutation status and the standardized uptake value (SUV) of 18F-FDG PET scanning has not been fully elucidated. Correlations between EGFR or KRAS mutation status and clinicopathological factors including SUVmax were statistically analyzed in 734 surgically resected lung adenocarcinoma patients. Molecular causal relationships between EGFR or KRAS mutation status and glucose metabolism were then elucidated in 62 lung adenocarcinomas using cap analysis of gene expression (CAGE), a method to determine and quantify the transcription initiation activities of mRNA across the genome. EGFR and KRAS mutations were detected in 334 (46%) and 83 (11%) of the 734 lung adenocarcinomas, respectively. The remaining 317 (43%) patients had wild-type tumors for both genes. EGFR mutations were more frequent in tumors with lower SUVmax. In contrast, no relationship was noted between KRAS mutation status and SUVmax. CAGE revealed that 4 genes associated with glucose metabolism (GPI, G6PD, PKM2, and GAPDH) and 5 associated with the cell cycle (ANLN, PTTG1, CIT, KPNA2, and CDC25A) were positively correlated with SUVmax, although expression levels were lower in EGFR-mutated than in wild-type tumors. No similar relationships were noted with KRAS mutations. EGFR-mutated adenocarcinomas are biologically indolent with potentially lower levels of glucose metabolism than wild-type tumors. Several genes associated with glucose metabolism and the cell cycle were specifically down-regulated in EGFR-mutated adenocarcinomas.

[Mutants of the yeast Saccharomyces cerevisiae characterized by enhanced induced mutagenesis. III. Effect of the him mutation on the effectiveness and specificity of UF-induced mutagenesis].

PubMed

Ivanov, E L; Koval'tsova, S V; Korolev, V G

1987-09-01

We have studied the influence of him1-1, him2-1, him3-1 and himX mutations on induction frequency and specificity of UV-induced adenine-dependent mutations in the yeast Saccharomyces cerevisiae. Him mutations do not render haploid cells more sensitive to the lethal action of UV-light; however, in him strains adenine-dependent mutations (ade1, ade2) were induced more frequently (1.5--2-fold), as compared to the HIM strain. An analysis of the molecular nature of ade2 mutants revealed that him1-1, him2-1 and himX mutations increase specifically the yield of transitions (AT----GC and GC----AT), whereas in the him3-1 strain the yield of transversions was enhanced as well. We suggest him mutations analysed to affect specific repair pathway for mismatch correction.

Functional analysis of LDLR promoter and 5' UTR mutations in subjects with clinical diagnosis of familial hypercholesterolemia.

PubMed

De Castro-Orós, Isabel; Pampín, Sandra; Bolado-Carrancio, Alfonso; De Cubas, Aguirre; Palacios, Lourdes; Plana, Nuria; Puzo, Jose; Martorell, Esperanza; Stef, Marianne; Masana, Luis; Civeira, Fernando; Rodríguez-Rey, Jose Carlos; Pocoví, Miguel

2011-08-01

Familial hypercholesterolemia (FH) is a dominant disorder due to mutations in the LDLR gene. Several mutations in the LDLR promoter are associated with FH. Screening of 3,705 Spanish FH patients identified 10 variants in the promoter and 5' UTR. Here, we analyse the functionality of six newly identified LDLR variants. Mutations located in the LDLR promoter regulatory elements R2 and R3 (c.-155_-150delACCCCinsTTCTGCAAACTCCTCCC, c.-136C>G, c.-140C>G, and c.-140C>T) resulted in 6 to 15% residual activity in reporter expression experiments and changes in nuclear protein binding affinity compared to wild type. No reduction was observed when cells were transfected with c.-208T, c.-88A, and c.-36G mutant fragments. Our results indicate that mutations localized in R2 and R3 are associated with hypercholesterolemia, whereas mutations outside the LDLR response elements are not a cause of FH. This data emphasizes the importance of functional analysis of variants in the LDLR promoter to determine their association with the FH phenotype. © 2011 Wiley-Liss, Inc.

Highly sensitive and quantitative detection of rare pathogens through agarose droplet microfluidic emulsion PCR at the single-cell level.

PubMed

Zhu, Zhi; Zhang, Wenhua; Leng, Xuefei; Zhang, Mingxia; Guan, Zhichao; Lu, Jiangquan; Yang, Chaoyong James

2012-10-21

Genetic alternations can serve as highly specific biomarkers to distinguish fatal bacteria or cancer cells from their normal counterparts. However, these mutations normally exist in very rare amount in the presence of a large excess of non-mutated analogs. Taking the notorious pathogen E. coli O157:H7 as the target analyte, we have developed an agarose droplet-based microfluidic ePCR method for highly sensitive, specific and quantitative detection of rare pathogens in the high background of normal bacteria. Massively parallel singleplex and multiplex PCR at the single-cell level in agarose droplets have been successfully established. Moreover, we challenged the system with rare pathogen detection and realized the sensitive and quantitative analysis of a single E. coli O157:H7 cell in the high background of 100,000 excess normal K12 cells. For the first time, we demonstrated rare pathogen detection through agarose droplet microfluidic ePCR. Such a multiplex single-cell agarose droplet amplification method enables ultra-high throughput and multi-parameter genetic analysis of large population of cells at the single-cell level to uncover the stochastic variations in biological systems.

TGFβ pathway limits dedifferentiation following WNT and MAPK pathway activation to suppress intestinal tumourigenesis

PubMed Central

Cammareri, Patrizia; Vincent, David F; Hodder, Michael C; Ridgway, Rachel A; Murgia, Claudio; Nobis, Max; Campbell, Andrew D; Varga, Julia; Huels, David J; Subramani, Chithra; Prescott, Katie L H; Nixon, Colin; Hedley, Ann; Barry, Simon T; Greten, Florian R; Inman, Gareth J; Sansom, Owen J

2017-01-01

Recent studies have suggested increased plasticity of differentiated cells within the intestine to act both as intestinal stem cells (ISCs) and tumour-initiating cells. However, little is known of the processes that regulate this plasticity. Our previous work has shown that activating mutations of Kras or the NF-κB pathway can drive dedifferentiation of intestinal cells lacking Apc. To investigate this process further, we profiled both cells undergoing dedifferentiation in vitro and tumours generated from these cells in vivo by gene expression analysis. Remarkably, no clear differences were observed in the tumours; however, during dedifferentiation in vitro we found a marked upregulation of TGFβ signalling, a pathway commonly mutated in colorectal cancer (CRC). Genetic inactivation of TGFβ type 1 receptor (Tgfbr1/Alk5) enhanced the ability of KrasG12D/+ mutation to drive dedifferentiation and markedly accelerated tumourigenesis. Mechanistically this is associated with a marked activation of MAPK signalling. Tumourigenesis from differentiated compartments is potently inhibited by MEK inhibition. Taken together, we show that tumours arising in differentiated compartments will be exposed to different suppressive signals, for example, TGFβ and blockade of these makes tumourigenesis more efficient from this compartment. PMID:28622298

A genetic screen for temperature-sensitive cell-division mutants of Caenorhabditis elegans.

PubMed Central

O'Connell, K F; Leys, C M; White, J G

1998-01-01

A novel screen to isolate conditional cell-division mutants in Caenorhabditis elegans has been developed. The screen is based on the phenotypes associated with existing cell-division mutations: some disrupt postembryonic divisions and affect formation of the gonad and ventral nerve cord-resulting in sterile, uncoordinated animals-while others affect embryonic divisions and result in lethality. We obtained 19 conditional mutants that displayed these phenotypes when shifted to the restrictive temperature at the appropriate developmental stage. Eighteen of these mutations have been mapped; 17 proved to be single alleles of newly identified genes, while 1 proved to be an allele of a previously identified gene. Genetic tests on the embryonic lethal phenotypes indicated that for 13 genes, embryogenesis required maternal expression, while for 6, zygotic expression could suffice. In all cases, maternal expression of wild-type activity was found to be largely sufficient for embryogenesis. Cytological analysis revealed that 10 mutants possessed embryonic cell-division defects, including failure to properly segregate DNA, failure to assemble a mitotic spindle, late cytokinesis defects, prolonged cell cycles, and improperly oriented mitotic spindles. We conclude that this approach can be used to identify mutations that affect various aspects of the cell-division cycle. PMID:9649522

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

PubMed Central

Chen, Kaifu; Chen, Zhong; Wu, Dayong; Zhang, Lili; Lin, Xueqiu; Su, Jianzhong; Rodriguez, Benjamin; Xi, Yuanxin; Xia, Zheng; Chen, Xi; Shi, Xiaobing; Wang, Qianben; Li, Wei

2016-01-01

Tumor suppressors are mostly defined by inactivating mutations in tumors, yet little is known about their epigenetic features in normal cells. Through integrative analysis of 1,134 genome-wide epigenetic profiles, mutations from >8,200 tumor-normal pairs, and our experimental data from clinical samples, we discovered broad H3K4me3 (wider than 4 kb) as the first epigenetic signature for tumor suppressors in normal cells. Broad H3K4me3 is associated with increased transcription elongation and enhancer activity together leading to exceptionally high gene expression, and is distinct from other broad epigenetic features, such as super-enhancers. Broad H3K4me3 conserved across normal cells may represent pan-cancer tumor suppressors, such as P53 and PTEN, whereas cell-type-specific broad H3K4me3 may indicate cell-identity genes and cell-type-specific tumor suppressors. Furthermore, widespread shortening of broad H3K4me3 in cancers is associated with repression of tumor suppressors. Together, the broad H3K4me3 epigenetic signature provides mutation-independent information for the discovery and characterization of novel tumor suppressors. PMID:26301496

Activation of the MAPK pathway is a common event in uveal melanomas although it rarely occurs through mutation of BRAF or RAS.

PubMed

Zuidervaart, W; van Nieuwpoort, F; Stark, M; Dijkman, R; Packer, L; Borgstein, A-M; Pavey, S; van der Velden, P; Out, C; Jager, M J; Hayward, N K; Gruis, N A

2005-06-06

In contrast to cutaneous melanoma, there is no evidence that BRAF mutations are involved in the activation of the mitogen-activated protein kinase (MAPK) pathway in uveal melanoma, although there is increasing evidence that this pathway is activated frequently in the latter tumours. In this study, we performed mutation analysis of the RAS and BRAF genes in a panel of 11 uveal melanoma cell lines and 19 primary uveal melanoma tumours. In addition, Western blot and immunohistochemical analyses were performed on downstream members of the MAPK pathway in order to assess the contribution of each of these components. No mutations were found in any of the three RAS gene family members and only one cell line carried a BRAF mutation (V599E). Despite this, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (MEK), ERK and ELK were constitutively activated in all samples. These data suggest that activation of the MAPK pathway is commonly involved in the development of uveal melanoma, but occurs through a mechanism different to that of cutaneous melanoma.

Activation of the MAPK pathway is a common event in uveal melanomas although it rarely occurs through mutation of BRAF or RAS

PubMed Central

Zuidervaart, W; van Nieuwpoort, F; Stark, M; Dijkman, R; Packer, L; Borgstein, A-M; Pavey, S; van der Velden, P; Out, C; Jager, M J; Hayward, N K; Gruis, N A

2005-01-01

In contrast to cutaneous melanoma, there is no evidence that BRAF mutations are involved in the activation of the mitogen-activated protein kinase (MAPK) pathway in uveal melanoma, although there is increasing evidence that this pathway is activated frequently in the latter tumours. In this study, we performed mutation analysis of the RAS and BRAF genes in a panel of 11 uveal melanoma cell lines and 19 primary uveal melanoma tumours. In addition, Western blot and immunohistochemical analyses were performed on downstream members of the MAPK pathway in order to assess the contribution of each of these components. No mutations were found in any of the three RAS gene family members and only one cell line carried a BRAF mutation (V599E). Despite this, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (MEK), ERK and ELK were constitutively activated in all samples. These data suggest that activation of the MAPK pathway is commonly involved in the development of uveal melanoma, but occurs through a mechanism different to that of cutaneous melanoma. PMID:15928660

Involvement of ER Stress in Dysmyelination of Pelizaeus-Merzbacher Disease with PLP1 Missense Mutations Shown by iPSC-Derived Oligodendrocytes

PubMed Central

Numasawa-Kuroiwa, Yuko; Okada, Yohei; Shibata, Shinsuke; Kishi, Noriyuki; Akamatsu, Wado; Shoji, Masanobu; Nakanishi, Atsushi; Oyama, Manabu; Osaka, Hitoshi; Inoue, Ken; Takahashi, Kazutoshi; Yamanaka, Shinya; Kosaki, Kenjiro; Takahashi, Takao; Okano, Hideyuki

2014-01-01

Summary Pelizaeus-Merzbacher disease (PMD) is a form of X-linked leukodystrophy caused by mutations in the proteolipid protein 1 (PLP1) gene. Although PLP1 proteins with missense mutations have been shown to accumulate in the rough endoplasmic reticulum (ER) in disease model animals and cell lines transfected with mutant PLP1 genes, the exact pathogenetic mechanism of PMD has not previously been clarified. In this study, we established induced pluripotent stem cells (iPSCs) from two PMD patients carrying missense mutation and differentiated them into oligodendrocytes in vitro. In the PMD iPSC-derived oligodendrocytes, mislocalization of mutant PLP1 proteins to the ER and an association between increased susceptibility to ER stress and increased numbers of apoptotic oligodendrocytes were observed. Moreover, electron microscopic analysis demonstrated drastically reduced myelin formation accompanied by abnormal ER morphology. Thus, this study demonstrates the involvement of ER stress in pathogenic dysmyelination in the oligodendrocytes of PMD patients with the PLP1 missense mutation. PMID:24936452

Brigatinib combined with anti-EGFR antibody overcomes osimertinib resistance in EGFR-mutated non-small-cell lung cancer

PubMed Central

Uchibori, Ken; Inase, Naohiko; Araki, Mitsugu; Kamada, Mayumi; Sato, Shigeo; Okuno, Yasushi; Fujita, Naoya; Katayama, Ryohei

2017-01-01

Osimertinib has been demonstrated to overcome the epidermal growth factor receptor (EGFR)-T790M, the most relevant acquired resistance to first-generation EGFR–tyrosine kinase inhibitors (EGFR–TKIs). However, the C797S mutation, which impairs the covalent binding between the cysteine residue at position 797 of EGFR and osimertinib, induces resistance to osimertinib. Currently, there are no effective therapeutic strategies to overcome the C797S/T790M/activating-mutation (triple-mutation)-mediated EGFR–TKI resistance. In the present study, we identify brigatinib to be effective against triple-mutation-harbouring cells in vitro and in vivo. Our original computational simulation demonstrates that brigatinib fits into the ATP-binding pocket of triple-mutant EGFR. The structure–activity relationship analysis reveals the key component in brigatinib to inhibit the triple-mutant EGFR. The efficacy of brigatinib is enhanced markedly by combination with anti-EGFR antibody because of the decrease of surface and total EGFR expression. Thus, the combination therapy of brigatinib with anti-EGFR antibody is a powerful candidate to overcome triple-mutant EGFR. PMID:28287083

Brigatinib combined with anti-EGFR antibody overcomes osimertinib resistance in EGFR-mutated non-small-cell lung cancer

NASA Astrophysics Data System (ADS)

Uchibori, Ken; Inase, Naohiko; Araki, Mitsugu; Kamada, Mayumi; Sato, Shigeo; Okuno, Yasushi; Fujita, Naoya; Katayama, Ryohei

2017-03-01

Osimertinib has been demonstrated to overcome the epidermal growth factor receptor (EGFR)-T790M, the most relevant acquired resistance to first-generation EGFR-tyrosine kinase inhibitors (EGFR-TKIs). However, the C797S mutation, which impairs the covalent binding between the cysteine residue at position 797 of EGFR and osimertinib, induces resistance to osimertinib. Currently, there are no effective therapeutic strategies to overcome the C797S/T790M/activating-mutation (triple-mutation)-mediated EGFR-TKI resistance. In the present study, we identify brigatinib to be effective against triple-mutation-harbouring cells in vitro and in vivo. Our original computational simulation demonstrates that brigatinib fits into the ATP-binding pocket of triple-mutant EGFR. The structure-activity relationship analysis reveals the key component in brigatinib to inhibit the triple-mutant EGFR. The efficacy of brigatinib is enhanced markedly by combination with anti-EGFR antibody because of the decrease of surface and total EGFR expression. Thus, the combination therapy of brigatinib with anti-EGFR antibody is a powerful candidate to overcome triple-mutant EGFR.

Iris phenotypes and pigment dispersion caused by genes influencing pigmentation

PubMed Central

Hawes, Norman L.; Trantow, Colleen M.; Chang, Bo; John, Simon W.M.

2010-01-01

Summary Spontaneous mutations altering mouse coat colors have been a classic resource for discovery of numerous molecular pathways. Although often overlooked, the mouse iris is also densely pigmented and easily observed, thus representing a similarly powerful opportunity for studying pigment cell biology. Here, we present an analysis of iris phenotypes among sixteen mouse strains with mutations influencing melanosomes. Many of these strains exhibit biologically and medically relevant phenotypes, including pigment dispersion, a common feature of several human ocular diseases. Pigment dispersion was identified in several strains with mutant alleles known to influence melanosomes, including beige, light, and vitiligo. Pigment dispersion was also detected in the recently arising spontaneous coat color variant, nm2798. We have identified the nm2798 mutation as a missense mutation in the Dct gene, an identical re-occurrence of the slaty light mutation. These results suggest that dysregulated events of melanosomes can be potent contributors to the pigment dispersion phenotype. Combined, these findings illustrate the utility of studying iris phenotypes as a means of discovering new pathways, and re-linking old ones, to processes of pigmented cells in health and disease. PMID:18715234

Iris phenotypes and pigment dispersion caused by genes influencing pigmentation.

PubMed

Anderson, Michael G; Hawes, Norman L; Trantow, Colleen M; Chang, Bo; John, Simon W M

2008-10-01

Spontaneous mutations altering mouse coat colors have been a classic resource for discovery of numerous molecular pathways. Although often overlooked, the mouse iris is also densely pigmented and easily observed, thus representing a similarly powerful opportunity for studying pigment cell biology. Here, we present an analysis of iris phenotypes among 16 mouse strains with mutations influencing melanosomes. Many of these strains exhibit biologically and medically relevant phenotypes, including pigment dispersion, a common feature of several human ocular diseases. Pigment dispersion was identified in several strains with mutant alleles known to influence melanosomes, including beige, light, and vitiligo. Pigment dispersion was also detected in the recently arising spontaneous coat color variant, nm2798. We have identified the nm2798 mutation as a missense mutation in the Dct gene, an identical re-occurrence of the slaty light mutation. These results suggest that dysregulated events of melanosomes can be potent contributors to the pigment dispersion phenotype. Combined, these findings illustrate the utility of studying iris phenotypes as a means of discovering new pathways, and re-linking old ones, to processes of pigmented cells in health and disease.

The liquid biopsy: a tool for a combined diagnostic and theranostic approach for care of a patient with late-stage lung carcinoma presenting with bilateral ocular metastases.

PubMed

Bouhlel, Linda; Hofman, Véronique; Maschi, Célia; Ilié, Marius; Allégra, Maryline; Marquette, Charles-Hugo; Audigier-Valette, Clarisse; Thariat, Juliette; Hofman, Paul

2017-12-01

Liquid biopsies (LB) are used routinely in clinical practice in two situations for late stage non-small-cell lung cancer (NSCLC) patients, (i) at the initial diagnosis when looking for activating mutations in EGFR in the absence of analyzable tissue DNA and, (ii) during tumor progression on a tyrosine kinase inhibitor treatment to look for the resistance mutation T790M in EGFR. LB is not presently recommended in daily practice for the diagnosis of NSCLC. Areas covered: We report the diagnosis of a NSCLC in a patient with bilateral ocular metastases after detection of a deletion in exon 19 of EGFR when using plasma DNA. Without histological analysis, the origin of the primary ocular metastasis was uncertain. In this context, a LB showing an activating mutation in EGFR and circulating tumor cells positive for TTF1 led to the diagnosis of NSCLC and targeted therapy. Expert commentary: When no tumor tissue sample is available a LB can be used to diagnose for metastatic NSCLC, when a mutation in EGFR is identified. While a tissue biopsy is the gold standard approach for the diagnosis of a NSCLC and for identification of activating mutations, LB can exceptionally provide both a diagnosis of the primitive tumor and indicate appropriate therapy based on a molecular analysis.

The relationship between BIM deletion polymorphism and clinical significance of epidermal growth factor receptor-mutated non-small cell lung cancer patients with epidermal growth factor receptor-tyrosine kinase inhibitor therapy: a meta-analysis.

PubMed

Zou, Qian; Zhan, Ping; Lv, Tangfeng; Song, Yong

2015-12-01

BIM deletion polymorphism is a germline that might lead to little or no BH3 expression, which affects epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) related apoptosis. Recent studies show that BIM deletion polymorphism might be a critical factor leading to the resistance of EGFR-TKIs in EGFR mutation-positive non-small cell lung cancer (NSCLC) patients. Thus, a meta-analysis was conducted by combing seven original eligible studies including 778 NSCLC patients to investigate a steady and reliable conclusion. Our study indicated that BIM deletion polymorphism was significantly associated with the poor objective response rate (ORR) of EGFR-TKIs in EGFR-mutated NSCLC patients [odds ratios (OR) =0.55, 95% confidence interval (CI), 0.33-0.92]. And disease control rate (DCR) in EGFR-mutate NSCLC patients treated with EGFR-TKIs was significantly decreased in patients with BIM deletion polymorphism (OR=0.55, 95% CI, 0.27-1.12). Moreover, the progression-free survival (PFS) of patients with BIM deletion polymorphism is shorter. These findings suggested that BIM deletion polymorphism might be a genetic cause of intrinsic resistance to TKI therapy and it could be emerged as an independent predictor to identify patients who would benefit from TKI targeted therapy in EGFR-mutated NSCLC.

Usher syndrome type 2 caused by activation of an USH2A pseudoexon: implications for diagnosis and therapy.

PubMed

Vaché, Christel; Besnard, Thomas; le Berre, Pauline; García-García, Gema; Baux, David; Larrieu, Lise; Abadie, Caroline; Blanchet, Catherine; Bolz, Hanno Jörn; Millan, Jose; Hamel, Christian; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise

2012-01-01

USH2A sequencing in three affected members of a large family, referred for the recessive USH2 syndrome, identified a single pathogenic alteration in one of them and a different mutation in the two affected nieces. As the patients carried a common USH2A haplotype, they likely shared a mutation not found by standard sequencing techniques. Analysis of RNA from nasal cells in one affected individual identified an additional pseudoexon (PE) resulting from a deep intronic mutation. This was confirmed by minigene assay. This is the first example in Usher syndrome (USH) with a mutation causing activation of a PE. The finding of this alteration in eight other individuals of mixed European origin emphasizes the importance of including RNA analysis in a comprehensive diagnostic service. Finally, this mutation, which would not have been found by whole-exome sequencing, could offer, for the first time in USH, the possibility of therapeutic correction by antisense oligonucleotides (AONs). © 2011 Wiley Periodicals, Inc.